article stringlengths 0 826k | abstract stringlengths 174 4.34k |
|---|---|
three different types of carbon nanotubes are experimentally observed : armchair , zigzag and chiral .
these carbon structures are finished with semispheres containing pentagons and hexagons , being formally parts of fullerenes . due to their structure ,
the cnts are hydrophobic , strongly interact with light and possess interesting electrical and physical properties [ 13 ] .
modification of hydrophobic carbon nanotubes by allowing stronger intermolecular interactions , leading to solubility is expected upon addition of selected small molecules covalently bonded to the ( a ) end , ( b ) surface , or ( c ) both the end and surface ( mixed ) of swcnts [ 2 , 413 ] .
the rim structure of swcnt in case of zigzag or armchair open ended cnt shows a different pattern .
zigzag carbon nanotubes show metallic or semiconductor properties and their ends shows saw - tooth like shape .
for example , oh , cooh or nh2 functionalized cnt are easily transformed and could bear longer chains connecting antibodies or drugs .
end - substituted swcnt are by - products of mild oxidation and carboxylic , carbonyl and hydroxyl groups are frequently formed .
most previous works [ 46 ] concentrated on single functionalized swcnts and the impact of substituent on physical properties of modified versus pristine structure ( for example , density of states , homo - lumo gap ) .
the pristine cnts are insoluble in water and organic solvents and this is a serious hindrance in their industrial applications , for example , as efficient nanocomposites [ 1 , 14 , 15 ] .
earlier works demonstrated a possibility of transforming inert and hydrophobic cnts , into soluble forms [ 1417 ] .
this was accomplished by subsequent chemical modification of water soluble cnts , containing cooh groups [ 1417 ] .
unfortunately , little is known about the systematic changes of energy of zigzag and armchair swcnts upon consecutive replacement of rim hydrogen atoms by cooh groups .
density functional theory ( dft ) and , in particular , the exchange - correlation b3lyp hybrid density functional is widely used in molecular modeling studies to predict structure , spectroscopic parameters and energy changes of small , middle and large size molecules [ 7 , 8 , 1820 ] . due to the large size of cnts ,
the dft calculations with relatively small basis sets ( 3 - 21 g or 6 - 31 g * ) , and also am1 and pm3 semiempirical methods , have been used for theoretical description of molecular structure and other parameters of finite models of cnts . in this study , as an extension of our previous works on hydroxyl substituted swcnts [ 19 , 21 , 22 ] , we would like to get a more detailed information at the atomistic level on the open - end cnt modification with cooh , up to full substitution with nine ( zigzag ) or ten ( armchair ) carboxylic groups .
reliable exchange - correlational b3lyp hybrid density functional and basis sets of relatively small size ( 3 - 21 g and 6 - 31 g * ) , enabling completing fairly large scale calculations were selected .
full structure optimization of unsubstituted open - ended ( with dangling bonds on carbon saturated with hydrogen atoms ) , and cooh - modified swcnts were performed .
several models of swcnt were selected , including ( 9,0 ) zigzag and ( 5,5 ) armchair structures with one and three layers ( strings ) of hexagon units .
ir and raman harmonic frequencies were calculated in case of one layer with one to 9/10 cooh substituents .
all positive frequencies ensured ground state structure of the optimized system . for comparison purposes only , the calculations with small model molecules including methane , benzene , anthracene and phenanthrene before , and after replacing one hydrogen atom with the carboxyl group were performed at the same level of theory .
in addition , to verify the basis set quality impact , these calculations were performed with a large basis set ( 6 - 311++g(3df,2pd ) .
energy of one cooh group formation at nanotube terminated initially with h atoms was calculated by considering a hypothetical reaction:1\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ { \text{swcnt } } - { \text{h } } + { \text { c}}{{\text{h}}_{{3}}}{\text{cooh } } \to { \text{swcn } } - { \text{cooh } } + { \text { c}}{{\text{h}}_{{4}}}. $ $ \end{document } energies of adding subsequent groups ( e in kcal mol ) were assumed as follows:2\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ { \text{d}}{{\text{e}}_{\text{n } } } = { } \left [ { { \text{e}}\left ( { { \text{swcnt}}{{\left ( { \text{cooh } } \right)}_{\text{n } } } } \right ) + { \text{e}}\left ( { { \text{c}}{{\text{h}}_{{4 } } } } \right ) } \right]-\left [ { { \text{e}}\left ( { { \text{swcnt}}{{\left ( { \text{cooh } } \right)}_{{{\text{n } } - { 1 } } } } } \right ) + { \text{e}}\left ( { { \text{c}}{{\text{h}}_{{3}}}{\text{cooh } } } \right ) } \right ] , $ $ \end{document}where n = 1,2, 9 ( 10 ) . initially , the calculations were conducted at b3lyp/3 - 21 g level of theory .
qualitatively , the changes in energies obtained with smaller basis set ( 3 - 21 g ) were similar to those , obtained at b3lyp/6 - 31g*. thus , the final results , obtained with the larger basis set will be only discussed .
the carboxylic group can be considered as an asymmetric substituent with two different ends ( o atom vs. oh group ) and their position in respect to the rim of the cnt be positioned in a way which minimizes the interactions with the neighboring h - atoms and/or forms h - bonds with other cooh substituents .
this was tested on model systems ( scheme 1 ) by rotating the cooh substituent relative to the aromatic ring plane ( changing the dihedral angle cring cring
c = o).scheme 1small model molecules ( benzoic , anthracene-9-carboxylic and phenathrene-4-carboxylic acids small model molecules ( benzoic , anthracene-9-carboxylic and phenathrene-4-carboxylic acids the energy landscape of cooh rotation in case of monosubstituted benzene , phenanthrene and anthracene are shown in fig . 1 .
in case of benzene , the energy minimum , corresponding to favorable carboxylic orientation , coplanar with the ring , is observed and the perpendicular position , e.g. , at both sides of the ring , are about 8 kcal mol higher . in case of anthracene , the energy minimum corresponds to about 45 degree deviation of cooh plane from rings plane and there are also two maxima of the same height ( at about 3 kcal mol ) for the perpendicular orientation .
the rotation of cooh in phenanthrene at position 4 ( see scheme 1 ) leads to an asymmetric shape of energy curve . the basis set effect on the position of energy maxima upon cooh rotation in c6h5cooh is also shown in fig .
thus , upon improving the basis set quality from 6 - 31 g * to 6 - 311++g * * and 6 - 311++g(3df,2pd ) the barrier height slightly decreases ( from 7.85 to 6.73 and 6.52 kcal mol ) .
it is apparent that the barrier height decreases by about 1.3 kcal mol upon significantly improving the basis set quality.fig .
1energy change upon rotation of cooh substituent relative to ring plane in ( a ) benzoic acid and ( b ) anthracene-9-carboxylic acid and phenathrene-4-carboxylic acid energy change upon rotation of cooh substituent relative to ring plane in ( a ) benzoic acid and ( b ) anthracene-9-carboxylic acid and phenathrene-4-carboxylic acid in fig .
2a and b are shown optimized structures of zigzag and armchair cnt consisting of three ring layers with a single cooh substituent at the rim.fig .
2optimized structures of model ( a ) zigzag and ( b ) armchair swcnts with a single cooh substituent at the rim ( dimensions in ) optimized structures of model ( a ) zigzag and ( b ) armchair swcnts with a single cooh substituent at the rim ( dimensions in ) in fig .
3 are shown energy landscapes of single cooh group rotation attached to zigzag and armchair swcnts . in this case , the preferred geometry is observed for both -oh and = o ends of carboxylic group outside the tube ( on the circumference ) .
two energy maxima are observed for cooh group oriented along the tube radius and the slightly lower one corresponds to oh being outside the tube . in case of zigzag cnt
, the energy minimum corresponds to c c c = o angle of about 5 degrees , ( substituent on the circumference ) and the highest maximum corresponds to about 90 degrees ( c = o outside the tube ) .
the other maximum ( with c = o inside , or oriented toward the tube center ) is slightly lower .
similarly to fig . 1a , the improvement of basis set quality from 3 - 21 g to 6 - 31 g * leads to energy barrier lowering by about 4 kcal mol .
in the case of carboxylic group rotation at the armchair rim , the situation is similar and the corresponding barrier heights are 9 and 7 kcal mol and the energy minimum is observed at about 10 degrees.fig .
3energy change upon rotation of cooh substituent at the rim of model ( a ) zigzag and ( b ) armchair swcnts energy change upon rotation of cooh substituent at the rim of model ( a ) zigzag and ( b ) armchair swcnts up to nine carboxylic substituents were placed consecutively at the zigzag rim ( see fig .
, a kind of threefold symmetry was observed . nevertheless , some funnel shape deformation and increase of the tube - end diameter was observed.fig .
4optimized structures of model ( a ) zigzag and ( b ) armchair swcnts fully functionalized with cooh substituents at the rim .
threefold symmetry is indicated for zigzag nanotube optimized structures of model ( a ) zigzag and ( b ) armchair swcnts fully functionalized with cooh substituents at the rim .
threefold symmetry is indicated for zigzag nanotube the armchair model consisting of three hexagon layers with up to nine cooh groups at one rim was also stable .
in addition , upon complete functionalization of one hexagon layer ( the shortest armchair nanotube model ) a stable system was also observed ( fig .
however , all attempts to obtain fully functionalized one end of a longer tube , containing three layers of hexagons , failed .
this was probably due to steric crowding at the relatively rigid tube skeleton end . in the next step ,
starting from model systems of methane and benzene , we examined the energetics of substitution process calculated according to eq . 2 ( see table 1 ) .
addition of zpv correction changes the substitution energy slightly while hydroxylation is more favorable in the case of benzene.table 1comparison of carboxylation and hydroxylation energy ( kcal mol ) calculated at b3lyp/6 - 311++g(3df,2pd ) level for two model compounds according to eq .
2ch4c6h6-coohe3.8(e + zpv)4.9-oh e29.439.9(e + zpv)26.538.4 in agreement with formula ( 2 ) an opposite sign to that in ref .
is given comparison of carboxylation and hydroxylation energy ( kcal mol ) calculated at b3lyp/6 - 311++g(3df,2pd ) level for two model compounds according to eq .
2 in agreement with formula ( 2 ) an opposite sign to that in ref .
2vs . the number of cooh substituents for zigzag and armchair are displaced in fig .
2 for model zigzag and ( b ) armchair swcnts functionalization at two basis set sizes . for better visualization the data points
. 2 for model zigzag and ( b ) armchair swcnts functionalization at two basis set sizes . for better visualization
that the carboxylation energy for the first hydrogen atom at the rim of zigzag nanotube formed from three layers is about 13 kcal mol .
this differs from the calculated previously hydroxylation energy of about 35 kcal mol .
significantly smaller energy increments are needed for adding three to nine carboxylic groups . in fig .
5b is shown a similar carboxylation energy dependence on replacement of consecutive hydrogen atoms at the rim of armchair cnt model .
the first carboxylation energy is higher than for zigzag model ( about 8.5 vs. 13 kcal mol ) whereas for the second group this energy is about 1 vs. 3 kcal mol , for armchair and zigzag models , respectively .
however , some oscillation of energy is observed , with minima located at odd numbers of cooh .
this resembles the results for hydroxylation energy pattern observed previously for armchair cnt [ 21 , 22 ] .
the reason of this behavior was explained earlier as a result of different h - bond ring pattern formation at the rim .
the present density theory studies using b3lyp hybrid functional indicate a possibility of cooh - functionalization of one end of zigzag cnt with one to nine substituents .
however , the end of armchair nanotube can not be fully functionalized with cooh groups ( one hydrogen atom remains unsubstituted ) . on the basis of
the performed b3lyp/6 - 31 g * calculations it appears that the replacement of one hydrogen atom at the rim of the zigzag cnt model is a more exothermic process than for armchair model ( 13 vs 8.5 kcal mol ) .
a gradual and nearly linear increase of energy is observed for subsequent carboxylation , starting from two to nine groups on a zigzag nanotube end . | structure and energy calculations of pristine and cooh - modified model single wall carbon nanotubes ( swcnts ) of different length were performed at b3lyp/6 - 31 g * level of theory . from 1 to 9 cooh groups
were added at the end of the nanotube .
the differences in structure and energetics of partially and fully functionalized swcnts at one end of the nanotube are observed . up
to nine cooh groups could be added at one end of ( 9,0 ) zigzag swcnt in case of full functionalization . however , for ( 5,5 ) armchair swcnt , the full functionalization was impossible due to steric crowding and rim deformation .
the dependence of substituent attachment energy on the number of substituents at the carbon nanotube rim was observed.figurestructure and energy calculations of pristine and cooh - modified model single wall carbon nanotubes ( swcnts ) of different length were performed at b3lyp/6 - 31 g * level of theory and from 1 to 9 cooh groups was added at the end of the nanotube |
periodontal diseases are considered to be multifactorial diseases , where putative periodontopathogens trigger inflammatory and immune responses .
it is characterized by irreversible loss of alveolar bone and connective tissue attachment in the periodontium which ultimately results in the loss of teeth .
these pathogens are known to produce proteolytic enzymes as well as elicit signals in resident gingival cells or in immune cells infiltrating the gingival tissues that result in immune responses ; these responses lead to either the successful removal of the pathogens or to host mediated destruction of the periodontal tissues .
gingival inflammation is regulated by reciprocal interactions between various cell types including , leukocytes , epithelial cells , fibroblasts , and endothelial cells . among the many immune and inflammatory mediators known cytokines
proinflammatory and anti - inflammatory cytokines play a key role in the pathogenesis of periodontal disease thereby influencing destruction , remodeling , and repair of periodontal tissues .
interleukin-12 ( il-12 ) is one such cytokine which appears to contribute to inflammatory response in numerous physiological and pathological processes . the il-12 family , which is evolutionarily linked to the il-6 cytokine superfamily , is composed of il-12 , il-23 , il-27 , and il-35 .
the il-12 related cytokines are heterodimeric proteins comprised of an chain ( p19 , p28 , or p35 ) and a chain ( p40 or ebi3 ) .
il-35 , the newest member of il-12 family , is composed of the il-27 chain ebi3 and the il-12 chain p35 .
secretion of bioactive il-35 has been described in forkhead box protein 3 ( foxp3 ) regulatory t cells ( tregs ) , peripheral t cells , cd8 t cells , and placental trophoblasts .
il-35 has been shown to be an inhibitory cytokine that may be specifically produced by treg cells and is required for maximal suppressive activity .
loss of il-35 expression results in reduced in vivo suppressive capacity of tregs . also il-35-expanded cd4+cd25 + t - cell population expressed foxp3 and produced elevated levels of il-10 . a previous studies had shown that patients with chronic periodontitis presented increased frequency of t lymphocytes and cd4cd25 t cells in the inflammatory infiltrate of gingival tissues and exhibited the phenotypic markers of tregs such as foxp3 .
these results indicate that tregs are found in the chronic lesions and must be involved in the modulation of local immune response in chronic periodontitis patients .
the search for potential markers associated with the severity , as well as the susceptibility of periodontal disease , has recently been receiving considerable attention .
although roles of many other cytokines have been evaluated in the pathogenesis of periodontal diseases , the exact role of il-35 has not been studied yet .
so the current analytical cross - sectional descriptive study was carried out to evaluate and compare the expression of il-35 mrna in gingival tissues of healthy controls , chronic periodontitis , and aggressive periodontitis patients by rt - pcr .
we also intended to correlate the expression levels of il-35 with the severity of disease process among the 3 groups so as to obtain an insight into the probable role of il-35 in immunopathogenesis of periodontal diseases .
the present study included 60 subjects in the age range of 2159 years ( 32.4 10.7 ) who visited the outpatient department of periodontics , pmnm dental college and hospital at bagalkot and was divided as follows : group 1 : 20 chronic periodontitis patients , group 2 : 20 aggressive periodontitis patients , and group 3 : 20 periodontally healthy controls .
the exclusion criteria used were smoker , patients with systemic diseases like diabetes mellitus , hepatitis , and hiv infection which are known to influence the periodontal disease ; patients who received periodontal treatment for at least 6 months prior to sampling and recording were excluded from the study .
patients with diseases of oral hard and soft tissue except caries and periodontitis , use of antibiotics and analgesics within three months prior to study , and pregnant women and lactating mothers were also excluded . after explaining the nature of the study and the method of sample collection , the patients signed an informed consent form .
the study protocol was approved by the ethical committee of pmnm dental college & hospital , bagalkot , karnataka , india .
probing pocket depth ( ppd ) and clinical attachment loss ( cal ) were recorded with a graduated williams 's periodontal probe at six sites on each tooth for all the groups .
debris and calculus was scored using the simplified oral hygiene index ( ohi - s ) .
study population was divided as healthy subjects showing absence of clinical manifestations of periodontal disease with at least 20 teeth present .
chronic periodontitis patients comprised of at least 20 natural teeth and a minimum of six teeth with periodontal pockets 5 mm and clinical attachment loss 3 - 4 mm and aggressive periodontitis patients with proximal attachment loss of 5 mm affecting at least three teeth other than first molars and incisors and bone loss as assessed by radiographs .
sixty gingival tissue samples were biopsied from 20 chronic periodontitis , 20 aggressive periodontitis , and 20 healthy sites .
patients received local anaesthesia and biopsies were obtained by surgical excision from labial / buccal surface of the gingival margin / papilla , of multirooted teeth .
two parallel vertical incisions , 2 to 3 mm apart from each other were made with a scalpel equipped with a number 15 bard parker blade followed by an incision perpendicular to the two vertical ones ' . the surgical blade point was directed to the portion of the alveolar bone crest in order to obtain a well - oriented and representative biopsy .
the gingival tissue sample was stored and transported in rna save solution ( life technologies india pvt ltd . ) for rna stabilization .
rna was isolated from these tissues using the total rna isolation kit ( chromous biotech pvt . ltd . ) followed by reverse transcription ( chromous biotech pvt .
the kit contained mmulv reverse transcriptase to synthesize first strand cdna and high fidelity polymerase for pcr ( chromtaq polymerase ) .
usa ) : il-12 p35 ctgcatcagctcatcgatgg ( forward ) and cagaagctaaccatctcctggttt ( reverse ) ; ebi3 tgt ttc cct gac ttt cca gg ( forward ) and ggg gca gct tct ttt ctt ct ( reverse ) .
the pcr cycle consisted of 94c for 15 s , 55c for 30 s , and 68c for 60 s. samples were amplified for 23 to 33 cycles .
the reaction was terminated by heating at 72c for 5 min . the pcr product ( 5 l ) were separated by electrophoresis on a 2% agarose gel and stained with ethidium bromide .
the results were expressed on a scale of 1 to 10 using total lab software .
the statistical difference between the groups was tested using kruskal wallis anova test , mann - whitney u test , and tukeys multiple post hoc test .
the various clinical parameters as well as il-35 m rna levels were analyzed in gingival tissue samples for all the 3 groups .
mean age of subjects were 24.40 5.01 years in healthy group , 44.80 7.62 years in chronic periodontitis group , and 27.90 4.54 years in aggressive periodontitis group .
comparison for mean clinical attachment level and mean probing depth for healthy controls , chronic periodontitis , and aggressive periodontitis groups was statistically significant ( table 1 ) .
this was also true when pairwise comparison among healthy versus cp , healthy versus agp , and cp versus agp , was carried out .
correlation between il-35 mrna expression with gingival index , ohi - s , pd , and cal by karl pearson 's correlation coefficient method in three groups ( table 3 ) .
il-35 mrna expression for healthy controls , chronic periodontitis , aggressive periodontitis were 3.03 1.91 , 6.87 2.32 , and 4.71 1.43 , respectively .
the difference in the il-35 mrna expression in healthy , cp , and agp was found to be statistically significant . statistically significant difference was found after pairwise comparison amongst the groups relating to il-35 mrna expression ( table 2 ) .
periodontitis is a chronic inflammatory condition of the periodontium which develops in response to local infectious challenge .
periodontopathogenic antigen - driven host cell responses serve as initiators of chronic inflammatory disease ; secondary endogenous degenerative pathways may act as auxiliary magnification loops to propagate inflammation and local tissue destruction .
since these pathways may be exemplified by the release of inflammatory cytokines , researchers have of late attempted to link various clinical and pathological entities to the specific immune responses elicited .
recently il-35 , a treg cell specific cytokine that is required for the maximum regulatory activity of treg cells in vitro and in vivo has drawn considerable attention .
il-35 has been shown to be expressed by resting and activated tregs but not by t effector ( teff ) cells .
subsequently , previous studies have described that treg cell subset is involved in the attenuation of the inflammatory reaction and bone loss after periodontal infection [ 11 , 12 ] .
the current case control study was carried out to evaluate , compare , and correlate the expression of il-35 mrna in gingival tissues of healthy controls , chronic periodontitis , and aggressive periodontitis patients by rt - pcr so as to obtain an insight into the probable role of il-35 in immunopathogenesis of periodontal diseases . in the present study
, we demonstrated the expression of il-35 mrna in gingival tissues of healthy , cp , and agp subjects .
the levels of il-35 mrna were more in the chronic periodontitis subjects ( 6.87 2.32 ) as compared to the aggressive periodontitis group ( 4.71 1.43 ) and was least expressed among the healthy patients ( 3.03 1.91 ) . comparisons among all the three groups as well as pairwise comparisons showed statistically significant differences . in a recent literature by wei et al .
il-35 has been shown to be secreted by treg cells and is required for the immunological capacity of treg cells .
consequently some reports have demonstrated an increased frequency of treg cells in periodontal diseased tissues suggesting that treg infiltration could reflect an attempt to control tissue destruction but could also be indicative to have a destructive role in periodontitis [ 11 , 12 ] .
treg cells have also been shown to impair the immune response against infectious agents which could be potentially deleterious in periodontal environment .
previously , it has been established that treg expression is elevated by stimulation with porphyromonas gingivalis antigens in periodontitis patients .
p. gingivalis is associated with disease progression associated alveolar bone loss in established periodontitis patients .
il-35 has been known to expand treg cells ; thus , it can be hypothesized that this increase in treg cells may be attributed to the increased levels of il-35 in periodontitis cases . to the best of our knowledge and the available literature
there is no direct published evidence supporting the expression of il-35 in gingival tissues and this is the first study where il-35 mrna expression has been evaluated . in experimental models ,
tregs have been predicted to play a role in the maintenance of chronic infections such as infection by leishmania , hsv , and schistosoma mansoni , with persistence of pathogens , consequently enabling the disease reactivation .
similar results were reported by collison et al . , where they showed that treg cells induced in vivo generation of itr35cells and il-35 under inflammatory conditions in intestines infected with trichura muris .
thus , elevated levels of il-35 could also be involved in unresolved chronic infection / inflammation in periodontitis . in periodontitis , the effector immune response has to be regulated to control the bacterial growth , dissemination , and to prevent tissue damage .
cardoso et al . indicated that tregs accumulate within the gingiva of periodontitis patients limiting the effector immune responses , promoting pathogen survival , and maintaining the chronicity of the disease .
this is consistent with the higher levels of expression of il-35 mrna in chronically inflamed gingival tissues of chronic periodontitis patients .
also , previous studies have mentioned that expression of il-35 following activation with anti - cd3/anti - cd28-coated beads remained low for 3 days , suggesting that human treg cells do not express il-35 upto 2 days after stimulation .
this may be hypothesized as one of the reasons for higher levels in chronic periodontitis patients as compared to the aggressive periodontitis patients . further in the present study , il-35 mrna expression was also demonstrated in healthy gingival tissue sample , even though at lower frequencies than in periodontal lesions .
previous studies have shown il-35 expression in extracts of the trophoblast component of a human full - term normal placenta , thus , suggesting that it may be important in immune regulation . a previous study by ernst et al .
has demonstrated an increased frequency of tregs in healthy tissues suggesting a role for tregs in the maintenance of periodontal health .
this could explain the lower levels of expression of il-35 in healthy gingival tissues when compared to that of aggressive and chronic periodontitis patients .
contrastingly , a recent literature has mentioned the failure of human treg cells to express il-35 constitutively but how be may able to express it when induced .
however , presence of il-35 even at low levels in healthy tissues may be attributed to variation in the inflammatory tissues considering the presence of the vast number of commensal bacteria colonizing the gingival sulcus and the absence of absolute pristine gingiva even in clinically healthy sites . also previously existence of treg cells
have been shown to be present constitutively in gingival tissues which may explain the possible mechanism by which immune responses to these microbes are controlled and periodontal destruction is thus prevented .
as no previous studies have addressed the role of il-35 in periodontal disease , we could not compare our results with any other study .
however , based on the differential roles of treg cells in healthy as well periodontitis sites , the mechanism of involvement of il-35 needs to be addressed .
although we may hypothesize that in healthy sites il-35 mediated treg cells control the immune pathology so as to avoid periodontal tissue destruction , while in established periodontitis lesions il-35 mediated treg cells may be recruited into the lesion in an attempt to suppress tissue destruction possibly through a negative feedback mechanism .
moreover , the upregulation of treg and regulatory cytokines at the same time suggests a need for further studies regarding the reciprocal regulation of these il-35 and treg in the pathophysiology in periodontal disease .
however within the limitation of the study , the present findings indicate that il-35 is associated with the pathogenesis of periodontitis . from the present study
, it can be concluded that the expression of il-35 mrna may be associated with the immunopathogenesis of chronic and aggressive periodontitis as well as it may play a significant role in maintaining the immune balance in healthy state .
further studies with larger sample size and precise detection of protein levels and il-35 variation during progression of disease are required to elaborate the respective roles of il-35 in the pathogenesis and progression of periodontal disease as well as in periodontal tissue homeostasis . | background . proinflammatory and anti - inflammatory cytokines
play a key role in the pathogenesis of periodontal diseases .
secretion of bioactive il-35 has been described by t regulatory cells ( tregs ) and is required for their maximal suppressive activity .
tregs are involved in the modulation of local immune response in chronic periodontitis patients .
objective .
hence , the present study was aimed to investigate the expression of il-35 mrna in chronic periodontitis and aggressive periodontitis patients .
materials and methods .
the present study was carried out in 60 subjects , which included 20 chronic periodontitis patients , 20 aggressive periodontitis patients , and 20 periodontally healthy controls .
il-35 mrna expression in gingival tissue samples of all subjects was semiquantitatively analyzed using reverse transcriptase polymerase chain reaction ( rt - pcr ) .
results .
the present study demonstrated the expression of il-35 mrna in gingival tissues of all the three groups .
il-35 mrna expression was highest in chronic periodontitis subjects ( 6.87 2.32 ) as compared to the aggressive periodontitis group ( 4.71 1.43 ) and least seen in healthy patients ( 3.03 1.91 ) .
conclusion .
the increased expression of il-35 in chronic and aggressive periodontitis suggests its possible role in pathogenesis of periodontitis .
future studies done on large samples with intervention will strengthen our result . |
it is believed that the genesis of epiphrenic diverticulum ( ed ) , a rarely encountered disease , was associated with an oesophageal motor disorder .
failure to diagnose an epiphrenic oesophageal diverticulum may lead to some serious problems , such as gastrointestinal ( gi ) bleeding , pneumonia or cancer .
most researchers believe that only the presence of large ed with severe symptoms should result in consideration of surgical options . the choice of minimally invasive techniques and whether heller myotomy with antireflux fundoplication should be employed after diverticulectomy became points of debate . in the following report
, the discussion concentrates on our 11-case series of laparoscopic transhiatal diverticulectomy ( ltd ) operations with the aid of intraoperative gi endoscopy , and investigating when the oesophagomyotomy should be added after ltd .
there were 4 men and 7 women ( ages ranging 45 - 81 years ) .
the common symptoms included regurgitation , dysphagia , chest pain , and nausea or vomiting .
both preoperative oesophagoscopy and barium oesophagram generally not only confirmed the existence of ed [ figure 1 ] , but they also might rule out malignancy and assess associated oesophageal problems . because it is difficult for patients with large ed to undergo oesophageal manometry , only 4 patients in our series successfully underwent oesophageal manometry : oesophageal dysfunction and an increase of the lower oesophageal sphincter pressure ( lesp ) were found in 2 patients .
7 patients were found to have oesophagitis , 2 having barrett 's oesophagus , 3 showing evidence of oesophageal mucosal ulceration and 3 having strictures of gastro - oesophageal junction ( gej ) .
barium gi study and endoscopy reveal a large ed for these patients , a high - energy liquid diet was provided 3 days prior to surgery .
patients were warned regarding the potential risks prior to surgery , and signed consent forms . during follow - up , all patients were evaluated with barium oesophagram , oesophagoscopy , oesophageal manometry and 24-h continuous oesophageal ph monitoring at 6 months after surgery .
the patient was placed in a supine position with legs spread ( 20 - 30 ) under general endotracheal anaesthesia .
pneumoperitoneum was established , maintaining a constant abdominal pressure between 12 mmhg and 14 mmhg .
the dissection then was carried up and down the right and left crura and into the mediastinum .
white cotton tape was used to encircle the abdominal oesophagus [ figure 2 ] . during mobilisation of the oesophagus ,
care was taken to clearly identify and preserve both the anterior and posterior vagus nerves .
adequate mobilisation of the oesophagus was needed to get enough of the oesophagus down into the peritoneal cavity .
the base of the ed was identified first , and then the diverticulum was carefully and completely dissected from all adherent tissue [ figure 3 ] . at the same time , intraoperative gi endoscopy was performed to facilitate identification of ed and its base , and learn about the gej . during performance of gi endoscopy , it is necessary to turn laparoscopic screen brightness down to clearly show the position of endoscopy .
the endostapler must be placed parallel to the long axis of the oesophagus [ figure 4 ] . after performing a diverticulectomy
, we decided if a heller myotomy and dor fundoplication would be added according to observation of intraoperative gi endoscopy . if the lumen of the abdominal oesophagus narrowed , the myotomy is performed opposite the site of diverticulectomy and should be carried onto the stomach 1 - 1.5 cm below the gej .
white cotton tape is used to encircle the oesophagus to facilitate the dissection the diverticulum and its base are carefully dissected from the adjacent tissue the diverticulum at its base was amputated using an endostapler placed parallel to the long axis of the oesophagus usually , a clear liquid diet was permitted after a successful gi iodolography 7 days after surgery , and then , is advanced gradually to a normal diet within 5 days .
there were 4 men and 7 women ( ages ranging 45 - 81 years ) .
the common symptoms included regurgitation , dysphagia , chest pain , and nausea or vomiting .
both preoperative oesophagoscopy and barium oesophagram generally not only confirmed the existence of ed [ figure 1 ] , but they also might rule out malignancy and assess associated oesophageal problems . because it is difficult for patients with large ed to undergo oesophageal manometry , only 4 patients in our series successfully underwent oesophageal manometry : oesophageal dysfunction and an increase of the lower oesophageal sphincter pressure ( lesp ) were found in 2 patients .
7 patients were found to have oesophagitis , 2 having barrett 's oesophagus , 3 showing evidence of oesophageal mucosal ulceration and 3 having strictures of gastro - oesophageal junction ( gej ) .
barium gi study and endoscopy reveal a large ed for these patients , a high - energy liquid diet was provided 3 days prior to surgery .
patients were warned regarding the potential risks prior to surgery , and signed consent forms . during follow - up , all patients were evaluated with barium oesophagram , oesophagoscopy , oesophageal manometry and 24-h continuous oesophageal ph monitoring at 6 months after surgery .
the patient was placed in a supine position with legs spread ( 20 - 30 ) under general endotracheal anaesthesia .
pneumoperitoneum was established , maintaining a constant abdominal pressure between 12 mmhg and 14 mmhg .
the dissection then was carried up and down the right and left crura and into the mediastinum .
white cotton tape was used to encircle the abdominal oesophagus [ figure 2 ] . during mobilisation of the oesophagus ,
care was taken to clearly identify and preserve both the anterior and posterior vagus nerves .
adequate mobilisation of the oesophagus was needed to get enough of the oesophagus down into the peritoneal cavity .
the base of the ed was identified first , and then the diverticulum was carefully and completely dissected from all adherent tissue [ figure 3 ] . at the same time , intraoperative gi endoscopy was performed to facilitate identification of ed and its base , and learn about the gej . during performance of gi endoscopy , it is necessary to turn laparoscopic screen brightness down to clearly show the position of endoscopy .
the endostapler must be placed parallel to the long axis of the oesophagus [ figure 4 ] . after performing a diverticulectomy
, we decided if a heller myotomy and dor fundoplication would be added according to observation of intraoperative gi endoscopy . if the lumen of the abdominal oesophagus narrowed , the myotomy is performed opposite the site of diverticulectomy and should be carried onto the stomach 1 - 1.5 cm below the gej .
white cotton tape is used to encircle the oesophagus to facilitate the dissection the diverticulum and its base are carefully dissected from the adjacent tissue the diverticulum at its base was amputated using an endostapler placed parallel to the long axis of the oesophagus usually , a clear liquid diet was permitted after a successful gi iodolography 7 days after surgery , and then , is advanced gradually to a normal diet within 5 days .
there were 2 cases of conversion to an open transthoracic procedure with diverticulectomy , heller myotomy and dor fundoplication , due to tight adhesion surrounding the diverticulum .
six patients underwent ltd , heller myotomy and dor fundoplication , and 3 only undergoing ltd .
mean operative time averaged 199 15 min and mean intraoperative blood loss was 152 32 ml . all patients were routinely treated with antacid medical therapy ( 20 mg of famotidine , twice a day ) for at least 1 month after surgery .
eleven patients experiencing dysphagia and regurgitation before surgery improved significantly and the improvement persisted over time .
motor function studies showed that there was no oesophageal peristalsis in 5 patients during follow - up , while 6 patients showed seemingly normal oesophageal motility .
the lesp of 6 patients undergoing ltd , myotomy and dor fundoplication was 16.7 10.2 mmhg , while the lesps of 3 patients undergoing only ltd were 26 mmhg , 18 mmhg and 21 mmhg . in 4 cases undergoing ltd , myotomy and dor fundoplication , gastro - oesophageal reflux occurred during the sleep stage .
on endoscopic examination it was found that there were 2 patients with oesophagitis and 1 with ulcer . for 6 patients undergoing ltd , heller myotomy and dor fundoplication
, the post - operative barium oesophagogram demonstrated that the lumen of the distal oesophagus was widening unevenly [ figure 5 ] .
two years after ltd , heller myotomy and dor fundoplication , oesophagoscopy and barium oesophagram showed that the lumen of the distal oesophagus was widening unevenly
it may be an innate defect of the distal oesophagus . in a review by the mayo clinic , 63.4% ( 71/112 ) of untreated patients with ed
none of 71 patients having an ed with minimal symptoms had clinically significant progression of symptoms . as a result
, some experts claimed that only the presence of large diverticulum with severe symptoms should lead to the consideration of surgical options .
traditionally , diverticulectomy has been performed through a thoracotomy . in the era of minimally invasive surgery , a few surgeons reported having surgically managed large ed by thoracoscopy or laparoscopy .
the main advantages of laparoscopy over thoracoscopy include the fact that laparoscopy may provide better exposure to the distal oesophagus and that it is relatively easy to perform myotomy and antireflux surgery with laparoscopy .
it has long been believed that ed is a kind of pulsion diverticula usually resulting from an oesophageal motility disorder . in some articles , most of which were case reports , most researchers preferred performing diverticulectomy , myotomy and fundoplication .
, he found that among 33 patients with big ed undergoing surgery , 24.2% had achalasia , 9.1% had diffuse oesophageal spasms and 21.2% had non - specific motor abnormalities of the oesophageal body .
, we also discovered that not all ed with severe symptoms were associated with an oesophageal motor disorder . because the presence of ed made it difficult for the oesophageal manometry probe to pass through the distal oesophagus , in our series 4 patients successfully received oesophageal manometry before surgery , and oesophageal dysfunction was found only in 2 patients , .
besides , only 5 out of 11 cases , accounting for 45.5% ( 5/11 ) showed postoperative oesophageal dysfunction .
thus we support the notion that not all big ed cases have oesophageal motility disorder . according to the analysis mentioned above
, we think that there are two kinds of big ed which need surgery : for some big ed associated with some kinds of oesophageal motility disorder , such as achalsia , myotomy is mandatory after diverticulectomy ; for other big ed without oesophageal motility disorder , pressing the distal oesophagus leading to symptoms , there is no need for patients to undergo myotomy in addition to diverticulectomy .
the main drawback of myotomy after diverticulectomy is post - operative gastro - oesophageal reflux .
even if dor fundoplication was performed , 4 in 6 cases undergoing ltd , myotomy and dor fundoplication experienced nocturnal gastro - oesophageal reflux . among them , 2 patients had oesophagitis and 1 had ulcer .
accurate preoperative recognition of oesophageal disorders is helpful in determining how to perform surgery for big ed .
although preoperative oesophageal manometry is often difficult to perform , extra efforts , such as guiding by gi endoscopy , should be made to obtain manometric diagnoses . associated with observation by gi endoscopy , manometric diagnoses will allow surgeons to confidently categorise before surgery and direct surgical procedures .
in conclusion , ltd represents a safe and valid approach for ed patients with severe symptoms . because not all patients with large ed have oesophageal disorders , according to manometric and endoscopic results , surgeons can categorise and decide beforehand whether or not myotomy and antireflux surgery after ltd will be conducted .
| objective : most researchers believe that the presence of large epiphrenic diverticulum ( ed ) with severe symptoms should lead to the consideration of surgical options . the choice of minimally invasive techniques and whether heller myotomy with antireflux fundoplication should be employed after diverticulectomy became points of debate .
the aim of this study was to describe how to perform laparoscopic transhiatal diverticulectomy ( ltd ) and oesophagomyotomy with the aid of intraoperative gastrointestinal ( gi ) endoscopy and how to investigate whether the oesophagomyotomy should be performed routinely after ltd.patients and methods : from 2008 to 2013 , 11 patients with ed underwent ltd with the aid of intraoperative gi endoscopy at our department . before surgery , 4 patients successfully underwent oesophageal manometry : oesophageal dysfunction and an increase of the lower oesophageal sphincter pressure ( lesp ) were found in 2 patients.results:there were 2 cases of conversion to an open transthoracic procedure .
six patients underwent ltd , heller myotomy and dor fundoplication ; and 3 patients underwent only ltd .
the dysphagia and regurgitation 11 patients experienced before surgery improved significantly .
motor function studies showed that there was no oesophageal peristalsis in 5 patients during follow - up , while 6 patients showed seemingly normal oesophageal motility .
the lesp of 6 patients undergoing ltd , myotomy and dor fundoplication was 16.7 10.2 mmhg , while the lesps of 3 patients undergoing only ltd were 26 mmhg , 18 mmhg and 21 mmhg , respectively . in 4 cases experiencing ltd , myotomy and dor fundoplication , the gastro - oesophageal reflux occurred during the sleep stage.conclusions:ltd
constitutes a safe and valid approach for ed patients with severe symptoms .
as not all patients with large ed have oesophageal disorders , according to manometric and endoscopic results , surgeons can categorise and decide whether or not myotomy and antireflux surgery after ltd will be conducted . |
among various microbial pathogens , mycobacterium tuberculosis ( tb ) infection has been regarded as an important subject of scientific studies on the diseases prevalent among pre - modern peoples . by evidences of anatomical pathology
, researchers could report the presence of tb in the archaeologically obtained human samples . using the ancient samples
, the phylogeny of tb continues to have been traced by the molecular biological techniques ( 1234 ) .
although more historical knowledge on tb infection has been obtained by studies on archaeological samples worldwide , there were very few reports on the presence of tb cases from ancient human remains in korea .
considering that tb was known to have been endemic in this country until quite recent days , the deficiency of medical evidences on the tb infection in archaeological samples of korea looks exceptional . in this regard ,
the current case about calcified pulmonary nodules ( pn ) that were recently identified in 350-yr - old - korean mummy is very meaningful to concerned researchers . by differential diagnosis based upon ct radiological findings
, we can conclude that this looks the first - ever case of pulmonary tb identified among archaeologically obtained , pre - modern korean samples .
a female mummy was discovered in april 2010 , from a joseon tomb discovered in mungyeong county of korea ( fig .
after the mummy was moved to our laboratory , the sex determination was made as a female , by its external genitalia and by morphology of the pelvic bone ( 5 ) .
the mummy 's age was estimated to be 40 - 44 yr old , by the degeneration pattern of the auricular and pubic symphyseal surfaces of the hipbones ( 6 ) .
( 1992 ) ( 7 ) on right maxillary first premolar as about 47.2 yr - old .
next , the ct scan was performed on this case with a 64 mdct scanner ( vct , ge healthcare , milwaukee , wi , usa ) at seoul national university hospital , korea . using the helical technique ( 120 kvp ) , a spiral volume from head to toe
all of the data were reconstructed into axial images representing 1.25 mm thicknesses at 1.25 mm intervals .
these images were transferred to a workstation ( advantage windows workstation 4.3 ; ge healthcare ) preparatory to post - processing , by which coronal and sagittal multi - planar reformation and volume - rendering images were obtained .
volume - rendering images were obtained by invesalius 3.0.0 beta 5 ( cti , campinas , brazil ) .
the ct images exhibited six radiopaque nodules in right - sided lung within thoracic cavity , at the level of thoracic vertebrae ( tv ) 1 to 6 ( fig .
2 ) . briefly , at tv1 level , a radiopaque nodule ( # 1 ) was located in front of trachea , especially at the right side of it ( fig .
a small - sized nodule ( # 2 ) was also identified at tv3 , along the trachea .
another radiopaque nodule ( # 3 ) was found in the mummified lung ( tv4 level ) that was displaced to posterior thoracic cavity ( fig .
2b ) . at tv5 level , two large nodules ( # 4 and # 5 )
the nodule # 6 was found in the right lung , around costovertebral junction at tv6 level ( fig .
2e . from tv1 to tv7 level , we found presumptive pleural adhesions on ct , mainly in the right - sided thoracic cavity . for post - factum validation of the ct findings
, we dissected the mummy in the department of anatomy , seoul national university college of medicine ( korea ) .
we made an incision along the lower borders of the xiphoid process and the 12th ribs . from the lower tip of the xiphoid process
the skin was then turned back to expose the internal organs within the abdominal cavity .
the thoracic cavity was opened , specifically by cutting the costal cartilages of the ribs , and then by incising the costal or sternal origins of the diaphragmatic muscles .
the sternum was then bent back to reveal the organs within the chest cavity . during the dissection
, we found possible sign of pleural adhesion in her right - sided thorax , which is well correspondent to the findings on ct images ( fig .
3 ) . the calcified pns identified on the ct images were counter - checked by our dissection findings .
briefly , the calcified pns were located in the apical segment of upper lobe , superior and posterior basal segments of lower lobe in the right lung .
next , we cut the nodules ( # 4 and # 5 ) to examine their nature .
the deposition of calcium seen in the center of nodules re - confirmed the radiopacities on ct images as dystrophic calcification ( fig .
our results clearly show multiple calcified parenchymal nodules in the hilar region of the mummy 's right lung .
most calcified pn on radiological images are clinically benign though some malignant diseases ( e.g. primary or metastatic lung cancer ) , even if the chances are rare , also cause it . based on the radiological pattern of calcified pn
, we think that the current case might have been old healed granulomatous disease ( calcified ghon complex ) .
though intra - thoracic , diffuse nodular calcifications include granulomatous tissue response caused by various pathogens ( histoplasma capsulatum etc . )
( 8) , pulmonary tb might be the first candidate in this case because it is one of the most common etiologies for calcified pn detected in the patients ( 9 ) .
however , we should note that many other diseases such as infections , pulmonary metastases , pulmonary hamartoma , chronic hemorrhage , pneumoconiosis , carcinoid , amyloids , and other idiopathic disorders etc .
differential diagnosis between them is therefore very important for the confirmation of our radiological diagnosis of the current case as pulmonary tb .
first of all , we do not regard this case as primary lung cancer because calcification in lung cancer is very rare ; and if any , they show punctuate , amorphous and reticular patterns .
we also rule out lung carcinoid because it is generally a central pulmonary tumor associated with dense amorphous calcification .
if the current pns were neoplasms , pulmonary metastases might be a better candidate for this case .
however , as we could not get any radiological evidences for calcifications caused by primary cancer in the organs other than lung , calcified pns in this study are not likely to be caused by pulmonary metastases . as for pulmonary hamartoma ( ph ) , we note that it appears as sharply outlined , solitary pn .
ph generally associates popcorn - shaped round / oval pn with a central nidus and a laminated calcification pattern .
the focal collection of fat that alternates with foci of calcification in pn is also a specific characteristic of ph on ct ( 9 ) . considering that the current case did not show such radiological patterns , we can rule out it easily from the diagnosis of current case .
as amyloids generally show well - defined 2 - 4 mm nodules with abnormal reticular opacities , diffusely dispersing in lung parenchyme ( 11 ) , it can be excluded from the current diagnosis .
it is well known that calcified pn is also made by infectious diseases ( e.g. healed disseminated histoplasmosis or miliary tuberculosis ) , hemosiderosis , pneumoconiosis , talcosis etc .
however , we can rule out them without difficulties because they are very rare diseases , exhibiting the radiological patterns of multiple high - density , diffuse small calcification nodules throughout the lung parenchyma ( 910 ) . taken together , the general pattern observed in the current korean mummy case was well matched with previous clinical findings reported from modern patients ( 1213 ) .
as far as our ct radiography and dissection results are concerned , the current case is likely to be the healed case of pulmonary tuberculosis ( calcified ghon complex ) , the first case identified among archaeologically obtained , pre - modern korean ( joseon ) samples .
in fact , revealing the earlier history of tb infection was a serious quest in paleopathology .
bartels ( 14 ) reported the evidence of spinal tuberculosis in a neolithic skeleton discovered near heidelberg , germany in 1907 .
spinal destructions possibly caused by pott 's disease were also identified in the ancient human bones from two different italy sites , dated between 3500 and 4000 bc ( 1516 ) .
more recent studies on ancient tuberculosis cases were successfully summarized by roberts and manchester ( 17 ) in 2007 and ortner ( 18 ) in 2003 .
although many pathological studies on archaeologically obtained human or animal samples worldwide have already been focused upon the evidences of ancient tuberculosis remained in them ( 19 ) , similar researches were very rarely performed on the counterpart samples discovered in korea .
only an exception was the ancient skeletal samples discovered in nukdo archaeological site ( gyeongsangnam - do ) , which was dated to the first century bc . upon the ancient korean skeletons , suzuki et al .
( 20 ) reported presumptive osteological sign of spinal tuberculosis having occurred in ancient korean people .
in fact , in the case , tv12 was collapsed wedge - shaped , and being fused with tv11 . though this might be the first - ever report discussing about the presumptive tuberculosis case identified among ancient korean remains
, we should admit the technical limitation of this because the conclusion of suzuki et al .
in fact , clear evidences on the tb infection affecting the lung parenchyme of ancient peoples therefore were not available yet in this country . in this regard ,
the current case is very significant to concerned researchers in korea . as calcified pn in our report
can be identified as an evident sign of pulmonary tb in a joseon mummy , we show that the disease could have been also prevalent in pre - modern korean society . considering recent studies on ancient mycobacteria dna worldwide have provided valuable addition to the knowledge of molecular evolution of the infectious disease , tb infecting human samples should be accumulated more in the future even from archaeological samples of korea as well . | we found calcified pulmonary nodules in a middle - aged female mummy discovered from 350-yr - old joseon tomb of korea . in the ct scan
, we found six radiopaque nodules in right lung , through the levels of thoracic vertebrae 1 to 6 .
we also found presumptive pleural adhesions in right thoracic cavity of ct images .
we re - confirmed radiological findings by our post - factum dissection on the same mummy . by the differential diagnosis , we speculate that the radiopaque calcification nodules and associated pleural adhesion could have been caused by tuberculosis .
this is the first - ever report on the pulmonary tuberculosis identified in archaeologically obtained , pre - modern korean samples . |
the number of publications about therapeutic and beneficial effects of transcranial direct current stimulation ( tdcs ) on the central nervous system has dramatically increased over the past several years .
one of the main reasons for the attractiveness of tdcs as a tool to modify neuroplasticity and neuronal activity is that tdcs is a noninvasive brain stimulation technique that is well tolerated and easily employed with other peripheral therapies [ 2 , 3 ] .
studies have highlighted tdcs as an alternative treatment method for schizophrenia , alzheimer 's , major depressive disorder [ 6 , 7 ] , stroke , and other neurological disorders .
moreover , tdcs has shown potential for aiding cognitive performance in healthy individuals with previous studies showing improvement of sustained attention , enhanced working memory , and enhanced functional connectivity in spatial navigation networks .
animal - based studies have been conducted to identify underlying electrophysiological mechanisms by which tdcs produces its beneficial effects on brain performance . using rodent models ,
studies have shown that tdcs increased cortical excitability , modulated motor - evoked potentials , stimulated synaptic mechanisms , and enhanced hippocampal synaptic plasticity .
these results suggest that tdcs may be a potential therapeutic option for patients with neurological and neuropsychiatric diseases and disorders . of interest ,
effects of tdcs were still observed following the cessation of stimulation and persisted for hours after tdcs treatments [ 1416 ] . compared to the electrophysiological mechanisms , less is known about the molecular and cellular pathways affected by tdcs .
spezia adachi et al . reported that hippocampal tnf- levels were decreased by repeated stimulation ( 20 min / day for 8 days ) .
another rodent - based study showed that tdcs reduced middle cerebral artery occlusion - induced expression of hemichannel pannexin-1 in hippocampal neurons in addition to preventing the occlusion - induced decrease in dendritic spine density .
another occlusion study reported that tdcs affected map-2 and gap-43 expression in some brain regions of cerebral ischemic rats .
overall , very few studies have been conducted to analyze tdcs - induced changes in protein and gene expression .
therefore , the purpose of this study was to assess the impact of anodal tdcs on whole transcriptomic profiles within the cerebral cortex , on which an electrode was attached , and provide insight into the molecular mechanisms of anodal tdcs at various current intensities . for this study ,
anodal tdcs was applied at several different intensities ( sham , 250 a , 500 a , and 2,000 a ) . following stimulation ,
dissects of the cerebral cortex were collected , rna was extracted , and rna - seq analysis was completed using next - generation sequencing ( ngs ) technology , obtained with the illumina rna - sequencing system .
data from the sequencer was analyzed with the tuxedo suite tools to produce gene counts and fold changes , which were analyzed using multiple bioinformatics databases .
results show that different intensities of tdcs can modulate a massive number of genes representing a collection of functional biological pathways .
male sprague dawley rats ( 9 - 10 weeks old ) were obtained from charles river laboratories ( wilmington , ma ) and housed in the wright - patterson air force base ( wpafb ) animal facility .
rats between 300 and 500 g were used for these experiments , doubly housed with ad libitum access to food and water , and maintained on a 12 : 12-hour light - dark cycle .
rodents were randomly assigned to sham , 250 a , 500 a , and 2,000 a tdcs groups ( n = 7 - 8 per group ) , and all experiments were performed during the light cycle and done by 12 pm .
all procedures were approved by the wpafb institutional animal care and use committee and performed in accordance with the national institute of health standards and the guide for the care and use of laboratory animals ( national research council , 2013 ) .
rodents were anesthetized with isoflurane ( piramal , shope med vet , mettawa , il ) at an average of 2 - 3% and maintained during the stimulation .
a head incision was made to expose the implantation area and a head electrode ( approximately 5 5 mm , axelgaard manufacturing factory ltd .
, fallbrook , ca ) was placed with the center on the sagittal suture , 2.5 mm caudal bregma .
the head electrode was cemented to the skull using metabond adhesive luting cement ( parkell inc . ,
edgewood , ny ) . once the cement was dry , acrylic ( stoelting co. fisher scientific , pittsburgh , pa ) was added over the cement to create a head cap .
a head clamp ( afrl , wpafb , oh ) was attached to the skull in order to anchor the acrylic and maintain the integrity of the head cap .
after anodal tdcs for 20 min was completed , rats were immediately euthanized and a portion of the cerebral cortex under the anodal tdcs location was collected and frozen on dry ice .
total rna was extracted from the cerebral cortex utilizing the rneasy mini kit , following the manufacturer 's protocol ( qiagen , valencia , ca ) .
rna samples from two animals were combined together for rna - seq analysis ( n = 4 per group ) to allow for sufficient volume of total rna and , then , overnight shipped to the next generation sequencing ( ngs ) facility at the ucla , ca . at the ngs facility ,
the library was constructed , and samples were multiplexed and tagged with standard illumina tags .
data was first obtained in .qseq file format from the rna sequencer , demultiplexed , and stored in .fastq file format .
tophat ( version 2.0.6 ) together with bowtie ( version 0.12.8 ) was used to align reads to ucsc genome browser ( rat genome assembly rgsc5.0/rn5 ) .
the sequencing resulted in about 54 million raw reads for each sample ( mean sed : 54,905,147 1,204,160 , p > 0.05 ) and more than 40 million of uniquely mapped reads ( mean sed : 44,790,986 930,596 , p > 0.1 ) . only uniquely mapped gene reads ( mean sed : 82% 0.25% )
the gene reads were quantified by htseq ( version 0.5.3p9 ) with ensembl 75 gene sets .
1.4.5 ) and genes that had no gene reads across all samples were discarded .
as previously recommended , genes with more than 1.2 log2 fold change in expression and an adjusted p value of less than 0.1 were classified as significantly differentially expressed .
david bioinformatics and panther classification system were used to analyze differentially expressed genes .
these databases were used to classify the genes into functional groups , providing information about their biological function . when using david , the enrichment score cutoff was set to be 1.3 ( which corresponds to a corrected p value of 0.05 ) .
the panther classification system ( http://pantherdb.org/ ) was also used to classify differentially expressed genes .
lists of gene names were entered and analyzed with the organism selection of rattus norvegicus .
the panther database recognized 418 , 252 , and 450 genes , respectively , from the gene lists from 250 , 500 , and 2,000 a samples ( at least 77% recognition rate ) .
genes recognized by the panther were classified according to pathway , biological process , and molecular function .
the panther database contains about 12,000 protein families , which are also divided into more than 83,000 functionally distinct protein subfamilies [ 25 , 27 ] .
normalized expression values for genes from deseq data were used to construct signed coexpression networks using the wgcna package in r .
low expression genes were first excluded from the analyses to remove noise ( the number of total genes decreased from 17,749 to 12,714 ) .
network construction and module detection were done based on the wgcna package manuals . briefly , after the 1st step of data input and cleaning was completed , the step - by - step construction of the gene network and identification of modules was used to construct a weighted gene network with a soft - thresholding power of 5 , for which scale - free topology fit index ( sft .
a dissimilarity calculated based on the topological overlap matrix transformed from the adjacency was used for hierarchical clustering to produce a hierarchical clustering tree of genes that was then used to identify the modules with a set of the minimum module size as 30 .
the dynamic tree cut was used to identify similar modules ; their eigengenes were calculated , clustered based on their correlation , and , then , merged into modules if their correlation was greater than 0.75 .
an association of individual genes in each module with our trait , tdcs current intensity , was quantified by defining gene significance as the absolute value of the correlation between the gene and the trait ( see figure 6(a ) ) .
a correlation of the module eigengene and the gene expression profile was calculated and defined as a quantitative measure of module membership .
modules that had a high significance for tdcs current intensity with genes as well as high module membership were identified and 2 modules with the top 2 highest correlations ( r 0.7 with p 0.005 ) were used to perform gene ontology ( go ) enrichment analysis ( table 4 ) .
the top 30 genes from the highest module were visualized with visant 5.0 for gene connections ( threshold of 0.35 ) .
results were analyzed both from htseq - count 's list of names , p values , and fold changes and from the pathways indicated by david and panther .
once tophat and htseq - count were run on the rna - seq data , log2 fold changes ( log2fc ) and p values were determined to gauge the difference between sham and experimental groups .
only those genes which fulfilled the minimum requirements for significance ( see bioinformatic analysis for details ) were considered for analysis .
when log2fc were compared between sham animals and those stimulated at 3 different currents , 947 , 945 , and 948 genes were identified from the groups of 250 a , 500 a , and 2000 a , respectively . when the data were plotted ( figure 1 ) , there was a clear separation between those stimulated at 250 or 500 a , and those stimulated at 2000 a .
the stimulation at 2000 a shows a marked overall increase in fold change . on the other hand , genes induced by
the 250 and 500 a intensities of anodal tdcs were expressed more when stimulated by the 2000 a intensity of anodal tdcs .
david bioinformatics analysis was used to classify significantly expressed genes into functional clusters as shown in figure 2 .
overall , each tdcs group included unique genes and , thus , unique functional clusters , which were not expressed in any other group .
groups with a large number of associated genes include transmembrane / signal peptide ( 22 genes ) in the intersection of 250 and 500 but not 2000 a , humoral immune response ( 36 genes ) in the intersection of 250 and 2000 but not 500 a , defense and immune response ( each with 6 genes ) in the intersection of 500 and 2000 but not 250 a , and cell adhesion / leukocyte activation ( 37 genes ) in the intersection of all 250 , 500 , and 2000 a . a number of clusters were unique to each tdcs current intensity : notably ribosomal proteins with 28 genes in the 250 a group , signal peptides with 84 genes in the 2000 a group , and , while not as enriched as the other clusters , cell adhesion in the 500 a group .
interestingly , no functional cluster was detected from the group 500 a only with significant enrichment .
the panther database was used to perform functional pathway analysis on the selected differentially expressed genes , and the data was consolidated into a heatmap ( figure 3 ) .
several similarities are readily evident by viewing the heatmap ; genes relating to inflammation mediated by the chemokine and cytokine pathway fell into the largest or second - largest functional pathways in some intersections and groups of 250 a and 2000 a .
another highly represented pathway in the intersection of 250 and 500 a , 250 and 2000 a , and all 250 , 500 , and 2000 a was t - cell activation , where it was the largest or second - largest functional pathway .
other large functional pathways included the interleukin signaling , cckr signaling map , apoptosis signaling , and egf - receptor signaling pathways in the 250 a group ; cadherin signaling and wnt signaling pathways in the 500 a group ; and integrin signaling pathway in the 2000 a group and the intersection of 250 , 500 , and 2000 a .
additionally , a number of neurotransmitter functional pathways were affected by tdcs , such as serotonergic , adrenergic , and dopaminergic pathways .
pantherdb classification analysis was used to visualize functional biological processes ( figure 4(a ) ) and molecular protein categories ( figure 4(b ) ) . in the functional biological process categories
in particular , for every intensity , the functional biological processes with the greatest number of associated genes were metabolic and cellular processes ( figure 4(a ) ) .
immune system process , response to stimulus , developmental process , and localization were also categories showing a consistently large number of genes , with the exception of immune system processes in the 500 a group only . in order to further explore the makeup of the largest functional biological process categories , genes associated with cellular ( figure 5(a ) ) and metabolic ( figure 5(b ) ) processes
cell communication dominates every group , with over half of the genes associated with it .
likewise , cell cycle and cellular component movement categories have relatively large numbers of genes in all groups .
the genes associated with cellular communication , the largest category in every group , are listed in table 1 .
metabolic process groups were dominated by one particular category . in particular , primary metabolic processes had more than half the genes in every group , often approaching three - quarters of all the genes .
aside from this huge group , phosphate - containing compound metabolic processes , nitrogen compound metabolic processes , and biosynthetic processes were identified from the groups of 250 a , 500 a , and 2000 a and the intersection of 250 and 500 a . these processes frequently have relatively large numbers of genes associated with them .
genes associated with primary metabolic processes ( the largest subgroup ) are listed in table 2 .
consistent patterns can be found in the functional protein categories shown in figure 4(b ) . in all groups ,
receptor proteins had the greatest number of associated genes . beyond this group , there is significantly more variation between groups , but it is typical that phosphatase , defense / immunity protein , signaling molecule , and transfer / carrier proteins have a large number of genes associated with them .
the genes associated with receptors , the largest category of molecular functional proteins , are listed in table 3 .
the panther analysis of our whole transcriptomic data showed that major subgroups within the receptor protein class were g - protein coupled receptors , cytokine receptors , ligand - gated ion channels , and protein kinase receptors .
to evaluate relationships between gene expression and tdcs intensities , we conducted wgcna analysis . a network heatmap plot ( figure 6(a ) ) was created by wgcna showing overall module - related gene branches in hierarchical clustering dendrograms .
an eigengene network heatmap ( figure 6(b ) ) showed the correlations among these 15 module eigengenes and tdcs intensities ( indicated by black arrows ) .
as shown in figure 6(b ) , tdcs current intensity is significantly correlated with only the brown and dark grey module eigengenes .
figure 6(c ) shows their correlations and p values with the tdcs current intensity trait , and only 2 modules showed absolute correlation values equal to or greater than 0.7 with p values less than 0.01 : the brown module ( r = 0.78 , p = 0.001 ) and dark grey module ( r = 0.7 , p = 0.005 ) .
gene significance ( an indicator for biological significance ) for tdcs current intensity was highly and significantly correlated with module membership ( an indicator for gene connectivity with the module eigengene ) in the brown module ( figure 6(d ) ) .
because the brown module showed the highest level of interconnectedness , the top 30 genes were pulled out from the brown module and exported for visual analyses ( figure 6(e ) ) . among these top 30 genes , the 3 most highly connected genes were six2 , cdh1 , and mpzl2 ( red - colored balls ) .
gene ontology ( go ) annotation of the brown and dark grey modules was used to identify the functional pathways of genes in these modules ( table 4 ) .
the analysis determined that the top 3 most highly ranked pathways in the brown module were labeled : extracellular region , proteinaceous extracellular matrix , and extracellular space . in the dark grey module ,
the top 3 pathways were response to drug , eosinophil chemotaxis , and eosinophil migration . among the top 20 ranked pathways in the combined brown and dark grey modules , the pathways extracellular region ( 299 genes ) ,
response to organic substance ( 245 genes ) , tissue development ( 178 genes ) , response to lipid ( 119 genes ) , and extracellular space ( 116 genes ) were found to have a great number of genes .
this study was conducted to investigate how anodal tdcs affects whole transcriptome expression in the cerebral cortex and to identify the functional biological pathways modulated by brain stimulation .
overall , a series of bioinformatics analyses of the rna - seq data demonstrated that tdcs resulted in significant transcriptomic modifications in the cortex and identified multiple biological pathways , such as various receptor signaling , metabolism , cytokine / chemokine signaling , cell adhesion , and transmembrane signaling .
additionally , our results also discovered that different current intensities have various effects on transcriptomic expression levels and , thereby , demonstrated that the patterns of gene induction and the magnitude of the response are dependent upon tdcs current intensity .
we first employed the david pathways tool to identify functional clusters of genes and found 32 functional clusters that were affected by tdcs at the different intensities .
however , not all functional clusters were significantly enriched across all intensities . cluster analysis with david bioinformatics resulted in 25 , 12 , and 21 clusters from the groups of 250 a , 500 a , and 2000 a , respectively ( figure 2 ) .
all intensities stimulated , to some degree , inflammatory / immune pathways , such as the activation of immune response ( 30 genes ) , cell adhesion / leukocyte activation ( 37 genes ) , and positive regulation of immune - regulation signal transduction ( 16 genes ) .
the stimulation at higher intensities affected a greater number of functional clusters related to inflammatory and immune responses ( 42% , 50% , and 57% of clusters were related in the 250 , 500 , and 2000 a groups , resp . ) . additionally , the inflammatory and immune pathways were significantly more upregulated in the 500 and 2000 a groups .
this result may be used to explain previous findings showing that higher intensities induced negative effects ( e.g. , tissue damage ) on the rodent cortex .
our histology data ( unpublished ) showed no visible lesion at or below 300 a , but visible lesion on the cortex was greater when the intensity was increased to 500 a .
a growing body of evidence suggests an antidepressant effect of tdcs in humans and rodents , and our data may provide more evidence to support the antidepressant effect of tdcs .
it was reported that potential therapeutic effects of tdcs on some psychiatric disorders , such as major depressive disorder , were induced through the regulation of gtp signaling pathways in the cerebral cortex .
the modulation of gtp signaling also requires the activation of some ion channels , especially calcium channels .
the results of the david functional clustering indicated that tdcs at all intensities affected gtp signaling pathways .
moreover , our data showed that , in particular , 250 and 500 a intensities affected more signaling pathways related to calcium ion binding and transmembrane / signal peptide .
our results suggest that tdcs could modulate calcium channel - to - gtp signaling , providing a potential mechanism by which tdcs could provide therapeutic and beneficial effects on some psychiatric disorders .
additional studies should be warranted to clarify the interaction between tdcs , psychiatric disorder , and these pathways , based upon the findings reported here .
david bioinformatic analysis was also able to detect gene pathways relating to inflammation , and chemokine and cytokine signaling were differentially expressed following stimulation at different intensities .
these pathways are important for metabolism and intercellular communication and can have effects on neuroplasticity , ltp , and the development of new neural pathways .
these pathways can serve both as indicators of the process by which neural plasticity might be affected and as warning signs of neural damage when establishing safe parameters for current intensity and duration of tdcs . moreover , increased levels of neural inflammation , as shown at the higher intensities ,
have been reported to be related to cognitive impairment , reduced cognitive performance , and depression , thus inducing negative behavioral changes [ 3437 ] .
the upregulation of proinflammatory cytokines and pathways correlated with observed lesioning of the brain in our study but was also observable when no visible lesions occurred .
these pathways can indicate that some damage is taking place , and the amount by which these pathways are upregulated can indicate how risky a current intensity might be for a subject .
we also analyzed our rna - sequencing data by using panther database in addition to david bioinformatics .
the use of panther database allowed for our data to be analyzed using additional databases and allowed results to be produced using slightly different bioinformatic methods for interpreting the rna - sequencing data .
the panther database analysis revealed that tdcs modified about 90 different functional biological pathways , 13 biological processes , and 26 protein molecule categories in the cortex .
as shown in figure 4 , the results showed similar patterns as seen in the david analysis , such as inflammatory / immune signaling and intracellular signaling pathways .
many genes in the intersection of 250 and 500 a function as intracellular signaling , while most of the genes detected in the intersection of all intensities were classified as immune and inflammatory signaling .
as discussed above , literature and our unpublished data showed that tdcs at 2000 a induced some degree of damage on the cortex ( especially in the upper layers ) .
this , in addition to the data from david functional analysis , suggests that some of the gene expression changes observed at 2000 a are the result of tissue damage , induced possibly by too high current intensity , and may be , thus , confounding effects of increased current intensity .
the panther pathway analysis showed that tdcs at different intensities modified signaling pathways of some neurotransmitter receptors , including serotonergic , adrenergic , gabaergic , dopaminergic , acetylcholinergic , glutamate , and oxytocin receptors .
these receptors , such as glutamate receptors , are required to form synaptic plasticity with the ras signaling pathway , and our data discovered this signaling pathway is affected by anodal tdcs .
interestingly , the 250 a intensity showed the greatest expression of ras signaling pathway - related genes , and as the current intensity was increased , fewer genes were expressed .
these findings may suggest that neurotransmitter receptors related to synaptic plasticity are affected at all levels of stimulation but that signaling pathways related to synaptic plasticity are more dependent upon stimulation current intensity . as identified by the panther biological analysis tool , the two largest biological process categories modified by tdcs at all current intensity levels were cellular and metabolic processes ( figure 4(a ) ) . when these categories were further broken into subcategories ( figure 5 ) , we found that most genes in cellular and metabolic processes were subclassified into cell communication and primary metabolic process categories ( at least more than 70% in each subcategory ) .
briefly , genes related to intracellular signaling pathways , receptors , and inflammatory response were detected in the subcategory of cell communication and genes related to transmembrane proteins , metabolic pathways , and intracellular signaling pathways were detected in the subcategory of primary metabolic process .
these results indicate that tdcs at all current intensity levels is effective to modify both cell metabolism and communication .
panther molecular protein analysis also produced significant findings , as shown in figure 4(b ) .
the panther analysis showed that 20 molecular classes in the cortex were affected by tdcs .
the largest protein class designation was receptor across all the groups , followed by nucleic acid binding , signaling molecule , and enzyme modulator classes .
we further analyzed the largest protein category , receptor , and found four subcategories : g - protein coupled receptor , cytokine receptor , ligand - gated ion channel , and protein kinase receptor .
one of the largest subclasses within the receptor category , g - protein coupled receptor , is known to be related to neurotransmitter receptors , metabolic pathways , and extracellular and intracellular signaling pathways .
an interesting finding from the receptor protein class was that one of the largest protein subclasses affected was cytokine receptors .
this result , that is , tdcs significantly effects a variety of receptor pathways , may support the results obtained from panther analyses showing significant changes in cell communication .
future studies should be warranted to elucidate underlying mechanisms of tdcs - related expression of these cytokine receptors and other receptors in the cortex . to evaluate the effects of tdcs intensity on transcriptomic expression ,
genes from the top 2 modules had pathway analysis performed on them by go annotation .
as shown in table 4 , some of the functional pathways in given modules had already been detected as important pathways by david and pantherdb .
in particular , the functional pathways response to organic substance from the brown module and heparin binding from the dark grey module had been detected by the david functional analysis ( figure 2 ) .
while some of the pathways detected by wgcna were unique , for example , extracellular space , extracellular region , tissue development , vasculature development , and blood vessel development in the brown module , many other pathways have clear analogues from the other bioinformatics assays . the cytokine and chemokine signaling pathways were detected by all three methods we conducted for this study .
these similarities between results obtained from wgcna and those from david bioinformatics and panther database analyses highlight the result that tdcs induces change in signaling pathways , especially involving cytokine and chemokine receptors , which in turn have important effects on how neural cells are communicating , metabolizing , and structuring . while several categories of genes , that is , those involved in metabolism or immune response , were significantly upregulated at all intensities , this does not indicate that modification of gene expression by tdcs is not dose - dependent .
rather , a single category of genes might be upregulated at all intensities , but the specific genes belonging to that category might be different from intensity to intensity .
indeed , some particular pathways can be upregulated at all current intensities yet have different outcomes depending on the presence or absence of regulatory genes , genes which are demonstrably dose - dependent .
one notable example of a functional pathway activated in an intensity - dependent manner , discovered through david analysis , is the nlrp3 inflammasome .
involved in neurogenesis , inflammation , and neural plasticity , the inflammasome leads to the production of il-1 , which can further upregulate inflammatory pathways , polarizing macrophages to the aggressive m1 phenotype , recruiting other immune system cells , and leading to tissue damage . at 250 and 500 a
, this pathway was regulated by il-10 and dusp1 , and il-1 was not significantly upregulated from the sham group . at 2000 a
, the picture is reversed : the regulatory elements were similar to the sham group , and il-1 showed 6-fold upregulation .
thus , the dose dependence is clearly shown to be a factor in the change of expression levels for some , but not all , of the genes significantly affected by tdcs .
modulation in treatment should therefore involve frequency stimulation , but only with acceptable parameters for current intensity , determined through experiment .
moreover , our findings may provide evidence to support long - lasting effects of one - time anodal tdcs on brain performance , such as neuroplasticity .
one recent electrophysiologic study showed beneficial effects of one - time anodal tdcs on neuronal plasticity and long - term potentiation ( ltp ) , and acute tdcs - induced changes were reported to last for hours [ 12 , 14 , 38 ] .
this enduring effect of one - time brain stimulation may be induced by changes in genes , thus protein , expression , and pathways that play an important role in neuronal plasticity and ltp .
although more supporting evidence is warranted to be provided , the current study shows that even one - time anodal tdcs modified the expression of a variety of genes and pathways and thus will suggest that enduring effects of one - time anodal tdcs in the brain performance could be the results of changes in transcriptomic expression
. additionally , future studies investigating in greater detail the time course of transcriptomic changes will be also necessary .
in this study , we revealed that anodal tdcs modified the expression of a variety of genes in the cerebral cortex .
our data provides transcriptomic evidence to explain the importance of the current intensity of anodal tdcs on the pattern of gene induction .
these results show an increased number of transcriptomic changes that are related to neuronal function and identified specified pathways that could contribute to the beneficial effects of tdcs on brain performance .
thus , noninvasive tdcs can be utilized to modulate gene expression within the brain and the pattern and magnitude of the transcriptomic response to tdcs are dependent upon the current intensity applied . | transcranial direct current stimulation ( tdcs ) has been shown to modulate neuroplasticity .
beneficial effects are observed in patients with psychiatric disorders and enhancement of brain performance in healthy individuals has been observed following tdcs .
however , few studies have attempted to elucidate the underlying molecular mechanisms of tdcs in the brain .
this study was conducted to assess the impact of tdcs on gene expression within the rat cerebral cortex .
anodal tdcs was applied at 3 different intensities followed by rna - sequencing and analysis . in each current intensity , approximately 1,000 genes demonstrated statistically significant differences compared to the sham group . a variety of functional pathways , biological processes , and molecular categories were found to be modified by tdcs .
the impact of tdcs on gene expression was dependent on current intensity .
results show that inflammatory pathways , antidepressant - related pathways ( gtp signaling , calcium ion binding , and transmembrane / signal peptide pathways ) , and receptor signaling pathways ( serotonergic , adrenergic , gabaergic , dopaminergic , and glutamate ) were most affected . of the gene expression profiles induced by tdcs
, some changes were observed across multiple current intensities while other changes were unique to a single stimulation intensity .
this study demonstrates that tdcs can modify the expression profile of various genes in the cerebral cortex and that these tdcs - induced alterations are dependent on the current intensity applied . |
rice is a major crop used by two thirds of the world 's population as their staple food .
it is drawing attention recently as a food with considerable impact on people 's health , and is usually consumed as brown rice or polished rice depending on the degree of milling .
brown rice is spotlighted as a health food containing a large variety of nutrients , dietary fiber , minerals and vitamins and its consumption is reported to be increasing every year . according to previous studies on americans ' consumption of grain ,
it was reported that those who kept taking a regular meal of whole grain maintained a normal weight and exhibited lower prevalence of adult diseases compared to those who did not . on the other hand , those eating rice preferred foods such as grains , vegetables , poultry and fish ,
so they were supplied with more diverse nutrients from healthy menus than those who preferred meat . in a study on american people 's grain consumption ,
the intake of rice was found to have an effect on preventing adult diseases , and another study on the effect of rice intake on mental health and immunity among japanese , comparing before and after rice intakes , found that rice intake improved mental health and immunity .
for these reasons , the intake of rice and vegetables is increasing in americans ' menus .
people in developed western countries get carbohydrates mainly from grain foods such as bread , snacks and noodles . and the consumption of wheat is greater than that of other grains , though the intake of cereal and processed rice foods has been increasing since the 1990s .
it is reported moreover , that rice enriched with thiamin , riboflavin , iron , b vitamins , niacin , etc .
is being consumed in the u.s . to supplement the shortage of nutrients in polished rice or processed cereal . in asian countries where rice is consumed as a staple food however
, gradually we see that rice intake is decreasing while meat intake is increasing due to changing menus as a result of westernization . particularly in korea
the intakes of wheat and meat per person have increased by 2 and 1.5 times respectively during the period from the 1990s to the present but rice intake has decreased every year during the period from 1998 to 2005 .
what is more , the meal skipping rate in korea , which was heightened by the economic crisis starting in 1997 , is believed to have contributed to the decrease in rice intake in the early 1990s , but even after the recovery of the economic situation rice intake has continued to decrease [ 11 - 13 ] .
previous studies reported that rice is a crucial food for maintaining health and preventing adult diseases . whether to eat rice or not , and the quantity of rice intake are recognized as important factors related to the incidence of various diseases .
for these reasons , many countries have conducted studies on the effects and intake of rice as well as on rice consumption . in korea however , although rice is consumed as staple food , few studies have been conducted on rice consumption .
thus , this study purposed to analyze trends in korean adults ' rice intake using data from knhanes ( 1998 - 2005 ) and to provide basic data usable in food - related areas and the food service industry .
this study was conducted using the research methods of lee and kim , who studied korean people 's vegetable intake , and the specific research methodology is as follows .
this study analyzed 28,660 koreans between the ages of 19 and 65 who participated in the dietary lifestyle survey and 24-hour dietary recall method during 1998 , 2001 and 2005 knhanes ( korean national health and nutrition examination survey ) subjects .
this study regarding rice consumption of korean adults analyzed the trend of annual per capita consumption of rice intake according to meal type ( breakfast , lunch , dinner and snack ) and serving place(home , institution , restaurant and other place ) .
foods were coded and analyzed using a five - digit food coding scheme developed according to the korean ministry of health and welfare in 1998 , 2001 and 2005 for knhanes .
items falling under the category of rice were further characterized as polished rice , unpolished rice and sticky rice . in addition
, rice was consumed by a significant portion of the korean adult population from 1998~2005 .
comparison of the amount of rice consumption per day included a 24h recall scenario sampling of 28,660 from the knhnes during 1998~2005 .
total gender , age , household income and region are directly related to rice consumption in korean adults .
10.01(sudaan , research triangle institute , research triangle park , nc , usa ) by chi - square test , bonferroni 's multiple t - test .
this study was conducted using the research methods of lee and kim , who studied korean people 's vegetable intake , and the specific research methodology is as follows .
this study analyzed 28,660 koreans between the ages of 19 and 65 who participated in the dietary lifestyle survey and 24-hour dietary recall method during 1998 , 2001 and 2005 knhanes ( korean national health and nutrition examination survey ) subjects .
this study regarding rice consumption of korean adults analyzed the trend of annual per capita consumption of rice intake according to meal type ( breakfast , lunch , dinner and snack ) and serving place(home , institution , restaurant and other place ) .
foods were coded and analyzed using a five - digit food coding scheme developed according to the korean ministry of health and welfare in 1998 , 2001 and 2005 for knhanes .
items falling under the category of rice were further characterized as polished rice , unpolished rice and sticky rice . in addition
, rice was consumed by a significant portion of the korean adult population from 1998~2005 .
comparison of the amount of rice consumption per day included a 24h recall scenario sampling of 28,660 from the knhnes during 1998~2005 .
total gender , age , household income and region are directly related to rice consumption in korean adults .
10.01(sudaan , research triangle institute , research triangle park , nc , usa ) by chi - square test , bonferroni 's multiple t - test .
under this study , the data of adults 19 years and older who responded to the food intake frequency survey ( 12 years old and older ) and the food intake survey ( survey of 24-hour recall method for each individual ) of the national health and nutrition surveys ( 1998 - 2005 ) was facilitated to implement cross analysis for 3 years following gender , age , education level , occupation , income , residence , marital status and eating - out frequency .
looking into the general information of adults , under the gender of ( table 1 ) , men had 3,362 persons in 1998 , 3,265 persons in 2001 , and 2,946 persons in 2005 that 2005 had the most . in the case of women , there were 3,849 persons in 2001 which was more than 1998 and 2005 , and the ratio showed a higher rate for women than men ( p < 0.001 ) . for the age group ' 30 - 49 years old ' in 1998 had 46.4% , 2001 for 45.5% , and 2005 for 46.2% to show the highest , and 65 years old or more had the lowest ratio ( p < 0.001 ) . for regions ,
the highest number of respondents was from ' metropolitan ' areas and the least was from ' rural ' areas .
the residents in ' metropolitan ' areas in 1998 was 48.3% which increased in 2001 by 12.3% , and eventually fell in 2005 by 0.5% (
the number of respondents in the ' middle & small cities ' , compared between 1998 and 2001 , showed a decrease of 7.1% and increase of 2.3% between 2001 and 2005 .
respondents in ' rural ' regions , showed a decrease from 20.3% in 1998 to 5.3% and 1.8% in 2001 and 2005 , respectively , to display noticeable result ( p < 0.001 ) .
looking into education level , a ' person with high school education ' was the most common respondent in 2001 and 2005 , excluding 1998 , and a person with college or higher education was the least common respondent on all 3 occasions . for household income ,
the ' low income class ' in 1998 was 34.6% and it decreased by 2001 to 15.7% and in 2005 it fell to 14.8% ( p < 0.001 ) . the ' middle class ' , accounted for 44.5% in 1998 and declined by 1.9% in 2001 and 6.1% in 2005 to display a noticeable result ( p < 0.001 ) .
in the ' high income class ' , data showed a difference from 1998 to decline in 2001 to 17.6% and 2005 for 20.8% ( p < 0.001 ) . for occupation ,
all 3 years had more ' employed ' than ' unemployed ' , and both ' employed ' and ' unemployed ' had shown a noticeable result in 2001 and 2005 compared to 1998 ( p < 0.001 ) .
the ' employed ' group declined in 2001 by 2.4% compared to 1998 , but it increased in 2005 by 1.5% ( p < 0.001 ) , and in the event of the ' unemployed ' , it increased by 2.4% in 2001 from 40.3% of 1998 , but then decreased by 1.5% in 2006 ( p < 0.001 ) . looking into the marital status ,
all 3 years showed ' married ' with an 80% higher rate than ' unmarried ' and both ' married ' and ' unmarried ' displayed a noticeable result for 3 years ( p < 0.001 ) .
the ' unmarried ' group were 18.1% in 1998 which increased in 2001 by 0.7% and 20005 by 2.4% ( p < 0.001 ) .
but in the event of ' married ' , compared to 1998 , it declined in 2001 by 0.7% and in 2005 by 4.4% ( p < 0.001 ) .
the rice intake amount of all korean adults is shown as in ( table 2 , fig .
1 ) . the whole rice intake amount in 1998 was 224.6 g and it declined in 2001 and 2005 to 190 g and 179.4 g , respectively ( p < 0.05 ) . for the rice intake category of adult men and women , the whole rice intake amount showed a decrease from in 1998 to in 2001 and 2005 ( p < 0.05 .
the intake amount of ' polished rice ' was declined in 2001 for and 2005 from in 1998 . in the event of ' unpolished rice ' and ' sticky rice ' ,
the survey showed an increasing trend in 2001 and 2005 compared to 1998 . and , regarding the rice intake amount of adult men and women
the intake measurements of ' polished rice ' was shown to decline in 1998 to in 2001 and 2005 ( fig .
the rice intake amount for each meal showed a decrease in 2001 and 2005 compared to 1998 for ' breakfast ' , ' lunch ' and ' dinner ' , and the place of meal preparation had a declining trend for ' home ' , ' institution ' , ' restaurant ' , and ' other places ' . in the case of rice consumption at each meal , breakfast , lunch , and dinner a decline was seen in 2001 and 2005 compared to 1998 , but in the event of snacks , it increased beginning in 1998 . and ,
in the case of the rice intake amount of each place , home , ' institution ' , ' restaurant ' , and ' other places ' showed a decline in 2001 and 2005 compared to 1998 . for the rice intake amount of each meal , each meal showed a steady decline in 2001 and 2005 compared to 1998 , and for the rice intake category for each place for the meal , it displayed a declining trend in all places .
the results of analyzing the rice intake amount trend for each age are shown on ( table 3 , 4 , fig . 1 , 2 ) and
the extrapolated whole rice intake amount and intake amount of ' polished rice ' are analyzed from the data to have a declining trend of declining in all age divisions .
whole rice intake amount in the rice consumption category of the ' 19 - 29 years old ' , was 210.8 g in 1998 and showed a steady decline in 2001 and 2005 to 174.1 g and 163.8 g , respectively , and the consumption amount of ' polished rice ' was declined in 2001 and 2005 from beginning in 1998 .
the consumption amount of ' unpolished rice ' and ' sticky rice ' showed an increasing trend in 2001 and 2005 compared to 1998 . on the consumption amount of rice for each meal ,
all meals had declined in 2001 and 2005 compared to 1998 , but in the event of ' snacks ' , it was shown to increase compared to 1998 .
consumption of the least amount of rice was for ' breakfast ' while lunch had the highest rice consumption .
for the rice intake consumption by place , ' home ' was the place with the greatest consumption , followed by ' institution ' , ' restaurant ' , and ' other places ' , and all places had a declining trend in 2001 and 2005 compared to 1998 . in the age group ' 19 - 29 years old ' , the whole rice consumption amount and consumption amount of ' polished rice ' was lowest for all age classes , while rice consumption amount continued to decline each age category .
the whole rice consumption data of the ' 30 - 49 ' age group in 1998 was 223.2 g and it declined to 187.7 g in 2001 and 173.9 g in 2005 ( p < 0.05 ) , and in the event of ' polished rice ' it was 1998 but showed a noticeable result with a decline in 2001 and 2005 by in 1998 .
the consumption amount of ' unpolished rice ' was shown to increase from 1998 , and in the case of ' sticky rice ' , it declined in 2001 but increased in 2005 . in the rice consumption data for each meal , ' snack ' was shown to be the lowest consumption amount , and ' lunch ' had the largest consumption amount , and in all meals 2001 and 2005 had a decrease compared to 1998 ( fig .
set for each place of meals , all places had a declining trend in 2001 and 2005 compared to 1998 . '
home ' showed the most rice consumed and other places had the least consumption amount ( fig .
the age group of ' 30 - 49 years old ' consumed more rice than the age class of ' 19 - 29 years old ' , and 2001 and 2005 showed a decreasing trend compared to 1998 .
the whole rice consumption amount of the age group ' 50 - 64 ' in 1998 showed 238.4 g and in 2001 and fell to 207.1 g and in 2005 to 195.2 g with a declining trend each year ( p < 0.05 ) , and the consumption amount of ' polished rice ' was reduced in 2001 and 2005 by 1998 .
the consumption data of ' unpolished rice ' comparing 1998 to 2001 showed an increase of 9.2% , but in 2005 it did not show any noticeable change . in the rice consumption data for each meal , ' lunch ' had the highest rice consumption , and ' snack ' had the lowest rice consumption amount and in the case of the consumption amount for ' breakfast ' , different age class had more rice consumption than the amount of rice consumption in ' breakfast ' .
for each meal , 2001 and 2005 showed a declining trend compared to 1998 , but in the event of ' snack ' , it was shown to increase ( fig .
the rice consumption amount of ' home ' was the highest and ' other places ' was lowest , and in all places , 2001 and 2005 showed a declining trend compared to 1998 .
the age group ' 50 - 64 ' consumed the most rice , but like other age classes , the whole rice consumption amount was in a declining trend ( fig . 6 ) .
whole rice consumption data in the age group of ' 65 or older ' in 1998 was 233.9 g. this fell in 2001 to 194 g and in 2005 to 202.3 g , and the consumption amount of ' polished rice ' in 1998 was 253 g , which fell in 2001 , and 2005 ( p < 0.05 ) . unlike the trend of reduction each year for the consumption amount of ' polished rice ' of other age groups , the age group of ' 65 or older ' showed a higher consumption amount in 2005 than in 2001 . the consumption amount of ' unpolished rice ' and ' sticky rice ' reduced in 2001 and 2005 compared to 1998 , and it showed differences with other age groups . in the rice consumption data set for each meal , lunch meals consumed the most rice and ' snacks ' had the lowest consumption overall , and all meals had a declining trend in 2001 and 2005 compared to 1998 ( fig .
the rice consumption amount at ' home ' was the highest , and it was higher than the rice consumption amount at ' home ' out of any other age group .
the rice consumption amount of other places was the lowest , and it declined at ' home ' and ' institution ' in 2001 and 2005 compared to 1998 .
the rice intake amount at ' other places ' increased by 14.9 g in 2001 compared to 1998 , but in 2005 , it was surveyed and decline by 14.5 g. the age group of ' 65 or older ' had the higher frequency of rice consumption at home compared to other age groups and the rice consumption at ' breakfast ' did not have much of a difference from the rice consumption amount of lunch and dinner , but the whole rice intake amount was shown to decline ( fig . 8) .
under this study , the data of adults 19 years and older who responded to the food intake frequency survey ( 12 years old and older ) and the food intake survey ( survey of 24-hour recall method for each individual ) of the national health and nutrition surveys ( 1998 - 2005 ) was facilitated to implement cross analysis for 3 years following gender , age , education level , occupation , income , residence , marital status and eating - out frequency .
looking into the general information of adults , under the gender of ( table 1 ) , men had 3,362 persons in 1998 , 3,265 persons in 2001 , and 2,946 persons in 2005 that 2005 had the most . in the case of women , there were 3,849 persons in 2001 which was more than 1998 and 2005 , and the ratio showed a higher rate for women than men ( p < 0.001 ) . for the age group ' 30 - 49 years old ' in 1998 had 46.4% , 2001 for 45.5% , and 2005 for 46.2% to show the highest , and 65 years old or more had the lowest ratio ( p < 0.001 ) . for regions ,
the highest number of respondents was from ' metropolitan ' areas and the least was from ' rural ' areas .
the residents in ' metropolitan ' areas in 1998 was 48.3% which increased in 2001 by 12.3% , and eventually fell in 2005 by 0.5% (
the number of respondents in the ' middle & small cities ' , compared between 1998 and 2001 , showed a decrease of 7.1% and increase of 2.3% between 2001 and 2005 .
respondents in ' rural ' regions , showed a decrease from 20.3% in 1998 to 5.3% and 1.8% in 2001 and 2005 , respectively , to display noticeable result ( p < 0.001 ) .
looking into education level , a ' person with high school education ' was the most common respondent in 2001 and 2005 , excluding 1998 , and a person with college or higher education was the least common respondent on all 3 occasions . for household income ,
the ' low income class ' in 1998 was 34.6% and it decreased by 2001 to 15.7% and in 2005 it fell to 14.8% ( p < 0.001 ) . the ' middle class ' , accounted for 44.5% in 1998 and declined by 1.9% in 2001 and 6.1% in 2005 to display a noticeable result ( p < 0.001 ) .
in the ' high income class ' , data showed a difference from 1998 to decline in 2001 to 17.6% and 2005 for 20.8% ( p < 0.001 ) . for occupation ,
all 3 years had more ' employed ' than ' unemployed ' , and both ' employed ' and ' unemployed ' had shown a noticeable result in 2001 and 2005 compared to 1998 ( p < 0.001 ) .
the ' employed ' group declined in 2001 by 2.4% compared to 1998 , but it increased in 2005 by 1.5% ( p < 0.001 ) , and in the event of the ' unemployed ' , it increased by 2.4% in 2001 from 40.3% of 1998 , but then decreased by 1.5% in 2006 ( p < 0.001 ) . looking into the marital status ,
all 3 years showed ' married ' with an 80% higher rate than ' unmarried ' and both ' married ' and ' unmarried ' displayed a noticeable result for 3 years ( p < 0.001 ) .
the ' unmarried ' group were 18.1% in 1998 which increased in 2001 by 0.7% and 20005 by 2.4% ( p < 0.001 ) .
but in the event of ' married ' , compared to 1998 , it declined in 2001 by 0.7% and in 2005 by 4.4% ( p < 0.001 ) .
the rice intake amount of all korean adults is shown as in ( table 2 , fig .
1 ) . the whole rice intake amount in 1998 was 224.6 g and it declined in 2001 and 2005 to 190 g and 179.4 g , respectively ( p < 0.05 ) . for the rice intake category of adult men and women , the whole rice intake amount showed a decrease from in 1998 to in 2001 and 2005 ( p < 0.05 .
the intake amount of ' polished rice ' was declined in 2001 for and 2005 from in 1998 . in the event of ' unpolished rice ' and ' sticky rice ' ,
the survey showed an increasing trend in 2001 and 2005 compared to 1998 . and , regarding the rice intake amount of adult men and women
the intake measurements of ' polished rice ' was shown to decline in 1998 to in 2001 and 2005 ( fig .
the rice intake amount for each meal showed a decrease in 2001 and 2005 compared to 1998 for ' breakfast ' , ' lunch ' and ' dinner ' , and the place of meal preparation had a declining trend for ' home ' , ' institution ' , ' restaurant ' , and ' other places ' . in the case of rice consumption at each meal , breakfast , lunch , and dinner a decline was seen in 2001 and 2005 compared to 1998 , but in the event of snacks , it increased beginning in 1998 . and , in the case of the rice intake amount of each place , home , ' institution ' , ' restaurant ' , and ' other places ' showed a decline in 2001 and 2005 compared to 1998 . for the rice intake amount of each meal ,
each meal showed a steady decline in 2001 and 2005 compared to 1998 , and for the rice intake category for each place for the meal , it displayed a declining trend in all places .
the results of analyzing the rice intake amount trend for each age are shown on ( table 3 , 4 , fig . 1 , 2 ) and
the extrapolated whole rice intake amount and intake amount of ' polished rice ' are analyzed from the data to have a declining trend of declining in all age divisions .
whole rice intake amount in the rice consumption category of the ' 19 - 29 years old ' , was 210.8 g in 1998 and showed a steady decline in 2001 and 2005 to 174.1 g and 163.8 g , respectively , and the consumption amount of ' polished rice ' was declined in 2001 and 2005 from beginning in 1998 .
the consumption amount of ' unpolished rice ' and ' sticky rice ' showed an increasing trend in 2001 and 2005 compared to 1998 . on the consumption amount of rice for each meal ,
all meals had declined in 2001 and 2005 compared to 1998 , but in the event of ' snacks ' , it was shown to increase compared to 1998 .
consumption of the least amount of rice was for ' breakfast ' while lunch had the highest rice consumption .
for the rice intake consumption by place , ' home ' was the place with the greatest consumption , followed by ' institution ' , ' restaurant ' , and ' other places ' , and all places had a declining trend in 2001 and 2005 compared to 1998 . in the age group ' 19 - 29 years old ' , the whole rice consumption amount and consumption amount of ' polished rice ' was lowest for all age classes , while rice consumption amount continued to decline each age category .
the whole rice consumption data of the ' 30 - 49 ' age group in 1998 was 223.2 g and it declined to 187.7 g in 2001 and 173.9 g in 2005 ( p < 0.05 ) , and in the event of ' polished rice ' it was 1998 but showed a noticeable result with a decline in 2001 and 2005 by in 1998 .
the consumption amount of ' unpolished rice ' was shown to increase from 1998 , and in the case of ' sticky rice ' , it declined in 2001 but increased in 2005 . in the rice consumption data for each meal , ' snack ' was shown to be the lowest consumption amount , and ' lunch ' had the largest consumption amount , and in all meals 2001 and 2005 had a decrease compared to 1998 ( fig .
set for each place of meals , all places had a declining trend in 2001 and 2005 compared to 1998 . ' home ' showed the most rice consumed and other places had the least consumption amount ( fig .
the age group of ' 30 - 49 years old ' consumed more rice than the age class of ' 19 - 29 years old ' , and 2001 and 2005 showed a decreasing trend compared to 1998 .
the whole rice consumption amount of the age group ' 50 - 64 ' in 1998 showed 238.4 g and in 2001 and fell to 207.1 g and in 2005 to 195.2 g with a declining trend each year ( p < 0.05 ) , and the consumption amount of ' polished rice ' was reduced in 2001 and 2005 by 1998 .
the consumption data of ' unpolished rice ' comparing 1998 to 2001 showed an increase of 9.2% , but in 2005 it did not show any noticeable change . in the rice consumption data for each meal , ' lunch ' had the highest rice consumption , and ' snack ' had the lowest rice consumption amount and in the case of the consumption amount for ' breakfast ' , different age class had more rice consumption than the amount of rice consumption in ' breakfast ' .
for each meal , 2001 and 2005 showed a declining trend compared to 1998 , but in the event of ' snack ' , it was shown to increase ( fig .
the rice consumption amount of ' home ' was the highest and ' other places ' was lowest , and in all places , 2001 and 2005 showed a declining trend compared to 1998 .
the age group ' 50 - 64 ' consumed the most rice , but like other age classes , the whole rice consumption amount was in a declining trend ( fig .
whole rice consumption data in the age group of ' 65 or older ' in 1998 was 233.9 g. this fell in 2001 to 194 g and in 2005 to 202.3 g , and the consumption amount of ' polished rice ' in 1998 was 253 g , which fell in 2001 , and 2005 ( p < 0.05 ) .
unlike the trend of reduction each year for the consumption amount of ' polished rice ' of other age groups , the age group of ' 65 or older ' showed a higher consumption amount in 2005 than in 2001 .
the consumption amount of ' unpolished rice ' and ' sticky rice ' reduced in 2001 and 2005 compared to 1998 , and it showed differences with other age groups . in the rice consumption data set for each meal , lunch meals consumed the most rice and ' snacks ' had the lowest consumption overall , and all meals had a declining trend in 2001 and 2005 compared to 1998 ( fig .
the rice consumption amount at ' home ' was the highest , and it was higher than the rice consumption amount at ' home ' out of any other age group .
the rice consumption amount of other places was the lowest , and it declined at ' home ' and ' institution ' in 2001 and 2005 compared to 1998 . the rice intake amount at '
other places ' increased by 14.9 g in 2001 compared to 1998 , but in 2005 , it was surveyed and decline by 14.5 g. the age group of ' 65 or older ' had the higher frequency of rice consumption at home compared to other age groups and the rice consumption at ' breakfast ' did not have much of a difference from the rice consumption amount of lunch and dinner , but the whole rice intake amount was shown to decline ( fig . 8) .
this study analyzed trends in korean adults ' rice intake during the period from 1998 to 2005 , and found that whole rice intake was decreasing every year . in the results of this study
, rice intake was decreasing in similar patterns for both men and women , and similar decreasing trends were observed in each age category as well .
what is more , rice was consumed more at lunch and dinner than in breakfast among the meals , and households consumed the largest amount of rice by place of meal preparation .
the decreasing trend in rice intake was similar between men and women and in all age groups , but the rate of rice intake at home was higher in older age groups . in the study on one - portion size foods frequently eaten by korean adults as well ,
rice intake per person decreased every year and the one - portion size of rice taken by koreans reached 80 g in 2005 , showing a result similar to the decreasing rice consumption found in this study .
the results of this study showed that korean people 's rice intake had been decreasing every year since the late 1990s .
this trend was also observed in other countries consuming rice as a staple food . according to a study that analyzed trends in annual rice intake per household in jiangsu province , china during the period from 1995 to 2007 ,
rice consumption decreased steadily from 71.3 kg in 1995 to 56.2 kg in 2000 and 50.2 kg in 2007 . with regard to trends in annual rice intake per person in other asian countries using rice as a staple food , annual rice intake was found to have decreased from 65.1 kg in 1999 to 61.4 kg in japan ( data from maff : ministry of agriculture , forestry and fisheries in japan ) , from 54.9 kg in 1999 to 48.6 kg in 2005 in taiwan ( data from taiwan food balance sheet ) , and from 96.9 kg in 1999 to 80.7 kg in 2005 in korea ( fig .
9 ) . summing up these previous studies , korea is still consuming a larger amount of rice than japan and taiwan , but the rate of decrease is higher than that in japan and taiwan . considering the fast rate of decrease in rice intake in korea compared to other asian countries consuming rice as their staple food ,
it is necessary to enact campaigns and dietary life education programs to promote rice consumption .
different from asian countries where rice intake is going down , western regions like the u.s . and
europe show an increasing trend in the intake of grains including rice as reported by several studies on the trends of rice intake . according to a study on americans ' rice intake during the periods between 1994 - 1996 ( data from csfii ) and between 2001 - 2002 ( data from nhanes ) ,
the proportion of people taking rice over 1/4 cup a day ( 14.1 g in dry weight ) increased from 17.4% in 1994 - 1996 to 18.2% in 2001 - 2002 , and the proportion of those not eating rice decreased from 78.8% to 77.3% , showing a general trend of increase in rice intake among the american population . in a study on 10 years ' intake of foods and nutrients by australians aged over 60 , on the contrary , the intake of bread and cereal decreased from 239 g in 1992 - 1994 ( baseline ) to 229 g and 222 g , respectively , in 1997 - 1999 and 2002 - 2004 among men , and from 218 g in 1992 - 1994 to 212 g ( 1997 - 1999 ) and 209 g ( 2002 - 2004 ) among women , showing a decreasing trend in the consumption of bread and cereal among both men and women . in the results of this study ,
rice consumption by restaurants went down from 141.4 g in 1998 to 109.4 g in 2001 and up to 110.7 g in 2005 , but whole rice intake decreased compared to the baseline level in 1998 .
this was similar to the previous report that the consumption of rice , which had been used as the main nutrition source , decreased naturally as a result of the westernization of restaurant menus in asian countries , the diversification of foods replacing rice as the sole staple food , and the increasing frequency of dining - out .
when studies on rice consumption in korea were reviewed , rice consumption decreased gradually as a result of food culture being westernized since the 1990s and increasingly frequent dining - outs , and rice intake was lowest among women in their 20s-30s who dine out more frequently than other age groups .
studies on factors influencing rice intake reported that the type and amount of rice consumed were influenced by factors such as race , gender , age , area , economic level , and lifestyle . a study on rice consumption by asian immigrants living in houston and
texas found that the preferred variety and quality of rice were different according to the consumer 's income . according to another study on americans ' rice intake during the periods 1994 - 1996 and 2001 - 2002 , the proportion of people eating rice over 1/4 cup a day was largest as 30.2% among hispanics , and 23.6% , 23.4% and 14.2% , respectively , among blacks , mexican americans , and caucasians . in a study that surveyed american people 's rice intake according to education level ,
the proportion of rice eaters was largest as 21.0% among middle school graduates or lower , and 19.3% and 13.5% , respectively , among two - year college graduates and high school graduates . in another survey on rice consumption according to age by asian immigrants living in houston and texas in the 1990s , young consumers influenced by western culture preferred jasmine - type rice but consumed rice less than adult immigrants . in this study
as well , korean people 's rice intake was higher in older people as reported similarly in previous studies .
in many studies , on the other hand , socio - economic environment was found to influence food intake .
the meal skipping rate increased and rice consumption decreased considerably in korea with the imf crisis in december , 1997 , but the meal skipping rate went down sharply along with economic recovery .
in the same way , korean people 's vegetable intake decreased in 1998 and then increased gradually with economic recovery .
according to a study that surveyed indonesian pregnant women 's dietary habits during the economic crisis between 1996 - 1998 , the number of women avoiding beneficial food was 3 among urban pregnant women and 53 among rural pregnant women before the economic crisis but the numbers decreased to 2 and 47 , respectively , during the economic crisis . in this study on korean people 's rice intake , the decreasing trend in rice intake was observed in all age groups and rice intake was lowest in the age group of 20 - 30s and highest in the group aged over 65 . in a study that surveyed the american population consuming grains during the period 1990 - 1992 , the proportion of those taking grain food 3 - 3.99 times a day was 23.4% among adults aged over 19 , lower than 35.7% in the age group of 2 - 18 and 26.1% in the infant group younger than 2 . in this study , the amount and ratio of rice consumption were different among meals .
in general , the amount was lowest at in breakfast and larger in lunch and dinner , but in the age groups of 50 - 64 and over 65 , rice intake was little different among the meals and was larger than that in other age groups .
the results of the data suggest that the declining trends in korean adults ' rice consumption can be related to the tendency to skip breakfast altogether or the abundance of substitute breakfast foods ie.bread and other cereal grain . moreover , rice consumption was lowest in the age group of 19 - 29 showing the highest tendencies to skip breakfast of all age division , and was highest in the age group of 50 - 64 who hardly skip breakfast . in a study on korean people 's vegetable intake as well , breakfast skipping in every category influenced the group 's vegetable consumption and the same result was reported on the breakfast skipping rate by age group . according to the results of analysis in this study ,
this trend was considered to be influenced by several the factors of the possibility of changed food culture , socio - economic phenomena , and other external factors .
but there is a limitation in the diversity of comparative studies on rice intake in connection to changed dietary life environment , socio - economic factors and other related factors .
thus , more advanced research on food intake and change should be conducted in consideration of various socio - economic factors of subjects and countries based on various previous studies on rice intake . | the objective of this study was to provide information regarding trends of rice consumption of korean adults based on different meal types .
respondent reports 24-hour recall data from the korean national health and nutrition examination survey were used to assess daily rice consumption and intake ratios of rice for different meal types and places of preparation .
rice intake had gradually decreased from 224.6 g in 1998 to 190 g in 2001 and to 179.4 g in 2005 .
the rice consumption of korean adults decreased every year in all ages for all places of meal preparation in 2001 and 2005 compare to 1998 .
analysis for each meal type showed that rice intake at breakfast had not considerably changed , but rice intake had decreased at lunch and dinner . while the rice consumption ratio at lunch and dinner decreased , it also decreased or did not change at snack times except for the 19 - 29 age groups .
all the age groups revealed comparable change in the analysis for meal types .
there was some diversity between all age divisions in daily rice intake depending on place of meal preparation .
the rice consumption by place of meal preparation was generally highest at home , lowest at other places , but it decreased in all places .
the rice consumption at home was highest in the over 50 age group , lowest in the 20 - 30 age group .
these changes seem to be related to food intake patterns of rice and substitutional foods in the diets and development regarding socio - economic status .
so the need for further study on differences in rice intake based on socioeconomic levels and age group are indicated . |
inclusion - body myopathy with paget 's disease of the bone and frontotemporal dementia ( ibmpfd ) is a rare , late - onset autosomal disorder arising from missense mutations in a gene coding for valosin - containing protein .
we report the case of a man carrying the previously described p.arg159his mutation , who had an unusual axonal sensorimotor neuropathy as the first clinical manifestation of ibmpfd , and for whom diagnosis only became clear 8 years later when the patient developed frontotemporal dementia .
this underdiagnosed disorder should be considered when a patient develops dementia or has signs of paget 's disease .
inclusion - body myopathy ( ibm ) with paget 's disease of the bone ( pdb ) and frontotemporal dementia ( ftd ) ( ibmpfd ; online mendelian inheritance in man # 167320 ) is a rare , late - onset autosomal dominant disorder arising from missense mutations in a gene on chromosome 9p21.1-p12 coding for valosin - containing protein ( vcp).1 vcp , also known as p97 , is a member of the atpases associated with various cellular activities ( aaa ) family of proteins and is highly abundant , accounting for about 1% of total cellular protein in humans.2 this chaperone protein consists of two aaa domains ( d1 and d2 ) that can bind and hydrolyze adenosine triphosphate . the obtained chemical energy is believed to be converted into mechanical forces that change the stereotactic conformation of the n - terminal domain .
this n - domain ( also known as cdc-40 ) can bind with a wide variety of tissue - specific cofactors and substrates , especially ubiquitin , and helps in the assembly , disassembly , or functional operation of protein complexes.2 as a consequence of its molecular promiscuity , mutations in vcp can hamper endoplasmic - reticulum - associated protein degradation , ubiquitin - related proteasomal protein degradation , the maturation of autophagosomes into autolysosomes , endosomal trafficking , the prevention of polyglutamin aggregation , the assembly of myosin , and the organization of myofibrils.2 these malfunctions account for what is probably only a slight imbalance in the complex processes controlling protein quality in cells , but they can lead to a long - term fatal accumulation of misfolded or aggregated proteins . the slowness of this intracellular accumulation would not only explain the late onset of the disease , but also its preferential phenotypic expression in organs with a low cell turnover , such as skeletal muscle and the central nervous system ( cns ) .
at least 20 different missense mutations that can lead to a clinical picture of ibmpfd have been discovered , most of them in this n - domain.3 ibmpfd is believed to be underdiagnosed due to several factors that make it difficult to diagnose clinically.3,4 first of all , ibmpfd is a rare disorder , accounting for less than 1% of all patients with a familial form of ftd.5 second , only a small group of all patients ( 12% ) will ultimately exhibit the triad of cardinal symptoms that gave the disease its name : while 80 - 90% of all patients will have ibm and approximately half of them are diagnosed with pdb , only a third will develop ubiquitin - positive ftd.6 moreover , the phenotypic expression of a mutation can vary so widely that carriers of the same mutation in a single affected family can have completely different symptoms : for example , one member might have pdb and ftd while his or her siblings might have only ibm.4 to complete the confusion , even two family members with ibm can exhibit a marked variability in the patterns of muscle weakness,7 or atypical features such as pyramidal tract dysfunction [ mimicking spastic paraplegia or amyotrophic lateral sclerosis ( als ) ] , sensory motor axonal neuropathy , parkinsonism , sensorineural hearing loss , cataract , cardiomyopathy , liver steatosis , sphincter disturbances , or erectile dysfunction.3,8,9,10 in this paper we report the case of a patient carrying the previously described p.arg159his mutation11,12 in the cdc-40 domain , who had an unusual combination of peripheral nerve damage and lower motor neuron signs , and for whom diagnosis of ibmpfd only became clear 8 years later when he developed ftd .
a 69-year - old belgian caucasian man complained of cramps in the right calf and walking difficulties that had started 6 months previous but had progressed to the point of needing support from the banisters when walking up a staircase .
his personal history included arterial hypertension , hypercholesterolemia , complete deafness of the right ear due to a mastoidectomy in early childhood , and completely asymptomatic pdb that had been diagnosed 7 years previously by elevated alkaline phosphatases in a routine blood check , and had been confirmed by bone diphosphonate technetium-99 m scintigraphy .
his sister had died of dementia at the age of 62 years , while his mother had died at 67 years suffering from dementia and walking difficulties . at the first neurological examination
he had slight paresis of the dorsal extensors of the left foot , eft quadriceps , and right deltoid muscle , atrophy of the left thigh , and diffuse tendon hyperreflexia .
fasciculations were noted in the right deltoid muscle but not in the tongue , which was not atrophic .
the first electromyography ( emg ) investigation revealed a diffuse chronic neurogenic pattern in all tested muscles of the left leg and in the right deltoid muscle , without signs of subacute denervation such as fibrillations or positive sharp waves .
there was a marked slowing of the motor nerve conduction of the right peroneal nerve , without conduction block .
an extensive laboratory workup produced normal results except for slight elevations of alkaline phosphatase ( 115 mu / ml , normal range 30 - 90 mu / ml ) and lactate dehydrogenase ( 308 mu / ml , normal range 140 - 280 mu / ml ) . magnetic resonance imaging ( mri ) of the lumbar spine and computed tomography scans of the cervical spine and pelvis did not reveal significant abnormalities . walking for longer than 20 minutes
had become difficult in the intervening 3 years since these initial investigations , with the patient reporting falls and intermittent paresthesias in the left big toe .
further electrophysiological studies ( table 1 ) revealed diffuse sensorimotor neuropathy with a chronic neurogenic denervation pattern in the bilateral tibialis anterior and rectus femoris muscles , the right vastus lateralis , and soleus .
there were signs of subacute denervation ( fibrillations and/or fasciculations ) in the right tibialis anterior muscle , the left vastus lateralis , and the biceps of the right arm .
the desirability of performing muscle and nerve biopsies was discussed with the patient , but they were refused .
somatosensory evoked potentials ( sep ) suggested subcortical , supramedullary slowing of central somatosensory pathways , while motor evoked potentials ( mep ) induced by transcranial magnetic stimulation ( tms ) of the central motor pathways revealed elevated stimulus thresholds and slightly delayed central conduction , which were restricted to the lower limbs .
a lumbar puncture showed normal protein , glucose , cytology , and igg index , and identical oligoclonal bands in the serum and cerebrospinal fluid .
the levels of serum human t - lymphotropic virus 1 antibodies , serum arylsulphatase - a , and urinary catecholamines were normal . a further workup for polyneuropathy ( including vitamin b status
, diabetes screening , thyroid function , protein electrophoresis , and tumor markers ) did not reveal any metabolic , inflammatory , paraneoplastic , or toxic cause of polyneuropathy .
1 ) . mri of the dorsal spine showed focal atrophy spanning about 5 cm of the spinal cord at the d4 level , with secondary centromedullary dilatation ( unfortunately these images could not be retrieved ) .
he showed perseverations and paraphasias in conversation and had become deaf in his left ear .
he had no hallucinations , frontal release signs , or sphincter problems , and normal oculomotricity .
he had paraparesis that especially affected the psoas muscles , hamstrings , and dorsiflexors of the feet , with relative sparing of flexor muscles .
there was slight muscle atrophy , which , like the paraparesis , was more pronounced in the left quadriceps ( fig .
the babinski sign had disappeared but there was a bilateral hoffmann - trmner sign and generalized hyperreflexia , except for the ankle reflexes , which were absent .
the presence of personal and familial histories of dementia and progressive gait disturbance and the history of ( albeit asymptomatic ) pdb led to a putative diagnosis of ibmpfd .
a sequence analysis of the 17 coding exons of the vcp gene ( born - bnge institute , university of antwerp ) confirmed the existence of a simple base mutation in codon 159 ( arg > his ) , which was confirmed in a second independent analysis .
to our knowledge , four families with a p.arg159his mutation have been described . through the screening of 123 belgian patients with ftd ,
van der zee et al.11 identified 2 families with this mutation ; none of the 10 patients in these 2 families had myopathy : 6 siblings of the first family presented only ftd , with an age at onset ranging from 60 to 64 years , while 4 siblings of the second family were affected with dementia , pdb , or both , with a mean onset age of 46 years .
haubenberger et al.12 reported four siblings of an austrian family affected with the same mutation .
the disease onset occurred between the ages of 37 and 60 years , with pdb followed by myopathy in three women , while the man had the inverse presentation .
they all had proximal weakness and atrophy in the legs , which ( at least in the women ) later spread to the upper limbs .
emg findings were consistent with myopathy ( brief and small motor - unit action potentials ) , which was confirmed in the male patient by muscle biopsy .
this patient also had distal hypoesthesia and paresthesia of the lower limbs , and a polyneuropathy that had been attributed to diabetes .
the initial picture of the three members of the family reported by stojkovic13 was myopathy of both upper and lower limbs .
two had cognitive impairment , but none of them had pdb . since our patient refused a muscle biopsy , we can not formally rule out that at least a part of his motor symptoms were due to unrecognized ibm .
repeated emg explorations failed to detect features suggestive of myopathy , but this does not rule out the presence of ibm .
there were clinical and electrophysiological arguments for the involvement of both the peripheral and central nervous systems : nerve conduction studies and emg confirmed the presence of a sensorimotor neuropathy .
the muscle atrophy and the absent ankle reflexes were consistent with involvement of lower motor neurons , while hyperreflexia and the results from evoked potentials implied concomitant damage to the cns .
the presence of dorsal medullar atrophy of unknown origin may have contributed to the slowed central conduction times on sep and mep but can not account for the elevated stimulus thresholds on tms .
very few cases of ibmpfd have involved the peripheral nervous system . as mentioned above , the austrian patient with polyneuropathy had diabetes .
this was also the case in one patient with a r191q mutation described by spina et al.9 a review of 49 patients from 9 families revealed that 2 of the patients had diabetic neuropathy .
however , a third patient from a canadian family carrying a a232e mutation - whose clinical picture was mistaken for limb girdle muscle dystrophy and pbd - had an electrophysiological workup suggestive of axonal sensory neuropathy in the legs.4 finally , miller et al.10 reported two patients with pudendal neuropathy in a large british pedigree with a p.r155h mutation .
our case report supports the hypothesis that peripheral nerve involvement is a rare feature of ibmpfd , and is in line with the findings of kumar et al.14 who demonstrated - through elaborate electrophysiological studies of two families with ibmpfd - the presence of axonal hyperpolarization in motor and probably sensory axons , possibly via a diminished vcp - mediated breakdown of na / k pumps .
the differential diagnosis in our patient included other autosomal dominant mutations associated with ftd , especially of c9orf72 ( which often has an als - like manifestation),5 adult polyglucosan body disease ( which could have accounted for the involvement of the peripheral nervous system , als features , and ftd ) , and nasu - hakola disease , which can produce ftd and sensorimotor polyneuropathy .
although no data were available from formal neuropsychological testing , the reported behavioral symptoms met the current clinical criteria for ftd,15 and this diagnosis was supported by the prominent atrophy of the left temporal lobe that occurred even before the clinical onset of ftd .
this combined with a history of pdb ( albeit asymptomatic ) pointed to a vcp mutation .
this case illustrates the need to include ibmpfd in the differential diagnosis of atypical progressive disorders of gait , especially in the presence of a personal or familial history of gait disorders , pbd , or dementia .
it is useful to screen patients for elevated alkaline phosphatases , and to perform a detailed radiological survey if they are elevated or when there are complaints of pain or pathological bone fractures . | backgroundinclusion - body myopathy with paget 's disease of the bone and frontotemporal dementia ( ibmpfd ) is a rare , late - onset autosomal disorder arising from missense mutations in a gene coding for valosin - containing protein.case reportwe report the case of a man carrying the previously described p.arg159his mutation , who had an unusual axonal sensorimotor neuropathy as the first clinical manifestation of ibmpfd , and for whom diagnosis only became clear 8 years later when the patient developed frontotemporal dementia.conclusionsperipheral neuropathy is a rare manifestation of ibmpfd .
this underdiagnosed disorder should be considered when a patient develops dementia or has signs of paget 's disease . |
cerebral palsy ( cp ) , with a prevalence of 1 in 278 children , is the most common childhood motor impairment .
the term cerebral palsy describes a group of permanent disorders of the development of movement and posture attributed to nonprogressive disturbances that occurred in the developing fetal or infant brain .
there are no specific treatments for the brain insults that lead to the motor dysfunction of cp . instead
, treatment is focused on a range of therapies ( e.g. , physiotherapy , surgery , medication ) with the aim of enhancing a patient 's overall quality of life by mitigating musculoskeletal impairments and pain [ 3 , 4 ] .
health - related quality of life ( qol ) is a subdomain of qol that encompasses physical , mental , and social well - being [ 46 ] . for children with cp
, health - related qol has been increasingly positioned as an important outcome indictor [ 6 , 7 ] .
research indicates that pediatric and adolescent patients with cp have impaired functional and psychosocial qol when compared with their normative peers [ 810 ] .
while traditional cp treatments have been associated with improvements to patients ' functional quality of life , these treatments have had less impact on psychosocial qol [ 3 , 11 , 12 ] .
specifically , previous studies have found a weak relationship between measures of cp severity and psychosocial qol [ 7 , 1315 ] .
this has led to a call for further examination of other patient level variables that could influence psychosocial qol . in the pediatric cp literature ,
highly prevalent dysfunctions accompanying the primary diagnosis of musculoskeletal impairment include visual , hearing and feeding impairments , language delays , and epilepsy [ 16 , 17 ] .
the cooccurrence of many of these impairments , that is , comorbidities , may be associated with decreased qol .
if this is indeed the case , clinical interventions which focused on reducing cp comorbidities could have a positive impact on patient qol .
additionally , there is a need to explore mechanisms beyond clinical interventions to improve psychosocial qol for patients with cp .
children with cp have complex healthcare needs and rely heavily on the healthcare system , spending 2.2 times the amount of time in outpatient care settings when compared with their healthy peers , and often interacting with multiple care providers .
this high utilization of the health and related services positions the health delivery system as a potential focus of psychosocial qol interventions .
one such intervention is family centered care , considered the best approach to service delivery in pediatric rehabilitation [ 2022 ] .
family centered care ( fcc ) is a set of principles underlying care delivery that recognizes the role of the family in the child 's care , focusing on shared decision making , information sharing , empowerment , and care coordination to enhance the quality of life for all family members .
we provide a preliminary exploration of the role of comorbidities and family centered care on qol in children with cp by assessing two specific aims : ( 1 ) to assess if the perceived psychosocial qol of a child with cp is associated with patient demographics and health status , including cp severity or comorbidity .
prior research has found a strong correlation with physical qol but the association with psychosocial qol is less clear [ 7 , 1315 ] . given this
, we hypothesize that patient psychosocial qol will not be associated with severity and comorbidity ; ( 2 ) to determine if there is an association between the receipt of family centered care and psychosocial qol for these children .
based on the few studies that have found a positive association in pediatric populations of children with disabilities [ 20 , 2225 ] , we hypothesize that among a sample of pediatric patients with cp reporting high levels of family centered care will be associated with increasing psychosocial qol .
to achieve these aims , a sample of caregivers of children with cp who attended outpatient cp and therapy clinics at a large tertiary care university medical center was surveyed regarding their experiences with the health care system .
demographic and health status information was extracted from the medical records of the respondents ' children .
specifically , subjects with cp were identified through a review of the electronic medical records of the developmental disabilities clinic , the cerebral palsy clinic , and the physical therapy / occupational therapy clinics at the children 's hospital .
caregivers of patients identified as having cerebral palsy in the electronic medical record were recruited for participation by a member of the research team during their clinic or therapy appointments , prior to clinical evaluation . caregivers who agreed to participate completed a consent form , and verbal assent was obtained from pediatric patients when appropriate .
caregivers were then provided a paper and pencil survey . there were no specific clinical exclusion criteria .
the caregiver survey included a measure of processes of care-20 ( mpoc-20 ) and the parent - proxy cerebral palsy quality of life questionnaire for children ( cp qol - child ) .
the mpoc-20 is a self - report measure of parents ' perceptions of the extent to which the health services the family receives are family centered , measured on a seven point scale across five domains with a higher score indicating a higher level of family centered care . in large validation studies of caregivers of children with cp
this measure has been demonstrated to be valid and reliable with a positive correlation with standardized measures of satisfaction [ 2527 ] .
the cp qol - child is a condition specific measure of qol for children with cp .
the parent - proxy version covers two psychosocial domains : social well - being and acceptance and emotional well - being and self - esteem . to score the cp qol - child ,
caregiver 's responses are aggregated across items and an average is calculated across the sample and then converted to a 0 to 100 scale based on the coding algorithm provided by waters et al . ; a higher average score equals higher qol . in multiple validation studies the cp qol - child had good test - retest reliability ,
construct validity and internal consistency , and cronbach 's alphas of 0.74 to 0.91 [ 5 , 28 , 30 , 31 ] .
additionally , parental perceptions provided in the cp qol - child correlate with medical professional ratings of patient qol for children with cp .
there is a version of the cp qol - child that is self - report for children 9 to 12 years old .
however , only the parent - report version was used in this study because the sample is between 2 and 12 years and not all children in the 912 age group would have been able to complete the cp - qol independently due to cognitive and communication limitations .
a retrospective chart review of all participating patients was conducted to extract patient age , race , sex , severity of illness , and level of comorbidity . for the purposes of analysis age
white and nonwhite ( a necessity given the sample size ) , and sex was binary male or female .
severity of illness was operationalized by the gross motor function classification system ( gmfcs ) .
a patient 's gmfcs is assigned by the physician as i through v , with v as the most severe impairment in gross motor function during the conduct of daily activities .
a comorbidity is recorded in the patient 's chart for each impaired organ system and physical or mental disability ( ent , skin , eye / head , cardiology , etc .
this categorization scheme for comorbidities differs from the traditional count of medical diagnoses but is consistent with the pediatric cerebral palsy literature in which highly prevalent dysfunctions accompanying the primary diagnosis of musculoskeletal impairment include visual , hearing and feeding impairments , language delays , and epilepsy [ 16 , 17 ] . for the purposes of analysis comorbidity
is coded as none , one , or two or more .
first , survey measures were scored and results entered into a password - protected ms excel research database .
next , the patient health and sociodemographic variables extracted from health records were appended to the survey data using unique patient identifiers .
means were then calculated for all variables and a series of univariate linear regressions of the demographic , severity , and family centered care ( mpoc-20 ) variables on the two psychosocial qol domains was conducted .
when more than one variable was significantly associated with a qol domain these variables were put into a multivariate linear regression to assess independent associations .
the survey and data collection from patient medical records was completed for 53 children with a diagnosis of cp .
children were majority white , between the ages of 2 and 12 and functioning across all gmfcs levels , with 80% having one or more comorbidities .
mean scores on the five mpoc domains ranged from 4.4 , providing general information to 5.9 , respectful and supportive care
( on a scale of 1 to 7 with a higher score denoting a high level of family centered care ) .
the mean qol score for the social well - being and acceptance scale was 78.7 with a standard deviation of 13.2 ( with 100 being the highest possible score ) .
the mean score for emotional qol was 82.5 with a standard deviation of 13.5 .
table 3 presents a series of univariate linear regressions of the sociodemographic variables , severity variables , and level of family centered care on both psychosocial qol domains .
no significant association was found between age , sex , or race and either psychosocial qol domain .
comorbidity was strongly correlated with both social well - being and emotional well - being .
specifically , an additional comorbidity is associated with a 6-point decrease on the social well - being scale ( p = 0.016 ) and a 9-point decrease on the emotional well - being scale ( p = 0.000 ) .
the only mpoc domain associated with either psychosocial qol domain was care coordination , a step up the seven - point scale toward higher family centered care was associated with a 4.3-point increase in emotional well - being and self - esteem ( p = 0.025 ) . in a multivariate linear regression model
an additional comorbidity was independently associated with a 9-point decrease in this qol score ( p = 0.001 ) .
controlling for level of comorbidity , the mpoc measure of care coordination was no longer significantly associated with psychosocial qol ( p = 0.107 ) .
the adjusted r - squared of this model is 0.26 meaning that 26% of the variation in emotional well - being and self - esteem is explained by the two variables included in this model .
regression diagnostics show that the residuals are normally distributed , based on visual analysis of a stem and leaf plot of the studentized residuals and a k - density plot .
the other patient and mpoc variables were not included in this model because none were significantly associated with either qol domain in the univariate regressions .
no multivariate model was conducted for the qol domain social well - being because the only measured variable associated with this domain in univariate analyses was level of comorbidity . among a sample of pediatric patients with cp , child psychosocial qol decreased with increasing comorbidity but was not associated with cp symptom severity . to our knowledge
this is the first study to explore the relationship between comorbidity and qol in the pediatric cp population . while it has been shown that surgery and pain management , the focus of traditional cp interventions , can improve a child 's functional quality of life , rarely does their psychosocial qol improve as well [ 3 , 11 , 12 , 14 , 35 ] .
propose that perhaps social interactions , school environment , and other social factors play a larger role in determining a child 's psychosocial quality of life . based on the descriptive results of the present study future research
perhaps children with multiple comorbidities and thus high care complexities are either not able to engage in age appropriate social interactions due to the complexity of their cases or are not afforded the opportunity to do so , driving the strong association between increasing comorbidity and decreasing psychosocial qol .
the second aim of this research was to explore the potential impact of receipt of family centered care on the qol of the child with cp , with a specific focus on psychosocial qol .
we did not find support for the a priori hypothesis that reporting high levels of family centered care is associated with increasing psychosocial qol . while one measure of family centered care , providing care coordination assistance , was significantly associated with both psychosocial qol domains , in a multivariate model controlling for level of comorbidity this measure of family centered care was no longer significant .
this finding is counter to a previous study which found an association between family centered care and family quality of life for families of young children with disabilities .
additionally , in a national sample of caregivers of children with cp , the perception of receiving a high level of fcc was associated with having community , financial , and social support needs met .
the discrepancy between the present results and previous research may be due to a combination of two factors : ( 1 ) the prior studies lack multivariate modeling that controls for comorbidity and ( 2 ) the present study focused on child quality of life and previous studies focused on adequate support for the family .
theoretically , these family variables may be a pathway through which fcc positively affects child psychosocial qol , but the relationship was not strong enough to detect in our study given the limited sample size .
future research should compare the psychosocial qol of children in different care settings to further investigate family centered care and the potential role of family support as a mediating variable .
an important limitation of this study is the descriptive study design and the small , convenience sample .
however , this study is an important step in the assessment of potential health services interventions that can improve psychosocial qol .
this is also the first study , to our knowledge , to consider health status variables beyond gmfcs levels .
the finding that comorbidity is significantly associated with psychosocial qol highlights an important area of future study .
this descriptive study should lead to future research in large patient populations across care settings .
another important limitation is the use of the parent - proxy cp - qol to assess child qol .
it has been demonstrated that children with cp generally report higher qol scores than their parents .
if the bias is uniform across parental respondents the relationship between variables would not be affected .
however , there could be results affected if the magnitude of this discrepancy varies by patient or family characteristics .
for example , a previous study found associations between parental stress level and proxy - reported qol .
future larger scale studies could explore these potential confounders and control for parental stress level when proxy - report is necessary due to the age of the study population .
for children with cp , qol has been increasingly positioned as an important outcome indictor [ 6 , 7 ] .
given this , the identification of associated variables amenable to intervention has important practice implications .
specifically , the finding of a strong association between comorbidity and psychosocial qol positions comorbidity as an area of intervention that could have a positive impact on patient qol . in the present study comorbidity was defined as a physical or mental impairment beyond musculoskeletal dysfunction ( e.g. , including impairments in hearing , sight , epilepsy , and language or developmental delay ) .
interventions to reduce comorbidity may not eliminate intractable diagnoses but could focus on reducing the impact of a patient 's impairment and potentially reduce the number of disabilities that accompany the musculoskeletal challenges of cp .
the findings of this study show that interventions which focused on this goal may lead to improvements in pediatric cp patients ' psychosocial qol . | background . current health services
interventions focus on the treatment of the musculoskeletal impairments of cerebral palsy ( cp ) .
the goal of this study was to explore whether the severity of physical symptoms correlates with psychosocial quality of life ( qol ) among pediatric patients with cp .
methods .
a sample of 53 caregivers of children with cp was surveyed and health status information was extracted from patient medical records . descriptive analysis explored the association between the main outcome variable , psychosocial qol ( cp qol - child ) , and patient demographics , comorbidity ( e.g. , visual , hearing and feeding impairments , language delays , and epilepsy ) , cp severity ( gmfcs ) , and the receipt of family centered care ( mpoc-20 ) . results .
child psychosocial qol decreased with increasing comorbidity but was not associated with cp symptom severity or any measured demographic factors . reporting high levels of family centered care ( fcc ) was associated with higher psychosocial qol in univariate analysis but was not significant when controlling for comorbidities .
conclusion .
there is no clear connection between symptom severity and psychosocial qol in children with cp .
comorbidity however is strongly associated with psychosocial qol .
focusing on reducing cp comorbidities could have a positive impact on psychosocial qol . |
paw withdrawal thresholds ( pwts ) is the most commonly used method to assess pain - related behaviors in rodents [ 1 , 2 ] . due to the absence of verbal communication with animals
, pain can not be monitored directly in preclinical research but can be estimated by examining behavioral responses to nociceptive stimuli .
hence , a nociceptive withdrawal reflex response is used to explore pain mechanisms in rats . however , pain is a subjective and multidimensional experience , including sensory - discriminative , affective , and cognitive components , which requires cortical involvement and modulation [ 57 ] .
previous studies have shown that spinal dorsal horn neurons receive nociceptive information , convey it to the ventral horn , and contribute to spinally - mediated nocifensive reflexes .
if the mechanical stimulus - induced withdrawal behavior is only a simple reflex that does not activate cortical areas , the pwts can not be used as a behavioral standard for evaluating pain .
thus , it is crucial to establish whether a synchronous cortical response accompanies the withdrawal behavior used in preclinical pain research .
emerging evidence suggests that cortical areas are adaptive processors , subject to top - down expectations , in which neural activity reflects internal goals and states in addition to external stimuli .
the rostral anterior cingulate cortex ( racc , brodmann s areas 24 and 32 ) , a major area implicated in the descending pain modulatory system , is also involved in prefrontal top - down processing .
previous research , using positron emission tomography ( pet ) , documented that racc served to prepare for upcoming pain by regulating anticipatory threat responses , consistent with activity in the racc during visual stimuli predicting disagreeable noises observed in an fmri study .
expectation is highly subjective and subject to the intrinsic dynamics of oscillations and synchrony in cognitive processing .
neural oscillations observed in local field potentials ( lfps ) reflect coherent neuronal population activity .
the mechanisms of oscillation generation are computationally interesting and may serve as a means of explaining various aspects of perception and cognition .
therefore , our key interest in this study was to simultaneously record the lfps of the racc in quietly resting , unanesthetized rats under multiple mechanical stimulus conditions to elucidate pain expectation modulation coincident with the withdrawal behaviors .
male adult sprague - dawley rats , 250300 g body weight , were obtained from the experimental animal center of zhejiang chinese medical university .
the animals were housed in groups of 5 in plastic cages with soft bedding at the university animal care facility with an artificial 12/12 h light - dark cycle ( lights on at 8 a.m. ) .
animals received food and water ad libitum with a constant room temperature of 2325c and a relative humidity of 4070% . before experimental manipulations
, rats were given a period of 1 week to adjust to the new surroundings .
the whole experiment was performed in accordance with the guidelines of the international association for the study of pain and the institutional animal ethics committee ( iaec ) .
the paw withdrawal threshold was measured automatically using a dynamic plantar aesthesiometer ( model 37450 ; ugo basile , comerio , italy ) .
animals were habituated to the testing surroundings daily for 2 consecutive days ( between 9 a.m. and 12 a.m. ) before testing .
each rat moved freely in a transparent plastic compartment of a 6-compartment box with a wire mesh floor and were acclimatized for 20 min before the test session .
a paw - flick response was elicited by applying an increasing vertical force ( increased steadily from 0 to 50 grams in 20 s ) using a stainless - steel probe ( a straight 0.5-mm diameter ) placed underneath the mesh floor and focused on the middle of the plantar surface of the ipsilateral hind paw .
the ipsilateral paw of each rat was measured 5 times at intervals of 1-min or more and the value of the applied force was determined and used for statistical analysis .
1 recording microwire array was surgically implanted under urethane anesthesia ( 1.2 g / kg i.p .
surgical procedures were the same as in previous studies , with the exception of the location of the microwires arrays .
rats were placed in a stereotaxic frame on a heated surgical platform maintained at a constant temperature of 37c , and a midline scalp incision was made to expose the skull to allow the implantation of 4 screws and an array .
the array was driven into the right side racc at a 20-degree angle using a hydraulic microdrive ( model 51421 , stoelting , wood dale , usa ) ; the array was advanced while recording the neural ensemble activity to achieve the correct placement .
each microwire array consisted of 8 filaments of nickel chromium wire ( 35-m diameter , stablohm 675 ; california fine wire company , grover beach , ca , usa ) . the array was constructed in 42 architecture , with 200 m between recording wires . the following coordinates ( relative to the bregma ) were used to center the array : racc ( + 2.7 mm rostrocaudal , + 0.8 mm mediolateral , 2.0 mm dorsoventral ) .
after a 7-day recovery period , rats were allowed to adapt to the recording environments ( nociceptive behavioral testing surroundings ) for 2 days . with the application of cone - beam computed tomography ( cbct )
, we could evaluate the location of microwire array more accurately ( figure 1 ) , since cbct image data are acquired in digital format from a single 360 rotational scan and through a kavo ct 3d examination ( kavo , germany ) with 0.2-mm voxel size .
we performed 3d modeling and panoramic reconstructions , as well as cross - sections obtained using reconstruction software ( examvision , version 1.9.3.13 , kavo dental , germany ) .
extracellular local field potentials ( lfps ) were recorded from the implanted microwire array by a cerebus neural signal processing system ( blackrock microsystems , salt lake city , ut , usa ) .
lfps signals were preamplified ( 300 ) , bandpass filtered ( 0.3250 hz ) , and sampled at 1 khz .
a plantar video camera and video tracking system ( any - maze , stoelting , co , usa ) was used to provide real - time imaging of the rats plantar and the stimulus probe in the dynamic plantar aesthesiometer , permitting synchronization of the probe s stimulus process with the acquired neuronal data .
no animals were removed from the study due to poor placement of the recording wires .
paw withdrawal thresholds to 5 sequential mechanical stimuli were expressed as a scatter plot and violin plot ( figure 2 ) .
the scatter plot was an important tool for assessing the trend shown by the data ; it represents each observation as a point , with paw withdrawal threshold plotted on the y - axis .
the violin plot was a combination of a box plot and a kernel density plot , which retained more information about the shape of the distribution .
the main advantage of the violin plot was that it presented the density ; a wider violin plot shows higher density .
levene s test was used to assess the homogeneity of variances across samples . a small p value of levene s test ( typically 0.05 ) suggests that differences in sample variances were unlikely to have resulted from random sampling from populations with equal variances , leading to rejection of the hypothesis that the variances were homogenous
. data were processed and validated by offline analysis using neuroexplorer 5.021 ( nex , plexon inc . ) and exported to matlab 2014a ( mathworks , natick , ma ) for complementary analysis .
spectrogram analysis was used to visualize lfp power at different frequency bands as a function of time for each condition .
the raw racc lfps were bandpass filtered at 245 hz using a non - causal zero - phase - shift filter ( fourth - order butterworth ) .
next , the power spectral densities ( psd ) were calculated by hanning window , 2 frequency bins over the 245 hz range , and 50% overlapping windows .
the power was normalized by the logarithm of the psd ( in decibels ) and a smoothing was applied ( gaussian filter , width=3 ) .
five frequency band intervals were considered : 24 hz ( delta ) , 49 hz ( theta ) , 915 hz ( alpha ) , 1530 hz ( beta ) , and 3045 hz ( gamma ) .
all data for parametric analysis was originally assessed using levene s test for homogeneity of variance .
one - way or two - way repeated measures analysis of variance ( rmanova ) with bonferroni post hoc analysis was used when the variances were equal .
when the variance was not homogeneous , dunnett s t3 post hoc test was used to perform pairwise comparisons . in all cases ,
male adult sprague - dawley rats , 250300 g body weight , were obtained from the experimental animal center of zhejiang chinese medical university .
the animals were housed in groups of 5 in plastic cages with soft bedding at the university animal care facility with an artificial 12/12 h light - dark cycle ( lights on at 8 a.m. ) .
animals received food and water ad libitum with a constant room temperature of 2325c and a relative humidity of 4070% . before experimental manipulations
, rats were given a period of 1 week to adjust to the new surroundings .
the whole experiment was performed in accordance with the guidelines of the international association for the study of pain and the institutional animal ethics committee ( iaec ) .
the paw withdrawal threshold was measured automatically using a dynamic plantar aesthesiometer ( model 37450 ; ugo basile , comerio , italy ) .
animals were habituated to the testing surroundings daily for 2 consecutive days ( between 9 a.m. and 12 a.m. ) before testing .
each rat moved freely in a transparent plastic compartment of a 6-compartment box with a wire mesh floor and were acclimatized for 20 min before the test session .
a paw - flick response was elicited by applying an increasing vertical force ( increased steadily from 0 to 50 grams in 20 s ) using a stainless - steel probe ( a straight 0.5-mm diameter ) placed underneath the mesh floor and focused on the middle of the plantar surface of the ipsilateral hind paw .
the ipsilateral paw of each rat was measured 5 times at intervals of 1-min or more and the value of the applied force was determined and used for statistical analysis .
to study electrophysiological properties , 1 recording microwire array was surgically implanted under urethane anesthesia ( 1.2 g / kg i.p .
surgical procedures were the same as in previous studies , with the exception of the location of the microwires arrays .
rats were placed in a stereotaxic frame on a heated surgical platform maintained at a constant temperature of 37c , and a midline scalp incision was made to expose the skull to allow the implantation of 4 screws and an array .
the array was driven into the right side racc at a 20-degree angle using a hydraulic microdrive ( model 51421 , stoelting , wood dale , usa ) ; the array was advanced while recording the neural ensemble activity to achieve the correct placement .
each microwire array consisted of 8 filaments of nickel chromium wire ( 35-m diameter , stablohm 675 ; california fine wire company , grover beach , ca , usa ) . the array was constructed in 42 architecture , with 200 m between recording wires .
the following coordinates ( relative to the bregma ) were used to center the array : racc ( + 2.7 mm rostrocaudal , + 0.8 mm mediolateral , 2.0 mm dorsoventral ) .
animals were placed in a new cage with warm bedding until awakening from anesthesia . after a 7-day recovery period , rats were allowed to adapt to the recording environments ( nociceptive behavioral testing surroundings ) for 2 days .
with the application of cone - beam computed tomography ( cbct ) , we could evaluate the location of microwire array more accurately ( figure 1 ) , since cbct image data are acquired in digital format from a single 360 rotational scan and through a kavo ct 3d examination ( kavo , germany ) with 0.2-mm voxel size .
we performed 3d modeling and panoramic reconstructions , as well as cross - sections obtained using reconstruction software ( examvision , version 1.9.3.13 , kavo dental , germany ) .
extracellular local field potentials ( lfps ) were recorded from the implanted microwire array by a cerebus neural signal processing system ( blackrock microsystems , salt lake city , ut , usa ) .
lfps signals were preamplified ( 300 ) , bandpass filtered ( 0.3250 hz ) , and sampled at 1 khz .
a plantar video camera and video tracking system ( any - maze , stoelting , co , usa ) was used to provide real - time imaging of the rats plantar and the stimulus probe in the dynamic plantar aesthesiometer , permitting synchronization of the probe s stimulus process with the acquired neuronal data .
no animals were removed from the study due to poor placement of the recording wires .
paw withdrawal thresholds to 5 sequential mechanical stimuli were expressed as a scatter plot and violin plot ( figure 2 ) .
the scatter plot was an important tool for assessing the trend shown by the data ; it represents each observation as a point , with paw withdrawal threshold plotted on the y - axis .
the violin plot was a combination of a box plot and a kernel density plot , which retained more information about the shape of the distribution .
the main advantage of the violin plot was that it presented the density ; a wider violin plot shows higher density .
a small p value of levene s test ( typically 0.05 ) suggests that differences in sample variances were unlikely to have resulted from random sampling from populations with equal variances , leading to rejection of the hypothesis that the variances were homogenous .
data were processed and validated by offline analysis using neuroexplorer 5.021 ( nex , plexon inc . ) and exported to matlab 2014a ( mathworks , natick , ma ) for complementary analysis .
spectrogram analysis was used to visualize lfp power at different frequency bands as a function of time for each condition .
the raw racc lfps were bandpass filtered at 245 hz using a non - causal zero - phase - shift filter ( fourth - order butterworth ) .
next , the power spectral densities ( psd ) were calculated by hanning window , 2 frequency bins over the 245 hz range , and 50% overlapping windows .
the power was normalized by the logarithm of the psd ( in decibels ) and a smoothing was applied ( gaussian filter , width=3 ) .
five frequency band intervals were considered : 24 hz ( delta ) , 49 hz ( theta ) , 915 hz ( alpha ) , 1530 hz ( beta ) , and 3045 hz ( gamma ) .
paw withdrawal thresholds to 5 sequential mechanical stimuli were expressed as a scatter plot and violin plot ( figure 2 ) .
the scatter plot was an important tool for assessing the trend shown by the data ; it represents each observation as a point , with paw withdrawal threshold plotted on the y - axis .
the violin plot was a combination of a box plot and a kernel density plot , which retained more information about the shape of the distribution .
the main advantage of the violin plot was that it presented the density ; a wider violin plot shows higher density .
a small p value of levene s test ( typically 0.05 ) suggests that differences in sample variances were unlikely to have resulted from random sampling from populations with equal variances , leading to rejection of the hypothesis that the variances were homogenous .
data were processed and validated by offline analysis using neuroexplorer 5.021 ( nex , plexon inc . ) and exported to matlab 2014a ( mathworks , natick , ma ) for complementary analysis .
spectrogram analysis was used to visualize lfp power at different frequency bands as a function of time for each condition .
the raw racc lfps were bandpass filtered at 245 hz using a non - causal zero - phase - shift filter ( fourth - order butterworth ) .
next , the power spectral densities ( psd ) were calculated by hanning window , 2 frequency bins over the 245 hz range , and 50% overlapping windows .
the power was normalized by the logarithm of the psd ( in decibels ) and a smoothing was applied ( gaussian filter , width=3 ) .
five frequency band intervals were considered : 24 hz ( delta ) , 49 hz ( theta ) , 915 hz ( alpha ) , 1530 hz ( beta ) , and 3045 hz ( gamma ) .
all data for parametric analysis was originally assessed using levene s test for homogeneity of variance .
one - way or two - way repeated measures analysis of variance ( rmanova ) with bonferroni post hoc analysis was used when the variances were equal . when the variance was not homogeneous , dunnett s t3 post hoc test was used to perform pairwise comparisons . in all cases ,
we reanalyzed 1220 previous mechanosensitivity measurements on the ipsilateral paws of 244 rats measured 5 times in succession .
variances were not equal across all 5 successive measurements ( levene statistic=14.136 , df1=4 , df2=1215 , p<0.001 ) . however , this was due entirely to the first measurement ; the variances of the subsequent 4 measurements were homogeneous ( levene statistic=1.769 , df1=3 , df2=972 , p=0.151 ) .
pairwise comparisons using dunnett s t3 post hoc test found no significant differences among the 5 sequential measurements . in figure 2 , the scatter and violin plots illustrate the shape and density of the distributions .
these results suggest that during 4 later measurements , the distributions of pwts were more robust and volatility was smaller than in the first one .
compared to the first mechanical stimulus , higher - amplitude lfp signals were observed during the pre - stimulus period of the subsequent 4 stimuli ( figure 3a ) , yielding a generally higher psd in the longitudinal heat maps ( figure 3b ) .
the pre - stimulus psd of lfp signals is further shown in figure 4a and 4b .
the statistical comparison of the total psd of each pre - stimulus period across the 5 sequential stimuli revealed significant differences ( one - way rmanova ; f= 246.6 , p<0.001 ) .
the pre - stimulus total psd of the last 4 stimuli was significantly higher than that of the first stimulus ( p<0.001 , p<0.001 , p<0.001 , p<0.001 ) ( figure 4a ) .
furthermore , during the pre - stimulus period , significant differences were encountered across frequency bands ( two - way rmanova ; f=4739.22 , p<0.001 ) and the number of stimuli ( two - way rmanova ; f=102.50 , p<0.001 ; figure 4b ) .
compared to the first pre - stimulus period , post hoc analysis revealed an increase in psd in the delta frequency band ( p<0.001 for the subsequent 4 times ) , and a decrease in the theta band ( p<0.001 for the third time ) , as well as in the alpha , beta , and gamma bands ( p<0.001 , p<0.001 , and p<0.001 for the subsequent 4 times ) .
together , these data suggest that paw withdrawal behavior increased the total power and delta band power of the pre - stimulus lfps in the racc during subsequent stimuli .
we reanalyzed 1220 previous mechanosensitivity measurements on the ipsilateral paws of 244 rats measured 5 times in succession .
variances were not equal across all 5 successive measurements ( levene statistic=14.136 , df1=4 , df2=1215 , p<0.001 ) . however , this was due entirely to the first measurement ; the variances of the subsequent 4 measurements were homogeneous ( levene statistic=1.769 , df1=3 , df2=972 , p=0.151 ) .
pairwise comparisons using dunnett s t3 post hoc test found no significant differences among the 5 sequential measurements . in figure 2 , the scatter and violin plots illustrate the shape and density of the distributions .
these results suggest that during 4 later measurements , the distributions of pwts were more robust and volatility was smaller than in the first one .
compared to the first mechanical stimulus , higher - amplitude lfp signals were observed during the pre - stimulus period of the subsequent 4 stimuli ( figure 3a ) , yielding a generally higher psd in the longitudinal heat maps ( figure 3b ) .
the pre - stimulus psd of lfp signals is further shown in figure 4a and 4b .
the statistical comparison of the total psd of each pre - stimulus period across the 5 sequential stimuli revealed significant differences ( one - way rmanova ; f= 246.6 , p<0.001 ) .
the pre - stimulus total psd of the last 4 stimuli was significantly higher than that of the first stimulus ( p<0.001 , p<0.001 , p<0.001 , p<0.001 ) ( figure 4a ) .
furthermore , during the pre - stimulus period , significant differences were encountered across frequency bands ( two - way rmanova ; f=4739.22 , p<0.001 ) and the number of stimuli ( two - way rmanova ; f=102.50 , p<0.001 ; figure 4b ) . compared to the first pre - stimulus period , post hoc analysis revealed an increase in psd in the delta frequency band ( p<0.001 for the subsequent 4 times ) , and a decrease in the theta band ( p<0.001 for the third time ) , as well as in the alpha , beta , and gamma bands ( p<0.001 , p<0.001 , and p<0.001 for the subsequent 4 times ) .
together , these data suggest that paw withdrawal behavior increased the total power and delta band power of the pre - stimulus lfps in the racc during subsequent stimuli .
in previously published studies , pwts were generally measured multiple times , and the arithmetical average was used to assess mechanical hyperalgesia in rats .
this view is built on the assumption that the paw withdrawal behavior is nothing more than a spinal reflex ; therefore , the method of averaging multiple measures in physics was deemed valid in living animals with perceptual ability .
our results indicate that a top - down expectation is manifested by changes in pre - stimulus lfp activity in the racc over the course of multiple withdrawal behaviors . in the dataset of withdrawal behaviors ,
the distributions of pwts in the subsequent 4 measurements were denser and more stable than in the first one . taken together , our measurements during paw withdrawal are indicative of cognitive processing of pain , as exemplified by changes in the racc lfp activity in the pre - stimulus period , and expectations increase the stability of later withdrawal behaviors .
the lfp , measured with very fine microwires , reflects the synaptic activity of only tens to perhaps thousands of nearby neurons .
power increase is usually interpreted as increased synchrony in the neuronal assembly surrounding each microwire , implying the connectivity between these neurons .
our results are in agreement with the recent characterization of the brain as a dynome or
chronectome , highlighting the role of dynamic communication within or between networks in shaping cognition and behavior . as aaron and
karen reported , the processing of pain is encoded by a pain connectome , the spatiotemporal signature of brain network communication that represents the integration of all cognitive , affective , and sensorial aspects of pain .
additionally , a strong delta band component was encountered during pre - stimulus periods of the last 4 withdrawal behaviors .
in fact , it has been shown that the pre - stimulus modulation of delta oscillations serves as a neural mechanism underlying the faster processing of expected events .
our results recorded during multiple withdrawal stimuli also confirm an increase of the delta band power , which is correlated with an increase in top - down expectations , inducing more stable withdrawal behaviors .
another important point is that the method of averaging multiple measures in physics can not be directly used in the detection of pwts .
previous research of pain in rodents has usually treated pwts as a key index of pain behavior in the study of pain - related molecular targets , while only a few of these targets play an important role in humans .
the reason for this may be that the pwts is not equivalent to pain threshold , defined as the minimal intensity of a stimulus that is perceived as painful .
our results show that the pre - stimulus period of the last 4 withdrawal responses exhibited a change in cortical activity and brain state . taken together
, these results suggest that the average pwt , under conditions of cortical engagement , might be regarded as a behavioral indicator of pain in rats
. therefore , the results may be conducive to the translation from basic research of pain - related biomarkers to potential clinical applications .
this study provides evidence that the first withdrawal behavior causes changes of pre - stimulus lfp activity in the racc during subsequent stimuli , and this preparation in advance could affect subsequent stimuli - induced withdrawal behaviors , which contribute to the dynamics of bottom - up input and top - down expectation . | backgroundthe rostral anterior cingulate cortex ( racc ) is important in pain expectation .
previous studies demonstrated that mechanical stimulus - induced withdrawal behaviors are spinally - mediated nocifensive reflexes in rats , but it is not known whether pain expectation is influenced by withdrawal behaviors.material/methodswe reanalyzed previous mechanosensitivity measurements of 244 rats measured 5 times in succession . to study neural oscillation in the racc ,
1 recording microwire array was surgically implanted .
then , we simultaneously recorded the local field potential ( lfp ) of the racc over the course of multiple withdrawal behaviors in unanesthetized rats.resultsfrom our previous withdrawal behavioral data in 244 rats , we observed that the distributions of paw withdrawal thresholds ( pwts ) were denser and more concentrated after the first withdrawal behavior .
compared to the first mechanical stimulus , increased neuronal synchrony and a stronger delta band component existed in each pre - stimulus lfp in the racc during subsequent stimuli.conclusionspain expectation could be involved in withdrawal behaviors , which is related to increased total power and delta band power of the subsequent pre - stimulus lfps in the racc . |
diabetes mellitus is a metabolic disorder resulting from a defect in insulin secretion ,
insulin action , or both .
a consequence of this is chronic hyperglycemia with disturbances in
carbohydrate , fat , and protein metabolism .
diabetes mellitus ( dm ) is a common disorder of
carbohydrate , fat , and protein metabolism reflected by inappropriate high fasting and
postprandial glucose levels ( hyperglycemia ) .
this ailment results from the absence or
scantiness of insulin secretion with or without concurrent impairment of insulin action .
consequently , the disease was classified into two types known as type i ( insulin dependent ,
iddm ) and ii ( non - insulin dependent , niddm ) according to the degree of pancreatic defect .
this classification has been even recognized since the time of ibn sinaa , who mentioned it
in his book the canon of medicine .
dm is not confined to abnormal blood glucose levels but progresses to affect other body
systems .
this fact has been confirmed by several epidemiological studies and clinical trials
that have linked hyperglycemia to several complications at the macrovascular ( coronary
artery disease and cerebrovascular disease ) and microvascular levels ( renal failure ,
blindness , limb amputation , neurological complications and premature death)1 .
endocrine and metabolic alterations in diabetes mellitus can trigger disorders of calcium
homeostasis , skeletal metabolism , and bone mass1 .
it is reported that more than of 50% type 1 diabetes patients have
osteoporosis ( op ) , which is called diabetic osteoporosis ( do ) , a reduced bone mass and an
increased fracture risk shown to occur in type 1 diabetes mellitus2 . on the other hand , in type 2 diabetes ,
several but not all
cross - sectional studies have found normal3
or elevated4 bone mass , and these results
are surprising given the increased fracture risk associated with type 2 diabetes5 . in type 2 dm patients complicated with op ,
there is a larger decrease in bone formation than bone resorption in compared with the case
of postmenopausol op , and this mainly influences the indexes of bone formation and may be a
lower turnover ratio type .
we investigated whether there is any difference among dm patients and a control group in
terms of lumbar and femur bmd ( bone mineral density ) and standard deviation scores ( z score
and t score ) .
this randomized , prospective , controlled , single - blind study was conducted in physical
medicine and rehabilitation department faculty of medicine , bezm - i alem vakf university .
in addition to their demographic
characteristics ( age , gender , weight , height , body mass index [ bmi ] ) , waist circumference ,
hip circumference , waist / hip proportion , used medicines , body muscle masses , fat masses , and
fat percentages were obtained . the patients included in this study were between the ages of
40 and 65 .
all the recruited subjects signed informed consent forms before participating in the study ,
and approval of a local ethics committee was obtained .
the exclusion characteristics were
early menopause , hormone replacement therapy , usage of medicines able to affect bmd
( thiazide diuretics , statins , anticoagulants , antiepileptics ) , diseases affecting bone
metabolism ( hypo / hyperthyroid , cushing syndrome , primary hiperparathyroidism , renal failure ,
liver disease , inflammatory bowel disease , malabsorption ) , alcoholism , osteoporotic breakage
history , scoliosis .
data about
the presence of diabetic complications ( retinopathy , ischemic cardiac disease , hypertension ,
neuropathy , nephropathy ) were regularly recorded in during follow - up .
the whole blood count ,
fasting blood glucose , urea , creatine , c - reactive protein , hba1c ( glycolysed hemoglobin ) ,
alkaline phosphatase ( alp ) , calcium ( ca ) , phosphor ( p ) levels , and erythrocyte sedimentation
rate ( esr ) were examined , and a 24-h urinalysis was carried out . through dual - energy x - ray absorptiometry ( dexa , dpx - lunar ) ,
bmd measurements of the lumbar
spine ( anteroposterior projection of l1-l4 ) and left proximal femur ( total score ) were
executed .
the bmd data are presented in g / cm and standard deviation scores ( z
and t scores ) .
t scores between 1 and 2.5 were considered to indicate osteopenia , and
those equal or below 2.5 were considered to indicate osteoporosis ( who study group ,
1994 ) .
the calculations were performed using the statistical package for social sciences for
windows software version 16.0 ( spss inc . ,
the kolmogorov - smirnov test was
used to confirm that data within the ranges of the normal distribution in both groups .
the
comparison of the data between the groups was carried out with the mann - whitney u - test .
the
wilcoxon signed - rank test was used to examine the pre- and post- exercise differences within
groups .
statistical significance was based on a value of p < 0.05 with a 95% confidence
interval .
a total of 126 patients completed the study ( 63 in the study group , 63 in the control
group ) .
the clinical and demographic characteristics of the patients and the healthy
controls are listed in table 1table 1.clinical and demographic characteristics of patient and control groups ( mean sd
or n , % ) dm group(n=63)control group(n=63)age60.18.558.47.8male patients ( n , % ) 29 ( 46%)30 ( 47%)bmi ( cm / kg)32.44.828.45.5 dm : diabetes mellitus ; sd : standard deviation .
there was no significant difference in the result of the laboratory
examinations of the cases ( table 2table 2.clinical and demographic characteristics of patient and control groups ( mean sd
or n , % ) dm group(n=63)control group(n=63)ca ( mg / dl)8.80.28.50.2p ( mg / dl)4.20.84.30.8alp ( u / l)85.9 + 26.784.4 + 32.3fasting blood glucose ( mg / dl)162.444.898.415.524-h urea ca143.881.1133.855.4urea ( mg / dl)4811.2428.2creatine ( mg / dl)0.90.30.70.2esr15.68.218.17.5crp0.20.40.10.5 dm : diabetes mellitus ; sd : standard deviation .
p < 0.05 is significant ) . the bone mineral densities of the cases are presented in table 3table 3.bmd , z and t scores of patient and control groups ( mean sd or n , % ) dm group(n=63)control group(n=63)plumbar ( l14 ) bmd46.6205.41.10.1lumbar ( l14 ) t score0.91.10.011.7lumbar ( l14 ) z score0.011.10.11.2total femur bmd14.9110.61.00.1total femur t score0.21.00.01.2total femur z score0.50.90.11.3 dm : diabetes mellitus ; sd : standard deviation .
p < 0.05 is
significant .. regarding the medications taken by the diabetic patients , 48 patients were
using oral antidiabetic , and 8 patients were using insulin , and 7 patients were using both
of them . with regard to the disease durations , there were 23 patients in the 05 year group
( 36.5% ) , 17 patients in the 610 year group ( 27% ) , 14 patients in the 1115 year group
( 22.2% ) , 4 patients in the 1620 year group ( 6.3% ) , 1 patient in the 2125 year group
( 1.6% ) , and 4 patients in the 2630 year group ( 6.3% ) .
no significant correlation was
detected when comparing disease durations and the bone marrow densities of the type 2 dm
patients by the medicines taken ( p>0.050 ) ( table
4table 4.bmd , z and t scores of drug usages of diabetic patients ( mean sd or n ,
% ) oral antidiabetic(n=48)insulin(n=15)lumbar ( l14 ) bmd53.6195.442.3180.1lumbar ( l14 ) t score0.61.10.81.7lumbar ( l14 ) z score0.041.00.01.3total femur bmd14.9110.613.0100.1total femur t score0.21.10.11.2total femur z score0.50.90.51.2 dm : diabetes mellitus ; sd : standard deviation .
the most important aim of our study was to compare the bone mineral densities of type 2
diabetes mellitus patients with those of a normal , healthy population . in our examinations
,
we determined that there was a significant decrease in the lumbar region t score in compared
with the normal population .
although osteoporosis is one of the complications of type 1 diabetes , the effect of type 2
dm on bone mineral density is controversial . in different studies , the bmd values in type 2
dm have increased6 , decreased7 , or stayed normal8 . in general , the type 2 dm patients with low bmd values have
been observed to have long - term diabetes and menopause , to have poor glucose control , and to
have disordered renal functions9 .
furthermore , in some studies , it has been concluded that diabetic women are protected from
osteopenia10 .
this can be explained in
type 2 dm , unlike the case of type 1 dm , by the frequent observation of obesity due to
increased insulin resistance and the higher of osteoarthritis in dm patients11 . in the study of sosa et al .
, 47 female type 2 dm patients and 252 nondiabetic women were
compared in terms of bmd through dexa and quantitative computerized tomography , and no
significant difference was detected12 . in
the literature
, it has been found that type 2 dm patients , individuals using a dietary and
oral antidiabetic , and individuals taking insulin have lower bmd values13 .
it has been asserted that better glysemic control ,
exercise , diet , and medical therapy can decrease the complications in dm14 .
but in our study , no difference could be
determined in bmd in relation to medicine usage . in measurements from the calcaneal region ,
a previous study reported higher bmd values in
postmenapousal women and similar values to those of a control group in diabetic men , and it
has been determined that there was no difference between women and men15 .
one of them is
that it can lead to diabetic osteopenia due to deficiency in anabolic activation of
insulin13 .
another mechanism asserted
in diabetic osteopenia is suppression of osteoblastic bone formation16 . in previous studies
, it has been shown that decreases in
osteoblastic functions occurred in diabetic ostopenia17 .
previous studies have also shown that the bone cycle speed in type
2 dm is much slower than that in healthy postmenopausal patients18 . in another study on type 1 and type 2 diabetes patients
,
it has been underlined that the decrease in bone mass can be related with decrease in bone
formation and microangiopathy in bone tissue19 . in histopathologic examination of type 2
dm patients , the
osteoblast surface , cortical thickness , osteoid thickness , osteoid volume , and bone volume
have been found to be lower in diabetic patients .
it has been concluded that the mechanism
laying behind the diabetic osteopenia can be the decrease of quantitative osteoid , the
decrease of osteoblasts , and finally the decrease of bone cycle17 . in dm patients ,
estradiol has a direct stimulatory effect on
osteoblasts , and this may contribute to osteoporosis20 . as a result ,
the bmd measurements the postmenopausal women with type 2 diabetes mellitus in
the present study did not show any difference in proportion to those of the control
group . | [ purpose ] diabetes mellitus is a metabolic disorder resulting from a defect in insulin
secretion , insulin action , or both .
a consequence of this is chronic hyperglycemia with
disturbances in carbohydrate , fat and protein metabolism .
we investigated whether there is
any difference among dm patients and a control group in terms of lumbar and femur bmd
( bone mineral density ) , and standard deviation scores ( z score and t score ) .
[ subjects and
methods ] this randomized , prospective , controlled , single - blind study was conducted in the
physical medicine and rehabilitation department faculty of medicine , bezm - i alem vakf
university .
patients with type 2 diabetes mellitus were included in the patient groups .
healthy individuals were included in the control group . [ results ]
a total of 126 patients
completed the study ( 63 in the study group , 63 in the control group ) .
there was no
significant difference in the results of the laboratory examinations of the cases .
the
bone mineral densities of the cases were found to be significantly low in terms of the
lumbar ( l14 ) t scores in the type 2 diabetes group .
[ conclusion ] although osteoporosis is
one of the potential complications of type 1 diabetes , its effect on bone mineral density
in type 2 dm is controversial . in different studies ,
the bone mineral density values have
increased , decreased or remained normal . with the exception of the lumbar ( l14 ) t score ,
similar results were obtained in this study . |
amyloid aggregation of misfolded proteins that escape the cellular quality - control mechanisms is a common feature of a wide range of debilitating and increasingly prevalent diseases such as alzheimer s , parkinson s , huntington s , and creutzfeldt
jakob s diseases.1 amyloid fibrils display a core region formed from repetitive arrays of -sheets oriented perpendicular to fibril axis forming the known cross- structure.2 these fibrils are non - crystalline and insoluble , and , for this reason , they can not be analyzed by x - ray crystallography and solution nuclear magnetic resonance ( nmr ) , the classical structural biology tools.3 the knowledge of three - dimensional structure of amyloids is critical for understanding the mechanism of self - assembling and the design of potential inhibitors . in the same sense , the structural basis of prion infectivity remains largely elusive , mainly because of the difficulty in obtaining atomic resolution of such structures.4 in the last decade , solid - state nmr ( ssnmr ) has emerged as an alternative tool to decrypt the structural signatures of amyloid fibrils , providing major contributions to our understanding on the molecular structures of amyloids such as -amyloid peptide associated with alzheimer s disease or fungal prions among others.5 despite the numerous attempts to obtain the atomic molecular structure of the majority of amyloid fibrils such as a(140)6 or a(142),7
-synuclein,8 transthyretin,9,10 amylin,11 prp,12 ure2p,13,14 sup35p15 by ssnmr , the low resolution of such spectra has limited the acquisition of their atomic structure . only the atomic structure of a few number of amyloid peptides , ie , het - s prion - forming domain ( het - s pfd)4,1619 and short peptides of a,2022 sup35p,23 or 2-microglobulin24 have been well resolved .
thus , it could be considered low - resolved ssnmr spectra when the line broadening and the resonance splitting of ssnmr data limits the atomic structure acquisition and well - resolved ssnmr spectra when the atomic structure can be elucidated from ssnmr data .
since amyloid conformation seems to be an omnipresent process in both eukaryotic and prokaryotic organisms,25 a detailed analysis of decrypted structures could provide essential information on these self - assembling processes . in this sense , we use in the present work the decrypted structure of het - s pfd to propose the potential causes of the observed low resolution of the most amyloid aggregates when analyzed by ssnmr . since prions are infectious proteins assembled as amyloid or amyloid - like structures that have a self - perpetuating capacity in vivo and , thus , turn into pathological infectious agents or protein - based genetic elements,2628 structural models are essential to understand the prion and amyloid motifs .
in contrast to the majority of amyloids , the fibrils of het - s pfd at neutral ph display well - resolved ssnmr spectra facilitating their atomic structural resolution . since het - s protein participates in a fungal self / nonself recognition process called heterokaryon incompatibility,29 the surprising high structural order of het - s pfd fibrils has been hypothesized to be the consequence of the fact that het - s has an evolved biological function.5 the het - s protein displays a globular -helical domain appended to a natively unfolded pfd that act together in a structural model wherein amyloid fibrils built from a cross- core are decorated with globular domains.30 the het - s pfd structure based on ssnmr represents the first complete structure decrypted of an amyloid fibril .
het - s pfd fibrils assembled at neutral ph forms a left - handed -solenoid , with each molecule forming two helical windings , and a highly ordered triangular cross- compact hydrophobic core with three salt bridges and two asparagine ladders.4,16,19 this model is supported by electron diffraction where a prominent meridional reflection at 0.47 nm ( indicative of cross- structure ) is observed ; moreover , scanning transmission electron microscopy measurements yielded 1.020.16 subunit per 0.94 nm , such values in agreement with the predicted value in the model of the fibrils formed at neutral ph.31
a diversity of het - s pfd amyloids formed in vitro has been reported.31,32 these fibrils , which share a width of 5 nm , are observed as tightly twisted fibrils at low ph and as bundled or disordered ones at neutral ph ; moreover , whereas het - s pfd fibrils formed at low ph are not infectious , all het - s fibrils formed at neutral ph act as prions.32 the ssnmr spectra of uniformly n , c - labeled , fully hydrated het - s pfd amyloid formed at neutral ph4,16,19 are qualitatively different from the spectra of a(140),6 amylin,11 ure2p(189 ) fibrils13 or het - s pfd fibrils formed at low ph33 obtained under very similar conditions .
the spectra of het - s pfd fibrils formed at neutral ph exhibit n and c magic angle spinning ( mas ) nmr line widths similar to those obtained for small proteins in microcrystalline states.34,35 no evidence for multiple sets of nmr chemical shifts has been reported for neutral ph het - s pfd fibrils , suggesting the absence of polymorphism at the molecular level.5 in contrast , het - s pfd fibrils at low ph display a spectral resolution with line widths between 128 and 202 hz , which is somewhat worse than that shown by neutral ph fibrils wherein the values of 100 hz are obtained .
this lower resolution of het - s pfd fibrils at low ph could be associated with a higher disorder degree ( figure 1).33
nowadays , amyloid fibril polymorphism is one of the main arguments to explain the low resolution obtained by ssnmr.5,36,37 amyloid polymorphism , which is being reported for an increasing number of amyloid - prone proteins , probably reflects that fibrils have not been under evolutionary constraints to retain a single active conformation.38 amyloid folding is a consequence of a delicate balance between a multitude of conformational states and of the inter - conversion between them in a complex network of equilibriums.39 in this context , the alternative conformations of amyloid proteins depend on their multi - step assembly pathways that could be altered by fibrillation conditions.40 in this way , it is widely accepted that the same amyloid sample could contain several amyloid structures with different -sheet cores because of alternative amyloid pathways .
the presence of different -sheet cores could be the reason of the low - resolution ssnmr spectra .
however , amyloid formation exhibits two classes of polymorphism : one referred to the metastable intermediates commonly observed during amyloid formation and the other , the range of conformational distinct mature fibrils often seen at the reaction endpoint.41 hence , polymorphism at the molecular and/or the macroscopic level should be taken into account .
the electronic interactions and the ionization of amino acid residues are the key factors in the formation of different types of amyloid fibrils with alternative -sheet folds .
since the experimental isoelectric point of het - s pfd is ~5,42 phs below 4 and over 6 could switch between both alternative amyloid pathways , and non - prion and prion pathways , respectively . at neutral ph ,
acidic ( aspartic and glutamic acids ) and basic residues ( arginine and lysine ) are fully ionized entailing the formation of three salt bridges,19 that could be critical for neutral ph fibril assembling in -solenoid with a triangular hydrophobic core .
in contrast , at low ph , the lag of the salt bridges and the change in the ionic states of several amino acidic residues may arise from a perturbation in the subunit fold , although maintaining a rigid part almost exclusively in -sheet conformation but in contrast to the neutral ph fibrils without flexible residues.33 these compiled evidences suggest that the ph acts as a trigger between two amyloid pathways in the het - s model suggesting the formation of only two elementary -sheet structures : non - prion and prion states at low and neutral ph , respectively .
it is relevant to point out that prion het - s pfd fibrils are assembling at neutral ph in bundled or disordered macroscopic structures at high and low ionic strength , respectively ( figure 2 ) .
in contrast , at low ph , non - prion het - s pfd fibrils are shown as twisted fibers as main macroscopic structure ( figure 2).31,32 this observation suggests an apparently high polymorphism degree at the macroscopic level for both elementary structures , ie , non - prion and prion het - s pfd amyloids .
it is important to note that whereas the seemingly disordered prion het - s pfd undergoes aggregation , showing two macroscopic states , ie , bundled and disordered fibrils , sometimes mixed at intermediate conditions;32 such aggregates exhibit well - resolved n and c mas nmr line widths .
this confirms the existence of a single elementary amyloid structure without any polymorphism.19 contrarily , the apparently more ordered low ph fibers display broadening line widths suggesting polymorphism . since polymorphism at the molecular level
would not be envisaged for the samples assembled at ph 3 and 7 , the polymorphism at macroscopic level should be responsible for the low resolution of non - prion het - s pfd ( assembled at low ph ) .
nevertheless , up to now , the reason why the polymorphism at the macroscopic level of prion het - s pfd fibrils does not affect the resolution of ssnmr spectra remains still unresolved .
ssnmr measurements require a total homogeneity of the sample to obtain a well - resolved spectrum .
however , prion het - s pfd fibrils at neutral ph , which usually display a large range of macroscopic structures , show surprisingly the well - resolved ssnmr spectra.19,31,32 this finding , indicative of single cross- structure , suggests that bundled and disordered fibrils share the same cross- motif .
this fact suggests that both bundled and disordered het - s pfd aggregates could be composed of single , independent , and identical fibrils , which , in turn , could be laterally associated with weak interactions forming stacks or disordered aggregates depending on the external conditions low and high ionic strength . in this sense , when bundled and disordered het - s pfd aggregates are brought to ph values close to 45 and sonication , neutral ph aggregates are gradually dissociated resulting in individual fibrils.31,32 accordingly , detailed electronic microscopy analysis confirms the presence of 100% of individual fibrils into stacked aggregates of prion het - s pfd fibrils at neutral ph.31 in contrast , non - prion het - s pfd fibrils at ph 3.3 display three types of fibers individual ( 92.7% ) , doublet ( 5.5% ) , and triplet ( 1.8% ) , and six types at ph 2.2 doublet ( 0.8% ) , triplet ( 75.8% ) , quadruplet ( 0.1% ) , quintuplet ( 2.6% ) , sextuplet ( 18.4% ) , and septuplet ( 2.3%).31 interestingly , these fibers can not be easily dissociated by sonication.32 thus , whereas only single fibrils should be considered at neutral ph , several non - dissociable macroscopic fibers are present at low phs . in summary , at low phs , single fibrils are strongly associated with forming fibers , whereas at neutral ph , the single fibrils are weakly associated probably with weak electrostatic forces remaining de facto as single fibrils .
interestingly , the polymorphism at macroscopic level has been reported for other amyloid - prone peptides as a. thus , the formation of several fibers of a40 and a42 displaying different pitch length and twist as well as several macroscopic associations has been shown by cryoem.4345 in the same way , several a structures have recently resoluted by ssnmr.46,47 these compelling evidences suggest that macroscopic polymorphism could also be a potential cause of the usual low resolution of the a ssnmr spectra .
there is a crucial difference between laterally associated single fibrils and single fibrils associated with forming fibers ; whereas the laterally associated fibrils act as a solution of associated cylinders , the fibrils associated with forming fibers behave as a solution of associated strands of a rope ( figure 3 ) .
the effective interaction area between two cylinders is typically much larger than that for two fibers .
this results in a much weaker attraction between fibers compared with that for cylinders
since fibers are vastly more stable structures than stacked cylinders , single fibrils associated with fibers are much more difficult to dissociate than those associated as stacked cylinders . in the het - s model , het - s pfd fibril stacks observed at neutral ph could be considered as an association of cylinders considering that single fibrils act as a cylinders .
a possible explanation is that finite fibrils are never stable if the primary twist strength is extremely unrealistically high ; in this case , single fibrils are stable and infinite stacks are formed for higher inter - fibril sticking energies.48 at neutral ph , we observe protein precipitation typical of this type of associations forming different macrostructures that can be dissociated if the
stability is reduced ( eg , ph , temperature , or sonication ) obtaining the single fibrils .
in contrast , low ph het - s pfd fibrils form a clear and stable gel consistent with a veritable fiber system
. under these conditions , the inter - fiber association , entailing fiber stacking , is highly unlike because of the intrinsic morphology of the mature fibers , favoring the presence of non - precipitating fibers .
in addition , the high fiber stability prevents the fiber dissociation and the existence of single fibrils .
amyloid fibrils are , for definition , repetitive and very ordered structures , and it is difficult to figure out , that these very regular structures can be heterogeneous and disordered as suggested by ssnmr .
this essential paradigm could be explained for the model of self - assembling chiral rod - like units.49,50 a peptide in -strand conformation could be considered as a chiral rod - like unit , with complementary donor and acceptor groups aligned on opposing sides , and having chemically different upper and lower surfaces .
the rod - like monomers self - assemble via recognition between complementary donor and acceptor groups , to form long twisted tapes .
the tape twist stems from the chirality of the monomers naturally occurring amino acids are l - chirals which gives rise to a left - handed twist around the long axis of the tape .
the differences in the chemical structures of the two faces of the tape and in their affinity to the solvent lead to a cylindrical - like structure .
this chemical anisotropy results in inter - tape attraction and hence in double tape formation , obtaining single fibrils also named ribbons or proto - filaments or proto - fibrils when take part of a fiber .
both faces of the single fibrils are identical and are characterized by a saddle curvature .
hence , the single fibril does not bend , and its axis is straight at equilibrium ( figure 4).49,50 the sides of the single fibrils could be , in turn , mutually attracted resulting in stacks of cylinders or fibers in het - s pfd model .
stacks are bundled or disordered aggregates , whereas fibers are twisted structures formed mainly by single fibrils triplets .
tapes must exhibit a twist resulting from amino acid chirality,51 nevertheless , the fibrillogenesis from tape non - stable specie to single fibrils and fibers entails twist changes . in order to combine two tapes to form single fibrils , the twisted tapes must reduce their primary twist for inter - twist together . in the same manner ,
when the single fibrils are combined with fibers via weak face - to - face attraction , the stronger are the distortions of the single fibrils and more reduced is the twist - angle ( figure 5 ) .
the same is true if different fibers are joined together to form macro fibril structures .
additionally , the characteristics of each single fibril could determine the shape of the mature fiber in both the number of single fibrils and the position of the single fibrils in the rope .
interestingly , the amino acid composition could become a key factor in the fibril association determining the final twist - angle.52 thus , importantly , there is a relationship between the number of single fibrils that forms a fiber and the twist reduction . in case of
small peptides , the formation of a tape - to - tape union is essential for the single fibril formation .
in contrast , long peptides , ie , a(140 ) or het - s pfd , have the tendency to form a roll structure in a same monomer obtaining single fibrils composed by a single subunit monomer per unit of length.3,31 het - s pfd single fibrils are composed by monomers in cross- structure forming an axial stacking of -solenoids with two coils per unit.31 het - s pfd single fibrils at neutral ph are obtained as individual entities with the same angle of twist , entailing the same amino acid alignments .
in contrast , het - s pfd single fibrils at low ph are part of fibers mainly triplets and sextuplets . as previously stated , single fibrils in triplet or sextuplet structures display different twist - angle and consistently different amino acid alignments .
thus , at low ph , we should expect the existence of a single low ph het - s pfd single fibril structure with different twists depending on both the number of single fibrils that compose every fiber and the macroscopic distribution of the single fibrils in the mature fiber ( figure 6 ) .
these amino acid alignment variations between consecutive and identical -stand monomers could explain the low resolution of het - s pfd fibers at low ph by ssnmr .
in concordance of our assumption , recently it has been shown that spontaneous aggregation of the insulin - derived steric zipper peptide vealyl resulting in different aggregation forms with common features .
the comparison of ssnmr chemical shift data of twisted and untwisted structures from molecular dynamic ( md ) simulations , suggest that different angles of twist could be the responsible for the experimentally observed line broadening and resonance splitting by ssnmr.53
amyloid polymorphism has been reported for an increasing number of amyloid - prone proteins , it is likely that other amyloid - prone proteins display a similar behavior than that shown for het - s pfd amyloids at low ph , showing different types of non - easily dissociable fibers composed for a discrete number of identical single fibrils with the same -stand motif .
the number of single fibrils as well as the relative position of those in the mature fiber could entail a wide range of angles of twist , involving changes in amino acid alignments between -stand monomers that could be enough to limit the ssnmr resolution .
the variation of the external conditions ( eg , ph , temperature , ionic strength , agitation , and sonication ) can alter the equilibrium among different amyloid structures favoring determined ones . the research of the ideal conditions to obtain a specific structure or the isolation of individual single fibrils will make possible better ssnmr determinations and open the possibility to decrypt new amyloid proteins in their amyloid fold . | amyloids are non - crystalline and insoluble , which imply that the classical structural biology tools , ie , x - ray crystallography and solution nuclear magnetic resonance ( nmr ) , are not suitable for their analysis . in the last years , solid - state nmr ( ssnmr ) has emerged as an alternative tool to decrypt the structural signatures of amyloid fibrils , providing major contributions to our understanding of molecular structures of amyloids such as -amyloid peptide associated with alzheimer s disease or fungal prions , among others . despite this , the wide majority of amyloid fibrils display low resolution by ssnmr .
usually , this low resolution has been attributed to a high disorder or polymorphism of the fibrils , suggesting the existence of diverse elementary -sheet structures . here
, we propose that a single -sheet structure could be responsible for the broadening of the line widths in the ssnmr spectra .
although the fibrils and fibers consist of a single elementary structure , the angle of twist of each individual fibril in the mature fiber depends on the number of individual fibrils as well as the fibril arrangement in the final mature fiber .
thus , a wide range of angles of twist could be observed in the same amyloid sample .
these twist variations involve changes in amino acid alignments that could be enough to limit the ssnmr resolution . |
invasive aspergillosis ( ia ) represents a serious health problem for the immunocompromised patient , especially those undergoing cancer chemotherapy or receiving corticosteroid therapy or immunosuppression to avoid allograft rejection or solid organ rejection .
aspergillus fumigatus is a ubiquitous mold and the most frequent cause of aspergillosis in humans , causing a wide spectrum of diseases ranging from allergies to severe life - threatening invasive manifestations .
spores of a. fumigatus enter the body through inhalation , and infection primarily occurs in the lungs .
given the limitations of clinical signs and the difficulty in obtaining appropriate specimens for diagnosis , a significant proportion of cases remain undetected , resulting in late or inappropriate therapy and increased mortality rates as high as 90% with cerebral disease ( 1 ) .
hence , there is an urgent need for an accurate and standardized approach for diagnosing ia .
the performance of mycological diagnostics when testing serum or plasma samples is assumed to be similar .
the revised european organization for research and treatment of cancer / invasive fungal infections cooperative group and the national institute of allergy and infectious diseases mycoses study group ( eortc - msg ) definitions for invasive fungal infections include galactomannan ( gm)-enzyme immunoassay ( eia ) for testing of both serum and plasma ( 2 ) , although the testing of plasma with this assay has not been validated by the manufacturer .
a study comparing gm - eia performance in serum and plasma confirmed that the testing of plasma using the same thresholds was appropriate , but interestingly , the mean index generated by testing plasma was significantly higher than that for serum ( 0.315 versus 0.279 ; p = 0.0398 ) .
moreover , four possible ia cases would have been classified as probable ia had plasma been tested .
the authors hypothesized that differences in indices could be attributed to the formation of the blood clot potentially ensnaring some of the gm within the sample taken for serum testing .
it is conceivable that the same might be true for extracellular dna , the aspergillus target in the cell - free fraction of host blood , which would thereby affect pcr performance .
this paper describes further efforts of the european aspergillus pcr initiative ( eapcri ) to evaluate the analytical performance of plasma and serum samples through the blinded distribution of simulated panels , as described previously for whole blood and plasma ( 4 , 5 ) .
we report data on the differences in analytical performance associated with different sample types ( plasma versus serum ) and on how differences in the initial formation of the sample types ( clot versus no clot ) and sample processing ( whole - blood centrifugation ) affected the availability of dna within the cell - free sample itself . in a companion paper ( 6 ) to this analytical in vitro study , a further multicenter clinical study , which compares the performance of plasma and serum , was performed in parallel ( 6 ) .
dna was obtained from a sporulating culture of a. fumigatus ( strain atcc 1022 ) .
the participants comprised 8 laboratories representing the eapcri core facilities and an extended group of an additional 15 laboratories . to maintain impartiality throughout the analytical process
, all centers were given a numerical code to allow a blinded review of individual methodological procedures , determination of performance , and statistical analysis .
all edta whole - blood and clotted - blood samples were obtained from consenting healthy volunteers and screened for the presence of infectious agents , as per protocol of the institute of transfusion medicine , wrzburg university hospital , ( wrzburg , germany ) , and approved by the local ethics review board .
serum and plasma were fractionated by centrifugation and pooled , respectively , before being distributed to public health wales , microbiology cardiff , cardiff , united kingdom , to develop the panel . to avoid airborne contamination ,
the panel was validated through testing with an in - house aspergillus - specific real - time pcr ( 7 ) .
the participating centers were asked to confirm receipt , comment on the state of the panel ( frozen or thawed ) , and keep specimens frozen at 80c until testing .
initially , serum was divided into 3 35-ml aliquots ; one aliquot was retained to provide a negative - control sample , while two aliquots were spiked with 100 and 10 genome equivalents ( ge ) of a. fumigatus dna per milliliter of serum .
the 35-ml serum batches were further divided into 1-ml aliquots and frozen at 80c until distribution on dry ice to the 23 centers .
this panel was a quality control ( qc ) exercise designed to confirm the findings of the previous research investigating serum , in doing so providing a reference for a comparison with the plasma results but also determining centers with optimal results for the analyses of further panels , including the analysis of plasma samples ( 5 ) .
plasma was divided in eight 12-ml aliquots ; two aliquots were retained to provide negative - control samples , while six aliquots were spiked with various concentrations of a. fumigatus genomic dna ( 1,000 , 100 , 50 , 10 , 5 , 1 , and 0 ge / ml ) and divided into 1-ml aliquots .
the panels were distributed on dry ice to the 8 eapcri core centers for testing . in keeping with previous studies ,
the threshold of detection , based on 95% variance , was set at 10 ge / ml ( 5 ) .
dna was spiked into blood collected into an edta vacutainer and into a vacutainer without any anticoagulant immediately after sampling but before centrifugation .
blood was spiked with various concentrations of genomic a. fumigatus dna ( 100 , 50 , 10 , and 0 ge / ml ; fig .
both the edta and clotted - blood vacutainers were left for a minimum of 30 min at room temperature to allow the blood without anticoagulants to clot .
the vacutainers were then centrifuged ( 3,500 g for 5 min ) to separate the cell - free fractions , which were pooled according to sample type and initial concentration of fungal burden . each sample
was then divided into 0.5-ml aliquots ( potential target burdens , 50 , 25 , 5 , and 0 ge ) and frozen at 80c prior to distribution on dry ice .
serum and plasma samples were shipped on dry ice to the 8 eapcri core centers .
flow diagram highlighting the process for determining the availability of aspergillus dna in serum and plasma samples post - blood fractionation .
the following experiments were performed in a two - center study in cardiff and wrzburg using identical spiking protocols , described below .
two 4-ml aliquots of serum and plasma were spiked with 100 ge of a. fumigatus dna .
an aliquot of plasma and an aliquot of serum were centrifuged at 3,500 g for 5 min , mimicking the centrifugation process necessary to fractionate blood samples and potentially identifying any losses associated with this process .
the other aliquot of plasma and serum , equivalent to a direct spike control , remained untouched at ambient temperature until further processing by extraction .
dna was extracted from a minimum of three replicates of 0.5 ml of serum and 0.5 ml of plasma that were spiked but not centrifuged and a minimum of three replicates of 0.5 ml of serum and 0.5 ml of plasma that were both spiked and centrifuged .
dna was extracted using the in - house protocols of both centers ( 8 , 9 ) .
briefly , in cardiff , aspergillus dna was extracted using the qiagen ez1 dsp virus kit , as per the manufacturer 's instructions , with dna eluted in 60 l ; in wrzburg , the qiaamp ultrasens virus kit ( qiagen ) was used , as described by the manufacturer , and dna was eluted in 70 l .
pcr was performed in duplicate and included an internal control to measure pcr inhibition . immediately after blood was drawn ,
4 ml of edta whole blood and 4 ml of clotted blood were spiked with 100 ge of a. fumigatus dna .
the clotted blood was left at ambient temperature for 30 min to coagulate , while the edta blood remained untouched at room temperature for the same period .
after centrifugation , a minimum of three 0.5-ml aliquots of plasma and serum and the cell pellet from the edta whole - blood samples were extracted using local protocols , and dna was eluted in < 100 l . the clot was not processed , as no eapcri - validated procedures are currently available to do so .
pcr was performed in both centers using in - house amplification protocols and an inhibition control , all in accordance with eapcri guidelines ( 5 ) .
centers were requested to return both qualitative ( positive / negative ) and quantitative ( quantification cycle [ cq ] ) results within a designated time frame and provide detailed protocols for their dna extraction and pcr amplification systems .
the information required included sample volume used , extraction method , dna elution volume , pcr method , pcr target , pcr template input volume , pcr total reaction mixture volume , pcr amplification platform , and internal control pcr results .
the cq was the dependent variable , whereas the explanatory variables were ( i ) the genomic load ( as log10 genomic dna ) , ( ii ) the spiked sample type ( as a binary variable for serum or plasma ) , and ( iii ) the interaction between genomic load and fluid .
a multilevel mixed - effects model was performed , using the centers as a grouping variable .
this model was comparable to a simplified calibration curve , also comparing the calibration lines concerning serum and plasma .
in addition , bivariate linear regression was performed to analyze possible associations between pcr sensitivity and selected covariates ( table 1 ) .
bivariate analysis for the sensitivity of aspergillus pcr testing spiked plasma specimens distributed to 8 eapcri core centers all continuous and binary center - specific covariates were included into the basic model . with a negative z score , the variable tended to exert a favorable effect on the pcr assay .
covariates exerting a significant effect ( p < 0.05 ) and an absolute z score of > 1.96 .
the serum analysis in this qc panel compared favorably with the previous eapcri serum evaluation ( 5 ) .
all 23 centers were able to reproducibly detect the sample that was spiked with 100 ge and generate negative results when testing the sample not containing aspergillus dna .
samples spiked with 10 ge / ml generated an overall positivity rate of 74% ( 17/23 centers ) and a positivity rate of 82% ( 14/17 ) in centers that were strictly in accordance with eapcri recommendations for serum .
five out of the 6 centers that were not in accordance with eapcri recommendations were unable to detect 10 ge / ml . centers that were unable to detect the 10 ge / ml did not routinely process serum samples ( 6/6 ) or used serum volumes of < 0.5 ml ( 5/6 ; volume range , 0.1 to 0.2 ml of serum ) . in addition , these centers used only a small portion of their original serum sample volume in the subsequent pcr assay ( mean 7.9% , range , 1% to 25% ) , compared to a mean volume of 24.4% ( range , 16% to 82% ) for centers that were able to detect 10 ge / ml ( p = 0.028 ) .
all centers that had received this plasma panel were requested to adhere to the eapcri guidelines for serum testing , and their positivity rates in the related qc serum panel were 100% , 100% , and 0% ( 100 , 10 , and 0 ge / ml , respectively ) .
all 8 centers achieved 100% positivity for fungal burdens between 5 ge / ml and 1,000 ge / ml , while the sample spiked with 1 ge / ml was positive in a single sample at one center only ( fig .
2 ) . six out of 8 centers stated that they use either serum or plasma or both in their routine diagnostic procedures ( 2 centers mainly tested bronchoalveolar lavage fluid ) . aspergillus pcr performance using plasma samples spiked with different fungal loads plasma samples 1 to 8 were spiked with different fungal burdens ( genome equivalents [ ge]/ml of plasma ) .
descriptive statistics for aspergillus real - time pcr crossing points when testing plasma samples containing various concentrations of a. fumigatus genomic dna . means ( closed diamonds ) , 95% confidence intervals of the means ( vertical bars ) , and single observations ( open circles ) are shown for each fungal load .
the centers used between 0.1 ml and 1 ml ( mean , 0.5 ml ) of plasma for subsequent dna extraction , 50 to 100 l ( mean , 60 l ) for the elution volume , and 2 to 15 l ( mean , 8.7 l ) for the template volume in their pcr assays . in bivariate analyses , we observed significant positive correlations between pcr sensitivity and the volume of plasma used for dna extraction , the ratio between the volume of plasma used for extraction and the subsequent elution volume , the reaction mixture volume used for pcr , the analysis of 2 replicates , and the use of an internal control ( table 1 ) . to provide complete cq values for a range of different plasma volumes ,
a linear mixed model was used , which predicts cq values for hypothetical plasma volumes ( 0.1 ml to 0.5 ml ) and various a. fumigatus dna concentrations ( 5 to 1,000 ge / ml ) .
the model shows that both plasma volume and dna load influence cq values ( e.g. , predicted cq values for 5 ge / ml ranged depending on the plasma volume between 37.6 and 40.7 [ table 3 ] ) .
influence of sample volume ( 0.1 to 0.5 ml ) on aspergillus real - time pcr crossing points when testing plasma samples containing a range of a. fumigatus genomic dna concentrations ( 5 to 1,000 ge / ml ) the prediction of cq values was calculated using a linear mixed model . in order to measure the availability of dna in the cell - free fraction post - whole - blood processing , an additional panel , consisting of 4 serum samples and 4 plasma samples , was shipped to the 8 core eapcri centers .
our linear model showed that while the slope for pcr from plasma and serum did not differ significantly ( p = 0.381 ) , the plasma intercept was 4.3 cycles lower ( standard error , 1.38 ; 95% confidence interval 6.996 to 1.585 ) than the serum intercept ( z score = 3.11 , p = 0.002 ) .
interestingly , this shift in cq values was achieved at all dna concentrations tested ( 50 , 25 , and 5 ge / ml ; fig .
the individual performance of each center in this panel was significantly associated with the volume of sample used for dna extraction . while both centers using 0.2 ml of serum or plasma achieved suboptimal sensitivity , as the serum sample spiked with 5 ge / ml was not detected , the centers using 0.5 ml of plasma and serum were able to detect this sample as positive ( p < 0.001 ) ( table 4 ) .
in addition , we observed a trend that laboratories that routinely test serum or plasma by aspergillus pcr achieved higher sensitivity ( p = 0.07 ) .
comparison of aspergillus real - time pcr when testing serum and plasma samples containing various fungal loads using a linear mixed model .
data are shown after the regression of the cq value versus the fungal genomic burden , with serum or plasma as a binary covariate .
details of the molecular procedures used by the eapcri centers investigating the performance of aspergillus pcr when testing serum and plasma in order to identify any potential loss of dna during centrifugation necessary to fractionate blood samples , the recovery of dna from spiked serum and plasma specimens that were centrifuged at 3,500
g was compared to that of spiked samples that were not centrifuged ( fig .
, there were no significant differences in cq values between centrifuged or noncentrifuged samples for either plasma or serum ( table 5 ) .
these results demonstrate that centrifugation at 3,500 g is not sufficient to sediment free dna from serum and plasma .
( a ) flow diagram highlighting the process for determining the effect of centrifugation on the availability of aspergillus dna in serum and plasma samples .
( b ) flow diagram highlighting the process for determining the effect of clot formation on the availability of aspergillus dna in serum compared to the processing of plasma samples .
effect of centrifugation at 3,500 g on dna recovery ( as indicated by mean cq values ) from spiked serum and plasma specimens the two centers revealed no significant differences in cq values between centrifuged and noncentrifuged plasma and serum samples , respectively ( p > 0.05 ) .
interestingly , in both centers , plasma obtained after centrifugation of spiked edta blood samples showed earlier cq values than those with serum obtained from the corresponding clotted - blood samples ( difference of mean cq values between plasma and serum , 2.26 ; standard error , 0.45 ; p = 0.0002 ) .
the concentration of genomic dna added to the pcr was significantly lower ( p = 0.028 ) in serum samples post - clot formation ( mean , 1.9 copies ; standard deviation [ sd ] , 0.8 ) compared to dna extracted from serum not influenced by clot formation ( mean , 4.2 copies ; sd , 1.3 ) . although it is likely that a substantial amount of a. fumigatus dna is bound during blood clot formation and consequently is unavailable for dna extractions using serum , it was not possible to test the clot material , as optimized protocols are not available , and technical limitations prevent the processing of the entire clot material , which in this scenario was > 2 ml in volume
however , whole - blood cell pellets from centrifuged edta vacutainers containing peripheral blood mononuclear cells were tested .
relatively small amounts of a. fumigatus dna ( mean , 0.4 input copies ) were detectable in samples at both centers ( center 1 , 1/4 samples positive [ threshold cycle { ct } value , 51.9 cycles ] , center 2 , 2/5 samples positive [ ct values , 40.2 and 42 cycles ] ) , although it appears that the majority of the dna remains in the plasma fraction ( mean , 3.3 input copies ) .
the european aspergillus pcr initiative ( eapcri ) has published standards for aspergillus pcr and protocols for detecting aspergillus dna in whole blood ( 4 ) and serum ( 5 ) .
the identification of the critical stages of aspergillus dna extraction from both specimen types allowed the eapcri to propose a protocol that helps ensure optimal performance of aspergillus pcr across laboratories .
however , no such data exist for plasma , and no direct comparison between plasma and serum specimens has been performed .
thus , eapcri continued its efforts to evaluate the analytical performance of plasma compared with serum samples through the blinded distribution of simulated panels . in parallel ,
a multicenter clinical study was performed to compare the detection of a. fumigatus dna isolated from plasma and serum obtained from hematological patients ( 6 ) .
the group of 8 eapcri core laboratories was able to demonstrate that the cq values obtained from plasma were significantly lower ( p = 0.002 , fig .
3 ) than cq values from serum ( 50 , 25 , and 5 ge ) .
almost 15 years ago , loeffler et al . ( 10 ) compared the sensitivities of a. fumigatus dna detection from plasma and whole blood .
although plasma and whole - blood samples spiked with aspergillus conidia showed an identical lower detection limit ( 10 cfu ) , the sensitivity of plasma pcr was inferior to that of pcr performed on whole - blood samples obtained from patients with proven ia .
however , both dna extraction and pcr amplification technology have advanced over the past decade .
in addition , the quality of molecular diagnostics has advanced through numerous external quality assessment initiatives , including the eapcri , the minimum information for publication of quantitative real - time pcr experiments ( miqe ) guidelines ( 11 ) , and the quality control for molecular diagnostics ( qcmd ) ( http://www.qcmd.org ) . in a recent study comparing eapcri methods for the testing of serum and whole blood
, there was a trend toward superior sensitivity when testing whole blood , but this did not reach statistical significance , and any benefit was outweighed by the simplicity of testing serum ( 8) . the current study demonstrated that after spiking whole blood , the pcr testing of plasma samples showed superior sensitivity to that of serum ( p = 0.002 , fig .
no data exist comparing the detection of a. fumigatus dna detection in both serum and plasma .
( 12 ) showed that candida dna was detected more often in serum ( 71% ) and plasma ( 75% ) than in whole blood ( 54% ) in a study of 109 patients with candidemia .
however , there was no significant difference between plasma and serum , possibly because of the relatively small numbers of serum and plasma specimens that were tested ( n = 29 and 24 , respectively ) or the differences in fungal disease manifestation . with respect to ia , the concentration of galactomannan as determined by eia was shown in another study to be significantly higher in plasma than in serum ( p : 0.0398 ) and may have been associated with clot formation ( 3 ) .
the presence of compounds that may interfere with molecular assays is always a concern when processing clinical samples . compared to serum ,
plasma samples contain various coagulation factors that lead to the conversion of fibrinogen to fibrin and clot formation .
fibrinogen is a soluble protein , which is exclusively found in plasma ( normal range , 150 to 400 mg / dl ) but not in serum , and it has been shown to interact with magnesium , which is also an essential component of the pcr ( 13 ) .
if this interaction results in lowering the magnesium concentration , it might result in pcr failure .
all dna extraction protocols used by the 8 eapcri study centers ( table 4 ) provided plasma dna eluates that yielded superior sensitivity and lower cq values than those of serum , indicating that the additional components in plasma had no effect on pcr efficiency . in addition , the source of anticoagulant is also important ; garca et al .
( 14 ) showed in rat blood that when comparing sodium citrate , heparin , and tripotassium - edta as anticoagulants , only tripotassium - edta did not interfere with pcr used to diagnose ia .
the eapcri recommendations for aspergillus pcr in serum included the use of a minimum volume of 0.5 ml of serum as starting material , dna elution in a volume of < 100 l ( p = 0.003 ) , and the use of an internal control ( 5 ) .
for plasma , bivariate linear regression was used to evaluate similar covariates , finding that there was a statistically significant positive association between pcr sensitivity and larger sample volumes ( 0.5 ml of plasma ) , the use of 2 replicates ( from a single eluate ) , and an internal control .
while the dna elution volume itself is not significantly associated with pcr sensitivity , the ratio of the initial plasma sample volume to the subsequent elution volume was significantly associated ( z score = 2.32 , p = 0.02 , table 1 ) .
all 8 core centers complied with eapcri serum recommendations on elution volume ( < 100 l ) , so a correlation with pcr sensitivity is to be expected .
however , the use of an internal control was correlated and found to be statistically significant .
although this parameter is only indirectly associated with the detection of a. fumigatus dna , it reflects the degree of diligence and accuracy of an individual laboratory .
interestingly , a. fumigatus genomic dna , spiked into edta whole blood and left untouched for 30 min , was detectable in small amounts in some leukocyte pellets and in the cell - free fraction .
this suggests that circulating extracellular dna reaches the cell pellet either by gravitational force or due to binding to leukocyte surface receptors .
( 15 ) showed that there is a common binding site for dna on white blood cells .
however , in a comparison to the detection of a. fumigatus dna in serum clots , only 3/9 leukocyte pellets showed weak pcr - positive results , whereas mcculloch et al .
( 16 ) reported significantly more aspergillus dna detectable in serum clots than that in the cell - free fraction ( p < 0.001 ; 95% ci , 2.24 to 6.48 ) .
these authors found that the average cq value for the clot sample was 2.38 cycles lower than that for edta blood and 3.69 cycles lower than that for serum .
while this equates to 7.9- and 12-fold increases in dna yield from the clot in edta blood and serum , respectively , difficulties in processing these samples limit their use in routine practice .
this observation might partially explain our observation that cq values from native serum ( used before clotting ) developed consistently later than cq values obtained from native plasma samples , which were spiked with identical number of genome equivalents . in conclusion ,
the analytical sensitivity of plasma , as determined by a multicenter evaluation of pcr - based detection of a. fumigatus dna , is superior to that with serum .
recommendations published by eapcri for serum ( 5 ) , including sample volume , a minimum of duplicate pcr testing of each dna extract , and an internal control , can be applied to plasma . to confirm the analytical findings described here , a parallel multicenter clinical study ( 6 )
the retrospective case - control study supports the findings of this analytical paper and comes to the conclusion that there is a trend toward increased sensitivity of plasma , although this did not reach significance ( p = 0.0897 ) , and positivity was most frequently earliest when testing plasma by pcr . | the use of serum or plasma for aspergillus pcr testing facilitates automated and standardized technology .
recommendations for serum testing are available , and while serum and plasma are regularly considered interchangeable for use in fungal diagnostics , differences in galactomannan enzyme immunoassay ( gm - eia ) performance have been reported and are attributed to clot formation .
therefore , it is important to assess plasma pcr testing to determine if previous recommendations for serum are applicable and also to compare analytical performance with that of serum pcr .
molecular methods testing serum and plasma were compared through multicenter distribution of quality control panels , with additional studies to investigate the effect of clot formation and blood fractionation on dna availability . analytical sensitivity and time to positivity ( ttp ) were compared , and a regression analysis was performed to identify variables that enhanced plasma pcr performance . when testing plasma , sample volume , preextraction - to - postextraction volume ratio , pcr volume , duplicate testing , and the use of an internal control for pcr were positively associated with performance . when whole - blood samples were spiked and then fractionated , the analytical sensitivity and ttp were superior when testing plasma .
centrifugation had no effect on dna availability , whereas the presence of clot material significantly lowered the concentration ( p = 0.028 ) . technically , there are no major differences in the molecular processing of serum and plasma , but the formation of clot material potentially reduces available dna in serum . during disease ,
aspergillus dna burdens in blood are often at the limits of pcr performance . using plasma might improve performance while maintaining the methodological simplicity of serum testing . |
mycobacteria are important agents of human infections . while the most well - known infections are tuberculosis and leprosy , infections with nontuberculous mycobacteria are an increasing problem in soft tissues after surgical or cosmetic procedures ( 1 ) or in the lungs of cystic fibrosis and immunosuppressed patients ( 2 ) .
killing mycobacteria in health care settings is important because mycobacterium tuberculosis strains in clinical specimens or cultures may contain drug - resistant organisms that are difficult or impossible to eradicate ( 3 ) , and environmental mycobacteria must be thoroughly eliminated from surgical implements and respiratory equipment .
disinfection of mycobacteria can be a problem , as mycobacteria are the most disinfectant - resistant bacteria ( 4 ) .
quaternary ammonium compound ( qac ) disinfectants are regarded as only mycobacteriostatic ( 4 ) , and qac tolerance is a problem with mycobacteria of the mycobacterium abscessus complex ( 5 ) .
some of the more effective disinfectants ( 6 ) , such as chlorine bleach and peracetic acid , can be relatively toxic , unstable , or expensive ( 4 ) , and the emergence of glutaraldehyde - resistant strains has caused extensive outbreaks of nontuberculosis infections ( 7 ) . while using acetic acid as a solvent , we fortuitously found that it had significant mycobactericidal activity .
vinegar has been used as a disinfectant for thousands of years ( 8 , 9 ) and is today commonly used for , among other things , eliminating bacteria from fresh produce ( 10 , 11 ) or curing acute otitis externa ( 12 , 13 ) .
there is a description of its use in the middle ages for treating infected wounds and scrofula , which generally means tuberculosis of the lymph nodes in the neck ( http://en.wikipedia.org/wiki/medieval_medicine_of_western_europe ) . in this study , we quantitated the significant mycobactericidal activity of acetic acid and suggest that it may be a useful , low - cost , and effective disinfectant .
acetic acid or vinegar was added to aliquots of bacterial cultures in proportions to create the concentrations shown in table 1 .
the cultures were then inverted several times and incubated at room temperature without agitation for the specified periods ( 20 to 30 min ) .
they were then centrifuged , and the pellet was resuspended in middlebrook 7h9 medium supplemented with oleic acid - albumin - dextrose - catalase ( oadc ) .
aliquots of serial dilutions were plated on lb agar plates for escherichia coli and middlebrook 7h10 plates for mycobacteria , except for mycobacterium smegmatis , which was plated on either medium with the same results .
all experiments were performed at least twice , and the results were the same whether the bacterial pellets were resuspended in middlebrook 7h9 medium - oadc or in a sodium hydroxide solution to neutralize the acetic acid .
negative controls with sterile water were included to determine the original number of viable bacteria .
bactericidal effect of increasing exposure times and acid concentrations high - level disinfectant activity is indicated in bold .
the numbers represent the reductions , expressed in log10 , in the number of colonies recovered after the acid exposures , compared to that of controls exposed to sterile water alone under the same conditions .
m. abscessus with optical density at 600 nm of 1 was diluted 1:10 in the acetic acid solutions .
exposure to acetic acid at a concentration of 5% for 20 min reduced viable escherichia coli dh5 and m. smegmatis mc155 bacteria by at least 7 log10 ( table 1 ) . in some experiments in which the initial culture had ~9 log10 of bacteria / ml
when these colonies were grown in broth media and tested again , they showed no evidence of resistance or tolerance to acetic acid , and their exposure to 5% for 20 min again produced 7 log10 of killing . to test whether the low ph of acetic acid was responsible for the bactericidal effect , we exposed m. smegmatis and e. coli for 20 min to a dilute solution of hcl in water with ph 2.5 , corresponding approximately to the ph of 5% acetic acid .
other studies have looked at the effect of ph on mycobacterial growth by reducing the ph in the culture media to as low as ph 3 with hcl or ph 5 with citric acid and found that after a couple of days , the number of viable bacteria was reduced by only approximately 1 log10 ( 14 , 15 ) .
next , to determine whether the effect was specific for acetic acid , a two - carbon acid , we also tested solutions of the three - carbon propionic acid that had been diluted to have approximately the same molarity as 6% acetic acid .
propionic acid had bactericidal activity against both e. coli ( table 1 ) and m. abscessus .
a 13.7% solution of sodium acetate , with about the same molarity as 10% acetic acid , produced less than a 1-log(10 ) killing of m. smegmatis ( data not shown ) , indicating that the bactericidal effect of acetic acid was caused by its carboxylic acid function .
we then tested for activity against m. tuberculosis . while exposure to 5% acetic acid for 20 min obtained only a 3- to 4-log10 reduction of viable bacteria , exposure to a 6% solution for 30 min resulted in at least an 8-log10 reduction .
the same levels of mycobactericidal activity were seen with virulent ( h37rv ) and avirulent auxotrophic ( mc7000 [ h37rv rd1 pancd ] ) ( 16 ) m. tuberculosis laboratory strains , as well as with multidrug - resistant ( mdr ) and extensively drug - resistant ( xdr ) m. tuberculosis clinical isolates .
we also tested acetic acid on the notoriously resistant mycobacterium abscessus complex bacteria ( 17 ) .
although m. abscessus sensu stricto was efficiently killed by exposure to 6% acetic acid for 30 min , mycobacterium bolletii and mycobacterium massiliense were more resistant .
the levels of reduction in viable bacteria differed somewhat in different experiments , but exposure to 10% acetic acid for 30 min achieved a minimum of a 6-log10 reduction in the colony counts of these two species , with m. massiliense appearing to be slightly more resistant than m. bolletii .
dirty conditions that were meant to simulate contamination with organic material in clinical samples , with the acetic acid solution containing 2 to 3.5% bovine serum albumin and 2 to 3.5% red blood cells ( table 1 ) .
the results described above suggest that acetic acid can be an effective , economical bactericidal agent for m. tuberculosis and nontuberculous mycobacteria , although the 20- to 30-min exposure time required to obtain optimal killing is longer than the 5 min recommended for some commercial bactericides .
exposure to 6% acetic acid for 30 min resulted in an 8-log10 reduction of viable m. tuberculosis bacteria , including xdr and mdr strains . in tests with the m. abscessus complex , which are emerging as the most pathogenic of the nontuberculous mycobacteria ( 17 ) , the same conditions produced 8 log10 of killing only with m. abscessus sensu stricto , while m. massiliense and m. bolletii were more resistant in some assays .
however , the generally accepted definition of an effective mycobactericide is one that has the ability to reduce viable bacteria by 4 to 5 log10 ( 18 ) , while the 6-log10 reduction of both these bacteria achieved with 10% acetic acid for 30 min would be classified as high - level mycobactericidal activity ( 19 ) . in some assays
in which 10
m. smegmatis bacteria were exposed to 6% acetic acid for 20 min and 3 10
m. massiliense bacteria were exposed to 10% acetic acid for 30 min , there were no survivors . although we did not attempt carrier tests , the effective mycobactericidal activity was maintained even under
while this level of killing may not be adequate for all critical uses , such as sterilizing surgical instruments , it is likely that higher levels of killing of these highly resistant strains could be achieved with higher concentrations of acetic acid and/or longer exposure times than the ones tested here .
preliminary studies , however , suggest that 10% acetic acid for 30 min does not kill bacillus subtilis spores ( data not shown ) , so it can not be classified as a high - level general disinfectant ( 20 ) .
although the disinfectant properties of organic acids such as acetic acid , propionic acid , and butyric acid a component of sweat ( 21)are well known , they are not usually included in reviews of bactericides ( 4 )
. however , in the early part of the 20th century , they were fairly extensively studied for disinfectant properties , as reviewed by reid in 1932 ( 22 ) , and their tuberculocidal activity was evaluated by barker in 1964 ( 23 ) .
it was found that they had broad bactericidal activity that increased with increasing carbon chain length through caprylic acid ( c = 8) , although the longer - chain acids were less soluble .
bactericidal activity was also found to increase with decreasing surface tension of the organic acid solutions and appeared to be due to the undissociated acid rather than the hydrogen ion concentration .
it was therefore suggested that the bactericidal effect might be related to the ability of the acids to pass through the bacterial membrane ( 23 ) .
acetic acid is not very toxic , although prolonged exposure will produce corrosive effects , both on skin and metals . in reports from nearly 100 years ago
, it was found that the topical application of a 1% acetic acid solution in saline cured pseudomonas aeruginosa ( bacillus pyocyaneus ) wound infections ( 24 , 25 ) .
it might be worthwhile testing its effectiveness as a topical agent on mycobacterial ulcers ( 26 , 27 ) .
acetic acid is relatively inexpensive2.5 liters of 99% acetic acid costs less than us$100 and could effectively disinfect up to 20 liters of m. tuberculosis cultures or sputa .
commercial vinegar bought in supermarkets was used wherever possible in the experiments described here , but the concentrations vary from country to country .
commercial vinegar could be used at effective concentrations for m. smegmatis or m. tuberculosis in france , where it is sold as 8% acetic acid , but not in the united states or venezuela , where vinegar is sold as 5% acetic acid . while longer - chain organic acids may have better bactericidal activity , acetic acid ( vinegar )
is relatively nontoxic , inexpensive , and available , which could make it an effective , economical biocide for disinfecting m. tuberculosis from clinical specimens , cultures , and laboratory surfaces , and it would be particularly useful in low - income countries .
the high - level capacity of acetic acid in killing mycobacteria , regarded as the most disinfectant - resistant bacteria due to the structure of their lipid - rich cell walls ( 4 ) , suggests that perhaps it should be revived as a broadly effective bactericide that can be used as a general sanitizer . | abstracteffective and economical mycobactericidal disinfectants are needed to kill both mycobacterium tuberculosis and non - m .
tuberculosis mycobacteria .
we found that acetic acid ( vinegar ) efficiently kills m. tuberculosis after 30 min of exposure to a 6% acetic acid solution .
the activity is not due to ph alone , and propionic acid also appears to be bactericidal .
m. bolletii and m. massiliense nontuberculous mycobacteria were more resistant , although a 30-min exposure to 10% acetic acid resulted in at least a 6-log10 reduction of viable bacteria .
acetic acid ( vinegar ) is an effective mycobactericidal disinfectant that should also be active against most other bacteria .
these findings are consistent with and extend the results of studies performed in the early and mid-20th century on the disinfectant capacity of organic acids.importance mycobacteria are best known for causing tuberculosis and leprosy , but infections with nontuberculous mycobacteria are an increasing problem after surgical or cosmetic procedures or in the lungs of cystic fibrosis and immunosuppressed patients . killing mycobacteria is important because mycobacterium tuberculosis strains can be multidrug resistant and therefore potentially fatal biohazards , and environmental mycobacteria must be thoroughly eliminated from surgical implements and respiratory equipment .
currently used mycobactericidal disinfectants can be toxic , unstable , and expensive .
we fortuitously found that acetic acid kills mycobacteria and then showed that it is an effective mycobactericidal agent , even against the very resistant , clinically important mycobacterium abscessus complex .
vinegar has been used for thousands of years as a common disinfectant , and if it can kill mycobacteria , the most disinfectant - resistant bacteria , it may prove to be a broadly effective , economical biocide with potential usefulness in health care settings and laboratories , especially in resource - poor countries . |
this 34-year - old male patient had an impacted mytilus coruscus shell in the esophagus .
, the patients received a chest ct after contrast enhancement using a toshiba aquillion operating at 120 kvp and 62 mas , with a slice thickness of 3 mm ( fig .
1 ) . this 52-year - old male patient had a fish bone lodged in the espophagus .
prior to fb removal , the patient received a chest ct after contrast enhancement using a siemens navigator operating at 120 kvp and 90 mas , with a slice thickness of 2 mm ( fig .
the axial ct data were saved in dicom file format . to reconstruct the 3d images ,
the outer surfaces of the fb , skin , bones including vertebrae , inner surface of the trachea , and esophagus were drawn in all frames after detection of the outlines .
the 3d images and photographs were compared with respect to the shape and location of each fb in the esophagus .
after rotation of the 3d images , they looked similar in shape and orientation to the photographs of the fbs that had been removed .
this 34-year - old male patient had an impacted mytilus coruscus shell in the esophagus .
, the patients received a chest ct after contrast enhancement using a toshiba aquillion operating at 120 kvp and 62 mas , with a slice thickness of 3 mm ( fig .
the fish bone was removed by open thoracotomy under general anesthesia . prior to fb removal ,
the patient received a chest ct after contrast enhancement using a siemens navigator operating at 120 kvp and 90 mas , with a slice thickness of 2 mm ( fig .
the axial ct data were saved in dicom file format . to reconstruct the 3d images ,
the outer surfaces of the fb , skin , bones including vertebrae , inner surface of the trachea , and esophagus were drawn in all frames after detection of the outlines .
the 3d images and photographs were compared with respect to the shape and location of each fb in the esophagus .
after rotation of the 3d images , they looked similar in shape and orientation to the photographs of the fbs that had been removed .
although the flexible fiberoptic endoscope is a very popular tool for fb extraction , the rigid esophagoscope is equally safe and represents a good tool in the hands of an experienced surgeon .
if endoscopy fails , an open thoracotomy is the method of last resort . in asian countries ,
since fish bones and shells tend to be calcium - rich , they are visible upon routine x - ray examination , if sufficiently large in size .
use of a flexible fiberoptic endoscope can often allow both a definitive diagnosis and extraction of the fb . in the present cases ,
prompt extraction of the rigid and sharp - edged fbs is necessary , since they can cause erosion and laceration of the esophageal mucosa if left untreated .
endoscopic extraction is not risk - free , and problems that arise can demand emergency surgery . rapid knowledge of an esophageal fb , specifically , its composition ( i.e. , hard or soft ) , shape , size , location , and orientation , is vital for a surgeon in tailoring the safest and most effective treatment .
our patients were successfully treated under endoscopy or by thoracotomy with full knowledge about the fb . at the time of the treatment
the 3d reconstructions were made retrospectively , as was the comparison of these image reconstructions with actual photographs .
the time required for making the reconstructed image was less than 30 minutes once the chest ct had been acquired , it took even less time when skilled personnel was involved .
this shows another example of the practical value of ct reconstruction from the clinical point of view .
therefore , while the present data was not instrumental in the treatment of the patients from which the data was drawn , the potential of ct reconstruction for future cases was confirmed . in the case of the shell fb , photographs of the shell that was removed were taken without inclusion of a ruler and the images were distorted due to endoscope angles , so measurements were not possible .
for this fb , the 3d reconstructed images were helpful in determining the shape , size , and the relative location of the shell , and its orientation in the esophagus .
rotation of the 3d images could be performed to mimic the endoscopic images and to be used in simulation of surgical procedures if needed .
as a result , the patient was required to fast for 7 days until a second endoscopy confirmed healing . in this patient ,
real photographs and 3d images were available and were used for comparisons of fb size , location ( in the 3d image only ) , and orientation .
the shape in the 3d images was very similar to that in the real fb photograph .
the 3d image was rotated to match the endoscopic view of the fb ; the accuracy of the result indicates the potential of the approach as a simulation method .
information concerning the distance from a target point to the fb is available with one mouse click .
since ct is calibrated data , the 3d images can always be used for measuring distance .
a 3d reconstructed image from ct data can be converted into a real touchable physical model through rapid prototype ( rp ) technology . before operations for cardiac anomaly or bone - destroying cancer surgery ,
the use of rp can generate a surgical simulation or allow a bone defect to be measured to make implants or flaps .
patients with a vessel anomaly , vascular tumor , or stabbing injury can also benefit from the 3d reconstruction technique .
organs with hollow spaces occupied by fluid or air are the best candidates for virtual endoscopy .
the technique has been adapted in the screening for polyps or other space - occupying lesions of the large intestine .
virtual endoscopy has not been attempted frequently for esophagus procedures , since flexible fiberoptic endoscopy is quick and convenient .
in contrast , virtual esophagoscopy requires pretreatment with a gas - forming formula and motility - decreasing injections that distend the esophageal lumen to allow full examination of the esophagus .
the gas - forming medicine might not be suitable for patients with an esophageal fb because of the danger of leakage of the medicine through damaged esophageal mucosa . until now , virtual endoscopy has not been tried in patients with esophageal fb .
the reconstructions were able to accurately indicate the shape , size , location , and orientation of the fb in the esophagus in two patients .
the type of material comprising an fb can not be determined in the absence of information concerning the ingested material . on the other hand , endoscopy is superior to 3d reconstruction in identifying the composition of an fb . the information in a 3d reconstructed image can be quickly converted into an rp , which can be used to simulate an extraction procedure such as flexible fiberoptic endoscopy or open surgery .
finally , the present ct data was acquired in 2- or 3-mm - thick slices .
use of slices of 1 mm thickness or less would provide finer detail , and the resulting 3d reconstruction would even more realistically mimic the fb . | this study was conducted to investigate the clinical application of three - dimensional ( 3d ) reconstructed computed tomography ( ct ) images in detecting and gaining information on esophageal foreign bodies ( fbs ) .
two patients with esophageal fbs were enrolled for analysis . in both cases ,
3d reconstructed images were compared with the fb that was removed according to the object shape , size , location , and orientation in the esophagus .
the results indicate the usefulness of conversion of ct data to 3d images to help in diagnosis and treatment .
use of 3d images prior to treatment allows for rapid prototyping and surgery simulation . |
patterns of activity from the peripheral sensory receptor arrays can dramatically influence the development of connectivity and functional organization of cortical fields in mammals . in some species ,
evolution in relation to specific environmental cues has nurtured the brain 's blueprint in such a way that a sensory cortex processing specific survival needs has been enlarged over time as compared to other modalities ( figure 1 ) [ 15 ] .
similarly , when a sensory function is lost during development , spared senses compensate by taking more cortical space and recruiting the deafferented areas , to maintain homeostasis of sensory function . this reorganization optimizes and secures the individual 's survival and awareness to future environmental changes .
for example , the loss of sight at birth or during early life in humans leads to important anatomical and functional reorganization of the visually deprived cortex that will become activated by a wide variety of nonvisual stimuli involving touch , audition , and olfaction [ 611 ]
. enhanced spatiotemporal functions in the remaining sensory modalities have also been reported [ 1216 ] .
it seems therefore that the visual cortex of the blind is not lifeless and is capable of adapting in order to accommodate these nonvisual inputs through cross - modal plasticity . but how does a visually deprived cortical area signal its loss of sensory inputs to , or be recruited by , areas of other sensory modalities ?
two main hypotheses have been proposed to explain cross - modal plasticity in a visually deprived brain .
the first hypothesis proposes that early deprived visual cortical circuits can be rewired and/or cross - wired with other modalities following the initial insult [ 1719 ] .
this rewiring stipulates the formation of new and permanent aberrant connections from the sensory receptors of spared modalities to visual thalamic relays and up into the visual cortices .
the second hypothesis stipulates the activation , formation , and/or enhancement of corticocortical connections that involve local connectivity modifications in the deprived cortex as well as physically present but functionally silent connections between sensory cortices that could therefore be activated and/or sprout following a specific sensory loss .
these connections are not yet fully understood but would explain , in part , how the afferents of the remaining modalities could reach the deprived cortex . in order to clarify these hypotheses at the microscale level and to better understand the biological underpinnings of cross - modal plasticity , several early developmental models have been developed in the past four decades .
even if it is now widely accepted that cross - modal plasticity involves important anatomical and functional changes in the neocortex , its cellular mechanisms are still ill - defined .
inhibitory gabaergic interneurons are believed to subserve cross - modal plasticity processes such as in re - establishing homeostasis when the excitation - inhibition balance is perturbed .
for example , gabaergic neuronal activity coordinates the rhythmic behavior of principal ( excitatory ) neurons in the cortical networks .
gabaergic neurons are also critically involved in neuronal growth , fine tuning of sensory receptive fields , visual plasticity , and the formation of critical periods in development .
in addition , gabaergic interneurons especially those expressing calcium - binding proteins like calbindin ( cb ) , calretinin ( cr ) , and particularly parvalbumin ( pv ) have a protracted development reaching their neurochemical and innervation maturity only during early postnatal life making them very sensitive to sensory experience , sensory privation , and noxious environmental changes
. finally , gabaergic interneurons play a pivotal role in gating sensory thalamocortical feed - forward inputs [ 2022 ] , cortico - cortical [ 2325 ] , and corticothalamocortical connectivities between visual cortices which is of prime interest for cross - modal plasticity following an early sensory loss .
further , significant morphological alterations in inhibitory networks are found in animal models of sensory deprivation , early blindness , rewiring , and cross - modal plasticity [ 1 , 2730 ] .
since interneurons play such a significant role in activity - dependent modification of developing sensory circuits , it is thus important to study specific implications of the various gabaergic subpopulations in cross - modal plasticity paradigms . in this paper
we will first discuss general anatomical and functional findings in different animal models of cross - modal plasticity ( in particular hamsters , ferrets , opossum , and mice ) and the effects of loss of sensory function on gabaergic cortical networks .
we will then focus on how aberrations in inhibitory circuitry could explain cross - modal plasticity and briefly discuss future research directions in the field .
thus , the main objective of this paper is to stress out the importance of studying the gabaergic networks in animal models of cross - modal plasticity for future experimental work because information on the possible mechanisms involved is presently lacking .
during development , activity pattern amongst different sensory modalities determines the relative size and organization of its representative subcortical and cortical areas .
the loss or decrease of any one modality leads to the invasion of the deprived cortical area by inputs originating from other modalities , illustrating the remarkable capacity of the cerebral cortex for plasticity resulting in anatomical reorganization , functional and behavioral recovery .
as mentioned before , in blindness , cross - modal changes most probably require or involve rewiring and cross - wiring of cortices .
the remaining modalities could colonize the deprived visual cortex directly through changes at the subcortical level ( modified thalamo - cortical afferences ) and via cortico - cortical connections .
several studies have shown that the total or partial loss of a sensory modality like vision leads to changes in the anatomical and functional organization of the structures associated with the affected sensory input as well as from the spared modalities [ 31 , 32 ] . in the 1970s ,
rebillard et al . reported for the first time that the primary auditory cortex in congenitally deaf cats could be driven by visual or somatosensory stimuli and was later shown also in a congenitally deaf mouse strain .
furthermore , following bilateral lid sutures at birth in kittens it was also found that the neurons in the visual part of the anterior ectosylvian cortex ( aev ) could respond to other modalities [ 35 , 36 ] .
thus , areas normally dedicated to vision could be taken over by neighbouring auditory and somatosensory areas leading to superior performance in localization discrimination tasks relying on these remaining senses .
these changes were attributed to the expansion of the auditory and somatosensory areas to the detriment of extrastriate or associative visual cortices [ 37 , 38 ] .
cross - modal plasticity has also been observed in primary sensory cortices . in rats enucleated at birth
, the primary somatosensory cortex ( s1 ) can recruit the rostral part of primary visual cortex ( v1 ) conferring functional tactile neuronal responses in that area .
these rats showed better exploring skills and higher whisker responsiveness than control siblings [ 39 , 40 ] .
similar anatomical and electrophysiological findings have been reported in early postnatal and adult enucleated mice and rabbits [ 4143 ] .
enucleation at birth or congenital microphthalmia in kittens induces auditory activation of the visual cortex , principally area v1 [ 44 , 45 ] , which has also been shown in hamsters , opossums , and mice [ 4649 ] . in
very low - sighted mammals like the blind mole rat ( spalax ehrenbergi ) , the primary visual thalamic relay , the dorsal lateral geniculate nucleus ( dlgn ) , receives direct atypical subcortical projections from the inferior colliculus ( ic ) which gets its auditory input from the cochlea .
hence , in these animals , an auditory stimulus can activate neurons in both the dlgn and area v1 [ 5153 ] .
when the dlgn - v1 connectivity is preserved in these mice , there is an increase in the thalamo - cortical projections coming from the lateral posterior ( lp ) ( ancestor of the pulvinar in rodents ) and the somatosensory ventroposterior ( vp ) nuclei .
further , there is development of ectopic innervations of the dlgn and the lp by inputs originating in the dorsal column nuclei ( dcn ) of the somatosensory system and the ic [ 5557 ] .
chabot et al . found that an auditory stimulation provoked a strong c - fos response in cells of the dlgn and v1 and to a lesser extent in secondary associative visual cortices ( v2 m and v2l ) in these anophthalmic mutants only , compared to c57bl/6 normal controls and enucleated at birth mice that do not develop aberrant projections between ic and the dlgn [ 46 , 56 ] .
more recently , an elegant study using mice mutants that lacked functional rods ( gnat/ ) , but had normal cone function , reported that cortical connections of v1 in these animals were similar to those of normal siblings , but there were sparse inputs from the auditory cortex ( ac ) to area v1 .
this region also received some abnormal subcortical inputs from the anterior thalamic nuclei , the ventral posterior , the ventral lateral , and the posterior nuclei .
while vision generated from a small number of cones appeared to be sufficient to maintain most of the patterns of normal connectivity , the sparse abnormal thalamic inputs to v1 , existing inputs from ac , and possibly abnormal inputs to lg and lp may be responsible for generating alterations in the functional organization of v1 of these mice . taken together , these studies suggest that developmental timing and age at which sensory loss happens are of prime importance to the strength of rewiring and cross - wiring that occurs in cross - modal plasticity .
these studies also imply that a prenatal period of spontaneous retinal and/or basic postnatal retinal activities may play a role in shaping differences in sensory reorganization in mammals .
this corroborates results obtained in prematurely born animals like hamsters ( e15 ) and opossums ( e13,5 ) in which subcortical reconnections are generally more important .
for example , binocular enucleation at birth in these animals also induces strong auditory responses in the primary visual cortex [ 31 , 47 , 58 , 59 ] . in enucleated hamsters , single cell electrophysiological recordings
have shown that 63% of neurons in the v1 are now responsive to auditory stimulation .
this manipulation leads to the formation of direct new ectopic auditory projections from the ic to the dlgn while the connectivity between this nucleus and the visual cortex remains unchanged ( figures 2(a ) and 2(c ) ) .
these new auditory inputs to the visual thalamus and cortico - cortical connections from a1 are thought to be responsible for the auditory activities found in v1 .
interestingly , reducing or ablating visual thalamo - cortical inputs on the day of birth in normal hamsters significantly increases the number of cortico - cortical projections to v1 arising from both primary nonvisual and associative visual areas in the adult . in enucleated opossums , the cross - modal plasticity and alterations of the subcortical and cortico - cortical afferent circuits are stronger . as a result , in these marsupials , area v1 can now receive ectopic projections from the primary thalamic auditory ( medial geniculate nucleus ( mg ) ) and somatosensory ( ventrobasal nucleus ( vb ) ) relays as well as new inputs from primary auditory ( a1 ) and somatosensory ( s1 ) cortices .
however , no projections between the ic and the dlgn were seen in this model . for comparison purposes ,
a similar enucleation paradigm in the rat reported a reduction in thalamo - cortical afferents from the dlgn to the visual cortex , a significant increase in the projections from the lp to the v1 , and more cortico - thalamic projections between the s1 and the lp in these rats .
as previously mentioned , it is possible for auditory and/or somatosensory information to reach area v1 in blind mammals via modifications of the cortico - cortical connectivity .
several animal studies in the past decade show the existence of direct anatomical connections between the auditory and visual cortices , more particularly in normal - sighted cats and nonhuman primates [ 6266 ] .
long projections relaying the v1 to other primary sensory cortices are found in several mammalian species such as rats , gerbils , hamsters [ 47 , 60 ] , and ferrets .
recently , an indirect pathway between the primary auditory and visual cortices through layer v pyramidal neurons in v2l has been identified in the mouse and can be amplified by enucleation at birth .
the authors suggest that this a1-v2l - v1 pathway may be involved in multisensory processing and contribute to the auditory activation of the occipital cortex in blind rodents .
it is possible that such cortico - cortical connections in normal animals contribute to cross - modal plasticity by being stabilized , reorganized and/or being amplified following any form of sensory loss during development . taken as a whole , studies so far highlight the importance of putative reorganization of subcortical , thalamo - cortical , and cortico - cortical pathways in the blind brain .
cross - modal plasticity changes have also been studied by surgically creating new visual circuits .
schneider pioneered this approach and showed that a lesion of the visual and superficial layers of the superior colliculus ( sc ) at birth in hamsters ( that constantly give birth prematurely at e15 ) could produce ectopic retinal projections , from surviving ganglionic cells to subcortical sensory relays that normally receive small or no visual inputs .
for example , a bilateral lesion of the stratum opticum on postnatal day 1 leads to a fourfold amplification of retinal synapses in the lateral posterior nucleus ( lp ) of the thalamus , which is a secondary associative visual relay connected to the lateral secondary visual cortex ( v2l ) in rodents [ 72 , 73 ] ( figures 2(a ) and 2(b ) ) .
frost ( in hamsters ) and sur ( in ferrets ) were the first to optimize this model and demonstrate that , in combination to the superficial sc lesion at birth , surgically cutting the auditory ( i.e. , the inferior colliculus brachium ) or somatosensory ( i.e. , the medial lemniscus ) afferents could lead to the formation of new robust ectopic retinal projections to the auditory medial geniculate nucleus ( mg ) ( figures 3(a ) , 3(b ) ) or to the somatosensory ventrobasal nucleus ( vb ) , respectively [ 7480 ] . at birth thalamo - cortical projections from primary sensory thalamic relays
have not yet reached the cortical subplate ( this happens at p1 in hamsters and p14 in ferrets ) .
therefore , by using this experimental paradigm one can alter the nature of sensory activity that reaches the primary auditory or somatosensory cortices during development without changing the original thalamo - cortical connectivity .
the new retinal projections inducted in mg or vb are from the three main classical ganglion cell types , form functional synapses , and are retinotopically organized in the host primary auditory ( a1 ( figure 3(c ) ) ) or somatosensory ( s1 ) cortex , respectively [ 7884 ] . nevertheless , the molecular and cellular mechanisms involved in the formation of these new ectopic connexions are still unanswered . in the ferret ,
the morphology of the retinal synapses in the mg are similar to the ones found in the visual cs and dlgn in control animals [ 85 , 86 ] .
further , retinal afferents conserve their visual organization in the auditory relays [ 87 , 88 ] .
although the tonotopic organization of thalamo - cortical projections is preserved between mg and a1 in these rewired ferrets [ 89 , 90 ] , it has been shown that the horizontal network in the auditory cortex as well as its contralateral callosal projections is largely modified and is very similar to those normally found in the v1 [ 91 , 92 ] . in vivo
electrophysiological recordings of single neurons in both the a1 and s1 indicated that these cells have acquired functional receptive field properties of the visual cortex ( i.e. , orientation selectivity , motion and direction sensitivity ) ( see figure 4 ) and some also show a bimodal response [ 83 , 9397 ] . using intrinsic signal optical imaging in the a1 of rewired ferrets ,
visual orientation selectivity columns were found to be similar but broader than those in the v1 of control animals [ 98102 ] .
furthermore , at the behavioral level , these rewired animals can learn visual discrimination tasks and perceive vision with the rewired auditory cortex [ 95 , 103 , 104 ] . rewired hamsters with no visual cortex
can learn visual tasks as well as normal animals , and a lesion of the auditory cortex abolishes this ability and function ( figures 5(a ) and 5(b ) ) .
in fact , rewired hamsters with auditory cortex lesions exhibit cortical blindness similar to nonrewired hamsters with visual cortex ablations .
overall these results involving intermodal rewiring in neonatal hamsters and ferrets show that sensory information via subcortical thalamic afferents play an important role in shaping anatomical and functional specifications of primary sensory cortices .
this suggests that the type of sensory activity and experience can plays an important role in forging parts of the neuroarchitecture of the hosting cortex [ 1 , 4 , 105 , 106 ] .
observations in a variety of species suggest that each of these domains could already be subjected to influences from other senses in normally reared animals .
the first evidence was found in the early 1970s where a study , contested at the time , showed that auditory stimuli could elicit neuronal activity in primary ( area 17 ) and secondary ( area 18 ) visual cortices of normal cats .
more recently , transitional multisensory zones of multimodal responsive neurons have been reported at the border of the primary visual cortex in rats .
other recent electrophysiological studies in cats , ferrets , and monkeys have highlighted a low - level influence of other sensory modalities on auditory areas including a1 [ 69 , 109 , 110 ] .
these results suggest the possible existence of an important multisensory convergence , occurring at low hierarchical levels , of sensory cortical areas involving feedback , feedforward and lateral cortico - cortical connections and also subcortical inputs . this way a sensory area processing one particular modality could have access , simultaneously , to other unimodal and polymodal sensory information [ 18 , 111 ] . for example
, it is possible that in visually deprived animals or blind humans these putative interactions are modified to permit a greater recruitment of the primary visual cortex by the spared modalities . at this point
we can assert that cross - modal plasticity that occurs following an early sensory function loss involves important rewiring and cross - wiring processes .
however , the question of how thalamo- and cortico- cortical plastic changes , as well as new multisensory integrations , are taking place remains unresolved .
a possibly significant mechanism may involve the cortical inhibitory ( or gabaergic ) interneurons since they are important for visual cortex plasticity and for refinement of sensory information reaching the cortex .
the neocortex contains mainly two neuronal types , excitatory ( glutamatergic ) pyramidal cells and inhibitory nonpyramidal ( gabaergic ) neurons .
inhibitory interneurons include a vast array of subtypes that vary in morphological , physiological , and neurochemical characteristics ( e.g. , calcium - binding proteins , neuropeptides , ion channels , receptors , and transporters ) .
further , they target their synapses onto distinct subcellular locations at the postsynaptic level [ 112115 ] . in the cortex , different gabaergic
interneuron subtypes were originally classified by expression of calcium - binding proteins parvalbumin ( pv ) , calbindin ( cb ) , or calretinin ( cr ) .
recently , a more accurate classification through expression of several neuropeptides suggests that most inhibitory interneurons in the cortex can be classified in three largely independent populations expressing pv , cb / somatostatin ( ss ) , and cr / vasointestinal peptide ( vip ) [ 112 , 113 , 115 , 116 ] .
exactly how many specific interneuron subtypes actually exist in the cortices of different species [ 112 , 117119 ] is still a matter of debate .
inhibition is critical to a wide range of brain processes specifically in network oscillations and synchronisation , synaptic plasticity , and in preventing runaway excitation .
in addition , gabaergic interneurons also regulate nearly all key developmental steps in the cortex , from neuronal proliferation , migration , and differentiation to experience - dependent refinement of local cortical circuits . as a result
, disturbances in inhibitory circuits have been involved in a number of neurological disorders , such as epilepsy , schizophrenia , autism , anxiety disorders , and alzheimer 's disease [ 116 , 120 , 121 ]
interneurons play an essential role in refining sensory receptive fields as well as in confining and modulating sensory afferent activity to sensory cortices . for example , in the visual cortex they shape spacing between cortical columns and strongly influence ocular dominance plasticity [ 2022 , 122128 ] .
the large diversity of interneurons suggests that individual inhibitory classes may have unique roles in arbitrating the balance between excitation and inhibition in cortical circuits and plasticity .
development of gabaergic circuits is a prolonged process that begins during midgestation and is complete only by the end of adolescence [ 114 , 116 ] .
pv - positive cells represent the largest subgroup of the gabaergic population in sensory neocortices . amongst inhibitory neurons in the cortex ,
the pv subtype is the last to mature in rodents , human and nonhuman primates .
the prolonged development of interneurons may constitute a sensitive period where environmental changes can lead to permanent alterations in the inhibitory circuitry .
considering the numerous roles played by gabaergic interneurons in the development , function , and plasticity of cortical networks , combined with their late maturation in the postnatal life , it is reasonable to hypothesize that they could be a key component in gating cross - modal plasticity processes following early sensory deprivation .
we will discuss several lines of evidence that stress their possible implication in this context .
a large number of studies show that the expression of calcium - binding proteins ( cbps ) in cortical gabaergic interneurons can be altered significantly in different sensory areas , olfactory bulb , and in the hippocampus following modifications to the afferent sensory input [ 130138 ] .
for example , deafferentation of the primary auditory cortex in ferret at p14 ( two weeks before auditory capability ) by bilateral ablation of the cochlea causes a reduction in the density of neurons immunoreactive ( ir ) for gaba , pv , and cb .
ibotenic acid lesions of thalamic afferents from the somatosensory ventroposterior nucleus delay the development of pv and cb interneurons in the rat barrel cortex .
more precisely the visual cortex has mostly been studied in rodents , carnivores , and nonhuman primates in that context .
dark rearing , retinal lesions , ttx intraocular injections , mutated loss of photoreceptors in the retinae during development , visual deprivation by eye lid sutures or enucleation have all been shown to modify the expression of the different cbps ( pv , cb , and cr ) [ 140146 ] .
this was shown for the first time in rats where a monocular enucleation , performed before the critical period at p14 , could induce a significant decrease in pv expression in interneurons in the contralateral binocular zone of the primary visual cortex ( v1 ) [ 142 , 147 ] .
the authors had postulated an important role for pv - expressing interneurons in ocular dominance plasticity in this paper .
similar results were also found in the primary visual cortex of adult macaques , wherein following monocular inactivation by intraocular injection of ttx , both pv and cb but not cr were affected in ocular dominance columns associated with the deprived eye .
more specifically , in these columns there was significant decrease in the number of neurons , as well as neuropil expressing pv and cb in cortical layers iv to vi and ii / iii , respectively .
the main finding was the varying density of perineuronal nets expressing these neurochemical markers between layers
ii / iii and v [ 140 , 143 ] . in experiments using dark - reared mice , a decrease in the expression of pv but not cb and cr mrna levels
further studies done in cats show that following dark rearing from birth there is a significant decrease in the total number of cells expressing pv and cr but not cb in areas 17 and 18 .
long - term monocular deprivation in rats decreases the expression of cb but not cr and pv in primary visual cortex , suggesting that the cbps - ir neuronal subpopulations may be differently affected by the various types of visual deprivation paradigms .
more recently , distribution of pv - ir and cb - ir interneurons was studied in the primary visual cortex of crx/ mice , where photoreceptors lack outer segments resulting in the complete absence of vision from birth as compared to c57bl/6 controls . in crx mutants , there is significant decrease in pv in all layers and of cb only in layers ii / iii of the primary visual cortex .
developmental results in these mutant mice further suggest that pv expression requires visual activity in v1 . in hamsters a lesion of the stratum opticum layer of the sc at birth
leads to the death of ~70% of the primary retinal projections to the dlgn - v1 pathway and a fourfold increase in the remaining afferents to the lateral posterior nucleus ( lp)-v2l route .
interestingly , in these animals we found changes in the number of pv- and cb- immunoreactive neurons in v1 and v2l as compared to intact hamsters .
more precisely , these two populations of neurons were decreased in layer v of v1 , but pv interneurons were significantly increased in layer v of v2l in sc - lesioned animals ( figure 6(c ) ) .
these results suggest that the decline in visual activity influences pv and cb expressions only in layer v of area v1 whereas the increase of pv - ir cells in layer v of v2l may be correlated with the nurturing presence of new ectopic retinal projections in lp .
overall , these studies support the idea that different subpopulations of gabaergic neurons are differently influenced by sensory activity depending on their specific anatomical localisation ( cortical areas , layers , and modules ) and intrinsic cellular properties .
it is therefore important to assess the precise function of each specific subtype of interneurons .
however , in these experiments , it is not always clear whether the alterations are caused by reduced gaba , pv , cr , and cb immunoreactivity / expression in intact interneurons or by an overall reduction of the gabaergic interneuron population . furthermore , it is still not clear so far about how the neurochemical identity of a specific interneuron relates to its function .
several recent studies in the visual system suggest that an adequate development and function of gabaergic interneurons in the v1 are critical for controlling the onset and time course of critical periods and for the establishment of the cortical circuit architecture that is necessary for the occurrence of ocular dominance ( od ) plasticity [ 128 , 150153 ] .
this was demonstrated for the first time by hensch et al . where knockout mice , lacking glutamic acid decarboxylase 65 ( gad65 , the synaptic isoform of gaba - producing enzyme ) , showed no closure of the critical period and thus no occurrence of od plasticity .
nonetheless , this shortage was rescued by cortical infusion of the gaba agonist diazepam ( dz ) .
conversely , augmenting inhibitory signaling prematurely launches the critical period making the mice insensitive to monocular deprivation , as is normally the case in the adult mouse [ 150 , 154 , 155 ] . gaba transmission mediated by the 1 subunit containing gaba - a receptors has been shown to be mandatory for the induction of the critical period for od plasticity [ 155 , 156 ] . in parallel , the precocious development of inhibitory circuitry via exposure to brain derived neurotrophic factor ( bdnf ) in rodents accelerates the maturation of pv interneurons and triggers early onset of the critical period for visual plasticity [ 153 , 157 , 158 ] .
using kittens and the monocular eye lid suture paradigm , stryker and collaborators have shown that muscimol - induced blockade in v1 causes inversion of od plasticity , resulting in a consistent shift in the responsiveness of this cortex in favour of the less - active closed eye [ 159 , 160 ] . more recently , in similar conditions but using normal sighted cats it was found that infusion of dz on top of v1 resulted in a widening of ocular dominance column spacing , while reducing inhibition shortened the distance between columns .
in the adult visual system of the rat , ocular dominance plasticity is greatly reduced but can be restored to juvenile levels by suppressing inhibition with the antidepressant fluoxetine . indeed , directly attenuating gaba release by a gad inhibitor reinstates od plasticity in adult rats .
this is also true for environmental enrichment in old age where diazepam infusion averts the reduction in od plasticity .
more recently , it has been shown by maffei and collaborators that , in layer iv of binocular v1 in rats , depression of inhibitory synapses on pyramidal neurons is induced when these animals are monocularly deprived for 2 days at the end of the third postnatal week ( i.e. , before the critical period ) , whereas potentiation is induced if the monocular deprivation is started in the fourth postnatal week ( i.e. , within the critical period ) . during development , these two forms of plasticity shift the balance between circuit excitation and inhibition while the excitatory synaptic drive remains unaffected .
thus , inhibitory plasticity seems to be fundamental in modulating cortical circuit refinement and might be one of the key mechanisms promoting ocular dominance shifts
. such dynamic adjustment of the excitation - inhibition balance may allow the networks to maintain stable levels of activity in the face of variable sensory input .
others suggests that inhibition mediated specifically by fast - spiking ( fs ) basket - like ( pv positive ) and regular spiking nonpyramidal ( rsnp ) ( cb or ss positive ) interneurons is critically involved in plasticity following deprivation or deafferentation - induced degradation of visual function in v1 of rodents .
these effects may however depend upon the age and nature of the visual deprivation and might be differentially regulated across specific cortical layers in the primary visual cortex .
taken as a whole , these studies suggest that maturation of specific subclasses of gaba interneurons is crucial in initiating critical period plasticity , shaping thalamo - cortical afferents , and modulating experience - dependent plasticity in the visual cortex .
although great progress has been made towards understanding both the process of postnatal maturation of excitatory networks and the mechanisms underlying activity - dependent plasticity of excitatory synapses in principal neurons , an understanding of the maturation of inhibitory ( gabaergic ) circuits has emerged only recently .
while the first steps of the development and migration of gabaergic interneurons are likely coordinated by genetic programs , the maturation of these neurons and their synapses are strongly modulated by afferent neuronal activity and experience in both visual and somatosensory cortices .
monocular enucleation or dark rearing exposures in rats have been shown to decrease the number of cells and terminals containing gaba and glutamic acid decarboxylase ( gad ) [ 130 , 171 ] .
similar groundbreaking results were also found in the somatosensory cortex , where the unilateral resection of whiskers one day after birth induces a 50% decrease in gabaergic neurons and synapses in layer iv , in the deprived barrels .
conversely and even in the adult brain , mice that undergo excessive stimulation of a single whisker for 24 hours have an increase of inhibitory synapses on dendrites of principal cells in the corresponding barrel . in adult primates , eliminating retinal activity by an intraocular administration of tetrodotoxin ( ttx ) reduces the immunoreactivity for gaba , gad , and the gaba - a receptor in neurons in the areas corresponding to the injected eye in v1 [ 146 , 174176 ] .
more recently , morales et al . have shown that between the time at which the eyes first open and the end of the critical period for experience - dependent plasticity , the total gabaergic input converging onto pyramidal cells increases threefold in rats .
a developmental increase in gabaergic input can be prevented in animals deprived of light since birth , but not in animals deprived of light after a period of normal experience .
thus , sensory experience appears to play a permissive role in the maturation of intracortical gabaergic circuits . in the past decade
genetic strategies based on interneuron cell type specific promoters and fluorescent protein reporters have allowed more efficient high - resolution labelling of specific gabaergic interneurons and associated morphology . by using these approaches direct experimental evidence
was found linking structural and functional changes of specific inhibitory networks with their sensory experiences in vivo and in vitro . a significant study in this context from chattopadhyaya et al . showed that sensory input deprivation using intraocular injections of ttx in mice , and in postnatal organotypic cultures , causes a reduction in the density of perisomatic synapses formed by basket gabaergic neurons in the visual cortex .
this sensitivity was restricted to a critical time window during the third postnatal week in mice which correlates with the time course of the critical period for ocular dominance plasticity .
these results are consistent with studies done in the barrel cortex in mice that underwent whisker removal from the left mystacial pad at neonatal day 7 , until day 15 [ 134 , 138 , 179 ] .
these experiments using glutamate acid decarboxylase 67 ( gad67)-green fluorescent protein ( gfp ) ( delta neo ) and wild - type mice showed specific structural anatomical changes , illustrated by a reduction in the number of presynaptic perisomatic inhibitory boutons , specifically from pv interneurons . these changes were associated again with a lack of sensory experience during the second and the third postnatal week .
however , the total number of gfp - gad67 cells ( i.e. , total number of gabaergic cells ) remained unchanged indicating that these changes in pv expression from basket cells appeared to be the major effect of sensory deprivation .
moreover , these modifications were associated with a reduction in the amplitude of evoked intracortical inhibitory synaptic potentials in patch - clamp recordings in deprived versus spared cortices .
these results indicate that perisomatic inhibition mediated by pv - positive basket cells was pruned by sensory deprivation .
more recently , jiao and collaborators , using a line of mutant mice that lack activity - dependent bdnf expression ( bdnf - kiv ) , have shown that experience regulates the cortical gabaergic network via activity - driven bdnf expression of principal neurons .
levels of endogenous bdnf protein in the barrel cortex are strongly regulated by sensory inputs from the whiskers . moreover ,
the mutant barrel cortex exhibits significantly reduced levels of gaba release only from the pv - expressing fast - spiking ( fs ) interneurons .
postnatal deprivation of sensory inputs markedly decreases perisomatic inhibition selectively from fs cells in wild - type but not bdnf - kiv mice .
these results suggest that postnatal experience , through sensory - driven bdnf expression , controls cortical development by regulating fs cell - mediated perisomatic inhibition in vivo .
this further highlights that pv ( fs ) networks can selectively be inhibited by sensory deprivation from the thalamo - cortical afferent pathway .
together , these results suggest that the properties of local cortical inhibitory network are modified by sensory experience . thus , postnatal sensory activity is necessary for transformation of immature inhibitory transmission to a mature functional phenotype .
nevertheless , precisely how activity and molecular - driven mechanisms work together to accomplish the remarkable specificity of gabaergic synapse maturation , localization , and formation is not fully understood but is emerging .
several molecular factors have also been implicated in the process such as bdnf , gaba itself , otx2 homeoprotein , molecular components of the extracellular matrix , and cell adhesion molecules ( e.g. , chondroitin sulfate proteoglycans ( cspgs ) , polysialic acid ( psa ) , and the neural cell adhesion molecule ( ncam ) ) .
for example , in mouse visual cortex , psa is downregulated following eye opening and this decrease has been shown to allow the maturation of gabaergic synapses and the opening , of the critical period for ocular dominance plasticity . for more exhaustive reviews on this topic
very few studies have looked at the possible role of gabaergic interneurons in cross - modal plasticity .
alterations in inhibitory circuits were observed qualitatively for the first time in deaf and rewired cross - modal ferrets and concerned modifications in the morphology and proportion of interneurons containing pv and cb .
specifically , cb neurons in a1 of these animals showed an atypical and extended dendritic arborisation in the horizontal axis .
however these changes were never studied further with quantitative validation [ 1 , 105 ] .
interestingly , a recent study done in fvb ( gad - gfp ) mice has shown that olfactory deprivation occurring at p12 can lower the number of gabaergic interneurons in the piriform cortex and at the same time increase their number in the barrel cortex , ipsilateral to the lesion , upregulating whisker tactile sensation .
recent work carried out in our laboratory , on hamsters enucleated at birth ( eh ) , follows the idea that observed cross - modal plasticity changes may be due to modifications in gabaergic interneurons that express calcium - binding proteins ( cbps ) like pv and cb [ 29 , 30 ] . since the laminar distribution of these proteins is significantly different in the primary visual and auditory cortices of normal hamsters , the induction of aberrant connectivity to these cortices should also be evident at the neurochemical level .
indeed , hamsters enucleated at birth show significant changes in the distribution of cbps only in their primary visual cortex .
compared to intact hamsters , the density of pv - immunoreactive neurons is higher in layer iv and lower in layer v , whereas the density of cb - immunoreactive cells is significantly lower in layer v of v1 in the enucleated animals ( see figures 6(a ) and 6(b ) ) .
these results suggest that the affected primary visual cortex may adopt the gabaergic chemical features of the auditory cortex through cross - modal rewiring .
as described earlier , sensory deprivation generally reduces the expression of pv in primary sensory cortices .
normally , visual activity is an essential requirement in preventing a robust downregulation of pv expression , mainly in cortical layer iv .
the functional implications of this decrease , following sensory deprivation in several animal models , have been associated with a reduced inhibition following loss of sight .
one can therefore expect a general decrease in pv expression in the v1 of enucleated hamsters , with possible stronger effects in the thalamorecipient cortical layer iv . in crx/
mutant mice , there is a significant decrease of pv - ir cells in all layers of the primary visual cortex .
this contrasts with the increase in the number of pv - ir cells in layer iv and the decrease observed in layer v of enucleated hamsters .
the decrease in pv - ir in mutant mice suggests that parvalbumin expression requires visual activity in v1 .
there is clearly no visual activity during postnatal development in enucleated hamsters whereas in crx/ mice , even with photoreceptors lacking outer segments , there remain waves of spontaneous retinal ganglion cell activity transmitted to the thalamus and cortex before p14 .
it could therefore be expected that , in enucleated hamsters , one would find an even greater decrease of pv - ir cells in all cortical layers of the v1 as with these mice , but except for layer v this was not the case .
significant reduction of expression of both pv and cb in interneurons of layer v of v1 in enucleated hamsters may imply changes in an alternate pathway for cortico - cortical communication between the primary visual cortex and neighbouring - associated areas .
guillery and sherman proposed that the driving of cortico - cortical projections is mediated by layer v pyramidal neurons that project to the pulvinar of the thalamus ( or lateral posterior nucleus ( lp ) in rodents ) , which in turn provides the output to higher cortical areas ( i.e. , the feedforward corticothalamocortical pathway ) [ 187 , 188 ] .
dysfunction of inhibitory interneurons of layer v could play a pivotal role in gating this alternative process and corticocortical communications .
it is however unknown as to whether the observed changes in pv and cb expression in interneurons within layer v of eh are directly involved in cortico - cortical networks .
in fact , changes in the number of pv - ir and cb - ir neurons in enucleated hamsters might reflect laminar - specific increase and/or decrease of the synaptic drive on these particular neurons in layer iv and v of v1 after enucleation at birth .
changes in immunoreactive interneurons might reflect two phenomena : ( 1 ) a true change in the number / density of pv or cb immunoreactive neurons ( e.g. , via apoptosis / neurogenesis , impaired migration , suppressed cell proliferation , etc . ) or ( 2 ) altered immunocytochemical detection levels of the proteins pv or cb , respectively , whose cellular expression might be positively correlated to physiological activity levels [ 134 , 138 , 143 , 145 , 189191 ] . because we did not find any differences in the total population densities for these two proteins , we favour the interpretation that pv and cb expression ( changes in synthesis or degradation ) in layer iv and v of v1 is altered in eh and that the altered protein levels may be related to the activity of these inhibitory interneurons .
however , due to limited knowledge of the physiological function of cbp proteins , the interpretation of the physiological consequences of this early enucleation is complicated .
furthermore , the causal relationship between our anatomical findings and the putative role of these cells in cross - modal plasticity in this animal model remains exploratory .
the observed changes in eh could be explained not only by the absence of postnatal visual input to the v1 but also by the presence of auditory information reaching v1 from new ectopic projections arising from the ic to the dlgn of the thalamus in this rewired model .
we hypothesize that these specific changes in the laminar distribution of mostly pv - ir but also cb - ir neurons in v1 could be responsible for shaping auditory response properties of v1 neurons previously observed in enucleated hamsters .
the new auditory thalamic afferents into the visual system of the enucleated hamsters could explain the auditory cortex - like distribution pattern of pv - ir neurons in the primary visual cortex .
noteworthy is recent work by sugiyama et al . which led to the discovery of a novel mechanism explaining how visual input is tied to the onset of ocular dominance plasticity in the visual cortex .
this group has shown that a retinal - derived homeoprotein , otx2 , can be directly transferred into v1 through a visual - experience - dependent mechanism .
once otx 2 has reached the visual cortex , it can nurture specific types of gabaergic interneurons ( viz .
pv neurons ) and modulate critical period plasticity [ 22 , 151 , 185 , 192 , 193 ] . the study of target genes and proteins of otx2 could reveal further insights into the machinery linking sensory experience , gabaergic circuit maturation , and plasticity .
it is that , as yet unknown homologues of otx2 might be delivered from other sensory receptor arrays and pathways to precise cortical areas , to promote local inhibitory circuit maturation depending on modality type . in hamsters
enucleated at birth , for example , such a molecular factor coming from the auditory system but redirected to the primary visual cortex by the cochlea - ic - dlgn pathway could lead to modality - specific changes observed in circuits in absence of visually driven otx2 but in presence of an auditory homologue .
this might explain the altered auditory - like distribution of pv - ir neurons we observed therein [ 29 , 30 ] .
however , the absence of spontaneous electrical activity in the retinal afferents to the lateral geniculate nucleus and the lack of trophic influences of the retina on neurons in the dlgn and from there to area v1 could also be involved in the changes observed in our animal model .
it may also be that other sensory modalities , such as somatosensory inputs , could induce the same changes .
injections of hrp into the dorsal column nuclei of adult mice enucleated at birth have shown that ascending somatic sensory axons can be rerouted to the lateral geniculate nucleus .
even if this type of connection has not yet been reported in early enucleated hamsters , any combination of these factors , in addition to abnormal auditory rewired inputs to v1 in these animals , could account for the present modifications in the anatomy and laminar circuitry of the v1 .
in conclusion , several animal studies have revealed important properties of inhibitory network alterations in the neocortex following the early loss of a given sensory function .
we are just beginning to acquire the necessary knowledge on response properties of gabaergic neurons , their maturation mechanisms , and how they influence sensory and cross - modal plasticity .
hence , we have uncovered only the tip of a very large iceberg in that context .
visual and other sensory cortical circuits are organized at multiple levels of complexity including cortical areas , layers and columns , and specific cell types within these modules . making sense of the functions of these circuits , from an anatomical point of view , requires linking these circuits to function at each of these levels of complexity .
functional studies on cross - modal plasticity in animals have previously been limited to pharmacological approaches , electrophysiology , tracing or lesion researches that provide poor cell - type specificity and sometimes low - spatial or temporal resolutions .
nowadays , advancements in molecular techniques have made it possible to address questions that were unapproachable just a decade ago .
as new methods for single cell two - photon imaging , voltage sensitive dyes for cortical optical imaging , transneuronal viral tracing , in vivo mri spectroscopy ( mrs ) , laser microdissection , transfection and genetic targeting of specific subpopulations of inhibitory interneurons are perfected , we will certainly one day be able to highlight and incorporate better the roles of subtype of gabaergic neurons into multifaceted animal models of cross - modal plasticity .
more specifically , one interesting approach concerning this issue would be to use optogenetic in transgenic mouse strains for activation or inhibition of specific gabaergic subpopulations using a viral - mediated transfer of a cre / loxp transgene controlling the expression of light - activated ion channels in these cells in vivo or in vitro ( e.g. , channelrhodopsin chr and halorhodopsins enphr ) .
for example , these would allow us to dissect the function of different neuronal class during awakening behavior or electrophysiology , sensory stimulation , and discrimination tasks with a millisecond resolution .
experiments using these techniques will help us to understand more clearly some important questions in the field : how specific gabaergic subpopulations participate in the rewiring / cross - wiring processes between cortical modalities , what would be the effects of shutting down one population type on cross - modal integration , how these interneurons could integrate inputs from spared modalities , what are the possible multimodal versus unimodal receptive field properties in these cells in normal and sensory deprived cortices , what are the effects on neuronal plasticity as well as neighbouring neuronal networks , are there modality - specific biomarkers that could travel from the sensory receptor periphery to these cortical neurons via a modality experience - dependent - mechanism , and what are the cortical network dynamics between excitatory and inhibitory synapses in vivo following the early - life lost of sight ?
it is going to be a long ride , and experiments to tackle these issues will be very challenging technically .
nevertheless , the clarification of these underlying mechanisms may one day provide clues to develop new therapeutic advances aimed to increase adaptive circuit rewiring following insult to help sensory substitution and recovery . | early loss of a given sensory input in mammals causes anatomical and functional modifications in the brain via a process called cross - modal plasticity . in the past four decades , several animal models have illuminated our understanding of the biological substrates involved in cross - modal plasticity .
progressively , studies are now starting to emphasise on cell - specific mechanisms that may be responsible for this intermodal sensory plasticity .
inhibitory interneurons expressing -aminobutyric acid ( gaba ) play an important role in maintaining the appropriate dynamic range of cortical excitation , in critical periods of developmental plasticity , in receptive field refinement , and in treatment of sensory information reaching the cerebral cortex .
the diverse interneuron population is very sensitive to sensory experience during development .
gabaergic neurons are therefore well suited to act as a gate for mediating cross - modal plasticity .
this paper attempts to highlight the links between early sensory deprivation , cortical gabaergic interneuron alterations , and cross - modal plasticity , discuss its implications , and further provide insights for future research in the field . |
these diseases cause considerable morbidity and increase the risk of transmission of human immunodeficiency virus infection .
the main aims of sti control program are to interrupt the transmission of infection and to prevent the development of complications and sequelae .
while the interruption of transmission is addressed largely through campaigns promoting risk - reduction behavior and condom usage , the prevention of complications and sequelae is tackled through provision of health - care services to detect and treat stis as early as possible .
timely treatment of sti is secondary prevention for that particular patient and primary prevention for other members of the community .
health - care behavior includes healthcare - seeking behavior of the patient and behavior of the health - care provider .
healthcare - seeking delays focus on the time elapsed from infection to initial contact with the health - care provider who makes the diagnosis and recommends therapy . the quality of sti services varies between health sectors and type of providers . seeking treatment from providers who give effective care not only cures the sti but also reduces transmission of current and future infections if people follow risk reduction and prevention messages .
the health services - related issues include availability of other systems of medicine , perceived poor quality of care , accessibility , cost , stigmatization , lack of privacy , and confidentiality .
the importance of improving the accessibility and quality of health services related to stis and promoting appropriate health - seeking behavior has been recognized in industrialized countries and is equally important in developing countries .
insights into the factors that make people decide why , when , and where to seek care can improve the programs that focus on sti control . hence , we decided to study where the patients sought treatment before attending our institution , the appropriateness of that treatment , and the health services - related issues preventing them from seeking treatment from a government health facility .
sti patients attending the department of dermatology and venereology of a tertiary care center in south kerala were studied for6months after getting written informed consent .
hospital - based , cross - sectional descriptive type of study design was used . semi - structured questionnaire with both close- and open - ended questions was used to collect data .
the broad domains under which the details were recorded were sociodemographic characteristics , clinical characteristics , treatment - seeking behavior , details of health facilities visited before visiting our center , appropriateness of treatment , and health services - related issues .
inappropriate treatment - seeking behavior of the patient was defined as seeking treatment from sources other than modern medicine health facility .
the treatment received from the first point of contact was considered appropriate if it was in accordance with the national aids control organization / world health organization guidelines .
details regarding the risk - reduction messages and condom - promotion messages advocated by the first point of contact were also recorded .
eighty - five symptomatic sti patients who attended a tertiary care center in south kerala were studied for6 months regarding their healthcare - seeking behavior , the choice of health facility , the behavior of the health - care provider , and the concerns of the patient regarding the services from public sector . among the 85 patients , 47 ( 55.3% ) were males and 38 ( 44.7% ) were females .
majority of the males and females were from rural areas ( 94.1% ) , belonged to 2029 age group ( 48.2% ) , married ( 70.5% ) , with high school level of education ( 65.9% ) , and had monthly income less than rs .
herpes genitalis ( 34.1% ) , condylomata acuminata ( 20% ) , syphilis ( 17.6% ) , nongonococcal urethritis ( 12.9% ) , gonorrhea ( 10.5% ) , chancroid ( 2.3% ) , and trichomoniasis ( 2.3% ) were the stis in the decreasing order of frequency .
sociodemographic characteristics about 32.9% ( 28 ) of patients had inappropriate treatment - seeking behavior . 14 ( 29.8% ) males and 14 ( 36.8% ) females had inappropriate treatment - seeking behavior .
majority of the males ( 50% ) tried left over medicines to cure themselves , whereas majority of the females ( 35.7% ) sought the help of ayurvedic doctors [ table 2 ] .
nineteen ( 40.4% ) males and 7 ( 18.4% ) females came directly to our tertiary care center for treatment . excluding the patients who directly visited us ,
appropriate treatment - seeking behavior was seen in 59.6% ( 28 ) males and 81.6% ( 31 ) females .
government sector was the choice of treatment for 46.4% ( 13 ) males and 93.5% ( 29 ) females .
the difference between males and females in the choice of health sector was statistically significant ( p-0.00018 ) . among the 28 male patients , 18 ( 64.2% ) took treatment from general practitioners , 5 ( 17.9% ) from specialists , and 5 ( 17.9% ) from both .
surgeons , physicians , and urologists were the specialists from whom the male patients sought treatment . among 31 female patients , 15 ( 48.4% ) took treatment from general practitioners , 9 ( 29% ) from specialist , and 7 ( 22.6% ) from both .
the reasons for taking treatment from the chosen health facility are given in table 3 .
the number of health facilities attended prior to attending our center ranged from 1 to 6 for males and 13 for females .
nearly 28.6% ( 8) males and 32.3% ( 10 ) females had attended more than one health facility before visiting us [ table 4 ] .
reasons for seeking treatment number of health facilities visited among the patients who sought appropriate treatment , only 2 ( 7.1% ) males received appropriate treatment , 2 ( 7.1% ) were referred to higher centers where sti services were available , and the remaining 24 ( 85.7% ) received inappropriate treatment . only one ( 3.2% )
fifteen ( 48.4% ) were referred to higher centers , where sti services wereavailable and the remaining 15 ( 48.4% ) received inappropriate treatment .
all the three patients ( two males and one female ) who received appropriate treatment had herpes genitalis .
none of the patients received risk reduction messages and condom promotion messages from either the government sector or private sector .
many patients had multiple concerns about the government health facility . for majority of the male patients ( 66.7% ) ,
geographical access was a problem in seeking treatment from a government health - care facility followed by economic constraints ( 47.1% ) , lack of privacy ( 47.1% ) , lack of free medicine ( 47.1% ) , and lack of confidentiality ( 25.5% ) .
the concerns and problems for females were geographical access ( 85.7% ) , economic constraints ( 78.6% ) , lack of free medicine 71.4% lack of privacy ( 66.7% ) , and lack of confidentiality ( 11.9% ) .
the sti patients who attended the tertiary care centerfor6months were studied regarding their choice of health - care facility before attending our center , the appropriateness of treatment received and their concerns regarding services from the government health - care facility .
the majority of the males and females were from rural areas , belonged to 2029 age group , were married , with high school level of education , and belonged to the lower income group .
this was similar to the report from zambia and kenya where the proportion of patients who sought inappropriate treatment ranged from 23.7% to 30% .
females predominated in inappropriate treatment practices before visiting a modern medicine health facility ( 36.8% vs. 29.8% ) .
although the proportion of males and females resorting to treatment from theinformal sector was less in nairobi ( 13% of males and 16% of females ) , there was a predominance of females like in ours .
this observation of ours was contradictory to the kenyan study where men resorted to treatment from informal sector more than females , 32.7% and 16.1 , respectively .
the informal sector included pharmacists , traditional practitioners , drug peddlers , family members , ayurvedic practitioners , and homeopathic practitioners .
a traditional healer was consulted only by one male patient ( 7.1% ) in this study and was similar to kenyan study were 6.1% visited traditional healers .
traditional healer was the choice of 14.9% of patients in zambia and 56% of sti patients in uttarakhand .
this inappropriate treatment may be due to many factors such as stigma , shame , guilt , lack of easy accessibility to treatment care facilities , lack of knowledge regarding stis , lack of self - efficacy , perceived seriousness , and lack of support from family .
government sector was the choice of treatment for 49.4% of patients ( 46.4% males and 93.5% females ) . in zambia ,
69.3% sought care at public health facility and 15.8% from private facility and similar to our study females preferred government sector facility ( 59.6% males vs. 79.6% females ) .
about 37.7% of the patients sought treatment from public - sector health facilities ( 26.9% men and 46.8% women ) and 38.6% preferred private clinics ( 40.4% men and 37.1% women ) in kenya .
contrary to our findings and reports from zambia and kenya , majority sought treatment from private sector ( 72% men and 57% women ) in nairobi .
about 28.6% of males and 32.3% of females had attended more than one health facility before visiting us which was high when compared to nairobi where 13% of malesand 18% of females had attended more than one health facility .
the reasons cited for not seeking care from public facilities were similar to that reported from literature such as lack of privacy , lack of drugs , long waiting time , and insistence on bringing the sex partner .
sexual contact after the onset of symptoms was seen in 55.3% of patients and consistent condom usage was seen in none .
this was similar to zambian patients were 57% reported sex after the onset of symptoms and consistent condom use was reported in only 15% .
treatment failure at the first point of contact was evident as majority of our patients were referred from other peripheral centers although some patients came directly without reference .
although appropriate treatment - seeking behavior was there in all the patients ( 69.4% ) who visited other center 's before visiting our center , the fact that they came to us indicate some form of treatment failure .
the proportion of patients attending more than one health facility was also high . among them , only 7.1% of males and 3.2% of females received appropriate treatment .
this is a matter of grave concern as inadequate treatment or lack of treatment at the first point of contact with the health system inevitably increases the length of time during which individuals remain infectious providing more opportunities for transmission and chances of drug resistance .
none of the patients including those who received appropriate treatment were given risk reduction messages and condom promotion messages .
major improvements in the delivery of effective health - care services as well as increased educational efforts both in health facilities and in communities are required .
public awareness needs to be raised on the importance of early treatment seeking at public facilities , long - term consequences of stis , and sexual risk reduction strategies for reducing stis .
individuals should be made aware that they must seek treatment promptly and refrain from sexual activity until they have been effectively treated .
continuous training in syndromic management and the establishment of regular supportive supervision are necessary for both general practitioners and specialists .
periodic performance appraisals should be conducted for all public facilities by supervising authorities . as sti control
is a government initiative , the private sector is usually not included in periodic training .
training as part of sti control programs in future has to include private sector also .
standardization of sti care in both public and private facilities should be an important strategy .
government and program planners should take into consideration the concerns expressed by the patients regarding the healthservice - related issues such as availability of medicines , issues of confidentiality , stigmatization , and harassment from staff .
although the generalizability of the findings is poor , this study should be considered as an eye opener to the existing problems in our health facility .
strengthening of sti services in the public sector , periodic training of health care providers of both public and private sector and creation of public awareness regarding the importance of early appropriate treatment should be an integral aspect of sti control program .
| background : sexually transmitted infections ( stis ) are a major public health problem in developing countries . these diseases are associated with increased risk of transmission of human immunodeficiency virus as well as adverse outcomes on pregnancy and reproductive health . sexual behavior and healthcare - seeking behavior
are identified as the true risk factors of stis.methods:hospital-based cross - sectional study design was adopted .
eighty - five sti patients were studied regarding the inappropriate treatment - seeking behavior , the nature of the first point of contact with the health care , the appropriateness of treatment and the concerns of the patient regarding the services rendered by government health - care facilities.results:among the 85 patients studied , 55.3% were males and 44.7% were females .
inappropriate treatment - seeking behavior was seen in 29.8% of males and 36.8% of females .
about 59.6% of males and 81.6% of females sought appropriate treatment from modern medicine practitioners before attending our institution .
only 7.1% of males and 3.2% of females received appropriate treatment .
the government sector was the choice of treatment for 46.4% males and 93.5% females and this difference was statistically significant ( p = 0.00081 ) .
lack of free medicines , issues of confidentiality , and privacy were the major service - related issues in the public sector.conclusion:appropriate treatment at the first point of contact with the health system is an important measure to prevent further transmission and development of complications .
health providers from both private and public sector should be given frequent periodic training regarding syndromic management of stis and the training should stress on the need for risk reduction and condom promotion messages along with medical management .
program planners should take necessary steps to ensure adequate and continuous supply of free drugs and tackle issues of confidentiality and privacy . |
cutaneous metastasis from an internal malignancy is rare and it indicates the later stage . malignancies which affect internal organs may display cutaneous manifestations , which may be the presenting symptoms and signs of the underlying malignancy .
the aims of the study were to determine the frequency and significance of cutaneous manifestations of internal malignancies among the patients attending a cancer chemotherapy center .
seven hundred and fifty patients with internal malignancies involving various organs , attending the cancer chemotherapy department of government general hospital , chennai , were recorded for a period of 3 years from 2005 to 2008 . in our institution , during the study period , it was not considered mandatory to obtain approval of ethical committee for conducting clinical study , and hence it was not obtained .
data regarding history about the duration of the malignancy and the duration between the onset of malignancy and the skin changes , relapse of malignancy and the symptoms of cutaneous lesions were obtained .
clinical examination including the cutaneous and systemic examination , hematological , radiological and cytological investigation was done to confirm the nature and site of malignancy .
histopathology of the cutaneous lesions , suggestive of metastasis from an internal organ , was obtained .
fine needle aspiration cytology ( fnac ) and t cell marker studies were done wherever necessary .
out of the 750 patients studied , 52 ( 6.93% ) had cutaneous manifestations , 20 ( 2.66% ) had cutaneous metastases ( specific lesions ) and 32 ( 4.26% ) had nonspecific skin lesions .
overall , the most common malignancies were leukemia and lymphomas ( 19.2% ) , followed by carcinoma breast ( 13.46% ) , carcinoma stomach ( 11.5% ) , carcinoma cervix ( 5.76% ) , carcinoma of the prostate ( 5.76% ) and carcinoma of the buccal mucosa ( 5.76% ) .
the other malignancies encountered in our study in descending order of frequency were malignant melanoma , seminoma , carcinoma esophagus , carcinoma pharynx , hepatocellular carcinoma , astrocytoma , pheochromocytoma , secondaries in the neck with unknown primary . in males ,
non - hodgkin 's lymphoma ( nhl ) ( 26.47% ) [ figure 1 ] was the most common malignancy producing skin lesions , followed by leukemias ( 14.7% ) and carcinoma stomach ( 14.7% ) .
a case of non - hodgkin 's lymphoma having inguinal nodes and skin - colored nodules over chest and abdomen in females , the most common malignancy was carcinoma breast ( 38.88% ) [ figures 2a , b ] , followed by leukemia ( 27.77% ) , carcinoma cervix ( 16.66% ) , nhl ( 5.55% ) , carcinoma stomach ( 5.55% ) and astrocytoma ( 5.55% ) .
( b ) ca breast ( right ) with ulcerative plaque eroding nipple and areola of the specific skin infiltrates , contiguous cutaneous metastases were seen in 6 ( 11.53% ) patients and non - contiguous metastases in 14 ( 26.92% ) patients [ tables 1 and 2 ] .
skin - colored nodules were the most common , followed by erythematous and hyperpigmented papules and plaques .
contiguous metastases non - contiguous metastases of the nonspecific lesions , herpes zoster was the most common ( 11 patients ) followed by generalized pruritus , multiple eruptive seborrheic keratoses , bullous disorders , erythroderma , flushing , purpura , systemic lupus erythematosus , pyoderma gangrenosum , insect bite allergy and lichenoid dermatitis .
cutaneous metastasis can arise at any age . however , most cutaneous metastases occurred during or after the fifth decade as in the present study .
the period of interval between the onset of symptoms of the primary malignancy and the onset of cutaneous metastases ranged from 2 months to 5 years .
the shortest duration was 2 months in the case of acute myleoid leukemia and the longest was 5 years in the case of carcinoma breast .
cutaneous metastatic lesions are usually multiple and may range from 1 to 100 . in our study , 5 out of 6 cases with contiguous metastases and 11 out of 14 cases of non - contiguous metastases had multiple lesions .
skin - colored nodules at multiple sites were the most common clinical presentation of cutaneous metastases .
the site of localization of metastasis depends upon mode of spread of the primary tumor , whether it is by lymphatics or hematogenous .
the common malignancies that give rise to cutaneous metastases are carcinoma of the lung and colon in males and carcinoma of the colon and ovary in females .
overall , melanomas are the most common , followed by carcinoma breast , carcinoma oral cavity , lungs , colon , and ovary . in this study , nhl was the most common neoplasm to produce cutaneous metastases , followed by carcinoma breast and leukemia . however , this observation could not be taken as actual reflection of prevalence in south india , as our hospital is a tertiary referral center .
contiguous spread was more common in females ( 66.6% ) than males ( 33.3% ) , while non - contiguous metastases were more common in males ( 85% ) than females ( 15% ) .
this difference could be because the malignancy encountered in both sexes is different . in the present study ,
carcinoma breast was the most common ( 66% ) neoplasm causing direct extension to skin , followed by carcinoma buccal mucosa and amelanotic melanoma [ figures 3a , b ] .
nhl was the most common neoplasm to produce non - contiguous metastases , followed by gastrointestinal malignancies ( 28.5% ) [ figure 4a , b ] and leukemia ( 21.4% ) , especially acute myeloid leukemia .
the most common sites involved by cutaneous metastases in their order of occurrence were as follows : ( a , b ) amelanotic melanoma over right cheek with multiple nodules over neck ( a ) a case of carcinoma stomach showing a single nodule over neck .
( b ) histopathology of the nodule shows collection of atypical epithelial cells in upper dermis anterior chest wall , anterior abdominal wall , lower limb , neck , back , upper limb , face , pelvis , scalp .
and tharakaram [ table 3 ] . comparison of sites of cutaneous metastases among the nonspecific skin manifestations with internal malignancy , herpes zoster ( 27% ) came first .
carcinoma breast was the most common malignancy associated with herpes zoster , while carcinoma cervix ( 18% ) was the second . among 11 patients ,
6 had single dermatomal involvement , 2 had disseminated and 3 had multidermatomal involvement . according to literature , disseminated herpes zoster is commonly associated with underlying malignant disease .
one of them had nhl which was reported as the most common neoplasm associated with paraneoplastic pemphigus in a study by anhalt et al .
the other patient had paraneoplastic pemphigus in association with secondaries in the neck . in this patient ,
skin manifestation as the first sign of internal malignancy was noted in another two patients .
another was an elderly man who presented with erythroderma and was diagnosed to have szary syndrome on further systemic examination and investigations .
one of our patients with carcinoma prostate developed bullous pemphigoid which is also reported in the literature . in the present study ,
generalized pruritus was noticed in three patients with hepatocellular carcinoma , polycythemia vera and carcinoma stomach .
pruritus was observed as a common manifestation among patients with internal malignancy compared to controls in the study by rajagopal et al .
three patients had multiple eruptive seborrheic keratoses and the most common malignancy associated was carcinoma stomach which corroborates with the literature reports .
we encountered a patient with pronounced flushing involving the face and chest , associated with pheochromocytoma , and similar association is reported in literature .
a known case of acute myeloid leukemia presented with purpura , which is a well - known association . survival period in patients with cutanenous metastasis is said to be around 3 months .
early death in these patients could be due to undetected secondaries in visceral organs and high - grade malignant nature of the primary tumor . in our study , 23 out of 52 patients ( 44% ) , were lost to follow - up , and among the remaining 29 patients , 13 ( 44% ) succumbed to their illness during the study period .
seven patients ( 54% ) showing specific cutaneous metastasis expired in the period of 26 months , whereas 6 patients ( 37% ) showing nonspecific cutaneous changes expired during the period of 14 days to 8 months [ table 4 ] . shortest survival period ( 2 months )
two patients with carcinoma breast , who developed recurrence of malignancy after surgery , expired in 4 months and 6 months , respectively .
shortest survival period in patients showing nonspecific cutaneous metastases was 14 days in a patient with hepatocellular carcinoma .
cutaneous metastases indicating a sign of recurrence and widespread metastases have poor prognosis and the survival period is reduced .
though the skin is an infrequent site for metastasis and is only the 18th most common site , skin lesions offer easily accessible tissue for biopsy and histopathologic examination .
systemic response to any particular chemotherapeutic agent can be assessed by the visible regression of skin metastasis .
cutaneous metastases are important to recognize because they may precede internal visceral metastases and early recognition helps in prolonging the survival of the patient . | background : many malignancies affecting the internal organs display cutaneous manifestations which may be either specific ( tumor metastases ) or nonspecific lesions.aims:the study is aimed at determining the frequency and significance of cutaneous manifestations among patients with internal malignancy.materials and methods:750 cases of proven internal malignancy , who attended a cancer chemotherapy center in south india , were studied .
specific infiltrates were confirmed by histopathology , fine needle aspiration cytology ( fnac ) and marker studies.results:out of the 750 patients with internal malignancy , skin changes were seen in a total of 52 ( 6.93% ) patients.conclusion:cutaneous metastases ( specific lesions ) were seen in 20 patients ( 2.66% ) : contiguous in 6 ( 0.8% ) , and non - contiguous in 14 ( 1.86% ) .
nonspecific skin changes were seen in 32 patients ( 4.26% ) . none of our patients presented with more than one type of skin lesions .
herpes zoster was the most common nonspecific lesion noticed in our patients , followed by generalized pruritus , multiple eruptive seborrheic keratoses , bullous disorder , erythroderma , flushing , purpura , pyoderma gangrenosum , insect bite allergy and lichenoid dermatitis . |
as indicated in a recent systematic review by our group , there is conflicting information regarding both the relationship between flexibility training interventions and functional outcomes and the relationship between improved flexibility and daily functioning ; health benefits have not yet been established .
the comparison of studies in this area to provide a prescription of the flexibility is complicated by the variety of limb ranges of motion studied , testing procedures utilized , and methods of assessing physical activity levels .
furthermore , this component of physical health has been somewhat neglected or forgotten in the current literature despite the lack of evidence for recommendations of the amount and type of flexibility needed for health in older adults .
further , despite this lack of a synthesis of the literature to support the recommendation of the inclusion of a flexibility component to older adult exercise programs , many older adult activity programs place a considerable emphasis on flexibility .
the present study attempts to add additional insight to this area by presenting the relationship between declines in flexibility across age and functional outcomes in a large sample of individuals representing the older adult age range .
joint flexibility may decrease across the age span [ 24 ] , which has the potential to affect normal daily functioning .
upper body flexibility is known to be important for activities such as getting dressed and reaching for objects , while lower body flexibility is important for maintaining normal walking patterns and for activities involving bending and reaching . while the loss in flexibility with age has been attributable , in part , to decreased activity , the literature describing the influence of physical activity on flexibility and the aging process is surprisingly limited .
the purpose of the present study was to examine the cross - sectional age - related differences in flexibility in a large sample of independently living adults aged 5586 years with varying activity levels .
the recent systematic literature review identified the lack of an established relationship between improved flexibility and daily functioning and health benefits .
as such , a secondary purpose of the present study was to describe any relationships of physical activity levels and of functional outcomes ( specifically walking ) , with flexibility measures .
the municipal tax assessment list , containing names of householders and residents in the city of london , ontario ( 2011 , population 366,151 ) , provided the sampling frame .
those living in institutions , defined as nursing homes or chronic care facilities , were not eligible .
the strata were defined by gender and six five - year age groups , starting with age of 55 , and the sampling rate was set to select 35 men and women in each stratum .
those sampled were sent a letter inviting their participation , and a follow - up call to recruit and screen the respondents was made .
exclusion criteria were those who responded no to the question of their ability to walk an 80 meter course .
thus , the target population the noninstitutionalized population aged 5585 years who self - reported the ability to walk 80 meters .
the university 's human research review board approved the study , and each subject signed informed consent .
body height , mass , skinfold thickness ( four sites : biceps , triceps , subscapular , and suprailiac ) , and waist and hip girth were measured .
hip flexion was assessed using a leighton flexometer fastened to the hip , with the range of motion determined by bending backward as far as possible and then forward as far as possible .
shoulder abduction was measured as the range of motion of the right hand from the side of the leg , upward and outward in an arc .
the minnesota leisure - time physical activity questionnaire ( mltpaq ) was used to assess self - reported physical activity levels .
the questionnaire was administered with the aid of a research assistant . for the present data in older adults , the intensity codes ( metabolic rate scores ) for different activities , developed for middle - aged subjects ,
were reduced in proportion to the age - related slowing of self - paced walking speed , to acknowledge that older adults would pursue these activities at a slower absolute pace .
the codes were then decreased a further 0.61% per year in males and 1.02% per year in females for each year beyond the age of 55 , corresponding to the rate of decline in self - paced walking as measured in the sample of the present study ( age 55 to 85 years ) .
thus , the intensity codes for the vigor with which older adults participated in a particular activity were age - adjusted .
according to the mltpaq scoring system , physical activity was characterized by total energy expenditure ( in met / minutes / day ) and also examined for energy expenditure in activities characterized as light , moderate , or heavy intensity .
the design of the leg dynamometer and the procedures followed for measuring plantar flexion strength have been previously reported .
subjects were seated on a bench with the thigh locked in a horizontal position and knee flexed at 85 degrees in the leg dynamometer .
the dominant leg was clamped down and the subject was asked to push - off , that is , to attempt to raise their heel off the ground . the force generated against the clamp bar
maximal grip strength ( of three trials ) of the dominant hand was measured using a handgrip dynamometer with interchangeable casings to accommodate hand size . as a measure of lower body function , walking speed ( time / meters ) and step length were assessed by having subjects walk an 80-meter course at their normal and fast self - selected speeds .
self - rated health and life satisfaction were assessed using a questionnaire containing modified questions from the nottingham health profile , as were self - reported walking difficulty and difficulty with stairs , by rating degree of difficulty on a five - point scale .
data analyses were performed with the statistical package for the social sciences ( spss 19.0 , ireland , 2010 ) .
all descriptive data are presented as mean sd . frequency distributions were examined for categorical variables
. ranges of motion of the hip and shoulder joints across age were analyzed by both linear regression and piecewise linear regression with a 2-segment model ( sigma plot 12.0 , chicago , illinois , usa ) ; these fits produced similar r values .
age and physical activity were entered into a multiple regression analysis to determine associations with shoulder and hip flexibility .
further , expanded univariate logistic regression was performed to identify other variables associated with determining flexibility .
lastly , stepwise linear regression , allowing for entry and removal at the 0.10 level of significance , was used to examine the relationship of flexibility with physical ( self - rated health , self - reported arthritis , body mass index , and upper and lower body strength ) , functional ( walking and stair climbing difficulty , step length , and walking speed ) , and psychosocial ( self - rated health , life satisfaction ) variables .
the recruitment process resulted in 1451 individuals contacted ; 696 were eligible , and 441 ( 63.4% ) participated and is detailed by koval et al . .
participants were more likely to be widowed and less likely to be married , more likely to have had a white - collar job , and had some postsecondary education .
flexibility measurements were obtained from a total of 436 community - dwelling individuals ( 205 men , mean age 70.4 8.8 years ; 231 women , mean age 71.4 8.4 years ) .
self - rated health among the group indicated that 11% of the sample considered their health to be
almost half of the sample was fully retired ( 49% ) and 11% were employed full time .
sixty - three reported being quite satisfied and 30% reported being very satisfied .
based on self - reported physical activity levels , the calculated total energy expenditure in leisure time physical activity would indicate that the present sample was , on average , very active , but encompassed a wide range of activity levels .
the mean range of motion of shoulder flexibility was 138 degrees in our sample , with no difference between men and women .
shoulder abduction showed a significant decline across age , averaging 5 degrees per decade in men and 6 degrees per decade in women . from piecewise linear regression , an accelerated decline of 0.80 degrees per year
was observed in the sample of men starting with those 71 years old , whereas in women the onset of decline was 63 years and declined across age at a rate of 0.74 degrees per year ( figures 1(a ) and 1(b ) ) .
the women had significantly higher hip flexion of 114 degrees versus the men , with 102 degrees .
however , both showed a similarly significant age - related decline in hip flexion ( men : 6 degrees per decade ; women : 7 degrees per decade ) .
piecewise linear regression revealed a rate of decline of 1.16 degrees per year , across age , beginning at 71 years in men ( figure 2(a ) ) . in women ,
the decrease across the age span of the sample was a single linear decline of 0.66 degrees per year ( figure 2(b ) ) .
age was significant ( p < 0.01 ) , but the contribution of physical activity was not ( females : p = 0.14 ; males : p = 0.57 ) , when included in a regression model that described 9% of the variance for both males and females in the decline in shoulder abduction .
the regression model accounted for only 7% of the variance ( in both men and women ) in the change in hip flexion .
again , age showed a significant contribution ( p < 0.01 ) ; however , the contribution of physical activity to lower body flexibility was not significant for either males ( p = 0.71 ) or females ( p = 0.42 ) .
neither total physical activity nor the components of light- , moderate- , and heavy - intensity physical activity were significantly related to flexibility of the hip or shoulder at the univariate level ( tables 2(a ) and 2(b ) ) .
age was significant and explained 8% and 7% of variance in shoulder and hip flexibility , respectively . for upper body flexibility , age , bmi ,
plantar flexor strength , and handgrip strength were entered into the stepwise linear regression ( table 3(a ) ) .
regression analysis yielded a model including age , bmi , and plantar flexion strength that resulted in 10.5% of the variance in upper body flexibility being accounted for by those variables .
age , sex , bmi , and hand grip strength were entered into a regression model for lower body flexibility , accounting for 19.6% of the variance in hip flexibility ( table 3(b ) ) .
there was no association between upper body flexibility and the functional measures of self - reported difficulty in walking or climbing stairs .
step length was associated with upper body flexibility but not when adjustment was made for age .
normal , fast , and very fast walking speeds were associated with upper body flexibility , but only very fast walking speed ( p = 0.001 ) was still associated when adjustment was made for age .
lower body flexibility was associated with all walking speeds ; however , none of the associations were maintained when adjustment was made for age .
self - rated health and life satisfaction were not associated with either upper ( p = 0.18 ; p = 0.32 ) or lower body flexibility ( p = 0.09 ; p = 0.30 ) .
this study provides descriptive data on the age - related differences ( across the age range of 5585 years ) in flexibility in a large cross - sectional sample of male and female community - dwelling older adults .
it also provides an examination of the role of physical activity in the changes to upper and lower body flexibility with aging and a determination of the relationship of flexibility with functional outcomes in older adults .
our sample demonstrated a mean upper body flexibility of 138 degrees and a mean lower body flexibility of 109 degrees .
reported shoulder abduction values of 125 degrees for men and 119 for women in a similar large sample ( n = 894 ) of community - dwelling adults over the age of 65 years .
these values are lower than those reported for the present study 's sample ; however , it should be noted that the shoulder abduction measure was slightly different , and a large proportion of the sample in bassey 's study reported having a functional disability . with respect to sex differences , the majority of the literature indicates that women have greater flexibility at all ages [ 4 , 1318 ] .
our results were in agreement for lower body flexibility , although there was no significant difference based on sex for upper body flexibility .
this is in contrast to bassey et al . , who reported significantly lower shoulder abduction flexibility for females in their sample .
doriot and wang did not find consistent sex differences among their 26 measures of joint range of motion .
similarly , walker et al . found no differences in ranges of motion of the shoulder , elbow , hip , or knee joints , between older men and women .
these varying results are likely due to different population samples , joints studied , and customary use of the joints . the rate of decline in flexibility with age will vary depending on the body part measured , the training status of the sample , and population being studied . in our sample of relatively healthy community - dwelling older adults ,
the rate of decline in our measure of upper body flexibility ( shoulder abduction ) was 0.5 degrees per year in males and 0.6 degrees per year in females .
declines in hip flexion of 0.6 degrees per year in males and 0.7 degrees per year in females were documented . a 1% decline per year ( approximately 1.2 degrees per year , or nearly double the rate found in the present study ) in shoulder abduction range of motion of older men and women was reported by bassey et al . .
comparative rates of decline are not readily available in the literature , but rates of 1.5 degrees per year have been reported for lower back flexion , and the greatest decline appears to occur with trunk extension . whereas differences in flexibility by sex may occur
, the rate of change with age has been reported to be similar in both men and women [ 22 , 23 ] , and our results concur .
in contrast , mcculloch showed little decline in sit - and - reach scores in women versus men , who showed a dramatic decline in age groups of 65 to 75 years , citing differences in the decline in work activity of men over the older adult age range .
this study provides a description of potential critical periods of decline in flexibility across the older adult age range . at the age of 71 years
, it appears that both upper and lower body flexibility show an accelerated decline in males , whereas in females , only upper body flexibility shows a change in the rate of decline , with lower body showing a steady rate of change .
james and parker reported decreases in active and passive motion in lower limb joints during the period of 70 to 92 years , with the decline becoming more pronounced during the ninth decade . while not significant , charkravarty and webley reported a greater decline in range of motion in a group over the age of 75 years versus a group of 6574 years , adding support to the trend for an accelerated decline in flexibility in the oldest old .
the present sample had an age range including up to 86 years , and the piecewise linear regression did suggest that an accelerated decline would occur in the oldest women . whereas age may be associated with a decline in flexibility , older adults still maintain the ability to improve flexibility with general exercise training programs [ 2427 ] and with flexibility - specific training , as reviewed by stathokostas et al . .
in addition , the difference in rate of change in flexibility across joints has been attributed to chronic use of those joints , for example , those used in activities of daily living . as such , one purpose of the present study was to determine if age - related losses in flexibility were associated with in physical activity levels .
our results showed no relationship between self - reported physical activity levels and upper or lower body flexibility .
walker et al . also reported no differences in the ranges of motion in the shoulder , elbow , hip , or knee joints , in a sample of 60 older men and women classified into high and low physical activity categories based on self - report .
also , similar results were found by miotto et al . when comparing the hamstring flexibility in a sample of active versus sedentary adults with a mean age of 68 years ; no difference was observed .
studied the association between shoulder abduction and self - reported customary use of the shoulder and found an association ; however , it should be noted that the effect was not significant in women in multiple regression ( replaced by effort score ) , and the effect of customary use was greater in those with a disability .
this finding may suggest that a more closely - matched flexibility and activity - specific measurement is more reflective of the role of physical activity in the change in flexibility with age .
nevertheless , in a smaller sample of 30 older women , rikli and busch found a significant difference for trunk and shoulder flexibility in active versus inactive women , where active was considered as vigorous activity for at least 30 minutes , three days per week .
this study reported a significant age - by - activity interaction for shoulder flexibility , but not for trunk flexion .
voorrips et al . , in a sample of 50 women with a mean age of 72 years , reported significantly better flexion at the hip and spine in women who self - reported high activity levels ( several hours per week in aerobic - type exercises ) .
a five - year longitudinal study by lan et al . demonstrated that baseline and follow - up thoracolumbar flexibility values were higher in older adults participating in a chinese conditioning program of repeated motions and postures with range of motion warm - up versus a sedentary control group .
further , while both groups showed an age - related decline over the five years , the control group had a larger decline in flexibility , supporting a positive role of physical activity in attenuating the decline in flexibility with age .
thus , our results suggest that the age - related declines in flexibility of disability - free independently living older adults are not influenced by their overall level of daily physical activity ( although specific stretching exercises can still alter the flexibility levels of older adults ) .
normal step length and normal , fast , and very fast walking speeds were associated with shoulder abduction ; however , only for very fast walking speed was the association consistently maintained when adjustments were made for age .
our results did not provide evidence that the change in lower body flexibility ( hip flexion ) impacted functioning with age .
normal , fast , and very fast walking speeds were associated with hip flexion , but as with shoulder abduction , the relationship was not sustained when adjustment for age was made .
a factor to consider in range - of - motion declines is the loss of compliance in connective tissue with aging .
for example , it was shown by vandervoort et al . that a loss of flexibility in the ankle joint affects walking mechanics .
it might have been expected that our measure of lower body flexibility would be associated with our walking measures , as representatives of function ; however this was not the case .
nevertheless , self - reported difficulty with stair climbing also failed to show an association in the present population .
previously , our laboratory identified shoulder flexibility as one determinant of independence when comparing a group of independently living older adults versus those in rest or nursing homes .
. showed that ankle dorsi - flexion range of motion was a significant physical fitness factor in predicting six - year incidence of disability .
these studies might suggest that the roles of flexibility and function with aging are population - dependent and may not be as influential in younger or healthy subgroups of older adults , based on epidemiological data .
nevertheless , based on the reference values indicating that shoulder abduction range of motion of 120 degrees and hip flexion values of 3050 degrees ( for most hip - related functional activities ) are considered lower - end thresholds associated with functional loss , we would consider our sample of healthy community - dwelling older adults to be high functioning .
based on the present data for shoulder abduction , using the reference that a value of < 120 degrees was related to functional loss , the conclusion would be that , among our community - dwelling , disability - free sample the probability of the age - related decline in flexibility falling to below the reference values was very low
less than ~10 subjects beyond age 75 years fell below this functional threshold and the average for the 85 year old was close to 130 degrees . for the hip flexibility measure of the present study , we are not aware of data to establish a functional threshold ; however from the present data where hip flexion was not related to functional outcomes , the hip flexion was above 70 degrees and the average for the 85 year old was ~100 degrees .
an individual 's quality of life includes their sense of well - being , which depends on how they feel about their health and their level of satisfaction with life . in order to address the broader issue of how physical fitness attributes can contribute to health in older adults ,
self - rated health and life satisfaction were not associated with either upper or lower body flexibility in the present sample of independent older adults .
in contrast , bassey et al . reported an association of life satisfaction and social engagement with shoulder range of motion in a large sample of older men and women .
however , the difference between studies , as mentioned earlier , is that the sample of bassey et al
. reported a high rate of disability , including shoulder - specific disability and arthritis . in our sample ,
no relationship between arthritis and flexibility was indicated . in support of the decline in flexibility playing a role in quality of life of older adults , fabre et al .
reported a significant association between upper body flexibility and health - related quality of life in nonagenarians .
this sample was community dwelling , with 45% of the sample reporting orthopedic conditions and 43% reporting at least one chronic condition .
thus , although further research is required to understand the role of flexibility in quality of life and successful aging , a lack of relationship is suggested from our data , and where an association of flexibility and health outcomes occurs , it is likely related to a disability , that is , a range of joint motion below some critical threshold . while the present study does describe a large number of men and women from a random sample , the data is cross sectional , and so reverse causality can not be ruled out .
in addition , individual trajectories of flexibility could vary due to the individuality of the aging process , which would be provided by longitudinal data .
the joints measured and the functional outcomes may not be tightly matched or may not reflect functions of daily living that could potentially be limited in subgroups of the present sample , or in the older age ranges .
further to this point , based on the inclusion criteria for this study , the sample may not be representative of the usual aging population , but rather an independently living generally healthy one .
a decrease in flexibility of the shoulder and hip joints by approximately 6 degrees per decade was observed across ages 55 to 86 years in both men and women .
analysis of age subgroups shows that both shoulder and hip joints begin to experience significant declines after 70 years .
physical activity level did not explain a significant amount of the variance in flexibility measures , and flexibility was not associated with functional ability . while steeper gradients of flexibility with age over certain thresholds may be indicated , further analysis is warranted to discern whether the losses in flexibility impact functional outcomes and the degree of loss of range of motion that might relate to disability . in particular , a more direct matching of specific limb range of motion and meaningful functional outcome is needed , as are longitudinal studies . additionally , the specific type of physical activity that may influence the age - related loss needs to be further elucidated .
nevertheless , overall , in community - dwelling generally healthy older adults aged 55 to 85 years , the age - related loss of flexibility appears to be small such that the normal loss of joint range of motion ( i.e. , in the absence of underlying clinical condition ) is unlikely to neither impact significantly on daily functions nor result in disability . | cross - sectional age - related differences in flexibility of older adults aged 5586 years of varying activity levels were examined . shoulder abduction and hip flexion flexibility measurements
were obtained from 436 individuals ( 205 men , 71 9 years ; 231 women , 72 8 years ) .
total physical activity was assessed using the minnesota leisure - time physical activity questionnaire .
shoulder abduction showed a significant decline averaging 5 degrees / decade in men and 6 degrees / decade in women .
piecewise linear regression showed an accelerated decline in men starting at the age of 71 years of 0.80 degrees / year , whereas in women the onset of decline ( 0.74 degrees / year ) was 63 years .
men and women showed a significant decline in hip flexion ( men : 6 degrees / decade ; women : 7 degrees / decade ) .
piecewise linear regression revealed a rate of decline of 1.16 degrees / year beginning at 71 years in men and in women a single linear decline of 0.66 degrees / year .
multiple regression analysis showed that age and physical activity accounted for only 9% of the variance in hip flexion in women and 10% in men , with age but not physical activity remaining significant . similarly for shoulder abduction , age was significant but not physical activity , in a model that described 8% of the variance for both sexes . |
light - cured composite resins ( lccrs ) have been studied extensively in recent years .
the
formulation proposed by bowen ( 1963 ) ,
which is still in use today albeit with slight modifications , consists basically of a
resin matrix , filler particles , monomers and a photo absorbing compound .
the latest development in this field has been the introduction of low shrinkage monomers
and nanofiller particles .
lccr
( polymerase chain reaction ) materials are present in filtec z350 ( 3m / espe , saint paul ,
mn , usa ) , which combines nanometric particles and nanoclusters in a conventional resin
matrix , and in admira ( voco , cuxhaven , germany ) , whose resin matrix contains ormocer , an
organically modified ceramic .
the light - curing units ( lcus ) equipped with a light - emitting diode ( led ) , which produces
cold light at 450 nm wavelength , is a promising device of costs and efficiency .
however ,
the lcu operating with a halogen lamp is still the first choice of clinicians and
extensive research has been dedicated to testing its efficiency .
the present research focused on one of the important properties of lccrs - surface free
energy ( sfe ) , to study the interaction between the forces of cohesion and the forces of
adhesion that determine the occurrence of surface wetting .
the wetting performance of etched enamel is important in all types of adhesive
restorations because of the close interaction between the surface free energy of the
etched enamel and the wettability of the luting and bonding material .
the contact
angle measurement method is probably the most definite way to determine cell surface
hydrophobic .
the angle is very high for water if substrata are hydrophobic . if the
surface is hydrophilic , the droplet quickly dissipates and the measured angle is low .
contact angles values vary with surface topography , surface tension of the liquid ,
surface energy of the substrate and the level of interaction between the liquid and
solid .
hydrophobic materials
are more color - stable and stain - resistant than hydrophilic materials .
gaps formed at the tooth / restoration interface may be caused by inadequate wetting of
the tooth surface by the restorative material along the preparation walls during
placement .
surfaces with a low
surface free energy minimize plaque formation . to calculate de sfe ,
the first step consists of measuring the contact angle ( ca ) between
the solid under study and the test liquid , using a contact angle goniometer .
the ca
which is the macroscopic expression of the micro and macroscopic phenomena occurring
between the solid , the test liquid .
the acid - base theory involves the
multicomponent approach , whereby the sfe occurs through dispersive interactions or
lifshitz - van der waals ( lw ) and lewis acid - base ( ab ) interactions .
the second approach
involves the equation - of - state theory , which is highly criticized from the thermodynamic
standpoint .
although these theories are based on different concepts , they share the same
basic idea , i.e. , they attempt to express the reverse work of adhesion of some of the
components of the interfacial tension between liquids and solids .
the aim of this work was to evaluate the variations in the surface energy of various
composite resins after curing by led and halogen curing devices , based on contact angles
and surface free energy .
thirty - six test specimens of composite resins ( admira - voco , cuxhaven , germany ; filtec
z350 - 3m / espe , saint paul , mn , usa ; grandio - voco , cuxhaven , germany ) were prepared in
a 10 mm diameter , 2-mm thick articulated brass matrix .
the specimens were finished
with sof - lex discs ( 3m / espe ) and polished with kota diamond paste ( kota dental
products , so paulo , brazil ) .
the lcus employed were a led device ( elipar freelight ii -1000 mw / cm ,
3m / espe ) and a halogen device ( vip tm 500 mw / cm and 600
mw / cm , bisco , inc . , schaumburg , il , usa ) .
the light emission control was
preset with a radiometer ( demetron 100p / n ; demetron research corp . ,
the materials ( shade a2 ) were inserted into the matrix in two portions and pressed
with two microscope slides to achieve a smooth flat surface , after which they were
light - cured in the specimens center for 20 s on each side .
twelve samples of each
composite were prepared , 6 were light - cured wit a led lcu and 6 with a halogen lamp .
all specimens were stored in dark vials at 8c for 1 week , after which they were
finished and polished before testing .
the static contact angles were measured with a goniometer ( ram - hart 100-fo , netcong ,
nj , usa ) using deionized water and glycerol as test liquids ( table 1 ) .
the
36 samples were divided into 12 groups of 6 test specimens each , and 6 drops of each
liquid were used for the measurements .
the computer was set to record 10 contact
angle measurements of each drop , so 360 measurements were made for each group , making
a total of 4,320 measurements .
=relative equilibrium pressure , =interface tension ,
=interation forces ( london dispersive - debye dipole and
keeson dipole - dipole ) =acidic part -acceptor , =basic part -
donor the sfe was determined based on the harmonic mean method described by wu ( 1995 ) . because two test liquids are
required to calculate the sfe by this method , the samples were divided into 6 groups
of 6 test specimens each . a different lcu and test liquid
the contact angle values determined for each group were stored in the computer , and
the surface energy was calculated using dropimage standard software , netcong , nj ,
usa . the values were done by the soft but the calculations can be done by youngs
equation : 2=12+1 cos and with the acid - base theory .
statistical inter- and intra - group analyses of the data were made using anova and
tukey 's test at 0.05 significance level .
thirty - six test specimens of composite resins ( admira - voco , cuxhaven , germany ; filtec
z350 - 3m / espe , saint paul , mn , usa ; grandio - voco , cuxhaven , germany ) were prepared in
a 10 mm diameter , 2-mm thick articulated brass matrix .
the specimens were finished
with sof - lex discs ( 3m / espe ) and polished with kota diamond paste ( kota dental
products , so paulo , brazil ) .
the lcus employed were a led device ( elipar freelight ii -1000 mw / cm ,
3m / espe ) and a halogen device ( vip tm 500 mw / cm and 600
mw / cm , bisco , inc . , schaumburg , il , usa ) .
the light emission control was
preset with a radiometer ( demetron 100p / n ; demetron research corp . ,
the materials ( shade a2 ) were inserted into the matrix in two portions and pressed
with two microscope slides to achieve a smooth flat surface , after which they were
light - cured in the specimens center for 20 s on each side .
twelve samples of each
composite were prepared , 6 were light - cured wit a led lcu and 6 with a halogen lamp .
all specimens were stored in dark vials at 8c for 1 week , after which they were
finished and polished before testing .
the static contact angles were measured with a goniometer ( ram - hart 100-fo , netcong ,
nj , usa ) using deionized water and glycerol as test liquids ( table 1 ) .
the
36 samples were divided into 12 groups of 6 test specimens each , and 6 drops of each
liquid were used for the measurements .
the computer was set to record 10 contact
angle measurements of each drop , so 360 measurements were made for each group , making
a total of 4,320 measurements .
=relative equilibrium pressure , =interface tension ,
=interation forces ( london dispersive - debye dipole and
keeson dipole - dipole ) =acidic part -acceptor , =basic part -
donor
the sfe was determined based on the harmonic mean method described by wu ( 1995 ) . because two test liquids are
required to calculate the sfe by this method , the samples were divided into 6 groups
of 6 test specimens each . a different lcu and test liquid
the contact angle values determined for each group were stored in the computer , and
the surface energy was calculated using dropimage standard software , netcong , nj ,
usa . the values were done by the soft but the calculations can be done by youngs
equation : 2=12+1 cos and with the acid - base theory .
statistical inter- and intra - group analyses of the data were made using anova and
tukey 's test at 0.05 significance level .
table 2 shows the mean values and standard
deviations of the interactions among the various types of lccrs , lcus , and test liquids ,
as well as the statistically significant differences among the groups as indicated by
the tukey 's test .
mean values of contact angles ( meansd ) tukey 's multiple comparisons- ( same letters = not statistically significant
p>0.05 ) sd = standard deviation the resin admira ( 74.45 ) , using glycerol as the test liquid and the halogen lamp as the
lcu , yielded the highest mean ca value , while grandio ( 59.19 ) resin tested with
glycerol , using led as the light source , yielded the lowest ca value .
the inter- and intra - group ca values showed no significant difference ( p>0.05 ) for
the filtec z350 resin , but all values obtained for the resin grandio showed significant
differences ( p<0.05 ) .
the sfe results listed in table 3 were subjected
to tukey 's test , which indicated the absence of statistically significant differences
among the groups .
mean , standard deviation and standard error for surface free energy
( mj / m ) p>0.05 - not statistically significant
the main controllable variables
involved in ca measurements are the light - curing process , the test liquids and the
chemical composition of the resin under study .
all samples ( shade a2 ) were subjected to 40 s of light incidence upon the center of the
sample , which according to lindberg , peutzfeldt and van dijken ( 2004 ) is sufficient to cure the entire surface of such
samples .
although the intensity of the vip tm ( bisco ) halogen lamp varied from 500 to 600
mw / cm , we do not believe this variation impaired the polymerization of
the test specimens of the 3 resins .
the intensity of light emitted by a halogen lamp is
lower than that emitted by a led unit , but its values still exceed 280 to 300 mw / cm , according
to caughman , rueggeberg and curtis
( 1995 ) . in view of the lack of information about the surface energy of these materials ,
it is difficult to compare our results to those of other author .
the test liquids used here had different polarities , in spite of similar
values which explains the mean
ca values ranging from 59.19 to 74.45 obtained in this study .
the degree of purity and
the numerous measurements yielded reliable results and low standard deviations .
although
zisman ( 1964 ) stated that the
volume of the drop does not influence ca values , this volume , as well as room
temperature and humidity , were standardized in this study in order to reduce the number
of variables .
the organic matrix of admira resin is composed of ormocer , siloxane organic / inorganic
polymer , bis - gma , hema , udma , fe2o3 , tio and 4-tert - butylcatechol
( tbc ) , and its inorganic matrix contains ba - al borosilicate , a silicon dioxide ( 0.04 - 0.7
m ) - 78% in weight and 56% in volume .
the presence of these high surface energy
particles , which in some samples may have been located close to the surface , could cause
a decrease in measured ca values .
light curing of the organic material , which closes the
carbon chains , also probably interferes in the expression of these particles even in the
deepest layers .
the diameters of the inorganic particles of filtec z350 and grandio resins are
nanometric . wu ( 1973 )
argues that
the homogeneous dispersion of inorganic particles in the polymeric matrix is critical , a
statement confirmed by von werne and patten ( 2001 ) .
hydrophobic polymers and inorganic hydrophilic particles
are physically difficult to mix , and phase separation or agglomeration is common in such
mixtures , resulting , according to the aforementioned author , in alterations in their
mechanical , optical and electrical properties .
these particles can be treated chemically
used to produce a more hydrophobic or hydrophilic surface .
as shown in table 2 , the ca values of the filtek
z350 resin showed no major variations in any of the combinations . in view of these
results , it is reasonable to assume that the components of the resin in these test
specimens were distributed more homogeneously .
the ca values of the admira resin
revealed greater variations in the two test liquids and the two lcus . among the 3 resins
of this study ,
table 3 lists the mean values of the total sfe
calculated for each lccr with respective sd , indicating no significant differences among
the groups .
the admira resin showed the highest sfe value when light - cured with the led
unit ( 40.17 mj / m ) , while the grandio resin displayed the lowest sfe when
photo - activated by the conventional halogen lamp ( 34.74 mj / m ) .
the statistical analysis of the resins ' sfe data confirmed that the different types of
lcu employed to polymerize the resins did not influence these results .
this finding is
congruent with that reported by glantz and larsson ( 1971 ) , although the resins tested by these authors belong to
another generation of composites , whose chemical compositions differ considerably from
those used in our study .
milosevic ( 1992 ) who studied the
adhesion of saliva films on composite resins , stated that polymers are usually known as
low - sfe materials with values of about 40 mj / m , and that the particles of
their inorganic load have high sfe values .
all the results obtained in the present
research ( table 3 ) are in agreement with those
of this author .
the contact angles of the 3 polymers studied here did not
differ significantly , as did their wettability .
the research recommends the material
that showed the highest contact angle ; 2 . polymerization with led or halogen units did
not alter the surface free energy of the composite resins . | objectivesthis study evaluated the surface energy and wettability of composite resins
polymerized by different light - curing units to ascertain the good wetting of tooth
surfaces to achieve adhesion .
material and methodfiltek z350 ( 3 m espe ) , admira ( voco ) and grandio ( voco ) resins were selected for
the testing procedures .
the resins were light cured using led and halogen devices .
contact angles were measured goniometrically ( ram - hart f100 ) using water and
glycerol as test liquids .
surface energy values were calculated with a software
program ( dropimage standard ) that uses the harmonic mean method applied to the
acid - base theory .
the data were analyzed statistically by anova and tukey 's test
with a significance of 0.05 .
results and conclusionsno statistically significant differences were found between the values of surface
energy .
the measured wettability differed statistically in most combinations as a
function of the type of composite resin , type of light - curing unit , and the test
liquid . |
unrelated hematopoietic stem cell transplantation is a rapidly evolving field offering a curative therapy for various hematologic diseases . in particular ,
the proportions of older patients and patients transplanted with unrelated donors have increased over the last decade .
one prerequisite was the introduction of reduced intensity conditioning regimens ( ric ) as an alternative to myeloablative conditioning ( mac ) in elderly patients as well as in patients with co - morbidities .
there is already a wealth of data showing that ric is a safe and effective treatment form for patients previously not eligible for hematopoietic stem cell transplantation ( hsct ) . as a consequence , therapeutic schemes for elderly patients
nevertheless , classical risk factors still apply , and while increasing age did not influence the incidence of acute or chronic graft - versus - host disease ( gvhd ) , transplant - associated morbidity and mortality as well as disease relapse still pose challenges in elderly patients . one study investigating
a significant number of transplanted all patients aged over 45 years showed a substantially higher rate for transplant - related mortality ( trm ) in mac - treated patients with hla - mismatches when compared to the ric - treated cohort , prompting the authors to discourage mac conditioning in this patient group altogether .
this observation suggests an interaction between transplantation - associated mortality caused by age - associated risk and hla - mismatching .
age and hla - matching status are important clinical predictors for the outcome of hsct and are used among others for risk assessment in hsct .
we analyzed the relationship between age - risk and hla - risk in a large cohort of patients transplanted with unrelated donors and tested the hypothesis that age - risk varies according to hla - matching status .
a total of 3019 adult patients transplanted for malignant hematologic disorders were included in this analysis .
all patients received a first allogeneic unrelated transplant from bone marrow ( bm ) or peripheral blood stem cells ( pbsc ) with no more than 2 hla - mismatches on 5-loci ( hla - a , -b , -c , -drb1 and -dqb1 ) .
disease stage definitions were adopted from a previous study defining the european group for blood and marrow transplantation ( ebmt ) risk score .
mac was defined according to the recommendations of the ebmt central registry office ( medab manual forms ) .
treatments with busulfan 16 mg / kg + cyclophosphamide 120200 mg / kg , cyclophosphamide 120 mg / kg fractionated total body irradiation ( tbi ) 12gy , etoposide vp-16
3060 mg / kg + tbi 12gy fractionated/10gy single dose , beam polychemotherapy , cbv polychemotherapy or tbi 1014gy ; busulfan 16 mg / kg are considered as myeloablative .
patient and donor consent for hla typing and for the analysis of clinical data were obtained .
the study was approved by the ethical review board of the university of ulm ( project number 263/09 ) .
all patients and donors were high resolution typed for hla - a , -b , -c , -drb1 and -dqb1 .
ambiguities within exons 2 + 3 for hla - class i and exon 2 for hla - class ii alleles were resolved .
ambiguities involving non - expressed ( null ) alleles were resolved according to nmdp confirmatory typing requirements .
differences in exon 2 and 3 for hla - class i alleles and exon 2 for hla - class ii alleles were considered as hla - mismatch irrespective of the vector of mismatches .
patient hla - c kir ligand status was inferred from high resolution hla - c typing ( c1=asn80 ; c2=lys80 ) .
resulting phenotypes were c1c1 , c1c2 and c2c2 . for univariate analysis of overall survival ( os ) , the kaplan - meier method and logrank testing was applied .
multivariate analysis for os and disease - free survival ( dfs ) was performed using extended cox - proportional hazards models . for trm and ri , univariate competing risks analysis and multivariate competing risks regression for stratified data was used .
evaluated covariates were : patient age , hla - matching status , disease stage , conditioning regimen intensity , treatment with antithymocyte globulin ( atg ) , year of transplantation , time to transplantation , graft source , donor - recipient sex combination , kir ligand status , and donor origin ( national vs. international ) .
for antithymocyte globulin ( atg ) treatment , some data were missing ( table 1 ) .
models were validated by inclusion of missing values as a separate group and by omission of cases with missing values , and no bias was found .
violations of the proportional hazards assumption ( pha ) by disease stage , conditioning regimen intensity and transplantation before 2004 were adjusted using time - dependent modeling of these covariates .
a significant center effect was adjusted using a frailty term with gamma distribution . to assess the relationship between age and hla - compatibility , subgroups were formed and analyzed as factors : age group 1835 years ( hla - match : 10/10 , 9/10 and 8/10 ) , 3655 years ( hla - match : 10/10 , 9/10 and 8/10 ) , and over 55 years ( hla - match : 10/10 , 9/10 and 8/10 ) .
the cut - off value of 55 years for elderly patients has been used in previous studies and the cut - off value of 35 years is close to the arithmetic mean between the age boundaries in the remaining patients .
in addition , an interaction model between age and number of hla - mismatches was investigated .
the relative risk conferred by age was visualized as age - dependent risk in different hla - match categories relative to an 18-year old patient transplanted with a 10/10 matched donor as baseline . in this model ,
the covariate age was included as a continuous variable and no violation of the pha was found .
a total of 3019 adult patients transplanted for malignant hematologic disorders were included in this analysis .
all patients received a first allogeneic unrelated transplant from bone marrow ( bm ) or peripheral blood stem cells ( pbsc ) with no more than 2 hla - mismatches on 5-loci ( hla - a , -b , -c , -drb1 and -dqb1 ) .
disease stage definitions were adopted from a previous study defining the european group for blood and marrow transplantation ( ebmt ) risk score .
mac was defined according to the recommendations of the ebmt central registry office ( medab manual forms ) .
treatments with busulfan 16 mg / kg + cyclophosphamide 120200 mg / kg , cyclophosphamide 120 mg / kg fractionated total body irradiation ( tbi ) 12gy , etoposide vp-16
3060 mg / kg + tbi 12gy fractionated/10gy single dose , beam polychemotherapy , cbv polychemotherapy or tbi 1014gy ; busulfan 16 mg / kg are considered as myeloablative .
patient and donor consent for hla typing and for the analysis of clinical data were obtained .
the study was approved by the ethical review board of the university of ulm ( project number 263/09 ) .
all patients and donors were high resolution typed for hla - a , -b , -c , -drb1 and -dqb1 .
ambiguities within exons 2 + 3 for hla - class i and exon 2 for hla - class ii alleles were resolved .
ambiguities involving non - expressed ( null ) alleles were resolved according to nmdp confirmatory typing requirements .
differences in exon 2 and 3 for hla - class i alleles and exon 2 for hla - class ii alleles were considered as hla - mismatch irrespective of the vector of mismatches .
patient hla - c kir ligand status was inferred from high resolution hla - c typing ( c1=asn80 ; c2=lys80 ) .
for univariate analysis of overall survival ( os ) , the kaplan - meier method and logrank testing was applied .
multivariate analysis for os and disease - free survival ( dfs ) was performed using extended cox - proportional hazards models . for trm and ri , univariate competing risks analysis and multivariate competing risks regression for stratified data
evaluated covariates were : patient age , hla - matching status , disease stage , conditioning regimen intensity , treatment with antithymocyte globulin ( atg ) , year of transplantation , time to transplantation , graft source , donor - recipient sex combination , kir ligand status , and donor origin ( national vs. international ) .
for antithymocyte globulin ( atg ) treatment , some data were missing ( table 1 ) .
models were validated by inclusion of missing values as a separate group and by omission of cases with missing values , and no bias was found .
violations of the proportional hazards assumption ( pha ) by disease stage , conditioning regimen intensity and transplantation before 2004 were adjusted using time - dependent modeling of these covariates .
a significant center effect was adjusted using a frailty term with gamma distribution . to assess the relationship between age and hla - compatibility , subgroups were formed and analyzed as factors : age group 1835 years ( hla - match : 10/10 , 9/10 and 8/10 ) , 3655 years ( hla - match : 10/10 , 9/10 and 8/10 ) , and over 55 years ( hla - match : 10/10 , 9/10 and 8/10 ) .
the cut - off value of 55 years for elderly patients has been used in previous studies and the cut - off value of 35 years is close to the arithmetic mean between the age boundaries in the remaining patients .
in addition , an interaction model between age and number of hla - mismatches was investigated .
the relative risk conferred by age was visualized as age - dependent risk in different hla - match categories relative to an 18-year old patient transplanted with a 10/10 matched donor as baseline . in this model ,
the covariate age was included as a continuous variable and no violation of the pha was found .
patients over 55 years of age formed the second largest age group ( n=1195 , 39.6% ) . the distribution of diagnoses reflects the current spectrum of indications , with acute myeloid leukemia ( aml ) being the most frequent diagnosis ( n=924 , 30.6% ) .
single hla - mismatches were present in 30.2% ( n=911 ) and double mismatches occurred in 8.7% ( n=261 ) of all patients .
although the proportion of hla - dq mismatches among double mismatched transplantations was slightly higher in older patients , there was no statistically significant difference in the distribution of 8/10 mismatches .
mac was used in 62.1% ( n=1875 ) of the patients , with peripheral blood stem cells ( pbsc ) being the leading graft source ( n=2694 , 89.2% ) .
more than half of the transplantations were performed in the years between 2008 and 2011 ( n=1671 , 55.4% ) .
table 2 and figure 1 show the results of the univariate os analysis in patients according to their hla - matching status and age group .
logrank - testing showed no significant difference between 10/10 , 9/10 and 8/10 matched transplantations in the youngest age group ( aged 1835 years ) . in the intermediate age group ( 3655 years ) a highly significant difference ( p<0.001 ) was found with higher mortality for patients transplanted with single or double mismatches . in patients over 55 years of age , the differences were even more pronounced , showing high mortality , especially in the 8/10 matching group ( p<0.001 ) .
kaplan - meier estimates for overall survival according to hla - matching status ( 10/10 black lines , 9/10 blue lines , 8/10 red lines ) in different age categories .
in multivariate modeling , these results could be confirmed for os showing no significant differences between single and double mismatched transplantations in the younger age group ( table 3 ) .
risk sharply increased with age in the respective mismatch groups , reaching the highest relative risk in the age group over 55 years ( hr : 3.48 , ci 2.494.86 , p<0.001 ) .
similar patterns were seen for dfs and trm with hazard ratios spreading with increasing numbers of hla - mismatches and increasing age , thus conferring highest risk for patients aged over 55 years with double hla - mismatches [ dfs : hazard ratio ( hr ) 2.74 , ci 2.003.76 , p<0.001 and trm : hr 3.79 , ci 2.296.30 , p<0.001 ] .
modeling an interaction term between age and number of hla - mismatches allowed estimation of age risk within matched , single - mismatched and double mismatched patient groups .
age risk showed increasing risk estimates with increasing number of hla - mismatches . in 10/10
matched transplantations , this additional risk per life year at time of transplantation was lowest ( hr : 1.015 , ci 1.0101.020 ; p<0.001 ) .
it increased , however , with the decreasing degree of hla - compatibility between donor and patient ( 9/10 , hr : 1.019 , ci 1.0141.024 , p<0.001 and 8/10 hr : 1.026 , ci 1.0201.031 , p<0.001 ) .
the interaction term for age and 2 hla - mismatches was significant ( p=0.009 ) .
the cox regression model is a multiplicative hazard model . in order to visualize the component of age - risk within the respective hla - match groups , the change of risk contributed to the prognosis by age at the time of transplantation
this visualization is based on the different age - associated risk estimates within each hla - match category as observed in the multivariate model for os , and it illustrates the change in risk with increasing age ( figure 2 ) .
relative risk contributed by the continuous covariate age at the time of transplantation according to different levels of hla - mismatches ( completely matched 10/10 : black , single mismatched 9/10 : blue , double mismatched 8/10 : red ) .
we found a statistically significant interaction between hla - matching status and age - associated risk .
this interaction can be interpreted as different levels of age - associated risk according to the number of hla - mismatches .
our findings substantiate that transplantation for patients aged over 55 years with two hla - mismatches are particularly risky with a highly significant hazard ratio of 3.48 ( ci 2.494.86 ; p<0.001 ) when compared to 10/10 matched patients younger than 35 years . if compared to 10/10 transplantations within each age category , double mismatches increased mortality risk for os by a factor of 1.14 in the lowest age group , by a factor of 1.40 in the middle age group , and 2.27 in patients aged over 55 years .
this disproportional increase and the poor one - year survival rate of only 19% in double mismatched transplantations for elderly patients highlights the importance of hla - matching especially in this group of patients .
luckily , donors with 2 hla - mismatches had to be accepted only in a small fraction of patients aged over 55 years ( 6.3% ) .
the age cohorts showed expected structural differences in composition with regard to diagnosis and conditioning regimen , as well as graft source .
multivariate analysis adjusted for differences in conditioning treatment , while graft source showed no differential impact on survival end points .
it is known that older patients tolerate conditioning related toxicity less well than younger patients , which is the reason for the development and the use of conditioning regimes with reduced intensity .
treatment - associated toxicity correlates strongly with transplant - related mortality and therefore it greatly influences os .
this relationship explains our findings from the perspective of transplant biology , suggesting that older patients tolerate hla - mismatches less well than younger patients as it is also the case for treatment - related toxicity . on the other hand
, it can not be deduced from this data whether younger patients benefit less from better - matched donors , as life expectancy is higher and hla - associated risk cumulates over time .
this finding was only made possible because of the relatively high proportion of older patients in our dataset .
as most of the transplantations were performed in the years between 2008 and 2011 , our dataset reflects the substantial increase in elderly patients transplanted in germany in recent years .
other large studies investigating the impact of risk factors in hsct contained significantly fewer older patients , which is why this interaction may have remained unnoticed in these studies .
interestingly , in the youngest age group , no significant difference was found between completely 10/10 matched transplantations and single or double mismatched transplantations .
however , this age category was the smallest , consisting of only 17.5% of the cases , which limits interpretation of this particular result .
testing for proportional hazards assumption in our models showed no significant violation for the covariate age , which was treated as a continuous variable in the interaction model and in the prediction plot ( figure 2 ) .
thus , the way we chose to visualize the disproportional increase in hazard ratios for age - risk at the time of transplantation is justified .
our results were obtained from a cohort transplanted with allogeneic unrelated pbsc or bone marrow as a graft source . in our analysis ,
graft source did not differentially impact outcome , which is why no separate analysis for each graft source was made .
data on the impact of haploidentical transplantation or cord blood transplantations on the outcome of hsct in elderly patients are very limited , so that a sensible risk - benefit comparison of our data with alternative graft or transplant sources is difficult .
however , cord blood transplantation has been reported to result in similar outcomes in a small cohort of single mismatched transplantations in elderly patients treated with ric . in multivariate analysis ( table 4 ) , some predictors showed violation of the proportional hazards assumption ( pha ) .
these violations can be explained by a higher early mortality for patients transplanted in advanced disease stage , transplanted before 2004 and treated with mac . to reflect this relationship
, an extended cox regression model was fitted to obtain regression estimates for the respective predictors according to time periods where pha is satisfied , as we have shown before . in analysis of os ,
advanced disease stage showed a substantially higher mortality risk until day 314 but not thereafter .
patients treated with ric showed a significantly lower early mortality until day 96 and a non - significantly different risk afterwards .
in addition , patients transplanted before 2004 showed a higher mortality risk until day 198 after transplantation but not thereafter .
also a patient c2c2 kir - ligand status as well as an international donor status was associated with adverse outcome , which we have reported before .
atg treatment was not included in the final models because it did not reach statistical significance .
our analysis encompassed some simplifications , namely that any hla - mismatch was considered equally .
hla - dpb1 mismatches were not included and the vector of mismatches was also not regarded .
we included hla - dqb1 mismatches in this study , because a previous analysis on the same dataset has shown that these mismatches are associated with higher mortality risk .
hla - dpb1 mismatches have been shown to influence outcome of hsct , but due to lower linkage disequilibrium , hla - dpb1-mismatches in hla - a , -b , -c , -drb1 and -dqb1 matched and mismatched transplantations are almost equally distributed .
therefore , we may assume that our results are not biased by not including hla - dpb1 .
the vector of mismatches was not considered , because no significant differences in survival outcome have been seen for unidirectional mismatches when compared to bidirectional mismatches for the end points analyzed in our study .
we refrained from including karnofsky performance status and donor - recipient cytomegalovirus status due to the high proportion of missing data for these variables , which is a limitation of our analysis .
when selecting donors for elderly patients , the additional risk associated with hla - mismatches in this age group should be considered .
especially when only donors with double hla - mismatches are available for such a patient , the substantial risk conferred in this situation must be carefully weighed against the benefit of transplantation .
cord blood transplantation might be an alternative in such cases , although data regarding the impact of alternative graft sources for transplantation of elderly patients are still limited .
| we investigated a possible interaction between age - associated risk and hla - mismatch associated risk on prognosis in different age categories of recipients of unrelated hematopoietic stem cell transplants ( hsct ) ( n=3019 ) .
patients over 55 years of age transplanted with 8/10 donors showed a mortality risk of 2.27 ( ci 1.703.03 , p<0.001 ) and 3.48 ( ci 2.494.86 , p<0.001 ) when compared to 10/10 matched patients in the same age group and to 10/10 matched patients aged 1835 years , respectively . compared to 10/10 matched transplantations within each age category , the hazards ratio for 8/10 matched transplantation was 1.14 , 1.40 and 2.27 in patients aged 1835 years , 3655 and above 55 years . modeling age as continuous variable showed different levels of risk attributed to age at the time of transplantation [ os : 10/10 : hazards ratio 1.015 ( per life year ) ; 9/10 : hazards ratio : 1.019 ; 8/10 : hazards ratio 1.026 ] .
the interaction term was significant for 8/10 transplantations ( p=0.009 ) .
findings for disease - free survival and transplant - related mortality were similar .
statistical models were stratified for diagnosis and included clinically relevant predictors except cytomegalovirus status and karnofsky performance status .
the risk conferred by age at the time of transplantation varies according to the number of hla - mismatches and leads to a disproportional increase in risk for elderly patients , particularly with double mismatched donors .
our findings highlight the importance of hla - matching , especially in patients over 55 years of age , as hla - mismatches are less well tolerated in these patients .
the interaction between age - associated risk and hla - mismatches should be considered in donor selection and in the risk assessment of elderly hsct recipients . |
hot water epilepsy ( hwe ) is a well - defined entity within the forms of reflex epilepsies , which occurs while bathing with hot water .
allen first described hwe in 1945 and subsequently there have been many reports of its prevalence in both children and adults .
hwe is a term used to encompass a reflex epileptic condition , characterized by pouring hot water ( 4050c ) on the head . although it has been reported from all parts of the world , it is more prevalent in south indian population as most of the reported cases have been from there .
it has been rarely reported in other european countries and isolated case reports have been published from japan and turkey .
the differences among countries may depend on climatic conditions , bathing habits and probably genetic susceptibilities . here ,
a 1-year - old saudi male child had presented to the emergency ward with history of generalized seizures .
mother noticed that after pouring hot water on the head , while giving the ritual bath , the child suddenly became floppy and developed generalized seizures with loss of consciousness .
mother admitted that there was family history of similar seizures in her sister 's child , following hot water bath . while examination , the child was afebrile , conscious , moving all four limbs and there were no long tract signs .
routine blood tests , including complete blood count , biochemistry and neuroimaging [ magnetic resonance imaging ( mri ) brain study ] as well as sleep eeg were within normal limits .
diagnosis of hwe was made and the parents were counseled regarding its benign course and no anti - epileptic medications were prescribed .
parents were advised to reduce the temperature of the water to tolerably lower levels , while giving bath to this child . in the follow - up visits , although the seizure recurrences were not encountered , there was one episode of minor motor fit when the boy stepped into the bath tub with his elder brother , accidentally .
parents were convinced about the problem of their child and were aware of the correct temperature of the water which would not trigger the seizures in him .
an 11-year - old saudi girl was referred for the evaluation of seizure disorder ; she was diagnosed with epilepsy elsewhere and was on regular anti - epileptic medication , namely sodium valporate . on questioning , she had been getting generalized brief convulsions whenever she was bathing with hot water and there was no improvement with the above medication .
she admitted that splashing water only on her body never induced seizures on her , while a head bath had invariably precipitated it .
there was no family history of seizures and , interestingly , though the father was of saudi origin , her maternal grandparents were from india .
apart from routine blood tests , eeg and mri brain studies were done and showed normal reports .
genetic studies could not be offered because of the technical as well as financial constraints .
the father and the patient were counseled in detail regarding the water temperature reduction while bathing and the medication was withdrawn . in the follow - up visits
, the patient had a few infrequent seizures initially and later she became seizure - free after water at the correct temperature was used , as per our advice .
a 1-year - old saudi male child had presented to the emergency ward with history of generalized seizures .
mother noticed that after pouring hot water on the head , while giving the ritual bath , the child suddenly became floppy and developed generalized seizures with loss of consciousness .
mother admitted that there was family history of similar seizures in her sister 's child , following hot water bath . while examination , the child was afebrile , conscious , moving all four limbs and there were no long tract signs .
routine blood tests , including complete blood count , biochemistry and neuroimaging [ magnetic resonance imaging ( mri ) brain study ] as well as sleep eeg were within normal limits .
diagnosis of hwe was made and the parents were counseled regarding its benign course and no anti - epileptic medications were prescribed .
parents were advised to reduce the temperature of the water to tolerably lower levels , while giving bath to this child . in the follow - up visits , although the seizure recurrences were not encountered , there was one episode of minor motor fit when the boy stepped into the bath tub with his elder brother , accidentally .
parents were convinced about the problem of their child and were aware of the correct temperature of the water which would not trigger the seizures in him .
an 11-year - old saudi girl was referred for the evaluation of seizure disorder ; she was diagnosed with epilepsy elsewhere and was on regular anti - epileptic medication , namely sodium valporate . on questioning
, she had been getting generalized brief convulsions whenever she was bathing with hot water and there was no improvement with the above medication .
she admitted that splashing water only on her body never induced seizures on her , while a head bath had invariably precipitated it .
there was no family history of seizures and , interestingly , though the father was of saudi origin , her maternal grandparents were from india .
apart from routine blood tests , eeg and mri brain studies were done and showed normal reports .
genetic studies could not be offered because of the technical as well as financial constraints .
the father and the patient were counseled in detail regarding the water temperature reduction while bathing and the medication was withdrawn . in the follow - up visits ,
the patient had a few infrequent seizures initially and later she became seizure - free after water at the correct temperature was used , as per our advice .
reflex epilepsy is a condition in which seizures are provoked exclusively by an external stimulus and account for 6% of all epilepsies .
hwe is an unusual form of reflex epilepsy , precipitated always , by bathing in hot water .
both partial and generalized tonic seizures have been described secondary to hot water bathing , suggesting that the seizures might be influenced by the same afferent pathway .
most of the reported cases in the past were from southern parts of india and none of our patients had their origin from there , as they were born to saudi parents , although the first saudi patient 's mother had an indian origin . hot water is known to precipitate severe myoclonic epilepsy in infants , but hwe is an unique form of generalized or partial tonic , clonic seizures , even reported exceptionally with cold water , during tub bathing or taking a shower .
the exact mechanism of hwe remains uncertain and seizures had been reported during a bath even when water is not poured over the head .
ritual immersion baths at temperature around 45c are reported to trigger epileptic fits . at this higher temperature of water
thus , an aberrant thermo - regulatory center , which is sensitive to sudden spurt in regional temperature following hot water bath , could be the precipitation cause for hwe .
another reasonable mechanism , described on physiological grounds , could be a defective inhibitory influence over afferent volleys of somatosensory stimuli such as warm or hot water poured over large body surface . in this context
, hwe could be comparable to febrile seizures in the above - suggested mechanism of occurrence , although fever - induced fits were not significant in these patients .
an experimental animal model mimicking hwe has been developed in order to understand the pathophysiological mechanism .
familial clustering in hwe has suggested a genetic component as the probable cause of the disorder and a genetic locus in the 10th chromosome had been identified ( 10q21,3-q22,3 ) .
the diagnosis is entirely based upon history only , as inter - ictal electroencephalography and neuroimaging studies were reported to be normal .
shankar et al . had reported autopsy findings in three patients with hwe and concluded that there could be an aberrant thermoregulation in such genetically susceptible patients with possible environmental influences .
reframed the term as bathing epilepsy rather than hot water epilepsy because their patients had seizures with warm water but not with hot water .
postulated altered autonomic regulations or some form of channelopathies as the underlying mechanisms for this disorder .
satishchandra related this disorder as a form of geographically specific epilepsy syndrome , where some cases might have genetic basis with added environmental influence .
there is no role of anti- epileptic treatment in hwe because of its symptomatic nature of seizures ; altering the temperature of water or changing the method of washing would prevent the occurrence of these seizures .
anti - epileptic drugs are only indicated when such patients continue to have seizures even during regular baths with normal water temperature or non - reflex seizures .
since seizures show a tendency to decrease spontaneously , withdrawal of medication , if it had been given , should be carefully undertaken only after several months .
the above two case descriptions were made to highlight the rarity of its occurrence and to emphasize that hwe could be controlled exclusively by lifestyle modification without resorting to anti - epileptic medication . | hot water epilepsy is a form of reflex epilepsy in childhood .
we report two children from saudi arabia , who presented with seizures following pouring hot water on their head , while bathing .
they were not treated by anti - epileptic medication . by decreasing the temperature of the water used for bathing ,
the seizures were avoided to a large extent in them .
this form of epilepsy is reported to be seldom present in various countries but there are no records of its presence in saudi arabia . |
nonalcoholic fatty liver disease ( nafld ) is the most common cause of abnormal liver function tests in primary care in industrialized countries .
it is associated with insulin resistance ( ir ) and is considered as the hepatic manifestation of the metabolic syndrome ( mes ) .
the reported prevalence of nafld varies widely depending on the studied population , the diagnostic modality , and the definition . according to the latest data , 2030% of european and middle east population have nafld , with an incidence of 39/100.000 inhabitants in the uk . in usa
the prevalence of nafld as assessed by mr spectroscopy is 34% , while it is lower in the far east ( 15% ) .
ultrasonography , in association with routine laboratory investigations , is an acceptable first line test to identify patients with nafld , even if it has suboptimal sensitivity and reproducibility , being an operator - dependent technique . from a histological point of view
, nafld encompasses a wide spectrum of liver pathology , from simple steatosis to steatohepatitis , fibrosis , and cirrhosis .
while simple steatosis is associated with a low risk of progression , patients with nash , estimated to be 1520% of the nafld population , have increased risk of liver - related morbidity and mortality from cirrhosis and development of hcc [ 6 , 7 ] .
other metabolic risk factors , such as the presence of metabolic syndrome , are associated with more severe liver disease .
the pivotal issue in the management of patients with nafld is the diagnosis of steatohepatitis and fibrosis at an early stage .
this would allow the identification of those patients who require stricter follow - up , targeted lifestyle interventions for weight reduction , management of the components of the metabolic syndrome , and eventual inclusion in trials of new treatment strategies .
liver biopsy is the gold standard for diagnosing nash and assessing fibrosis , though its limitations are well known : potential risk of sampling errors , intra- and interobserver variability , invasiveness , and scarce tolerability by the patient [ 10 , 11 ] .
these characteristics , together with the high prevalence of hepatic steatosis and its low risk of progression in the majority of affected people , make liver biopsy an inappropriate first line tool for diagnosis in unselected patients .
noninvasive liver fibrosis tests have been extensively developed recently and offer alternatives for staging fibrosis . in this review ,
in the last years , we have witnessed explosive development and use of noninvasive fibrosis tests ( table 1 ) .
these can be divided into three categories , namely , simple or indirect serum markers , direct serum markers , and imaging modalities .
( i ) indirect or class ii serum markers consist of routine biochemical tests such as transaminases , platelet count , and albumin that are usually combined with demographic characteristics potentially linked to liver fibrosis such as age or diabetes .
indirect serum markers and panels usually have dual cut - offs : a high cut - off with high specificity and a low cut - off with high sensitivity . if these cut - offs are combined , depending on the clinical scenario and prevalence of the examined disease , the numbers of false positive and false negatives are minimized .
however , a proportion of patients will fall in the indeterminate range of values and will therefore need further testing .
( ii ) direct or class i serum markers detect the fibrogenic process and the extracellular matrix turnover .
such markers include hyaluronic acid , collagenases and their inhibitors ( timp ) , and profibrotic cytokines ( tgf beta ) .
although they perform better than indirect serum markers , their sensitivity is low in the initial stages of fibrosis and they are not routinely available in most clinical laboratories .
( iii ) imaging modalities measure the elasticity and/or stiffness of the liver tissue with mr and us techniques .
transient elastography ( fibroscan , echosens , paris , france ) is a noninvasive us - based technique in which a low - frequency ( 50 hz ) elastic shear wave is generated by a transducer and then propagates through the tissues .
the speed of propagation is proportional to the stiffness of the crossed tissue and its measurement can , through specific software , provide values of liver stiffness expressed in kilopascal ( kpa ) .
the volume of liver studied with this method is a cylinder of 1 4 cm length , therefore 100 times bigger than a sample taken by liver biopsy .
te has already been incorporated in the international guidelines for chb and chc for pretreatment fibrosis assessment [ 17 , 18 ] and it has also been evaluated as a potential technique to predict the presence and degree of portal hypertension [ 19 , 20 ] and hcc . in arfi ( acoustic radiation force impulse ) , the elastography system is integrated on an ultrasound machine , allowing the operator to select the site of liver stiffness measurement ( lsm ) through a real - time b - mode ultrasonography and localize the shear wave avoiding vessels and ribs . this technique showed a similar accuracy when compared to fibroscan [ 2224 ] in detecting fibrosis and/or cirrhosis .
the range of measured values is narrower than fibroscan , while quality criteria for arfi have not yet been established . the supersonic shear imaging ( ssi ) or shear wave elastography is also built on a us device but , while arfi is based on the emission of a single pulse wave , in ssi the transducer emits several wave fronts at increasing depth , with a frequency band ranging from 60 to 6000 hz .
it generates real - time color mapping of the elasticity , which is integrated in a standard b - mode image , allowing a quantitative representation of the tissue elasticity
. the final value will be the average of many obtained by selecting the region of measurement with guidance from both the b - mode and swe images .
magnetic resonance elastography ( mre ) combines the ability of elastography to provide information about liver tissue texture to the advantages of mr , which allows the assessment of the entire liver rather than a small part .
the main limitation of all the above noninvasive liver fibrosis tests is the absence of uniformly established and validated cut - offs for different disease etiologies and fibrosis stages .
both serum levels of aspartate aminotransferase ( ast ) and alanine aminotransferase ( alt ) may increase in patients with nafld and this is more prominent for alt rather than ast .
however , the increase is not proportionate to the liver inflammation or fibrosis and it is well documented that patients with significant fibrosis may present with normal transaminases .
data from different studies report a low accuracy for alt levels in predicting nash , with an area under the curve ( auc ) of 0.6 [ 29 , 30 ] . reducing the upper limit of normal cut - off value for alt from 30 to 19 u / l showed an improvement of sensitivity in a cohort of 233 patients undergoing bariatric surgery , but at the expense of specificity . in the last ten years
, emerging data suggested that hepatocellular apoptosis , a genetically determined form of cell death , may have a significant role in the transition from simple steatosis to nash . within the apoptotic process
the main substrate in the liver is cytokeratin 18 ( ck-18 ) , which is an intermediate filament protein . in total
there have been more than eight studies exploring the diagnostic accuracy of ck-18 fragments levels in nash .
the main issue is that the cut - offs for diagnosis of nash varied among studies ; therefore this remains an unvalidated test . in a cohort of 139 patients with biopsy - proved nafld
compared to 155 healthy controls , ck-18 fragments levels independently predicted the presence of nash ( auc 0.83 ) with a sensitivity of 0.75 and specificity of 0.9 .
similar results were obtained by the same group in a cohort of 201 pediatric patients . in a recent study , involving a multiethnic population of 424 patients ,
ck-18 fragments levels showed a high specificity for nafld and fibrosis but a limited sensitivity / specificity for nash ( 58%/68% ) .
therefore , ck-18 is not an adequate screening tool to discriminate nash or early fibrosis in nafld patients .
terminal peptide of procollagen iii ( piiipn ) , involved in fibrogenic processes , was evaluated in a single validation study on 136 subjects with nafld ( 71 in validation cohort ) as marker of nash and developing fibrosis .
although its performance was promising , with an auc of 0.850.87 , further validation studies in larger cohorts are needed .
nash diagnostic is a proprietary test which encompasses serum levels of cleaved ck-18 , adiponectin , and resistin .
it was tested in a cohort of 101 patients that also included a validation group of 32 patients and showed a moderate reliability for discriminating nash from simple steatosis ( auc of 0.85 and 0.73 in the derivation and validation cohort , resp . ) .
the same panel was reevaluated in an independent sample of 79 patients and had a suboptimal auc of 0.7 .
thus , a new model was subsequently developed by the same group , namely , the nash diagnostic panel that consists of presence of diabetes , gender , bmi , serum triglycerides , ck-18 fragments , and total ck-18 levels . although the auc was greater ( 0.8 ) than those for nash diagnostics or ck-18 fragment levels alone ( 0.7 and 0.71 , resp . ) , this test needs further validation in independent cohorts . the nashtest comprises 13 serum and clinical parameters , namely , total bilirubin , ggt , 2-macroglobulin , apolipoprotein a1 , haptoglobin , age , gender , weight , height , ast , serum glucose , triglycerides , and cholesterol , and divides patients into three categories : not nash , borderline nash , and nash .
nashtest showed a low sensitivity but high specificity in diagnosing nash with an auc ranging between 0.7 and 0.83 .
nashtest was also used in patients with hyperlipidaemia and morbid obesity and showed aucs of 0.8 and 0.77 , respectively , for the diagnosis of nash [ 39 , 40 ] .
nafic score was derived and validated in a cohort of 117 and 442 japanese biopsy - proven nafld patients .
the score , ranging from 0 to 4 , was calculated considering cut - off values for serum ferritin , serum fasting insulin , and serum type collagen 7s .
the auc for predicting nash was 0.85 and 0.78 in the estimation group and validation group , respectively . in a backward validation study published in 2013 , nakamura et al
. showed that the sensitivity of the nafic score for diagnosing nash could further improve by adding different insulin levels ( auc 0.8 , se 72.0 , sp 62 , ppv 62 , and npv 72% ) .
therefore , nafic score is promising but requires further validation . in a small study of 58 patients ,
magnetic resonance elastography ( mre ) was highly accurate ( auc = 0.93 ) for discriminating patients with nash from those with simple steatosis , with a sensitivity of 94% and a specificity of 73% .
further validation is required , considering that mre is costly and not widely available in routine clinical practice .
the ast / alt ratio is a simple noninvasive test that can detect cirrhosis with a reasonable accuracy as shown in patients with chronic hepatitis c .
although data in patients with nafld are scarce , it is widely available and could be used in primary care .
however , alcohol use should be excluded , as patients with alcoholic steatohepatitis would get a false positive result .
ferritin is the primary tissue iron - storage in the liver but also an acute - phase protein ; therefore it can be induced in both cases of iron overload and inflammatory systemic diseases .
hyperferritinemia is prevalent in about 30% of subjects with nafld and can be the only altered laboratory parameter . whether high ferritin levels in patients with nafld are an expression of hepatic inflammation rather secondary to insulin resistance or represent true iron overload is still not clarified .
indeed patients with nafld often have mild to moderate hepatic iron accumulation , and phlebotomies may improve insulin resistance [ 4850 ] . therefore , serum ferritin has also been proposed as a marker of both nash and liver fibrosis . in a study of 628 patients with nafld , serum ferritin levels greater than 1.5 times the upper value of normal were independent predictors of advanced fibrosis . in another study of 482 patients with nafld , although hyperferritinemia was common , the extent of elevation did not correlate with the histological stage . in a study of 1201 patients with biopsy - proven nafld , serum ferritin levels increased with increasing histological grade of steatosis , lobular inflammation , and ballooning ; however its diagnostic performance for detecting presence of fibrosis was suboptimal ( auc of 0.6 , 0.57 , and 0.55 for detecting fibrosis , severe fibrosis , and advanced fibrosis , resp . ) .
the above data suggest that serum ferritin can not be used as a biomarker for nash or fibrosis on its own ; however it is incorporated in panels for liver fibrosis assessment as discussed later .
the aspartate aminotransferase to platelet ratio index ( apri ) has been proposed as a simple test for staging fibrosis in several chronic liver diseases , firstly in chc .
apri has been designed to detect significant fibrosis ( metavir f2 ) and cirrhosis with dual cut - offs in both stages .
studies in patients with nafld are scarce compared to other diseases and have not always used the recommended cut - offs . in a recent study involving 358 patients with biopsy - proven nafld , the sensitivity and specificity of apri with a cut - off > 1 for significant fibrosis were , respectively , 30 and 93%
. therefore apri , similar to other simple noninvasive panels , could be used to exclude significant fibrosis .
bard score includes body mass index ( bmi ) , ast / alt ratio , and diabetes and has been designed to detect significant fibrosis ( brunt score f3 ) .
its main limitation is its high false positivity , based on the overestimation of bmi and presence of diabetes . using a cut - off point 2 the sensitivity for the detection of advanced fibrosis was between 86.8 and 100% while the specificity ranged from 32.5% to 34.7% in different studies [ 5759 ] .
subsequently , an enhanced model of bard was attempted by adding inr to the panel .
this was tested in a small cohort of 107 patients and resulted in an improved composite score for sensitivity and specificity ( auc 0.88 versus 0.8 ) . in a population of 242 nafld patients
, the bard score had the lowest specificity , sensitivity , youden index , and predictive values for predicting both significant fibrosis and cirrhosis when compared with other ( simple and complex ) models for diagnosis of liver fibrosis .
nafld fibrosis score was constructed and validated in a population of 733 patients with nafld for detecting significant fibrosis ( brunt score f3 ) .
it consists of age , hyperglycemia , bmi , platelet count , albumin , and ast / alt ratio and has dual cut - offs .
the auc for significant fibrosis is 0.88 and 0.82 , with sensitivity of 81% and 77% and specificity of 77 and 71% applying the low cut - off score , and sensitivity of 51 and 43% and specificity of 98 and 96% applying the high cut - off score in the estimation and validation group , respectively .
therefore , this score can be used to triage patients in primary care , as it accurately diagnoses patients without significant fibrosis .
the fib-4 index was developed as a noninvasive panel to detect significant fibrosis in subjects with hiv - hcv coinfection and it has been independently validated in subjects with hcv infection [ 62 , 63 ] .
similar to the nafld fibrosis score it has dual cut - offs , that is , a low cut - off of 1.45 with a high sensitivity and a high cut - off of 3.25 with a high specificity .
fib-4 has showed a better accuracy in diagnosing advanced fibrosis in nafld patients when compared to other simple noninvasive tests in several studies ( overall auc 0.88 ) [ 64 , 65 ] .
both the nafld fibrosis score and fib-4 can be used in the primary care as triaging tests , in order to decide which patients do not have advanced fibrosis and therefore can be safely managed there .
hepascore is a proprietary test that includes age , gender , bilirubin , gamma - glutamyl transferase ( ggt ) , hyaluronic acid , and 2-macroglobulin .
this scoring system has been tested in nafld population in a study of 242 patients . in comparison with other serum biomarkers and complex scores it apparently had a good diagnostic accuracy for staging fibrosis ( auc , sensitivity , and specificity of 0.73 , 50.5% , and 88.3% for stage f2 , 0.81 , 75.5% , and 84.1% for stage f3 , and 0.9 , 87% , and 89% for cirrhosis , resp . ) . in another study
it was showed that its reliability may vary depending on the influence of fasting on hyaluronic acid values .
the enhanced liver fibrosis ( elf ) test is a simplified version of the original elf ( oelf ) panel whose diagnostic performance has been validated for a variety of liver disorders .
elf test is an algorithm that consists of hyaluronic acid ( ha ) , amino - terminal propeptide of type iii procollagen ( piiinp ) , and tissue inhibitor of metalloproteinase 1 ( timp-1 ) . in the first validation study in a nafld / nash population of 196 patients for the staging of liver fibrosis , the elf panel had good performance in distinguishing severe fibrosis ( stages 3 - 4 ) with an auc of 0.9 , but lower aucs for moderate fibrosis and absence of fibrosis ( 0.82 and 0.76 , resp . ) .
fibrotest is a biomarker of liver fibrosis initially validated in patients with chronic hepatitis c .
it consists of bilirubin , haptoglobin , ggt , 2-macroglobulin , and apolipoprotein - a and classifies patients into 3 categories , namely , presence / absence of a certain stage of fibrosis or indeterminate values .
the fibrometer nafld score is a proprietary panel of serum markers that has shown a high diagnostic accuracy for the staging of fibrosis . in a study of 235 nafld patients ,
the aucs for the fibrometer nafld score were 0.94 for significant fibrosis ( f2 ) , 0.93 for severe fibrosis ( f3 ) , and 0.9 for cirrhosis , with high sensitivity , specificity , ppv , and npv .
it is easily calculated from simple parameters and employing optimal cut - off values for the diagnosis of significant fibrosis , 97.4% of patients would be correctly classified .
all the above proprietary panels need independent validation by groups not involved in their creation and also in non - caucasian populations . in a multicenter study of 242 patients , complex models ( hepascore , fibrotest , and fib-4 ) were compared to simple models ( apri , bard ) . for the prediction of significant fibrosis ( f2 )
all these models had modest accuracy ( auc 0.710.74 ) with bard being least accurate ( auc 0.61 , p < 0.05 versus others ) , while hepascore and fib-4 had the highest specificity ( 88.3% and 87.5% , resp . ) .
for the prediction of advanced fibrosis ( f3 ) , all complex models provided specificity values > 80% , with hepascore providing the highest sensitivity ( 75.5% ) , while all models ( especially fib-4 and hepascore ) had a good accuracy ( auc 0.80.86 versus 0.7 , p < 0.05 ) . for the prediction of cirrhosis
complex scores had the best accuracy ( auc for hepascore 0.94 , fib-4 and fibrotest 0.86 ) .
a recent meta - analysis has reported that fibrotest , elf , and nafld fibrosis scores have significantly better diagnostic accuracy than bard score and apri , and their aucs did not significantly differ from each other .
ultrasonography , ct scan , and mri are commonly used in clinical practice for routine liver imaging .
they can detect advanced cirrhosis with signs of portal hypertension ( enlarged spleen and portal vein , and collateral venous circulation ) , but not fibrosis of lesser stages [ 76 , 77 ] .
transient elastography ( fibroscan ) is the most evaluated elastography - based technique for fibrosis assessment in nafld : it has been shown to be an accurate and reproducible methodology to discriminate patients without any degree of fibrosis from those with advanced fibrosis or cirrhosis both in adult and in pediatric nafld patients [ 78 , 79 ] .
a meta - analysis of 40 studies showed that elastography had good sensitivity and specificity for cirrhosis of different etiologies and less accuracy for lesser degrees of fibrosis but a precise validation of specific stiffness cut - off values for the various stages of fibrosis is still lacking .
it can give falsely elevated values in certain conditions , such as acute hepatitis , extrahepatic cholestasis , hepatic congestion , congestive heart failure , hepatic amyloidosis , and recent food intake .
moreover , using the conventional m probe , liver stiffness measurements are uninterpretable in 19% of the cases and this is mainly due to increased waist circumference and bmi , as it is frequently the case in patients with nafld .
a new dedicated xl probe for obese patients , which produces lower width shear waves , has been recently created .
xl probe has similar overall diagnostic accuracy when compared to m probe with an auc of 0.80.83 for fibrosis f2 , 0.850.87 for f3 , and 0.890.91 for cirrhosis [ 82 , 83 ] .
however , it generates lower stiffness values than the m probe ; therefore different cut - offs should be used . when using the m probe in all patients as first line and the xl probe in those failing the m probe measurements
in a recent study , liver stiffness was measured by fibroscan , arfi , and ssi and the results were compared with histological data .
pairwise comparison of aucs values between ssi , fibroscan , and arfi showed no significant difference in diagnosing mild fibrosis ( f1 ) or cirrhosis ( f4 ) .
ssi showed higher accuracy in diagnosing significant fibrosis ( f2 ) compared to arfi and in diagnosing severe fibrosis ( f3 ) compared to fibroscan . real - time
( rt ) elastography is another technique of interest , as shown in a cohort of 181 patients , with a diagnostic accuracy of 0.830.96 depending on the assessed fibrosis stage . in a recent retrospective analysis of 142 patients ,
mre showed good accuracy for the diagnosis of advanced fibrosis ( auc 0.95 ) with high sensitivity and specificity ( 0.85 and 0.93 , resp .
these are probably the best results obtained by a noninvasive diagnostic technique for the present .
all elastography - based techniques need universally applicable validated cut - offs across different fibrosis stages .
it has also become increasingly apparent that genetic factors may influence the development and progression of nash .
these are polymorphisms of genes that regulate oxidative damage , the inflammatory cascade , and priming of fibrosis .
the first such polymorphism described was a variant of patatin - like phospholipase-3 ( pnpla3 ) ( also called adiponutrin ) , derived from an isoleucine - to - methionine substitution at residue 148 ( single - nucleotide polymorphism or snp ) .
the gg genotype of pnpla3 in patients with nafld has been associated with more severe steatosis , presence of nash , and fibrosis [ 87 , 88 ] .
furthermore , it seems to correlate with an increased risk of atherogenesis and subsequent cardiovascular events .
carriers of the pnpla3 rs738409 minor ( g ) allele have also a higher probability to develop nafld - correlated hcc , especially of the poorly differentiated type .
another single nucleotide polymorphism which has been recently correlated with the development and prognosis of nafld is a glutamate to lysine amino acid substitution at residue 167 in transmembrane 6 superfamily member 2 ( tm6sf2 ) sequence ; the t allele of this gene is associated with the development of nafld , its progression to fibrosis and cirrhosis , and also altered cholesterol metabolism ; however there are some contradictions in literature and further studies are required to validate its role in larger cohorts of patients .
further potential genetic determinants of nafld and progression of liver fibrosis are being evaluated in genome - wide association studies and may be used in the future as noninvasive prognostic indicators .
for the present several noninvasive diagnostic strategies have been proposed as alternatives to liver biopsy in patients with nafld , with various levels of diagnostic accuracy . although the accurate diagnosis of nash is still not possible with available noninvasive tools , there are several scores that can diagnose advanced fibrosis ( f3 ) .
simple panels , such as fib-4 and nafld fibrosis score , are easily computable , have a high negative predictive value for advanced fibrosis , and have been validated against clinical outcomes .
therefore they could be used as first line test to rule out patients without advanced fibrosis and thus prevent unnecessary secondary care referrals in a significant number of patients .
more refined noninvasive tests such as fibroscan , hepascore , fibrometer , fibrotest , or elf could be used as second tier tests to further characterize patients , although this sequential approach needs prospective validation .
the development and validation of such noninvasive algorithms will likely limit the need for liver biopsy in a selected few in the near future . | nonalcoholic fatty liver disease ( nafld ) is prevalent in 2025% of the general population and is associated with metabolic risk factors such as obesity , diabetes mellitus , and dyslipidemia .
histologically , nafld ranges from simple steatosis to nonalcoholic steatohepatitis ( nash ) , fibrosis , and cirrhosis .
as nash develops in only 1015% of patients with nafld , it is not practical to biopsy all patients who present with nafld .
noninvasive fibrosis tests have been extensively developed recently and offer alternatives for staging fibrosis . despite their increasing use , such tests can not adequately differentiate simple steatosis from nash . at present
, such tests can be used as first line tests to rule out patients without advanced fibrosis and thus prevent unnecessary secondary care referrals in a significant number of patients . in this review we present the evidence for the use of noninvasive fibrosis tests in patients with nafld
. |
as the skull provides valuable information about individual human characteristics , its use in personal identification of human remains is of primary importance in medicolegal proceedings .
comprehensive comparative identification based on the skull depends on detailed anatomical , anthropological , and odontological studies . with a skull and antemortem radiographs of the skull or facial photographs , the technique of superimposing photographs with the radiograph of the skull on a scale of 1:1
although the technique is adequate , it also requires the investigation of the outline and topographical relationships of the skull to parts of the face , the facial tissue thickness , and correlations between various anthropometric points .
the presented case was firstly directed to a multidisciplinary forensic team , who concluded after arduous research , that another method should be implemented in order to identify the deceased .
the aim of this paper is to demonstrate how postmortem computed tomography and 3d computer - aided reconstruction of the head and skull can contribute to positive identification when used in a comparison process and superimposition test .
a preliminary investigation by police found an addressed letter in the man s jacket , and upon finding this letter , they assumed the deceased to be s. j. , a man who was known to have been homeless for many years .
homeless individuals in the area where the body was discovered were interviewed by police and were able to confirm that the first name of the deceased was s. , however they were not familiar with the individuals surname .
as they had not seen each other for many years and his appearance had changed dramatically , the supposed brother of the unknown man was also unable to make a positive identification of the body .
after the body was found at the scene , it was transported to and investigated at the department of forensic medicine , and , as there was no evidence of suspicious circumstances and no injuries were found either within the head or the rest of the body , the public prosecutor did not commission an autopsy . due to the lack of an autopsy ,
the possible cause of death had not been clarified . however , as identification was the primary goal , the considered opinion of the public prosecutor was that genetic and anthropological testing was , theoretically more likely to provide a positive identification .
the results obtained during the genetic analysis using a set of powerplexesx17 did not clearly confirm kinship in line brother brother ( fig . 1 ) .
in order to obtain larger amounts of genetic information , the samples were analyzed using str markers on chromosome y ( fig . 2 ) .
2results of genetic analysis using str markers on chromosome y ( a supposed brother and b unknown body ) results of genetic analysis using powerplexesx17 ( a supposed brother and b unknown body ) results of genetic analysis using str markers on chromosome y ( a supposed brother and b unknown body ) a comparison of photographic documentation of the missing person and the deceased individual was performed .
a decision by the public prosecutor not to allow facial hair to be shaved from the deceased resulted in the analysis of features and parameters from photographic documentation proving inconclusive ( fig .
3a comparison of photographic documentation of the missing person ( a ) and the deceased individual ( b , c ) showed concordance in some features a comparison of photographic documentation of the missing person ( a ) and the deceased individual ( b , c ) showed concordance in some features the dental records of the missing man were found , but any comparison with the dental status of the deceased was ruled out as he was edentulous .
the identification of the facial characteristics using antemortem and postmortem photos of the man was possible but not positive .
due to the lack of conclusiveness in the previous steps of the medicolegal investigation , the public prosecutor was advised , and granted permission for , the use the computed tomography exclusively for the identification .
full body ct scans were obtained , but the ct of the skull was most crucial for identification . neither the bones of the skull nor postcranial elements of the skeleton revealed the fractures .
the computer tomography of the deceased was performed using the somatom sensation 64 ( siemens ) .
slice thickness in our case was 0.625 mm as a standard for 64-slice ct scanner for further 2d and 3d reconstruction .
this allows reconstruction of volumetric data ( 3d ) on the accuracy level of about 1 mm .
window settings were as follows : wl between minus ( ) 600 and minus ( ) 500 ( 566 ) ; ww between 500 and 600 ( 585 ) .
three months had passed before the ct was performed , and the body being stored in a low temperature environment , it showed significant signs of drying .
the graphic 3d reconstruction of the skull and the head was made using the software in space ( fig .
4computer tomography of the deceased was performed using the somatom sensation 64 ( siemens ) .
3d ct reconstruction of the head ( a , b ) and the skull ( c , d , e , f ) were made using the software in space computer tomography of the deceased was performed using the somatom sensation 64 ( siemens ) .
3d ct reconstruction of the head ( a , b ) and the skull ( c , d , e , f ) were made using the software in space a reliability study had been carried out prior to the superimposition test .
ten skulls were scanned in ct , and the standard anthropological measurements were made in both skeletonized specimens ( with use of anthropometric tools ) and ct scanned images .
wilk test and student s t tests were applied , and it was statistically established that the 3d model accurately depicts the original specimen .
the photographs of the skeletonized skulls were then taken with the use of the standard digital camera ( canon eos 50d ) .
the image of the skull as seen in the photograph was compared to the image obtained in 3d reconstruction , and the high similarity in a shape and parameters was revealed . following the 3d reconstruction ,
the initial analysis of the face and bone features was conducted , and the results were compared with the antemortem photographs .
analysis of the ct images of the face and skull made it possible not only to identify and segregate elements which were anatomically unrecognizable in the body ( the evidence of nasal bone fracture ) , but were also used to observe and record useful identifying features and parameters .
bony details of the viscerocranium , especially the typical curvature of the base of the mandible as well as the shape and length of the mandibular ramus were noted and showed relation to the antemortem appearance .
the relation of eye to bony orbit , the characteristic convexity of the supra- and infraorbital margins , as well as the shape of the orbit showed similarities .
the facial characteristics as shown in the ct of the body showed a high degree of correlation with the facial features of the missing person ( fig . 5 ) . particularly important for
this conclusion was the ct reconstruction of the lower - face region because this area of the dead body was not available for any other comparison due to the presence of facial hair.fig .
5facial characteristics as shown in the ct images of the body ( b ) showed a high degree of correlation with facial features of the missing person ( a ) facial characteristics as shown in the ct images of the body ( b ) showed a high degree of correlation with facial features of the missing person ( a ) the proportions of the face , particularly in the midface region ( the relation of the external nose to the nasal aperture , small piriform aperture ) were also distinctive . based on a comparative analysis of the ct images of the face and skull with the antemortem facial features of the missing person
, it was concluded that the reconstructed skull and head shown in the antemortem photographic documentation could potentially belong to the same person .
it was concluded that the computed tomography was superior in comparison to the performed autopsy in imaging of the shape and characteristics of bones and also revealed characteristic proportions of the viscerocranium ( fig .
6superimposition ( c , d ) using 3d - reconstructed skull ct image ( a ) and antemortem photograph of the missing person ( b ) demonstrated compatibility of structural traits of all analyzed morphological elements of both skull and face superimposition ( c , d ) using 3d - reconstructed skull ct image ( a ) and antemortem photograph of the missing person ( b ) demonstrated compatibility of structural traits of all analyzed morphological elements of both skull and face the superimposition method had been applied to the head of the unidentified body as a means of making a positive identification .
currently , the standard craniofacial superimposition requires an actual skeletonized skull for the purpose of layering the skull with the facial image of a deceased person .
however , in this study , the skull was replaced by a 3d reconstruction of the skull of the deceased which was superimposed with facial photographs of the missing individual .
superimposition was made using graphic editing system adobe photoshop ( adobe systems ) with advanced image tools for maintaining the original ratio and size , brightness , contrast , intensity , color balance , color saturation , and brightness control .
the antemortem photograph of missing person ( s. j. ) was first scanned and then imported into the first layer .
afterwards , the image of the 3d model of the skull , oriented in the position most closely corresponding to the antemortem photograph , was imported into the second layer .
the procedure of relative placement of two images according to one plane accompanied by simultaneous interpenetration of the images ( superimposition one image over another ) was then conducted . during the superimposition procedure of the antemortem photograph over the skull and head images of the unidentified person ,
all image correlations as well as proper ( 1:1 ) scale of the head to the skull were controlled .
superimposition using 3d - reconstructed skull images demonstrated compatibility of structural traits of all analyzed morphological elements of the skull and face ( fig .
. an adequate degree of morphological consistency between the 3d - reconstructed skulls and persons in the facial images allowed for positive personal identification .
shortly thereafter , it was revealed that the two men had one mother but different fathers , leading to the conclusion that they were stepbrothers .
taking into consideration the ct data of the body along with the 3d reconstructed image of the skull with computer - aided superimposition , it was possible to positively identify the unknown individual as in fact being s.j . and
the results obtained during the genetic analysis using a set of powerplexesx17 did not clearly confirm kinship in line brother brother ( fig . 1 ) .
in order to obtain larger amounts of genetic information , the samples were analyzed using str markers on chromosome y ( fig . 2 ) .
the results connected the two individuals , but not in the male line . at this point in time , positive identification was still not possible .
2results of genetic analysis using str markers on chromosome y ( a supposed brother and b unknown body ) results of genetic analysis using powerplexesx17 ( a supposed brother and b unknown body ) results of genetic analysis using str markers on chromosome y ( a supposed brother and b unknown body )
a comparison of photographic documentation of the missing person and the deceased individual was performed . a decision by the public prosecutor not to allow facial hair to be shaved from the deceased resulted in the analysis of features and parameters from photographic documentation proving inconclusive ( fig .
3a comparison of photographic documentation of the missing person ( a ) and the deceased individual ( b , c ) showed concordance in some features a comparison of photographic documentation of the missing person ( a ) and the deceased individual ( b , c ) showed concordance in some features the dental records of the missing man were found , but any comparison with the dental status of the deceased was ruled out as he was edentulous .
the identification of the facial characteristics using antemortem and postmortem photos of the man was possible but not positive .
due to the lack of conclusiveness in the previous steps of the medicolegal investigation , the public prosecutor was advised , and granted permission for , the use the computed tomography exclusively for the identification .
full body ct scans were obtained , but the ct of the skull was most crucial for identification . neither the bones of the skull nor postcranial elements of the skeleton revealed the fractures .
the computer tomography of the deceased was performed using the somatom sensation 64 ( siemens ) .
slice thickness in our case was 0.625 mm as a standard for 64-slice ct scanner for further 2d and 3d reconstruction .
this allows reconstruction of volumetric data ( 3d ) on the accuracy level of about 1 mm .
window settings were as follows : wl between minus ( ) 600 and minus ( ) 500 ( 566 ) ; ww between 500 and 600 ( 585 ) .
three months had passed before the ct was performed , and the body being stored in a low temperature environment , it showed significant signs of drying .
the graphic 3d reconstruction of the skull and the head was made using the software in space ( fig .
4computer tomography of the deceased was performed using the somatom sensation 64 ( siemens ) .
3d ct reconstruction of the head ( a , b ) and the skull ( c , d , e , f ) were made using the software in space computer tomography of the deceased was performed using the somatom sensation 64 ( siemens ) .
3d ct reconstruction of the head ( a , b ) and the skull ( c , d , e , f ) were made using the software in space a reliability study had been carried out prior to the superimposition test .
ten skulls were scanned in ct , and the standard anthropological measurements were made in both skeletonized specimens ( with use of anthropometric tools ) and ct scanned images .
statistica 10.0 ( statsoft inc . , usa ) was used for statistical analysis . the shapiro
wilk test and student s t tests were applied , and it was statistically established that the 3d model accurately depicts the original specimen .
the photographs of the skeletonized skulls were then taken with the use of the standard digital camera ( canon eos 50d ) .
the image of the skull as seen in the photograph was compared to the image obtained in 3d reconstruction , and the high similarity in a shape and parameters was revealed . following the 3d reconstruction , the initial analysis of the face and bone features
analysis of the ct images of the face and skull made it possible not only to identify and segregate elements which were anatomically unrecognizable in the body ( the evidence of nasal bone fracture ) , but were also used to observe and record useful identifying features and parameters .
bony details of the viscerocranium , especially the typical curvature of the base of the mandible as well as the shape and length of the mandibular ramus were noted and showed relation to the antemortem appearance .
the relation of eye to bony orbit , the characteristic convexity of the supra- and infraorbital margins , as well as the shape of the orbit showed similarities .
the facial characteristics as shown in the ct of the body showed a high degree of correlation with the facial features of the missing person ( fig . 5 ) . particularly important for
this conclusion was the ct reconstruction of the lower - face region because this area of the dead body was not available for any other comparison due to the presence of facial hair.fig .
5facial characteristics as shown in the ct images of the body ( b ) showed a high degree of correlation with facial features of the missing person ( a ) facial characteristics as shown in the ct images of the body ( b ) showed a high degree of correlation with facial features of the missing person ( a ) the proportions of the face , particularly in the midface region ( the relation of the external nose to the nasal aperture , small piriform aperture ) were also distinctive . based on a comparative analysis of the ct images of the face and skull with the antemortem facial features of the missing person
, it was concluded that the reconstructed skull and head shown in the antemortem photographic documentation could potentially belong to the same person .
it was concluded that the computed tomography was superior in comparison to the performed autopsy in imaging of the shape and characteristics of bones and also revealed characteristic proportions of the viscerocranium ( fig .
6superimposition ( c , d ) using 3d - reconstructed skull ct image ( a ) and antemortem photograph of the missing person ( b ) demonstrated compatibility of structural traits of all analyzed morphological elements of both skull and face superimposition ( c , d ) using 3d - reconstructed skull ct image ( a ) and antemortem photograph of the missing person ( b ) demonstrated compatibility of structural traits of all analyzed morphological elements of both skull and face
the superimposition method had been applied to the head of the unidentified body as a means of making a positive identification .
currently , the standard craniofacial superimposition requires an actual skeletonized skull for the purpose of layering the skull with the facial image of a deceased person . however , in this study
, the skull was replaced by a 3d reconstruction of the skull of the deceased which was superimposed with facial photographs of the missing individual .
superimposition was made using graphic editing system adobe photoshop ( adobe systems ) with advanced image tools for maintaining the original ratio and size , brightness , contrast , intensity , color balance , color saturation , and brightness control .
the antemortem photograph of missing person ( s. j. ) was first scanned and then imported into the first layer .
afterwards , the image of the 3d model of the skull , oriented in the position most closely corresponding to the antemortem photograph , was imported into the second layer .
the procedure of relative placement of two images according to one plane accompanied by simultaneous interpenetration of the images ( superimposition one image over another ) was then conducted . during the superimposition procedure of the antemortem photograph over the skull and head images of the unidentified person , all image correlations as well as proper ( 1:1 ) scale of the head to the skull were controlled .
superimposition using 3d - reconstructed skull images demonstrated compatibility of structural traits of all analyzed morphological elements of the skull and face ( fig .
. an adequate degree of morphological consistency between the 3d - reconstructed skulls and persons in the facial images allowed for positive personal identification .
shortly thereafter , it was revealed that the two men had one mother but different fathers , leading to the conclusion that they were stepbrothers .
taking into consideration the ct data of the body along with the 3d reconstructed image of the skull with computer - aided superimposition , it was possible to positively identify the unknown individual as in fact being s.j . and
radiology is a noninvasive method used to investigate the human body and as such , plays a significant role in medicolegal investigations and in the identification of human remains .
the bony details such as form , size , shape , and individual characteristics are evident and consistent as shown by radiological means .
thus , the comparison of earlier with later radiological records is significantly important for forensic medicine and anthropology .
the potential value of ct in the possible determination of the cause of death , estimation of age or visualizing features likely to enable personal identification is reported . in some cases
the aptitude of postmortem ct methods in the identification of human remains is also reported .
computed tomography is commonly appreciated as it assists in confirming human identification , especially when antemortem ct records are used for comparison with postmortem radiographs [ 5 , 6 ] .
the contribution of ct may significantly contribute to forensic purposes , increasing the quantity and quality of information and may play an important role in facilitating quick identification . furthermore , ct can be used for 3d reconstructions which in turn serve as comparative material for the superimposition tests in unidentified cases .
the 3d reconstructions of the skull performed as part of the forensic postmortem examination were previously described [ 3 , 10 ] and its use as a valuable screening tool in identification procedures was suggested .
it is emphasized that the documentation in digital form provided by ct can be saved as data files and easily stored [ 11 , 12 ] and it facilitates the distribution and evaluation of the work by transmitting ct data digitally .
this case demonstrates that ct is quick and extremely precise , and thus well suited as a supplement method to the routine autopsy .
ct allows investigation of anatomic structures that are not easily available by autopsy and allows accurate analysis of bony structures .
the possibility of being able to reconstruct a variety of images to permit multiple and recurrent analysis long after the event occurred is a further advantage of the applied method .
the postmortem ct analysis of the skull showed that indeed much of the postmortem information required for identification can be gathered from ct data .
the following interpretation of the reconstructed images showed that the details provided by ct are much more valuable and determining for identification than obtained in other methods .
the viscerocranium is unique to each individual and remains constant throughout that individual s lifetime .
the analysis of craniofacial structures can be challenging for forensic anthropologists and forensic pathologists in postmortem examinations .
if the investigation is performed on the skeletonized human remains , the bony features are visible and easily accessible to experts .
the situation is much more complex if the bones are still covered by the soft tissues or for any ( i.e. , legal ) reasons , an autopsy is not advised .
computed tomography allows for 3d reconstruction of the skull and enables the evaluation of the individual morphological characteristics not available for examination if covered by the skin and soft tissues .
bony features , landmarks , shapes , and proportions are definitely distinct as observed in 3d reconstructions .
the high quality of the images contributing to reconstructions of the skull are crucial for the projection of bony structures and are of the same probative value as the skeletonized skull usually used for the superimposition .
ishii et al . also reported that 3d skull reconstructions and the use of these images in superimposition demonstrates an adequate degree of morphological consistency between the 3d - reconstructed skeletonized skulls and the facial images and thus is effective for personal identification of unidentified bodies .
however , the present paper demonstrates the use of ct in the scanning of the non - skeletonized body and confirms the effectiveness of this method if the skeletonized skull is not available for examination .
the computer - assisted superimposition applied for the comparison was crucial in determining positive identification , and it confirmed two investigated individuals to be the same person .
we found the case remarkable due to the positive identification of a deceased individual by performing a ct scan and comparing multiple bony landmarks and images with corresponding features in antemortem photographs by superimposition .
it is proved that the 3d reconstruction of the skull is as useful as a skeletonized skull for the superimposition test .
furthermore , the case illustrates the enormous potential for computerized tomography to complement the personal identification process . | computed tomography is commonly used in modern medicine , and thus , it is often helpful for medicolegal purposes , especially as part of the antemortem record . the application of postmortem computed tomography and 3d reconstruction of the skull in challenging cases is reported , and its valuable contribution to positive identification is discussed .
this paper presents a case in which the body of an unknown individual is identified .
positive identification had not been possible despite a multidisciplinary examination . the postmortem use of computerized tomography and 3d reconstruction of the skull followed by the comparison of individual morphological characteristics of the viscerocranium showed the concordant points between the deceased and a missing person . finally , superimposition using a 3d - reconstructed skull instead of the skeletonized skull demonstrated an adequate degree of morphological consistency in the facial images of the analyzed individuals that lead to positive identification .
it was concluded that where other methods of personal identification had failed , the use of postmortem computed tomography had proved to be instrumental in the positive identification of the deceased . |
recent investigations have demonstrated that increased intra - abdominal pressure ( iap ) during laparoscopic surgery , due to co2 insufflation , is associated with oliguria and anuria . using a porcine model ,
we have previously shown there to be a direct relationship between the decreased urine output and decreased renal vein flow during increased intra - abdominal pressures . while these effects appear to have no long term consequences , a better understanding of this renal physiology is important as the frequency and complexity of laparoscopic surgery increases .
some researchers have suggested that the decreased urine output is associated with reduced cortical blood flow and shunting of blood to the renal medulla .
other investigators have shown that direct compression of the kidney will result in a similar decrease in urine output . to date , the physiologic assessment of kidney function during a co2 pneumoperitoneum has included invasive monitoring with arterial and venous catheters , laser doppler needle probes placed in the renal cortex and mechanical compression of the kidney following surgical exposure of the kidneys .
all of these techniques may , in and of themselves , alter renal physiology and thereby obscure the actual effect of the pneumoperitoneum alone .
noninvasive evaluation of renal perfusion with magnetic resonance imaging ( mri ) has recently become feasible with the development of rapid data acquisition techniques .
the purpose of this study was to evaluate noninvasively the differential perfusion of the renal cortex and renal medulla , and renal artery and renal vein flow velocity during prolonged pneumoperitoneum in a porcine model , using mri .
six adult female farm pigs ( weighing 70 - 90 lbs ) underwent a standardized general endotracheal anesthetic .
cystoscopically , a guidewire was placed into the bladder and a foley catheter was positioned over the guidewire to provide continuous bladder drainage and urine output evaluation during the study .
a pulmonary artery catheter was placed via the internal jugular vein using a cut - down technique , to allow for monitoring of cardiac filling pressures and cardiac output during the study .
a left ventricular pigtail catheter was placed , via a carotid artery cut - down technique , to allow bolus injection of radioactive microspheres and gadolinium .
a femoral artery line was placed using a cut - down technique to allow blood gas monitoring throughout the experiment and to allow blood withdrawal during microsphere injections .
intravenous fluid was administered at 100 cc / hr with additional fluid bolus dosing applied to maintain the central venous pressure at 10 - 12 mm hg .
all of the animals underwent two mri sessions in a 1.5 tesla whole body imaging magnet ( vision , siemens medical systems , iselin , nj ) .
the initial scan established a baseline renal vein and artery blood flow velocity , and renal parenchymal perfusion .
for perfusion evaluation , immediately prior to , and following , a bolus injection of the contrast agent gd - dtpa ( 0.05 mmol / kg ) ( omniscan , gadodiamide , nycomed inc . , new york , ny ) , a series of 64 images at the same slice position was obtained using a double echo fast gradient echo technique during the first pass of the agent through the kidney .
regions of interest ( roi ) were selected in both the cortex and the medulla of the kidneys and the mr signal intensity versus time was plotted .
application of the dual echo sequence allowed detection of signal enhancement due to t1 effects alone , which are directly proportional to gd - dtpa concentration present in the tissues.6 the perfusion index , time to reach peak signal , was calculated to evaluate the difference in cortical and medullary perfusion .
absolute values of the renal artery and renal vein flow velocity were obtained using a cardiacgated cine phase - contrast flow quantitation sequence . after the baseline mri scan the six pigs were divided into two groups . in the control group ( n=3 ) ,
a 12 mm port was placed in the left upper quadrant , but no intra - abdominal insufflation was performed ; each pig was monitored during three hours of general anesthesia . in the study group ( n=3 ) , a 12 mm port was placed in the left upper quadrant and a 15 mm hg co2 pneumoperitoneum was established and maintained for three hours .
after three hours of pneumoperitoneum in the study group , or following three hours of general anesthesia in the control group , all six pigs underwent a repeat mri scan .
the same imaging sequences were used to evaluate and measure differential renal parenchymal perfusion , and renal artery and renal vein flow velocity following repeat injection of gd - dtpa ( 0.05 mmol / kg ) . during the evaluation period in both groups
, measurements were performed at 30-minute intervals , including : pulse rate , blood pressure , end - tidal co2 , cardiac output , urine volume , arterial blood gases and serum electrolytes .
urine samples were collected from all animals during the initial and second mri studies and the measurement of urine osmolality was performed . as an independent method of measuring renal perfusion ,
one hundred ci ( 3.7 bmq ) of 15 m diameter radiolabelled scandium 46 microspheres in one ml of saline were thoroughly mixed with an additional one ml of saline , and injected into the left ventricle near the time of the gadolinium injection for the baseline mri study .
using the same technique , strontium 85 radiolabelled microspheres were injected near the time of the second gadolinium injection and mr imaging . using an indwelling femoral artery line and an automatic calibrated withdrawal pump ,
blood was withdrawn at a constant rate of 10 ml / min during and following each injection , beginning about five seconds before injection and continuing for two minutes .
the contralateral kidney served as an internal control for the time to peak concentration of gadolinium using mr imaging measurements , and for the independent radiolabelled microsphere perfusion measurements . the change in time to peak gadolinium measurements and the change in microsphere perfusion measurements were similar for both kidneys ( within 10% ) in the cortex and medulla , supporting the reliability of these measurements . at the completion of the entire study 50 cc of intravenous potassium chloride
five biopsy samples , 0.5 to 1 cm , were taken from the inner cortex , the outer cortex , and the medulla of each kidney ; each sample was weighed and counted in a nai ( tl ) well scintillation detector .
values of cortical and medullary perfusion in units of ml / g / min , at baseline and during the study period , were determined from the separately recorded scandium 46 and strontium 85 count rates .
the mann - whitney , unpaired nonparametric statistical analysis was used in the comparison of renal vessel flow velocities and renal cortex and renal medulla perfusion and time to peak concentration of gadolinium .
statistical analysis of the comparison of the urine osmolality in the two study groups was performed with the wilcoxian signed rank test .
due to the small number of animals in the two study groups significant statistical analysis could not be determined ; however , trends were apparent on comparison of the various data .
the changes noted in urine output in the pneumoperitoneum and control animals were similar to those seen in our previous evaluation of the effect of pneumoperitoneum on renal function in the porcine model . during the first two hours of pneumoperitoneum , there was a decrease in urine output in the pneumoperitoneum animals compared to the control group .
the cardiac output decreased in the pneumoperitoneum group on average by 32% ( range 17 - 49% decrease ) ( table 1 ) . in the control group ,
the cardiac output increased an average of 92% ( range 24 - 160% increase ) . due to the wide range in standard deviation
there was no statistical difference in the decrease in cardiac output between the pneumoperitoneum and control groups .
effect of pneumoperitoneum on cardiac output ( mean standard deviation ) in the control group of animals the mean renal artery flow velocity decreased by an average of 7% from baseline ( figure 1 ) . in the pneumoperitoneum group the mean renal artery flow velocity decreased by an average of 20% .
there was no significant difference in the change of renal artery flow velocity comparing the control and pneumoperitoneum groups .
the mean renal vein flow velocity increased by an average of 6% from baseline in the control group .
however , the mean renal vein flow velocity decreased on average by 28% from baseline in the pneumoperitoneum group . despite the small study group size
, the reduction in renal vein flow velocity in the pneumoperitoneum group compared to the control group approached , but did not achieve , statistical significance ( p= 0.07 ) ( figure 1 ) .
the percent change in blood flow velocity f rom baseline , in the renal artery and renal vein , in the control and pneumoperitoneum study groups demonstrates the trend to decreased renal vein flow velocity during pneumoperitoneum ; this approached but did not achieve statistical significance .
the time to peak signal intensity after gd - dtpa administration in the control group was essentially unchanged , comparing the baseline and the three - hour mri scans ( table 2 ) .
the time to peak concentration of the gd - dtpa in the pneumoperitoneum group was increased by an average of 99% in the renal cortex and by an average of 79% in the renal medulla , correlating with decreased renal perfusion . in all animals
the time to peak enhancement was shorter for the cortex as compared to the medulla , consistent with the known greater blood flow of the cortex .
the longer time to peak concentration of gd- dtpa in the pneumoperitoneum group as compared to the control group for both the cortex and the medulla also approached , but did not reach , statistical significance ( figure 2 ) .
the increased time to peak concentration of the gadolinium in the pneumoperitoneum animals was essentially the same for the cortex and medulla .
comparison of time to peak concentration of gadolinium and microsphere perfusion in the renal cortex and medulla the change in time to peak concentration of gadolinium from baseline , in the renal cortex and medulla , in the control and pneumoperitoneum study groups demonstrates that the time to peak gadolinium concentration was increased in the pneumoperitoneum study group .
the change in gadolinium concentration time was similar in the renal cortex and medulla for both study groups . in the control animals
the evaluation of renal perfusion , utilizing radiolabelled microspheres , demonstrated an average 29% increase in the renal cortex perfusion and an average 32% increase in the renal medulla perfusion when compared to baseline values . in the pneumoperitoneum animals the microsphere perfusion evaluation demonstrated an average 28% decrease in renal cortical perfusion and an average 31% decrease in renal medullary perfusion ( table 2 ) .
again , there was a similar decrease in cortical and medullary perfusion in the pneumoperitoneum group .
there was also a similar increase in cortical and medullary perfusion in the control group .
the absolute renal perfusion was greater in the cortex than in the medulla in all animals .
these data corroborate the mri findings of decreased perfusion to both the cortex and the medulla for the pneumoperitoneum group as compared to the control group . for both groups
there was a highly similar change in perfusion comparing the left and the right kidney , for the cortex and the medulla ( less than 10% difference in percentage change of the individual renal perfusion values ) .
in the control group the urine osmolality increased from a mean of 661 mosm / kg to 840 mosm / kg during the three hours of anesthesia .
in the pneumoperitoneum group the urine osmolality decreased from a baseline mean of 665 to 544 mosm / kg during the three hours of 15 mm hg pneumoperitoneum .
comparison of the urine osmolality in the two groups showed a decrease in urine osmolality during the period of pneumoperitoneum , although this difference was not statistically significant ( p= 0.50 ) ( figure 3 ) .
the comparison of the change in urine osmolality from baseline in the control and pneumoperitoneum study groups demonstrates a decrease in the concentrating ability of the pneumoperitoneum group .
early clinical experience with laparoscopic nephrectomy demonstrated that prolonged periods of increased intraabdominal pressure of greater than two hours were associated with decreased urine output .
previous animal studies confirmed a direct correlation between a reduction in renal vein flow and urine output during prolonged periods of pneumoperitoneum .
other investigators have suggested that compression of the renal parenchyma may result in an alteration of the renal cortical and medullary blood flow and subsequently reduce the urine output .
some investigators have suggested a shunting of blood flow from the cortex to the medulla to explain the alteration in urine production .
however , all previous studies have employed invasive monitoring techniques to evaluate the renal vein and parenchymal blood flow during pneumoperitoneum .
these techniques may impact on the renal perfusion independent of the increased intra - abdominal pressure .
magnetic resonance imaging using phase - contrast techniques has the capability to quantify blood flow velocity in the main renal arteries and veins .
the mri results demonstrating a decrease in renal vein flow velocity with pneumoperitoneum were consistent with the renal vein flow results from our previous study using a renal vein flow catheter .
a functional approach to renal perfusion using dynamic gd - dota enhanced turboflash mri compares well with renal scintigraphy .
our experience with mri to evaluate renal perfusion in the porcine model demonstrated a brief learning period to applying parenchymal evaluations to calculate accurately the perfusion rates .
furthermore , on comparison to radiolabelled microsphere measurement of renal perfusion , the gold standard , the mri measurements were consistently in agreement with the microsphere calculations .
in addition , concerns about the difficulty of identifying the roi in small blood vessels on mr imaging were largely unfounded as our study findings on renal artery and renal vein flow velocity were similar to those previously reported during 15 to 20 mm hg pneumoperitoneum .
this study demonstrated that during a prolonged co2 pneumoperitoneum of 15 mm hg , there was a decrease in renal vein flow velocity and a decrease in renal parenchymal perfusion .
there was a similar reduction in the renal cortical perfusion and the renal medullary perfusion during 15 mm hg pneumoperitoneum .
there was no difference in the change of perfusion between the renal cortex and renal medulla during the period of increased intra - abdominal pressure .
oliguric renal failure has been associated with increased intra - abdominal pressure secondary to ascites , tumor , trauma , and retroperitoneal bleeding .
renal failure can result from reduced renal perfusion ; an ischemic , toxic , or obstructive insult to the renal tubule ; inflammation or edema within the tubulointerstitium ; or a reduction in the filtering capacity of the glomerulus .
intact renal tubular and glomerular function associated with a limited clearance secondary to reduced renal perfusion is defined as prerenal failure or azotemia .
prerenal azotemia is common in surgical patients and is usually reversible if the underlying cause of the hypoperfusion is corrected .
some drugs reduce renal blood flow and gfr secondary to their effects on the central circulation as a result of myocardial depression and peripheral pooling .
razvi and colleagues created unilateral , 15 mm hg compression in a dog model and showed that the effective renal blood flow decreased 26% and was associated with a 635 decrease in mean urine output from the treated kidney .
these results are similar to the effects that we have noted with mri and radiolabelled microsphere evaluation of the renal perfusion and the urine output during 15 mm hg pneumoperitoneum .
we similarly noted an approximately 30% reduction in renal parenchymal perfusion during 15 mm hg pneumoperitoneum .
interestingly , in razvi 's animal model the effective renal blood flow did not return to baseline following decompression , although the urine output increased 109% . in this study , cardiac output , flow in the renal vessels , and renal parenchymal perfusion were correspondingly decreased during increased iap .
however , from our previous work we similarly noted an increase in urine output and a return of renal vein flow , albeit slower , toward baseline following two hours of release of pneumoperitoneum . reduced cardiac output and a concomitant reduction in renal vessel flow may result in decreased renal plasma flow and glomerular filtration rate .
however , these effects would suggest a shunting of blood away from the cortex and functioning glomeruli to the medulla .
harmon and colleagues demonstrated that correcting the reduction in cardiac output , during 20 mm hg intra - abdominal pressure , by administration of a plasma expander , did not correct the observed renal dysfunction.18 in our previous animal study , we demonstrated that the administration of dopamine at 2 mcg / kg / min during pneumoperitoneum did not change the reduction in urine output .
compression of the renal parenchyma may result in diffuse small vessel obstruction , independent of the main renal vessel flow .
this would also correspond to a generalized and similar reduction of blood flow in both the medulla and the cortex .
our results , in conjunction with the report by razvi and colleagues , supports a directly mechanical compressive effect on the renal parenchyma as the primary cause of the decreased urine output and concentrating ability of the kidney during pneumoperitoneum .
the loss of the urine concentrating capacity of the kidney is one of the most sensitive indicators of intrinsic renal damage during renal hypoperfusion .
a reduction in urine osmolality , which may reflect injury to the renal medulla or the regulatory response of the kidney to decreased medullary perfusion , usually indicates prerenal azotemia . in our study , the decreased cortical and medullary perfusion state of 15 mm hg pneumoperitoneum was associated with a reduction in urine osmolality suggesting a direct effect on the concentrating ability of the renal tubules .
this may be secondary to the directly compressive effect on all tubules in the kidney , an associated sympathetic tone of the afferent arterioles , or due to hormonal changes ( e.g. , adh , renin ) and not directly related to the reduced renal vein flow .
this study demonstrated the usefulness of mr imaging to assess renal and parenchymal blood flow to the kidney .
the reliability of the renal perfusion measurements by mri and by radiolabelled microspheres is supported by using the contralateral kidney as a comparative internal control .
one of the limitations of the initial application of this technique included a brief learning curve , during the first one or two animals , to accommodate for the small vessel size and accurate identification of the roi for determination of vessel flow velocity and parenchymal perfusion .
the smaller size and greater pulsatility of the renal artery makes measurement of flow velocity more difficult than the same measurement in the renal vein .
however , definite trends were apparent in urine output , cardiac output , renal vessel flow velocity and parenchymal perfusion , which were in agreement with established techniques for evaluating these parameters .
it is important to recognize that these animal studies have been performed on essentially normal functioning kidneys .
the effect of the same perfusion reduction in the presence of pre - existing renal dysfunction is as yet unanswered .
as such , many investigators have suggested that the effect of prolonged pneumoperitoneum on renal function may be more significant at higher pressures or in patients with underlying renal function compromise .
magnetic resonance imaging provides a noninvasive evaluation of renal vessel flow and parenchymal perfusion during prolonged pneumoperitoneum .
increased intraabdominal pressure results in reduced cardiac output , lower flow velocity in the renal vessels , decreased renal parenchymal perfusion and a concomitant reduction in urine output .
the changes seen in renal perfusion are similar in the cortex and medulla ; no shunting phenomenon could be demonstrated .
the decreased renal perfusion during prolonged pneumoperitoneum in the normal kidney may result in a temporary loss of renal concentrating ability and decreased urine osmolality .
further laboratory and clinical evaluation will be necessary to assess the effect of prolonged pneumoperitoneum on the kidney with compromised renal function . | background : increased intraabdominal pressure ( ipa ) during laparoscopy has been associated with decreased urine output .
the purpose of this study was to use a noninvasive mri technique to measure renal vessel flow velocity and change in differential renal medulla and cortex perfusion during pneumoperitoneum.study design : six female farm pigs underwent general endotracheal anesthesia and dynamic imaging following left ventricular ( lv ) injection of gd - dtpa , utilizing a dual echo gradient echo sequence .
mri was repeated after three hours of continuous 15 mm hg pneumoperitoneum in three study pigs and after three hours of monitored general anesthesia without pneumoperitoneum in three control pigs .
renal artery and renal vein flow velocities were calculated using cine phase - contrast technique .
renal perfusion was independently measured by lv injection of radiolabelled microspheres.results:there was a decrease in mean renal vein flow velocity in the pneumoperitoneum group as compared to the control group .
during pneumoperitoneum there was a similar percentage reduction in the perfusion of the cortex ( -28% ) and medulla ( -31% ) ; this corresponded with a decreased urine output .
in addition , radiolabelled microspheres corroborated the similar decrease in both cortical and medullary perfusion rates during pneumoperitoneum.conclusions:prolonged iap is associated with a decrease in renal vein flow velocity and urine output .
there is a similar decrease in the renal medulla and cortex perfusion rates during pneumoperitoneum of 15 mm hg . |
some of the most fundamental cellular processes rely on anciently conserved non - coding rnas ( ncrnas ) .
these include , for instance , the ribosomal rnas which are assembled together to constitute ribosomes , the factories for translation of messenger rnas ( mrnas ) into proteins .
other ancient roles of ncrnas include the transport of amino acids through ribosomes via the transfer rnas ( trnas ) or the splicing of introns of pre - mrna which is mediated in part by the snrnas ( small nuclear rnas ) .
more recently , the crucial role of ncrna in post - transcriptional gene regulation has been highlighted by the discovery of micrornas ( mirnas ) , which repress gene expression by targeting semi - complementary motifs in target mrnas ( lee et al . , 1993 ) .
many additional classes of ncrnas have been discovered in the last decade reinforcing the view that they are of central importance in the functioning of cells from all the branches of life ( amaral et al . , 2008 ) .
amongst the various ncrna classes , we know probably least about the long non - coding rnas ( lncrnas ) .
in particular , what is the total number of lncrnas in mammalian genomes ? where are they localized ? what is their significance in the context of evolution , and particularly in the evolution of complex processing in primate brains ?
now that good catalogs of lncrnas have become available , the most critical question is to address the functionality of these transcripts .
this question is particularly acute given that we have no a priori methods for the prediction of lncrna function based on sequence alone , in contrast to proteins where confident inferences on protein function can be made by simply analysis of the amino acid sequence . given the sheer number of new unexplored lncrna transcripts ( 15,000 at last count ; derrien et al .
, submitted ) , the field must move forward to address this question of function by using large - scale functional screens .
such moves are already underway , with groups such as eric lander s carrying out sirna screens ( guttman et al . ,
large - scale analysis of protein - binding partners will also add another layer of valuable information to such annotation of lncrna catalogs .
hopefully , advances in bioinformatic annotation of rna structures ( torarinsson et al . , 2006 ; parker et al . , 2011 ) , and methods to predict functions based on this , will be developed . in this way
, we might build up a richly annotated catalog of lncrnas with functional predictions , that will enable us to integrate them into existing knowledge of the cell , and infer possible roles in human diseases .
one of the earliest examples was xist , a 19 kb non - protein - coding transcript which is responsible for the inactivation of one of the two x chromosome in placental females through dna methylation ( brockdorff et al . , 1992 ) .
others examples of lncrnas located in imprinted regions , such as airn ( sleutels et al . , 2002 ; nagano et al . ,
2008 ) , h19 ( gabory et al . , 2009 ) , nespas ( wroe et al . , 2000 ) , or kcnq1ot1 ( mancini - dinardo et al . , 2006 ; mohammad et al
are involved in the inactivation of gene expression via specific associations with chromatin - modifying complexes .
more recently , the hotair lncrna was shown to epigenetically repress the hoxd locus via the recruitment of the prc2 complex ( rinn et al . , 2007 ) . strikingly , this study described a trans mechanism of action of a lncrna located on human chromosome 5 which modulates expression of multiple genes clustered on human chromosome 4 ( hoxd locus ; rinn et al . , 2007 ) . supporting this hypothesis , two recent papers ( cabili et al . , 2011 ;
guttman et al . , 2011 ) showed that lncrnas primarily affect gene expression in trans .
the latter work used loss - of - function protocols to demonstrate that large intergenic ncrnas ( lincrnas ) both up- and down - regulate hundreds of genes expression in trans which support a primary role of lincrnas in the circuitry controlling embryonic stem ( es ) cell states ( guttman et al . ,
, previous studies showed that some lncrnas could also activate expression of protein - coding genes in their immediate genomic neighborhood .
this cis - mechanism of action was demonstrated by rom and colleagues who used interference rnas ( sirnas ) to knock down candidate lncrnas annotated as part of the gencode project ( harrow et al . , 2006 ) .
the inactivation of some of these lncrnas further triggers a down - regulation of protein - coding genes transcription located either in the same or opposite strand within 1 mb from the lncrna ( rom et al . ,
2010 ) suggesting the latter functions as a transcriptional activator . further supporting the cis - mechanism ,
a lincrna called hottip transcribed from the hox a locus coordinates the transcription of several genes localized in cis at the 5 of the hoxa locus ( wang et al . , 2008 ) .
hottip was shown to activate gene expression by recruiting the wdr5/mll complex and thus depositing the activating histone modification h3k4me3 .
for instance , about 12,000 actively regulated enhancer were identified based on their bindings to the transcriptional co - activator p300/cbp in mouse neurons ( kim et al . , 2010 ) .
using chipseq analysis to define rna polymerase ii binding sites , the authors also reported that 25% of the enhancers co - localize with rnapii sites suggesting that some enhancers are transcribed ; they termed these transcripts ernas for enhancer rnas ( kim et al . , 2010 )
. it will be important to functionally define whether such ernas are all required for enhancer function , or are simply a by - product of some non - functional transcription of enhancers by rna polii .
similarly it will be important to define whether the activating lncrnas ( rom et al . , 2010 ) are in fact a subset of ernas , or not .
while it is more likely that an lncrna regulates the co - expression of nearby protein coding genes ( as for tandemly duplicated genes , imprinted genes , or ubiquitously expressed genes ) , an interesting study demonstrate that modulating the expression of a particular locus will also trigger the modification of the expression of nearby transcripts by a mechanism known as ripple of transcription
( ebisuya et al . , 2008 ) . taken together and similar to the behavior of protein - coding genes , lncrnas seem to act both in cis and trans and are a key player of the regulation of gene expression .
for instance , recent work implies a non - coding rna , lincrna - p21 , in the p53 response though the modulation of multiple p53 dependent gene expression in trans ( huarte et al . , 2010 ) .
another example is meg3 , which is thought to directly activate the tumor suppressor gene p53 , although the mechanism has yet to be elucidated ( zhou et al . , 2007 ) .
finally , another long non - coding rna , called anril , located in the p15/cdkn2b p16/cdkn2a
p14/arf is genetically associated with diverse diseases such as diabetes , gliomas , coronary diseases , and basal cell carcinomas via genome - wide association studies ( gwas ; pasmant et al . , 2010 ; wapinski and chang , 2011 ) .
more generally , given the lack of annotation of human lncrnas , one could speculate on the impact of non - coding regions of the human genome in an answer to the missing heritability in gwas studies ( manolio et al . , 2009 ) .
indeed , given that at least a half of the human genome is transcribed into rna molecules ( carninci et al .
, 2005 ; encode project consortium et al . , 2007 ) , it is now exciting to further characterize the 80% of disease - associated variants that are located outside of protein - coding genes ( manolio et al . , 2009 ) .
it will be fascinating to observe whether it will be possible to specifically drug lncrna pathways , perhaps through the use of specific modified small oligonucleotides .
it is also worth mentioning that ncrnas can be detected in human bodily fluids and hold great promise as biomarkers ( gaughwin et al . ,
similar to that of protein coding genes , resources for the global annotation of lncrnas are needed in order to identify , classify and elucidate the roles of these transcripts within the cell machinery . particularly relevant
is the effort from john mattick s group to compile and centralize biologically meaningful information dedicated to lncrna ( amaral et al . , 2011 ) .
the lncrna database ( lncrnadb ) provides sequence , structural , and conservation evidence for mutli - species lncrnas together with a list of lncrnas that are experimentally known to interact with coding mrnas . in mouse in the early 2000s ,
the fantom consortium pioneered the genome - wide discovery of lncrnas publishing a set of 34,030 lncrnas based on cdna sequencing ( maeda et al . , 2006 ) .
more recently , guttman and colleagues used chromatin signatures via chipseq ( chromatin immuno - precipitation followed by high throughput sequencing ) to reveal 1,600 lincrnas ( guttman et al . , 2009 ) .
they further showed that some of these lincrnas are functional and transcriptionally regulated by key transcription factors such oct4 ( guttman et al . , 2009 ) .
while expressed in a wide range of tissue , lincrnas tend to be modestly conserved ( marques and ponting , 2009 ) as shown by using a neutral indel model which exploits the patterns of substitutions and insertions or deletions ( lunter et al . , 2006 ) .
the methodology employed by guttman and colleagues has been applied to human thus leading to the identification of about 3,300 lincrnas whose functional roles may include guidance of chromatin - modifying complexes to specific regions of the genome ( khalil et al . , 2009 ) .
very recently , the growing interest in lincrnas led to the annotation of more than 8,000 lincrna genes in human using a combination of computational methods and rnaseq experiments especially from the human body map ( hbm ) project ( cabili et al . , 2011 ; table 1 ) .
it is worth mentioning that many of the current rnaseq data ( including hbm ) mainly select rna transcripts harboring a polya tail at their 3end ( polya+ ) and therefore offer little information on transcripts lacking polya ( polya ) . to tackle this issue , sequencing technologies such as single - molecule sequencing ( sms ; pushkarev et al . , 2009 )
was used to estimate the abundance of ncrnas by avoiding amplification and minimizing sample preparation ( kapranov et al . , 2010 ) .
interestingly , this studies revealed that dark matter transcription may represent the majority of the total ( non - ribosomal and non - mitochondrial ) rna of a cell .
in addition , it shed light on a new class of very long ncrnas ( min size 50 kb ) , abundantly expressed and localized in intergenic regions of the genome , the so - called vlincrnas ( very long intergenic ncrnas ) .
focusing on the total rna of a cell rather than the highly selected polya+ transcripts seems to complement the latest catalog of lincrnas ( cabili et al . ,
we also recently showed that the gencode lncrna set tends to have higher polya representation compared to protein - coding mrnas ( derrien et al .
although many studies have concentrated on the intergenic lncrnas ( the lincrnas ) , this seriously underestimates the true number of lncrna transcripts in the genome .
approximately one third ( derrien et al . , submitted ) to one half ( jia et al . , 2010 ) of lncrnas
it seems therefore essential to annotate lncrnas both in intergenic and coding regions since ( i ) the exact boundaries of protein - coding genes is frequently subject to variations and reannotations ( denoeud et al .
, 2007 ; gingeras , 2007 ) and thus could lead to the revision of a lincrnas into a bona - fide lncrnas , ( ii ) thousands of protein - coding genes harbor natural antisense transcripts belonging to the lncrnas class ( he et al .
, 2008 ; iii ) numerous functional genic lncrnas overlapping protein - coding genes have been experimentally validated , especially in disease states ( faghihi et al . , 2008 ; pasmant et al . , 2011 ; wapinski and chang , 2011 ) .
a recent catalog of both genic and intergenic lncrnas has been released based on genome - wide computational approach combined with intensive manual annotation .
this led to the identification oh 6,736 lncrna genes in human ( jia et al . , 2010 )
among which 63% are localized within or in a close proximity ( < 10 kb ) of known protein coding genes ( jia et al . , 2010 ) .
most recently , the gencode annotation group has produced the most comprehensive , high - quality human lncrna annotation to date . in order to identify all evidence - based functional gene features in the human genome , the gencode group ( harrow et al . , 2006 ) within the encode framework ( encyclopedia of dna elements ; encode project consortium et al . , 2007 ) provides a high - quality collection of lncrnas .
gencode annotation involves manual curation , multiple computational analysis , and targeted experimental approaches , all together representing complementary methodologies for the complete identification of all human functional elements ( coding and non - coding genes ) . at present , the gencode collection ( version 7 ) comprises 14,880 lncrna transcripts arising from 9,277 distinct gene loci ( derrien et al . , submitted ) . in a recent study , we investigated whether these lncrnas are under negative evolutionary selection , indicative of functionality ( derrien et al . ,
evolutionary scores were computed based both on the phastcons program ( siepel et al . , 2005 ) and custom blast alignments within mammals in order to measure the conservation profiles of gencode lncrnas in comparison with protein - coding transcripts and ancestral repeats ( ars ) , the latter representing a good proxy for measuring neutrally evolving sequences ( ponjavic et al . , 2007 ) .
this lower sequence conservation may reflect the fact that functional rna structures are more robust in the face of sequence mutations and insertions deletions ( indels ) , compared to the higher constraints inherent of protein - coding open reading frames .
nevertheless , lncrnas and more especially , their promoters , showed statistically significant , non - random conservation , strongly suggesting a functional role for these ncrnas .
interestingly , about one third of the 15,000 lncrnas display a primate - specific pattern of conservation ( derrien et al . , submitted ) . using whole transcriptome sequencing ( rnaseq ) of 16 human cell lines produced in the framework of the encode consortium ( encode project consortium et al . , 2007 ) and 16 tissues from the human body map project ( www.illumina.com )
, we showed that 94% of the gencode lncrnas transcripts are expressed in at least one of these tissue / cell line studied .
strikingly , the level of expression of polya+ lncrnas is 1020 times lower than protein - coding transcripts reinforcing the need to use deep sequencing based technologies to identify these low expressed non - coding loci ( figure 1 . ) .
we also demonstrated that lncrnas tend to be enriched in nucleus in comparison with mrnas ; this latter observation being consistent with the idea that many lncrnas may be devoted to gene regulation in the nucleus .
finally , the question is raised as to whether lincrnas could encode very small peptides as shown by ingolia et al .
( 2011 ) . however , there is still conflicting evidence about this hypothesis since a recent study which used comprehensive mass spectrometry data ( ms ) produced as part of the encode project only found about a hundred of gencode lncrna to be matched by small peptides ( banfai et al . , submitted ) .
proportion of gencode polya+ lncrnas and protein coding at the gene ( n = 9,277 and 18,063 ; respectively ) and transcript levels with increasing thresholds of expression values ( rpkm ) in encode rnaseq experiments .
over the past decade , the estimation of the proportion of functional dna in the human genome has been constantly revised upward ( ponting and hardison , 2011 ) .
we now know that the human genome contains thousands of lncrnas , both genic and intergenic .
this new class of non - protein coding rnas ( ncrnas ) lack functional orfs , are modestly conserved and seem to negatively and positively regulate protein coding gene expression , in cis and trans .
diverse mechanisms of action have been observed ( see for reviews ponting et al . , 2009 ; nagano and fraser , 2011 ) suggesting that lncrnas are a fundamental regulators of transcription .
the classification of lncrnas remains difficult , and we presently have only a vague idea of what sub - categories exist , and how we might use experimental or sequence information to distinguish between such categories . with the ongoing and increasing number of rnaseq experiments characterizing transcriptomes of multiples cell lines and human tissues ( in particular within the encode consortium ) , it is likely that the number of annotated lncrnas will increase dramatically in the near future .
future studies will likely focus on identifying functional lncrnas , and those involved in human disease processes .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | the transcriptome of a cell is represented by a myriad of different rna molecules with and without protein - coding capacities . in recent years , advances in sequencing technologies have allowed researchers to more fully appreciate the complexity of whole transcriptomes , showing that the vast majority of the genome is transcribed , producing a diverse population of non - protein coding rnas ( ncrnas ) .
thus , the biological significance of non - coding rnas ( ncrnas ) have been largely underestimated . amongst these multiple classes of ncrnas , the long non - coding rnas ( lncrnas )
are apparently the most numerous and functionally diverse
. a small but growing number of lncrnas have been experimentally studied , and a view is emerging that these are key regulators of epigenetic gene regulation in mammalian cells .
lncrnas have already been implicated in human diseases such as cancer and neurodegeneration , highlighting the importance of this emergent field . in this article , we review the catalogs of annotated lncrnas and the latest advances in our understanding of lncrnas . |
in the first day of life , bilirubin production is increased to an estimated average of 8 to 10 mg / kg of body weight per day , an amount about two or three times greater than that of adults .
phototherapy is the most widely used form of therapy for the treatment and prophylaxis of neonatal hyperbilirubinemia .
several potential complications may occur with the use of phototherapy , such as retinal degeneration , fluid imbalance , and bronze baby syndrome .
some reports have demonstrated that home phototherapy may be an effective and safe alternative to prolonged hospitalization for healthy full - term neonates with jaundice .
clear advantages of home - centered phototherapy include : ( 1 ) reduced coast ; ( 2 ) avoidance of parent - infant separation ; and ( 3 ) parental satisfaction .
although some pharmacological agents such as activated charcoal or agar are suggested to treat neonatal jaundice , further study of this type of therapy is needed before to their routine clinical use .
mohammadzadeh et al studied the effect of clofibrate on reducing serum bilirubin of neonates beyond the first week of life .
badeli and colleagues determined the effect of clofibrate on uncomplicated hyperbilirubinemia of neonates during the first week of life .
the aim of the present study was determination the effect of 50 mg / kg of clofibrate on tsb of hyperbilirubinemia of neonates under home phototherapy .
from april 4 , 2007 to june 20 , 2008 60 neonates with uncomplicated hyperbilirubinemia who were under home phototherapy in rasht , iran , entered our study .
inclusion criteria were body weight between 25004000 grams with gestational age 38 to 41 weeks , breastfed , and having total serum bilirubin ( tsb ) between 14 to 20 mg / dl , with postnatal age above 72 hours .
infants with abo or rh incompatibility , g6pd deficiency , and conjugated hyperbilirubinemia or any concomitant disease were excluded .
portable phototherapy units consist of 4 special blue tubes placed 40 cm above the infant as home phototherapy .
patients were examined and a sample of serum bilirubin was taken daily . the neonates ( n=60 ) were randomly divided into two groups and they were matched regarding weight , sex , age and value of the first tsb .
30 neonates were allocated to clofibrate group ( group i ) and 30 neonates to control group ( group ii ) .
clofibrate group ( group i ) was given a single dose of 50 mg / kg clofibrate before starting phototherapy .
in the first day , laboratory tests included estimation of total bilirubin ( direct and indirect ) , blood group including rh of the mother and neonate , complete blood count ( cbc ) , g6pd activity , coombs test , reticulocyte count .
direct and indirect , as well as tsb were measured every 24 hours by the same laboratory till tsb dropped under 10 mg / dl .
data were analyzed using spss 10 ; t - test and anova were used for analyzing the data .
among 60 neonates , 30 infants consisting of 18 ( 60% ) females and 12 ( 40% ) males belonged to group i ( clofibrate ) and 17 ( 56.7% ) females and 13 ( 43.3% ) males to group ii ( control ) .
there were no statistically significant differences between the two groups regarding weight , age and first tsb value ( table 1 ) .
tbs values show significant difference between the two groups 24 and 48 hours after starting phototherapy at home .
mean ( sd ) phototherapy time in group i was 72(0.0 ) hours and in group ii 76.80 ( 9.76 ) hours .
mean ( sd ) age , weight and first tsb- value in the two groups sd : standard deviation tsb : total serum bilirubin comparison of mean total serum bilirubin ( mg / dl ) after 24 and 48 hours of phototherapy in the two groups the duration of phototherapy was significantly shorter in clofibrate group ( p<0.001 ) .
all neonates in group i needed phototherapy still after 72 hours but in group ii 24 ( 80% ) neonates had to receive phototherapy for 72 and 6 ( 20% ) for 96 hours .
serum bilirubin levels after physician 's examining were measured at beginning and 24 , 48 hours after phototherapy .
bilirubin of both groups was measured in the same laboratory . on serial daily examination during phototherapy and up to 2 days after that no problems or side effects were observed . also for a period of two months
in this clinical trial study we determined the effect of lower dose ( 50 mg / kg ) of clofibrate on neonatal hyperbilirubinemia in term neonates under home phototherapy . in the present study we demonstrated that in clofibrate group there was lower tsb after 24 and 48 hours home phototherapy compared with control group . also the neonates in group i needed to receive shorter phototherapy than those in group ii .
although there are advantages of home phototherapy , several potential complications may occur with its use . at present
there is no safe drug for treatment of neonatal icterus and shortening of phototherapy time .
metalloporphyrins and d - penicillamine act by inhibition of heme oxygenase , agar and charcoal by decreasing entrohepatic circulation .
the clofibrate and phenobarbital are potent inducers of microsomal enzymes that increase bilirubin conjugation and excretion .
clofibrate like phenobarbital is a hepatic bilirubin metabolism inducer , in addition causes 100% increase of hepatic bilirubin clearance within 6 hours with no drowsiness effect in contrast to the latter .
clofibrate when used as an antilipidemic agent in adults , has some side effects such as nausea , gastrointestinal disturbance , vomiting and loose stools .
none of these side effects were reported in neonates with a single dose of clofibrate[15 , 16 ] .
like phenobarbital , clofibrate increases bilirubin conjugation and excretion and is a better enhancer of glucuronosyl transferase induction causing 100% increase of hepatic bilirubin clearance within 6 hours , sooner than phenobarbital .
phenobarbital also causes drowsiness in neonates and may slow down the oxidation of bilirubin in the brain leading to worse bilirubin toxicity .
although we detected in our studies no side effects in infants with a single dose of clofibrate , determination of minimum and effective dose would be important .
this study demonstrated that a single dose of clofibrate ( 50mg / kg ) significantly reduces indirect hyperbilirubinemia in healthy breastfed term newborns with home - based phototherapy .
this result is similar to the studies of mohammadzadeh et al and badeli et al , noting that they used 100 mg / kg of the drug in hospitalized patients .
our study demonstrated that lower dose of clofibrate is effective on neonatal hyperbili - rubinemia receiving home phototherapy as well .
he found significant reduction in bilirubinemia at 16 hours and decrease in the intensity and duration of jaundice and also phototherapy requirement .
lindenbaum showed significant reduction 16 hours after treatment with clofibrate in tsb of 47 neonates .
other studies in iran and france confirmed the beneficial effect of clofibrate for reducing of tsb in babies with no risk factor for hemolysis . in conformity with those previous studies
, we did not detect any untoward complications during therapy and after two months follow up .
twenty mothers discontinued home phototherapy because of their own concern or others ' comments ; they were excluded of the study .
this study suggests that a lower dose of clofibrate is effective in outpatients with neonatal hyperbilirubinemia under home phototherapy .
further studies are needed for approved routine use of this drug in non - hemolytic hyperbilirubinemia of healthy term inewborns as outpatients .
| objectivethis study was designed to determine the effect of clofibrate on neonatal uncomplicated jaundice treated with home phototherapy.methodsthis clinical trial study was performed on 60 newborns with jaundice that received home phototherapy .
inclusion criteria were body weight between 2500 to 4000 gr , breastfed , total serum bilirubin ( tsb ) between 14 to 20 mg / dl , aged over 72 hours .
the neonates were randomly divided into two groups . all received home phototherapy .
group i received a single dose of 50 mg / kg clofibrate and the other group served as control group .
total serum bilirubin level was measured every 24 hours.findingstwo groups were matched regarding weight , sex , age and first tsb . at 24 and 48 hours of treatment , the mean values of tsb in the clofibrate group were 13.72 ( 1.56 ) , 9.5 ( 0.56 ) and in the control group 15.30 ( 1.44 ) , 12.6 ( 1.44 ) .
the results show that tsb was significantly decreased after 24 and 48 hours in clofibrate group ( p<0.001 ) .
the mean duration of phototherapy in group i was 72(0.0 ) hours and in the control group 76.80 ( 9.76 ) hours .
the duration of phototherapy was significantly shorter in clofibrate group ( p<0.001).conclusionclofibrate is effective for outpatients with neonatal hyperbilirubinemia who are under home phototherapy .
of course , further studies are needed for approved routine use of this drug in the treatment of neonatal jaundice . |
portal hypertension is a clinical manifestation of cirrhotic ( scarred ) liver disease ; however , it can arise from other etiologies not associated with cirrhosis .
this article focuses on noncirrhotic pediatric portal hypertension , which is not well documented in the literature .
noncirrhotic etiologies of portal hypertension are classified as prehepatic , hepatic , and posthepatic ( see causes of pediatric portal hypertension).3 etiologies and further workup are managed by the specialist .
the np plays a role in initial recognition and health maintenance of pediatric patients with portal hypertension .
the most commonly identified cause of pediatric portal hypertension is extrahepatic portal vein obstruction ( ehpvo ) .
the etiology of ehpvo is poorly understood , although studies have identified predisposing factors , such as history of umbilical catheterization , dehydration , trauma , or a hypercoagulable state .
portal hypertension is defined as a pathologic increase of pressure of the portal system . due to the presence of ehpvo
, this blockage causes blood to backflow into connecting organs , such as the spleen ( causing splenomegaly ) , esophagus , and gastrointestinal ( gi ) tract ( causing dilated blood vessels).5 ( see portal circulation . )
the two most common clinical manifestations of pediatric portal hypertension that may prompt referral are upper gi bleeding ( ugib ) and splenomegaly.5 ehpvo may present from age 6 to adulthood but is primarily a childhood disorder.6 in children , ugib is most commonly the initial clinical manifestation of ehpvo .
esophageal varices occur in 90% to 95% of patients , and gastric varices occur in 35% to 40%.5 seventy - nine percent of children with ehpvo are anticipated to have at least one episode of ugib in their lifetime.5 variceal bleeding in children is often seen following an upper respiratory infection , fever , or aspirin ingestion . throughout the duration of the illness ,
coughing and sneezing create abdominal pressure ; fever increases cardiac output ; and the use of nonsteroidal anti - inflammatory drugs or aspirin ( when medically indicated ) to treat symptoms can create ulcers and contribute to the rupture of varices .
in addition , long - standing gastroesophageal reflux can contribute to erosions over varices , which could result in bleeding.5 splenomegaly is often first discovered during routine physical exam.5 children with enlarged spleens are often first referred to a hematologist to rule out any possible hematologic processes , especially if leukopenia is present .
once hematologic causes are ruled out , referral to a pediatric gastroenterologist or hepatologist is appropriate.7 clinical findings may include growth failure ; one prospective study showed that 50% of children with ehpvo had growth retardation compared with healthy children who did not have ehpvo.5
diagnostic lab tests that the np can obtain as initial workup include a complete blood count ( cbc ) with differential and platelet count ( cbc with platelets ) , hepatic function panel , gamma - glutamyl transpeptidase , magnesium , phosphorus , and international normalized ratio .
lab findings of pediatric patients with portal hypertension due to ehpvo have normal or near normal liver function tests in the absence of underlying functional liver disease .
in addition , anemia may be due to chronic blood loss from variceal bleeding.5,6 doppler ultrasonography is the most useful diagnostic tool for differential diagnosis .
the aspect of hepatic parenchyma and the liver capsule , the patency of the portal vein or its replacement by a cavernoma , the flow pattern of the hepatic veins and hepatic artery , and the presence of splenomegaly or liver atrophy are important elements for the diagnosis and staging of the patient 's condition.1,6 for the diagnosis of ehpvo , ultrasonography with doppler has a sensitivity and specificity above 95%.5 depending on the resources of the practice , nps may obtain an ultrasonography with doppler before a referral to the specialist .
doppler ultrasonography helps to assess anatomy and blood flow and rule out the presence of any masses .
common findings on abdominal ultrasound in the setting of portal hypertension may include splenomegaly , the presence of collaterals ( new veins ) , and possible reversal of portal vein blood flow ( more severe cases).3 patients with ehpvo have an abdominal ultrasound showing obstruction of the main portal vein with cavernous transformation .
this appears as an irregular tangle of vessels near the hilum of the liver , which is a sign of chronicity.5 if the child has had previous blood work and/or imaging , the parents should be instructed to bring copies of reports and imaging on a compact disc to the initial consultation with the specialist .
a positive history and physical , blood work , and doppler ultrasonography are a sufficient workup that the np can initiate prior to referral to a pediatric gastroenterologist or hepatologist .
additional workup that the specialist may prescribe is a contrast - enhanced computed tomography or magnetic resonance angiography.4 both are useful for assessing the extent of thrombosis and can serve as an anatomical road map if surgery is needed.4,5 a liver biopsy is standard practice for the diagnosis for ehpvo because the liver parenchyma is usually normal.1 a liver biopsy would be warranted if there was suspicion of other underlying liver disease.1,5 diagnosis of portal hypertension can be further confirmed by measuring portal pressures .
this practice is invasive , requires anesthesia , and is not a common diagnostic tool used in pediatrics .
portal hypertension is defined as a portal pressure greater than 12 mm hg or gradient greater than 6 mm hg to 7 mm hg .
normal portal pressure is between 5 mm hg and 10 mm hg.8 measuring portal pressure gradients is invasive and requires catheterization of the jugular or femoral vein with measurement of right atrial pressure , free hepatic venous pressure ( fhvp ) , and wedged hepatic venous pressure ( whvp ) .
the hepatic venous pressure gradient is the difference between whvp and fhvp.8 if a pediatric patient is going under anesthesia for a different purpose , portal pressures may be measured for a baseline , but this is not a common practice in diagnosis and management .
a retrospective single - center study showed that this practice is safe and feasible in children with acute and chronic liver disease , including those who are critically ill ; however , further research is needed regarding its use as a diagnostic tool after initial presentation.9
treatment measures for pediatric portal hypertension include endoscopic treatment , drug therapy to reduce portal pressures , and surgery.10 treatment and management are determined by the underlying cause of portal hypertension and the expertise of the specialist.1,5 endoscopic treatment .
a surveillance esophagogastroduodenoscopy ( egd ) may be performed at baseline to stratify risk for variceal bleeding .
egd is the best available test for the diagnosis for varices.3 there are two types of endoscopic modalities : endoscopic sclerotherapy ( est ) and endoscopic variceal ligation ( evl ) , also known as endoscopic band ligation .
both are highly effective in controlling acute variceal bleeding in over 90% of cases as well as in eradication of variceal bleeding.5 the use of beta - blockers , est , and/or evl are considered primary prophylaxis treatments for variceal bleeding in adults ; however , due to the lack of controlled pediatric data , primary prophylaxis remains controversial , and practices among centers vary significantly.1,3 est is the use of an endoscope and injecting sclerosing agents , such as ethanolamine oleate , inside or around varices.5,11 children with ehpvo who received est for variceal bleeding showed low recurrence rates.5 potential complications associated with est include esophageal ulcerations and strictures , esophageal perforation , motility disorders , decreased low esophageal sphincter pressure , and gastroesophageal reflux disease.5 est was shown to be useful even in very small children as young as 5 months weighing 12 lb ( 5.5 kg).1,8 evl is performed via an upper endoscopy and uses bands to tie off varices to prevent further bleeding . in the past 10 years , evl has been more widely used and found to be more superior to est as far as efficacy , safety , and degree of standardization in adults and children.1,3 however , it is not always feasible because there currently are no devices small enough that can be used in pediatric patients .
therefore , est remains the only option for young children.5 evl is the recommended therapy for acute esophageal variceal bleeding.1 recurrence of bleeding is lower in patients treated with evl because the varices are eradicated in fewer endoscopic sessions.5 there are very little data on the diagnosis and grading of esophageal varices in children .
the current scoring system has been adopted from adult practice ; however , it has not been validated in the literature.1,2,11 one retrospective study conducted in a single academic hospital setting found that the majority of patients with noncirrhotic portal hypertension did well long term without surgical shunt placements , and treatment focused mainly on surveillance and treatment of varices.12 however , this practice has not been well studied and reviewed in the literature.12 drug therapy to reduce portal pressure .
the use of nonselective beta - blockers ( propranolol or nadolol ) should be avoided in children while evidence is awaited regarding appropriate dosing , efficacy , and safety.1 however , some specialists may use them to reduce hepatic venous pressure gradient by decreasing cardiac output ( beta1-receptor antagonism ) and inducing splanchnic vasoconstriction ( beta2-receptor antagonism).5 the data for using beta - blockers for the treatment for children with portal hypertension are scarce , deriving mainly from case series with a limited number of patients .
adverse reactions from the use of beta - blockers in children include significant hypotension due to suppression of the normal tachycardic response and hypovolemia due to poor ability to increase stroke volume to support cardiac output , bronchospasm , and hypoglycemia.2,5 it is important for the np to be aware of indications for a beta - blocker in the management of portal hypertension and the potential adverse reactions .
surgical shunts are usually reserved for patients with thrombocytopenia and recurrent bleeding when liver transplant is not a consideration and endoscopic therapy is ineffective.7 surgery is performed at a children 's hospital that the specialist is affiliated with . the ideal surgery for patients with ehpvo is a meso - rex bypass shunt , which connects the junction of the superior mesenteric and splenic veins to the left portal vein using an internal jugular jump graft.1,5 this procedure bypasses the obstruction and restores nutritive blood flow to the liver . if the meso - rex can not be performed due to unsatisfactory anatomy , a distal splenorenal shunt should be considered if est or evl did not adequately control variceal bleeding.1 patients being considered for surgical interventions should be immunized in advance to include protection from meningococcus , haemophilus
influenzae type b , and pneumococcus ( pneumococcal 13-valent conjugate vaccine and pneumococcal vaccine polyvalent given 8 weeks apart ) .
this is congruent with the american academy of pediatrics ' recommendations for vaccinating patients with chronic liver disease or cirrhosis.13,14 there is a potential for splenic injury during shunt surgery due to the anatomic location , and an emergency splenic embolization may be performed ; therefore , proper preoperative immunization is important.1 transjugular intrahepatic portosystemic shunt ( tips ) , which may be a good technical option in ehpvo , is rarely if ever indicated as a means of secondary prophylaxis in variceal hemorrhage for portal hypertension in children .
main indications are refractory or recurrent variceal bleeding and diuretic - resistant ascites in adults.5 placement of tips stents can prevent future successful meso - rex bypass by permanently blocking access to the intrahepatic vein if it is open.1 however , this practice is rarely used in pediatrics , and there is no supporting evidence in the literature on its efficacy .
reported complications from portal hypertension include hemorrhage from varices , ascites , hepatopulmonary syndrome , portopulmonary hypertension , and hepatic encephalopathy.3 variceal bleeding is the most serious complication of portal hypertension , which can occur from venous collaterals in the stomach or esophagus .
varices and ascites are seen when portal pressure is 12 mm hg or greater.8 this is not a subtle finding , as there is a 30% mortality with variceal bleeding.8 variceal bleeding can occur with or without the above treatments at any time .
patients with active variceal bleeding should be directed to the closest ed because this constitutes a medical emergency . upon arrival
, the child 's parent or guardian should tell the ed provider that the child has ugib due to portal hypertension .
octreotide is a vasopressin analogue ( used off - label for variceal bleeding ) that is effective in stopping acute variceal bleeding in 95% of cases when administered as an infusion .
after stabilization with octreotide , acid - blocking agents ( for gi prophylaxis ) , and blood products ( red blood cells and/or platelets ) , the patient should have an egd performed within 24 hours.1 portal hypertension : a guide for parents
it is important that both the np and specialists stay current on guidelines and recommendations in the management and care of pediatric portal hypertension .
education of the family regarding portal hypertension is important ( see portal hypertension : a guide for parents ) . in addition , limiting excessive salt and water intake to avoid ascites and recognition of ugib to expedite emergent intervention is clearly a shared charge between the primary care np and specialist .
a team approach by the np and specialist is paramount in managing patients with portal hypertension .
the np is typically the gatekeeper who first identifies the initial signs of portal hypertension , such as splenomegaly on physical exam , and plays a crucial role in the initial workup , referral , diagnosis , and management ( see clinical pathway for referral ) .
children with portal hypertension should receive all routine healthcare maintenance , including childhood vaccinations and routine screenings .
children with an enlarged spleen should refrain from contact sports and may need to wear a spleen guard for prevention of splenic rupture.1 the np should work closely with the child 's school nurse to monitor for changes in clinical status , such as checking vital signs , and help carry out avoidance of contact sports in physical education class if the child has splenomegaly .
the school nurse may also be the first responder in the event the child may show signs of a ugib and aid in getting medical attention .
the specialist will manage surveillance of portal hypertension , such as physical exam , endoscopy , labs , possible beta - blockers , and imaging .
the main management of portal hypertension in children focuses on preventing decompensation , which includes control and prevention of ascites and portal hypertension bleeding.5 if a child is placed on a beta - blocker or if there is titration in the dose by the specialist , the child may be scheduled for follow - up visits with the np for heart rate and bp monitoring .
parents of children with portal hypertension can reach out to the center where the child is being managed for support and support groups that may be available to them locally .
clinical pathway for referral additional research is needed on the management of esophageal varices in children with portal hypertension .
conversely , in adults , treatments have been challenged with a plethora of studies that have been conducted in the baveno v consensus workshop .
most pediatric centers adapt practices to what has been found to be successful in adult studies.11 depending on the center 's preference and clinical status of the child with portal hypertension , treatments can vary from routine endoscopy to use of beta - blockers as primary prophylaxis and surgical options as secondary treatment .
currently , management relies on expert opinion , low - quality pediatric studies , and the extrapolation of results seen in studies in the adult population .
understanding the pathophysiology of portal hypertension due to ehpvo in pediatric patients is important to help guide proper management , prevention , and overall outcomes .
effective collaboration between the np and specialist is key in providing optimal care for a child with portal hypertension .
management of portal hypertension can include medications , endoscopic and surgical options to ensure a good long - term prognosis , and routine healthcare maintenance , including childhood vaccinations and routine screenings . | abstract : pediatric portal hypertension management is a team approach between the patient , the patient 's family , the primary caregiver , and specialty providers .
evidence - based practice guidelines have not been established in pediatrics .
this article serves as a review for the primary care np in the management of pediatric portal hypertension , discussing the etiology , pathophysiology , and clinical presentation of pediatric portal hypertension , diagnostic tests , and treatment and management options . |
a 77-year - old woman with known spina bifida occulta presented to the emergency department with a 6-week history of severe low back pain and progressive paraparesis
. she was able to walk only two to three steps and only with two helpers .
she was previously asymptomatic and was aware of a hairy patch in the lower back since birth .
her medical comorbidities included diabetes mellitus ( type ii ) , hypertension , increased body mass index , and mitral regurgitation .
neurological examination of the lower limbs revealed proximal lower limb weakness of mrc ( medical research council ) grade 3 in l2 , l3 myotomes and grade 4 in l4 , l5 , and s1 myotomes .
reflexes were brisk with upgoing plantars and three beats of clonus in the right foot .
subsequent investigation with magnetic resonance imaging of the whole spine showed a low - lying tethered cord and a large disc prolapse at l2/3 causing cord compression with associated syringomyelia ( figs .
1 , 2 , and 3 ) .
axial view l2l3 level .
sagittal view t1-weighted image .
sagittal view t2-weighted image .
the initial operative plan was to perform an anterior decompression , which may have entailed a corpectomy with bone graft and fusion . however , her extensive medical comorbidities increased the risk of perioperative morbidity .
consideration was given for posterior approach with the possibility of increased risk of wound infection due to the large lumbar pit and hairy patch , overlying the planned surgical wound .
as posterior approach presented a significantly lower risk to the patient overall , a posterior decompression with a standard midline incision and laminectomy was performed at l2/3 under general anesthesia .
following posterior decompression , the patient recovered full motor power in her lower limbs , and she could eventually walk unaided . in the early postoperative period , she had a deep wound infection , which was successfully treated with debridement , negative pressure therapy ( vacuum - assisted closure pump ) , and antibiotics .
follow - up in outpatient clinic 6 months after surgery , she was walking unaided and the wound had healed satisfactorily .
tcs was described in last 3 decades and was previously associated only with the pediatric population.4 now , however , there is good evidence that it can occur even in adults and is much more common than previously thought.1
adults with tcs are considered to belong to two groups : those who were healthy in childhood but symptoms developed in adulthood or those who had static neurological deficits or skeletal deformities that were diagnosed in childhood but remained well until the onset of new and progressive neurological deficits in adulthood.3
5 other classifications included grouping them on basis of extent of spinal dysraphism6 or surgical outcome following detethering of the cord.7
it has been shown that adults commonly present with varying neurological symptoms usually following a precipitating factor such as coughing , bending , or strenuous physical activity .
it is thought that the mechanical longitudinal traction as a result of tethered cord causes these symptoms .
many clinical series have found that these patients can present with a gradual , insidious onset of back pain , nondermatomal leg pain , burning pain in the buttocks and perineal region , and bowel and/or bladder dysfunction.1
2
4
7 they can mimic symptoms of lumbar disc disease or spinal stenosis .
there are some reports of symptoms being aggravated due to disc disease.8
the recommended treatment is to detether the cord and excise any lesion.1
2
3 though the role of surgery is controversial , it has been shown that surgical detethering in the presence of neurological deterioration has been of some benefit .
motor weakness and pain seem to resolve though the return of sensory deficit , and return of bladder function varies.4 some surgeons have even questioned the role of detethering in the absence of symptoms and whether it would alter the natural history of tcs.9
our hypothesis is that the neurological deficit in this patient was likely secondary to the prolapsed disc . owing to the natural lordosis of lumbar spine
, posterior decompressive surgery may have allowed the spinal cord and neural elements to fall back and therefore relieved anterior cord compression .
upper motor neuron signs and myelopathy are not usually seen with lumbar disc prolapse when the cord is in the normal position .
however , in the presence of low - lying cord , this could result in signs of cord compression with resulting myelopathy or upper motor neuron signs .
this is the first case we know of that describes the management of lumbar cord compression with progressive neurological deficit .
| low - lying cord is an uncommon entity , and cord compression due lumbar disc disease is rarely encountered .
we discuss our experience with a case of lumbar cord compression secondary to a large disc protrusion , which caused myelopathy in a low - lying / tethered cord . a 77-year - old woman with known spina bifida occulta presented with 6-week history of severe low back pain and progressive paraparesis .
magnetic resonance imaging showed a low - lying tethered cord and a large disc prolapse at l2/3 causing cord compression with associated syringomyelia .
medical comorbidities precluded her from anterior decompression , and therefore a posterior decompression was performed .
she recovered full motor power in her lower limbs and could eventually walk unaided .
she had a deep wound infection , which was successfully treated with debridement , negative pressure therapy ( vacuum - assisted closure pump ) , and antibiotics .
six months after surgery , her oswestry disability index improved from 55% preoperatively to 20% .
posterior spinal cord decompression for this condition has been successful in our case , and we believe that the lumbar lordosis may have helped indirectly decompress the spinal cord by posterior decompression alone . |
tumefactive demyelinating lesions ( tdls ) are a rare inflammatory demyelinating disease of the central nervous system ( cns ) that can mimic the clinical and radiological features of intracranial neoplasms ( 1 ) .
therefore , brain biopsy is often needed for an accurate diagnosis , particularly if tdls occur in patients without a pre - existing diagnosis of demyelinating disease , such as multiple sclerosis ( ms ) or neuromyelitis optica spectrum disorder ( nmosd ) .
although tdls are generally considered a single event , previous studies have indicated that the majority of patients with tdls ultimately develop definite relapsing - remitting multiple sclerosis ( rrms ; 2 , 3 ) .
the management of tumefactive demyelinating disease is a challenge , as standardized guidelines do not exist .
we herein report a patient with relapsing - remitting tumefactive ms characterized by recurrent large demyelinating lesions that successfully responded to natalizumab treatment .
a 57-year - old woman with a 1-month history of slowly progressive left - sided hemiparesis visited another hospital in november 2013 .
brain magnetic resonance imaging ( mri ) showed a well circumscribed rounded mass lesion in her right frontal lobe accompanied by mild perilesional edema ( figure a - d ) .
given the possibility of a brain tumor , she was transferred to the neurosurgical department of our hospital , and brain biopsy was performed .
histology revealed a loss of myelinated fibers with relative axonal preservation , lipid - laden macrophages , bizarre astrocytes , and perivascular lymphocytic inflammatory infiltration ( figure q - t ) as well as occasional creutzfeldt cells , findings compatible with tumefactive demyelination .
a - c : axial and coronal t2-weighted magnetic resonance imaging ( mri ) images , and axial fluid - attenuated inversion recovery ( flair ) mri image obtained at the clinical onset reveal a high - intensity tumefactive lesion with mild perilesional edema in the right frontal lobe .
d : axial post - contrast t1-weighted mri image obtained at clinical onset shows open ring enhancement .
e - g : axial t2 weighted and coronal flair mri images obtained on her first admission ( 2.5 months after the clinical onset ) show enlargement of the pre - existing tumefactive lesion and a new hyper - intense lesion in the left basal ganglia .
h : magnetic resonance spectroscopy ( mrs ) performed on her first admission shows an abnormal elevation of the glutamate / glutamine ( glx ) peaks , a decreased n - acetylaspartate ( naa ) level , and elevation of the choline ( cho ) , lipid , and lactate levels .
i - l : axial and coronal flair mri images obtained on her second admission ( 9 months after the clinical onset ) reveal multiple new tumefactive lesions in the right frontal and temporal lobe .
m , n : axial and coronal flair mri images obtained 2 weeks after her second admission show new lesions in the right frontal lobe .
o , p : axial t2-weighted and coronal flair mri images obtained on her third admission ( 13 months after the clinical onset ) reveal a new high - intensity tumefactive lesion in the left temporal lobe .
q - t : brain biopsy of the tumefactive lesion revealed the characteristic features of active inflammatory demyelination consisting of perivascular lymphocytic infiltration ( q ; hematoxylin and eosin staining ) , gliosis of reactive astrocytes ( q ) , myelin loss ( r ; kluver - barrera ) , relative axonal preservation ( s ; neurofilament ) and macrophage infiltration ( t ; cd68 ) .
. the patient 's neurological status did not deteriorate until january 2014 , when she began to suffer from progressive gait disturbance and rapid cognitive deterioration , and so she entered our department . a neurological examination uncovered left - sided paresthesia and motor weakness , and her mini mental state examination ( mmse ) score was 14/30 .
a repeat mri demonstrated an increase in the size of the pre - existing lesion ( figure e and f ) and one new lesion in the left basal ganglia ( figure g ) .
magnetic resonance spectroscopy ( mrs ) showed an abnormal elevation of the glutamate / glutamine ( glx ) peaks , a decreased n - acetylaspartate ( naa ) level , and elevated levels of choline ( cho ) , lipids , and lactate ( figure h ) .
a cerebrospinal fluid ( csf ) analysis showed a protein concentration of 62 mg / dl and a myelin basic protein ( mbp ) level of 712 pg / ml . her glucose level was normal , and oligoclonal bands were negative .
a diagnosis of tumefactive demyelinating disease was confirmed , and 3 courses of intravenous methylprednisolone pulse ( ivmp ) therapy ( 1,000 mg / day for 3 days ) were started , followed by maintenance therapy with oral prednisolone ( psl ; 30 mg / day ) .
thereafter , the patient 's serum collected on admission was reported as being negative for anti - aquaporin-4 ( aqp4 ) antibody as assessed by an enzyme - linked immunosorbent assay .
furthermore , her mental activity had gradually decreased , and she had become apathetic . the psl dose at that time was 5 mg / day .
brain mri showed multiple new lesions involving both cortical gray and white matter in the right frontal and temporal lobes ; however , the pre - existing lesion in the left basal ganglia had decreased in size ( figure
a csf sample showed elevated mbp ( 615 pg / ml ) and was negative for cultures , cytology , and viruses , including jc polyomavirus , based on the results of polymerase chain reactions .
as 3 courses of ivmp therapy did not ameliorate the disease progression ( her mmse score decreased to 7/30 ) and follow - up mri revealed another new lesion in the left frontal lobe ( figure m and n ) , plasma exchange ( plex ) therapy was subsequently initiated , resulting in improvements in her mental and cognitive dysfunction .
she became able to walk unassisted , and her mmse recovered from 7/30 to 17/30 following completion of the seventh plex cycle .
another brain mri disclosed an additional lesion in the left temporal lobe ( figure o and p ) , leading to the discontinuation of ifn-1a therapy .
three additional courses of ivmp and 7 cycles of plex improved her symptoms partially . at this time
her clinical condition did not respond to this natalizumab therapy , but follow - up mri revealed a reduction in the size of the left temporal lesion .
she became stable with neither clinical relapse nor new mri lesions throughout the following 16 months of clinical follow - up .
our patient presented with pathologically confirmed tdl and recurrently developed multiple cortical and subcortical lesions , despite short - term positive responses to ivmp and plex .
the radiological characteristics of tdls are lesions a diameter larger than 2 cm , located mainly in white matter , with varying degrees of mass effect or perilesional edema and often complete or incomplete ring enhancement ( 2 ) .
the initial lesions in the present case had these mri characteristics consistent with a diagnosis of tdls . however , the recurrent lesions were large , intracranial ones exceeding 2 cm in size , although these lesions did not resemble brain tumors .
mrs of the tdls may cause a decrease in the naa / creatine ( cr ) ratio and an increase in the cho / cr ratio , but this is also a common finding in gliomas ( 4 ) .
a few previous reports have indicated that an abnormal elevation of the glx peaks appears to favor tdls ( 5,6 ) , a finding which was in accordance with our results .
recurrence of a tumefactive lesion itself is infrequent in patients who present with a tumefactive lesion .
stated that only 16.7% of patients developed new lesions exceeding 2 cm in diameter , with a median follow - up of 38 months after the first attack with tdl ( 3 ) .
in addition , jeong et al . reported that only 16.1% of 31 patients with initially diagnosed tdl developed new lesions exceeding 2 cm in diameter over a median follow - up period of about 38 months ( 7 ) .
our patient had a third large demyelinating attack during the first year of follow - up .
our case met the 2010 mcdonald criteria for ms ( 8) , as there were two or more attacks disseminated in time and space with clinical evidence of two or more lesions .
however , a diagnosis of ms appeared unlikely , as there were several discrepancies between the present case and typical ms cases , including the superficial gray matter involvement , the presence of recurrent large demyelinating lesions , the absence of small ovoid lesions typical of ms , the lack of oligoclonal bands in the csf , and the unresponsiveness to ifn-1a therapy , which has been demonstrated to have beneficial effects in rrms patients .
anti - aqp4 antibody was not found , but the presence of anti - myelin oligodendrocyte glycoprotein ( mog ) antibody has not yet been investigated in our case . given that autoantibodies against mog are reportedly found in patients with acute disseminated encephalomyelitis , ms , and aqp4-seronegative nmosd ( 9 ) , further analysis and longer follow - up will be required for a definitive clinical diagnosis of ms .
hardy et al . proposed an algorithm for the acute management using ivmp and/or plex followed by disease modification with ifn or glatiramer acetate ( ga ; 1 ) .
as tdls have also been reported as a first clinical event in patients with nmosd ( 10,11 ) , we decided to continue the maintenance therapy with oral psl after pulse therapy .
however , the possibility of nmosd was excluded based on the diagnostic criteria ( 12 ) and serologic test findings for aqp4 antibody , and so oral psl was tapered .
six months later , when the psl dose had been reduced to 5 mg / day during tapering , the patient relapsed severely .
we commenced ifn-1a treatment to prevent the attacks as disease modification therapy ( dmt ) , but she experienced another event 1 month after the start of ifn-1a .
at present , second - line dmts , such as fingolimod and natalizumab , are available in japan . given the increasing evidence of an association between tdls and fingolimod treatment ( 13 - 15 ) and the fact that natalizumab has been recommended for the treatment of rrms in patients with not only insufficient response to ifn/ga but also aggressive ms ( 16 ) , we decided to initiate natalizumab therapy , regardless of the lack of seropositivity for jc polyomavirus . in our case , treatment with natalizumab effectively suppressed disease activity .
although the clinical outcomes have only been reported in a few cases , natalizumab seems to be effective in treating patients with relapsing - remitting tdls ( 17 - 19 ) .
the findings in our present case further suggest that natalizumab may also be used to prevent new events as an immunomodulatory treatment for tumefactive demyelination with relapsing episodes . in conclusion
, we presented a case of rapidly evolving severe relapsing - remitting tumefactive ms , where the patient showed no evidence of disease activity after the initiation of natalizumab treatment .
the management of tumefactive demyelinating disease can be a challenge , as tdls are pathologically heterogeneous .
when a diagnosis of relapsing ms is supported , we should consider natalizumab therapy as soon as possible for patients presenting with recurrent large demyelinating lesions .
| we herein report the case of a 57-year - old woman presenting with a biopsy - proven tumefactive demyelinating lesion as her first clinical event .
subsequently , she displayed a relapsing - remitting course with recurrence of large demyelinating lesions exceeding 2 cm in diameter rather than the small ovoid lesions characteristic of multiple sclerosis .
administration of interferon beta did not suppress the disease activity .
finally , treatment with natalizumab , which is a humanized monoclonal antibody against the cell - adhesion molecule 4-integrin , was initiated , resulting in clinical and radiological stabilization .
our experience here suggests that natalizumab may be an effective therapeutic option for relapsing - remitting tumefactive multiple sclerosis with high disease activity . |
craniosynostosis is premature fusion of one or more cranial sutures , which is usually encountered early in life .
this relatively common disorder of the skull affects between 1 in 2100 to 2500 children111 ) .
skull deformities have a wide range of etiologies from positional plagiocephaly to complex genetic syndromes .
craniosynostosis can be divided into primary , secondary , syndromic or nonsyndromic ; more than 85% of patients have nonsyndromic craniosynostosis2 ) .
primary single - suture synostosis is relatively easy to diagnose because the main symptom is skull deformity , which is typical according to the fused suture .
multiple suture synostosis is less common than single suture , accounting for ~15% of cases .
the intracranial pressure is usually normal in primary craniosynostosis , although ~20% of single - suture synostosis patients have high intracranial pressure1821 ) .
brain damage in cases of single - suture synostosis is usually mild but requires prolonged monitoring7 ) .
syndromic craniosynostosis should be diagnosed as early as possible to facilitate interdisciplinary management , improve outcomes and provide genetic counseling for parents . in this regard
, the authors reviewed diagnostic evaluation with a focus on pediatric systematic evaluation and genetic studies .
secondary craniosynostosis results from a known underlying disorder , which can include systemic and metabolic conditions such as hyperthyroidism , hypercalcemia , hypophosphatasia , vitamin d deficiency , renal osteodystrophy , hurler 's syndrome , sickle cell disease , thalassemia , and encephalocele1019 ) .
secondary craniosynostosis also develops in cases with post - ventriculoperitoneal shunt and microcephaly due to developmental failure of the brain .
syndromic craniosynostosis is suspected when a patient has psychomotor retardation , digital anomalies , skeletal defects , cardiac defect , or other organ anomalies ; most are caused by genetic variants . to date , various causal genes and over 180 syndromes have been reported15 ) . secondary or syndromic craniosynostosis needs a more systematic approach .
it is important not only to distinguish craniosynostosis from positional skull dysmorphism but also to evaluate the cause of the condition .
next - generation sequencing ( ngs ) technology gives hope to a large number of patients with genetic craniosynostosis by sequencing many candidate genes simultaneously at a reasonable price . in this review
, we will focus on the diagnostic evaluation of syndromic craniosynostosis including ngs - based genetic analysis .
morphological evaluation of the skull should be performed for overall shape and size , and palpation of the anterior and posterior fontanels with attention to size , shape , and fullness with the infant in both the upright and supine positions .
in addition to looking at the infant from the front and sides , it is important to observe the skull shape from above , particularly to note any asymmetries in ear position and any flattening of the skull posteriorly , as well as from behind so the levelness of the skull base can be assessed .
deformational plagiocephaly resulting from external molding forces is one of the common causes of cranial asymmetry .
causes of torticollis include cervical spine abnormality , infection , congenital muscular torticollis , etc .
positional deformation is different from craniosynostosis in that the parallel quadrangular shape results from a positional effect instead of trapezoid shape and compensatory contralateral bulging in craniosynostosis .
occipital flattening is a relatively common feature in oriental neonates and should not be confused with bilateral lambdoid synostosis . the incidence has increased in western countries since the recommendation of putting babies to sleep on their back to prevent sudden infant death syndrome . sometimes , multiple synostotic patients present with a symmetric , normal - looking appearance . in this case , the skull is small for their age .
most cases of craniosynostosis can be diagnosed by their abnormal morphologies and routine radiological examination is not needed .
the mainstay of craniosynostosis imaging is three - dimensional ct scan , which facilitates diagnosis of skull fusion in addition to assessment of secondary changes in the cranial fossae , orbits and facial bones .
radioisotope bone scan is helpful ; however , it is not used in the clinical setting .
brain magnetic resonance imaging ( mri ) is useful for evaluating secondary craniosynostosis due to brain anomalies .
clinical evaluation is important to assess additional features suggesting a syndrome or complications that need urgent management .
coronal synostosis is the most common type of craniosynostosis associated with other anomalies , suggesting a syndromic nature20 ) .
the presence of characteristic facial features and malformations is important for diagnosis of a syndromic craniosynostosis .
special attention should also be paid to the functional consequences of the condition . decreased level of consciousness , neurologic deficits ,
breathing difficulty , choking or vomiting on feeds , and irritability may be indications for acute intervention8 ) .
abnormalities of extremities are diagnostic for syndromes ; for example , a broad medially deviated thumb or big toe in pfeiffer syndrome , and more extensive syndactyly in apert syndrome .
craniosynostosis involving multiple sutures frequently extends to premature fusion of the skull base and shows varying degrees of midfacial underdevelopment , shallow orbit , exophthalmos , low - set ears , narrow , highly arched palate , and malocclusion20 ) .
soft - tissue and skeletal involvement , airway obstruction , dental abnormalities , hearing loss , cardiac anomalies , genitourinary tract anomalies , and gastrointestinal tract anomalies may also be associated and should be assessed in syndromic craniosynostosis51419 ) .
laboratory evaluation of thyroid hormone , calcium , phosphate , alkaline phosphatase , and vitamin d levels can serve as adjuncts to history and examination .
a flow chart of clinical and genetic diagnosis of craniosynostosis is shown in fig . 1 .
molecular genetic evaluation of craniosynostosis is important because the results can provide information about the etiology of the disease and predict the clinical course and prognosis of the patient6 ) .
about 45% of unselected cohorts of craniosynostosis patients have a causal genetic alteration detected by current genetic testing strategies622 ) . when selecting candidates for molecular genetic testing , various factors including involved sutures , associated anomalies , developmental milestones , and family history
karyotyping and array comparative genomic hybridization ( cgh ) are recommended as basic molecular genetic tests for these patients6 ) .
various chromosomal aberrations have been associated with syndromic craniosynostosis , and account for at least 10% of the cases3416 ) . with the increasing availability and use of array cgh , copy number variants ( cnvs ) such as
mefford et al.12 ) reported that 7.5% of individuals with single - suture synostosis have at least one rare cnv .
trigonocephaly also results from genetic abnormalities , such as deletion of chromosome 9p22-p24 and 11q23 ( jacobsen syndrome)20 ) . some patients with 22q11.21 microdeletion show craniosynostosis8 ) .
other cnvs including 1q43 , 2p21 , 2q14 , 3p25 , 5p15 , 6p21 , 6q26 , 7q36 , 9q21 , 11q25 , 12p21 , and 17q25have been identified in affected individuals12 ) . at the gene level , most abnormalities related to craniosynostosis are fgfr- , twist1- , and efnb1- related syndromes16 ) .
the genetics , epidemiology and characteristic features of syndromic craniosynostosis are summarized in table 1 . according to wilkie et al.22 )
fgfr2 , fgfr3 , twist1 , and efnb1
much rarer genetic mutations are in fgfr1 ( mild pfeiffer syndrome ) , por ( antley - bixler syndrome ) , rab23 ( carpenter syndrome ) , efna4 ( non - syndromic coronal synostosis)13 ) , esco2 ( roberts syndrome ) , gli3 ( greig syndrome ) , jag1 ( alagille syndrome ) , kras ( noonan syndrome ) , recql4 ( baller gerold syndrome ) , tgfbr1 or tgfbr2 ( loeys - dietz syndrome ) , and msx2 ( single family with supraorbital recession ; several duplications have been associated with craniosynostosis)9 ) .
l1cam is associated with development of white matter and its mutation can manifest callosal agenesis , mental retardation , adducted thumbs , spasticity , or hydrocephalus15 ) .
a defect in the interaction of fgfr with l1cam may be the cause of the brain malformations and mental retardation in patients with craniosynostosis17 ) .
genetic consultation based on the result of the evaluation is an important role of the physician responsible for the patient .
when family history is negative , a sibling recurrence risk is 2% for metopic , sagittal and lambdoid synostosis , 5% for unicoronal synostosis and 10% for bicoronal and multisuture synostosis8 ) .
genetic evaluation is not mandatory for metopic , sagittal or lambdoid synostosis because the recurrence risk is low and they seldom cause complications .
when there is a family history , offspring risks are ~5% in the case of nonsyndromic sagittal , metopic and unicoronal synostosis ; 3050% in bicoronal and multisuture synostosis8 ) . targeted genetic testing should be performed for patients in whom a specific diagnosis is suspected .
if a wide range of mutations is found in the suspected causal gene or multiple candidate genes are present , whole - exome sequencing or targeted next - generation sequencing is faster and less costly than sanger sequencing .
genetic testing for the fgfr3 p.pro250arg mutation should be offered for all patients presenting with coronal or multisuture synostosis because it is the most commonly found mutation in all cases of craniosynostosis8 ) .
if no genetic abnormalities are identified in the first - line genetic evaluation , the second - line evaluation should include karyotyping and array cgh .
whole - exome sequencing or targeted next - generation sequencing should than be considered if not performed in the first - line genetic evaluation .
systematic evaluation of the craniosynostosis patient and careful selection of candidates for genetic analysis are important to improve patient outcome by interdisciplinary management of the disease and provision of genetic counseling to the parents . | most craniosynostoses are sporadic , but may have an underlying genetic basis .
secondary and syndromic craniosynostosis accompanies various systemic diseases or associated anomalies . early detection of an associated disease may facilitate the interdisciplinary management of patients and improve outcomes .
for that reason , systematic evaluation of craniosynostosis is mandatory .
the authors reviewed systematic evaluation of craniosynostosis with an emphasis on genetic analysis . |
supplementary material is available for this article at 10.1007/s13659 - 012 - 0028-x and is accessible for authorized users .
| six -carboline alkaloids including three new ones , trifilines a - c ( 13 ) were isolated from trigonostemon filipes , along with a new -carboline alkaloid , trigonoine c ( 7 ) isolated from trigonostemon lii .
their structures were elucidated by extensive spectroscopic techniques .
trifilines a ( 1 ) and b ( 2 ) showed weak anti - hiv-1 activity with ec50 values of 54.61 g / ml and 9.75 g / ml , along with ti ( therapeutic index ) values of 1.52 and 1.42 , respectively .
this is the first time to report the chemical constituents of trigonostemon filipes .
electronic supplementary materialsupplementary material is available for this article at 10.1007/s13659 - 012 - 0028-x and is accessible for authorized users . |
most of these are benign but malignant variants , called myoepithelial carcinomas ( mcs ) , are even rarer comprising about 10% of myoepitheliomas .
most of these occur in the parotid gland ; a few other sites of origin have been described such as lungs , trachea , oral cavity , larynx and breast . to our knowledge
there are very few countable reports of mcs of the nasopharynx in the literature which makes the nasopharynx an unusual location for mcs and considered difficult to access for the head and neck surgeon .
we present a case of myoepithelial carcinoma in the nasopharynx and discuss its diagnostic and therapeutic aspects .
a 60-year - old female reported to the department with a non - painful left laterocervical swelling measuring 3 cm in diameter .
the patient complained of nasal blockage , hyponasal speech , conductive hearing loss and ear fullness since two months though the cranial nerve examination results were within normal limits .
posterior rhinoscopy examination revealed a fungating tumor on the roof and left lateral aspect of the nasopharynx .
endoscopic nasopharyngeal biopsy was taken which reported the lesion as a mucus - secreting minor salivary gland tumor .
fine needle biopsy of the nasopharygeal swelling was performed , and the lesion was diagnosed as myoepithelial cell carcinoma . computed tomography ( ct ) scan depicted an irregular hypodense lesion measuring 4.5/3.8 cm in the left half of the nasopharynx , obliterating the eustachian tube opening and rosenmuller fossa . on
the left side the lesion was extending to the pterygopalatine fossa and involving the parapharyngeal space . on the ipsilateral side ,
chest x - ray and ultrasound ( usg ) abdomen were performed as a part of the metastatic workup .
axial ct scan showing the extent of the tumor in the nasopharynx the patient underwent excision of the tumor with paramedian mandibulotomy in conjunction with transpalatal approach [ figure 2 ] .
histopathology reports revealed myoepithelial carcinoma of the nasopharynx with infiltrating margins and the presence of numerous sheets and cords of both spindle - shaped and epithelioid neoplastic cells [ figure 3 ] .
tumor was immunoreactive for actin , smooth muscle actin ( sma ) , s-100 and cytokeratin ( ck ) markers .
the postoperative period was uneventful and the patient received external beam radiotherapy to the primary site { 70 gy/ 35 fractions } as well as to the neck { 56 gy/ 28 fractions } which was started within three weeks of surgery .
the patient is on regular follow - up since 28 months with no evidence of recurrence at the loco - regional level till date .
intraoperative photograph showing the surgical site after excision of the tumor histopathological picture of myoepithelial carcinoma showing spindle - shaped cells in the background
mcs are tumors of epithelial origin that may occur with preexisting benign lesions like pleomorphic adenomas or benign myoepitheliomas , but they also may arise de novo . nilles and associates and tuncel and colleagues reported only two cases of malignant myoepithelioma in the rhinopharynx that were confirmed histologically and immunohistochemically . in 1983 , nofal described a poorly differentiated spindle - cell carcinoma that could have been the third case of rhinopharyngeal myoepithelial carcinoma .
mc is usually insidious in onset , a painless mass that originates in the parotid gland .
however , other sites such as the palate , larynx , gums , retromolar area , and breast have also been reported . in the parotid gland ,
mcs usually affect patients over 50 years of age with no sex predilection . because they are relatively painless tumors , their diagnosis can be delayed by months or even years . when mcs occur in the nasopharynx , the symptoms are the same as those of other tumors that affect this region , such as nasal obstruction , ear fullness , serous otitis media , and conductive hearing loss . to ensure a correct early diagnosis of nasopharyngeal tumors , the lesion should first be evaluated via fiberoptic nasopharyngoscopy to identify the mass , which is usually covered with unaltered mucosa .
diagnostic imaging ( ct and magnetic resonance imaging ( mri ) ) allows the site and the extension of the tumor to be established , thus permitting a correct surgical approach .
the diagnosis can be further ascertained by taking a biopsy specimen for histological confirmation of the presence of a tumor and its type .
histologically , mcs appear to have pleomorphic spindle - shaped or more rounded cells , occasionally with eosinophilic cytoplasm ( otherwise known as plasmacytoid cells ) .
and torlakovic and associates demonstrated that tumoral cells are immunoreactive to cytokeratin , smooth muscle actin , and s-100 protein .
our patient was no exception , and this profile allowed the final histological diagnosis of myoepithelial carcinoma .
the criteria that indicate the malignancy of myoepithelial neoplasms include their destructive infiltrating growth , cellular pleomorphism , necrosis , and an increase in mitotic activity .
locally , this type of tumor is particularly destructive , but its clinical and biological features are not yet fully understood .
some authors believe that metastases are uncommon , while others have reported metastases in 30% of the cases .
it has been reported that mcs in the parotid may spread to the submandibular and supraclavicular lymph nodes , hence requiring neck dissection procedures .
the treatment of choice for mcs is surgical excision , but there are no specific guidelines for the treatment of nasopharyngeal mcs .
however , it seems reasonable to apply the criteria used for mcs involving the most common site , the parotid .
so any type of selective neck dissection will prove to be a diagnostic as well as a therapeutic procedure . unlike certain nasopharyngeal tumors for which chemotherapy and radiotherapy are the preferred treatments in some cases , the application of these treatments to mcs has not been encouraging .
several surgical approaches have been proposed , depending on the size and site of the tumor.[6812 ] we adopted excision of the tumor with paramedian mandibulotomy in conjunction with a transpalatal approach . to our knowledge , this patient is the only case of nasopharyngeal mc treated with this technique .
it enabled complete resection of the lesion with negative margins , and there have been no signs of recurrence and metastasis during the 28-month follow - up period with stable dental occlusion , no velo - pharyngeal incompetence and no signs of trismus . | myoepithelial carcinomas are rare tumors of salivary glands . most occur in the parotid gland buta few other sites of origin have also been described .
myoepithelial carcinoma of the nasopharynx has only been reported very few times . because the lesion is so rare in the nasopharynx , there are no specific guidelines for its treatment .
we present a rare case of myoepithelial carcinoma in the nasopharynx and discuss its diagnostic and therapeutic aspects . |
in the current issue of critical care , paulus and colleagues investigate whether the need for additional analgesia to prevent pain from endotracheal suctioning can be predicted by measuring the pupillary dilatation reflex ( pdr ) response to tetanic stimulation in deeply sedated patients .
this study touches on two important issues : objective pain assessments and pre - emptive analgesia .
pain in the critically unwell can lead to significant physiological and psychological consequences , and may affect patient outcome . assessing pain in the critically ill is challenging . when patients are unable to self - report , assessment is based on behavioural and physical signs .
unfortunately physiological variables are not predictive of the presence or absence of pain , and recommended behavioural tools ( critical care pain observation tool and behavioural pain scale ) only identify patients who are experiencing pain .
this pain is common and poorly managed , explained in part by the inability of behavioural tools to predict those patients who require additional analgesia for painful procedures .
apart from chest drain removal , only low - grade evidence supports the use of pre - emptive analgesia for procedural pain and over - administering opioids to patients is not without potential consequence .
management at present is limited to either administering analgesia blindly before every procedure or taking a reactionary approach to treat pain after it has occurred .
the predictive utility of pdr to guide pre - emptive analgesia for painful procedures might be a possible solution to an important clinical question .
loewenfeld summarised this work and her own investigations in the late 1950s , and copious literature now exists exploring this phenomenon in adults and children under general anaesthesia , in awake volunteers , in organ donors and in the postoperative period as a means of assessing analgesic requirements .
larson and sessler summarised in their editorial other influencing factors that clinicians need to consider when using pdr in pain assessment , including the effect of drugs and technical difficulties such as patient movement . however , there are a number of questions that remain unanswered concerning the use of pdr in sedated patients , which should be considered .
paulus and colleagues are the first group to investigate pdr in response to tetanic stimuli in deeply sedated patients .
pdr is a supraspinal parasympathetic reflex in patients under general anaesthesia but is sympathetically mediated in awake patients .
does the mechanism differ dependent on the depth of sedation and how does this affect pdr ?
recently the pdr response to light has been shown to reduce with increased levels of sedation , and this needs to be explored in response to tetanic stimuli as well . furthermore , pupil size oscillates naturally ( pupillary hippus ) in the awake state .
this is due to the spontaneous fluctuation between the tone and activity of the sympathetic and parasympathetic nervous systems .
whether different depths of sedation make a similar contribution to pupil size and affect pdr remains elusive .
finally , the influence of different sedative pharmacological agents on the pdr response requires further investigation .
the use of pdr to predict additional analgesic requirements for endotracheal suctioning , in deeply sedated patients , shows promise .
the use of a non - invasive , innoculus stimulus in conjunction with pdr potentially provides an objective measure to guide pre - emptive analgesia .
however , to make pdr a truly useful clinical tool , further research needs to address some of the questions raised above .
cb is funded by the higher educational funding council for england and chelsea and westminster hospital nhs foundation trust . | the pupillary dilatation reflex may present an objective method of predicting whether sedated patients require additional analgesia for painful procedures .
behavioural pain assessment tools identify pain only once it has occurred and are unable to guide pre - emptive management .
the pupillary dilatation reflex response to a tetanic stimulus has been utilised to assess analgesic requirements in patients under anaesthesia and for those with postoperative pain .
this tool appears promising to assess pain in the critically ill ; however , a number of questions remain unanswered regarding the influence of sedation on this response .
these questions require further exploration before the pupillary dilatation reflex can be widely adopted into clinical practice . |
cycle ergometer exercise is very consistent since it comprises constant movement in a
sitting position , which reduces the load on joints1 and has a low risk of falls ; the load and pedaling types are readily
controllable .
therefore , the cycle ergometer is appropriate for elderly persons , who tend to
have reduced exercise ability compared with the young .
age - related weakening of the
lower - limb muscles causes physical deterioration and postural and movement instability .
therefore , it is necessary for the elderly to perform suitable lower limb
muscle - strengthening exercises , which can improve the quality of life2 .
cycle ergometer exercise activates mainly the hamstring ,
vastus lateralis , tibialis anterior , and gastrocnemius muscles due to movement of the hip ,
knee , and ankle joints .
cycle exercise has been reported to increase endurance , heart function , and balance and gait
function , as well as muscle and physical strength3 .
cycle ergometer exercise is similar to walking since it involves
repetitive flexion and extension by alternating contraction of antagonistic muscles4 .
therefore , cycle ergometer exercise is
suitable for enhancing muscle strength in the elderly .
improper pedaling postures
affect joint movement ; thus , excessive contraction and relaxation of muscles due to
immoderate joint movement can lead to injury .
the likelihood of injury due to improper
pedaling posture is increased in the elderly because of low bone density and muscle
weakness .
therefore , proper pedaling posture is more important for the elderly than the
young .
many studies have been conducted on the pedaling characteristics in the young and the
elderly .
published studies have addressed the difference in cadence efficiency between the
young and the elderly using power and oxygen consumption7 , and the leg muscle activities in the elderly performing cycle
ergometer exercise2 . for the determination of proper pedaling posture ,
the index of effectiveness ( ie ) is a suitable variable for
studying pedal force4 .
the direction and magnitude of pedal force depends
on the movement of the joint and the activation of muscles , and it is necessary to
investigate the pedaling characteristics of the elderly due to age - associated changes5 . to investigate pedaling characteristics ,
kinematic and pedal force analysis
thus , the purpose of this study was to compare
the joint angle , range of motion ( rom ) , and pedaling effectiveness in the young and the
elderly using ie under identical cycling conditions .
the study involved 8 young male adults ( age : 26.3 0.7 years , height : 174.6 5.3 cm ,
weight : 70.5 11.2 cm ) and 8 elderly male adults ( age : 76.4 5.1 years , height : 163.3
4.6 cm , weight : 63.8 5.0 cm ) with no history of musculoskeletal disease and who could
pedal normally .
the protocol for this study was approved by the ethics committee of konkuk
university .
experimental procedures were explained to the subjects , and written consents
were obtained . a 3-dimensional
( 3d ) motion analysis system with 6 infrared cameras ( motion analysis corp . ,
usa ) and a 3-axis pedal force plate ( dacell corp , korea ) ( hysteresis : 0.5% , nonlinearity :
0.5% ) were used to acquire kinematic and pedal reaction force data at the frequencies of
120 hz and 1,200 hz , respectively .
twenty - three reflective markers were attached as a
plug - in set , and pedaling was conducted over 3 min at 40 rpm .
the saddle height was set to a
155 knee flexion angle ( identical to the 25 knee angle method that is generally accepted
for saddle height with proper posture8 )
with the pedal crank at the 6 oclock position .
i - magic trainer ( tacx , netherlands ) and srm
power meter ( srm , germany ) were used to maintain constant conditions .
knee and ankle ranges
of motion ( roms ) and angles of the lower joints were calculated using motion data .
ie has
been used as a measure of effective pedaling4 , and is defined as the ratio of the force perpendicular to the crank
( effective force , ef ) and the total force applied to the pedal ( resultant force , rf ) over a
complete crank revolution6 , 7 ( fig .
definition of joint angle and pedal force during pedaling , when the pedal is located at the top of the crank ( 0 ) , the position is
called the top dead center , and when at the bottom of the crank ( 180 ) , the bottom dead
center .
the pedaling phase can be divided into the power phase for propulsion ( 30150 ) and
the recovery phase for restoration ( 210330 ) . in this study , pedaling was divided into the
following 4 phases : phase 1 ( 33030 ) , phase 2 ( 30150 , power phase ) , phase 3 ( 150210 ) ,
and phase 4 ( 210330 , recovery phase ) , as shown in fig .
2.average force pattern in the young and elderly during pedaling . in general , phase 2 is a propulsive phase and phase 4 is a recovery phase9 .
data were statistically analyzed using spss
( ibm co. , usa ) version 22 , and a p - value less than 0.05 was considered to indicate
significance for all cases .
kinematic results showed that knee rom , ankle rom , maximum knee extension , and maximum
ankle dorsiflexion in the elderly were significantly decreased compared with those in the
young ( table 1table 1.significant differences in kinematic variables between the young and elderly
( mean sd)kinematicsknee romknee flexion maxknee extension maxankle romdorsiflexion maxplantar flexion max20s mean71.43 3.17 * 86.25 5.31157.68 5.39 * 30.04 7.90 * 20.45 4.92*9.59 8.3870s mean65.22 6.54 * 80.78 7.80146.01 9.81 * 20.33 6.62 * 17.37 8.71*3.20 9.53t - test , * p<0.05 , unit : degree ) .
however , there were no significant differences in maximum knee flexion and
maximum ankle plantar flexion .
t - test , * p<0.05 , unit : degree there were significant differences in ie for the total phase , phase 1 , and phase 4 between
the elderly and the young , but no significant differences for phase 2 and phase 3 , as shown
in table 2table 2.significant differences in ie variables between the young and elderly ( mean
sd)ietotal phasephase1phase2phase3phase420s mean0.34 0.05 * 0.30 0.14 * 0.82 0.030.11 0.100.68 0.06 * 70s mean0.25 0.04 * 0.07 0.13 * 0.79 0.030.08 0.130.78 0.05*t - test , * p<0.05 , unit : dimensionless ratio of effective force to resultant
force .
the ie of the young was greater than that of the elderly , except in phase
3 .
t - test , * p<0.05 , unit : dimensionless ratio of effective force to resultant
force
however ,
improper pedaling postures can increase the likelihood of injury . to investigate pedaling
characteristics , kinematic and pedal force analysis
thus , to evaluate the proper
pedaling posture for the elderly , this study compared the pedaling efficiency in the elderly
with that in the young using ie and kinematic results .
the kinematic results showed that the knee rom in the elderly was less than that of young
adults ( table 2 ) , because the maximum knee
extension in the elderly was less than that of the young .
therefore , the elderly could not
extend the knee sufficiently during phase 3 , which affects the flexion of the ankle joint .
however , there was no significant difference in ie in phase 3 and maximum plantar flexion of
the ankle between the 2 groups .
the maximum knee flexion during phase 1 was not significantly
different between the 2 groups ; however , the maximum dorsiflexion in the young adults was
greater than that in the elderly .
it is believed that ankle movement had an effect on ie
during phase 1 .
therefore , ankle joint movement has an effect on the ie ; i.e. , the pedaling
effectiveness , rather than knee joint movement .
the ankle joint rom in the young was greater
than that in the elderly because of activation of the tibialis anterior ( ta ) muscle .
ankle
joint movement is generally controlled by the agonistic and antagonistic function of the ta
muscle and gastrocnemius medialis muscle3 , 10 .
the ta muscle is activated at the start of the swing phase and during toe clearance ,
and ankle joint rom in the elderly is generally reduced during gait3 .
this is due to the weakness of the ankle plantar and
dorsiflexor muscles in the elderly .
aging has a profound effect in terms of decreases in the
distribution and properties of muscle fibers , and therefore on pedal force1 .
the ankle flexion results in the elderly
indicated that ankle movement is less free than that in the young .
pedaling is generally carried out by applying a downward force during the propulsive phase
( phase 2 ) and an upward force during the recovery phase ( phase 4 ) .
2 ) during
the propulsive phase ( phase 2 ) and relatively efficient pedaling , although the difference
was not significant .
moreover , the resistive force in the young was greater than that in the
elderly .
the effective force was negative during phase 3 and phase 4 , which involve
application of a resistive force to the pedal5 .
the fact that the young pedaled more effectively indicated that the
elderly have weak muscles and poorer kinematic movement than the young do . falling is a
major cause of morbidity in the elderly , and can result from an abnormal gait . to prevent
falls , it is important to increase joint flexibility and muscle activation3 . pedaling can enhance the joint flexibility
and muscle strength in the lower extremities . there was a significant difference in joint
movements between the 2 groups , particularly in the resistive force of ankle movement . to
overcome the resistive force and pull the pedal upward effectively , the use of a cleat or
toe clip pedal is recommended , to enhance the power of the pulling muscle .
this study compared the pedaling efficiency in the young with that in the elderly using the
ie concept .
the young pedaled more effectively at all phases than the elderly , except in
phases 2 and 3 .
to propose an
efficient pedaling method for the elderly , a further comparative study using
electromyography is underway . | [ purpose ] proper pedaling posture can improve muscle strength and cardiopulmonary
function . to investigate proper pedaling posture for the elderly , this study compared the
pedaling efficiency of the elderly with that of the young by using an index of
effectiveness ( ie ) and kinematic results .
[ subjects and methods ] eight adults in their
twenties and eight in their seventies participated in 3-min , 40 rpm cycle pedaling tests ,
with the same load and cadence .
the joint angle , range of motion ( rom ) , and ie were
compared by measuring 3-dimensional motion and 3-axis pedal - reaction force during 4
pedaling phases ( phase 1 : 33030 , phase 2 : 30150 , phase 3 : 150210 , and phase 4 :
210330 ) .
[ results ] the knee and ankle rom , maximum knee extension , and maximum ankle
dorsiflexion in the elderly were significantly decreased compared with those in the young .
moreover , there were significant differences in ie for the total phase , phase 1 , and phase
4 between the elderly and young .
ie of the young was greater than that of the elderly ,
except in phase 3 .
[ conclusion ] joint movement in the elderly during pedaling was limited .
this study provides information that will facilitate the proposal of an efficient pedaling
method for the elderly . |
tumours are heterogeneous and contain hypoxic and anoxic regions , which alter cellular metabolism tending to select for a more malignant phenotype , which increases mutation rates , increases expression of genes associated with angiogenesis and tumour invasion , and is associated with a more metastatic phenotype of human cancers [ 1 , 2 ] . by enhancing metastasis , hypoxia compromises curability of tumours by surgery .
conversely , the hypoxic cells are associated with increased resistance to radiation and chemotherapy . due to the inadequate vascularisation of solid tumours , drugs do not reach hypoxic cells in adequate concentrations .
also , conventional anticancer drugs in clinical use are antiproliferative agents that kill dividing cells , by attacking dna ( synthesis , replication , or processing ) , being ineffective in the hypoxic tumours , because these cells are not dividing rapidly .
however , hypoxia has been identified as an important tool for the specific activation of some antitumour prodrugs , namely , bioreductive agents .
these prodrugs are inactive in well - oxygenated tissues and are selectively biotransformed to active cytotoxic species in hypoxic cells .
one of the most studied bioreductive agent is the n - oxide , tirapazamine ( sr4233 , figure 1(a ) ) [ 5 , 6 ] which after one - electron reductive activation releases hydroxyl free radical ( oh , figure 1(a ) ) producing oxidative dna damage without covalent binding to dna and proteins .
additionally , hybrid compounds that combine an n - oxide and a -dna stacking moieties have been described as enhanced - cytotoxic agents ( aq4n , figure 1(b ) ) . in this sense , we have designed a series of phenazine 5,10-dioxides ( pdos ) as prodrugs that could damage tumour hypoxic cells through bioreduction , generating free radicals and dna damage by intercalation .
some of the developed pdos are in vitro hypoxic selective cytotoxins , that is , pdo1 ( figure 1(c ) ) , others are hypoxic partially or nonselective cytotoxins , that is , pdo2 , pdo3 , and pdo4 , respectively ( figure 1(c ) ) , and others are noncytotoxic , that is , pdo5 ( figure 1(c ) ) [ 912 ] . besides , some of the pdos displayed in vitro aerobic - antiproliferative activity against caco-2 cells .
the selective hypoxic reduction and its relationship to bioreductive activity were proved using enzymatic mammal systems .
to get insight into the mechanism of pdos hypoxic / oxic cytotoxicity , herein , we depict a series of experiments .
electron spin resonance ( esr ) experiments , in aerobic and anaerobic metabolic conditions , were done to confirm the hypothesis that hypoxic - selective pdos could selectively produce oh in system with low oxygen content like sr4233 ( figure 1(a ) ) .
additionally , pdos oxidative genetic damage was evaluated by the modified comet assay after postdigestion of the cells with formamidopyrimidine - dna - glycosylase ( fpg ) and endonuclease iii ( eiii ) . for the best selective derivative , pdo1 , aerobic - cytotoxicity mechanism on human colorectal adenocarcinoma cell line
was studied analyzing the cell growth inhibition capacity , by mtt assay , the capability to alter the cell cycle and the possibility to induce apoptosis , by fluorescence - activated cell sorter ( facs ) and hoescht analysis , and the capacity to produce dna fragmentation by agarose gel electrophoresis . due to
the esr experiments showed that some pdos were able to produce oh in normoxia , we also studied the effect of vitamin c ( vitc ) on the bioreductive profiles .
this study tried to determine if this antioxidant modifies pdos biological behaviours , especially exhibiting a protective action in normoxic cells . to select the type of tumour for the in vivo studies , bioreductive profiles against a set of tumour cells ( mcf-7 , tk-10 , and ht-29 ) were determined . from these results ,
the pdos were studied in vivo on a chemically induced model of rat breast tumours , evaluating initially the systemic toxicity of compounds on healthy animals .
pdo1-pdo5 were prepared according to previous description . all the reagents and solvents for syntheses and esr experiments were purchased from sigma - aldrich ( st .
v79 cells ( chinese hamster lung fibroblasts ) were obtained from european collection of animal cell cultures , and maintained in logarithmic growth as subconfluent monolayer by trypsinisation and subculture to ( 1 - 2 ) 10 cells / cm twice weekly .
the growth media was eagle 's minimal essential medium ( emem , gibco , prat de llobregat , barcelona , spain ) , containing 10% ( v / v ) foetal bovine serum ( fbs , gibco , prat de llobregat , barcelona , spain ) and penicillin / streptomycin at 100 u/100 g / ml . caco-2 cells ( atcc / htb-37 , atcc , manassas , va , usa ) , were grown in dulbecco 's modified eagle 's medium ( dmem , gibco , prat de llobregat , barcelona , spain ) supplemented with 10% fbs and 1% antibiotic ( 10,000 u / ml penicillin and 10,000 ug / ml streptomycin , gibco , prat de llobregat , barcelona , spain ) .
cells were maintained as monolayer cultures at 37c in a humidified atmosphere with 5% co2 .
an adequate number of mcf-7 ( human mammary adenocarcinoma , atcc htb-38 ) , tk-10 ( human kidney carcinoma , nci ) , and ht-29 ( human colon adenocarcinoma , atcc htb-38 ) cells , were maintained in rpmi-1640 growth media , supplemented with l - glutamine ( 1% ) , penicillin / streptomycin ( 1% ) , nonessential amino acids ( 1% ) , and 10% ( v / v ) fbs .
the cultures were maintained at 37c and 5% co2 for 48 h. the absorbance at 540 nm before the treatment was determined .
all esr experiments were conducted using a bruker ecs 106 spectrometer ( bruker instruments inc . ,
billerica , mass , usa ) in the x band ( 9.85 ghz ) using a rectangular cavity and 50 khz field modulation .
all the spectra and the hyperfine couplings ( to 0.1 g ) were registered in the same scale and after 15 scans .
livers were obtained from female wistar rats ( 250300 g ) , provided by the
the experimental protocols with animals were evaluated and supervised by the local ethics committee and the research adhered to the principles of laboratory animal care .
the animals were sacrificed by cervical dislocation and the livers , maintained in a ice bath , were perfused in situ with an ice - cold nacl ( 0.9% ) solution and washed with 3 volumes of tris - hcl ( 0.05 m)-sucrose ( 0.25 m ) ph = 7.4 , then they were sliced and homogenised in a potter - elvehjem glass - teflon homogeniser .
the homogenates were centrifuged for 30 min at 900 g at 4c and the supernatant fraction was centrifuged at 10,000 g for 1 h at 4c .
the pellet was discarded and the supernatant fraction was further centrifuged at 100,000 g for 1 h at 4c . the cytosolic fraction , supernatant , was recovered .
protein content was determined by the bicinchoninic acid assay from sigma ( st . louis , mo , usa ) as suggested by the manufacturer .
pdo1-pdo3 or pdo5 ( 1 mm in dmso ) , the spin trap n - tert - butyl--(4-pyridyl ) nitrone n-oxide ( pobn , 100 mm ) , and rat liver cytosolic proteins ( 1 mg / ml ) in phosphate buffer ( 0.1 m , 1.5 mm edta , ph = 7.4 ) were mixed at 37c in the esr cell and gassed with nitrogen ( simulated - hypoxia ) or oxygen ( simulated oxia ) for 20 min .
monolayer v79 cells in exponential growths were trypsinised ( trypsin , gibco , prat de llobregat , barcelona , spain ) and suspension cultures were prepared in 50 ml glass flasks : 3.3 10 cells / ml in 30 ml of growth media .
the glass flasks were topped with rubber caps perforated with two 21 g needles ( microlance , becton dickinson , fraga , huesca , spain ) to provide gas inlet and outlet in order to generate hypoxia and well - oxygenated conditions .
they were placed on a shaking device introduced in a water bath at 37c and were gassed with humidified air ( oxygenated experiment ) or with nitrogen ( hypoxic experiment ) during all the experiment .
after 30 min of gassing , 200 l of each solution were added to reach the following final concentrations : 10 and 20 m in oxygenated conditions and 1 , 5 , and 10 m in hypoxia . at these concentrations ,
after 2 h of treatment , cells were centrifuged at 175 g and resuspended in 1 ml of growth media .
the cell concentration was adjusted to 6.25 10 cells / ml in pbs .
forty microliters were mixed with 130 l of 1% low - melting - point agarose ( sigma - aldrich , st .
louis , mo , usa ) and 80 l was spread onto microscope slides ( menzel - glaser , braunschweig , germany ) precoated with 0.5% of normal - melting - point agarose ( sigma - aldrich , st .
three slides were prepared for each condition , slides 1 , 2 , and 3 .
glass cover slips ( menzel - glaser , braunschweig , germany ) were placed on the gels , which were allowed to set at 4c .
then , the cover slip was removed and the cells embedded in agarose were lysed for 1 h by immersion of the slides in 2.5 m nacl , 100 mm na2edta , 10 mm trizma
hcl , ph = 10 and 1% triton x-100 at 4c . after that the slides were washed three times ( 5 min each time ) with enzyme buffer ( 0.1 m kcl , 0.5 mm na2edta , 40 mm hepes - koh , 0.2 mg / ml bsa , ph = 8.0 ) and incubated for 45 min at 37c with fpg in the enzyme buffer slide 1 , or eiii in the enzyme buffer slide 2 , or with buffer alone slide 3 .
then , the slides were placed on a horizontal gel electrophoresis tank and the dna was allowed to unwind for 40 min in freshly prepared alkaline electrophoresis buffer ( 300 mm naoh and 1 mm na2edta , ph > 13 ) .
electrophoresis was run in the same buffer for 30 min at 25 v ( about 0.8 v / cm across the gels and approximately 300 ma ) in an ice bath condition .
the slides were rinsed three times ( 5 min each time ) with 400 mm trizma ( ph = 7.5 ) to neutralize the excess alkali .
gels were stained with 25 l of 1 g / ml dapi ( sigma aldrich , st .
louis , mo , usa ) , covered with a cover slip and coded before microscopic analysis .
dapi stained nuclei were evaluated with a nikon eclipse te 300 fluorescence microscope ( nikon , tokyo , japan ) .
a total of 100 comets on each gel were visually scored and classified as belonging to one of five classes according to the tail intensity .
each comet class was given a value between 0 and 4 : ( 0 ) = no damage and ( 4 ) = maximum damage .
the total comet score ( tcs ) was calculated by the following equation : ( percentage of cells in class 0 0 ) + ( percentage of cells in class 1 1 ) + ( percentage of cells in class 2 2 ) + ( percentage of cells in class 3 3 ) + ( percentage of cells in class 4 4 ) .
controls were included , only solvent for negative and treatment with hydrogen peroxide ( 50 m ) during 5 min on ice for positive one .
samples containing 200 l cell suspension ( 2 10 cells / ml ) were plated in 96-well - flat - bottomed microtiter plates .
after adherence of the cells within 24 h of incubation at 37c , pdo1 and pdo2 at doses ranging from 1 m to 1000 m were added to different wells ( 3 - 4 per concentration ) . after additional incubation time
( 24 , 48 , and 72 h ) at 37c in a humidified incubator with 5% co2 , mtt dissolved in pbs and sterile filtered was added to all the wells at a final concentration of 1 mg / ml . following 1 h of incubation , the generated formazan was dissolved with 100 l dmso per well .
the optical density was measured using an elisa plate reader ( merck elisa system mios version 3.2 . ) at 550 nm .
the concentrations that caused 50 and 80% inhibition of cell growth ( ic50 and ic80 ) were calculated .
cells were cultured in 6-well flat bottomed microtiter plates containing 2 ml of cell suspension .
the number of cells was determined by calculation according to the number of cells / wells in 96-well plates ( 582,000 cells ) .
after 24 h of incubation at 37c with 5% co2 , pdo1 was added at ic50 dose . following 24 h of incubation
, cells were harvested by mild trypsinisation , collected by centrifugation and stained in tris buffered saline for 1 h at 4c .
facs analysis was carried out at 488 nm in an epics xl flow cytometry ( coulter corporation , hialeah , fla , usa ) .
data from 12,000 cells were collected and analysed using multicycle program ( phoenix flow systems , san diego , calif , usa ) .
apoptosis was assessed using annexin v - fluorescein isothiocyanate ( fitc ) kit binding assay and analyzed by facs .
cell culture and treatment with pdo1 was carried out as described in cell - cycle analysis section .
thereafter , cells were resuspended in binding buffer ( 10 mm hepes / naoh , ph = 7.4 , 140 mm nacl , 2.5 mm cacl2 ) .
annexin v - fitc ( bender system kit ) was added according to the product insert and incubated for 30 min at room temperature in the dark .
one min before facs analysis , propidium iodide ( pi ) was added at a concentration of 20 g / ml . approximately 500.000 viable cells were counted to assess apoptosis .
cells were cultured in 6-well flat bottomed microtiter plates containing 2 ml of cell suspension .
the number of cells was determined by calculation according to the number of cells / wells in 96-well plates ( 12,000 ) .
after 24 h of incubation at 37c with 5% co2 , pdo1 was added at its respective ic50 and ic80 doses .
following 24 h of incubation in the absence or presence of the indicated compound , cells were harvested by mild trypsinisation , collected by centrifugation and fixed with paraformaldehyde at 3.7% for 10 min at 20c .
cells were washed with pbs , centrifuged at 2500 rpm for 5 min , triton - x100 at 0.5% was added for 5 min at 4c and cells were stained with 50 ng / ml hoechst 33258 dye for 15 min and then placed onto slides , coverslips were mounted with mowiol 488 .
2 10 cells / well were cultured in 100-mm plates and treated for 24 h with pdo1 at ic50 dose . chromosomal dna was isolated ( real , durviz , valencia , spain ) and ladder formation was analysed in a 1% agarose gel visualizing with ethidium bromide staining .
monolayers of cells ( v79 , mcf-7 , tk-10 , or ht-29 ) in exponential growth were trypsinised , and suspension cultures were set up in 50 ml glass flasks : 2 10 cells / ml in 30 ml of the corresponding growth media .
the glass flasks were submerged and stirred in a water bath at 37c , where they were gassed with humidified air or pure nitrogen .
stock solutions , 150-fold more concentrated , were prepared in pure dmso ( aldrich , st .
thirty min after the start of gassing , 0.2 ml of the stock compound solution was added to each flask , two flasks per dose . in every assay
, there was one flask with 0.2 ml of dmso ( negative control ) .
in the assays with vitc , after 5 min of gassing the cells suspension , with air or nitrogen , 100 l of vitamin solution was added to reach the same concentrations that the studied pdos and 25 min pretreatment before compounds addition was done . cloning :
after 2 h exposure to the compound , the cells were centrifuged and resuspended in plating medium .
cell numbers were determined with a haemocytometer and 1010 cells were plated in 6-well plates to give a final volume of 2 ml/30 mm of well .
plates were incubated at 37c in 5% co2 during 7 days , for v79 , or 14 days , for mcf-7 , tk-10 , and ht-29 , and then stained with aqueous crystal violet .
the plating efficiency ( pe ) was calculated by dividing the number of colonies by the number of cells seeded .
the percent of control - cell survival for the compound - treated cultures ( sfnormoxia and sfhypoxia ) was calculated as pe - treated / pe - control 100 .
the compounds were tested at different doses in duplicate flasks both in normoxic and hypoxic conditions .
specific pathogen - free 180-day - old adult ( for maximum tolerated doses ( mtd ) studies and toxicity in healthy animals studies ) or 60-day - old adult ( for in vivo tumour studies ) female sprague - dawley rats were purchased from centro de investigaciones nucleares - universidad de la repblica ( montevideo , uruguay ) .
rats were housed in sterile individually ventilated cages ; food and water were provided ad libitum , in accordance with the standard operating procedures set down in si 17/94 of the european union .
animals were sacrificed by cervical dislocation if found to be in distress ( hunching , failure to groom , etc . ) or if tumour volume exceeded 10% of mouse bodyweight .
all experiments were performed according to the local animal ethics committee ( universidad de la repblica ethical committee , montevideo , uruguay ) guidelines for animal experimentation .
pdo1 and pdo2 were suspended in sterile saline : tween80 ( 4 : 1 ) ( vehicle solution ) immediately prior to injection .
these preparations were made under aseptic conditions and in all cases suspensions were obtained by shaking under ultrasound conditions . in order to determine the in vivo dose with the minimum associated - toxicity
first at all the mtds ( dose giving 20% weight loss within 3 days of a single ip administration ) for pdo1 and pdo2 were determined .
consequently , three nontumour - bearing animals per dose level were injected intraperitoneally with a single dose of compound , at 60 , 120 , or 300 mg / kgb.w .
animals were weighed and observed daily for alterations in skin , physical aspect , activity and faeces aspect .
after that , nontumour - bearing animals were treated intraperitoneally , at a dose equivalent to mtd/6 , according to schedule showed in figure 1s ( see appendix .
animals were sacrificed at the experimental end point ( figure 1s ) , the organs ( lung , kidney , liver , spleen , heart , and intestine , maintained in aqueous formalin solution ( 10% ) ) for further histological studies were obtained by autopsy and blood for biochemical and haematological studies was drawn by sectioning the subclavian artery .
biochemical and haematological determinations were done immediately or no more than 24 h post - extraction maintaining the blood in edta or heparin at 0c .
louis , mo , usa , dissolved in acidified saline ) by tail - vein injection at 60 , 90 , and 120 days of age .
animals were palpated twice a week 60 days after the last nmu administration in order to record the presence , location , size , and date of detection for all tumours .
induction efficiency of 50% was obtained . when the tumours reached approximately 4 mm in diameter
the rats were randomly divided into three groups ( untreated animals , pdo1- , or pdo2-treated ) .
the treatment groups received an ip injection of pdos , at a dose equivalent to mtd/6 ; once daily according to schedule showed in figure 1s ( see appendix .
the long ( l ) and short ( s ) axes were recorded , and tumour volume ( v ) was calculated using the following equation as described previously :
( 1)v=(s2l)2 .
regarding statistical analysis ,
animals were sacrificed at the experimental end point ( figure 1s ) , the organs ( lung , kidney , liver , spleen , heart , and intestine , maintained in aqueous formalin solution ( 10% ) ) and tumours for further histological studies were obtained by autopsy and blood for biochemical and haematological studies was drawn by sectioning the subclavian artery .
biochemical and haematological determinations were done immediately or no more than 24 h after extraction maintaining the blood in edta or heparin at 0c .
sections from organs and tumours were fixed in 10% neutral buffered formalin and embedded in paraffin .
in order to probe that the pdo bioreduction is associated to oh production and to know whether it occurs according to compounds selectivity profiles , some pdos were metabolised under normoxia and simulated hypoxia and esr spectra were acquired .
therefore , one selective , pdo1 , two partially selective , pdo2 and pdo3 , and one noncytotoxic derivative , pdo5 ( figure 1(c ) ) , were included in this study . except for compounds
pdo1 in normoxia and pdo5 in both conditions the spectra show a double triplet signal ( figure 2 ) with hyperfine splitting of ah = 2.9 and an = 16.0 g , which pattern is attributed of the spin trap(pobn)-oh adduct .
spin trap - esr experiments clearly demonstrated pdos were able to release oh in presence of bioreductive systems finding that non selective and cytotoxic derivative , that is , pdo2 , produces it under both conditions contrary non active derivative , that is , pdo5 , shows no free radical production ( no signal in the esr spectrum ) . while the in vitro hypoxic selective cytotoxin pdo1 releases oh only under simulated hypoxia . for pdo2 and pdo3 in normoxia the identified oh could be the result of a
, where the produced superoxide radical , o2 , via spontaneous dismutation gives h2o2 that could be reduced to the oh free radical .
these results confirm that cytotoxic selectivity could be due to the selective radical species generation during the bioreduction process under hypoxic conditions as it is described for sr4233 . to evaluate the role of oh on the dna damage we checked , using alkaline comet assay , whether pdo1 and pdo2 were able to generate dna strand breaks and oxidative dna damage .
this last phenomenon could be probed by alkaline comet assay using two enzymes , that is , fpg and eiii .
fpg is involved in the first step of base excision repair to remove specific modified bases from dna excising mainly 2,6-diamino-4-hydroxy-5-n - methylformamidopyrimidine and 8-oxo - g .
figure 3 shows the comet assay results obtained with pdo1 and pdo2 in the different experimental conditions . under simulated - hypoxia the treatment with pdo1 during 2 h ( figure 3(a ) )
increased moderately the total comet score ( tcs ) of v79 cells comparing to hypoxic untreated cells ( c( ) , figure 3(a ) ) however lower than the tcs of positive control ( c(+ ) : h2o2 , 50 m , during 5 min on ice ) at all the studied doses . additionally , pdo1 was less genotoxic in both conditions than previous studied quinoxaline dioxide .
interestingly , according to a significant increase in the tcs when the v79 cells were digested with fpg , pdo1 could produce genotoxicity in hypoxia by production of 8-oxo - g .
no differences were found between treatments with and without eiii showing absence of hypoxic - pdo1 oxidizing capability on pyrimidines . on the other hand ,
pdo2 produced ( figure 3(b ) ) , in a dose - dependent manner and in both conditions , higher tcs than negative control and pdo1 being the results more notorious in simulated hypoxic conditions .
there were differences between the hypoxic tcs when the digestions were done with both fpg and eiii and without them showing pdo2 hypoxic genotoxicity could be the result not only of the production of oxidised - purines ( 8-oxo - g ) but also oxidised pyrimidines .
these results indicate pdo1 and pdo2 promote in hypoxia dna - oxidative damage yielding oxidised purines or oxidised purines and pyrimidines , respectively , like sr4233 . in agreement with the esr experiments in normoxia , pdo2 produced higher dna - strand breaks than pdo1 .
for the best selective derivative , that is , pdo1 ( better in vitro phypox and hcr , figure 1(c ) ) , aerobic - cytotoxicity mechanism on human colorectal adenocarcinoma cell line , caco-2 , was studied . according to our previous results pdo1 showed low oxic cytotoxicity , and this , according to results herein depicted ,
could be related to dna damage ( figure 3(a ) ) and not to oh production ( figure 2 ) .
caco-2 growth inhibition capacity of derivative pdo1 was studied by mtt assay , its capability to alter the cell cycle and the possibility to induce apoptosis were examined using fluorescence - activated cell sorter ( facs ) and hoescht analysis , and its capacity to produce oxic dna fragmentation was analyzed by agarose gel electrophoresis . as indicated by the ic80 , pdo1 was less caco-2-antiproliferative agent than pdo2 in oxic conditions ( figure 4(a ) ) .
pdo1 was able to induce an arrest in g2/m cell cycle phase , after 24 h and at ic50 dose ( figure 4(b ) ) , which led cells to necrosis confirmed by annexin v analysis .
however , pdo1 also produced apoptotic cells at ic50 and ic80 doses , confirmed by hoechst ( data not shown ) and by the appearance of dna - ladder pattern ( figures 4(c)4(e ) ) .
these experiments highlight the relevance of pdo1 as potential drug in overcoming cancer . due to
the esr experiments showed that pdo2 and pdo3 were able to produce oh in normoxia , we studied the effect of vitc on their v79-hypoxic and normoxic cytotoxicities . therefore , to see whether vitc had protective activity in oxygenated systems and prooxidant activity in hypoxic ones we performed an in vitro bioreductive study preincubating the cells with vitc 25 min before the incorporation of pdo2 , pdo3 , or pdo4 into to the milieu .
pdo3 and pdo4 selective cytotoxic profiles were modestly modified to most selective behaviours in presence of vitc ( table 1 ) which apparently scavenges reactive oxygen radicals in normoxia . however , in hypoxic conditions , and also for pdo2 , vitc potentiates compounds cytotoxicity in v79 cells , like it was described previously for sr4233 .
this information could be used for future cancer treatment schedules . to select the type of tumour for in vivo studies , hypoxic and normoxic cytotoxicity against a set of tumour cells , mcf-7 , tk-10 , and ht-29 ,
were performed with the hypoxic partially selective cytotoxins pdo2 . from these studies ( table 1 )
, it could be seen partially selective cytotoxic profiles on the three studied tumour cells , like in v79 ones , showing the major cytotoxicity against human breast cancer cells ( mcf-7 ) . after the demonstration that hypoxic selective pdo1 induce some degree of apoptosis in oxia and hypoxic non - selective pdo2
is not just specific for any of the studied tumour cells but awfully toxic for mcf-7 , we next sought to determine the effects of both compounds in an in vivo breast - cancer model .
we selected the model of nmu chemically induced breast tumours because these tumours have hypoxic regions , and consequently , it is appropriate to study the in vivo behaviour of hypoxic cytotoxin pdo1 .
initially , we confirmed that pdo1 and pdo2 did not adversely affect healthy animals being the mtd higher than 300 mg / kgbw .
both derivatives have very good values of mtd in comparison to values in mice for similar dioxides ( quinoxalines and sr4233 ) [ 19 , 27 ] .
also , four - week treatments were performed according to the selected schedule ( figure 1s , appendix .
supplementary data ) using a dose of 50 mg / kgbw / day equivalent to mtd/6 . in this condition , animals showed no alteration of behaviour during the study and the mortalities were 0% .
organs histology ( data not shown ) and biochemical and haematological findings ( table 2s , appendix .
supplementary data ) showed this treatment did not affect the healthy and strength of the animals .
secondly , treatments with pdo1 and pdo2 , according to schedule shown in figure 1s ( appendix .
supplementary data ) , to breast - tumour - bearing animals resulted in strong and significant decreases in tumour size indicating that both pdo1 and pdo2 significantly impeded tumour growth ( figure 5(a ) ) .
whereas for pdo2 the size tumours diminution , respect to day 0 , was evident at day 20th for pdo1 was manifested at the treatment 's beginning . during pdo1 and pdo2 treatments
no alteration of the animals was observed and mortality was 0% . from the necropsies , at experimental end point day 29th , were obtained the tumours ( figure 5(b ) ) and organs .
the histopathologic studies of pdo1-treated tumours showed absence of necrotic zones and good vascularisation ( arrows in figure 5(c ) ) , while the untreated tumours had full necrosis areas ( circle in figure 5(c ) ) .
in addition , the size reduction could be the result of the tumour compartmentalisation as result of the collagen from the tumour capside ( figure 5(d ) ) .
moreover , the untreated tumours showed local metastasis and absence of compartmentalisation phenomenon ( figure 5(d ) ) .
additionally , in the pdo1-treated tumours a desmoplastic and peritumour reaction was observed with infiltration of lymphocytes and eosinophils ( arrows in figure 5(e ) ) . this high infiltration
, we completed the information related to pdos mechanism of cytotoxicity and in vivo behaviours .
the pdos acted as bioreductive agents by hypoxic oh free radical production oxidative - damaging dna .
clearly , the esr studies showed that the pdos bioreduction , concomitantly with the generation of the corresponding reduced analogues , releases oh free radical .
the selective hypoxic cytotoxin pdo1 only produces this species in simulated hypoxia while the non- or poorly selective cytotoxins , pdo2 and pdo3 , produce it in both conditions .
the in vivo results could be indicating that pdo1 and pdo2 reach the tumour on a very good concentration and after the bioreduction process drugs remain in the tumour cells .
this could increase the possibility of cytotoxic events and also trigger action killing the surrounding well oxygenated cells .
future studies investigating the activity of the pdos in combination with vitc , and with other anticancer agents in vivo are planned , as are other tumour models and dosing - schedules .
also a combined treatment of both compounds could be performed considering the immune response activation produces by pdo1 and the excellent size tumour reduction provides by pdo2 .
| phenazine 5,10-dioxides ( pdos ) are a new class of bioreductive cytotoxins , which could act towards tumours containing hypoxic regions .
the pdos selective - hypoxic bioreduction was probed in vitro ; however , the mechanism of action has not been completely explained . besides , pdos in vivo antitumour activities have not been demonstrated hitherto .
we study the mechanism of hypoxic / normoxic cytotoxicity of pdo representative members .
electron spin resonance is used to confirm oh production , alkaline comet assay to determine genotoxicity , and gel electrophoresis and flow cytometry to analyze dna fragmentation and cell cycle distribution .
chemically induced rat breast tumours are employed to evaluate in vivo activities . for the most selective cytotoxin , 7(8)-bromo-2-hydroxyphenazine 5,10-dioxide ( pdo1 ) ,
exclusive hypoxic oh production is evidenced , while for the unselective ones , oh is produced in both conditions ( normoxia and simulated hypoxia ) . in normoxia ( caco-2 cells ) , pdo1 induces cell - cycle arrest and dna fragmentation but does not significantly induce apoptosis neither at ic50 nor ic80 . no difference in the comet - assay scores
are observed in normoxia and simulated hypoxia being the unselective 2-amino-7(8)-bromophenazine 5,10-dioxide ( pdo2 ) the most genotoxic .
the in vivo efficacy with the absence of systemic toxicity of pdo1 and pdo2 is checked out .
results from this study highlight the potential of pdos as new therapeutics for cancer . |
chemical leucoderma ( cl ) occurs after repeated topical or systemic exposure to a variety of chemicals , usually without preceding inflammation .
herein , a case of cl secondary to ear - ring stoppers made of polyvinyl chloride ( pvc ) is illustrated .
a 15-year - old girl presented with a patterned depigmentation over the back of both ear lobules of 2 months duration .
she refused previous history of spontaneous depigmented lesions on her body or in family members .
examination revealed well - defined circular areas of depigmentation , symmetrically involving back of both ear lobules and extending to the immediate retroauricular region , with no signs of inflammation or change in skin texture [ figure 1 ] .
the location of the lesions almost corresponded to the site of contact of the plastic ear - ring stoppers [ figure 2 ] .
patterned circular area of depigmentation over the back of left ear lobule plastic ear - ring stoppers made of polyvinyl chloride standard patch testing was done with the indian standard series and cosmetic series of allergens ( chemotechnique ) , approved by the contact and occupational dermatoses forum of india .
it was negative after 48 h. the patient refused patch testing for extended duration for fear of possible induced depigmentation at the patch test site .
she was started on topical 0.1% tacrolimus cream , but unfortunately she was lost to follow - up .
in a clinic - aetiological study of 864 cases , the aetiological agents causing cl identified were : hair dye 27.4% ( 21% self - use , 6.4% not self - use ) , deodorant and spray perfume 21.6% , detergent and cleansers 15.4% , adhesive bindi 12% , rubber chappal 9.4% , black socks and shoes 9.1% , eyeliner 8.2% , lip liner 4.8% , rubber condoms 3.5% , lipstick 3.3% , fur toys 3.1% , toothpaste 1.9% , insecticides 1.7% ,
therapeutic response was much better in pure cl ( 73.4% ) than in those with co - existing vitiligo ( 20.9% ) .
cl may pose a diagnostic dilemma as clinicopathological criteria do not reliably differentiate cl from vitiligo .
nevertheless , a history of repeated exposure to a known or suspected depigmenting agent is often useful .
genetically determined fragility of melanocytes is speculated to be the key mechanism . unlike idiopathic vitiligo ,
predisposing factors are implicated in cl , which initiate programmed cell death or apoptosis of melanocytes .
genetic inability of melanocytes to tolerate and/or respond to oxidative stress may be the underlying molecular mechanism in cl . to facilitate the diagnosis of cl ,
clinical diagnostic criteria have been proposed , according to which any three out of the following four should be present : a ) acquired vitiligo - like lesions , b ) history of repeated exposure to specific chemical compounds , c ) patterned vitiligo - like macules conforming to the site of exposure and d ) confetti macules .
our case met the first three criteria and hence labelled as a case of cl .
cl may occur at patch test sites , and patch test results may not always be positive in cases of cl . in a study of 50 patients of contact leucoderma , positive patch test reactivity with offending agent
was seen in 18 ( 36% ) and depigmentation was seen in only 4 ( 8% ) cases after 21 days of patch testing .
the final pvc products , when completely cured or hardened , are generally considered to be inert and non - hazardous to the skin .
however , there are a number of additives included in the final pvc products such as plasticisers and stabilisers , as well as molecules of the monomer . di ( 2-ethylhexyl )
phthalate ( dop ) , butyl benzyl phthalate and di - n - butyl maleate are used as plasticisers for soft pvc .
these plasticisers are known to cause contact dermatitis and contact urticaria . however , after a meticulous search on pubmed and medline , only three reports of pvc - induced cl have been found .
kim et al . reported cl with oxygen nasal cannula containing both pvc and plasticisers like dop , dibutyl phthalate and diethyl phthalate .
frenk and kocsis reported a case of depigmentation from adhesive tape made of pvc with a natural rubber adhesive base that contained a derivative of dihydroxydiphenyl methane .
it would have been interesting to know what plasticisers were used in its manufacture , but the facility was not available in our institution .
though the exact mechanism of pvc - induced depigmentation is not known , it has been mooted that pvc causes cl following prolonged contact .
treatment options of cl include discontinuation of the offending agent , topical steroids , tacrolimus , oral steroid pulse , phototherapy ( narrow band - uvb , puva ) , etc .
techniques of surgical repigmentation involve the transfer of melanocytes , melanocytes and keratinocytes , or full - thickness skin from normally pigmented areas to hypomelanotic patches .
autologous skin grafts can be divided into three major groups : ( 1 ) grafting of normal skin ( epidermis with or without dermis ) that contains melanocytes , ( 2 ) grafting of a noncultured epidermal or hair follicle suspension that contains melanocytes , and ( 3 ) grafting of cultured melanocytes with or without keratinocytes , in suspension or as sheets . in this case , the patient was advised to use the metallic stoppers instead of the pvc ear - ring stoppers .
pvc ear - ring stoppers are in vogue among girls / women as a substitute to the precious and expansive metals like gold or silver .
this is the first report of cl induced by plastic ear - ring stoppers . in future , with increasing use of pvc ear - ring stoppers in precious as well as imitation jewellery , dermatologists are more likely to encounter this patterned depigmentation , and therefore it is imperative to take cognisance of this new pattern and cause of cl . | we report a case of chemical leucoderma ( cl ) in a 15-year - old girl , who developed patterned depigmentation at the back of both ear lobules after contact with plastic ear - ring stoppers made of polyvinyl chloride ( pvc ) after continuous use for 67 months .
patch test with indian standard series and cosmetic series was negative after 48 h , but she refused patch testing for extended duration as the possibility of induced depigmentation at the test site was unacceptable to her . to the best of our knowledge ,
this is the first report of plastic ear - ring stopper induced cl . |
descrever a tcnica operatria da drenagem pulmonar atravs do estudo anatmico
em cadveres , determinar se o local definido para a drenagem pulmonar adequado e
seguro , e determinar a relao anatmica do tubo de drenagem com a parede
torcica , pulmes , grandes vasos e mediastino .
foram dissecados 30 cadveres de ambos os sexos , fornecidos pelo necrotrio do
hospital central da santa casa de so paulo , em so paulo ( sp ) no perodo entre
maio e novembro de 2011 .
foi inserido um dreno de ao de 7,5 cm com 24 f de
dimetro no segundo espao intercostal , na linha mdio - clavicular , bilateralmente ,
e foi medida a distncia do dreno com as seguintes estruturas : brnquios
principais , brnquios dos lobos superiores , vasos subclvios , artrias pulmonares ,
artrias pulmonares do lobo superior , veia pulmonar superior , veia zigos e aorta .
foram realizadas medies de peso , altura , dimetro laterolateral do trax ,
dimetro posteroanterior do trax e espessura da parede torcica de cada cadver .
dos 30 cadveres dissecados , 20 e 10 eram do sexo masculino e feminino ,
respectivamente .
a mdia da extremidade distal do dreno com os brnquios
principais direito e esquerdo foi de 7,2 cm .
a utilizao de um dreno torcico de tamanho fixo na posio preconizada
factvel e segura , independentemente das caractersticas antropomtricas do
paciente .
the disease copd is a nosological entity characterized by chronic airflow obstruction ,
associated with chronic bronchitis and emphysema .
in the latter ,
there is
an abnormal enlargement of the air spaces distal to the terminal bronchiole , accompanied
by destructive changes of the alveolar walls . in pulmonary emphysema
, the destruction of the alveolar walls adversely affects the
essential functions of the ventilatory mechanism . without the alveolar tissue
elastic
recoil and radial support properties , alveolar pressures will cause airway collapse
during exhalation .
airflow communication among adjoining alveoli ( collateral
ventilation ) is much more prevalent in the emphysematous lung than in the normal
lung .
bullous emphysema occurs as a result of bronchospastic obstructive disorders of the
bronchioles , with rupture of the interalveolar septa , forming extremely thin - walled ,
air - filled vesicles that are functionally inert and take up considerable space in the
chest cavity .
lung volume reduction surgery ( lvrs ) or " pneumoplasty " is indicated only in cases of
heterogeneous emphysema in which most of the diseased area of the lung is resected ,
allowing the remaining tissue to work more efficiently .
lung transplantation ( ltx ) is
the only option for patients with advanced diffuse ( homogeneous )
emphysema
.
two important limitations of ltx are the chronic shortage of organs and the limited
number of specialized centers , which result in increased waiting time for an organ of
such a magnitude that 25% of candidates for ltx die while on the waiting
list .
both methods require general anesthesia , icu admission , and prolonged hospital stays , as
well as having high morbidity and mortality .
, lvrs has an approximate cost of us$20,000 , whereas unilateral ltx costs
approximately us$400,000 .
in the department of surgery of the faculdade
de cincias mdicas da santa casa
de so paulo ( fcmscsp , santa casa de so paulo school of
medical sciences ) , located in the city of so paulo , brazil , surgery for pulmonary
emphysema has been performed since 1956 ,
such as in cases of thoracotomy
for resection of emphysematous pulmonary bullae . since the 1990s
, video - assisted thoracic surgery has been used to treat patients with
bullous emphysema .
however , regardless of the route of access , patients undergo general
anesthesia , resection of diseased lung parenchyma , and ( manual or staple ) suturing of
lung parenchyma .
mortality ranges from 1.5% to 26% .
to simplify surgical treatment and reduce the number of resulting complications ,
goldstraw et al .
,
in 1988 , described the technique for drainage of
emphysematous bullae in 20 patients , with resection of costal segment and general
anesthesia .
there was symptomatic improvement in 94% of patients , as well as objective
improvement in pulmonary reserve , as measured by spirometry .
in 1996 ,
a treatment alternative for patients with giant emphysematous bullae was
introduced by the fcmscsp surgical team : simple drainage under local
anesthesia .
this technique was developed at our facility and is based
on a modification of the procedure described by monaldi
for the treatment
of tuberculous lung cavities .
it is performed through a small thoracostomy in
association with pleurodesis with talc , which is introduced through the chest
tube .
in an article published in 2007 , botter et al .
described 31 procedures of
thoracostomy drainage of bullae under local anesthesia in 27 patients . from a functional
standpoint , spirometric parameters were improved one month after surgery when compared
with preoperative values . to provide one more treatment alternative for the relief of the debilitating effects of
advanced emphysema ,
surgeons at our institution presented , in 2008 , a new
protocol
for the treatment of patients with either homogeneous or
heterogeneous pulmonary emphysema who , even after having undergone the gold standard
treatment , continue to have disabling dyspnea .
the proposed method is designed to create alternative exhalation passageways by draining
the lung parenchyma , thereby establishing communication between the alveoli and the
external environment .
a small thoracotomy is performed in the second intercostal space
at the midclavicular line to access the affected lung .
a fixed - size chest tube is placed
in the opening and is attached to the lung .
the tube is located within the lung
parenchyma and is inserted after blunt dissection of the lung parenchyma .
another chest
tube is placed into the pleural space to aid lung reexpansion , whereas the first one
remains in the lung indefinitely .
this procedure is a surgical alternative to lvrs and ltx and has the following
advantages :
it is performed under local anesthesia , without the need for ventilatory
support during surgeryno resection or suturing of diseased lung parenchyma is performedimmunosuppressants are not used , and , consequently , their inconvenient adverse
effects are avoidedit is technically simpleit requires short hospitalization , and icu admission might not be necessaryit is inexpensive ( approximately us$1,000 )
it is performed under local anesthesia , without the need for ventilatory
support during surgery no resection or suturing of diseased lung parenchyma is performed immunosuppressants are not used , and , consequently , their inconvenient adverse
effects are avoided it is technically simple it requires short hospitalization , and icu admission might not be necessary it is inexpensive ( approximately us$1,000 ) in our original study ,
the inclusion criteria were as follows : having
emphysema ; being 75 years or younger ; being disabled despite having undergone the gold
standard treatment ( pulmonary rehabilitation ) ; having chest x - ray findings of lung
hyperinflation and hrct findings of homogeneous or heterogeneous emphysema ; having a
post - bronchodilator fev1 less than 35 - 30% of predicted , a tlc greater than
250% of predicted , and a dlco less than 50% of predicted ; having stopped smoking at
least three months before the procedure ; and being on a waiting list for ltx or
lvrs .
after approval by the fcmscsp human research ethics committee , the first surgical
procedures were performed , with encouraging results . to date , 9 patients have been
operated on with this technique .
the results for 3 of those 9 cases have been reported
recently .
despite the significant clinical improvement observed in the operated patients ,
there
have been no experimental studies describing the technical and anatomical aspects of
pulmonary drainage in terms of the safety of the technique in accessing the lung
satisfactorily without injuring the patient 's vital structures .
nor have there been
studies designed to determine whether the use of a fixed - size chest tube , regardless of
the anthropometric characteristics of the patients , affects the results .
we therefore designed this cadaver - based study to describe the surgical technique for
pulmonary drainage , to determine whether the site for the insertion of the chest tube is
appropriate and safe , and to determine the anatomical relationship of the chest tube
with the following structures : chest wall ; lungs ; large blood vessels ; and
mediastinum .
initially , the research project was presented to the scientific committee of the
department of surgery and to the heads of the department of anatomic pathology of the
fcmscsp with the aim of obtaining authorization for its performance . after authorization
was granted , the research project was submitted to the fcmscsp human research ethics
committee for approval . between may and november of 2011 ,
30 cadavers of both genders
were dissected at the santa casa de so paulo central hospital
mortuary , located in the city of so paulo , brazil . for inclusion of cadavers in the study , family members ( or legal guardians ) gave written
informed consent .
the consent form was presented to the family members ( or legal
guardians ) by one of the researchers , who answered any questions about the procedure
that would be performed .
we included cadavers of patients at the santa casa de so paulo who
died of natural ( non - violent ) causes and in whom the chest wall , mediastinum , pleural
space , and lungs were intact .
we excluded cadavers with extensive lung destruction , such as significant adhesions
( cases of severe tuberculosis or pneumonia , for instance ) .
the following anthropometric variables were measured on each cadaver : weight ; height ;
posteroanterior diameter of the chest ; laterolateral diameter of the chest ; and chest
wall thickness . the same pair of 7.5-cm , 24 f steel chest tubes was always used .
initially , the chest tube was inserted into the second intercostal space at the
midclavicular line , bilaterally , perpendicularly to the chest wall .
the sternum was
opened transversely , and the entire anterior chest wall was removed ( sternal plastron ) ,
approximately at the level of the fourth intercostal space ( figure 1 ) . subsequently , chest wall thickness was measured
bilaterally , near the opening for the insertion of the chest tube .
since the pleural
cavity was exposed , the lung was atelectatic , and the distal end of the chest tube was
found to be inserted into the pleural cavity ( figure
2 ) . with the lung in its normal anatomical position and
having the
intrathoracic , distal end of the chest tube as a reference , we measured , with a ruler ,
the distances from the tube to the following structures : right and left main bronchi ;
right and left upper lobe bronchi ; right and left upper lobe pulmonary arteries ; right
and left pulmonary arteries ; and right and left subclavian veins and arteries ( figure 3 ) .
the lung was then pushed aside , and we
measured , on the left , the distance from the tube to the aortic arch and , on the right ,
the distance from the tube to the azygos vein .
figure 3distance from the distal end of the chest tube to the right upper lobe
artery .
the variables chosen for the statistical analysis included the following : gender ; weight
( kg ) ; height ( cm ) ; posteroanterior diameter of the chest ( cm ) ; laterolateral diameter of
the chest ( cm ) ; distance from the tube to the main bronchi ( cm ) ; distance from the tube
to the right and left upper lobe bronchi ( cm ) ; distance from the tube to the right and
left subclavian vessels ( cm ) ; distance from the tube to the right and left pulmonary
arteries ( cm ) ; distance from the tube to the right and left upper pulmonary arteries
( cm ) ; distance from the tube to the right and left superior pulmonary veins ( cm ) ;
distance from the tube to the azygos vein ( cm ) ; wall thickness ( cm ) ; and distance from
the tube to the aorta ( cm ) .
for these variables , we performed an exploratory analysis to obtain information relevant
to the study . for qualitative variables , we calculated frequencies and percentages ,
whereas , for quantitative variables , we calculated means , medians , standard deviations ,
and ranges ( minimum and maximum ) .
the relationship between the
measured distances from the chest tube to the anatomical structures and the
anthropometric variables measured on the cadavers was investigated by calculation of
spearman 's correlation coefficient .
of the 30 cadavers dissected , 20 and 10 were male and female , respectively .
table 1 shows that the mean weight of the
operated cadavers was 68.6 2.1 kg , and the median weight was 66.5 kg .
the mean height
was 1.70 0.02 m , and the median height was 1.70 m. the mean posteroanterior diameter
of the chest was 29.4 2.8 cm , and the median posteroanterior diameter was 22.5 cm .
the
mean laterolateral diameter of the chest was 34.5 1.1 cm , and the median laterolateral
diameter was 34.0 cm .
table 1summary of measurements of anthropometric variables.variablenminimummaximummeanmedianstandard errorweight , kg3050.088.068.666.52.1height , m301.41.91.71.70.02age , years3024.082.061.868.02.8anteroposterior diameter of the chest , cm3015.060.029.422.52.5laterolateral diameter of the chest ,
cm3022.053.034.534.01.1
we measured the distances ( in cm ) from the intrathoracic , distal end of the chest tube
to each of all anatomical structures in question , except wall thickness ( table 2 ) .
no anatomical structure was perforated by
the chest tube , i.e. , none of the distances measured were equal to zero .
the greatest mean distance to the chest tube was 7.2 0.2
cm , for the left main bronchus , and the smallest mean distance was 5.2 0.2 cm , for the
left upper lobe pulmonary artery .
variablenminimalmaximalmeanmedianstandard errorright side
main bronchus304.59.07.27.00.2
upper lobe bronchus304.010.06.06.00.2
subclavian vessels304.09.06.46.50.2
phrenic nerve304.08.05.96.00.2
pulmonary artery305.010.07.16.80.2
upper lobe pulmonary artery304.08.55.85.80.2
superior pulmonary vein304.010.06.46.00.2
azygos vein304.011.07.07.00.3
wall thickness301.55.02.93.00.2left side
main bronchus306.010.07.27.00.2
upper lobe bronchus304.511.05.86.00.2
subclavian vessels304.09.056.06.00.2
phrenic nerve304.09.06.16.00.2
pulmonary artery304.59.06.46.20.2
upper lobe pulmonary artery303.59.05.25.00.2
superior pulmonary vein304.09.06.06.00.2
wall thickness301.55.02.93.00.1
aorta303.09.06.26.20.4aall distances are expressed in cm
all distances are expressed in cm in all cases , the intrathoracic , distal end of the chest tube touched or partially
perforated the anterior segment of the upper lobes bilaterally .
the intensity of contact
between the chest tube and the lung depended on whether the lung was partially expanded
or collapsed .
to our knowledge , there have been no studies describing pulmonary drainage in the
treatment of severe pulmonary emphysema , except for the previously mentioned studies
carried out by the fcmscsp team of thoracic surgeons .
however , in his
study of collateral ventilation , macklem , in 1978 ,
hypothetically
mentions creation of communication between the emphysematous parenchyma and the
environment as a way of decompressing trapped air . on the basis of previously demonstrated success and experience in accessing the lung
parenchyma , either by bronchostomy , as described by saad jr . ,
or by
drainage of giant emphysematous bullae , as described by botter ,
a clinical
protocol was developed for the purpose of identifying candidates for pulmonary
drainage .
the analysis of the data gathered in this study led to some important considerations :
the increased posteroanterior diameter of the chest in patients with copd makes
the technique for pulmonary drainage recommended in the protocol even safer ,
given that the mediastinal structures are more detached from the chest wall
because of the hyperinflated lungthe distal end of the chest tube was related to the anterior segments of the
upper lobes bilaterally ; therefore , insertion of the chest tube into the second
intercostal space at the midclavicular line provides satisfactory access to the
lung region to be drained ( target area)of the nine operated patients , eight underwent pulmonary drainage unilaterally
and one ( the last one ) underwent the procedure bilaterally , which was found to
be perfectly feasible and clinically safethere is no difference between chest wall thickness on the right and left
sides , the mean chest wall thickness being 2.9 cm ; since the chest tube
measures 7.5 cm , there were therefore 4.6 cm of intrathoracic chest tube
available to penetrate the cadaver lung . during the surgical procedure
,
approximately 5 cm of chest tube is inserted into the parenchyma . from a
clinical standpoint
, this value seems to be safe , given that there was no
significant bleeding during the surgical procedure , as well as efficient ,
allowing satisfactory drainage of the trapped air .
of the nine operated
patients , only one had bleeding through the chest tube insertion site in the
late postoperative period . at the time
, a chest x - ray showed that the distal
end of the chest tube was in close contact with the peripheral vessels of the
lung parenchyma but not with those of the hilum .
the late onset of bleeding
suggests neovascularization related to local foreign - body - type inflammation .
once the chest tube was removed , bleeding stopped , and the chest tube insertion
site healed spontaneously.in the comparison of the expanded lung of a live patient with the partially
expanded lung of a cadaver , the distances from the distal end of the chest tube
to the measured structures should be different in the two cases ; however , the
distances from the distal end of the chest tube to the fixed structures of the
mediastinum ( subclavian vessels , aorta , and azygos vein ) should be similar in
the live patient and in the cadaverthe extent to which the chest tube penetrates into the lung was not measured
( although , in all cases , the distal end of the chest tube partially penetrated
into or touched the anterior segments of the upper lobes ) ; nor was the severity
of structural damage in the drained parenchyma assessed , because , in order to
do so , it would be necessary to use another study model : explantation of a
lung , which would be connected to a respirator in order to remain expanded ,
followed by microscopic analysis of the lesion in the drained lungfor analysis of data correlation , all of the variables were cross - referenced in
order to detect a pattern . in general , it was found that a greater distance
from the chest tube to the main bronchi translated to a greater distance from
the chest tube to the other mediastinal structures .
an interesting finding is
that there was a positive relationship between weight and the left phrenic
nerve , i.e. , higher weight translated to a more medial position of the chest
tube , i.e. , on the left , drainage occurs closer to the heart in obese
patients.the correlation analysis also showed that chest wall thickness does not
correlate with weight or height .
therefore , a fixed - sized chest tube can be
used regardless of the anthropometric characteristics of the patients , given
that chest wall thickness does not correlate with these variables .
the increased posteroanterior diameter of the chest in patients with copd makes
the technique for pulmonary drainage recommended in the protocol even safer ,
given that the mediastinal structures are more detached from the chest wall
because of the hyperinflated lung the distal end of the chest tube was related to the anterior segments of the
upper lobes bilaterally ; therefore , insertion of the chest tube into the second
intercostal space at the midclavicular line provides satisfactory access to the
lung region to be drained ( target area ) of the nine operated patients , eight underwent pulmonary drainage unilaterally
and one ( the last one ) underwent the procedure bilaterally , which was found to
be perfectly feasible and clinically safe there is no difference between chest wall thickness on the right and left
sides , the mean chest wall thickness being 2.9 cm ; since the chest tube
measures 7.5 cm , there were therefore 4.6 cm of intrathoracic chest tube
available to penetrate the cadaver lung . during the surgical procedure
,
approximately 5 cm of chest tube is inserted into the parenchyma . from a
clinical standpoint
, this value seems to be safe , given that there was no
significant bleeding during the surgical procedure , as well as efficient ,
allowing satisfactory drainage of the trapped air .
of the nine operated
patients , only one had bleeding through the chest tube insertion site in the
late postoperative period . at the time , a chest x - ray showed that the distal
end of the chest tube was in close contact with the peripheral vessels of the
lung parenchyma but not with those of the hilum .
the late onset of bleeding
suggests neovascularization related to local foreign - body - type inflammation .
once the chest tube was removed , bleeding stopped , and the chest tube insertion
site healed spontaneously . in the comparison of the expanded lung of a live patient with the partially
expanded lung of a cadaver , the distances from the distal end of the chest tube
to the measured structures should be different in the two cases ; however , the
distances from the distal end of the chest tube to the fixed structures of the
mediastinum ( subclavian vessels , aorta , and azygos vein ) should be similar in
the live patient and in the cadaver the extent to which the chest tube penetrates into the lung was not measured
( although , in all cases , the distal end of the chest tube partially penetrated
into or touched the anterior segments of the upper lobes ) ; nor was the severity
of structural damage in the drained parenchyma assessed , because , in order to
do so , it would be necessary to use another study model : explantation of a
lung , which would be connected to a respirator in order to remain expanded ,
followed by microscopic analysis of the lesion in the drained lung for analysis of data correlation , all of the variables were cross - referenced in
order to detect a pattern . in general , it was found that a greater distance
from the chest tube to the main bronchi translated to a greater distance from
the chest tube to the other mediastinal structures .
an interesting finding is
that there was a positive relationship between weight and the left phrenic
nerve , i.e. , higher weight translated to a more medial position of the chest
tube , i.e. , on the left , drainage occurs closer to the heart in obese
patients .
the correlation analysis also showed that chest wall thickness does not
correlate with weight or height .
therefore , a fixed - sized chest tube can be
used regardless of the anthropometric characteristics of the patients , given
that chest wall thickness does not correlate with these variables .
the placement of a fixed - size chest tube in the position specified in the clinical
protocol makes pulmonary drainage feasible and safe , regardless of the anthropometric
characteristics of the patients , given that the chest tube in this position caused no
injury to the structures studied . | objective : a cadaver - based study was carried out in order to describe the pulmonary drainage
surgical technique , to determine whether the site for the insertion of the chest
tube is appropriate and safe , and to determine the anatomical relationship of the
chest tube with the chest wall , lungs , large blood vessels , and mediastinum . methods : between may and november of 2011 , 30 cadavers of both genders were dissected .
the
cadavers were provided by the santa casa de so paulo central
hospital mortuary , located in the city of so paulo , brazil . a 7.5-cm , 24 f steel
chest tube was inserted into the second intercostal space along the midclavicular
line bilaterally , and we measured the distances from the tube to the main bronchi ,
upper lobe bronchi , subclavian vessels , pulmonary arteries , pulmonary arteries in
the upper lobe , superior pulmonary vein , azygos vein , and aorta .
weight , height ,
and chest wall thickness , as well as laterolateral and posteroanterior diameters
of the chest , were measured for each cadaver .
results : of the 30 cadavers dissected , 20 and 10 were male and female , respectively .
the
mean distance between the distal end of the tube and the main bronchi ( right and
left ) was 7.2 cm ( for both ) .
conclusions : the placement of a fixed - size chest tube in the specified position is feasible
and safe , regardless of the anthropometric characteristics of the patients . |
premature born infants are at increased risk for morbidity , longer hospital stay , and death as opposed to term born infants [ 1 , 2 ] .
much of the recent neonatal outcome literature focuses on infants with a very low birth weight ( < 1500 gram ) or infants born very prematurely ( < 32 weeks gestation ) [ 35 ] .
several studies have mentioned lower cognitive scores , increased risk for attention deficit hyperactivity disorder , and delayed motor development in premature infants with very low birth weight [ 38 ] . however , the group of infants born between 32 and 37 weeks of gestation is larger . in the netherlands approximately 30% of all infants
are born at home , almost all at term . of the infants born in hospitals , approximately 7% to 11%
it is known that infants born between 32 and 34 weeks have a four times greater risk of needing mechanical ventilation , ten times greater risk of developing a pneumothorax , and a 15 times greater risk of developing a sepsis as opposed to term born infants [ 1 , 2 , 10 , 11 ] .
there are only a few studies on long - term motor developmental outcome , that is , several years after hospital discharge , in infants born between 32 and 34 weeks [ 2 , 12 , 13 ] .
our hypothesis was that preterm infants born between 32 and 34 weeks are at risk for delayed motor development .
from january 1999 till january 2005 , we included all 126 infants born between 32 0/7 and 34 0/7 weeks admitted to our neonatology ward , a medium and high care unit . during their stay ,
follow - up of motor development was offered by the attending physician and physical therapist as part of the post clinical developmental care program .
we studied their motor development at the corrected ages of 3 , 6 , and 9 months and 4 years .
written parental consent was obtained to describe the results in a manuscript . as follow - up of the psychomotor development is part of our standard care for premature born infants it was not necessary to ask for approval from the institutional medical ethical committee .
stay one of the physical therapist took a full history and performed a first exam .
after discharge , the alberta infant motor scale ( aims ) was performed by one of the physical therapists at the corrected age of 3 , 6 and 9 months . at the corrected age of 4 years the children
the infants were assessed at the hospital in a separate room during 45 minutes , of which 20 minutes was pure observation time .
the infants were randomly assessed by one of the physical therapists using the standardized aims and m - abc forms .
the alberta infants motor scale ( aims ) is a reliable norm - referenced observational tool that has been validated for use from term to 18 months of age in infants both born premature and full term .
aims measures qualitative aspects of movements without touching the infant and is sensitive to changes in an infants motor behavior .
after observation of the infant , a raw aims score is based on the number of gross motor positions and movements that the infant has shown while being prone , supine , sitting , and standing .
this raw score is translated to a percentile ranking that can be compared with normative age - matched samples of infants .
since there are no dutch norm values yet , we used the cutoff point of the tenth percentile , as recommended by darrah et al . .
below the tenth percentile the motor development was classified as abnormal . at the corrected age of 4 years
the m - abc is a norm - referenced test that consists of 32 tasks divided into four age bands . for this study , we used band 1 ( 46 years ) .
the tasks are divided into three sections : manual dexterity , ball skills , and static and dynamic balance .
a child 's score on each test is converted to a standardized impairment score , based on centile bands for the child 's age group .
an infant has a normal score when the total impairment score ( tis ) is at or above the 16th percentile .
infants with a tis < 16 percentile were considered to be abnormal . in the final analysis we included patients for whom 2 or more assessments , of which one was the m - abc , were performed .
the data were analyzed using spss for windows ( version 17.0 ; spss , chicago , il ) .
to determine the correlation between aims and m - abc , we used the spearman 's rho correlation test .
from january 1999 until january 2005 , 126 inborn infants , born after a gestational age between 32 0/7 and 34 0/7 weeks were admitted to the neonatology ward of the groene hart ziekenhuis , gouda , the netherlands and assessed by our physical therapists .
none of the children had serious abnormalities on cranial ultra sound ( 10 had flaring grade 1 in the first week only , and two infants had an enlarged ventricle but still within normal values according to levene .
. ninety percent of the patients of the study group were infants of caucasian parents .
as far as recorded , 4% of the families had a lower socio - economic status ( ses ) . in the majority of 70 infants ( 51 infants ) ,
fourty - two infants ( 60% ) received breast milk for any period of time .
of the infants who did not receive breast milk 7.4% had abnormal scores at 4 years of age , as opposed to the infants with breast milk where 21.4% had abnormal motor development at 4 years of age . of 70/126 infants ( 55% ) ,
the m - abc at 4 years of age was done next to at least one other assessment in the first year of life ( median of 3 assessments ) .
the subgroup of infants with assessments at 4 years of age and at least one in the first year was further analyzed .
due to a very limited number of assessments at 6 months of age , these results are not described .
the outcome of all assessments is shown in figure 1 . at 3 months of age 8/66
infants assessed ( 12% ) showed an abnormal motor development , only one of these infants still had an abnormal development at four years of age . at the corrected age of 9 months , 20/62 infants scored abnormal , of which 20% ( 4 infants ) still scored abnormal at 4 years of age .
the percentage of children with a normal motor development was 68% and 83% , respectively at 9 months and 4 years of corrected age .
there was no statistical correlation between the motor development at 3 months or 9 months and 4 years ( p = .26 and p = .21 , resp . ) .
six infants had an apgar score below 7 after 5 minutes ( 6% ) . at 3 months
, one of these infants scored abnormal but normal at four years of age . at the corrected age of 4 years
an abnormal assessment at 3 or 9 months of age evolved to normal motor developmental outcome in 80% at 4 years of age . on the other hand
, 10% of the children who scored normal in the first year showed a delayed / abnormal motor development at the age of four years .
our results suggest that long - term follow - up of these late preterm born infants is necessary , as the assessments in the first year do not predict the long - term outcome .
our results show that almost 20% of the infants born late preterm has an abnormal assessment at the age of 4 , which is comparable with the outcome of elbw infants .
variables as ses , presence of chorioamnionitis , breast milk , and ethnicity have been described to be of influence on motor development [ 2022 ] . in our study there
seems to be no effect of gestational age , birth weight , apgar score , ses , or sex on motor developmental outcome , but the numbers were too small for statistical analysis . in our study
pathological exam of the placenta was not routinely done , leading to too small numbers for analysis . in our study group ,
on the contrary to other studies , breast milk was not protective for abnormal motor development .
it is possible that we did not find the same results as other studies because of the small study group .
gestational age range in this study was also very narrow which could also explain that no effect was seen for this item .
restiffe and gherpell , described the use of the aims in 43 infants , ranging from 26 to 36 5/7 weeks .
they concluded that all premature infants should be assessed at corrected ages to prevent children from being wrongly diagnosed with developmental delay .
they found that dutch children in the age of 012 months scored significantly lower on the aims than the canadian reference group of 19901992 .
also , they stated that the aims is the most sensitive in the first year of life .
, assessed 800 preterm infants with the aims and found evidence of a specific way of early motor developmental in the first 18 months of life of these infants .
they suggested that standard gross motor developmental scales should be adjusted for preterm infants .
as shown by the above - mentioned authors it is difficult to compare preterm infants to term infants . furthermore , our results show that infants that have been assessed in the first year of life and scored abnormal can evolve to normal motor development at four years of age .
on the other hand , a normal score the first year can lead to abnormal motor development later on .
it is possible , however , that the sample size of our study is too small to rule out chance in this respect .
it is possible that the percent with abnormal motor development at each age is within the range expected by chance with this sample size .
as there are no data described for this age group , we can not compare this .
there was a relatively high rate of loss to follow up in the total group of 126 infants .
of the group with an assessment at four years , several infants were not assessed at all study moments in the first year .
possibly , these infants had motor developmental difficulties and may have been seen by physical therapists nearby their home , whose assessments were not available for this study .
another possibility is that the infants were developing well and the parents did not see the necessity of a motor assessment .
second limitation is not blinding the investigators to the gestational age , which may have led to a bias .
our study results show that assessments in the first year of life in late preterm infants do not predict their motor developmental outcome at 4 years of age . however , we do suggest assessments at 3 , 9 , months and at 4 years of age .
assessments in the first year seem warranted to establish motor developmental delay , in order to provide for the most optimal support in the motor development of this potentially vulnerable group of infants .
possibly assessment at a later age ( for instance at 7 to 9 years ) is warranted to evaluate later outcome in fine motor skills . | little is known about motor development in late preterm born infants .
our objective was to determine long - term outcome of motor skills of infants born between 32 and 34 weeks .
all infants were assessed at corrected ages of 3 and 9 months , using the alberta infant motor scale . at corrected ages of 4 years , the movement assessment battery for children was done .
seventy infants were seen at 4 years of age ( median of 3 assessments per infant ) .
abnormal assessment at 3 or 9 months of age resulted in normal outcome in almost 80% at 4 years . on the other hand , a normal outcome in the first year of life resulted in an abnormal outcome at 4 years in 10% of the infants .
our results suggest that long - term followup of these late preterm born infants is necessary , as the assessments in the first year do not predict the long - term outcome . |
in order to gain insight into the perspective of a dialysis patient s carer , it is important to listen to and talk to carers . this is not as easy as it seems , since carers often feel that they can not talk freely about the burden of caring since they believe that they have nothing to complain about when compared to the suffering and loss experienced by the renal patient for whom they care .
however , as health care professionals , it is important that we give carers the time , space and permission to talk about how caring impacts on their lives and the sacrifices and joys it can bring .
so , the emphasis in this description is on carer awareness , highlighting for you the importance and value in supporting carers in their role .
carer is not a label many people feel comfortable with , and they see themselves as primarily a husband , wife , mother , father , daughter or friend rather than a
carers uk website offers the following definition:carers provide unpaid care and support to ill , frail or disabled friends or family members
carers provide unpaid care and support to ill , frail or disabled friends or family members more than three in five people will become a carer at some stage in their life and every year 2 million people become carers .
there are > 6 million carers in the uk and a study at leeds university estimated that they save the national health service and social care > 87 billion .
the legislation covering carers is detailed and the rights of carers are enshrined in : carers recognition and services act 1995 , carers and disabled children act 2000 and the carers ( equal opportunities ) act 2004 .
the work and families act 2006 and the equal opportunities act 2010 also make provisions for carers .
the carers recognition act ( 1995 ) formally recognized the role of carers and entitled carers to ask for an assessment of their own needs .
the carers and disabled children act ( 2000 ) extended this right to be a freestanding right and enabled local authorities to provide services for and make direct payments to carers .
the duty of a local authority to inform carers of their rights is detailed in the carers ( equal opportunities ) act 2004 and includes the requirement to include carer s employment , education , training and leisure during an assessment . the work and families act 2006 grants the right for carers
to request flexible working and the equalities act 2010 ensures that carers are not discriminated against in the workplace and are permitted time off to fulfil their caring responsibilities . in summary , carers have significant rights enshrined in law and a carer s assessment from a local authority can be helpful for a carer .
this assessment considers how caring impacts on the carer physically , emotionally , financially and examines ways to support and sustain the carer .
the benefits system is complex and details of the benefits available for carers are beyond the scope of this paper .
however , it is important to emphasize that carers benefits are linked to those of the person they care for , who has to have been awarded attendance allowance if > 65 years of age or disability living allowance if < 65 years of age .
renal patients performing haemodialysis at home qualify for medium rate care disability living allowance or low rate attendance allowance .
patients performing peritoneal dialysis at home may also qualify but only if they require some assistance with the treatment .
carers allowance is payable to carers > 16 years of age , who care for > 35 h , and do not earn > 100 per week or are in education for > 21 h per week .
it is payable at the weekly rate of 53.90 and can not be paid with another benefit such as retirement pension but can help increase eligibility for means tested benefits .
this leaflet was the outcome of work undertaken in york by the renal social worker and carers as part of a department of health action learning set looking at the year before dialysis. we produced a six - page leaflet covering topics such as carers ' rights , diet , medication , exercise , benefits , employment and who s who in the renal team , with telephone numbers .
my final message is for renal teams to think carers and to ensure that they are put in touch with the local renal social worker .
a renal social worker can help your team work with the financial and psychosocial aspects of living with kidney disease for both patients and their families and in particular highlight the important and often ignored issues for carers . | carers provide unpaid care and support to ill , frail or disabled friends or family members .
it is important for health professionals to give carers of home dialysis patients time , space and permission to talk about how caring impacts upon their lives and to look at how best to support them . |
airborne contact dermatitis ( abcd ) is a morphological diagnosis that encompasses all acute or chronic dermatoses predominantly of exposed parts of body , which are caused by substances which when released into the air , settle on the exposed skin .
although the diagnosis of abcd is not difficult for the trained eye , finding the causative contactant and the treatment of the resultant clinical condition may prove to be a challenge for the treating dermatologist .
airborne on the basis of the history of the patient and the follow - up , existence of dust or of volatile causative agents , the morphology and distribution of the lesions and the results of epicutaneous tests . over the years
, there has been an increasing recognition on the part of dermatologists regarding the occupational as well as the non - occupational airborne allergens and irritants .
the present review is aimed at discussing the various epidemiological aspects of abcd , the newly observed occupational and non - occupational airborne contactants , the protean clinical manifestations and the therapeutic modalities available in abcd .
this is primarily because of the fact that it can be very difficult and cumbersome to prove an abcd , especially of irritant type , and secondly because the term airborne has been less often used in literature .
it is generally believed that occupational airborne irritant contact dermatitis is grossly underreported and is much more common compared to airborne allergic contact dermatitis .
although abcd has been reported to be caused by a number of agents , most of which have been published as case reports or small case series , majority of the data from india and outside focus largely on plant antigens as being an important cause of abcd .
cabanillas et al . , reported a 3% prevalence of allergic dermatitis to plant antigens among patients presenting with contact dermatitis in the allergy unit , mostly in abcd pattern .
many authors have reported a significantly lower incidence and severity of sesquiterpene lactone ( sl ) sensitivity in east asian population ( 1.4% ) compared to european population ( 0.95.9%).[35 ] mak et al .
, postulated that consumption of chrysanthemum since childhood in east asia may result in induction of oral tolerance . among the patients with sl sensitivity , one
third acquire it occupationally . in india , parthenium dermatitis , caused by parthenium hysterophorus ,
it belongs to the family compositae , subfamily asteroide ( tribe heliantheae ) , which itself is a large , diverse group of the plant kingdom .
it is a wind pollinated plant and produces an enormous quantity of pollen ( up to 624 million per plant ) that can be carried away in clusters of 600800 grains .
lonkar and jog were the first to report the epidemic of parthenium dermatitis in agriculturists and field workers at pune , maharashtra , in 1968 .
presently , it is the commonest cause of plant dermatitis in india and is responsible for 40% of patients attending contact dermatitis clinics . today , there is increased use of herbal ingredients in culinary , cosmetic and medicinal products .
other members of the compositae family which are in wide use are the ornamental annuals like sunflowers , cosmos , marigold , asters ; herbaceous perennials like dahlia , chrysanthemum , marguerites ; vegetables like lettuce , chicory , artichokes ; herbal medicines like feverfew ( tanacetrim parthenium ) , pot marigold ( calendula ) ; natural insecticides like pyrethrum and weeds like bindii ( soliva pterosperma ) , ragweed , fleabane , stinkwort and capeweed . in a study by agarwal et al .
, from south india , 50 patients with a clinical picture and history consistent with parthenium dermatitis due to exposure to p. hysterophorus were studied .
the most common type of dermatitis was the classic abcd pattern ( 46% ) followed by the mixed pattern ( 30% ) , erythroderma ( 14% ) and chronic actinic dermatitis ( cad ) ( 10% ) .
of the 40 patients patch tested , 90% had patch - test results positive for parthenium .
in another study from delhi , 75 patients with clinically suspected contact dermatitis were patch tested with the indian standard series and indigenous antigens .
parthenium was the most common contact sensitizer ( 20% ) , followed by potassium dichromate ( 16% ) , xanthium ( 13.3% ) , nickel sulfate ( 12% ) , chrysanthemum ( 8% ) , mercaptobenzothiazole and garlic ( 6.7% each ) .
a study targeting regional danish floristry gardeners and greenhouse workers determined a lifetime prevalence of almost 20% of occupational dermatitis and identified working with compositae plants , having occupational mucosal symptoms or having a history of previous occupational eczema as the risk factors for developing occupational abcd .
in airborne allergic dermatitis , initially there is a refractory phase where there is a periodic or continuous contact with allergen but no response .
this is followed by an induction phase where the hapten penetrates skin , conjugates with epidermal protein , comes in contact with antigen presenting cells , migrates to draining lymph nodes followed by stimulation of naive t cells .
this leads to proliferation of activated t cells to produce effector and memory cells which then enter the circulation .
re - exposure to the specific hapten leads to the release of mediators producing skin inflammation .
the inflammation may resolve with cellular and enzymatic degradation of antigen , inhibition of antigen presenting cells and stimulation of suppressor t cells .
akhtar et al . , studied the cytokine profile in 50 patients with parthenium dermatitis , with all of them showing increased levels of pro - inflammatory cytokines like interleukin ( il)-6 , il-8 , il-17 and tumor necrosis factor ( tnf)- , and decreased levels of anti - inflammatory cytokines like il-4 and il-10 .
a study investigating the relationship between polymorphisms of tnf and contact allergy found that the distribution of tnf-308 genotypes was significantly different between cases with contact allergy and healthy controls , with carriers of the a allele being more frequent among polysensitized patients .
experimentally proved that dermatitis can be caused by inhalation of allergen with interplay of type 1 and 3 hypersensitivity .
their patient showed a positive patch test to parthenium , positive delayed reaction to prick test on day 1 and histopathology showing vasculitis .
in contrast , lakshmi et al . incriminated type 1 and 4 hypersensitivity in causation of abcd due to presence of positive prick test and raised serum ige levels in patients with patch test positive parthenium dermatitis .
abcd to cedar pollen is a recently identified disease that generally affects individuals with nasal and/or ocular symptoms , as well as some patients with atopic dermatitis .
it was suggested that in cedar pollinosis , pgd2-crth2 signaling contributes to inflammation , with the lesional skin showing il-13 , il-18 , eotaxin / chemokine ( c - c motif ) ligand ( ccl ) 11 , rantes / ccl5 , macrophage - derived chemokine / ccl22 and thymus and activation - regulated chemokine / ccl17 .
fillagrin mutation , as in atopic dermatitis , has been linked to causation in contact dermatitis .
however , studies so far have shown conflicting results . recently , poltromeri et al . gave the concept of occupational allergic march to describe the rapid evolution of contact dermatitis to ammonium persulfate into abcd with rhinitis and asthma in a hairdresser .
inhalation of pollens , dusts , and animal hair causes either flare - up of atopic dermatitis or an apparent superimposed contact dermatitis ; in some instances , the airborne allergens may produce positive patch - test reactions ( i.e. with dermatophagoides ) .
the common allergens and irritants which have been demonstrated to produce an airborne dermatitis like picture are listed in table 1.[12032 ] these include various acids and alkalis , metals and powders of metallic salts , cement , industrial solvents , glass fibers , sewage sludge , ammonia , vegetable and wood allergens , plastics , rubbers and glues , insecticides , pesticides , animal feed additives and many others .
the airborne contactants can also be classified on the basis of their physical state as volatile airborne contactants like acids , alkalis , ammonia and pesticides ; droplets like insecticides , perfumes and hair sprays ; powders which include aluminum , anhydrous calcium silicate , and metallic oxides ; and particles like tree sawing particles , wool and plastics .
common and newer antigens which can cause airborne contact dermatitis ( modified from santos et al .
the most important allergens in p. hysterophorus responsible for allergic contact dermatitis are sls , consisting of a lactone ring combined with a sesquiterpene .
parthenin , which belongs to the pseudoguinolide class of sls , is the major allergen .
it has an alpha methylene group exocyclic to gamma lactone , which is probably essential for the induction of allergy .
the other allergens that have similar group are coronopilin and tetraneurin a. the other components , namely , thiopenes , monoterpenes and acetylenes , are known to cause phytophotodermatitis .
sls are also found in other genera , namely , liverwort ( frullania ) , tulip tree ( liriodendron , magnoliacea ) and sweetbay ( lauraceae , laurus nobilis ) .
a person can be sensitised to airborne contactants by direct and indirect contact , ingestion of allergens in herbal teas or exposure to herbal cosmetics .
dooms - goossens classified airborne dermatitis into five different types , namely , airborne irritant contact dermatitis , airborne allergic contact dermatitis , airborne phototoxic reactions , airborne photoallergic reactions and airborne contact urticaria .
rare presentations include acne like , lichenoid eruptions , fixed drug eruptions , exfoliative dermatitis , telengiectases , paresthesias , purpura , erythema multiforme like eruption , pellagra like dermatitis and lymphomatoid cd .
similarly , formaldehyde and phosphorus sesquisulfide can lead to an airborne irritant or allergic cd and contact urticaria . in the classical airborne allergic contact dermatitis
, there is involvement of exposed areas of face , v of neck , hands and forearms , wilkinson 's triangle , both eyelids , nasolabial folds and under the chin .
the involvement of both light - exposed and protected areas helps to differentiate abcd from a photo - related dermatitis .
another close differential is atopic eczema as both abcd and atopic eczema have predominant flexural and skin crease involvement .
initially , there is an acute flare of the dermatitis during the plant growing season but , with repeated exposure , the flare becomes prolonged and produces a chronic lichenified eczema associated with secondary infection , fissuring and hypo or hyperpigmentation . in patients wearing glasses , dermatitis occurs at the edge of nose due to occlusion . some patients present with facial swelling before manifesting classical eczematous lesions .
verma et al . , put forward a clinical severity score ( css ) to assess the severity of abcd [ table 2 ] .
it takes into consideration both the subjective features like pruritus experienced by the patient as well as the objective features like the morphology of lesions and the area involved .
airborne agents like fibrous materials ( such as glass fibers , rock wool , and grain dust ) give rise to mechanical dermatitis by friction due to their abrasive physical properties .
dust that contains glass fibers can produce cuts from sharp glass fragments , and asbestos corns may be seen on palmer aspect of fingers on exposure to spicules of asbestos .
a lichenified dermatitis may be produced by wood and cement dust collecting around the collar , belt line , or sleeve end and other points of contact .
clinical severity score to assess severity of abcd ( adapted from verma et al . )
alternatively , abcd can be subclassified into that of plant origin and non - plant origin .
wood and plants are a rich source of airborne allergens and irritants , the causative agent often being the dried botanical material .
the most commonly seen parthenium dermatitis classically presents as abcd but may occasionally present with photosensitive lichenoid eruption in morphology and distribution .
a study observing the evolution of parthenium dermatitis recruited 74 patients who were classified into abcd , cad pattern or mixed pattern dermatitis .
sixty patients had abcd , five had mixed pattern and nine had cad pattern at the onset .
of the 60 patients with abcd , 27 changed to cad pattern and 11 to mixed pattern after an average period of 4.2 years .
additionally , sawdust from teak , redwood , mahogany , and rosewood may contain sensitizers that produce a dry dermatitis , particularly on the face , penis , and scrotum in carpenters and woodworkers .
dermatitis of woodworkers may be caused also by liverworts ( sls ) and lichens ( usnic acid or atranorin ) found on the bark of trees .
cement dust usually presents as a dry , lichenified dermatitis due to its alkaline and hygroscopic properties .
the eruption tends be dry rather than oozy even in cases of allergic contact dermatitis to the chromium or cobalt content in cement .
genital dermatitis due to indirect hand contact and accumulation of sawdust on the clothes is often seen in cabinet makers .
turpentine used to be the most frequent cause of airborne dermatitis , but is seen rarely now .
polyolefins , when heated , degrade and form aldehydes , ketones , and acids and very rarely induce airborne dermatitis . additionally , plastic , rubber , glues , metals , insecticides , pesticides , solvents , and other industrial and pharmaceutical chemicals have been described as causing airborne dermatitis .
while managing abcd , care must be taken to distinguish between occupational and non - occupational disease and between irritant and allergic occupational abcd , as management will differ .
a temporal correlation with work only raises the suspicion which needs to be confirmed with patch test or prick test . in suspected cases of occupational irritant dermatitis
, the responsible agent may be isolated by means of chemical analysis or direct microscopic study of the air or material in the air .
photopatch tests can be useful for excluding light as a factor in the pathogenesis of the lesions . during patch testing ,
volatile allergens sometimes also cause irritant dermatitis ; therefore , high dilutions should be used . sometimes special glass cups which permit exposure to the vapor of allergen have to be used . for testing wood dust
sl mix 0.1% petrolatum is commercially available and consists of equimolar quantities of three pure sls ( alantolactone , dehydrocostus lactone and costunolide ) . in a study , only 35% of cases of compositae allergy were detected by using only sl mix and it was concluded that sl mix was not an adequate screening test .
these patients can be identified by using additional compositae extracts like dandelion or feverfew extracts when there is a clinical suspicion of compositae allergy .
another study comparing compositae mix with sl mix was done in which compositae mix led to few irritant reactions and less false - negative test results as compared to sl mix .
it was concluded that compositae dermatitis is being underdiagnosed and that the compositae mix is significantly more sensitive in detecting compositae allergy than the sl mix .
severity of contact dermatitis depends upon degree of contact hypersensitivity and quantity of antigen to which the patient is exposed . for effective control of dermatitis
as the hypersensitivity is difficult to be reduced , the only option is to reduce quantity of antigen to which patient is exposed .
substitution reduces the incidence of occupational dermatitis and urticaria . in cases of abcd due to parthenium
, one should avoid going outdoors on days when pollen are present in high concentrations in air , especially in summers and in the months from september to november following the north - east monsoon showers .
simple routines like taking a bath after coming indoors ; wearing fresh clothes and eliminating weeds and grasses in the house garden can offer great help .
use of a barrier cream on the exposed areas after every wash is important to slow down penetration of antigen into skin .
other measures which can be used are photoprotection , sunscreens , change of job , change of residence , antihistamines , drying agents in cases of weeping eruptions , aluminum sulfate and calcium acetate and emollients for lichenified areas , etc .
they decrease the number of hla dr+ langerhans cells and inhibit the production and function of il-1 , il-2 and interferon ( ifn)-. systemic steroids decrease t cell proliferation and are indicated when there is more than 25% body surface area involvement and when dermatitis is suspected to be caused by allergens which persist in the skin for weeks after exposure ( toxicodendron oleoresins ) .
psoralens and uva ( puva ) decreases hla dr+ langerhans cells [ lc ] , whereas uvb induces epidermal hyperplasia and pge .
it blocks dna replication by incorporating 6-thioguanine into dna and prevents lymphocytic proliferation after antigenic stimulation .
both the number and antigen presenting capacity of lc are affected . in a study ,
the response was excellent ( 80100% clearance of disease ) in 58.3% patients and good ( 60% clearance ) in 41.7% patients .
the cost of therapy with this regimen was reduced by 60% . in another therapeutic study on patients of parthenium dermatitis ,
three therapeutic regimens with azathioprine were used . a total of 22 patients ( group i )
were given 50 mg azathioprine twice a day , 11 patients ( group ii ) received 50 mg azathioprine per day and 300 mg azathioprine every 28 days , and 10 patients ( group iii ) were given 50 mg azathioprine twice a day along with 300 mg azathioprine every 28 days .
twenty out of 22 in group i and 9/11 patients in group ii and 9/10 patients in group iii had complete remission .
nine out of 22 , 7/11 and 6/10 patients in the respective groups needed additional oral betamethasone 12 mg per day for brief periods only during the peak season in order to maintain complete remission .
sharma et al . , treated 16 patients with parthenium dermatitis , unresponsive to topical treatment , with oral methotrexate ( 15 mg / week ) .
seven patients completed 6 months or more of follow - up , and their mean dasi fell to 5 , 2.7 and 2.1 at the end of 1 , 3 and 6 months , respectively , from a baseline score of 10 .
hyposensitization refers to introduction of an antigen into the body by a route different from the natural one , to induce such a change in the immune system that the body does not develop clinical manifestations when the antigen is introduced into the body through normal route .
oral hyposensitization , although demonstrated to be effective for ragweed dermatitis , has not been widely accepted because it carries considerable risk of provoking and worsening eczema . in some cases ,
patients are co - sensitized with several unrelated pollen allergens . based on frequent co - sensitization patterns , some of the hybrid proteins have been developed with the polymerase chain reaction .
antibodies induced with the hybrids in mice inhibited the binding of grass pollen - allergic patients immunoglobulin e to each of the individual allergens and grass pollen extract , and may thus represent protective antibodies .
handa et al . , evaluated the effect of oral hyposensitization as an alternative therapeutic modality and observed a gradual improvement in the clinical status of 70% of those patients who completed the study , as evident from a fall in their clinical severity score for eczema .
the treatment had to be stopped in 30% of patients as they experienced an exacerbation during the course of the study .
overall , patients tolerated the therapy well and no significant side effects were seen , except for abdominal pain , heartburn and cheilitis .
evidence indicates that up to 50% of patients with abcd , whether occupational or non - occupational , experience adverse effects on quality of life , daily function and personal relationship , and take time off work on sick leave and may lose or change job because of their skin disease . a significant proportion of patients still tend to have active symptoms many years after diagnosis , despite treatment and change of job .
however , it should be emphasized to all that avoidance of further exposure can lead to recovery from dermatitis in many cases . with respect
to abcd occurring secondary to parthenium dermatitis , there are continuing attempts to control the spread of the weed through biological measures like introduction of exotic arthropods and opportunistic pathogens , use of antagonistic plants and bioherbicides as well as use of selective chemical herbicides . | the increasing recognition of occupational origin of airborne contact dermatitis has brought the focus on the variety of irritants , which can present with this typical morphological picture . at the same time , airborne allergic contact dermatitis secondary to plant antigens , especially to compositae family , continues to be rampant in many parts of the world , especially in the indian subcontinent .
the recognition of the contactant may be difficult to ascertain and the treatment may be even more difficult .
the present review focuses on the epidemiological , clinical and therapeutic issues in airborne contact dermatitis . |
the liver is the major site of detoxification and the primary target of drug exposure in the body ; therefore , drug - induced liver injury is a significant public health problem , accounting for over half of all cases of acute liver failure .
acetaminophen ( apap ) is a commonly used analgesic and antipyretic agent . at therapeutic doses ,
some individuals experience apap toxicity even at therapeutic doses of less than 4 g / day , and , in pediatric populations , the majority of apap overdoses are unintentional . moling et al . reported a case of severe hepatotoxicity after therapeutic doses of apap in an adult man .
in fact , apap overdose is the most common cause of drug - induced acute liver failure in the united kingdom and the united states [ 6 , 7 ] .
the toxicity of apap is related to its bioactivation by cytochrome p450 to the electrophilic metabolite n - acetyl benzoquinone imine ( napqi ) . at therapeutic doses
, napqi is efficiently detoxified by glutathione ( gsh ) and eliminated through urine or bile ; however , at supratherapeutic doses , both the glucuronidation and sulfation pathways become saturated , and extensive bioactivation of apap depletes the hepatic gsh pool and causes oxidative stress .
this oxidative stress may trigger signaling pathways to act through mitochondrial toxicity , ultimately causing cell death .
a significant amount of evidence has pointed to the potential involvement of oxidative stress in acetaminophen toxicity [ 9 , 10 ] .
several studies have shown that antioxidants and anti - inflammatory agents effectively protect against the acute hepatotoxicity induced by acetaminophen overdose [ 1113 ] .
several herbal medicines , their active constituents and formulations , are used in the treatment of a wide variety of clinical diseases and provide benefit to societies .
their protective action is through antioxidant enzymes ( e.g. , sod , cat , gst , and gr ) , which modify many pathways and proteins , including the dna damage / repair processes , nrf-2 , and xenobiotic response elements , thus maintaining the prooxidant / antioxidant balance in the body . in this context
carqueja , a member of the asteraceae family and a native shrub from south brazil , paraguay , uruguay , and argentina .
medicinal teas prepared from the aerial parts of this shrub are used in folk medicine to treat not only gastrointestinal and liver diseases but also inflammatory processes . because of these biological effects , research on the chemical composition of b. trimera was conducted and demonstrated that this plant has many bioactive compounds , such as flavonoids , diterpenes , and triterpenes .
triterpenes have been reported to be primarily responsible for its anti - inflammatory activity [ 19 , 20 ] , while the flavonoids , due to their antioxidant activity , have been linked to protecting the body against reactive oxygen species ( ros ) .
this study was conducted to investigate the effect of b. trimera in the modulation of oxidative stress and to evaluate the preventive effect of b. trimera in acetaminophen - induced liver damage .
the chemical reagents , including dtnb [ 5,5-dithio - bis ( 2-nitrobenzoic acid ) ] , 2,4-dinitrophenylhydrazine ( dnp ) , and thiobarbituric acid ( tba ) , were purchased from sigma - aldrich ( st . louis , mo , usa ) .
acetaminophen ( apap ) ( 200 mg / ml ) was obtained from janssen - cilag pharmaceuticals , brazil .
the kit for measuring serum alanine aminotransferase ( alt ) and aspartate aminotransferase ( ast ) was from diagnostic labtest , brazil .
the aerial parts of b. trimera were collected during august 2011 in the city of ouro preto , minas gerais , brazil .
the specimen , voucher number oupr 22.127 , was identified by professor viviane r. scanlon and deposited in the herbarium jos badini , ufop .
the aerial parts of the plant were dried in a ventilated oven , sprayed in a mechanical mill , and stored in plastic bottles . to obtain the hydroethanolic extract , approximately 100 g of the plant
was extracted with distilled water and 70% alcohol at a ratio of 1 : 1 for 24 h. vacuum filtration and evaporation of the solvent in a rotovap were then performed .
the crude extract that formed , with a percentage yield of 8 - 9% , was then diluted with phosphate - buffered saline ( pbs , ph 7.4 ) ; a concentration of 600 mg / kg body weight was used in vivo .
the methodology for the extract preparation was based on the work of grance et al . with some modifications .
analyses were performed using an uplc acquity ( waters ) ion trap mass spectrometer equipped with an atmospheric pressure chemical ionization ( apci ) interface operated in the following conditions : positive and negative ion mode ; capillary voltage , 3500 v ; capillary temperature , 320c ; source voltage , 5 kv ; vaporizer temperature , 320c ; corona needle current , 5 ma ; and sheath gas , nitrogen , 27 psi .
the esi - ms / ms analyses were additionally performed in an uplc acquity ( waters ) with helium as the collision gas , and the collision energy was set at 30 ev .
chromatographic separation was done on acquity uplc beh ( 1.7 m , 50 2 mm i.d . ) ( waters ) .
the mobile phase consisted of water 0.1% formic acid ( solvent a ) and acetonitrile 0.1% formic acid ( solvent b ) .
the elution protocol was 011 min , linear gradient from 5% to 95% b. the flow rate was 0.3 ml min , and the sample injection volume was 4.0 l . the uv spectra were registered from 190 to 450 nm . mass spectrometry analysis was performed on quadrupole instrument fitted with an electrospray source in the negative mode ( figure 1 ) .
ion spray voltage : 4 kv ; orifice voltage : 60 v. the cell strains were acquired at the cell bank , federal university of rio de janeiro ( ufrj ) .
liver cells were cultured in 75 cm growth vials ( sardest ) containing mem culture medium .
hepes , 10% ( v / v ) bovine fetal serum , and 1% ( v / v ) of a mix of penicillin ( 200 u / ml ) and streptomycin ( 200 g / ml ) were added to the medium .
the vials were stored in oven at 37c and humidified with 5% carbon dioxide ( co2 ) .
this medium was replaced every two or three days depending on the confluence of the cell monolayer and the subcultures ( passages ) carried out .
when the vials reached 100% confluence , the medium was vacuumed , and the cell monolayer was rinsed twice with phosphate - buffered saline solution without calcium and without magnesium ( pbs ) .
later , to detach the monolayers , a solution of 0.20% trypsin and 0.02% edta was used .
next , the cell count was carried out with trypan blue 0.3% in a neubauer chamber .
the cell line was acquired from the cell bank , federal university of rio de janeiro ( ufrj ) .
we added 5.0 10 hepg2 in culture medium mem ( 10% v / v bovine fetal serum and 1% v / v mixture of penicillin / streptomycin ) .
the plates were incubated in a humidified chamber with 5% co2 at 37c for 172 hours . after this time
, the supernatant was removed , and 20 l mtt was added and incubated for 30 minutes .
the absorbance was read at 570 nm in a microplate reader ( thermo plate ) .
hepg2 was incubated in the presence of 1 , 2 , and 3% ( 50 l ) of the b. trimera extract for 1 and 24 hours to assess cell viability .
the calculation used to assess the percentage of cell viability was ( absorbance of treated cells / absorbance control ) 100 .
the laboratory of experimental nutrition of the federal university of ouro preto ( ufop ) provided the male albino fischer rats used in the experiment ; the animals were approximately 12 weeks old and weighed approximately 180 g. all animals were kept in individual cages placed in an environment with controlled temperature , light , and humidity , and the animals received both commercial rat chow and water ad libitum .
this work was conducted in accordance with the international standards of animal protection and with the ethical principles of the brazilian college of animal experimentation , and the protocols were approved by the ethics committee on animal use ( ceua ) of ufop ( of 166/2011 protocol 2011/82 ) . for the experiments ,
the control group ( c ) received 1.0 ml pbs , the b. trimera ( bt ) group received 600 mg / kg of the b. trimera extract , the acetaminophen ( apap ) group received a single dose of 835 mg / kg acetaminophen , and the b. trimera + acetaminophen ( bt + apap ) group received 600 mg / kg of the b. trimera extract and a single dose of 835 mg / kg acetaminophen an hour later .
all treatments were administered by gavage and the interval between the b. trimera pre - treatments and apap dose were based on the work of meotti et al . and ajith et al . .
the dose of apap used and the experimental lining were based on the work of yen et al . .
the animals that received 835 mg / kg apap orally demonstrated , by the kit labtest , a higher activity of alt and ast .
the liver tissue was collected immediately after euthanasia of animals . to determine carbonyl protein concentrations ,
200 mg of tissue was homogenized in 50 mm phosphate buffer ( ph 6.7 ) and 1 mm edta . to determine the concentration of thiobarbituric acid reactive substances ( tbars ) , catalase and superoxide dismutase activity , 100 mg of liver tissue was homogenized in phosphate buffer ( ph 7.4 ) .
similarly , to determine total glutathione concentration , 100 mg of liver tissue was homogenized in 5% sulfosalicylic buffer .
after homogenization , the samples were centrifuged at 10.000 g for 10 minutes at 4c .
the tbars concentration was determined based on thiobarbituric acid ( tba ) binding to oxidized lipids .
protein oxidation by ros leads to the formation of carbonyl derivatives , which can be measured by sensitive methods .
methods that use 2,4-dinitrophenylhydrazine ( dnph ) , which reacts with carbonyl groups to generate the corresponding hydrazone and can then be analyzed spectrophotometrically , are especially useful .
the activity of total superoxide dismutase ( sod ) was measured using a kit ( cayman chemical company , mi , usa ) .
briefly , hepatic tissue was homogenized in cold 20 mm hepes ( ph 7.2 ) containing 1 mm egta , 210 mm mannitol , and 70 mm sucrose .
the plate was incubated on a shaker for 20 min at room temperature , and the absorbance was measured at 450 nm using a plate reader ( biotek elx808 ) .
catalase activity was determined based on its ability to convert hydrogen peroxide ( h2o2 ) into water and molecular oxygen .
glutathione is present in cells mainly in its reduced form ( gsh ) , which represents approximately 90% of the total glutathione in the cell .
the remaining amount is in the form of oxidized glutathione ( gssg ) . to determine the levels of total glutathione ( gsg + gssg ) in our biological samples
, we used a sigma kit that employs a kinetic method based on the reduction of dtnb [ 5,5-dithiobis(2-nitrobenzoic acid ) ] to tnb , which can be spectrophotometrically measured at 412 nm .
a solution of reduced glutathione ( g4251-sigma ) was used to determine the standard curve .
louis , mo , usa ) was used to measure glutathione peroxidase activity in tissue extracts .
the decrease in nadph absorbance measured at 340 nm during the oxidation of nadph to nadp is indicative of glutathione peroxidase activity because the enzyme is the rate - limiting factor of the coupled reactions .
the enzyme activity is expressed as units / ml . glutathione reductase ( gr ) activity was measured using a kit ( sigma - aldrich , st .
glutathione reductase is essential for the glutathione redox cycle to maintain adequate levels of reduced cellular gsh , which serves as an antioxidant that reacts with free radicals and organic peroxides .
the activity of glutathione reductase was measured by following the increase in absorption caused by the reduction of dtnb at 412 nm .
the enzyme activity is expressed as units / ml . the total rna was extracted from 50 mg tissue using trizol reagent ( invitrogen life technologies , ca , usa ) according to the manufacturer 's protocol and resuspended in 30 l rnase - free water .
the concentration and purity of rna were estimated spectrophotometrically from the a260/a280 ratio ( nanovue , ge healthcare , uk ) .
a total of 1 g rna was converted to cdna using oligo ( dt ) and a high - capacity cdna reverse transcription kit ( applied biosystems , foster city , ca , usa ) according to the manufacturer 's recommendations .
quantitative real - time pcr ( qpcr ) was performed using the power sybr green pcr master mix reagent ( applied biosystems , foster city , ca , usa ) in a final reaction volume of 12 l .
the reaction included 0.1 g cdna and 0.5 l of each primer ( forward and reverse , 10 m ) .
the forward and reverse primer sequences for zn - sod , mn - sod , cat , glutathione peroxidase ( gpx ) , and gamma - glutamylcysteine ( -gcs ) were obtained from published nucleotide sequences .
the reactions were performed using the abi prism 7300 sequence detector ( applied biosystems ) under the following conditions : 50c for 2 min , 95c for 10 min and 40 cycles of 95c for 15 s , and 60c for 1 min .
the specificity of the products obtained was confirmed by analysis of the dissociation curves of the amplified product . as an internal control ,
liver fragments not exceeding 4 mm in diameter were fixed in 10% formaldehyde solution and then dehydrated , diaphanized , and embedded in paraffin .
paraffin sections of approximately 4 m were obtained by sectioning embedded fragments on a rotary microtome .
all data were subjected to a normality test . after determining that the data were normally distributed , we chose to use student 's t test .
the tests were performed using graphpad prism version 4.00 for windows ( san diego , ca , usa ) .
in hydroethanolic extract of b. trimera we identify five flavonoids by lc - dad - esi - ms obtained of chromatogram in lc - dad , as shown in table 1 .
after incubation for 1 and 24 hours ( table 2 ) , it was observed that cells treated with the extract maintained high viability of 89.0% and 98.6% , respectively , without exhibiting significant toxicity .
figure 3 shows the activity of serum transaminases in the different treatment groups . the alt and ast transaminases were significantly enhanced ( p < 0.05 ) by 9.8- and 6.3-fold , respectively , in apap - intoxicated animals .
treatment with b. trimera significantly inhibited the elevation of the activity of serum transaminases alt and ast , which was found to be 5.0- and 3.6-fold lower than that in the apap - intoxicated animals , respectively .
we evaluated the oxidative damage to proteins and lipids by measuring oxidative stress markers in hepatic tissue .
the results shown in figure 4 indicate a significant increase in the concentration of carbonylated protein in the livers of animals intoxicated with apap compared to the nonintoxicated control group . however , treatment of apap - intoxicated rats with b. trimera resulted in the reduction of hepatic carbonylated protein concentration compared to the untreated b. trimera group .
moreover , we observed increased lipid peroxidation in rats intoxicated with apap compared to nonintoxicated animals , and b. trimera treatment was also capable of reducing hepatic lipid peroxidation compared to the untreated group .
thus , these results demonstrate that treatment with b. trimera is capable of minimizing oxidative damage . to investigate the involvement of antioxidant enzymes in mediating the radical - scavenging activity of b. trimera , the mrna levels and activities of intracellular antioxidant enzymes were measured in the different groups .
the apap - intoxicated group showed an increase in zn - sod ( figure 5(a ) ) and mn - sod ( figure 5(b ) ) expression compared to control animals .
this increase in the expression of different isoforms of sod was accompanied by an increase in the total activity of this enzyme in the group intoxicated with apap ( figure 5(d ) ) ( 0.33 0.07 units / mg protein ) compared to the control ( 0.24 0.036 units / mg protein ) . in the apap - intoxicated group treated with b. trimera , the mrna level and activity were significantly lower than their respective control ( apap group ) . in this study ,
the mrna levels and activity of catalase decreased significantly ( p < 0.05 ) in the apap - treated rats , and this decrease in expression and activity was prevented in the group intoxicated with apap and treated with b. trimera .
figure 6 shows that there was a significant increase in -gcs ( figure 6(a ) ) gene expression in the livers of animals intoxicated with apap .
treatment with b. trimera was able to reverse this profile , decreasing the expression of -gcs . despite the increased expression of -gcs
, there was a decrease in the concentration of total glutathione in the livers of animals intoxicated with apap .
however , treatment with b. trimera was able to reverse this decrease ( figure 6(b ) ) .
the results in figure 7 show a decrease in the mrna and enzyme activity of gpx ( figures 7(a ) and 7(b ) ) and in the activity of the enzyme gr ( figure 7(c ) ) in the livers of apap - intoxicated rats compared to control rats .
no change was observed in the activity of gpx and gr in the livers of rats that received only the extract .
microscopic observations revealed normal histology with regular morphology of the liver tissue in the control ( figure 8(a ) ) and b. trimera groups ( figure 8(b ) ) . in the apap - intoxicated group ( figure 8(c ) ) , cellular damage was visible in the form of hydropic degeneration , inflammation , and hemorrhage .
the b. trimera treatment ( figure 8(d ) ) considerably improved the liver morphology in comparison to the apap - intoxicated rats .
research aiming to propose new strategies of therapeutic intervention increasingly includes the use of plant extracts and other natural products .
studies carried out in our lab have demonstrated the beneficial potential of the hydroalcoholic extract of b. trimera on the toxicity induced by apap . in the peripheral neutrophils of rats intoxicated with this drug ,
the extract was able to regulate the production of reactive oxygen species ( ros ) and reactive nitrogen species ( rns ) .
( 2014 ) studied the activation of neutrophils during apap - induced hepatotoxicity and demonstrated that ros generation mediated by nadph oxidase is not a critical event during liver injury caused by this drug .
however , they also found that neutrophils present in peripheral blood are activated after administration of apap .
although the contribution of inflammatory cells to the hepatic damage induced by apap is still controversial , the innate immune response and the production of reactive species from different sources are correlated with many diseases that affect the liver .
for example , neutrophils are associated with hepatic injury during ischemia , endotoxemia , and obstructive cholestasis in animal models [ 9 , 32 ] .
the pharmacological effect of the hydroalcoholic extract of b. trimera was investigated in our lab . a lc - dad - esi - ms analysis of the hydroalcoholic extract revealed presence of flavonoids , flavone , and glucosides of flavone compounds ( figure 2 ) .
many studies have found that the hepatotoxicity induced by apap is the result of oxidative stress , which causes alterations in mitochondrial proteins due to a depletion of glutathione , leading to an inhibition of cellular respiration with consequent cell death . because of the biological effects described for flavonoids found in the extract , this study was conducted to investigate the effect of b. trimera in the modulation of oxidative stress and to evaluate the preventive effect of b. trimera in acetaminophen - induced liver damage . despite the lack of studies related to the toxicity of b. trimera
, histopathological alterations have recently been found in the livers of pregnant rats treated with a hydroethanolic extract of the plant ; moreover , rodrigues et al . showed that b. trimera produced some genotoxic and mutagenic effects after consumption of high doses of the extract . in this context , to analyze its toxicity , hepatic hep g2 cells were incubated in the presence or absence of b. trimera extract to obtain the cellular viability / toxicity relationship .
after the assays , it was observed that the hydroalcoholic extract did not present significant toxicity , and cells maintained viability of 89.0% and 98.6% after incubation periods of 1 h and 24 h , respectively . these values show no statistical difference .
based on these results , we wondered whether the b. trimera extract would be able to reverse the hepatotoxicity induced by apap .
to do this , initially , we analyzed the activity of the hepatic enzymes ast and alt .
both ast and alt are intracellular enzymes present in large amounts in the cytoplasm of hepatocytes .
our study showed that apap caused a significant increase in the activity of alt and ast .
however , pretreatment with the plant extract restored this activity to values similar to those of the control .
high doses of apap have been associated with higher activity of alt and ast [ 35 , 36 ] .
the ability of b. trimera to prevent the increase in the activity of these enzymes makes it evident that its chemical constituents exert an important hepatoprotective activity .
in addition to analyzing the activities of these hepatic enzymes , the levels of products of oxidative stress have also been described to demonstrate the occurrence of oxidative damage . among these products
the levels of these substances are used as markers of redox balance in terms of lipid peroxidation and protein oxidation , respectively , in hepatic cells . in our results , animals intoxicated with
however , pretreatment with b. trimera extract was able to reduce the levels of these compounds to values similar to those of their respective controls .
it is known that plants , because they present antioxidant constituents , are efficient in reducing the lipid peroxidation and protein oxidation induced by apap [ 39 , 40 ] . one of the explanations for this phenomenon is that these phytochemicals are able to minimize the oxidative stress in the livers of animals intoxicated with high doses of this drug . because b. trimera has shown such a significant effect on the development of oxidative stress products , we evaluated its effect on the expression and activity of antioxidant enzymes .
the protective action of several herbal medicines and their active constituents occurs through antioxidant enzymes ( e.g. , sod , cat , gpx , and gr ) , which maintain the prooxidant / antioxidant balance in the body . to eliminate ros from the cellular system , sod and cat function coordinately to remove superoxide radicals .
our results showed that the livers of animals intoxicated with apap presented higher expression of the sod - zn and sod - mn isoforms .
however , treatment with b. trimera was able to regulate this expression to values similar to those of the livers of the control animals .
although sod is an antioxidant enzyme , some studies have suggested that its overexpression is in fact harmful to cells .
the toxic effect of ros that has been observed in many cells overexpressing sod has been linked to elevated levels of h2o2 and oxidative damage accompanying hydroxyl radical formation .
our results showed that the liver of animals intoxicated with apap presented lower expression of cat .
however , b. trimera treatment was able to regulate this expression to values similar to those of the livers of control animals .
our results were similar in that cat activity was significantly diminished following toxic apap insult .
this would allow for the accumulation of ros and hydrogen peroxide , which can exacerbate the hepatocellular damage initiated by napqi .
treatment with the b. trimera extract abrogated the effect of apap and induced an increase in cat activity .
this suggests the involvement of their antioxidant constituents in facilitating the rapid and efficient consumption of reactive oxygen species generated by apap - mediated p450 bioactivation .
glutathione ( gsh / gssg ) is regarded as the main redox buffer in cells .
glutathione plays an important role in the removal of ros and protects the thiols in biomacromolecules . under normal conditions ,
glutathione is mainly found in its reduced form ( gsh ) and in much smaller amounts in its oxidized form ( gssg ) .
the results of our present study showed that the livers of animals intoxicated with apap , even presenting high -gcs activity , presented levels of total glutathione less than those of the livers of control animals . however , pretreatment with b. trimera increased the level of total glutathione in apap - treated animals .
these results suggested that b. trimera could exert its hepatoprotective and radical - scavenging activities by preventing the formation of free radicals originating from apap metabolism as well as peroxidation products and enhance the antioxidant defense system .
this hypothesis is supported by recent findings that demonstrate that the antioxidant and hepatoprotective activities of extract might be mediated through augmentation of antioxidant defenses and increase in free radical inhibition due to the presence of important antioxidative factors .
the antioxidant effects of glutathione are directly related to gpx and gr , which are key enzymes in the maintenance of redox homeostasis via protecting cells from free radical - generated toxicity .
our results show a decrease in the mrna and enzyme activity of gpx and in the activity of the enzyme gr in the livers of rats 24 h after treatment with apap compared to control rats .
gr is an enzyme that plays a critical role in oxidative stress by apap ; a decrease in its activity will lead to interruption of the cycling between gssg and gsh and , thus , to a shortage of gsh . although the impairment of gr activity by apap is not well understood , at least two hypotheses have been put forth to explain this occurrence , one invoking direct action of ros or toxic aldehydes and another ascribing the effect to the napqi - gsh conjugate that forms in the presence of glutathione s - transferase .
the low activity of gpx is one of the early consequences of a disturbance of the prooxidant / antioxidant balance in favor of the former .
inhibition of gpx increases the susceptibility of hepatocytes to paracetamol toxicity , indicating that a component of paracetamol 's toxic effect involves the formation of species that are detoxified by gpx enzymes .
flavonoids have been demonstrated to protect against paracetamol toxicity by inhibiting lipid peroxidation and increasing glutathione concentration .
hence , the ability of plant extracts to restore the loss of gpx activity is most likely due to the presence of flavonoids .
the striking increase in the gpx activity of the b. trimera - treated group compared with the group that received only apap may be a result of the presence of quercetin and flavones in addition to other antioxidants in the plant .
due to the inhibition of gpx , this study concluded that hepatic cell injury was the result of an increase in the steady - state level of h2o2 and hydroperoxides . while this suggestion implies that oxidative stress is the determining factor of gsh depletion , there is also evidence to support the opposite order of events ; namely , ros production follows the depletion of gsh .
in other words , the levels of antioxidant enzymes , if analyzed concomitantly , allow us to infer that the animals intoxicated with apap presented high concentration of hepatic h2o2 , given that high sod activity leads to a high production of ero , and low cat and gpx activities prevent the h2o2 generated from being neutralized . to confirm the hepatoprotective effect of b. trimera
apap - intoxicated animals treated with the b. trimera extract had improved histopathology compared to the apap - intoxicated group without treatment . in conclusion
, the present study demonstrated that the hydroalcoholic extract of b. trimera has a hepatoprotective effect against apap - induced hepatotoxicity in rats .
the enhanced levels of antioxidant enzymes and reduced amount of peroxidation products are suggested to be the major mechanisms by which the b. trimera hydroalcoholic extract prevents the development of liver damage induced by apap ( figure 9 ) .
furthermore , a recent study published by our research group shows that the extract of b. trimera is also capable of modulating the activity of nadph oxidase in peripheral neutrophils of rats intoxicated with apap . | background . acetaminophen ( apap ) is a commonly used analgesic and antipyretic .
when administered in high doses , apap is a clinical problem in the us and europe , often resulting in severe liver injury and potentially acute liver failure .
studies have demonstrated that antioxidants and anti - inflammatory agents effectively protect against the acute hepatotoxicity induced by apap overdose .
methods .
the present study attempted to investigate the protective effect of b. trimera against apap - induced hepatic damage in rats .
the liver - function markers alt and ast , biomarkers of oxidative stress , antioxidant parameters , and histopathological changes were examined .
results . the pretreatment with b. trimera attenuated serum activities of alt and ast that were enhanced by administration of apap .
furthermore , pretreatment with the extract decreases the activity of the enzyme sod and increases the activity of catalase and the concentration of total glutathione .
histopathological analysis confirmed the alleviation of liver damage and reduced lesions caused by apap .
conclusions .
the hepatoprotective action of b. trimera extract may rely on its effect on reducing the oxidative stress caused by apap - induced hepatic damage in a rat model .
general significance .
these results make the extract of b. trimera a potential candidate drug capable of protecting the liver against damage caused by apap overdose . |
upper respiratory tract infections ( urtis ) are illnesses caused by an acute infection of the upper respiratory tract ( ie , the nose , sinuses , pharynx , or larynx ) .
acute urtis include the common cold , acute sinusitis , acute pharyngitis , acute laryngotracheobronchitis ( croup ) , acute epiglottitis ( supraglottitis ) , acute rhino sinusitis and acute otitis media .
acute urtis are a major cause of morbidity , especially in children and the elderly .
common symptoms include cough , fever , headache , sore throat , runny nose , and sneezing .
usually , the symptoms subside after a few days . to reduce fever and ease pain and headaches , paracetamol ( acetaminophen ) , ibuprofen , or aspirin
how ever , misuse of antibiotics in acute urtis caused by viruses is common and may contribute to overuse of antibiotics and risk for development of antibiotic - resistant bacteria .
probiotics are live microorganisms that might lead to health benefits when administered in adequate amounts .
they are commonly consumed in fermented foods , such as yogurt and soy yogurt , or as dietary supplements .
the underlying mechanisms of how probiotics may improve health are unclear , but improved local immunity ( by maintaining gut wall integrity ) and systemic immunity ( by enhancing nonspecific and specific arms of the immune system ) are possible explanations . this review was carried out to assess the effectiveness and safety of probiotics ( any specified strain or dose ) compared with placebo in the prevention of acute urti in people at risk of acute urti .
not all research provides the same quality of evidence . the higher the quality , the more certain we are about what the research says about an effect .
the words will ( high - quality evidence ) , probably ( moderate - quality evidence ) , and may ( low - quality evidence ) describe how certain we are about the effect ( table ) .
summary of findings : probiotics compared to placebo for preventing acute upper respiratory tract infections patient or population : children and adults of all ages settings : day - care centers , hospital , or unclear intervention : probiotics the corresponding risk ( and its 95% confidence interval ) is based on the assumed risk in the comparison group ( ie , the median control group risk across studies ) and the relative effect of the intervention ( and its 95% ci ) .
abbreviations : ci , confidence interval ; or , odds ratio ; rr , risk ratio ; urti , upper respiratory tract infection .
grade working group grades of evidence high quality : further research is very unlikely to change our confidence in the estimate of effect .
moderate quality : further research is likely to have an important impact on our confidence in the estimate of effect and may change the estimate .
low quality : further research is very likely to have an important impact on our confidence in the estimate of effect and is likely to change the estimate . very low quality : we are very uncertain about the estimate .
the included studies had heterogeneous populations ( ie , infants , children , marathon runners , and healthy volunteers ) .
all participants in all 3 studies were children , which limits the generalizability of findings to adults .
high statistical heterogeneity ( ie , i - square = 92% ) and high clinical heterogeneity ( ie , 1 of the 2 studies includes only marathon runners , and the other study includes the general population ) .
the study with marathon runners is in favor of placebo ( although nonsignificant results ) ( md 1.60 ; 95% ci 0.34 to 3.54 ) and the study with the general population is in favor of probiotics ( md 1.90 ; 95% ci 2.04 to 1.76 ) . very wide confidence interval .
unclear risk of bias in the smaller of the 2 studies ; however , the larger of the 2 studies had a low risk of bias
the 10 studies that the cochrane authors reviewed showed that for people at risk of acute urti , compared with a placebo , probiotics may reduce the number of participants who experienced urti episodes ( at least 1 event ) , have an uncertain effect on the mean duration of an episode of urti because the quality of evidence is very low , may reduce the number of participants who used antibiotics , and may make little or no difference to adverse events .
none of the studies measured the effect of probiotics on older people . in general , side effects are poorly documented and it is difficult to provide precise information . in these studies ,
the main side effects were gastrointestinal symptoms such as vomiting , flatulence , and increased irritability .
however , pooled analysis showed no statistical difference between the probiotics group and the placebo group ( low - quality evidence ) .
the cochrane collaboration is an independent global network of volunteers dedicated to summarizing research about healthcare .
this information is taken from this cochrane review : hao q , lu z , dong br , huang cq , wu t. probiotics for preventing acute upper respiratory tract infections . | as part of its efforts to disseminate the results of cochrane reviews to a wider audience , the cochrane complementary and alternative medicine ( cam ) field develops summary of findings ( sof ) tables and then uses those tables as a basis for its plain - language summaries .
each sof table presents the most important outcomes for the review as well as the effect of the intervention and the quality of the evidence for each outcome .
the process of developing the sof table involves deciding which outcomes to present for which time points and evaluating the strength and quality of the evidence for the outcomes.in this article , we present a cochrane review about the effects of the use of probiotics for preventing acute upper respiratory tract infections .
we contacted the authors of the cochrane review to request clarification on points that we did not understand and to have them review the sof table . |
breast cancer is the most common malignancy in females , accounting for 1 of 4 cancers diagnosed , and it is the second leading cause of deaths due to cancer among north american women . the american cancer society predicted that cancer of the breast would be diagnosed in 254,650 women and that 40,170 women would die secondary to breast cancer in 2009 .
moreover , the american cancer society estimated that 25,100 new breast cancers would be diagnosed , with 2,820 deaths secondary to breast cancer , occurring in american women under 45 years of age in 2009 .
the incidence of initial presentation of breast cancer is known to peak between the ages of 45 and 55 years , and although women 40 years of age and under account for less than 5% of those developing this disease , we observed that during the last ten years , the incidence of breast cancer has increased most markedly in this younger population .
changes in diet , an escalating incidence of obesity , and an increased exposure to endogenous and exogenous hormones may have contributed to this increase , together with the decisions by larger numbers of women in the developed world to delay their first pregnancy until later in life . finally , the 5-year survival rate is lower for women diagnosed with breast cancer before age 40 ( 83% ) compared with women diagnosed at ages 40 years or older ( 90% ) .
these observations prompted us to examine the differences that might exist between young women 40 years of age and younger , and older women , with breast cancer .
a fundamental difference in the pathophysiology is that young women tend to present with a more advanced stage of breast cancer than do older women , and , hence , the earliest possible detection is crucial to their optimal prognosis .
it is important to emphasize that a malignant breast neoplasm which has grown to a palpable size usually presents as a painless mass .
many studies have shown that women who regularly practice breast self - examination initially present with smaller tumors and with neoplasms that less frequently involve the axillary lymph nodes [ 310 ] . despite these facts , the american cancer society decided to change their previous guideline for regular breast self - examination ( bse ) , recommending instead that bse now be optional because benefits of performing the self - examination had not been substantiated unequivocally in the literature .
the guidelines advocated by the american cancer society in 2003 for early breast cancer detection in asymptomatic women over 40 years of age were very specific : annual mammography , annual clinical breast examination , and an optional monthly breast self - examination .
the guidelines are less stringent for females under 40 years of age and consist of a clinical breast examination every three years and an optional monthly breast self - examination .
the american cancer society eliminated its recommendation that all women perform monthly bse after publication of studies such as the randomized trial of 266,062 women in shanghai , which concluded that intensive instruction in bse does not reduce the mortality rate of breast cancer .
nonetheless , the society still recommends that women be informed of the potential benefits and limitations of bse and that those women who wish to do so should receive instruction in proper bse from their health care providers .
we hypothesized that younger women are more concerned with breast disease as it relates to their breast image and appearance , to their lifestyle , and to longer life expectancy . the various considerations and observations
concerning young women and their breast disease led us to attempt to understand several concepts more clearly , including the relationships between breast carcinoma biology and age , breast carcinoma management patterns and age , and outcomes and age .
the purpose of this study was to evaluate the characteristics that are unique to women 40 years of age and under , who present with breast cancer , in order to assess the role and potential benefits of bse more meaningfully .
presumably , diagnosis and treatment of breast lesions are delayed in young women due to a low index of suspicion .
thus , we evaluated the detection , incidence , and treatment patterns of women 40 years of age and under with breast cancer who presented to our community teaching hospital over a 10-year period .
the clinical and pathological characteristics of cancer in this patient population and the role of bse as a screening tool in detecting malignancy in these patients were also examined .
young women were defined as those 40 years old or younger . after approval by the institutional review board , a retrospective review of a total of 822 women diagnosed with breast carcinoma during the decade between the years of 1994 and 2005 was completed at our community teaching hospital . of those ,
64 women were below 41 years of age , accounting for 7.7% of all breast cancers .
retrospective clinical information , which was obtained from the tumor registry , the hospital medical records , and office charts , was analyzed . in order to create a uniform basis for comparison ,
the tumors of all patients were restaged according to the tnm classification advocated by the american joint committee on cancer ( ajcc ) .
tumor size and the status of the axillary nodes were ascertained from review of the original pathology reports .
mann whitney , fisher exact , and chi - squared tests were used as appropriate to compare the two age groups of breast cancer patients , and p < .05 was considered statistically significant .
all of the 822 women with breast cancer were treated in our institution , and none were referred elsewhere .
throughout the decade - long study period , a statistically significant increase in age - adjusted incidence of breast cancer among women 40 years of age and younger became obvious ( p < .005 ) .
the number of patients having a significant family history for breast cancer in both groups ( > 40 years and < 41 years ) could not be derived accurately from the family history data recorded on the charts , especially during the 1990s .
the entries for these data improved remarkably in the 21st century but were sufficiently inconsistent to be of significant value in this group of patients .
similarly , the situation was comparable regarding genetic testing in these patients during the time period of the study ( 19942005 ) .
of the 758 older patients , over the age of 40 , three hundred eighty two ( 49% ) discovered their cancer by mammography , 278 ( 39% ) by self - examination , and 98 ( 14% ) by a clinical breast examination .
magnetic resonance imaging ( mri ) was not available for use in the diagnosis of patients with breast cancer during the decade of this study .
estrogen and progesterone receptor status was known in 660 ( 80% ) patients and unknown in 166 ( 20% ) .
lymph nodes were positive in 156 ( 21% ) patients and unknown in 154 ( 21% ) of the older patients . at the time the older patients had their breast cancers diagnosed , 122 ( 16% ) patients had stage 0 disease , 331 ( 44% ) had stage i , 212 ( 28% ) had stage ii , 48 ( 6% ) had stage iii , 21 ( 3% ) had stage iv , and 24 ( 3% ) had an indeterminate stage .
of 822 women diagnosed with breast cancer in our hospital from 1994 to 2004 , sixty four ( 7.7% ) were 40 years of age or younger .
the ages of the 64 young patients ranged from 19 to 40 years , with a mean age of 36.4 years . forty four ( 69% ) of these younger women discovered their breast cancers by breast self - examination , 17 ( 18% ) by mammography , and 3 ( 5% ) by professional clinical breast examination .
this series spans 10 years , and the surgical procedures chosen reflect the dominant influences of that time period .
thirty three ( 50% ) of these young patients underwent a modified radical mastectomy , and 2 ( 3% ) underwent a simple mastectomy .
only 28 ( 44% ) of the patients chose to have a breast conservation procedure .
there were 14 ( 22% ) patients with stage 0 , 14 ( 22% ) patients with stage i disease , 25 ( 39% ) patients with stage ii , 9 ( 14% ) with stage iii , 0 with stage iv , and 2 ( 3% ) young patients with an unknown stage .
the number of young patients diagnosed per year appeared to be increasing , even in this relatively small cadre , as follows : 5 ( 1994 ) , 5 ( 1995 ) , 2 ( 1996 ) , 3 ( 1997 ) , 6 ( 1998 ) , 7 ( 1999 ) , 6 ( 2000 ) , 8 ( 2001 ) , 6 ( 2002 ) , 6 ( 2003 ) , and 10 ( 2004 ) .
when compared with women under 41 years of age , a higher percentage of women over 40 years of age discovered their breast cancers by mammography ( 49% ) and had a higher number of hormone sensitive tumors ( 87% ) .
the frequency of lymph node metastases reported in the older women was one - half that in the younger women ( 21% versus 42% ) , and a higher percentage of younger women presented with more advanced disease , a difference which was statistically significant ( p < .05 ) .
many of the patients ( in the unknown lymph node status category ) had undergone simple mastectomy in the 1990s , thus accounting for the overall 20% unknown lymph node status , which was 20% in the > 40 year - old and 19% in the < 41 year - old group ( table 1 ) .
carcinoma of the breast in young women is a relatively uncommon occurrence , with our data depicting an incidence of approximately 8% of all women with breast cancer .
this correlates with findings of other authors who have reported incidences of 0.3% to 25% [ 1 , 1214 ] .
mammography remains the premier screening tool for older women ; however , it is of questionable value in young women primarily because small lesions tend to be undetectable or interpreted as benign secondary to the increased density of the breasts of young women , which renders radiographic differentiation of normal from abnormal tissue difficult .
ashley and colleagues found that 77% of mammograms in young women produced an x - ray suspicious for malignancy , and only 23% were obviously benign .
ultrasonography identified the pathology correctly in 58% , while fine - needle aspiration ( fna ) cytology was most precise , identifying 78% of tumors as definitely malignant and 15% as suspicious , for an overall accuracy of 93% .
the most frequent lesion noted in this cadre of patients , as well as in other series , is infiltrating duct carcinoma .
the prognosis of women with cancer of the breast is related to a variety of clinical findings and pathological factors , especially the status of the axillary lymph nodes and the tumor size .
studies have also shown that young women with breast cancer have a lower 5-year relative survival rate than older women [ 1214 , 18 , 19 ] .
it has been postulated that the tumors in younger women are more aggressive and less responsive to hormone therapy and that these characteristics account for the differences in 5-year survival between the age groups ( table 2 ) .
however , it remains unclear whether the dismal outcome in the younger age group is a reflection of more advanced disease at the time of diagnosis and/or is due to a difference in underlying tumor biology [ 12 , 14 , 15 , 18 ] .
finally , it has been observed commonly that breast carcinoma appears to be more indolent generally in older women , and most particularly in the elderly .
in 2003 , the american cancer society recommended that breast self - examination be optional primarily because of a lack of unequivocal supporting evidence of benefit .
hence , the only screening guideline currently suggested for women 1840 years of age is a clinical breast examination every three years .
however , 5-year survival among young women diagnosed with breast cancer is clearly related to the stage of the disease at the time of diagnosis [ 17 , 22 ] .
breast self - examination has not been encouraged or recommended , in part , because it has not been consistently associated with a decrease in morbidity or mortality , and because it purportedly can cause increased patient anxiety , especially when biopsies of breast masses that are discovered on self - examination are performed .
we propose that the anxiety can be dispelled or ameliorated by quality time spent properly counseling and supporting the patient .
our data confirm that young women with breast cancer are likely to present with a more advanced stage of the disease compared with older patients . in response to increasing breast cancer in young women under 41 years of age in recent years , further investigation focused on this age group is indicated , and encouragement of proper breast self - examination is warranted and should be advocated as a quality health maintenance practice .
| in 2003 , the revised american cancer society guidelines recommended that breast self - examination ( bse ) be optional . of 822 women diagnosed with breast cancer in our hospital from 1994 to 2004 , sixty four ( 7.7% ) were 40 years of age or younger .
forty four ( 68.7% ) of these young women discovered their breast cancers on bse , 17 ( 18% ) by mammography , and 3 ( 4.7% ) by clinical breast examination by medical professionals
. of 758 women over 40 years of age diagnosed with breast cancer , 382 ( 49% ) discovered their cancer by mammography , 278 ( 39% ) by bse , and 98 ( 14% ) by a clinical breast examination .
lymph node metastases in the older women was one - half that in the younger women ( 21% versus 42% ) , and a higher percentage of younger women presented with more advanced disease . in response to increasing breast cancer in young women under 41 years of age , encouragement of proper breast self - examination
is warranted and should be advocated . |
this is particularly true during early childhood as oral health can influence overall health and well - being .
keeping primary teeth healthy is essential as those who suffer from caries in their preschool years are more likely to experience caries throughout childhood and adolescence [ 2 , 3 ] .
early childhood caries ( ecc ) is decay affecting the primary dentition of children < 72 months of age [ 4 , 5 ] .
several groups have been found to be at a high risk for ecc including first nations and aboriginal children , refugees and newcomers , and those experiencing poverty [ 69 ] .
prevalence rates for ecc in several distinct canadian pediatric populations have been reported with most groups exhibiting rates above 40% .
for instance , urban and on - reserve first nations and aboriginal children are reported to have high rates , sometimes reaching 8090% of the population with many meeting the definition of severe early childhood caries ( s - ecc ) , a more rampant form of ecc [ 810 ] . meanwhile nearly 40% of rural hutterite children
other groups in canada such as vietnamese children , immigrants from south asia , and portuguese - speaking immigrants have been reported to experience ecc [ 1214 ] .
however , still very little is known about the oral health of newcomers , although anecdotal conversations with practitioners would suggest a high level of dental needs .
there is a growing realization that newcomers are at increased risk for caries as the american academy of pediatric dentistry ( aapd ) has included a question on immigrant status in their caries - risk assessment tool ( cat ) .
one - size - fits - all approaches and strategies that have worked with the general population often have little impact on reducing the incidence of ecc in high - risk populations and may not be effective with distinct cultural groups .
even if it were possible to reach all high - risk children and provide them with tailored programming , the desired behavioural change may not take place ( despite the increase in knowledge offered by traditional oral health approaches ) .
differing practices and views on oral health , which may be related to cultural diversity , may contribute to increased caries risk .
many aspects of cultural diversity can influence oral hygiene routines , diet , health beliefs , reaction to pain , and access to care , factors which may in turn affect oral health status [ 17 , 18 ] .
if a person belongs to a cultural group that does not define poor oral health as abnormal , they may lack both information about oral health and access to care and may not comply with professional recommendations for treatment [ 18 , 19 ] .
there is a growing realization that qualitative research methods are useful in identifying how knowledge and ideas develop and operate within a given cultural context .
overall , there is limited qualitative research on the topic of ecc and the promotion of early childhood oral health ( ecoh ) among cultural minority groups in north america [ 21 , 22 ] .
there is a growing realization that qualitative research methods may be helpful to uncover family and cultural issues that influence infant and preschool oral health .
having an appreciation of different cultural views may allow for focused outreach and promotion activities [ 23 , 24 ] . while known barriers to good oral health include a lack of funds to seek dental care ( especially with newcomer populations ) , the effect of knowledge and beliefs on child oral health is less well understood .
parental and caregiver lack of knowledge of and negative attitude towards preschool oral health have been found to be associated with increased caries experience in their young children .
the purpose of this pilot study was to examine the knowledge and beliefs of parents and caregivers from four different cultural groups with respect to ecoh and ecc .
the ultimate goal was to use these findings to assist in tailoring ongoing promotional activities to improve ecoh and prevent ecc .
a qualitative study design using focus groups was chosen to explore parent and caregiver views on ecoh and ecc from four different cultural groups .
this pilot study was undertaken by the healthy smile happy child ( hshc ) partnership that has been promoting ecoh in manitoba , canada , since 2000 .
the partnership adopted and maintains a community engagement approach to address ecc and has been guided by three pillars : community development , health promotion and education and evaluation [ 2628 ] .
focus groups were selected as health promotion programs can often be strengthened through participatory planning approaches that allow participants to voice their experiences and opinions .
the project team recognized the value of focus groups and the different findings that can be obtained using such an approach .
four pilot focus groups involving parents and caregivers of children < 6 years of age were held .
each focus group involved a different cultural group and was held in southern manitoba , canada . a nonprobabilistic approach to recruitment using a convenience sample of participants was selected .
the four groups included parents and caregivers from an urban aboriginal community , a rural hutterite colony in southwest manitoba , a refugee group in the city of winnipeg , and an urban group of recent newcomer immigrants to the city of winnipeg , manitoba .
these four distinct groups were selected as children from these communities often experience a higher burden of ecc than the mainstream population .
aboriginal participants were recruited through an aboriginal head start program and an organization providing culturally relevant preventive and supportive programming to families .
hutterite participants were recruited with the help of a teacher and research assistant who was a member of a hutterite colony and who had an existing working relationship with the department of pediatrics and child health at the university of manitoba .
the hutterite live on colonies and are a communal branch of anabaptists ( like the amish and mennonites ) .
finally , the newcomer focus group participants were recruited from an english - as - an - additional - language ( eal ) program in winnipeg , canada .
participants were landed immigrants , who had an english benchmark of at least four and who had been in canada for at least one year .
the team facilitating the focus groups included a qualitative research consultant and a hshc staff member .
the study was approved by the university of manitoba health research ethics board and followed established community research protocols .
the research team made notes on a flipchart during the discussions while the hshc team member took additional notes .
participants were invited to review the notes and to correct , delete , or add to any inaccurate or inadequate representations of their comments .
participants in the urban focus groups were provided with bus tickets and all participants received a small honorarium .
focus group discussions followed a sequence of guiding questions from a semistructured tool developed by the hshc partnership as follows .
if i said that someone 's child had healthy teeth , what would that mean to you?is it important for kids to have healthy teeth in your culture?what do you think makes very young kids get cavities or decay in their baby teeth?do you think whether or not a child 's baby teeth are healthy makes any difference to their overall health ? if yes , ask how or in what ways.where did you learn how to take care of your babies ' or young children 's teeth?has anyone ever learned about dental care for babies or very young kids at any of the programs they attend?has anyone read any pamphlets or brochures about dental health for babies or young kids?what do you think is the best way to get information out to parents and families about dental health for babies or young kids?how do you take care of your babies ' or young children 's teeth?are there any specific practices that your culture does to keep children 's teeth healthy?what helps you keep your babies ' or young children 's teeth healthy?are there any things that make it hard for you to take care of your babies ' or young children 's teeth?does anyone here have children who have had problems with their teeth?what kinds of problems did they have?what did you do about it?does anyone here know any kids who have had dental surgery ?
if yes , ask what that was like for the kids and the families.is there one thing that somebody ( anybody government , health workers , family members , the people in this room , or anyone else you can think of ) could do to help parents and caregivers take care of young children 's teeth ?
what would it be?is there anything else that you would like to tell me about what we talked about today ?
if i said that someone 's child had healthy teeth , what would that mean to you ?
is it important for kids to have healthy teeth in your culture?what do you think makes very young kids get cavities or decay in their baby teeth ?
what do you think makes very young kids get cavities or decay in their baby teeth ?
do you think whether or not a child 's baby teeth are healthy makes any difference to their overall health ?
if yes , ask how or in what ways . where did you learn how to take care of your babies ' or young children 's teeth
has anyone ever learned about dental care for babies or very young kids at any of the programs they attend?has anyone read any pamphlets or brochures about dental health for babies or young kids?what do you think is the best way to get information out to parents and families about dental health for babies or young kids ? has anyone ever learned about dental care for babies or very young kids at any of the programs they attend ? has anyone read any pamphlets or brochures about dental health for babies or young kids ?
what do you think is the best way to get information out to parents and families about dental health for babies or young kids ?
are there any specific practices that your culture does to keep children 's teeth healthy?what helps you keep your babies ' or young children 's teeth healthy?are there any things that make it hard for you to take care of your babies ' or young children 's teeth ?
are there any specific practices that your culture does to keep children 's teeth healthy ? what helps you keep your babies ' or young children 's teeth healthy ?
are there any things that make it hard for you to take care of your babies ' or young children 's teeth ?
what kinds of problems did they have?what did you do about it?does anyone here know any kids who have had dental surgery ?
if yes , ask what that was like for the kids and the families . what kinds of problems did they have ?
is there one thing that somebody ( anybody government , health workers , family members , the people in this room , or anyone else you can think of ) could do to help parents and caregivers take care of young children 's teeth ?
is there anything else that you would like to tell me about what we talked about today ? questions of particular interest included what good oral health means for their child , their experiences with dental problems like ecc , and how they learned to care for their children 's teeth .
another area of interest was whether there were any practices unique to their cultures relating to caring for young children 's teeth .
additional probing questions were used as needed to elicit specific details or clarification . notes and recordings from each focus group were transcribed verbatim and analyzed independently using thematic analysis by two members of the team . when analyzing the data , transcripts from each of the participant groups were examined independently , drawing out participants ' responses to the overarching research questions .
themes that emerged in each cultural group were reported separately so that findings would be more practical to inform existing and future oral health promotion and research activities .
a total of 40 parents and caregivers participated in this pilot study , including nine in the aboriginal focus group and 14 in the hutterite focus group .
eight were residents of the community where the focus group was held while the additional six resided at a different colony .
participants originated from countries in africa , the middle east , and western asia including chad , congo , ethiopia , iraq , morocco , nigeria , and somalia .
six people participated in the immigrant focus group and were from africa and western asia including congo , eritrea , nigeria , and sudan .
aboriginal participants described healthy teeth as being clean , free from decay , and not falling out .
participants referred to a link between oral health and temperament , stating thatif they have a toothache , they 're going to be all upset and miserable , crying , in pain and if they have a cavity , then they 're going to be crabby .
if they have a toothache , they 're going to be all upset and miserable , crying , in pain and if they have a cavity , then they 're going to be crabby . if they have healthy teeth , they wo n't be grouchy . however , another participant felt that baby teeth are of little value as they are going to fall out anyway .
one was a mother 's diet during pregnancy and the other was the use of bottles and bottle - feeding .
one participant expressed,everything you eat when you 're pregnant , everything that goes in your mouth , your baby gets it everything you eat when you 're pregnant , everything that goes in your mouth , your baby gets it some participants believed that giving children a bottle at bedtime or naptime causes caries .
while several participants had heard this before , a few stated that they did not believe this to be true .
participants generally learned how to care for their children 's teeth from their mothers , grandparents , and friends .
one participant described how her grandparents tought her to use a facecloth and infant toothbrush to clean her babies ' gums and teeth .
another indicated that she learned about using infant toothbrushes and toothpaste and the importance of antenatal oral health by attending a community - based healthy baby program .
this included uncooperative children , the cost and inability to purchase oral hygiene supplies , and lack of time .
one participant expressed , it 's hard with my kids to get them to brush their teeth .
some caregivers indicated that they had little difficulty in getting their child to cooperate in brushing , though one parent noted that despite this her child still developed caries in her front teeth .
three participants in the aboriginal group had at least one child or family member who had experienced s - ecc and underwent dental surgery under general anesthesia ( ga ) .
one stated that her child 's teeth had rotted before she reached the age of two because she did not have enough enamel and had surgery to remove these teeth .
the mother of a three - year - old described the surgery experience as awful .
another stated that her niece had all her teeth removed when she was four years old.her teeth rotted really quickly . by the time she was three years old , her top and her bottom was just black , like on posters you see of tooth decay .
her teeth rotted really quickly . by the time she was three years old , her top and her bottom was just black , like on posters you see of tooth decay .
many of the parents indicated that they had difficulty in getting their children to see the dentist .
for some , it was because they had been scared or hurt during previous dental encounters or feared needles .
unfortunately , one mother admitted that her son has five cavities right now because he wo n't go to the dentist .
this fear of the dentist led two parents to agree that it might be better if the dentist were to simply use a gas to just knock [ their children ] out .
aboriginal participants shared information about traditional medicines and practices such as the use of herbal and traditional medicines when babies have rotten teeth .
one had taken her child to a traditional healer because of the way the gums looked and had informed the dentist of this .
however , participants suggested that before incorporating any traditional knowledge or medicines into programming and prevention activities , it is important to first seek permission from an elder to share knowledge and teachings .
sharing information on a one - to - one basis and making use of existing parental networks were described by participants as effective ways to promote ecoh within the urban aboriginal community .
it was suggested that front - line workers , such as public health nurses and dentists , begin making home visits .
talk to children in school about taking care of teeth and the [ traditional ] medicines .
hutterite participants identified four factors they believed influenced oral health : oral hygiene , intake of junk food , use of fluoride , and genetics .
some participants felt that brushing and rinsing may be more important than a child 's intake of candy and treats.you can have a kid who does not eat candy and does not brush or a kid who eats lots of candy and brushes and the kid who eats a lot of candy will be better off .
you can have a kid who does not eat candy and does not brush or a kid who eats lots of candy and brushes and the kid who eats a lot of candy will be better off .
participants were not aware of colonies that fluoridate their drinking water , but noted that fluoride does occur naturally in the water of some colonies .
other colonies use water that has been treated by reverse osmosis to remove minerals and one participant wondered whether or not this might affect oral health as it removes fluoride from the water .
one mother pointed out that even in colonies where parents are making quite a bit of an effort to care for children 's teeth , a lot of kids have to fill their teeth .
another stated that , while they did not remember ever brushing their teeth as children , they never had cavities and wondered if this might be due to genetics .
it was noted that , on several occasions , the children 's temperaments hindered oral hygiene .
specifically , children were often too tired , grumpy , or simply unwilling to brush their teeth .
parents and caregivers also expressed difficulty in making the time to help or encourage their children to brush their teeth due to their own fatigue .
i never give her candy , but she gets it from everybody else ! one caregiver acknowledged that she only cleans her children 's teeth once a day , even though she knows it is recommended to wipe the teeth after each feeding .
her attempt to reduce the risk of decay was to give her baby water to drink , a practice that other parents in the group seemed to share .
as one parent pointed out , it is important to clean babies ' mouths because there are something like 8 or 9 [ sugar ] cubes per cup of breast milk , only slightly less than juice .
participants admitted that it can be painful and traumatic for children when they have cavities , which can affect their quality of life : if [ children ] have bad teeth , how can they eat ?
one participant 's four - year - old daughter had been complaining of a toothache so she took her to a dentist who found a whole mouth full of problems .
she needed five teeth filled and another two removed.i never want to go through it again seeing her in all this pain and you can not do anything at all .
seeing her going into the operating room , they 're going to put her to sleep and what if she never wakes up ? and all of those things
i never want to go through it again seeing her in all this pain and you can not do anything at all .
seeing her going into the operating room , they 're going to put her to sleep and what if she never wakes up ? and all of those things
those who had learned about oral health through presentations in their communities were willing to share information with other family members .
for instance , one passed along information to family members that you should not give a bottle to a child over one year of age .
while participants felt empowered to share with family and friends , they indicated that they might feel uncomfortable about sharing information with others whom they did not know well .
participant 1 : i would n't dream of , if i see someone giving a baby a bottle , a two - year old , saying , do you know that 's not healthy ? participant 2 : of course not . participant 1 : if i know them but not if i did not know them .
participant 3 : i might if i knew them a little say do you know that this could cause this or that .
participant 2 : but it 's always better if they get it from somebody higher up .
participant 1 : i would n't dream of , if i see someone giving a baby a bottle , a two - year old , saying , do you know that 's not healthy ? participant 2 : of course not .
participant 1 : if i know them but not if i did not know them .
participant 3 : i might if i knew them a little say do you know that this could cause this or that .
participant 2 : but it 's always better if they get it from somebody higher up .
participant 1 : like at a meeting or a workshop . participant 4 : that 's non - confrontational .
they appeared to value a personal , one - to - one connection style of learning .
nothing propels you more to try to help your child than to see the results of non - caring , like pictures of decayed teeth .
however , they did say that if language is too high tech , nobody 's going to read it .
the community kitchen seems to be an established area for information sharing in hutterite colonies .
they recommended strategies like a parenting blog , forum , or an email list serve or contact list as ways to disseminate information .
caregivers from this colony also indicated that public health nurses could take a more active role in providing information .
those in the immigrant group felt that good oral health meant the absence of swelling , pain , and broken teeth .
if the first set of teeth starts bad then that will transfer to new [ adult ] teeth .
some in the refugee group felt that the health of baby teeth is important and explained that there is a relationship between overall health and healthy teeth .
two refugee participants believed that genetic factors play a role in the process of decay , with one referring to the high occurrence of bad teeth in her family .
the consumption of sweets , lack of oral hygiene , and the use of bottles were also identified as contributing factors in caries development .
participants also mentioned the inability to control their children 's intake of sweets at school , which makes it difficult for them to care for their children 's teeth .
milk and dairy products were identified as good choices for children due to their calcium content .
one mother from the immigrant group shared how she managed to curb her daughter 's intake of sweets : sometimes you need to scare them
. my daughter likes chocolate and sugar . when she has cereal , i give her a little sugar but she wants more . i tell her that if i give her more sugar , when i take her to the dentist , he 'll remove all her teeth
now , sometimes she says do not put sugar ! sometimes you need to scare them .
my daughter likes chocolate and sugar . when she has cereal , i give her a little sugar but she wants more .
i tell her that if i give her more sugar , when i take her to the dentist , he 'll remove all her teeth now , sometimes she says do not put sugar ! immigrant participants believed that regular visits to the dentist or doctor were important practices . however , those in the refugee group did not necessarily share this view , as one participant stated that children do not need to go to the dentist unless they are experiencing dental problems .
one immigrant mother mentioned how the dentist recommended that she give her daughter a cup rather than a bottle as her daughter 's teeth had turned black .
other participants agreed that children should start using a cup at an early age instead of bottles .
they described cleaning their babies ' gums and tongue using a cloth , warm water and salt , baking soda , glycerin , or cotton wool .
the majority of participants indicated they had first learned about oral health care from family members and friends and later from medical practitioners in their home countries .
children of participants from the immigrant focus group were reported to have had few dental problems .
the mother described her experience:[the ] family doctor , when my child 's tooth was a little black , he told me to go to dentist and gave address but no other information .
he said to brush all the time and i do not have to feed her by the bottle .
so i have to feed her by the cup and you have to clean always her teeth . [ the ] family doctor , when my child 's tooth was a little black , he told me to go to dentist and gave address but no other information .
he said to brush all the time and i do not have to feed her by the bottle .
so i have to feed her by the cup and you have to clean always her teeth .
participants in both groups spoke about the practice of using a twig from a specific tree to clean teeth , stating that it has the additional benefit of being natural and chemical - free .
sewak and reported that the plant has lots of benefits for your teeth .
the twig is reportedly very effective : sometimes a brush wo n't get everything , but that one will take everything off .
as one participant stated , it 's part of the obligation . as part of islam
there is a saying from our prophet that if i would have told any human being that these are the obligations that you must do , i would have encouraged them to clean their teeth five times a day .
there is a saying from our prophet that if i would have told any human being that these are the obligations that you must do , i would have encouraged them to clean their teeth five times a day .
participants suggested that oral health promotion activities could be delivered through existing programs , classes , daycares , schools , and organizations in which parents are already involved ( such as eal classes or programs for moms and tots).that 's a good reason to use community centres they can bring parents out , tell them what you want to say , what they need to do . for people who do not understand the language
that 's a good reason to use community centres they can bring parents out , tell them what you want to say , what they need to do . for people who do not understand the language , it 's better for them to see it with their eyes
. some indicated that they would appreciate getting information from a healthcare provider with experience and knowledge whom they could easily trust .
there was general agreement that some refugee caregivers might prefer someone who is like them or who knows their language .
the purpose of this pilot study was to gain an initial understanding of views on ecoh that may assist in shaping effective and appropriate culturally proficient promotional activities and materials targeting specific communities within an increasing diverse population . even though the intent of these pilot focus groups was not to contrast findings between the different cultural groupings , it was interesting that there were some differences and apparent similarities .
for instance , when asked what contributes to caries in young children , participants in the aboriginal group identified bottles and bottle - feeding along with prenatal diet as being important while hutterite participants identified a lack of fluoride in the drinking water , junk food , and genetics . meanwhile , newcomer participants mentioned sweets , a lack of oral hygiene , and genetics .
one apparent similarity between some of the groups related to barriers to regularly cleaning their children 's teeth was seen as both participants in the aboriginal and hutterite groups mentioned a lack of time as well as their children 's temperament and uncooperativeness . with regard to promoting ecoh
each group mentioned the importance of reaching parents and making personal connections but offered unique suggestions ranging from including aboriginal elders to share traditional knowledge , the use of workshops and health - education materials with the hutterites , and using laypeople in newcomer communities to including oral health messages in existing programs providing assistance to these families .
each focus group yielded useful suggestions on how to possibly promote oral health and engage members of their cultural community .
two specific issues were identified , namely , seeking permission from an elder to incorporate traditional medicine or knowledge into programming and the elder 's actual role in information sharing .
these findings are consistent with those of a study examining cultural factors affecting children 's oral health , which found that elders and their wisdom were highly respected .
they discussed concerns of passing on information to strangers and the importance of using a nonjudgmental approach as some felt guilty that their child required dental surgery .
they felt that appropriate methods included the use of pamphlets , posters , and e - mail updates .
this resembles a health - education model rather than health promotion and community development approaches and is not recommended for groups with low literacy levels , language barriers , or limited access to computers .
hutterite communities have a unique lifestyle as they live communally with community ownership of most goods .
communal living allows for less control over some aspects of living as compared to other groups , as is evident with shared meals , dress , and lack of individual finances .
this lifestyle may impact their access to oral hygiene supplies and dental care . as decision - making occurs at the community elder level
it is important to note that women in hutterite culture play a key role in making decisions about health [ 11 , 30 ] .
we previously reported that hutterite mothers had a highly accurate view of their children 's oral health .
both hutterite and refugee participants believed that genetics play a role in ecc development . while there is a proven increase in dental agenesis in the hutterite population , presently there is no literature to substantiate a genetic predisposition to caries with this group .
this belief is likely based on the fact that some genetically associated diseases , such as muscular dystrophy and cystic fibrosis , are more prevalent in or exclusive to the hutterite population [ 32 , 33 ] .
some genetic conditions do affect enamel and dentin formation , which can decrease host resistance to caries ( e.g. amelogenesis imperfecta ) . however , there is now emerging evidence supporting a genetic predisposition to caries in some populations [ 3436 ] .
the belief that hereditary factors contribute to caries is not exclusive to our study , as these views were also held by latino immigrant caregivers in another investigation .
regardless of the role that genetics play , it is important to increase parental awareness of the numerous factors involved in caries development so that they can minimize their children 's caries risk .
interestingly , some participants in the aboriginal group did not believe that putting children to sleep with a bottle could cause caries .
other reports have suggested that some parents may not understand this and may routinely give their infants and toddlers bottles at bedtime [ 23 , 37 ] .
in a recent qualitative study , nurses reported that parents often do not associate bottle - feeding with caries .
our findings also suggest that there may be some misconceptions about general infant feeding that require clarification .
for instance , participants from the hutterite group stated that breast milk is high in sugar .
while breast milk does contain a certain amount of natural sugar , breast milk itself is not cariogenic .
a recent review suggests that there is inconclusive evidence to support a relationship between breastfeeding and ecc .
however , while some studies have reported that breastfeeding may be protective against caries other studies have reported that prolonged breastfeeding and nocturnal breastfeeding may increase the risk .
the canadian dental association 's recent position statement on breastfeeding supports this practice but emphasizes the importance of regular oral hygiene once primary teeth begin to erupt .
therefore , it may be important to involve parents and grandparents in oral health promotion activities to equip them with essential oral - health - related information that they can then pass on to younger generations . a move towards family - centred care ( which encourages the involvement of all members of a patient 's circle , both familial and social ) would assist in meeting the needs of this group . in our study
this was surprising , as the group identified public health nurses as a possible messenger of oral health information .
immigrant participants possessed a good level of understanding about ecoh and few had children who developed ecc .
healthy immigrant effect , which suggests that the healthiest are more likely to migrate and be granted residence in another country .
participants in this focus group held differing opinions about who should deliver information to members of their community . while some felt that professionals would be best as they trust them
, others believed that lay workers in the community would be better suited to promote ecoh .
for instance , participants from each group identified that the difficulty in cleaning their children 's teeth and limiting sugar intake were challenges to keeping their children 's mouths healthy .
similar findings were also reported in a recent study involving african newcomers to canada as they expressed concern over their inability to keep their children from eating sugar and candies and fighting with their children to brush their teeth .
refugee participants believed that few of their children had dental issues and suggested that children really only need to visit the dentist when they experience a dental problem or toothache .
similarly , another report has suggested that the perceived need for dental care may be low among african newcomers as they mainly rely on their own assessments , toothaches , and advanced signs of caries to indicate the need for dental care rather than the established early warning signs of ecc .
additional evidence supports these findings , as certain groups have been found to seek dental care only after their children begin to experience pain .
seeking preventive dental care may not be the cultural norm [ 21 , 46 ] .
however , focus groups with a similar population of canadian newcomers have suggested that oral hygiene may not be a priority , as they believe that oral health is ultimately dictated by god 's will
. perhaps the involvement of religious institutions and leaders may be a worthwhile avenue to explore for continuing work with this population .
language is key to effective and safe communication and therefore must play a critical role if ecoh is to be effectively tailored to specific populations .
participants suggested that using individuals from their own cultural group to deliver oral health messages would be effective .
language barriers have a larger influence on how one successfully interacts with the health care system than cultural beliefs .
language is affected by cultural and historical context and is often about sharing and validating realities .
given the obvious language barriers that exist for newcomer populations , participants in the immigrant and refugee groups also suggested that providing visual information and resources may be useful in sharing key messages about ecoh .
as rates of immigration continue to grow , cultural groups are less likely to have access to health professionals who share the same beliefs and understandings of health and disease , language , and experiences .
linguistically appropriate care can be achieved when a provider shares an understanding of the experiences of the community .
perhaps the use of interpreters at dental care appointments can help to pass along oral health messages .
this service exists in some community - based dental programs in the winnipeg region . for practitioners to provide culturally responsive care
they require awareness of cultural beliefs and practices while recognizing that care still needs to be provided based on an assessment of the individual .
health promotion workers should continue to learn about distinct cultural groups while recognizing that communication and individual beliefs will still have an impact on knowledge acquisition and behavioural change .
this approach will help shape health promotion activities and develop prevention strategies targeted to unique at - risk groups .
if we are going to reduce the impact of ecc on these groups , we must ensure that preventive strategies are adapted as necessary and incorporate their suggestions .
due to our sampling approach , the findings are not generalizable to the entire communities participating in our study as these findings may not be reliable and reproducible if more representative samples were recruited .
further , those agreeing to participate may have been those with a greater appreciation and awareness of oral health .
participation was not restricted to only parents and caregivers of children who were affected by ecc , which may have resulted in an overrepresentation of those whose children were actually in good dental health .
the small numbers of participants and the pilot nature of this work also prohibit comparisons between groups .
language issues proved to be a large hurdle in the focus group process , as several participants spoke english as an additional language .
this was particularly evident in both focus groups with parents and caregivers who were refugees or other immigrants .
while all individuals in the immigrant focus group spoke english well , the majority of participants in the refugee group had limited english skills and relied on other participants to translate for them .
the reliance on these individuals as translators constituted another source of error , as the information obtained by researchers was , in a sense , passed through an intermediate party which had interpretive control .
the interpreters had control over what they communicated as the content and meaning of their language peers ' responses .
while the immigrant and refugee focus groups were somewhat heterogeneous in terms of country of origin , it can be argued that all participants in each respective group shared similarity as they self - identified as being either an immigrant or refugee .
participants in this study may have already had some understanding of ecc through exposure to the hshc initiative or other resources .
regardless , the information obtained during these focus group sessions is extremely valuable and provides useful insight into the best ways to promote ecoh amongst these at - risk populations .
the hshc partnership understands that meaningful community development requires that attention be paid to cultural proficiency for meaningful community engagement , the development of interventions , oral health promotion , and health education .
culturally and linguistically proficient approaches must be developed for at - risk communities if they are to fully participate in prevention and promotional activities .
developing culturally proficient and therefore relevant approaches to oral health promotion and caries prevention requires an understanding of diversity .
cultural proficiency can be enhanced by increasing awareness of the views and beliefs of cultural groups .
this pilot work will certainly help to inform our further qualitative and quantitative research and outreach activities with these different groups , especially immigrants and refugees to manitoba , canada .
there is a growing need for further qualitative investigation with larger samples of parents , especially those whose children have experienced ecc , to gain their perspectives .
this would also assist in the development of questions for use in survey instruments and caries - risk assessment tools for these cultural groups .
since little is known about the true oral health status of refugee and immigrant newcomers to manitoba , baseline studies on the prevalence of ecc and associated risk factors are warranted . at the present time we are using these findings to assist us in developing pictorial - based ecoh promotion materials for newcomer populations
these pilot focus group sessions were useful in identifying potential barriers to ecoh , sources of oral - health information , oral health - related misconceptions , and how to best reach each community with ecoh messages .
caregivers identified several barriers to maintaining ideal early childhood oral health including the child 's temperament , finances , and inability to control sugar intake .
however , both religion and genetics were found to influence the perception of oral health in some groups .
misconceptions regarding breast milk and bottle use were present . while participants from the refugee group believed that dental visits were only necessary if dental pain or problems were experienced .
one - on - one discussions , use of parental networks , and the use of laypeople from similar cultural backgrounds were suggested as ways to promote oral health .
the immigrant and refugee group placed emphasis on the use of visuals for those with language barriers while the hutterite participants recommended a more traditional health - education focused approach .
the findings from this paper have provided some initial insight into the oral - health - related knowledge and beliefs of these high - risk cultural groups .
these insights will help to inform planning of ecc prevention and research strategies , which can be tailored to specific populations . | objectives . several groups in manitoba , canada , experience early childhood caries ( ecc ) , including aboriginal , immigrant , and refugee children and those from select rural regions . the purpose of this pilot study was to explore the views of parents and caregivers from four cultural groups on early childhood oral health and ecc . methods . a qualitative descriptive study design using focus groups recruited parents and caregivers from four cultural groups .
discussions were documented , audio - recorded , transcribed , and then analyzed for content based on themes . results .
parents and caregivers identified several potential barriers to good oral health practice , including child 's temperament , finances , and inability to control sugar intake .
both religion and genetics were found to influence perceptions of oral health .
misconceptions regarding breastfeeding and bottle use were present . one - on - one discussions , parental networks , and using laypeople from similar backgrounds were suggested methods to promote oral health .
the immigrant and refugee participants placed emphasis on the use of visuals for those with language barriers while hutterite participants suggested a health - education approach .
conclusions .
these pilot study findings provide initial insight into the oral health - related knowledge and beliefs of these groups . this will help to inform planning of ecc prevention and research strategies , which can be tailored to specific populations . |
the plasminogen activation ( pa ) system plays an important role in various pathophysiological processes , including vascular and tissue remodeling , tumor development , and cancer progression [ 17 ] . in the cancer arena , which will be in the spotlight of this paper , some of the distinct molecular components of the pa system received much attention because of their rate - limiting role in plasmin generation or because their overall expression was linked to progression of certain types of cancers and patient outcome ( see some original publications [ 815 ] and summarizing reviews [ 1618 ] ) .
hence , the main focus of studies within the pa / plasmin system during the last two decades was placed on the plasminogen activators ( tpa and upa ) , their inhibitors ( pai-1 and pai-2 ) , the upa receptor ( upar ) , and various plasminogen receptors , whereas the investigation of specific effects of the actual , cleavage - executing enzyme , plasmin , appeared to be somewhat abandoned by mainstream cancer research . moreover , a tendency has been established to ascribe direct plasmin - mediated functions , such as cleavage of certain matrix proteins or activation of specific latent growth factors , to the activity of upa [ 19 , 20 ] .
conversely , plasmin involvement in vivo is generally implied in the outcomes of upa functionality without conclusive evidence of de novo generated plasmin or measuring or inhibiting its enzymatic activity .
in addition , being a potent proteolytic enzyme , plasmin was shown early to cleave and degrade in vitro a broad range of proteins , frequently in a test tube or assay plate .
these early findings may have hindered the later investigations of precise plasmin targets and functions in a live animal , especially within the context of the tumor microenvironment , for which the list of nonfibrin proteins proven to be actual in vivo plasmin substrates is rather limited . in this paper
we will concentrate on the evidence directly linking de novo generated activity of plasmin and its catalytic manifestations in cancer - related in vivo settings .
plasminogen is converted to plasmin via cleavage of the arg561-val562 peptide bond by either tissue - type plasminogen activator ( tpa ) or urokinase - type plasminogen activator ( upa ) .
the cleavage results in generation of the n - terminal chain , containing five kringle domains with lysine - binding sites , and the chain , containing the catalytic triad of his603 , asp646 , and ser741 .
produced by the liver , plasminogen circulates at relatively high concentrations ( approximately 2 m ) , making it an abundant zymogen in plasma and also in interstitial fluids , where its concentration can be increased upon inflammation or injury through exudation from the vascular system .
therefore , plasminogen activation by its specific activators is one of the ways to efficiently regulate plasmin functions . in the blood stream , plasminogen is activated mainly by tpa , generating the enzyme responsible for lysis of fibrin clots . in wounded tissues undergoing repair or in the tumor microenvironment undergoing constant remodeling ,
the enhanced expression of single - chain pro - upa by cancer cells and the ability of malignant tumor cells to activate pro - upa into the two - chain , catalytically active upa [ 24 , 25 ] , as well as regulation of upa activity by the specific inhibitors , pai-1 and pai-2 , are all critical factors in plasmin generation and consequently , regulation of plasmin - mediated cell functions .
a unique mechanism for plasminogen activation involves microparticles which are produced by endothelial cells under stress conditions and provide abundant surface for upar / upa - mediated plasmin generation . since the major components of the upa / plasmin systems are secreted proteins , activation of plasminogen by upa can occur extracellularly , albeit in close proximity to the upa - expressing cancer or endothelial cell .
pro - upa activation by trace plasmin , constituting a distinct feedback mechanism leading to further amplified plasmin generation , also can be achieved directly on tumor cell surfaces through the binding of pro - upa to its specific receptor , upar .
our findings with the highly disseminating variant of human prostate cancer cells , pc - hi / diss , indicate that most of the in vitro generated two - chain upa quickly dissociates from the cell surface and accumulates in the conditioned medium , but is undetectable in the cell lysates ( casar , unpublished observations ) .
therefore , only a fraction of plasmin activity could be demonstrated being directly generated by the cell surface - bound upa .
it is possible that upar and some plasminogen receptors initiate generation of upa and plasmin at the cell surface , but do not retain the respective activated enzymes for a long time . supporting this notion ,
it has been demonstrated that plasmin and plasminogen bind to distinct sites on one of the plasminogen receptors , s100a10 .
this finding implies that proteolytic conversion of plasminogen would result in plasmin translocation in cis within the same plasminogen receptor molecule or , more likely , in trans between two receptor molecules .
although binding of plasmin to plasminogen receptors and upa to upar is viewed as a mechanism for sequestration or escape of active enzymes from their natural inhibitors , respectively 2-antiplasmin and pai-1/pai-2 , the release of active upa and plasmin from the cell surface may actually represent a mechanism allowing for efficient re - usage of the respective zymogen - binding molecules during recurring cycles of enzyme generation .
whether activated upa remains bound to cell membrane via upar or is released but maintained in a pericellular pool , upa - generated plasmin will be localized to the close vicinity of the tumor cell surface .
this scenario is further supported by existence of a number of cell surface plasminogen - binding molecules .
these receptors present the bound plasminogen to upar - bound upa or pericellular soluble upa , and therefore localize any generated plasmin to the cell surface or to immediate proximity of the cell .
besides functioning as plasminogen receptors on tumor cells , plasminogen - binding molecules are also found on other cell types that might reside within or influx into the tumor microenvironment .
the interplay between tumor cells and host cells , such as endothelial cells and activated myofibroblasts , can induce various signaling pathways as a result of upa - mediated conversion of plasminogen bound to its receptors .
this tumor - host crosstalk resulting in plasmin generation might play an important role in cancer progression through regulation of cell proliferation , apoptosis , angiogenesis , adhesion , migration , and invasion .
in addition , expression of plasminogen receptors by host blood leukocytes might facilitate activation of juxtapositioned inflammatory cells presenting surface - bound plasminogen to the active upa bound to upar on either tumor or endothelial cell .
the latter scenario becomes even more relevant when one considers that angiogenic tumor tissues are invariably infiltrated with various types of inflammatory leukocytes .
numerous cell surface molecules have been shown to be capable of binding plasminogen , thereby facilitating its conversion into plasmin .
many of these plasminogen - binding receptors are intracellular molecules having well - known specific roles in the cytoplasm or nucleus . however , being translocated to the plasma membrane , these unusually displayed molecules apparently serve for plasminogen trapping .
most of these cell membrane molecules possess c - terminal lysines , which allow them to function as plasminogen receptors via direct binding of plasminogen through the lysine - binding sites located in its kringle domains .
a glycolytic enzyme enolase-1 ( -enolase ) was among the first c - terminal lysine - containing plasminogen receptors identified on the surface of peripheral blood cells .
recently , enolase-1 was shown to regulate , via plasminogen - binding mechanisms , monocyte recruitment to injured lungs and to play a central role in inflammatory lung disease .
another unusually localized plasma membrane molecule that possesses a c - terminal lysine is histone h2b , one of the main 5 histone proteins involved in the maintenance of chromatin structure in eukaryotic cells .
it originally was shown to serve as a plasminogen receptor on the cell surface of neutrophils and monocytic cells , and later its plasminogen - binding capability was implicated in the regulation of macrophage recruitment .
cell surface forms of actin were also identified as plasminogen receptors responsible for stimulation of plasminogen activation and plasmin - mediated processing of prohormones produced by neurosecretory cells .
a number of plasminogen - binding receptors belong to the families of calcium - binding proteins localized to the cell membrane as homodimers .
annexin 2 ( annexin ii ) is a member of annexin family , whereas s100a4 and s100a10 belong to the s100 family .
in addition to plasminogen , annexin 2 can independently bind tpa , accelerating cell surface conversion of plasminogen to plasmin [ 39 , 40 ] .
furthermore , two molecules of annexin 2 and two molecules of s100a4 or s100a10 ( p11 ) can generate heterotetramers [ 29 , 41 , 42 ] , thereby even further enhancing the catalytic efficiency of plasmin production .
the specific functions of these molecules as plasminogen receptors are described in the designated sections of this issue . in relation to cancer biology ,
specifically , attenuation or loss of s100a10 expression in tumor cells was shown to result in a significant reduction of plasmin generation , concomitant with a dramatic inhibition of extracellular matrix degradation , invasiveness and metastasis [ 29 , 43 ] .
annexin - mediated assembly of plasminogen and tpa on monocytes / macrophages contributed to the generation of plasmin activity in vitro and thus , facilitated matrix remodeling , invasion of monocytes and their differentiation into macrophages .
plasminogen binding to the annexin 2a and s100a10 complex on human monocytes was also implicated in upa - mediated generation of plasmin and plasmin activity , which in turn increased mmp-1 synthesis via multiple signaling pathways , including erk1/2 , p38 makk , cyclooxygenase-2 , and pge2 .
pkc - dependent phosphorylation of annexin 2 was reported to be induced by plasmin generated form plasminogen bound to the annexin a2-s100a10 heterotetramer on the surface of endothelial cells .
recently , the expression of s100a10 in macrophages was shown to be essential for their recruitment to the sites of primary tumor formation in murine lewis lung carcinoma and t241 fibrosarcoma models .
all the aforementioned plasminogen receptors lack signal sequences and transmembrane domains and therefore their cell surface location is supposed to be regulated by yet undetermined pathways .
in contrast , the most recently discovered plasminogen receptor , plg - rkt , not only possesses a c - terminal lysine exposed on the cell surface , but has been predicted to have two transmembrane helix domains and four - amino acid cytoplasmic - loop , assuring its true transmembrane nature .
the data have demonstrated that plg - rkt is highly colocalized with upar and also suggested direct interactions with tpa , thereby implicating plasminogen activation through the mechanisms established for other plasminogen receptors .
plg - rkt has been shown to play a critical role in chemotactic migration and matrigel invasion of macrophages in vitro and peritoneal macrophage recruitment in mice .
originally discovered on the surface of monocytic cells , this novel transmembrane plasminogen receptor was found also on neuronal , leukemic , and breast cancer cells . in neuronal cells , this plasminogen receptor stimulates plasminogen activation and modulates catecholamine release and neurosecretory cell functions .
the molecular structure of plg - rkt indicates its translocation to the plasma membrane by one of the known mechanisms established for transmembrane proteins .
therefore , it appears that the transmembrane plg - rkt is the only member of a redundant family of plasminogen - binding molecules that is properly translocated to the cell surface for plasminogen binding .
it is also likely that plg - rkt will be demonstrated to play a major role in plasmin generation in vivo and therefore in plasmin - dependent processes involved in tumor cell dissemination .
to discriminate the in vivo contribution of individual components of the upa / plasmin system to plasmin activity , de novo generation of which could be quantified and related to survival and colonization potential of tumor cells , we have recently introduced a mouse lung retention model . this model is based on intravenous inoculations of human tumor cells into mice with defined genetic backgrounds , for example , wild - type versus upa , tpa , or plasminogen knock - out mice . complementing or contrasting the different host backgrounds , inoculated tumor cells can either express or lack specific components of the pa / plasmin system ; for example , the tumor cells can be positive or negative for upar , or express only single - chain upa zymogen or both single- and two - chain upa .
different amounts of plasmin are generated , depending on the presence of distinct components of the upa / plasmin system provided either by the donor cells or the host microenvironment .
furthermore , the levels of de novo generated plasmin positively correlate with the actual numbers of survived tumor cells in the lung tissue , thereby predicting relative levels of long - term colonization by tumor cells with different phenotypes .
briefly , tumor cells are inoculated into the tail vein of mice . within 2 hr following cell inoculations ,
because of cell clearance and proapoptotic pressure , only a fraction of injected cells survives in the lungs by 24 hr . the mice are sacrificed at indicated time points by an overdose of anesthetics , the blood is collected into heparin - containing tubes to provide the source of plasma for measuring plasmin activity , while the lungs are excised for further quantitative human - specific alu pcr analysis of actual tumor cell numbers . lung tissue can also be analyzed biochemically for expression of human or host proteins , for example , for activation of signal transduction molecules , and analyzed by immunohistochemistry for tissue localization of tumor cells relative to the lung endothelial , stromal , and inflammatory cells .
the collected cell - free plasma is analyzed for plasmin activity by s2251 peptide cleavage assay ( figure 2(a ) ) . to determine the levels of de novo generated plasmin ,
the background levels of peptide cleavage activity in plasma collected from control mice that did not receive any tumor cells are subtracted from the data obtained for mice inoculated with human tumor cells . by using this model ,
we have demonstrated that intravenously injected aggressive prostate carcinoma cells , pc - hi / diss , expressing activated two - chain upa , facilitate generation of plasmin in plasminogen - competent mice . as
a proof of principle , the lack of the plasmin precursor in plasminogen knock - out mice completely abrogates de novo generation of plasmin , whereas supplementing of plasminogen knock - out recipients with plasmin or plasminogen ( figure 2(a ) ) almost completely restores plasmin generation , indicating that the activity of plasmin detected in the plasma of wild - type mice indeed reflects newly generated active enzyme .
in addition to monitoring plasmin generation , the levels of tumor cell vascular arrest and lung retention have been determined by alu pcr of lung tissue collected , respectively , at 2 hr and 24 hrs , after cell inoculations ( figure 2(b ) ) .
it is important that the levels of vascular arrest in the lungs determined at 2 hr after cell inoculations are similar between experimental cell variants and not affected by genetic backgrounds of either recipients or donor cells . meeting this criterion
is required to properly correlate the differentials in lung retention at 24 hr to the differences in cell survival rather than cell clearance .
thus , there is no difference in 2 hr vascular arrest of tumor cells regardless of plasminogen competence of recipients ( figure 2(b ) ) .
however , the genetic ablation of plasminogen results in diminishment of cell retention levels measured at 24 hr in the lung tissue .
concomitant with the rescue of plasmin production , supplementation of plasminogen - deficient mice with plasmin or plasminogen ( figure 2(b ) ) rescues the low lung retention of tumor cells , bringing the numbers of survived cells close to those observed in wild - type mice .
our recent unpublished findings also indicate that low metastatic prostate carcinoma cells , pc - lo / diss , which express little or no active upa , induce lower levels of newly generated plasmin as compared with their high disseminating counterparts , pc - hi / diss , which express active upa . furthermore , we have also demonstrated recently that de novo generation of plasmin activity , occurring in response to tumor cell inoculations , depends on the host plg - rkt as it was substantially diminished by anti plg - rkt mab 7h1 ( casar et al . , manuscript in preparation ) .
it appears that the monitoring of plasmin generation and tumor cell retention in the lungs at 24 hr , that is , well before any immunological reactions are initiated because of histoincompatibility , provides an ideal model to analyze functionality of distinct molecules of the upa / plasmin system expressed by human tumor cells versus host cells , such as murine vascular endothelium or inflammatory monocytes / macrophages .
finally , combined with the use of immunodeficient mice receiving human tumor cells or congenic hosts receiving murine tumor cells , our 24 hr lung retention model allows to delineate initial contribution of individual components of the plasminogen system and de novo generated plasmin to long - term colonization which would be manifested several weeks after tumor cell inoculations .
the elegant mechanism of upa - mediated plasmin generation has been demonstrated to operate within the tumor environment . hence , strong positive correlations exist between the levels of upa expression in tumor cells and their migration , invasion , colonization , and metastasis , processes that are enhanced at least in part by tumor upa - generated plasmin [ 53 , 54 ] . on the other hand ,
a specific role of host upa in tumor development has been indicated by the retarded development and diminished vascularity of primary tumors originating from upa - competent tumor cells implanted into upa - deficient mice compared to implants in wild - type recipients .
for example , the levels of macrophage infiltration in mouse prostate tumors were significantly higher in upa - competent hosts compared with upa - deficient counterparts .
comparative investigations performed in plasminogen null mice versus their plasminogen - expressing littermates allowed to more directly ascertain specific effects of plasmin in different aspects of normal physiology and cancer progression .
functional cooperation between host plasminogen and tumor upa was shown to promote tumor growth and angiogenesis in the study employing implantation of upa - competent t241 fibrosarcoma cells into wild - type or plasminogen knock - out mice . in the mmtv - pymt model of mammary gland carcinogenesis ,
the deficiency in plasminogen or upa significantly decreased metastatic potential and levels of spontaneous lung metastases , indicating the in vivo role of plasmin generation [ 58 , 59 ] .
the dependence of tumor growth on host plasminogen was demonstrated also in the foot pad model with lewis lung carcinoma and t241 fibrosarcoma .
surprisingly , no quantitative differences were observed in lung metastasis between plasminogen knock - out and control mice if the lewis lung carcinoma cells were implanted subcutaneously , pointing to complexity of plasminogen functions , manifestation of which in cancer can depend on the site of tumor development .
plasminogen - deficient mice also manifest a significantly decreased angiogenic response to vascular endothelial growth factor ( vegf ) or basic fibroblast growth factor ( bfgf or fgf-2 ) , which clearly indicates the importance of the plasmin system in angiogenesis in vivo .
the crossing of the blood - brain barrier by tumor cells also appears to depend on plasmin generation since plasminogen - deficient mice demonstrate lower levels of metastasis after intracarotid inoculations of melanoma cells compared to wild - type control .
an important physiological process as the recruitment of inflammatory cells also requires the availability of plasminogen , although the outcome of such influx critically depends on the model system .
thus , impaired accumulation of macrophages in the peritoneal cavity was observed in plasminogen knock - out mice [ 64 , 65 ] .
in contrast , plasminogen suppressed the influx of tumor - infiltrating macrophages into fibrosarcoma tumors and inhibited tumor progression and angiogenesis . in the following sections
, we will discuss enzymatic functions of plasmin , focusing mainly on those studies , which have implicated plasmin in physiological processes in vivo and emphasizing a clear distinction between the suggestive nature of in vitro findings and conclusiveness of in vivo results demonstrating the proteolytic roles of plasmin in a live animal . by proteolytic processing and activation of nonenzymatic protein precursors and releasing them from the matrix
, plasmin has been indirectly implicated in the downstream functional effects of several chemokines , hormones , and growth factors , including transforming growth factor ( tgf- ) , fibroblast growth factor-2 ( fgf-2 ) , and hepatocyte growth factor ( hgf ) .
tgf is a multifunctional cytokine that exerts diverse effects on virtually all cell types and plays a key role during embryo development and tissue homeostasis .
the tgf- isoform , tgf-1 , was one of the first cytokines shown to require proteolytic activation by plasmin to exert its biological functions .
unlike most propeptides , the propeptide cleaved from the tgf proprotein has a high affinity for tgf- and assembles intracellularly into a noncovalent complex , composed of homodimers of the propeptide and the active tgf- molecule .
after secretion from the cell , these large latent complexes covalently bind to various ecm molecules , including fibronectin , or to cell surface receptors .
the activation mechanism of latent tgf-1 involves the proteolytic cleavage within the n - terminal glycopeptides , which causes a disruption of tertiary structure and noncovalent bonds and results in the release of active , mature tgf-1 .
plasmin was initially shown to release tgf-1 from the pericellular matrix deposited by cultured fibroblasts and fibrosarcoma cells . pointing to a role in atherosclerosis , plasmin generated through upa - mediated conversion of exogenous plasminogen induced release of tfg- protein and tgf- activity in cultures of macrophages and foam cells .
in addition , the ability of cultured alveolar macrophages to generate plasmin suggested its involvement in tgf-1 activation in the mice after lung injury . during the last 2 decades of investigations , many mechanisms of tgf- activation have been described in vitro and comprehensively summarized in several reviews [ 68 , 74 ] .
however , a gap remains in the demonstration and understanding of tgf- activation in vivo .
since tgf- activation is the rate - limiting step in tgf- bioavailability , it is surprising that the functional role of plasmin has not been resolved by using mice genetically devoid of critical members of the pa system .
thus , neither plasminogen - deficient mice nor upa or tpa knockouts [ 7578 ] exhibit phenotypic similarities with tgf- null mice , casting some doubt on all the in vitro data extolling the role of plasmin - mediated activation of tgf-. thus far , the most compelling , albeit indirect , result indicating a contribution of plasmin to in vivo activation of tgf- was obtained in the study where the plasmin inhibitor , aprotinin , inhibited generation of tgf-1 in mice with il-13-induced lung fibrosis . the 1990 demonstration that plasmin can liberate fgf-2 represents another early example of protease - mediated release of a growth factor from the ecm .
fgf-2 is a potent growth factor , which plays an important role in various cell functions , including cell proliferation , and manifests its activity in a number of physiological processes , including tumor angiogenesis [ 81 , 82 ] .
similar to studies of tgf- activation , the plasmin - mediated fgf-2 release from pericellular matrices has been shown mainly in vitro .
thus , the release of fgf-2 by plasmin and other proteolytic enzymes was initially demonstrated in endothelial cell cultures , suggesting a mechanism for induction of angiogenesis . in an ex vivo system , the release of fgf-2 coordinated with fgf-2-dependent induction of smooth muscle cell proliferation was shown in organ cultures employing vein segments .
importantly , this study specifically addressed the contribution of plasmin activity to fgf-2 liberation and fgf-2-mediated cell proliferation . supporting the notion that plasmin activity indeed released matrix - bound fgf-2 ,
the inhibitory effects of the specific plasmin inhibitor , nalme , or the neutralizing anti - upa antibody on smooth muscle cell proliferation were reversed by exogenous fgf-2 added to inhibitor - containing cultures .
fgf-2 was shown also to increase secretion of upa by cultured endothelial cells , suggesting a putative in vivo feedback mechanism , whereby upa - generated plasmin would induce proteolytic degradation of the ecm , release more fgf-2 , and thus indirectly mediate fgf-2-dependent endothelial cell migration and angiogenesis . the first experimental evidence that plasmin can release fgf-2 in vivo
was provided in the chick embryo model where exogenous human upa or upa - overexpressing human tumor cells induced neovascularization which was attenuated by anti - fgf-2 antibody .
however , the data from our laboratory demonstrate that in a collagenous matrix environment , the release of fgf-2 is facilitated by mmp-9 delivered by inflammatory neutrophils . reconciling an apparent discrepancy of plasmin- versus mmp-9-mediated release of angiogenic fgf-2
, some recent data suggest cooperation between plasmin and mmp-9 during physiologic and tumor - induced angiogenesis .
thus , plasmin incorporated in low nanomolar concentrations into collagen rafts grafted onto the cam of chick embryos induces a dose - dependent angiogenic response susceptible to aprotinin inhibition ( ewa zajac , unpublished observations ) .
exogenous plasmin also induces the angiogenic potential of low metastatic and low angiogenic prostate carcinoma cells , pc - lo / diss , expressing only single - chain nonactive upa .
while the mechanisms of plasmin - induced angiogenesis in this model system are still under investigation , additional experiments have indicated that angiogenesis induced either by exogenously added purified mmp-9 or endogenously supplied neutrophil mmp-9 is highly sensitive to low concentrations of aprotinin .
these results demonstrate that the activity of de novo generated plasmin somehow overlaps or converges with the angiogenic functions of mmp-9 , suggesting close in vivo relationships between these two proteolytic systems , and highlighting functional cooperation between pa / plasmin and mmp-9 in tumor angiogenesis .
consistent with this suggestion , simultaneous downregulation of upa , upar , and mmp-9 significantly inhibited angiogenesis induced by glioma cells in an intracranial tumor model in nude mice .
a kringle domain - containing glycoprotein , hgf ( or scatter factor ) , is another growth factor that requires activation and release from the ecm to exert its biological activity through the binding to its cell surface receptor , c - met .
hgf is produced as a latent , single - chain precursor , which is tightly bound to heparan sulfate proteoglycans .
internal proteolytic cleavage of the hgf precursor generates the active disulfide - linker dimer that can be released from the ecm and bind the c - met on adjacent target cells .
plasmin - dependent mechanism of hgf release was suggested in a lung injury model , where the plasmin inhibitor , tranexamic acid , blocked release of the factor in the bleomycin - treated mice .
this suggestion was later validated in the in vitro study , where mouse lung fibroblasts were shown to functionally activate and release ecm - bound hgf in a plasminogen - dependent fashion .
plasmin has been also shown to proteolytically process chromogranin a ( cga ) , the neuronal prohormone stored in catecholamine vesicles .
since plasmin is present in the local environment of chromaffin cells , it was suggested that it can selectively cleave cga and generate a bioactive fragment inhibiting nicotinic - mediated catecholamine release .
data from plasminogen - deficient mice have also provided the evidence that plasmin is a major in vivo protease that regulates the processing of hormones derived from the pro - opiomelanocortin precursor .
thus , a deficiency of plasminogen reduces processing of -endorphin and -melanocyte stimulating hormone , thereby causing behavioral abnormalities in response to stress .
recently another neuronal factor , namely brain - derived neurotrophic factor ( bdnf ) , was demonstrated to be processed and activated specifically by plasmin .
being secreted as an unprocessed proform , this neurotrophin undergoes proteolytic cleavage in the pericellular environment by plasmin , which results in generation of an active form of bdnf capable of stimulating neurite outgrowth .
plasmin has also been shown to induce expression of cyr61 , the angiogenic growth - like factor , which acts as an ecm - associated signaling molecule and regulates proliferation and migration of fibroblasts during wound repair .
a pathway was suggested for plasmin - mediated promotion of fibroblast proliferation , which involves two independent steps . in the first step ,
cyr61 expression is induced via plasmin - mediated par1 activation , and then , in the second step , plasmin releases cyr61 , originally deposited in the extracellular matrix , making it ready to act on cells . in addition to overall release of cyr61 from the matrix deposited by fibroblasts , the authors also showed that cyr61 itself was a plasmin target since only plasmin - cleaved recombinant cyr61 was functionally competent to induce cell proliferation . therefore , this model system provides an example where plasmin - mediated release of a growth factor was accompanied by the direct demonstration of its functional activation . recently , kapoor with coauthors demonstrated that plasmin can activate the cytokine function of the extracellular synthetase , trprs , which becomes a potent angiostatic factor acting through the vascular endothelial - cadherin ( ve - cadherin ) receptor and akt signaling pathway . in vitro cleavage of recombinant trprs by plasmin resulting in production of low molecular weight fragments suggests that in vivo plasmin localized to the surface of endothelial cells , for example , through plasminogen receptors such as s100a10 , could process secreted trprs and generate angiostatic active fragments .
since trprs is secreted by endothelial cells , this scenario can also provide a possible mechanism for negative feedback regulation of tumor angiogenesis . indirectly , through its ability to proteolytically activate in vitro many matrix - remodeling proteases , plasmin has been implicated in various aspects of tissue remodeling , including tumor angiogenesis and cancer progression [ 2 , 99 , 100 ] . in cell - free systems and cell cultures , plasmin was shown to activate zymogens of many matrix metalloproteinases ( mmps ) , including mmp-1 [ 101103 ] , mmp-2 [ 104 , 105 ] , mmp-3 , mmp-9 [ 104 , 107 ] , mmp-13 , and mmp-14 . further solidifying the notion that plasmin has such a broad - range substrate specificity that renders it a nonspecific prommp activator
, cultures of macrophages isolated from upa deficient mice and supplemented with purified plasminogen clearly demonstrated accumulation of activated forms for mmp-3 , mmp-9 , mmp-12 , and mmp-13 in the conditioned medium .
activation of prommp-1 , the zymogen of a potent interstitial collagenase , represents a well - documented case for plasmin functioning as an mmp - activating enzyme . in cultures of dermal fibroblasts and keratinocytes ,
producing prommp-1 , plasmin was shown to induce rapid activation of the proenzyme which occurred through a upa pathway and was facilitated by exogenously added plasminogen .
strict dependency of prommp-1 activation on plasmin activity , generated on cell surfaces via plasminogen conversion , was demonstrated in alveolar epithelial cell cultures .
plasmin - activated mmp-1 then can perform specific collagenase functions manifested in collagen matrix modifications , for example , contraction of collagen matrices . in ht-1080 fibrosarcoma cell cultures
, plasmin was shown to activate two gelatinases , mmp-2 and mmp-9 , activation of which required plasminogen conversion through the surface bound upa .
activation of mmp-2 by plasmin was demonstrated to require the association of mmp-2 zymogen with the membrane - type mmp , mmp-14 , but surprisingly , the catalytic activity of mmp-14 was not essential .
though exact mechanisms of prommp-2 and prommp-9 activation by plasmin were not revealed in these studies , the processing of both zymogens was documented by zymography and the resulting enzymatic activity was confirmed biochemically by cleavage of collagen iv and fibrin , providing a nice example of cooperation between the serine protease system and mmp system in regulation of gelatinase functions .
gradual activation of prommp-9 was observed in cultures of thioglycollate - induced peritoneal macrophages in the presence of exogenously added plasminogen and in wild - type mice during thioglycollate - induced peritonitis , but it was impaired in plasminogen - deficient mice .
plasmin - dependent activation of prommp-9 was also demonstrated in comparative analysis of ex vivo cultures of vascular explants from wild - type versus plasminogen knock - out mice .
the upa / plasmin system was functionally implicated in cell migration dependent on active mmp-9 ; however putative activation of prommp-9 by plasmin was not manifested by pronounced accumulation of any activated species of mmp-9 in this study .
an indirect mechanism of mmp-9 activation was demonstrated in breast carcinoma cell cultures , where plasmin did not directly activate the mmp-9 zymogen but first activated the stromelysin mmp-3 , which in turn acted as a potent activator of prommp-9 .
together , these studies indicate that conversion of plasmin and mmp proteolytic systems is complex and may include several intermediate components
. functional involvement of the upa / plasmin cascade in activation of mmp-13 , collagenase-3 , was demonstrated in our investigation of the pro - angiogenic capacity of mmp-13 . in this study we demonstrated that during growth factor - induced angiogenesis , inflammatory monocytes / macrophages deliver prommp-13 to collagen - enriched matrices , where this zymogen is activated and then functions in upa / plasmin - dependent manner . in vitro ,
the mmp-13 proenzyme is rapidly and efficiently activated through the upa / plasminogen / plasmin cascade into a collagenase capable of cleaving native but not the mutant collagenase - resistant collagen . in vivo
, purified mmp-13 elicited an angiogenic response at nanomolar concentrations , comparable with angiogenic growth factors fgf-2 and vegf .
angiogenic responses induced either by fgf-2/vegf or mmp-13 were abrogated by the plasmin inhibitor aprotinin , not only indicating that plasmin - activated mmp-13 functions as an angiogenic factor in vivo but once again pointing to a functional cooperation between two distinct matrix - degrading protease systems . despite the fact that plasmin cleavage was well documented in vitro for several mmps , including mmp-1 , mmp-3 , mmp-9 , mmp-12 , and mmp-13
, the majority of studies did not confirm that the putative active mmps had actual enzymatic activity . in this regard
, we showed that under physiological conditions plasmin is not a direct activator of mmp-9 , and recently we also demonstrated that although plasmin is capable of processing 92-kda mmp-9 zymogen in vitro to lower - molecular - weight forms , it does not generate enzymatically active mmp-9 capable of cleaving specific peptides or gelatin .
furthermore , in vivo studies from other laboratories employing mice deficient in plasminogen or other components of the plasmin - generating system failed to clearly demonstrate that plasmin - mediated activation of distinct mmps indeed occurred in live animals during matrix remodeling even when the lack of plasmin functionally interfered with mmp - dependent processes .
usually the impairment in mmp - mediated functions has been liberally attributed to the lack of plasmin - mediated activation and therefore , lack of enzymatic activity of the corresponding mmps .
alternatively , when plasmin - dependent activation of mmps has been clearly documented biochemically in tissues or body fluids , physiological consequences of the mmp activity missing in plasmin - deficient mice might not have been followed up .
importance of plasmin in the regulation of mmp - mediated functions in vivo has been demonstrated for several mmps in studies involving mice deficient in plasmin generation .
these studies instigated a general conclusion that plasmin is involved in mmp - dependent matrix proteolysis and cell functions requiring matrix remodeling .
thus , mice lacking either plasminogen or both plasminogen activators , upa and tpa , manifest significantly delayed wound healing kinetics as compared to wild - type mice and show strict dependency of residual wound healing on the activity of unidentified , gm6001-sensitive mmps .
several mmps are expressed in the leading - edge keratinocytes in a skin wound , including mmp-2 , mmp-3 , mmp-9 , and mmp-13 .
however functional overlap of plasmin and mmp systems in wound healing was indicated thus far for mmp-13 in the double knock - out model .
in contrast , mice deficient in both mmp-2 and plasminogen manifested no difference in wound healing compared with singular plasminogen knockouts , likely indicating that , in contrast to in vitro results , plasmin is either not responsible for mmp-2 activation in vivo or that mmp-2 activity is dispensable in this model system .
the synergy between a plasminogen cascade and mmp-9 was also indicated in the mouse model of autoimmune disease where delayed blister formation in plasminogen - deficient or upa / tpa knockouts was restored by applications of the active form of mmp-9 .
importantly , this rescue of a plasminogen - dependent phenotype was not achieved with the mmp-9 zymogen , strongly implicating plasmin in functional activation of mmp-9 in vivo .
functional overlap between the two matrix - degrading proteolytic systems was definitively demonstrated in the hematopoietic system , where stem cells were shown to require plasmin activity to enter cell cycle and initiate multilineage differentiation since genetic deficiency in plasminogen severely impaired the recovery of the hematopoietic system after chemical ablation .
mechanistically , plasmin activity was linked to the activation of mmp-9 and mmp-9-induced release of kit ligand , the factor that earlier was shown to be obligatory for immobilization of hematopoietic stem / progenitor cells ( hspcs ) from bone marrow in response to myelosuppression .
the specific mechanisms whereby the plasmin fibrinolytic and mmp pathways control each other and cooperatively regulate hematopoiesis , hematopoietic regeneration , and angiogenesis driven by myeloid cells are described in detail in reviews by heissig and coauthors [ 122 , 123 ] .
an important clinical implication of functional activation of mmp-9 by plasmin was recently demonstrated by inhibitory effects of the active - site - directed inhibitor of plasmin , yo-2 , on mmp-9-dependent growth of t - cell lymphoma and recruitment of tumor - promoting myeloid cells to the sites of tumor development .
a broad range of substrates has been indicated by the ability of plasmin to cleave many purified proteins in vitro . however , relatively few studies directly linked de novo generated plasmin activity with proteolysis of extracellular matrix proteins in tissues or direct cleavage of specific proteins in the matrix deposited by cells in culture .
more than 30 years ago , liotta and coauthors demonstrated in vitro that plasmin could degrade several purified basement membrane proteins , including laminin and fibronectin , and also degrade native laminin from the amnion basement membrane .
later , a specific form of laminin , laminin 5 , found in the epithelial basement membrane and deposited in tumor - produced matrix , was shown to be susceptible to tpa - activated plasmin . in turn , binding of tpa and plasminogen to laminin 5 results in a dramatic , 30-fold enhancement of plasminogen activation . in the nervous system
, the positive contribution of laminin-1 proteolysis by plasmin was suggested in a neuritogenesis study , in which plasmin activity generated from the exogenously added plasminogen - enhanced development of neurites and induced laminin-1 cleavage in vitro .
however , the cleavage of the specific laminin form , laminin 1 , by plasmin - mediated proteolysis in the central nervous system in vivo , was shown to cause neuronal degeneration via activation of caspase-3 .
this neuronal degeneration due to laminin degradation was not observed in plasminogen - deficient or tpa - deficient mice and was prevented by the use of a plasmin inhibitor in plasminogen - competent mice , confirming that plasmin was involved in the observed effects in vivo and indicating crucial importance of regulating the generation of plasmin and its activity [ 130132 ] . when subjected to limited proteolytic digestion , fibronectin is cleaved only in specific regions , where the protein is believed to be nonfolded and therefore unprotected from protease attack .
most of fibronectin activities have been ascribed to an insoluble form that exists as part of the ecm , where fibronectin matrix assembly is a tightly regulated cell - mediated process . in fibroblast cultures ,
plasmin - induced degradation of matrix - bound fibronectin was associated with cell apoptosis . despite the fact that fibronectin can be digested in vitro by multiple proteases , including plasmin , the role of proteolytically modified fibronectin in vivo remains underexplored , especially in cancer - related systems . under normal physiological conditions in vivo
, adipocyte differentiation was shown to require plasmin - mediated degradation of the fibronectin - rich preadipocyte stromal matrix as it was abolished in plasminogen - deficient mice .
plasmin cleavage of fibronectin and laminin in vivo was demonstrated in wild - type mice during bone marrow remodeling and recovery of hematopoietic system after 5-fluorouracil treatment .
in contrast , plasminogen knock - out mice manifested substantially larger deposits of fibronectin and higher expression of laminin in bone marrow , indicating that loss of plasmin impaired degradation of these ecm proteins .
this conclusion was supported by immunoblotting analysis , which demonstrated less low - molecular - weight fragments of fibronectin and laminin in bone marrow plasma samples from plasminogen - deficient mice as compared to wild - type counterparts .
however , it was not clarified whether these cleavage products of fibronectin originated from nonsoluble ecm of bone marrow or directly related to soluble plasma fibronectin , one of the most abundant adhesion proteins in the blood . in our cam model of spontaneous metastasis , inhibition of upa - generated plasmin with
the serine protease inhibitor aprotinin resulted in accumulation of fibronectin at the tumor border and within primary tumors , suggesting that fibronectin undergoes plasmin - mediated proteolysis in nontreated control tumors .
since inhibition of plasmin generation or abrogation of plasmin activity was concomitant with significantly diminished tumor cell escape from primary tumors and reduced stromal invasion , we attempted to directly link cellular upa - generated plasmin to plasmin - executed fibronectin proteolysis to enhanced migration of tumor cells on the plasmin - modified fibronectin .
thus , when presented with fibronectin cleaved by plasmin , tumor cells increased their migration by 2.5-fold over the levels induced by nontreated fibronectin .
combined with the demonstration that escape from primary tumors and stromal invasion of active upa - expressing prostate cancer cells were inhibited by function - blocking antibody against 5 integrin , these findings suggested a motility - involving mechanism , whereby tumor cell upa - generated plasmin cleaves tumor - associated fibronectin and enhances 51 integrin - mediated cell motility of tumor cells in vivo .
a negative feedback mechanism for abrogation of plasmin generation was proposed whereby the ecm protein vitronectin was shown to be specifically cleaved by plasmin in vitro , significantly reducing the ability of the cleaved vitronectin to bind pai-1 , thus making pai-1 available to inhibit plasmin - generating upa .
in addition , in vitro cleavage of vitronectin by plasmin can diminish upar - dependent cell adhesion and therefore provide a mechanism for regulation of cell motility .
noteworthy , neither of these early demonstrations of vitronectin cleavage by plasmin was followed up to demonstrate that such cleavage occurs and has a functional importance in vivo .
tenascin c represents another matrix protein that was shown to be cleaved by plasmin in vitro , converting it from a non - adhesive to adhesive substrate for t lymphocytes . in tumors ,
tenascin c is produced by both tumor - associated fibroblasts , cancer cells , and cancer stem - like cells and interacts with various membrane receptors and ecm proteins to promote metastatic colonization .
furthermore , stromal tenascin c was shown to be produced by cells expressing the plasminogen receptor s100a4 , suggesting that these cells can also facilitate plasmin production at the sites of metastatic colonization .
recently , tenascin c has also been found in stem cell niches , where along with other matrix components it supports the survival of breast cancer cells responsible for lung metastases . therefore ,
plasmin - mediated cleavage of tenascin c inducing its adhesive functions may represent a putative proteolytic mechanism for regulation of the biochemical and functional properties of this important matrix protein in stem cell niches .
osteopontin , a secreted non - collagenous , sialic - acid - rich , chemokine - like protein , plays a crucial role in determining the oncogenic potential of various cancers .
osteopontin has been previously shown to be cleaved in vitro by thrombin and mmps , which modulate osteopontin functions and enhance integrin - binding properties in cell function assays [ 144 , 145 ] .
plasmin - mediated cleavage of osteopontin , occurring at multiple sites near integrin - binding motifs , also results in increase of cell adhesion mediated by v3 or 51 integrins .
therefore , plasmin can be a potent regulator of osteopontin functions at the sites of primary tumor development as well as at the secondary sites , for example , in metastatic niches , where osteopontin might be an important constituent .
noteworthy , osteopontin is a key component of hematopoietic niches , where it regulates physical location and proliferation of hematopoietic stem cells .
it might also be noted that plasmin cleavage of osteopontin enchancing integrin - mediated adhesion contrasts plasmin cleavage of fibronectin enhancing integrin - mediated cell migration . in conclusion of this section
, it is worth to mention that the notion that plasmin executes cleavage of a large number of distinct ecm proteins in vivo in live animals appears not to be well substantiated by rigorous experimental evidence .
studies performed in plasminogen - deficient mice or mice lacking upa and/or tpa have provided such evidence thus far for laminin and fibronectin , conclusively demonstrating the biological significance of plasmin in physiological processes critically dependent on limited proteolysis of these ecm molecules .
the recent generation of transgenic mice , expressing two alleles of plasminogen gene with an s743a inactivating mutation in the latent active site , allows for selective elimination of all in vivo proteolytic activity of plasmin while preserving all effects associated with the presence of plasminogen and its binding to plasminogen - receptor - like molecules , making this newly developed plg mouse line especially valuable for cancer progression studies .
the above - reviewed evidence strongly implicates plasmin as an extracellular proteinase that modulates the tumor microenvironment by cleaving proteinaceous substrates , although they often have been suggested by in vitro cleavage products rather than conclusively demonstrated as plasmin - cleaved proteins in vivo within tumor tissues .
however , several studies illuminate another side of plasmin functionality , namely , its ability to cleave specific membrane - anchored receptors and transmembrane proteins and to attenuate or trigger outside - in signaling cascades through distinct signaling partners or through direct activation of signal transduction initiated by the cytoplasmic domain of a membrane - retained cleaved fragment .
four known protease - activated receptors ( pars ) represent a unique class of g - protein - coupled receptors that play critical roles in thrombosis , inflammation , vascular biology and cancer [ 148 , 149 ] . among pars ,
proteolytic cleavage of par1 by thrombin represents the first example of signal transduction through a transmembrane receptor , proteolytically modified by serine proteases .
thrombin - induced activation of par1 involves cleavage of the full - length molecule at the r41-s42 site and release of an amino - terminal fragment , resulting in a reduction of molecular weight of the membrane - retained fragment .
this cleavage generates a new amino terminus that serves as a tethered ligand domain , which binds to the second loop of the cleaved receptor , resulting in the initiation of signal transduction .
thrombin - induced activation of pars and par signaling has been extensively investigated in studies on hemostasis , blood vessel development , and various cancer - related processes [ 148 , 152156 ] .
in contrast to thrombin , plasmin - mediated cleavage of par1 and its putative implications to cell physiology have not been followed up extensively and precise downstream signaling induced by plasmin - cleaved par1 has not been investigated in detail in cancer biology , possibly because plasmin was initially reported to desensitize par1 due to the cleavage within the tethered ligand .
maldi - tof mass spectrometry of fragments generated by plasmin proteolysis of the exodomain of recombinant pars also predicted that plasmin would inactivate par1 .
however , by cleaving par1 at the r41 thrombin cleavage site , plasmin can generate an activated exodomain without desensitization of ca signaling , suggesting that plasmin cleavage of par1 can produce dual , activating and attenuating , effects on par1 signaling .
furthermore , aprotinin has been demonstrated to inhibit par1-specific functions in vitro and also during cardiothoracic surgery , indicating that plasmin might be involved in par1 activation .
consistent with an activating role of plasmin cleavage of par1 , upa - mediated conversion of plasminogen into plasmin and plasmin - mediated cleavage of par1 have been shown to prevent apoptosis induced in monocytic cells by tnf or cycloheximdie
. functional involvement of par1 in mediating antiapoptotic signals was confirmed by the use of specific anti - par1 antibodies .
moreover , apoptosis resistance required the involvement of exogenous plasminogen with an intact protease domain for further proteolytic activity and the presence of unoccupied lysine binding sites within the kringle domains for binding to cell surface plasminogen receptors .
overall , these findings suggest that in specific in vivo locales enriched in active upa , such as the tumor microenvironment , newly generated plasmin activity may regulate cell death through induction of par1 survival signaling during crosstalk between tumor cells and peripheral blood monocytes . depending on tissue environment , par1 activation and par1-induced signaling
can be elicited not only by thrombin or plasmin , but by a member of a different class of proteases .
thus in certain tumor - stromal microenvironments , mmp-1 has been shown to function as a protease agonist of par1 , directly cleaving the receptor and generating par1-dependent cell signaling and migration . moreover
, mmp-1 activity was shown to derive from fibroblasts and not from the breast cancer cells , strengthening the importance of crosstalk and cooperation of host and tumor cells during cancer progression .
since par1 cleavage by thrombin and mmp1 appears to occur at the identical site , namely , between r41 and s42 residues , it is likely that par1 cleavage by any of these proteases would induce identical signaling cascades .
thus , both proteases were shown to induce par1-dependent ca signaling [ 148 , 161 ] . however , signaling by par1-associated partners has not been compared extensively , leaving a possibility that cleavage by thrombin , plasmin or mmp-1 , may induce unique signaling cascades differentially regulating cell functions in a specific , microenvironment - dependent manner . consistent with this notion , mmp-1-mediated cleavage of par1 in breast cancer cells was shown to activate akt survival pathway , attenuation of which by respective inhibitors of mmp-1 activity and par1 signaling resulted in the induction of cell apoptosis and inhibition of lung metastasis .
therefore , it is plausible to link the redundancy in par1 agonists to the possibility that cell locale enriched in proteolytic enzymes belonging to one or another class of proteases would dictate the specific choice of the receptor - activating protease(s ) .
investigations of the mechanisms underlying the impairment of hematopoietic recovery in upa and tpa knock - out mice indicated that , in addition to activation of mmp-9 and induction of mmp-9-mediated release of kit ligand , plasmin can be involved in an additional mechanisms of hsc mobilization .
namely , plasmin was shown to proteolytically cleave and functionally inactivate upar in hspcs , enabling them to detach from bone marrow matrix and egress into the circulation .
being a gpi - anchored molecule , upar signals through other accessory molecules such as 41 integrin but only if upar is intact , and therefore plasmin cleavage can functionally inactivate upar and abrogate upar - mediated signaling .
cleavage of upar , indicated in this study by a reduced binding of antibodies recognizing only intact upar , represents an example of proteolytic modification of a plasma - membrane - associated molecule , modification of which by plasmin does not directly induce downstream signaling cascades . in the central nervous system , plasmin has been shown to cleave n - methyl - d - aspartate ( nmda ) receptors , increasing their functional responses .
the functional nmda receptor is a heterotetramer consisting of two nr1 subunits and two nr2 subunits , which bind specific ligands : the coagonist glycine binds to the nr1 subunit , whereas nr2 subunit binds the neurotransmitter glutamate .
both nr subunits have a modular design , and each subunit has an extracellular module , a complex transmembrane domain , and an extensive cytoplasmic domain .
the nr2 subunit controls the electrophysiological properties of the nmda receptor and is represented by four distinct isoforms , which are expressed differentially in various cell types .
the intracellular c - terminal domains of individual nr2 isoforms can interact with different sets of signaling messengers .
the nmda receptors serve as ca cation channels that can be blocked by several divalent cations , including mg and zn [ 165 , 166 ] . by
proteolytically cleaving the nr2a subunit amino - terminal domain and removing the zn binding site , plasmin was shown to prevent zn - mediated inhibition of nr2a - containing ndma receptors .
plasmin cleavage of full - length 180 kda nr2a subunit occurs at lys , producing a 40 kda n - terminal fragment and leaving a truncated 140 kda transmembrane c - terminal fragment .
noteworthy , plasmin - mediated relief of the zn inhibition via removal of the zn binding site increases responses of nmda receptors in neurons independently of a plasmin activation of par1 . since nmda receptors have cytoplasmic domains , harboring residues that can be modified by protein kinases and phosphatases , as well as residues that can interact with various structural , adaptor , and scaffolding proteins , it is possible that plasmin - activated nmda receptor could induce antiapoptotic pathways to play a critical role in regulation of neuronal cell death .
recently , we have presented direct evidence that plasmin cleavage of a single - pass transmembrane molecule can trigger its functional activation through the phosphorylation signaling initiated at the cytoplasmic domain of the membrane - retained fragment .
specifically , we have demonstrated that plasmin executes in vivo cleavage of a cancer - related molecule , cub domain - containing protein 1 ( cdcp1 ) , and showed that cdcp1 cleavage leads to outside - in signaling involving activation of akt and suppression of parp1-induced cell apoptosis . this signaling cascade ultimately regulates the survival potential of tumor cells in the late stages of the metastatic cascade , namely , during extravasation and early tissue colonization .
cdcp1 is a transmembrane glycoprotein highly expressed in a number of malignancies , including cancer of colon , breast , prostate , stomach , lung , kidney , pancreas , and skin [ 167171 ] , making cdcp1 an attractive prognostic marker and putative therapeutic target .
functional importance of cdcp1 in cancer is supported by experimental findings demonstrating that cdcp1-positive tumor cells have advantage in metastasis xenograft model systems of lung and gastric cancers [ 172 , 173 ] .
our unpublished findings in mouse models of human prostate cancer also indicate that high levels of cdcp1 in prostate carcinoma pc - hi / diss cells positively correlate with high levels of secondary organ colonization compared to the cell counterparts where expression of cdcp1 was reduced by rna interference .
confirming the notion that cdcp1 is a prometastatic molecule , de novo expression of cdcp1 in hela and hek cell lines , both completely devoid of cdcp1 , dramatically increased their potential to colonize internal organs of immunodeficient mice and chick embryos [ 52 , 174 ] .
furthermore , our specific anti - cdcp1 mabs , uniquely generated by a process of subtractive immunization , significantly reduced colonization and spontaneous dissemination of prostate carcinoma pc - hi / diss cells naturally expressing cdcp1 in the chick embryo metastasis models .
the full - length cdcp1 is 135 kda molecule containing the extracellular n - terminus with 3 cub domains , the single - pass transmembrane domain , and the c - terminal domain with several tyrosine residues .
phosphorylation of c - terminal tyrosines by src family kinases was shown to lead to docking of pkc and its src - dependent phosphorylation .
this pkc signal transduction facilitates anoikis resistance of human tumor cells , indicating that cdcp1 can act as an important cell surface signal transducer and regulator of multiple cell functions . in search of the triggers of such outside - in signal transduction
, we explored the possibility whether cleavage of the cdcp1 molecule , previously demonstrated in cell cultures in vitro , would be responsible for initiation of cdcp1 phosphorylation and downstream signaling cascades in vivo .
however , several serine proteases , including trypsin , plasmin , and matriptase , can cleave cdcp1 at r368 and k369 , generating the 70 kda membrane - retained fragment [ 52 , 177 ] . in vitro studies confirmed that cdcp1 cleavage was associated with phosphorylation of the 70 kda fragment and src and pkc recruitment specifically to the cleaved cdcp1 fragment .
we further demonstrated that both cleavage by serine proteases and cleavage - induced phosphorylation of cleaved cdcp1 can be completely blocked by the serine protease inhibitor aprotinin or by genetic mutation of the cleavage site .
moreover , we confirmed that our function - blocking anti - cdcp1 mabs completely prevent proteolytic cleavage of cdcp1 , suggesting the in vivo mechanism for previously demonstrated inhibitory effects of these antibodies in metastasis . in agreement with our expectations ,
anti - cdcp1 mabs completely inhibited cdcp1 cleavage in vivo , concomitant with significant inhibition of experimental and spontaneous metastasis of pc - hi / diss cells .
the availability of our high - affinity anti - cdcp1 mabs allowed us to analyze for the first - time signal transduction elicited in vivo by cdcp1 cleavage and establish a signaling cascade required for high levels of tumor cell dissemination .
this cascade operating in vivo during tumor cell extravasation from the vasculature involves sequential docking of src , src - mediated phosphorylation of cdcp1 fragment at tyr734 and docking of pkc phosphorylated in phosphosrc / phosphocdcp1-dependent manner . by using the inhibitor of src activation , dasatinib
, we also clarified that both active and nonactive src can bind to the cleaved cdcp1 , but phosphorylation of cdcp1 occurs only if the docked src has kinase activity .
specific processing of cell surface cdcp1 by an extracellular serine protease is a prerequisite for cdcp1-induced signaling in vivo and cdcp1-mediated survival of cancer cells during metastasis .
the in vivo cleavage of cdcp1 triggers src / pkc signal transduction , involving downstream activation of akt and suppression of caspase - induced parp1 activation .
this multistep signaling cascade ultimately increases tumor cell survival and sustain high levels of tumor colonization . preventing the in vivo cleavage of cdcp1 with unique anti - cdcp1 antibodies , serine protease inhibitors or genetic modulation of the cleavage site in the cdcp1 molecule completely abrogated survival signaling and induced parp1-mediated apoptosis , resulting in a substantial inhibition of metastatic colonization .
finally , by using our lung retention model ( figure 1 ) , we demonstrated complete lack of cdcp1 cleavage in plasminogen knock - out mice , therefore for the first time identifying plasmin as the major serine protease responsible for cleavage of cdcp1 in a live animal .
this lack of cdcp1 cleavage in plasminogen - deficient mice was accompanied by reduction in tumor cell survival , which , importantly , could be both rescued by in vivo supplied purified plasmin or plasminogen ( figure 2(b ) ) , confirming that plasmin is the crucial serine protease executing cleavage of cdcp1 in vivo . moreover , in this tumor cell in vivo setting , we confirmed de novo generation of plasmin activity in wild - type mice and lack thereof in plasminogen knock - out recipients unless they were rescued by exogenous plasmin or plasminogen ( figure 2(a ) ) .
our most recent observations suggest additional mechanisms underscoring the critical role for plasmin - cleaved cdcp1 during spontaneous metastasis .
specifically , we have just shown that plasmin - cleaved cdcp1 engages 1 integrin , resulting in formation of stable complexes which trigger fak phosphorylation and induce downstream pi3k - akt signaling .
this complexing of 1 integrin with the cleaved cdcp1 , followed by phosphorylation - dependent signal transduction , provides a novel mechanism for increased tumor cell motility which is required for cell escape from the primary tumor , invasion of local stroma , and intravasation into tumor - associated vasculature , all processes regulated in part by plasmin - executed cleavage of a transmembrane protein residing at the apex of an outside - in signaling cascade .
figure 3 summarizes our findings and shows how different components of the upa / plasmin system , provided either by a tumor cell or a host cell , can contribute to the generation of plasmin , cleavage of tumor cell cdcp1 , and signal transduction by the cleaved cdcp1 fragment complexed with 1 integrin .
the cell surface of tumor cells expressing upar , upar - bound pro - upa , and full - length 135-kda cdcp1 is depicted on the left .
the plasma membrane of host cells represented by vascular cells ( endothelium ) and inflammatory cells ( monocytes / macrophages ) is depicted on the right .
although host cells can express upar and pro - upa and various plasminogen - binding molecules , only the transmembrane plasminogen receptor plg - rkt and plg - rkt - bound plasminogen ( plg ) and plasmin are depicted for clarity of the scheme .
briefly , we propose that tumor cell pro - upa bound to upar is initially activated by trace plasmin , either in solution or bound to one of the plasminogen receptors .
the upar - associated active upa then proteolytically activates plasminogen that is bound to plg - rkt ( or other plasminogen - binding molecules ) .
alternatively , plasminogen can be activated by tpa . upon activation , receptor - bound plasmin , protected from natural plasmin inhibitors , can cleave transmembrane 135-kda cdcp1 on the surface of tumor cells and generate plasma membrane - retained 70-kda fragment and shed 65-kda fragment .
plasmin can also be released from plasminogen receptor into pericellular milieu and cleave cdcp1 as a soluble enzyme .
if the src kinase is functionally active , it phosphorylates c - terminal tyrosine residues of cleaved cdcp1 , initiating signal transduction and complex formation with 1 integrin .
this signaling cascade involves docking of pkc to phosphorylated cleaved cdcp1 and fak to cdcp1-bound 1 integrin .
both pkc and fak become phosphorylated and functionally active , leading to activation of pi3k and pi3k - mediated activation of akt .
ultimately , akt - mediated phosphorylation signaling regulates tumor cell survival , via suppression of parp1 cleavage and parp1-induced apoptosis , and induces cell motility , via integrin clustering and activation of fak .
while enhanced integrin - mediated cell motility allows tumor cells to escape from the primary tumor , invade the adjacent stroma , and intravasate into the host vasculature , suppressed apoptosis allows tumor cells to survive during circulation and vascular arrest and efficiently extravasate and colonize secondary tissues to establish metastatic foci .
our findings indicate that in vivo blocking of cdcp1 cleavage upstream of cdcp1-induced prosurvival signaling provides a potential mechanism for therapeutic intervention into metastatic disease .
discovery of additional plasma membrane proteins , cleavage of which by plasmin would induce signal transduction that might regulate tumor cell fate , constitutes an exciting area of future cancer research .
in a cell - free in vitro system , plasmin and also thrombin were shown to shed the ectodomain of syndecan-4 .
syndecans are single transmembrane domain proteins that through their glycosaminoglycan chains can interact with a wide array of ligands regulating many vital functions of normal and cancerous cells .
syndecan ligands include growth factors such as fgf-2 , vegf , tgf- , and also ecm molecules such as fibronectin and tenascin c. this combination of ligand diversity and the possibility that serine proteases could be involved in the shedding of syndecans ectodomains makes it tempting to speculate that plasmin - mediated cleavage of syndecans might modulate such cell functions as adherence to the ecm or recognition of specific matrix components . however , in contrast to clear activation - inducing effects of plasmin cleavage demonstrated for cdcp1 , it is possible that plasmin - mediated shedding of syndecans in vivo would attenuate syndecan functions due to truncation of their extracellular domains and inhibition of intracellular signaling
. therefore , syndecans , including syndecans-4 , may represent novel transmembrane targets , proteolytic modification of which by plasmin might induce a negative feed back mechanism .
another putative transmembrane substrate of plasmin has been suggested by the study of the mechanisms involved in streptococcus pneumoniae spreading , which demonstrated that aprotinin - sensitive plasmin activity was responsible for disruption of endothelial monolayers .
endothelial transmigration in vitro was facilitated by precoating of bacterial cells with plasminogen , allowing for efficient generation of plasmin , likely through the streptococcal streptokinase , a potent bacterial plasminogen activator .
the authors showed that in vitro plasmin effectively cleaved recombinant ve - cadherin , the main component of endothelial adherens complexes , and proposed that endothelial monolayers in their model system were disrupted through plasmin - mediated cleavage of intercellular junctions .
this finding points to ve - cadherin as a putative transmembrane molecule , the function of which could be regulated by de novo generated plasmin at the sites of tumor cell - host vasculature interactions . finally , the study of fibrinolysis - independent role of plasmin during recovery of hematopoiesis after chemical ablation with 5-fluorouracil indicated that plasmin may have yet another plasma membrane - bound target , namely , vascular adhesion molecule 1 , vcam-1 . the hematopoietic recovery in wild - type mice is accompanied by transient increase of soluble vcam in the bone marrow plasma .
however , such an increase did not occur in plasminogen - deficient mice , implicating plasmin in vcam shedding . supporting this mechanism ,
direct treatment of a vcam-1-positive murine stromal cell line with purified plasmin in vitro increased the levels of soluble vcam-1 accumulated in the conditioned medium . vcam-1 ( cd106 ) is a type i transmembrane protein which serves as an adhesion molecule , namely , as an endothelial cell ligand for 41 or 47 integrins expressed on various blood leukocytes .
vcam-1 has been implicated in signal transduction elicited by crosstalk between endothelial cells and leukocytes , making plasmin cleavage of this molecule and its putative plasmin - induced signal transduction an attractive aim for further investigations of tumor cell functions under specific physiological conditions , which facilitate de novo generation of plasmin activity , for example , during extravasation of tumor cells from the capillary bed of secondary organs .
plasmin - mediated proteolytic modification of cell surface molecules , causing their functional activation , points to an aspect of plasmin functionality that has been overlooked or underappreciated by mainstream cancer research but likely deserves more attention and consideration . the latter becomes especially important in view of a preconceived notion that therapeutic inhibition of the proteolytic activity of plasmin , including plasmin - induced activation of certain prometastatic mmps , could be an efficient means to control metastatic spread in cancer patients undergoing surgical removal of solid tumors .
however , the broad use of antiplasmin inhibitors , resulting in the inhibition of plasmin - mediated fibrinolysis , can actually increase formation of microthrombi and therefore inadvertently facilitate thrombi - dependent survival of tumor cells . in agreement with this scenario , the size of thrombi and levels of lung colonization
were significantly increased in an experimental metastasis model when melanoma cells were inoculated into mice treated with aprotinin .
furthermore , aprotinin treatment significantly increased spontaneous metastasis to the lung from primary tumors generated by subcutaneously implanted lewis lung carcinoma cells .
the effects of genetic deficiency in plasminogen also indicate that fibrinolytic defects could constitute the main side effects caused by a lack of plasmin activity in mice .
these experimental studies and also clinical reports about termination of aprotinin trials for patients with lung , esophageal , or breast cancer ( see nct00306137 and nct00354900 at http://clinicaltrials.gov ) , all , caution against indiscriminate targeting of plasmin - like serine proteases for cancer therapy . for a long time , targeting those components of the pa system , which are responsible for activation of plasminogen or pro - upa or inhibition of upa activity , were considered as more promising strategies for anticancer therapy than direct inhibition of plasmin - mediated proteolysis . an emerging opinion , however , is that little progress has been made in translating the findings from test tubes , cell cultures , and even animal models into effective therapeutic approaches in patients , resulting in a paucity of clinical trials evaluating modulators of the upa system [ 7 , 16 ] . instead
, the inhibition of proteolysis mediated by upa - activated plasmin could be focused on preventing proteolytic modifications of specific transmembrane or cell - membrane - associated proteins , cleavage of which triggers cancer - promoting signaling in tumor and/or host cells .
such proteolysis - induced signaling can be blocked at the apex of corresponding signal transduction cascades by functionally targeting cleavable molecules , rather than by inhibiting overall activity of cleavage - executing enzymes . in this regard , we have demonstrated that ligation of cdcp1 with specific cleavage - blocking antibodies completely abrogates critical cleavage - dependent signaling , which would otherwise enhance 1 integrin - mediated motility , increase tumor cell escape , invasion , and intravasation at the primary tumor site , and help to resist apoptosis and improve survival of successfully intravasated tumor cells [ 52 , 174 ] .
furthermore , targeting the cleavage - activating step of cell surface - bound pro - upa with a specific activation - preventing mab , mab-112 , was shown by us to effectively decrease metastasis of prostate carcinoma cells in several independent models [ 28 , 185187 ] .
implemented together , specifically tailored antimetastatic tools targeting distinct transmembrane and plasma membrane - associated molecules , which are activated by limited plasmin cleavage , for example , cdcp1 or pro - upa [ 28 , 185 , 187 ] , can dramatically impede cancer cells from accomplishing different steps of the metastatic cascade and ultimately reduce spontaneous dissemination and tissue colonization .
finally , plasmin - cleaved portions of transmembrane molecules could also serve as biomarkers of a pathological process .
thus , just as biochemical detection of a plasmin - cleaved amino - terminal domain of the nmda receptor can indicate an injury of the central nervous system , the detection of the plasmin - cleaved 65 kda fragment of cdcp1 may indicate ongoing dissemination of cancer cells . | plasmin , one of the most potent and reactive serine proteases , is involved in various physiological processes , including embryo development , thrombolysis , wound healing and cancer progression .
the proteolytic activity of plasmin is tightly regulated through activation of its precursor , plasminogen , only at specific times and in defined locales as well as through inhibition of active plasmin by its abundant natural inhibitors . by exploiting the plasminogen activating system and overexpressing distinct components of the plasminogen activation cascade , such as pro - upa , upar and plasminogen receptors
, malignant cells can enhance the generation of plasmin which in turn , modifies the tumor microenvironment to sustain cancer progression . while plasmin - mediated degradation and modification of extracellular matrix proteins , release of growth factors and cytokines from the stroma as well as activation of several matrix metalloproteinase zymogens , all have been a focus of cancer research studies for decades , the ability of plasmin to cleave transmembrane molecules and thereby to generate functionally important cleaved products which induce outside - in signal transduction , has just begun to receive sufficient attention .
herein , we highlight this relatively understudied , but important function of the plasmin enzyme as it is generated de novo at the interface between cross - talking cancer and host cells . |
the study of normal brain ageing , neurodegenerative conditions , and age - related cognitive decline is of increasing interest as populations age .
magnetic resonance imaging is proving to be a powerful tool for the evaluation of structural and functional changes [ 1 , 2 ] .
additionally , magnetic resonance spectroscopy ( mrs ) can provide information on brain metabolites such as n - acetyl aspartate ( naa ) , choline , creatine , and glutamate .
since metabolites are related to cellular function , it is understandable that brain metabolites have been studied for their associations with cognitive function .
although brain metabolite levels have been measured in modest groups of young healthy subjects , there is relatively little literature concerning older adults . as early as 1993 , christiansen et al .
measured metabolite levels and relaxation times in healthy young adults ( n = 8 ; age 2030 ) compared with healthy elderly adults ( n = 8 ; age 6080 ) .
they found a 15 % decline in occipital naa in the older group compared with the younger group . in a recent meta - analysis of the available literature ,
haga et al . reported reduced naa and raised choline and creatine in healthy older subjects ( > 60 years ) relative to healthy younger subjects ( < 60 years ) .
previously , we used a single - voxel mrs technique and found an association between raised creatine and a decline in cognitive ability .
reported a decreased naa / creatine ratio in people with mild cognitive impairment and alzheimer 's disease relative to cognitively normal , age - matched controls . magnetic resonance spectroscopic imaging ( mrsi )
enables measurement of multiple voxels in a slice across the brain and thereby opens up the possibility of producing maps of metabolite distribution .
the objective of the current study was to establish brain metabolite levels in healthy older adults within a narrow age range .
forty participants ( 25 female ) were recruited from healthy , community - living people comprising the lothian birth cohort 1936 ( lbc 1936 [ 7 , 8 ] ) .
all participants were aged 73 or 74 at the time of mri scanning and formed a sub group of approximately 650 volunteers who were part of a longitudinal study on cognitive ageing and for whom recent detailed structural imaging and cognitive scores were available .
an experienced observer determined brain atrophy , iron , and white matter ( wm ) lesion scores from the structural images .
the study was approved by the local research ethics committee and all participants gave informed written consent . in order to avoid any possible confounding effects from diurnal variation , all scans were performed at the same time of day ( between 11 a.m. and 1 p.m. ) . all imaging was performed on a 1.5 t clinical research scanner ( hdxt , ge healthcare , uk ) .
the imaging protocol for this spectroscopy study used a standard quadrature head coil and included localiser , coronal t1-weighted ( t1w : 3d - ir - prep - fast - gre ) , and axial t2-weighted ( t2w : fse ) scans in addition to an mrsi scan for brain metabolite measurements .
key acquisition parameters for the t1w scans were 3d inversion recovery - prepared , ti / tr / te = 500/10/4 ms , flip angle 8 , matrix 192 192 , fov 256 mm slices of 1.3 mm thickness ( 156 slices total ) .
parameters for the t2w scans were tr / te = 4,000/102 ms , matrix 256 256 , fov 240 mm , slices of 5 mm thickness ( 28 slices total ) , and 2 signal averages .
the t2w images were used to plan a 10 mm thick axial mrsi slice at a level that included the basal ganglia .
press excitation was used with a volume of interest ( voi ) selected to cover the brain laterally and extend forward from the posterior edge of the brain , avoiding the frontal sinuses and orbits ( fig . 1 ) .
24 24 phase - encoding steps were applied over a field of view of 240 mm .
for each phase encode , 512 complex data points were acquired with a sampling interval of 1 ms .
manufacturer - provided ( first order ) automatic shimming was employed to reduce the b0 magnetic field inhomogeneity prior to the mrsi acquisitions .
water suppression used the default chess technique with three selective rf pulses . outer volume suppression
employed pre - saturation slabs parallel to the faces of the voi and an additional four slabs positioned around the edges of the brain to suppress lipid artifacts from the scalp ( fig . 1 ) .
1sagittal and axial localiser scan showing placement of press mrsi slab and additional saturation bands ( hatched ) to minimise lipid contamination sagittal and axial localiser scan showing placement of press mrsi slab and additional saturation bands ( hatched ) to minimise lipid contamination mrsi data were processed offline as described previously .
briefly , a two - dimensional spatial fourier transform with cosine - weighted apodisation was applied to the raw spectroscopic data , followed by zero - order phase and eddy - current correction on a voxel - by - voxel basis using the residual water signals , bringing water to a fixed nominal chemical shift of 4.70 ppm .
the residual water component was removed from each signal using the hankel lanczos singular value decomposition technique and the resulting signals quantified using the amares algorithm within the mrui package ( www.mrui.uab.es ) . a model consisting of three in - phase gaussian components ( corresponding to the major metabolite peaks of choline , creatine , and naa ) and two inverted components ( corresponding to lactate ) was used .
spectra were automatically discarded if fitted line widths were < 1 hz or > 10 hz ; if the metabolite peaks were more than 0.1 ppm offset from their nominal values ; or if the voxels lay on the edges of the press excitation region .
all spectra were also inspected visually and discarded if judged to be of poor quality , for example having a badly elevated baseline or containing spurious peaks .
spectral peak areas were corrected for relaxation effects using literature values for t1 and t2 in basal ganglia in elderly subjects and normalised according to the number of contributing protons .
the resulting institutional units are directly related to molecular concentrations and enable comparison between studies .
tissue segmentation maps for grey matter ( gm ) , wm , cerebrospinal fluid ( csf ) , and background
( bgnd ) were computed from the t1-weighted images using the fsl - fast algorithm ( http://www.fmrib.ox.ac.uk ) .
previously available t2 * ( gradient - echo ) images were first registered with the t1w and t2w images and used to create brain masks .
for each spectroscopic voxel , the percentage of gm , wm , csf , and bgnd content was calculated based on three contiguous slices to match the extent of the mrsi acquisition .
spectroscopy voxels containing more than 20 % csf or 5 % bgnd were rejected .
anova ( matlab ) and linear mixed effects ( pasw statistics ) analyses were carried out on metabolite levels , with ( % wm%gm ) as a variable and " subject " as a random factor .
subject - by - subject associations between metabolite levels and structural and cognitive scores were explored .
forty participants ( 25 female ) were recruited from healthy , community - living people comprising the lothian birth cohort 1936 ( lbc 1936 [ 7 , 8 ] ) .
all participants were aged 73 or 74 at the time of mri scanning and formed a sub group of approximately 650 volunteers who were part of a longitudinal study on cognitive ageing and for whom recent detailed structural imaging and cognitive scores were available .
an experienced observer determined brain atrophy , iron , and white matter ( wm ) lesion scores from the structural images .
the study was approved by the local research ethics committee and all participants gave informed written consent . in order to avoid any possible confounding effects from diurnal variation , all scans were performed at the same time of day ( between 11 a.m. and 1 p.m. ) .
all imaging was performed on a 1.5 t clinical research scanner ( hdxt , ge healthcare , uk ) .
the imaging protocol for this spectroscopy study used a standard quadrature head coil and included localiser , coronal t1-weighted ( t1w : 3d - ir - prep - fast - gre ) , and axial t2-weighted ( t2w : fse ) scans in addition to an mrsi scan for brain metabolite measurements .
key acquisition parameters for the t1w scans were 3d inversion recovery - prepared , ti / tr / te = 500/10/4 ms , flip angle 8 , matrix 192 192 , fov 256 mm slices of 1.3 mm thickness ( 156 slices total ) .
parameters for the t2w scans were tr / te = 4,000/102 ms , matrix 256 256 , fov 240 mm , slices of 5 mm thickness ( 28 slices total ) , and 2 signal averages .
the t2w images were used to plan a 10 mm thick axial mrsi slice at a level that included the basal ganglia .
press excitation was used with a volume of interest ( voi ) selected to cover the brain laterally and extend forward from the posterior edge of the brain , avoiding the frontal sinuses and orbits ( fig . 1 ) .
24 24 phase - encoding steps were applied over a field of view of 240 mm .
for each phase encode , 512 complex data points were acquired with a sampling interval of 1 ms .
manufacturer - provided ( first order ) automatic shimming was employed to reduce the b0 magnetic field inhomogeneity prior to the mrsi acquisitions .
outer volume suppression employed pre - saturation slabs parallel to the faces of the voi and an additional four slabs positioned around the edges of the brain to suppress lipid artifacts from the scalp ( fig . 1 ) .
1sagittal and axial localiser scan showing placement of press mrsi slab and additional saturation bands ( hatched ) to minimise lipid contamination sagittal and axial localiser scan showing placement of press mrsi slab and additional saturation bands ( hatched ) to minimise lipid contamination
briefly , a two - dimensional spatial fourier transform with cosine - weighted apodisation was applied to the raw spectroscopic data , followed by zero - order phase and eddy - current correction on a voxel - by - voxel basis using the residual water signals , bringing water to a fixed nominal chemical shift of 4.70 ppm .
the residual water component was removed from each signal using the hankel lanczos singular value decomposition technique and the resulting signals quantified using the amares algorithm within the mrui package ( www.mrui.uab.es ) . a model consisting of three in - phase gaussian components ( corresponding to the major metabolite peaks of choline , creatine , and naa ) and two inverted components ( corresponding to lactate ) was used .
spectra were automatically discarded if fitted line widths were < 1 hz or > 10 hz ; if the metabolite peaks were more than 0.1 ppm offset from their nominal values ; or if the voxels lay on the edges of the press excitation region .
all spectra were also inspected visually and discarded if judged to be of poor quality , for example having a badly elevated baseline or containing spurious peaks .
spectral peak areas were corrected for relaxation effects using literature values for t1 and t2 in basal ganglia in elderly subjects and normalised according to the number of contributing protons .
the resulting institutional units are directly related to molecular concentrations and enable comparison between studies .
tissue segmentation maps for grey matter ( gm ) , wm , cerebrospinal fluid ( csf ) , and background
( bgnd ) were computed from the t1-weighted images using the fsl - fast algorithm ( http://www.fmrib.ox.ac.uk ) .
previously available t2 * ( gradient - echo ) images were first registered with the t1w and t2w images and used to create brain masks .
for each spectroscopic voxel , the percentage of gm , wm , csf , and bgnd content was calculated based on three contiguous slices to match the extent of the mrsi acquisition .
spectroscopy voxels containing more than 20 % csf or 5 % bgnd were rejected .
anova ( matlab ) and linear mixed effects ( pasw statistics ) analyses were carried out on metabolite levels , with ( % wm%gm ) as a variable and " subject " as a random factor .
subject - by - subject associations between metabolite levels and structural and cognitive scores were explored .
three participants who had fewer than five spectroscopic voxels valid for naa , choline , or creatine were excluded from the subject - by - subject analysis . of the combined total of 6,476 voxels contained within the mrsi press excitation regions ( fig . 1 ) , 1,432 survived the spectral tests for naa , and only 703 survived when including choline and creatine .
these 703 voxels were included in the full anova analyses reported in table 1 .
there was a significant negative correlation between the percentage of valid voxels and the mean naa line width ( of retained voxels ) for each subject ( r = 0.44 , p = 0.005 ) .
the main metabolite findings are that creatine levels were significantly higher in gm than wm , whereas choline and naa levels were significantly higher in wm than gm . choline and creatine levels were highly correlated ( r = 0.55 , p < 0.001 ) , whilst creatine and naa showed a weak negative correlation ( r = 0.32 , p = 0.05 ) .
naa / cre and cho / cre metabolite ratios were significantly greater in wm than gm .
the naa / cho ratio was greater in gm than wm , although this difference did not quite reach significance ( p = 0.06).table 1metabolite levels [ in institutional units ( iu ) : see text ] and metabolite ratios from anova analysis of spectroscopic voxels in 40 subjectswmgm
p ( gm vs wm)metabolites ( iu ) naa76700.03 choline1310<0.001 creatine4557<0.001metabolite ratios naa / cho8.29.80.06 naa / cre2.11.4<0.001 cho / cre0.320.16<0.001spectral peak area ratios naa / cho2.42.80.06 naa / cre2.41.6<0.001
cho / cre1.30.7<0.001ratios of spectral peak areas are also given for comparison with other studies .
only voxels passing all spectral quality tests ( see figs . 2 , 3 and text ) are included
wm white matter , gm grey matterfig .
below is shown the grid of spectra contained completely within the press box , colour coded according to : pale grey ,
background ( bgnd ) , where brain comprises < 95 % of the voxel volume ; grey , csf more than 20 % ; red , fitting of naa peak failed ; blue , failed visual quality test ; green , failed choline and/or creatine fitting but valid for naa ; black , passed all tests .
tests were applied in the order described . for further details , refer to text .
40 subjects had a potential 6,476 voxels , of which 1,432 were valid for naa after spectral quality tests had been applied .
reasons for exclusion were : background more than 5 % of voxel volume ( bgnd ) ; csf more than 20 % ( csf ) ; fitting of naa peak failed ( naa ) ; failed visual quality test ( vis ) ; failed choline and/or creatine fitting ( chocre ) , but valid for naa .
tests were applied in the order described , and the number of additional voxels failing each test is given in the figure metabolite levels [ in institutional units ( iu ) : see text ] and metabolite ratios from anova analysis of spectroscopic voxels in 40 subjects ratios of spectral peak areas are also given for comparison with other studies .
only voxels passing all spectral quality tests ( see figs . 2 , 3 and text ) are included
wm white matter , gm grey matter mrsi grid superimposed on corresponding t2-weighted image . the press excitation box is outlined in red .
below is shown the grid of spectra contained completely within the press box , colour coded according to : pale grey ,
background ( bgnd ) , where brain comprises < 95 % of the voxel volume ; grey , csf more than 20 % ; red , fitting of naa peak failed ; blue , failed visual quality test ; green , failed choline and/or creatine fitting but valid for naa ; black , passed all tests .
the spectral range displayed is from 4 to 1 ppm exclusion of spectroscopic voxels for the cohort .
40 subjects had a potential 6,476 voxels , of which 1,432 were valid for naa after spectral quality tests had been applied .
reasons for exclusion were : background more than 5 % of voxel volume ( bgnd ) ; csf more than 20 % ( csf ) ; fitting of naa peak failed ( naa ) ; failed visual quality test ( vis ) ; failed choline and/or creatine fitting ( chocre ) , but valid for naa .
tests were applied in the order described , and the number of additional voxels failing each test is given in the figure there was a trend for choline levels to be associated with wm lesion scores ( r = 0.24 , p = 0.1 ) .
creatine levels were correlated with fluid intelligence ( r = 0.33 , p = 0.05 ) , and naa showed a trend towards association with memory scores ( r = 0.27 , p = 0.1 ) .
of the combined total of 6,476 voxels contained within the mrsi press excitation regions ( fig . 1 ) , 1,432 survived the spectral tests for naa , and only 703 survived when including choline and creatine .
these 703 voxels were included in the full anova analyses reported in table 1 .
there was a significant negative correlation between the percentage of valid voxels and the mean naa line width ( of retained voxels ) for each subject ( r = 0.44 , p = 0.005 ) .
the main metabolite findings are that creatine levels were significantly higher in gm than wm , whereas choline and naa levels were significantly higher in wm than gm .
choline and creatine levels were highly correlated ( r = 0.55 , p < 0.001 ) , whilst creatine and naa showed a weak negative correlation ( r = 0.32 , p = 0.05 ) .
naa / cre and cho / cre metabolite ratios were significantly greater in wm than gm .
the naa / cho ratio was greater in gm than wm , although this difference did not quite reach significance ( p = 0.06).table 1metabolite levels [ in institutional units ( iu ) : see text ] and metabolite ratios from anova analysis of spectroscopic voxels in 40 subjectswmgm
p ( gm vs wm)metabolites ( iu ) naa76700.03 choline1310<0.001 creatine4557<0.001metabolite ratios naa / cho8.29.80.06 naa / cre2.11.4<0.001 cho / cre0.320.16<0.001spectral peak area ratios naa / cho2.42.80.06 naa / cre2.41.6<0.001 cho / cre1.30.7<0.001ratios of spectral peak areas are also given for comparison with other studies .
only voxels passing all spectral quality tests ( see figs . 2 , 3 and text ) are included
wm white matter , gm grey matterfig .
below is shown the grid of spectra contained completely within the press box , colour coded according to : pale grey ,
background ( bgnd ) , where brain comprises < 95 % of the voxel volume ; grey , csf more than 20 % ; red , fitting of naa peak failed ; blue , failed visual quality test ; green , failed choline and/or creatine fitting but valid for naa ; black , passed all tests .
40 subjects had a potential 6,476 voxels , of which 1,432 were valid for naa after spectral quality tests had been applied .
reasons for exclusion were : background more than 5 % of voxel volume ( bgnd ) ; csf more than 20 % ( csf ) ; fitting of naa peak failed ( naa ) ; failed visual quality test ( vis ) ; failed choline and/or creatine fitting ( chocre ) , but valid for naa .
tests were applied in the order described , and the number of additional voxels failing each test is given in the figure metabolite levels [ in institutional units ( iu ) : see text ] and metabolite ratios from anova analysis of spectroscopic voxels in 40 subjects ratios of spectral peak areas are also given for comparison with other studies .
only voxels passing all spectral quality tests ( see figs . 2 , 3 and text ) are included
wm white matter , gm grey matter mrsi grid superimposed on corresponding t2-weighted image . the press excitation box is outlined in red .
below is shown the grid of spectra contained completely within the press box , colour coded according to : pale grey ,
background ( bgnd ) , where brain comprises < 95 % of the voxel volume ; grey , csf more than 20 % ; red , fitting of naa peak failed ; blue , failed visual quality test ; green , failed choline and/or creatine fitting but valid for naa ; black , passed all tests .
the spectral range displayed is from 4 to 1 ppm exclusion of spectroscopic voxels for the cohort .
40 subjects had a potential 6,476 voxels , of which 1,432 were valid for naa after spectral quality tests had been applied .
reasons for exclusion were : background more than 5 % of voxel volume ( bgnd ) ; csf more than 20 % ( csf ) ; fitting of naa peak failed ( naa ) ; failed visual quality test ( vis ) ; failed choline and/or creatine fitting ( chocre ) , but valid for naa .
tests were applied in the order described , and the number of additional voxels failing each test is given in the figure
there was a trend for choline levels to be associated with wm lesion scores ( r = 0.24 , p = 0.1 ) .
creatine levels were correlated with fluid intelligence ( r = 0.33 , p = 0.05 ) , and naa showed a trend towards association with memory scores ( r = 0.27 , p = 0.1 ) .
in this study we used mrsi to measure brain metabolite levels in healthy elderly subjects .
we looked for evidence of tissue type differences and for associations with structural and cognitive scores .
the narrow age range of the lothian birth cohort 1936 removes age as a potential confounding factor , although it does preclude looking for age - related effects in a single study such as this .
our finding of higher creatine levels in gm than wm is in agreement with previous literature reports , although the magnitude of the difference varies greatly , being 27 % in the present study , 11 % in schuff et al .
, 30 % in hetherington et al . , 40 % in tal et al . , and as much as 70 % in mclean et al . .
our finding of lower naa levels in gm than in wm ( 70 vs. 76 iu ) is consistent with some previous reports [ 15 , 16 ] but different from others .
for example , tal et al . averaged metabolite values over a large centrally placed volume of brain and found that naa was 11 % higher in gm than wm .
we found choline levels lower in gm than wm , consistent with previous reports [ 16 , 18 ] , although others have reported no significant difference [ 15 , 17 ] .
christiansen et al . found no difference in metabolite levels between basal ganglia and the occipital , temporal , and frontal regions in healthy elderly subjects .
however , they used large ( 8 ml ) volumes of interest containing unspecified proportions of gm and wm .
the reasons for the discrepancies in metabolite findings between various studies are unclear but will include exact details of the positioning , acquisition method and quantification , and possible ( unknown ) differences in metabolite t1 and t2 values between gm and wm . we used literature values for t1 and t2 correction and also normalised the results by the number of protons contributing to the spectral peaks ( 3 for naa and creatine , 9 for choline ) .
the final results in institutional units are therefore closely related to molecular concentrations . other researchers , including for example , have reported ratios of spectral peak areas under experimental conditions , and we have included these ratios in table 1 to enable comparisons with other studies .
we did not explore regional variations because of the relatively low number of valid voxels in particular regions , especially the frontal and cortical regions . the chemical shift displacement between choline and naa amounted to approximately 0.5 mm through - plane ( i.e. 5 % of the slab thickness ) , 4
mm anterior - posterior , and 6 mm left right . since we excluded voxels around the edge of the excitation volume
we found a positive correlation between creatine and fluid intelligence score , whereas previously we found a negative correlation between parietal cortex creatine and memory scores but no association with other cognitive measures .
however , the two studies investigated different brain regions . as in recent work by bainbridge et al . , we employed strict criteria to discard spectroscopic voxels that failed various quality tests .
although rather conservative , such criteria can be applied with minimal human intervention , will become important for future clinical studies , and will be essential when large data sets from whole - brain spectroscopy become routinely available . the large loss of voxels ( fig .
3 ) was caused by a high proportion of csf and failures of spectral quantification . in older people with brain
atrophy , it is inevitable that voxels will be lost due to csf and enlarged ventricles .
failures of quantification were due in part to the problems of shimming over an extended region of the brain , which is especially difficult at the level of the basal ganglia .
in some subjects , an unavoidable tilt of the head relative to the scanner led to portions of the frontal sinuses , ethmoid sinus , or eyes being included in the mrsi plane .
this is a particular problem in older people , as they are less able to tilt their heads into the optimum posture . only first - order ( linear ) shimming was available on the scanner used .
in other studies ( data not shown ) we have found greater success rates with mrsi slices at the level of the corpus callosum .
the use of modern scanners with higher - order shims is likely to help , as are higher field strengths and more sensitive multi - channel coils enabling higher snr and hence smaller voxels with improved line widths .
however , some brain areas , for example the frontal and temporal regions , will remain challenging in this regard .
a limitation of this study is that time did not permit the collection of non - suppressed spectroscopic data for water referencing purposes .
ideally , a rapid interleaved ( suppressed / reference ) technique would be used , as demonstrated by the echo - planar acquisition scheme of ebel and maudsley .
the measurement of brain metabolites is potentially useful in studies of healthy ageing and acute and neurodegenerative diseases .
the current study of a moderately sized cohort with a tight age range adds to the available literature .
however , technical challenges such as shimming across the whole brain and water referencing need to be resolved before the technique can be more widely applied in large trials .
future directions include rapid , three - dimensional , whole - brain coverage and longitudinal studies .
this study was approved by the local research ethics committee and all participants gave informed written consent . | object
we sought to measure brain metabolite levels in healthy older people.materials and methodsspectroscopic imaging at the level of the basal ganglia was applied in 40 participants aged 7374 years .
levels of the metabolites n - acetyl aspartate ( naa ) , choline , and creatine were determined in " institutional units " ( iu ) corrected for t1 and t2 relaxation effects .
structural imaging enabled determination of grey matter ( gm ) , white matter ( wm ) , and cerebrospinal fluid content .
anova analysis was carried out for voxels satisfying quality criteria.resultscreatine levels were greater in gm than wm ( 57 vs. 44 iu , p < 0.001 ) , whereas choline and naa levels were greater in wm than gm [ 13 vs. 10 iu ( p < 0.001 ) and 76 versus 70 iu ( p = 0.03 ) , respectively ] .
the ratio of naa / cre was greater in wm than gm ( 2.1 vs. 1.4 , p = 0.001 ) as was that of cho / cre ( 0.32 vs. 0.16 , p < 0.001 ) .
a low voxel yield was due to brain atrophy and the difficulties of shimming over an extended region of brain.conclusionthis study addresses the current lack of information on brain metabolite levels in older adults .
the normal features of ageing result in a substantial loss of reliable voxels and should be taken into account when planning studies .
improvements in shimming are also required before the methods can be applied more widely . |
lung cancer is a major cause of cancer deaths throughout the world and is classified into two categories
. small cell lung cancer ( sclc ) constitutes 15 - 20% of the lung cancers while non - small cell lung cancer ( nsclc ) accounts for the remaining group .
nsclc includes squamous cell carcinoma , adenocarcinoma , adenosquamous cell carcinoma and large cell carcinoma 1 , 2 .
the development and progression of lung carcinoma is a long process that involves multiple cancer - related genes , as well as environmental and host genetic factors .
advances in molecular biology have shown that lung cancer is caused by the complex interaction of genetic and environmental factors and by accumulation of multiple genetic alterations such as amplifications , deletions , mutations and epigenetic events 2 - 4 .
although smoking is the main cause of lung cancer approximately 10% of cases are never smokers
the overall 5-year survival rate is still less than 15% for nsclc and even lower for sclc 6 .
tyrosine kinase inhibitors ( tkis ) are used commonly to treat patients harboring activating mutations in the tyrosine kinase domain of the epidermal growth factor receptor gene .
patients who respond to tki treatment are usually those who have never smoked and have generally adenocarcinomas 6 - 8 .
another group of patients are individuals carrying k - ras mutations with a history of smoking .
therefore , patient survival has not improved significantly and many unanswered questions about the optimal use of tkis still remain . to achieve a better and more stable response combined analysis of the relevant pathways which are involved in the mechanism of killing the tumor cells by chemotherapy is necessary .
identification of key molecular events during lung carcinogenesis and tumor progression will facilitate characterization of new therapeutic targets and development of new treatment strategies .
therefore , numerous studies aim to identify new molecular biomarkers which may predict a better clinical outcome for the patients . like in other solid tumors , chromosomal aberrations represent critical molecular events in the pathogenesis of lung cancer and recurrent genomic alterations have been reported in nsclc 13 .
the loci of recurrent aberrations frequently display regions of focal amplification in a wide range of tumors .
most of these regions harbor several oncogenes and the number of the amplified genes as well as the level of amplification may differ depending on the type of the tumor 13 , 14 .
genes overexpressed within these amplicons are attractive targets for therapy . frequently , two or more of these amplicons are present in a given tumor , suggesting that genes in the two amplified regions may collaborate in the development of the transformed phenotype 15 , 16 .
in contrast to other high throughput analysis methods , multiplex ligation - dependent probe amplification ( mlpa ) is an inexpensive and reliable method for the simultaneous analysis of a high number of different loci 17 .
although gains of partial or whole chromosomal arms on 1q , 3q , 5p , 8p and 11q have been reported in nsclc copy number changes of the genes localized in these loci have not been analyzed in lung cancer 18 - 20 . in this study in order to understand the molecular background and to explore new targets for prevention and therapy , we investigated gene copy number changes in 22 genes in a group of 82 nsclc tumors and matched non - cancerous tissue samples using mlpa .
tumor tissue and the corresponding normal lung tissue samples were obtained from 82 patients undergoing surgery at the istanbul university cerrahpasa medical faculty , department of chest surgery .
the patients taken into the study had not undergone any previous treatment and were admitted to the hospital for removal of the tumor as primary treatment .
dna was obtained by digestion of the tissues using a dna isolation kit ( roche diagnostics dna isolation kit - mannheim , germany ) according to the manufacturer 's instructions .
copy number variations of 22 genes were analyzed by mlpa in 82 patients with nsclc .
mlpa analysis was performed by using 100 ng of genomic dna and the salsa mlpa p078-c1 probemix kit ( mrc - holland , amsterdam , netherlands ) according to the manufacturer 's instructions .
the list of the genes and the probes used in the study are shown in table 1 .
the samples were analyzed in duplicate using the abi 3100 genetic analyzer ( applied biosystems , foster city , ca , usa ) .
raw data were normalized using the genemapper program ( applied biosystems , foster city , ca , usa ) .
relative peak areas of the amplification products were evaluated using the coffalyzer mlpa analysis software ( mrc - holland , amsterdam , the netherlands ) and compared with results obtained from the healthy tissue specimens to calculate gene copy numbers . for genes analyzed with multiple probes , the mean of all the peak values for this gene was calculated .
a mean value below 0.75 was defined as loss , values between 0.75 and 1.25 were defined as normal , between 1.25 and 1.65 as heterozygote duplications , between 1.65 and 2.3 as triplications and between 0.25 and 0.75 as heterozygote deletions .
the study was approved by the ethics committee of istanbul university , cerrahpasa medical faculty and written informed consent was obtained from all patients enrolled in the study .
statistical analysis was performed using the spss 21 for windows ( ibm corp . released version 2012 .
we used the (2-tailed ) test to analyze the association between gene copy number variations and clinicopathological characteristics and the spearman 's rho test to evaluate the correlation between the most frequently amplified genes .
to investigate whether there is a change in cancer - associated gene copy numbers in tumors from patients with non - small cell lung cancer , we performed mlpa analysis in 82 tumors and matched normal tissue samples .
amplification of genetic material was found in 69 of 82 ( 84.14% ) of the nsclc tissues analyzed by the mlpa assay , while the remainder of the tumors did not display amplification among the tested 22 genes ( table 2 ) .
we used 7 and 5 probes hybridizing to the short and long arms of chromosome 8 , respectively .
altogether , fifty five samples ( 67% ) showed amplification of the znf703 , prdm14 and/or myc genes .
the most frequently amplified gene on the short arm of chromosome 8 was znf703 with a frequency of 46.3% . in 14 ( 17% ) of these cases
prdm14 and myc genes on the long arm were amplified in 41.5% and 32.9% of the patients , respectively .
exclusive amplifications of the prdm14 and myc genes were present in 9 ( 10.9% ) and 4 ( 4.9% ) out of 55 cases , respectively . in the remaining 28 ( 34.1% ) samples concurrent amplification of all or any two of these genes
73.9% , 70.4% and 67% of these amplifications were duplications and 26.1% , 29.6% and 33.6% were triplications of the znf703 , prdm14 and myc genes , respectively .
on the other hand , birc5 was the most frequently amplified gene on chromosome 17 .
there were 15 probes available hybridizing with 8 genes on the long arm of chromosome 17 .
amplification of the birc5 gene was observed in 32.9% of the samples with the same frequency as for the myc gene .
the remaining genes analyzed in this study were amplified with frequencies varying between 4.9% and 22.1% . in 20 ( 24.3% ) samples amplification of 7 or more genes were observed .
the mean copy numbers in the amplified samples were 1.310.36 for znf703 , 1.270.36 for prdm14 , 1.290.46 for myc and 1.230.25 for the birc5 genes . when we analyzed the correlation between the clinicopathological characteristics of the patients and gene amplification status , no association was observed with any clinical parameter ( table 4 ) .
the most frequently deleted gene was adam9 and was observed in 6 of 82 ( 7.3% ) of the tumor samples while deletion of fgfr1 was observed in 5 ( 6.1% ) tumors .
the only gene showing a homozygous deletion was med1 in 2 ( 2.4% ) of the patients . finally , we applied multivariate analysis for the 4 most frequently altered genes to evaluate whether variations in these genes affect each other .
a significant positive association was observed between the prdm14 and znf703 ( p=0.00 ) , myc ( p=0.01 ) and birc5 ( p=0.01 ) genes .
a positive correlation was also present between the znf703 and myc genes ( p=0.04 ) .
these data indicate that copy number variations in the genes located on chromosome 8 may affect other genes located on the same chromosome .
molecular cytogenetic methods such as fluorescence in situ hybridization ( fish ) , comparative genomic hybridization ( cgh ) , and spectral karyotyping ( sky ) have greatly improved our abilities to detect genome - wide copy number alterations in solid tumors 21 , 22 .
genome - wide and massively parallel sequencing analyses have shown the presence of recurrent abnormalities in different regions including amplifications in a broad range of epithelial cancers 16 .
therefore , to develop more accurate diagnostic and therapeutic strategies , several investigators have focused on the identification of chromosomal aberrations associated with nsclc using cgh or fish 13 , 14 , 23 , 24 .
results of these investigations have shown that recurrent genomic alterations such as gains of partial or whole chromosomal arms on several chromosomes along with losses of others are present in nsclc . however , the resolution of conventional cgh is not sufficient for the precise identification of the submicroscopic molecular changes on the gene level 21 . in recent years
a new method of high - throughput molecular analysis , the multiplex ligation - dependent probe amplification ( mlpa ) has been introduced .
however , the potential utility of this approach has not been evaluated for the analysis of gene copy numbers in lung cancer yet .
there is only a single report in the literature using mlpa for methylation analysis in lung tumors 25 .
since it requires only small quantities of dna and is much more sensitive and reliable than cytogenetic analysis we performed mlpa analysis to investigate the copy number alterations in matched tumor tissues 17 . among the 8 chromosomes which were investigated in this study chromosome 8 was the most frequently amplified chromosome . in previous studies
however , the myc oncogene has been reported as the most frequently amplified gene in various tumor types 26 . on the other hand , kubokura et al .
reported that chromosome 8 copy number alterations were not associated with myc amplification in nsclc 27 . in this study
although one of the amplified genes on the long arm of chromosome 8 was myc it was not the primarily amplified gene on chromosome 8 .
the most frequently amplified genes were the znf703 ( zinc finger protein 703 ) gene on the short arm , and prdm14 on the long arm of chromosome 8 .
znf703 is a member of the net / niz family of transcription factors and has been identified recently as a novel oncogene in human breast cancer 16 , 28 , 29 .
it has been characterized as the genetic driver of the a1 amplicon on chromosome 8 and has been implicated in different properties of the cancer cells including renewal , proliferation and invasion 30 .
overexpression of znf703 in lung cancer is in accordance with data observed in breast and gastric tumors 30 - 32 .
amplification of znf703 has been found to be second only to erbb2 and ccnd1 genes in breast cancer and it has been shown that znf703 overexpression increases genome instability and contributes to tumor aggressiveness in breast cancer 16 , 33 .
more recently , enhanced znf703 expression has been correlated with repression of e - cadherin and increased lung metastasis rates in breast cancer 34 .
these findings indicate that znf703 may function as an oncogene in different types of cancer .
it remains to be determined how the expression and function of the znf703 protein is regulated . the second most frequently amplified gene in our series was prdm14 which is located on 8q13 .
prdm14 is a member of the prdm family of transcriptional regulators and controls pluripotency and epigenetic reprogramming by repressing / activating relevant genes through a variety of different mechanisms 35 , 36 .
prdm14 is one of the key transcriptional regulators of primordial germ cell specification and over - expression of prdm14 has been reported in different cancers 37 - 40 .
recently , the prdm14 gene has been identified as a susceptibility locus for cancer 41 .
its amplification and over - expression has been associated with a more aggressive phenotype and reduced sensitivity to chemotherapy in breast cancer 37 .
there are only two studies in the literature investigating the expression rate of prdm14 in nsclc tumors by immunohistochemistry and western blotting reporting that prdm14 is strongly expressed in nsclc 42 , 43 .
the authors also report a correlation between prdm14 expression levels and differentiation . in our study group
the frequency of tumors with high prdm14 expression was lower than reported by liu et al .
the remaining frequently amplified genes were the birc5 and myc oncogenes in accordance with previous reports .
data from a recent study suggests that birc5 may exert its effect by modulating arf6 expression 44 .
there are many reports in the literature indicating overexpression of these two genes in nsclc and other cancers 45 - 49 . however ,
the more interesting finding is the frequent co - amplification of the genes which are located on the same chromosome .
some of the genes within the amplicons are oncogenes that drive the amplicon while others are passengers . in our study group none of the amplified genes
however , we observed significant correlations between the amplified genes , suggesting a collaborative role of different amplicons in the tumorigenesis of nsclc .
our data indicate that amplification of the multiple amplicons on chromosome 8 are an important and significant contributor to nsclc pathogenesis since collaboration between oncogenes within the different regions of the same chromosome are observed .
contribution of the regions on chromosome 8 may provide a selective advantage for the transformed phenotype .
further studies will be required to identify the associated genes and their mutual interactions in order to elucidate their role in lung carcinogenesis . | chromosomal alterations are frequent events in lung carcinogenesis and usually display regions of focal amplification containing several overexpressed oncogenes . although gains and losses of chromosomal loci have been reported copy number changes of the individual genes have not been analyzed in lung cancer . in this study 22
genes were analyzed by mlpa in tumors and matched normal tissue samples from 82 patients with non - small cell lung cancer .
gene amplifications were observed in 84% of the samples .
chromosome 8 was found to harbor the most frequent copy number alterations .
the most frequently amplified genes were znf703 , prdm14 and myc on chromosome 8 and the birc5 gene on chromosome 17 .
the frequency of deletions were much lower and the most frequently deleted gene was adam9 .
amplification of the znf703 , prdm14 and myc genes were highly correlated suggesting that the genes displaying high copy number changes on chromosome 8 collaborate during lung carcinogenesis . |
32 adult male sprague - dawley rats weighing 200 - 250 g were used for experimental procedures . the ambient temperature and relative humidity of the animal room were 211c and 607% , respectively .
the study , which was conducted after the required permit is obtained from the local council of ethics for animal experiments in sleyman demirel university , was conducted in the experiment animals and medical investigation implementation and research center in sleyman demirel university .
32 adult male sprague - dawley rats were divided into the following four groups , each containing eight rats : control ( c ) group , streptozotocin ( stz ) group , viscum album ( va ) group and viscum album + streptozotocin ( va+stz ) group .
after the stz had been prepared in citrated buffer ( 0.1 m , ph 4.5 ) with a rate of 55 mg / kg , it was applied to rats in a single dose and in an intraperitoneal way .
depending on their groups , the prepared extract was given to the rats daily by means of gavage for a period of 10 days ( 100 mg / kg ) .
on the 11 day , diabetes was induced by means of streptozotocin ( 55 mg / kg ) in specified groups .
the values were measured by means of the blood taken from their tails to glucometer strips .
first , the leaves of the viscum album collected from the pnargz region of the elmalyurt village in the district of glhisar in the province of burdur on january and february were separated and were dried in 45c temperature for a period of 5 - 6 hours by the researcers .
the dry and ground leaves were mixed with the 95 % ethanol at a rate of 1:5 .
then the mixture was kept at 4c for a period of 24 hours before sieving it using a 0.45 m membrane filter .
after ethanol is removed from the solution , it was kept at -20c until it is used .
the viscum album extract was given to the rats in the relevant groups ( to the groups va and va+stz ) by means of oral gavage at a dose of 100 mg / kg for a period of 10 days .
after the stz had been prepared in citrated buffer ( 0.1 m , ph 4.5 ) with a rate of 55 mg / kg , it was applied to rats in a single dose and in an intraperitoneal way .
the plasma glucose levels were determined by measuring them by glucometer using a drop of blood taken from the tip of the tails of the rats .
accutrend plus gct glucometer was used for measuring of the plasma glucose levels of rats .
the monitor of the glucometer device uses a reflectance photometer for measuring the intensity of the color formed at the end of the reaction .
bis- next mediator in oxidized form enzyme returning to step ( 2-hydroxyethyl ) - ( 4-hidroksiiminohekzo from 2,5-dienyl ) ammonium chloride selectively reduces .
it was assumed that the disease had developed if the blood glycose level exceeds 250 mg / dl .
after the stz had been applied , the blood glycose levels were monitored on a daily basis . at the end of the two weeks
, the rats were sacrificed , their liver and kidney tissues were removed and their antioxidant parameters were examined .
0.05 m tris - hcl buffer with a ph value of 7.4 was used in the homogenization of the tissues .
the tissue samples were weighed out by using a sensitive balance and their wet weights were recorded .
then they were placed in eppendorf tubes and kept at -80c until the biochemical examinations are conducted on them .
mda - cat and serum glucose levels in groups ( meansem ) c : control group ; stz : streptozotocin group ; va : viscum album group and viscum album+streptozotocin ( va+stz ) group ; sem : standard error mean . at the beginning of the homogenization process , the wet weights of the tissues were determined .
they were put into glass tubes by maintaining their low temperature and then 2 ml of cold tris - hcl buffer was added over them . then plastic bowls were filled with ice and the tissues in glass tubes were placed in these plastic bowls and they were homogenized at 16.000 rev / min for a period of 3 minutes .
buffer was added in a way that the last volume was 10 times the weight of the weight of the tissue . by maintaining them in low temperature ,
the amount of mda protein was determined by using the homogenates obtained . by means of the centrifugation of the homogenates at + 4c at 5.000 rev ( min for a period of 30 minutes ,
then , from the selected supernatants , the amount of proteins was determined by means of cat enzyme activities .
determination of the proteins in the homogenates , supernatants and extracts of the homogenized samples was carried out by using the lowry method .
according to this method , the cupper - protein complex is formed in the alkali solution , which , in turn , reduces the folin - ciocalteu - phenol reagent , resulting in a dark blue color .
the degree of the darkness of the blue color is directly proportional with the concentration of the protein .
the amount of malondialdehyde was determined by the spectrophotometric method based on the draper and hadley s method . in this method ,
the color produced by the reaction of mda and thiobarbituric acid ( tba ) is considered by means of a spectrophotometric measurement .
the h2o2 added into the experimental environment is broken down by the catalase enzyme into water and oxygen , which manifests itself on the ultraviolet spectrum as a decrease in the absorbance .
this decrease in the absorbance is directly proportional to the activity of the cat enzyme .
anova which is a parametric test , was performed for comparing of groups mda and cat levels .
32 adult male sprague - dawley rats weighing 200 - 250 g were used for experimental procedures . the ambient temperature and relative humidity of the animal room were 211c and 607% , respectively .
the study , which was conducted after the required permit is obtained from the local council of ethics for animal experiments in sleyman demirel university , was conducted in the experiment animals and medical investigation implementation and research center in sleyman demirel university .
32 adult male sprague - dawley rats were divided into the following four groups , each containing eight rats : control ( c ) group , streptozotocin ( stz ) group , viscum album ( va ) group and viscum album + streptozotocin ( va+stz ) group .
after the stz had been prepared in citrated buffer ( 0.1 m , ph 4.5 ) with a rate of 55 mg / kg , it was applied to rats in a single dose and in an intraperitoneal way .
depending on their groups , the prepared extract was given to the rats daily by means of gavage for a period of 10 days ( 100 mg / kg ) .
on the 11 day , diabetes was induced by means of streptozotocin ( 55 mg / kg ) in specified groups .
the values were measured by means of the blood taken from their tails to glucometer strips .
first , the leaves of the viscum album collected from the pnargz region of the elmalyurt village in the district of glhisar in the province of burdur on january and february were separated and were dried in 45c temperature for a period of 5 - 6 hours by the researcers .
the dry and ground leaves were mixed with the 95 % ethanol at a rate of 1:5 .
then the mixture was kept at 4c for a period of 24 hours before sieving it using a 0.45 m membrane filter .
after ethanol is removed from the solution , it was kept at -20c until it is used .
the viscum album extract was given to the rats in the relevant groups ( to the groups
va and va+stz ) by means of oral gavage at a dose of 100 mg / kg for a period of 10 days .
after the stz had been prepared in citrated buffer ( 0.1 m , ph 4.5 ) with a rate of 55 mg / kg , it was applied to rats in a single dose and in an intraperitoneal way .
the plasma glucose levels were determined by measuring them by glucometer using a drop of blood taken from the tip of the tails of the rats .
accutrend plus gct glucometer was used for measuring of the plasma glucose levels of rats .
the monitor of the glucometer device uses a reflectance photometer for measuring the intensity of the color formed at the end of the reaction .
bis- next mediator in oxidized form enzyme returning to step ( 2-hydroxyethyl ) - ( 4-hidroksiiminohekzo from 2,5-dienyl ) ammonium chloride selectively reduces .
it was assumed that the disease had developed if the blood glycose level exceeds 250 mg / dl .
after the stz had been applied , the blood glycose levels were monitored on a daily basis . at the end of the two weeks
, the rats were sacrificed , their liver and kidney tissues were removed and their antioxidant parameters were examined .
0.05 m tris - hcl buffer with a ph value of 7.4 was used in the homogenization of the tissues .
the tissue samples were weighed out by using a sensitive balance and their wet weights were recorded .
then they were placed in eppendorf tubes and kept at -80c until the biochemical examinations are conducted on them .
mda - cat and serum glucose levels in groups ( meansem ) c : control group ; stz : streptozotocin group ; va : viscum album group and viscum album+streptozotocin ( va+stz ) group ; sem : standard error mean . at the beginning of the homogenization process , the wet weights of the tissues were determined .
they were put into glass tubes by maintaining their low temperature and then 2 ml of cold tris - hcl buffer was added over them . then plastic bowls were filled with ice and the tissues in glass tubes were placed in these plastic bowls and they were homogenized at 16.000 rev / min for a period of 3 minutes .
buffer was added in a way that the last volume was 10 times the weight of the weight of the tissue . by maintaining them in low temperature
the amount of mda protein was determined by using the homogenates obtained . by means of the centrifugation of the homogenates at + 4c at 5.000
then , from the selected supernatants , the amount of proteins was determined by means of cat enzyme activities .
determination of the proteins in the homogenates , supernatants and extracts of the homogenized samples was carried out by using the lowry method . according to this method
, the cupper - protein complex is formed in the alkali solution , which , in turn , reduces the folin - ciocalteu - phenol reagent , resulting in a dark blue color .
the degree of the darkness of the blue color is directly proportional with the concentration of the protein .
the amount of malondialdehyde was determined by the spectrophotometric method based on the draper and hadley s method . in this method ,
the color produced by the reaction of mda and thiobarbituric acid ( tba ) is considered by means of a spectrophotometric measurement .
the h2o2 added into the experimental environment is broken down by the catalase enzyme into water and oxygen , which manifests itself on the ultraviolet spectrum as a decrease in the absorbance .
this decrease in the absorbance is directly proportional to the activity of the cat enzyme .
spss 20.00 package program was used for statistical analysis . anova which is a parametric test ,
when the liver mda values are compared between stz and va groups and between stz and c groups , it was seen that the mda values are lower in the stz group ( p=0.006 and 0.015 , respectively ) .
the differences between the liver mda values of the other groups were found to be insignificant .
the comparison of the kidney mda values between the stz and c groups , stz and va groups , and stz and va+stz groups showed that the mda level was significantly higher in the stz group ( p=0.029 , p=0.014 and p=0.011 , respectively ) .
when the kidney cat activity is compared between the stz and c groups and the stz and stz+va groups , it was found to be lower in the stz group ( p=0.028 and p=0.006 ) . when the liver cat values are compared between the stz and c groups and the stz and va groups
, a significant decrease was observed in the stz group ( p=0.012 and p=0.006 ) .
when the glucose values following the application of stz were examined , it was seen that the glucose value for the va group was higher than that for the c group ( p=0.001 ) ; the glucose value for the stz group was significantly higher than that for the c group ( p=0.000 ) ; and the glucose value for the stz+va group was higher than that for the c group ( p=0.000 ) .
when the glucose values for the va and stz groups were compared , it was seen that the glucose value for the stz group was higher ( p=0.000 ) ; and , when the values for the va and stz+va groups were compared , the glucose value for stz+va was found to be higher ( p=0.000 ) .
no significant difference was found out between the stz+va and stz groups in terms of their glucose levels .
when the balance between the free radicals produced during the physiological processes occurring in the body or during pathological processes and the antioxidant system is disturbed in favor of the free radicals , the oxidative damage occurs .
the organism tries to protect itself against this oxidative damage by enzymatic and non - enzymatic ways .
catalase and mda are among the important enzymes used in this enzymatic process of protection .
diabetes is a disease that affects the millions of people every sex and race effective and globally every year [ 17 , 18 ] .
diabetes is a disease which disturbs the glycemic control and the antioxidant metabolism disorder plays a role in the development of the clinic state . in a study investigating the possible effects of viscum album , in decreasing oxidative stress , which have been applied on the stomach and colon tissues of cancer patients and healthy individuals
, it has been shown that viscum album has an inhibiting effect on xanthine oxidase and adenosine deaminase .
there is also a study which have shown that viscum album might increase the insulin secretion and improve the glycemic control . in this study , rats in which diabetes had been induced by means of stz were given viscum album for short and long periods ( for 4 hours and 3 weeks respectively ) and the antidiabetic and antilipidemic effects of it were examined .
the results of this study showed that viscum album had caused hypoglycemia in these rats . in another study carried out on wistar rats
, the rats were divided into groups and , following a 12-hour period of hunger , they were loaded , depending on their groups , with glucose and viscum album extract . then blood samples were taken from the rats in order to examine their glycose , insulin and glucagon levels . while the extract resulted in no changes in the glucose levels in healthy rats , it lowered the level of blood sugar in diabetic rats .
it was found out that the insulin secretion had increased both in diabetic and healthy rats and it was shown that viscum album could have antiglycemic and insulinotropic effects . in a study carried out on rats in which diabetes had been induced by means of stz and which had been divided into groups based on the amount of viscum album given to them , it was shown that viscum album could have antihyperlipidemic and antioxidant properties ( by releasing mda and gsh ) . in another study carried out at the cellular level
, it was shown that the viscum album extract applied to pancreatic b cells could induce the secretion of insulin and thus could be used as an antidiabetic substance . in a study in which the effectiveness of the herbal treatments used for diabetes was investigated , the rats in which diabetes had been induced by means of stz were given viscum album and it was found out that the extract resulted in a decrease in polyphagia and polydipsia .
this suggests that viscum album can be used in decreasing the symptoms without having any effect on glycemic control . in the present study , which has been conducted at the biochemical level
, the antioxidant activity in the liver and kidney tissues of rats has been investigated .
this activity has been tried to be calculated based on the levels of mda , which plays an important role in lipid peroxidation and has a function of decreasing the oxidative stress , and catalase , which is an antioxidant enzyme . when the mda values are compared among the groups formed within the scope of the experiment , significant differences were found out between the stz and va groups ( p=0.014 ) and stz and va+stz groups ( p=0.011 ) , the values being higher for the stz group . in the rats in
which diabetes had been induced , the viscum album given beforehand resulted in significant changes in the kidney mda values , which has an effect of decreasing the oxidative stress .
when the blood sugar values were analyzed after the application of the stz , no significant difference was found out between the stz+va and stz groups .
this indicates that the viscum album given beforehand has no effect on the glycemic control .
consequently , an increase in the enzymatic activity of catalase , which is an antioxidant enzyme functioning in the kidney tissue , and a decrease in the level of mda , which is an indication of lipid peroxidation , were observed among the rats given viscum album .
considering the fact that a decrease in the oxidative stress provides positive contributions for the improvement of the clinical state and the overall situation in diabetes , it can be said that viscum album can produce benefits in the improvement of the clinical state in diabetics .
however , there is a need for further studies , especially the studies investigating the active ingredient , in order to find out the degree of the antioxidant and antidiabetic effects of viscum album . | objective : viscum album ( va ) is a species of mistletoe in the family santalaceae that is thought to have therapeutic properties for several diseases , including diabetes . in the present study , conventional experimental rat model was used with diabetes induced with streptozotocin ( stz ) to evaluate effect of va on lipid peroxidation and antioxidant system.methods:total of 32 adult , male sprague - dawley rats were divided into 4 groups of 8 rats : control group , stz group , va group , and group administered va+stz .
va extract was 100 mg / kg preparation delivered once a day by oral gavage for 10 days .
single dose of 55 mg / kg stz citrate buffer ( 0.1 m , ph 4.5 ) was administered intraperitoneally to induce diabetes .
fasting blood glucose level was measured and recorded .
animals were sacrificed , and catalase ( cat ) , malondialdehyde ( mda ) , and protein present in liver and kidney tissue samples were measured .
activity of cat , an antioxidant enzyme , was studied according to the aebi method .
mda , a product of lipid peroxidation , was analyzed using draper and hadley spectrophotometric procedure .
protein level was determined using supernatant and extract of tissue homogenates according to lowry method .
data were assessed using one - way analysis of variance and pairwise comparisons between groups .
post - hoc analysis included dunnet test , duncan test , and least significant difference test .
p<0.05 was considered significant probability value.results:oxidative stress is associated with diabetic complications .
va administered to diabetic rats reduced oxidative stress and improved their general condition.conclusion:further studies are needed to enhance understanding of potential antidiabetic and antioxidant effects of va . |
polycystic liver disease ( pcld ) is characterized by a large number of liver cysts scattered throughout the liver parenchyma . this disease entity
patients with autosomal dominant polycystic kidney disease have polycystic kidneys , a feature that is absent in patients with autosomal dominant pcld.1 symptoms are often absent in patients with pcld until there is a significant increase in cyst size .
they mainly include abdominal pain , early satiety , dyspnea , nausea , and vomiting.2 treatment is indicated if the symptom becomes severe or intolerable , and the therapeutic intention is to decrease the total liver volume leading to relief of compression - related symptoms.34 most of the pcld patients present with only disturbing symptoms that deteriorate health quality and limit daily activities rather than causing serious liver function - related complications .
there are several therapeutic options , including aspiration - sclerotherapy , cyst fenestration , partial liver resection , and liver transplantation .
the choice of treatment usually depends on the number , size , and location of the liver cysts.5 the technique of fenestration of liver cysts was first described in 1968,6 which was reported to be a safe and effective treatment for the management of symptomatic non - parasitic cysts of the liver.7 in this study , we intend to present the beneficial effect of palliative fenestration treatment on quality of life in a patient with symptomatic pcld .
a 48-year - old female patient had been followed up for 5 years for both polycystic liver and kidney diseases at other institution .
, she complained of progressive distension of the abdomen and abdominal fullness leading to gradual decrease in body weight without shortness of breath .
her liver function was quite normal ; hence , we decided to observe the patient regularly without considering palliative surgery or liver transplantation .
medical treatment with somatostatin analogue was not considered primarily due to the high medical cost as well as the undetermined therapeutic efficacy . during the outpatient clinic follow - up for 1 year
, we recognized that she had barely maintained her ability of function in daily activities due to progressive worsening of fatigue and dyspnea on exertion .
eastern cooperative oncology group ( ecog ) performance status worsened from 2 to 3 during observation for 1 year.7 gastrointestinal quality of life index ( giqli ) score also deteriorated from 75 to 44 during observation for 1 year.8 physical examination revealed that the liver was prominently bulged out of the abdomen , but leg edema was absent .
abdominal computed tomography ( ct ) showed progressive enlargement of multiple liver cysts with smooth and regular walls ( fig .
1 ) , which was regarded as type iii according to gigot 's classification ( fig .
2),9 grade 4 according to qian 's classification ( table 1),10 and type c according to schnelldorfer 's classification ( table 2).11 magnetic resonance imaging study revealed water - filled multiple liver and kidney cysts ( fig .
3 ) . after obtaining consent of the patient on the uncertain effect of fenestration treatment as well as high risk of disease recurrence , the patient underwent surgical fenestration treatment .
multiple cysts in the enlarged liver were opened and the cyst walls were excised with electrocautery ( fig .
4 ) . to avoid bleeding and bile leakage , the thin membranous portions were meticulously fenestrated and none of the viable normal liver parenchyma was resected .
the majority of accessible liver cysts were opened . at the end of the fenestration procedure
three jackson - pratt type drains were inserted to evacuate the ascitic fluid : the abdominal drainage output was about 500 ml / day at postoperative day 1 and then it gradually decreased to less than 150 ml / day after 5 days . after performing follow - up ct at 1 week , the drains were removed .
no surgical complication occurred and the patient was discharged 10 days after the open fenestration surgery .
the total liver volume by using ct volumetry was 3,870 ml before surgery and 3,125 ml at 1 week after surgery , showing a volume reduction of 19.3% . at 1 month after surgery ,
ecog performance status improved to 1 and the giqli score was significantly increased to 122 . during regular follow - up at an interval of 6 months , follow - up ct showed no progression in cyst size and flat abdomen was observed ( fig .
, ecog performance status improved to 0 but the giqli score was slightly decreased to 114 .
the patient is doing well and she is performing her normal activities at 18 months after surgery with no evidence of disease recurrence .
the therapeutic intention of fenestration treatment for pcld is to achieve relief of symptoms through liver volume reduction by rupture of liver cysts . in 1997 , gigot et al.9 evaluated 10 patients who had been treated by an aggressive attempt to reduce liver volume , mainly by open liver cyst fenestration .
deep - seated cysts were also opened with the aid of intraoperative ultrasonography , due to which the average liver volume decreased from 7,761 ml to 4,596 ml , resulting in a reduction of 43% .
both preoperative liver volume and volume reduction were greater than that obtained in the present case probably due to more extensive fenestration of deep - seated cysts .
such an aggressive approach is associated with a higher prevalence of intra- and postoperative complications such as intraoperative massive hemorrhage and a biliary tear , postoperative biliary leakage and ascites , and obstruction of the inferior vena cava .
thus , the extent of cyst fenestration should be prudently adjusted to minimize surgical complications .
one study using laparoscopic fenestration showed a median liver volume reduction of 12.5% , implicating the limit of laparoscopic fenestration approach.4 probably because high recurrence rate may be associated with low efficacy of liver volume reduction , laparoscopic fenestration for pcld has not yet been accepted as a definitive treatment.12131415 as shown in many other studies , liver cysts are prone to becoming enlarged with the passage of time . in view of the lack of an explicit definition of recurrence , it is difficult to assess the recurrence rate after fenestration treatment in the literature.4 some authors defined recurrence as recurrence of cysts on imaging studies , other authors defined recurrence as recurrence of symptoms , while some authors considered both symptomatic and radiological recurrence .
published series describing the results of open and laparoscopic fenestration has been summarized in the literature.16 immediate symptom relief is achieved in 92% of the patients , whereas up to 25% experience recurrence of the cysts or symptoms.17 complication rate after fenestration is in the range of 23% while mortality is about 2% .
factors that predict failure of fenestration are previous abdominal procedures , deep - seated cysts , incomplete unroofing , cysts in segments vii and viii , and the presence of diffuse pcld.17 hepatic resection is usually reserved for highly symptomatic patients who are incapacitated by their disease due to the massive expansion of their livers.9 in such patients , fenestration alone is rarely successful because the liver parenchyma is rigid and it does not collapse.17 symptom relief is achieved in 86% of the patients although cyst recurrence is expected in one third of the patients.18 the morbidity rate associated with this procedure can be up to 50% and includes ascites , pleural effusions , biliary leakage , and hemorrhage .
one of the reasons for these complications is the fact that there is a significant distortion of the intra - hepatic vasculature and biliary tree which makes these procedures technically very challenging .
orthotopic liver transplantation is the only curative treatment for patients with severe pcld.19 it is indicated in those patients with disabling symptoms that lead to decreased performance status and quality of life .
patients with pcld usually have normal liver function and the organ allocation system based on the model for end - stage liver disease ( meld ) or korean network for organ sharing ( konos ) is often unable to assist this group of patients . for these patients ,
meld exception criteria seem to be necessary.2021 because of the shortage of available grafts , the need for life - long immunosuppression , and the perioperative risks , liver transplantation is indicated only in symptomatic patients ( fig .
6 ) . in the current korean setting in which the majority of deceased donor liver grafts are allocated to urgent patients
, most patients with pcld have a very low chance of receiving deceased donor liver grafts ; therefore , some of them have undergone living donor liver transplantation.2223 in patients with pcld , patient selection , timing and choice of treatments can be very challenging . in symptomatic patients ,
treatment strategies should be based on the degree and progression of symptoms and the severity of other medical conditions .
symptomatic patients with large cysts or limited hepatic involvement might benefit from fenestration or sclerotherapy .
hepatic resection with or without fenestration should be favored in patients with diffuse involvement of the liver but with sufficiently preserved parenchyma .
finally , in the patients with diffuse disease , liver transplantation is a valid option and should be pursued as primary therapy prior to the development of debilitating disease that can significantly increase the risks of perioperative adverse events.16 in the present case , significant improvement in quality of life and daily activity performance was achieved after open fenestration treatment over 18 months of follow - up without disease recurrence . | polycystic liver disease ( pcld ) is characterized by a large number of liver cysts scattered throughout the liver parenchyma .
we herein intend to present the beneficial effect of palliative fenestration treatment on quality of life in a patient with symptomatic pcld .
a 48-year - old female patient had been followed up for 5 years for both polycystic liver and kidney diseases at another institution . during follow - up for last 1 year
, we recognized that she had barely maintained her ability of function in daily activities due to progressive worsening of fatigue and dyspnea on exertion .
the patient finally underwent surgical fenestration treatment .
multiple cysts in the enlarged liver were opened and the cyst walls were excised with electrocautery . no surgical complication occurred and the patient was discharged 10 days after the open fenestration surgery .
the total liver volume was 3,870 ml before surgery and 3,125 ml at 1 week after surgery , showing a volume reduction of 19.3% .
after surgery , her performance status improved significantly . in the present case ,
significant improvement in quality of life and daily activity performance was achieved after open fenestration treatment over 18 months of follow - up without disease recurrence . |
a first experiment which was fundamental , described in 1973 , discusses the immune response to various antigens of an asterid : asterina gibbosa .
it indicated ( leclerc , 1973 ) , more exactly , the specific immunocytochemical response to hrp ( horse - radish peroxydase ) of the sea star .
the general idea that emerged from the experiments made in our laboratories was that echinodermata ( leclerc and brillouet , 1981 , delmotte et al .
, 1986 , leclerc , 2012 ) , as exemplified by sea stars ( asterina gibbosa and asterias rubens ) , possessed an immune system able to mount cellular and humoral - specific responses after stimulation with a foreign antigen . in 2011
sea star antibody was shown to correlate to ig kappa genes ( leclerc et al . , 2011 ) and in 2013
a true candidate ig kappa gene was found ( leclerc et al . , 2013 ) .
we report the sequence and deduced amino - acid composition of the sea star ig kappa gene .
we used the experimental protocol concerning the smart kit pcr cdna synthesis ( clontech ) on the candidate gene cdna sequence ( leclerc et al . ,
5cagtcattaaaaggacatgataatttcggaccgggtctttaatattacaatgactgctgctatgcgtggc aacatggcgtctctatggatgttcttctttgtcgtggggataactttacaacggagtttggcgatttaca cgtttcgcgagcaaccgtcggacactagcgcgttgcaggggagcacagtggtgcttcactgctccgttga gcagtacataaacaccacggccatcgtttggtggagccgtgactcggtcatcagccacaacaaagacctg aaactgtccagtctaaacaccgaccagctccaaaggtactcgatttcaggcgacgcatctcggggggaat tcaaccttagaatagtgaactttaccgccacagacgccgccagttaccgctgtcagatgtttgcg3 we purified the polya fraction , according a specific kit and generated the c dna with an oligodt .
a non - specific amplification was performed and followed by a specific one with an oligo 956 forward ( 53 ) 5-cagattcagaaacacatgtatttcc-3 and then an oligo 957 reverse ( 53 ) 5-tttagcatggcatgtaaagacacc-3 , always requested for this experiment ( clontech ) .
the pcr products showed , in agarose gel , many bands for the negative control , and one band ( 400 bp ) for the specific pcr .
the results show that the revealed gene , after sequencing , shows only little gene described in the previous paper ( leclerc et al . , 2013 )
it is enough to decipher this gene to realize it ; here is the sequence as shown in fig . 1 .
based on sander 's review ( sander and schneider , 1991 ) , we propose that this gene relates to immunoglobulins as it contains 2 typical cysteines of the domains of ig , without being able to assert , at the moment , if it is about a heavy or light chain of immunoglobulins . a single indication ( delmotte et al . , 1986
) favors the light chain due to the observed molecular weight ( 30,000 da : delmotte et al .
another antigen such as hapten ( leclerc and brillouet , 1981 ) could produce another type of antibody currently , we do n't know , at the moment , if there are several types of antibody in the sea star a. rubens . what we are sure , on the other hand ( because there is a gene ( the sea star ig kappa ) ) , the function of which is the one of the defenses of the sea star against the immunopathogenicity attacks ; the hrp , in the present case . in terms of amino - acid , our gene could present 118 amino - acids as shown in fig .
this is slightly smaller than the true ig kappa region v - iv s107b which is reported to be 129 amino - acids found in mammals . in conclusion
, this antibody gene of sea star calls back the mouse ig kappa region v - iv s107b precursor gene but is different from it by the number of amino - acids ( 118 instead of 129 aa ) .
our data contributes to knowledge the molecular and genetic bases of non - self recognition by invertebrates which will allow further comprehension of the evolution of mhc antigens and immunoglobulins . | the sea star asterias rubens reacts specifically to the antigen : hrp ( horse - radish peroxydase ) and produces an antibody anti - hrp .
we previously identified a candidate ig kappa gene corresponding to this manuscript .
we show now the gene referred to as : sea star ig kappa gene in its specificity . |
spermatogenesis is the process by which a complex , interdependent population of germ cells produces spermatozoa by mitosis and meiosis .
the process of spermatogenesis takes place within the coiled seminiferous tubules , and continues from puberty to old age .
it consists of various stages beginning with the formation of germ cells ( spermatogonia ) in the germinal epithelium followed by their progressive development into primary and secondary spermatocytes , and finally mature spermatozoa .
spermatogenesis is highly dependent upon optimal conditions for the process to occur correctly , and is essential for sexual reproduction .
dna methylation and histone modification have been implicated in the regulation of this process ( 1 ) .
the process of spermatogenesis is highly organized ; proliferation and differentiation of the male germ cells and the intratesticular and extratesticular mechanisms of regulation of spermatogenesis can be disturbed at every level ( 2 ) .
this may occur as a result of environmental influences or may be due to diseases that directly or indirectly affect spermatogenesis , leading to infertility in men .
male factors have been reported to contribute between 3055% ( 36 ) to global cases of infertility .
( 2009 ) reported that male factor contributes averagely to half of the cases of infertility in couples ( 7 ) .
male factor infertility is seen as an alteration in sperm concentration and/or motility or morphology in at least one sample of two sperm analyses , collected between 1 and 4 weeks ( 8) .
apart from known hormonal disturbances ( 9 ) , other physical and psychological problems may also contribute to male infertility .
these include environmental factors such as diet and toxic elements ( 1011 ) , genetic aberrations ( 1213 ) , infection and inflammation ( 14 ) etc .
infection remains the commonest cause of infertility in africa particularly in sub - saharan africa ( 1516 ) .
when there is an infection to the reproductive tract , one important function of the innate immune system is to recruit more phagocytic cells and effector molecules to the site of the infection through the release of a battery of cytokines and other inflammatory mediators that have profound effects on subsequent events .
these include ( i ) ejaculatory duct obstruction : this is a common cause of male infertility and infections have been reported to be present in at least 2050% of these men ( 17 ) .
( ii ) epididymitis : this is the inflammation of the epididymis , a structure in the male reproductive system that joins the testes and the vas deferens .
inflammation of the epididymis may result in further complications such as scrotal swelling , pain , penile discharge and blood in urine .
( iii ) infections : inflammation results from sexually transmitted infections e.g. gonorrhoea , chlamydia , escherichia coli was reported to be the main cause of epididymitis in older men , but other types of bacteria including mycobacteria and ureaplasma may also cause this condition .
( iv ) urethritis : there could also be bladder or urethral infection that moves to the epididymis . in children , mumps and other viral infections
testicular torsion : this is a common problem affecting fertility that is caused by a supportive tissue abnormality which allows the testes to twist inside the scrotum which is characterized by extreme swelling .
( vi ) varicocoele : this is an enlargement of the internal spermatic veins that drain blood from the testicle to the abdomen ( back to the heart ) .
a varicocoele develops when the one way valves in the spermatic veins are damaged causing an abnormal back flow of blood from the abdomen into the scrotum creating a hostile environment for sperm development .
( vii ) several other causes include male urogenital obstruction , chronic prostatitis , inflammation of one or both testes ( orchitis ) , and drug therapy .
it is important to note that when any or the above processes occur in the male genital tract , the immune system will respond to the pathogens and possible tissue damage .
the collateral damage caused by this type of inflammation usually accumulates slowly , sometimes asymptomatically for years and further leads to tissue deterioration ( 18 ) .
the inflammatory system can be linked to a sprinkler system that prevents fire from spreading in a building .
while the intention of the process is to limit damage and restore function ( positive ) , the response itself can cause significant harm .
one undesirable consequence of inflammation , for example , is that some enzymes and toxic products contained within phagocytic tissues are inevitably released , damaging cells and tissues .
three principal changes occur when there is a case of acute inflammation ; an increased blood supply to the affected area , an increase in capillary permeability allowing larger serum molecules to enter the tissues and an increase in leukocyte migration into the tissue .
when there is a failure to eliminate the infectious agent , it leads to chronic inflammation .
this is characterized with recruitment and activation of macrophages , lymphocytes and other cells which trigger a coordinated action of cytokines .
in contrast to acute inflammation , where the host response leads to elimination of the irritant , followed by recovery involving tissue regeneration or repair , chronic inflammation is characterized by inflammation and repair occurring concurrently , rather than consecutively .
note that repair is always a feature of chronic inflammation because it is associated with irritants that cause destruction of tissue architecture .
repair is typically achieved by ingrowth of granulation tissue , which includes macrophages , fibroblasts and new blood vessels ( 19 ) .
the direct association between acute or chronic inflammation and the development of infertility constitute important issues in contemporary medicine .
the reduced semen quality during the inflammatory process can result from impairment of accessory gland functions , obstruction of sperm transport , and dysregulation of spermatogenesis ( 2021 ) .
inflammatory cytokines usually act locally , since they are produced by locally activated cells or produced temporarily after the stimulus has been activated . in male gonads ,
cytokines are also produced physiologically and have been reported to be involved in the normal function of the organ ( 2223 ) . in this respect , they appear as the natural components of seminal plasma ( 24 ) .
the main source of cytokines in the male gonad is testicular macrophages , although some cytokines ( il1 and il6 ) were also observed by some authors to be produced by leydig and sertoli cells ( 25 ) .
cytokines , particularly tnf , controls movement of leukocytes into tissues when there is tissue damage .
tnf is produced primarily by macrophages and other mononuclear phagocytes and has many functions in the development of inflammation and the activation of other leukocytes .
notably , tnf induces adhesion molecules and chemokines on the endothelium and activates the microbial systems of phagocytes .
inflammatory responses , which are operationally characterized by pain , redness , heat and swelling at the site of infection in the male genital tract reflect two types of changes in the seminal vesicles .
the first of these is an increase in diameter , leading to an increased local seminal flow hence the heat and redness and a reduction in the velocity of seminal flow , especially along the surface of local seminal vesicles .
inflammatory damage on the male genital tract leads to the increased generation of reactive oxygen species ( ros ) .
in addition , ros or free radical overproduction associated with inflammatory reactions may be caused by pathological , bacterial strains that colonize the reproductive tract ( 2728 ) .
free radicals are group of highly reactive chemical molecules with one or more unpaired electrons that can oxidatively modify bio - mole cules they encounter . reacting almost immediately with any substance in their environment , results in chains of reaction leading to cellular damage ( 29 ) .
( 2003 ) showed superoxide , hydroxyl and hydrogen hydroxide radicals as the major ros present in seminal plasma ( 30 ) .
to maintain normal cell function , excess ros must be continuously inactivated by seminal plasma antioxidants .
oxidative stress arises when excess free radicals overwhelm the antioxidant defence of the male reproductive tract ( 3132 ) , thereby damaging male reproductive tract .
it is interesting to note that seminal oxidative stress was earlier reported to correlate negatively with sperm concentration , motility and function ( 33 ) .
these observations also suggest that cytokines , mediators of oxidative damage may also have an impact on the quality of semen and male fertility .
the participation of some cytokines in the regulation of fertility is dependent upon their concentration ; for example , a study by naz and evans ( 1998 ) showed that interleukin 12 correlated with sperm density and sperm morphology ( 34 ) . increased levels of interleukin 6
were also observed in infertile men by the same author in an earlier study conducted .
high levels of certain cytokines in semen are often linked with a decrease in the quality of the seminological parameters ( 35 ) .
more recent studies have shown increased tnf in semen to be associated with reduced sperm count , sperm motility , and sperm morphology ( 3637 ) . the increased levels of this cytokine cause apoptosis in semen as a result of proliferation and differentiation of beta cells , proliferation of t cells and natural killer cells .
interleukin1 alpha ( il1 ) and interleukin1 beta ( il1 ) also induce apoptosis in semen via proliferation and differentiation of beta cells , chemoattraction of leucocytes to the site of inflammation and induction of neutrophils and monocyte generation .
these cytokines were also observed to adversely affect quality of semen . in another study reported by the same author ,
increased levels of il1 were associated with a decrease in sperm motility ( 38 ) .
these results were associated with a simultaneous increase in seminal levels of reactive oxygen species as well as malondiadehyde ( mda ) ; a product of lipid peroxidation , consequent to oxidative damage . the same cytokines that act as elements of immune modulation for the male gonad appear in large concentrations in semen during infection and when the tissues are damaged .
while some studies have associated with disturbed spermatogenesis ( 4142 ) , others have linked it to harmful influence of environmental factors ( 43 ) , and atypical sexual behavior ( 44 ) . under inflammatory conditions , white blood cells ( wbc ) in the semen leak from the site of infection or inflammation . in normal conditions ,
leukocytes are restricted to the center of seminal vesicles , where the flow is fastest . in inflammatory sites
, the blood vessels feeding the testis are dilated allowing the leukocytes to move out of the center of the blood vessels and interact with the vascular endothelium .
in addition to these changes , there is an increase in permeability , leading to the local accumulation of fluid hence the swelling and pain as well as the accumulation of immunoglobulins , complement and other semen proteins in the genital tract .
the migration of leukocytes out of the seminal vesicles depends on adhesive interactions activated by the release of inflammatory mediators
. thus , infection or physical damage to male genital tract sets in motion the recruitment of phagocytic cells to the site of damage .
neutrophils exposed to tnf are activated to mediate a respiratory burst that generates oxygen radicals and nitric oxide , and release their stored granule contents , contributing both to host defence and to local tissue destruction . in a study designed to evaluate the clinical relevance of inflammatory cytokines , such as tnf and il1 in seminal plasma of infertile men , the levels of these cytokines correlated significantly with leukocyte counts ( 45 ) .
levels of ros can be reduced by augmenting the scavenging capacity of the seminal plasma with antioxidants ( 46 ) .
administration of antioxidants to infertile men has been reported to reduce oxidative stress in their sperm cells , improving motility , particularly in asthenospermic patients ( 47 ) .
although the advantage of micronutrients and antioxidant supplementations as interventions in male infertility remains controversial , in a previous study , an inverse relationship of sperm count and viability was seen in serum and seminal zinc levels , respectively in infertile african men ( 48 ) .
oxidants can also damage cells by starting chemical chain reactions such as lipid peroxidation , or by oxidizing dna or proteins ( 49 ) .
damage to dna can cause mutations and possibly cancer , and can be reversed by dna repair mechanism ( 5051 ) while damage to proteins causes enzyme inhibition , denaturation , and protein degradation ( 52 ) . in sperm cells ,
lipid peroxidation reduces membrane fluidity , resulting in the inhibition of normal cellular components for fertilization .
patients with high oxidative stress were found to have sperm with multiple genes and double genes dna strand breaks in their seminal fluid ( 53 ) .
sperm dna is usually protected by its compact organization and by antioxidants in the seminal plasma .
spermatozoa themselves are incapable of dna repair and must depend on the oocyte for repair after fertilization ; however , knowledge concerning the process remains limited ( 54 ) .
ros exposure may result in dna base modification , production of free base sites , deletions , frame shifts , dna cross links and chromosomal aberrations ( 5556 ) .
sikka ( 2004 ) reported that ros promoted apoptosis ( 57 ) , which may lead to a decrease in sperm viability and density .
it is not fully established if sperm apoptosis caused by oxidative stress can also be reversed . however , with proper molecular framework of apoptosis , specific apoptosis inhibitors may have a role in promoting germ cell survival .
current research is underway to identify the agents that may manipulate the apoptotic machinery for therapeutic benefits .
one should bear in mind that in the context of male infertility , seminal oxidative stress , sperm dna damage and apoptosis are interlinked and constitute a unified pathogenic mechanism .
the impact of these factors , their clinical significance and management options have always been a subject of controversy . despite few clinical trials reporting the positive effects of antioxidant administration on sperm dna integrity , such as n - acetyl cysteine ,
studies on apoptotic inhibitors have only been evaluated in vitro ; their efficacy still remains to be validated in vivo .
selenium was reported to protect against sperm dna damage and is required for normal testicular development , spermatogenesis , motility , and sperm function ( 59 ) .
selenium , an integral part of the antioxidant enzyme ; glutathione peroxidase was implicated to play important role in male fertility in a previous study ( 60 ) . assisted reproductive technologies ( arts ) , which include in vitro fertilization ( ivf ) , and
intracytoplasmic sperm injection ( icsi ) , currently been used to treat infertility may not be successful when semen samples that contain a high dna damage are involved .
levels of the oxidative dna damage marker , 8hydroxyl2deoxyguanosine have been reported to be elevated in infertile men ( 61 ) .
studies have associated a high rate of miscarriage after icsi , which possibly reflects the fact that compromised spermatozoa are sometimes used and they lead to irreparable dna damage in the embryo ( 62 ) .
in patients with obstructive azoospermia , spermatozoa are often surgically retrieved from epididymis or testicular tissue . in general ,
however , the use of testicular spermatozoa is preferred over epididymal spermatozoa , because the former have less dna damage and a better developmental potential ( 63 ) .
these include ( i ) ejaculatory duct obstruction : this is a common cause of male infertility and infections have been reported to be present in at least 2050% of these men ( 17 ) .
( ii ) epididymitis : this is the inflammation of the epididymis , a structure in the male reproductive system that joins the testes and the vas deferens .
inflammation of the epididymis may result in further complications such as scrotal swelling , pain , penile discharge and blood in urine .
( iii ) infections : inflammation results from sexually transmitted infections e.g. gonorrhoea , chlamydia , escherichia coli was reported to be the main cause of epididymitis in older men , but other types of bacteria including mycobacteria and ureaplasma may also cause this condition .
( iv ) urethritis : there could also be bladder or urethral infection that moves to the epididymis . in children , mumps and other viral infections
testicular torsion : this is a common problem affecting fertility that is caused by a supportive tissue abnormality which allows the testes to twist inside the scrotum which is characterized by extreme swelling .
( vi ) varicocoele : this is an enlargement of the internal spermatic veins that drain blood from the testicle to the abdomen ( back to the heart ) .
a varicocoele develops when the one way valves in the spermatic veins are damaged causing an abnormal back flow of blood from the abdomen into the scrotum creating a hostile environment for sperm development .
( vii ) several other causes include male urogenital obstruction , chronic prostatitis , inflammation of one or both testes ( orchitis ) , and drug therapy .
it is important to note that when any or the above processes occur in the male genital tract , the immune system will respond to the pathogens and possible tissue damage .
the collateral damage caused by this type of inflammation usually accumulates slowly , sometimes asymptomatically for years and further leads to tissue deterioration ( 18 ) .
the inflammatory system can be linked to a sprinkler system that prevents fire from spreading in a building .
while the intention of the process is to limit damage and restore function ( positive ) , the response itself can cause significant harm .
one undesirable consequence of inflammation , for example , is that some enzymes and toxic products contained within phagocytic tissues are inevitably released , damaging cells and tissues .
three principal changes occur when there is a case of acute inflammation ; an increased blood supply to the affected area , an increase in capillary permeability allowing larger serum molecules to enter the tissues and an increase in leukocyte migration into the tissue .
when there is a failure to eliminate the infectious agent , it leads to chronic inflammation .
this is characterized with recruitment and activation of macrophages , lymphocytes and other cells which trigger a coordinated action of cytokines .
in contrast to acute inflammation , where the host response leads to elimination of the irritant , followed by recovery involving tissue regeneration or repair , chronic inflammation is characterized by inflammation and repair occurring concurrently , rather than consecutively .
note that repair is always a feature of chronic inflammation because it is associated with irritants that cause destruction of tissue architecture .
repair is typically achieved by ingrowth of granulation tissue , which includes macrophages , fibroblasts and new blood vessels ( 19 ) .
the direct association between acute or chronic inflammation and the development of infertility constitute important issues in contemporary medicine .
the reduced semen quality during the inflammatory process can result from impairment of accessory gland functions , obstruction of sperm transport , and dysregulation of spermatogenesis ( 2021 ) .
inflammatory cytokines usually act locally , since they are produced by locally activated cells or produced temporarily after the stimulus has been activated . in male gonads ,
cytokines are also produced physiologically and have been reported to be involved in the normal function of the organ ( 2223 ) . in this respect , they appear as the natural components of seminal plasma ( 24 ) .
the main source of cytokines in the male gonad is testicular macrophages , although some cytokines ( il1 and il6 ) were also observed by some authors to be produced by leydig and sertoli cells ( 25 ) .
cytokines , particularly tnf , controls movement of leukocytes into tissues when there is tissue damage .
tnf is produced primarily by macrophages and other mononuclear phagocytes and has many functions in the development of inflammation and the activation of other leukocytes .
notably , tnf induces adhesion molecules and chemokines on the endothelium and activates the microbial systems of phagocytes .
inflammatory responses , which are operationally characterized by pain , redness , heat and swelling at the site of infection in the male genital tract reflect two types of changes in the seminal vesicles .
the first of these is an increase in diameter , leading to an increased local seminal flow hence the heat and redness and a reduction in the velocity of seminal flow , especially along the surface of local seminal vesicles .
inflammatory damage on the male genital tract leads to the increased generation of reactive oxygen species ( ros ) .
in addition , ros or free radical overproduction associated with inflammatory reactions may be caused by pathological , bacterial strains that colonize the reproductive tract ( 2728 ) .
free radicals are group of highly reactive chemical molecules with one or more unpaired electrons that can oxidatively modify bio - mole cules they encounter . reacting almost immediately with any substance in their environment , results in chains of reaction leading to cellular damage ( 29 ) .
( 2003 ) showed superoxide , hydroxyl and hydrogen hydroxide radicals as the major ros present in seminal plasma ( 30 ) .
to maintain normal cell function , excess ros must be continuously inactivated by seminal plasma antioxidants .
oxidative stress arises when excess free radicals overwhelm the antioxidant defence of the male reproductive tract ( 3132 ) , thereby damaging male reproductive tract .
it is interesting to note that seminal oxidative stress was earlier reported to correlate negatively with sperm concentration , motility and function ( 33 ) .
these observations also suggest that cytokines , mediators of oxidative damage may also have an impact on the quality of semen and male fertility .
the participation of some cytokines in the regulation of fertility is dependent upon their concentration ; for example , a study by naz and evans ( 1998 ) showed that interleukin 12 correlated with sperm density and sperm morphology ( 34 ) .
increased levels of interleukin 6 were also observed in infertile men by the same author in an earlier study conducted .
high levels of certain cytokines in semen are often linked with a decrease in the quality of the seminological parameters ( 35 ) .
more recent studies have shown increased tnf in semen to be associated with reduced sperm count , sperm motility , and sperm morphology ( 3637 ) . the increased levels of this cytokine cause apoptosis in semen as a result of proliferation and differentiation of beta cells , proliferation of t cells and natural killer cells .
interleukin1 alpha ( il1 ) and interleukin1 beta ( il1 ) also induce apoptosis in semen via proliferation and differentiation of beta cells , chemoattraction of leucocytes to the site of inflammation and induction of neutrophils and monocyte generation .
these cytokines were also observed to adversely affect quality of semen . in another study reported by the same author , increased levels of il1 were associated with a decrease in sperm motility ( 38 ) .
these results were associated with a simultaneous increase in seminal levels of reactive oxygen species as well as malondiadehyde ( mda ) ; a product of lipid peroxidation , consequent to oxidative damage .
the same cytokines that act as elements of immune modulation for the male gonad appear in large concentrations in semen during infection and when the tissues are damaged .
while some studies have associated with disturbed spermatogenesis ( 4142 ) , others have linked it to harmful influence of environmental factors ( 43 ) , and atypical sexual behavior ( 44 ) . under inflammatory conditions , white blood cells ( wbc ) in the semen leak from the site of infection or inflammation . in normal conditions ,
leukocytes are restricted to the center of seminal vesicles , where the flow is fastest . in inflammatory sites
, the blood vessels feeding the testis are dilated allowing the leukocytes to move out of the center of the blood vessels and interact with the vascular endothelium .
in addition to these changes , there is an increase in permeability , leading to the local accumulation of fluid hence the swelling and pain as well as the accumulation of immunoglobulins , complement and other semen proteins in the genital tract .
the migration of leukocytes out of the seminal vesicles depends on adhesive interactions activated by the release of inflammatory mediators . thus , infection or physical damage to male genital tract sets in motion the recruitment of phagocytic cells to the site of damage .
neutrophils exposed to tnf are activated to mediate a respiratory burst that generates oxygen radicals and nitric oxide , and release their stored granule contents , contributing both to host defence and to local tissue destruction . in a study designed to evaluate the clinical relevance of inflammatory cytokines , such as tnf and il1 in seminal plasma of infertile men , the levels of these cytokines correlated significantly with leukocyte counts ( 45 ) .
levels of ros can be reduced by augmenting the scavenging capacity of the seminal plasma with antioxidants ( 46 ) .
administration of antioxidants to infertile men has been reported to reduce oxidative stress in their sperm cells , improving motility , particularly in asthenospermic patients ( 47 ) .
although the advantage of micronutrients and antioxidant supplementations as interventions in male infertility remains controversial , in a previous study , an inverse relationship of sperm count and viability was seen in serum and seminal zinc levels , respectively in infertile african men ( 48 ) .
oxidants can also damage cells by starting chemical chain reactions such as lipid peroxidation , or by oxidizing dna or proteins ( 49 ) .
damage to dna can cause mutations and possibly cancer , and can be reversed by dna repair mechanism ( 5051 ) while damage to proteins causes enzyme inhibition , denaturation , and protein degradation ( 52 ) . in sperm cells ,
lipid peroxidation reduces membrane fluidity , resulting in the inhibition of normal cellular components for fertilization .
patients with high oxidative stress were found to have sperm with multiple genes and double genes dna strand breaks in their seminal fluid ( 53 ) .
sperm dna is usually protected by its compact organization and by antioxidants in the seminal plasma .
spermatozoa themselves are incapable of dna repair and must depend on the oocyte for repair after fertilization ; however , knowledge concerning the process remains limited ( 54 ) .
ros exposure may result in dna base modification , production of free base sites , deletions , frame shifts , dna cross links and chromosomal aberrations ( 5556 ) .
sikka ( 2004 ) reported that ros promoted apoptosis ( 57 ) , which may lead to a decrease in sperm viability and density .
it is not fully established if sperm apoptosis caused by oxidative stress can also be reversed . however , with proper molecular framework of apoptosis , specific apoptosis inhibitors may have a role in promoting germ cell survival .
current research is underway to identify the agents that may manipulate the apoptotic machinery for therapeutic benefits .
one should bear in mind that in the context of male infertility , seminal oxidative stress , sperm dna damage and apoptosis are interlinked and constitute a unified pathogenic mechanism .
the impact of these factors , their clinical significance and management options have always been a subject of controversy . despite few clinical trials reporting the positive effects of antioxidant administration on sperm dna integrity , such as n - acetyl cysteine , studies on apoptotic inhibitors
have only been evaluated in vitro ; their efficacy still remains to be validated in vivo .
selenium was reported to protect against sperm dna damage and is required for normal testicular development , spermatogenesis , motility , and sperm function ( 59 ) .
selenium , an integral part of the antioxidant enzyme ; glutathione peroxidase was implicated to play important role in male fertility in a previous study ( 60 ) .
assisted reproductive technologies ( arts ) , which include in vitro fertilization ( ivf ) , and intracytoplasmic sperm injection ( icsi ) , currently been used to treat infertility may not be successful when semen samples that contain a high dna damage are involved .
levels of the oxidative dna damage marker , 8hydroxyl2deoxyguanosine have been reported to be elevated in infertile men ( 61 ) .
studies have associated a high rate of miscarriage after icsi , which possibly reflects the fact that compromised spermatozoa are sometimes used and they lead to irreparable dna damage in the embryo ( 62 ) .
the degree of inflammations in other genital tract may also affect success rate . in patients with obstructive azoospermia , spermatozoa
however , the use of testicular spermatozoa is preferred over epididymal spermatozoa , because the former have less dna damage and a better developmental potential ( 63 ) .
varieties of disorders ranging from hormonal disturbances to physical problems , to psychological anomaly have been implicated in male infertility .
although many treatment options are now available , in many cases success rate is still low . often , male infertility is caused by infections and testicular damage with resultant inflammation .
inflammatory reactions within the male genital tract have a negative impact on sperm quality and consequently , infertility .
furthermore , the process of inflammation generates ros in addition to inherent oxidative stress generated by sperm cells increasing exerted toxic effects on human spermatozoa .
the imbalance between prooxidative and antioxidative substances in semen leads to metabolic and functional disorders of the male germ cells and may be a primary cause of some types of infertility .
art may be more successful when markers of oxidative stress and dna damage in semen , such as 8hydroxyl2deoxyguanosine are evaluated prior to insemination .
all possible interventions to abrogate or reduce the consequential effect of inflammation on male reproduction , particularly seminal oxidative stress , sperm dna damage and apoptosis will not only reduce male reproductive failure but may also increase success rate of assisted reproductive technology .
| fertility in the male is dependent on the proper production of sperm cells .
this process , called spermatogenesis is very complex and involves the synchronization of numerous factors .
the presence of pro inflammatory cytokines , tumor necrosis factor - alpha ( tnf ) , interleukin1 alpha ( il1 ) and interleukin 1 beta ( il1 ) cytokines in the male reproductive tract ( testis , epididymis and sperm ) may have certain physiological functions .
however , when the levels of these cytokines are higher than normal , as seen in conditions of inflammation , they become very harmful to sperm production .
moreover , inflammation is also associated with oxidative stress and the latter is well known to impair sperm function .
epidemiological studies regarding male infertility have revealed that more and more infertile men suffer from acute or chronic inflammation of the genitourinary tract , which often occurs without any symptoms .
the inflammatory reactions within the male genital tract are inevitably connected with oxidative stress .
oxidative stress , especially in sperm , is harmful because it damages sperm dna and causes apoptosis in sperm .
this article reviewed the suggested mechanisms and contribution of inflammation to male infertility .
in addition , the review was further strengthened by discussing how inflammation affects both fertility and assisted reproductive technologies ( art ) . |
we examined 2,696 mb ( 92.67% ) of the chimpanzee genome aligning with single regions in humans , removing assembly and alignment artifacts , segmental duplications , and other regions with complex genome histories ( supplementary information ) .
chimpanzee sequences aligning to macaque but not human were identified as human - specific deletions .
we identified 70.0 mb ( 2.41% ) of the chimpanzee genome as highly conserved by calculating the fraction of identical base pairs within multiple sequence alignments using a series of sliding window criteria ( supplementary table 1 ) .
hcondels were validated by searching for individual human sequence reads in the ncbi trace archives spanning predicted deletions ; and by testing 39 hcondels by experimental amplification from individuals of 23 human populations ( coriell cell repositories , supplementary information ) .
gene enrichments were analyzed using great ( great.stanford.edu)19 . for each ontology we ran 1,000 simulations over 510 size - matched random deletions overlapping one or more chimpanzee conserved elements to derive a multiple test p value threshold for enrichment .
functional enhancer assays were carried out by injecting chimp and mouse expression constructs into fvb embryos ( xenogen biosciences and cyagen biosciences ) and staining for lacz expression activity at different developmental stages ; or by transfecting chimp and mouse enhancer constructs into human foreskin fibroblasts ( system biosciences ) or rencell cx human neural progenitor cells ( chemicon ) , and comparing expression to human - deletion / control constructs using galacto - light plus ( applied biosciences ) ( supplementary information ) .
| humans differ from other animals in many aspects of anatomy , physiology , and behavior ; however the genotypic basis of most human - specific traits remains unknown1 .
recent whole genome comparisons have made it possible to identify genes with elevated rates of amino acid change or divergent expression in humans , and non - coding sequences with accelerated base pair changes2 - 5 .
regulatory alterations may be particularly likely to produce phenotypic effects while preserving viability , and are known to underlie interesting evolutionary differences in other species6 - 8 .
here we identify molecular events particularly likely to produce significant regulatory changes in humans : complete deletion of sequences otherwise highly conserved between chimpanzees and other mammals .
we confirm 510 such deletions in humans , which fall almost exclusively in non - coding regions and are enriched near genes involved in steroid hormone signaling and neural function .
one deletion removes a sensory vibrissae and penile spine enhancer from the human androgen receptor ( ar ) gene , a molecular change correlated with anatomical loss of androgen - dependent sensory vibrissae and penile spines in the human lineage9,10 .
another deletion removes a forebrain subventricular zone enhancer near the tumor suppressor gene growth arrest and dna - damage - inducible , gamma ( gadd45g)11,12 , a loss correlated with expansion of specific brain regions in humans .
deletions of tissue - specific enhancers may thus accompany both loss and gain traits in the human lineage , and provide specific examples of the kinds of regulatory alterations6 - 8 and inactivation events13 long proposed to play an important role in human evolutionary divergence . |
primary squamous cell carcinoma ( scc ) of the stomach is a rare type of gastric cancer . to date , only approximately 100 cases have been reported in the literature.1 because most of the literature is limited to single case reports ; the clinicopathologic characteristics , pathogenesis , best treatment option , and prognosis of patients with primary scc of the stomach are controversial and remain to be elucidated .
in addition , primary scc of the remnant stomach after gastrectomy is an extremely rare occurrence.2345 herein , we report a case of primary scc of the remnant stomach after subtotal gastrectomy , which was treated with surgical resection and systemic adjuvant chemotherapy .
a 65-year - old man was admitted to our hospital owing to epigastric discomfort and dizziness . in addition , he experienced syncope a few days before admission and an 8 kg loss of body weight during the past 2 months .
he also had a history of anti - hypertensive medication use for the past 16 years .
the patient had unremarkable family and social history and he appeared chronically ill . upon physical examination , the vital signs were stable ; however , he had pale conjunctiva
. any specific symptoms of gastrointestinal system involvement and signs of gross bleeding were not observed .
initial laboratory findings showed microcytic hypochromic anemia with very low levels of hemoglobin ( 5.9 g / dl ) and serum iron ( 15 g / dl ) .
the serum levels of the carcinoembryonic antigen and ca19 - 9 were 2.99 ng / ml and 6.4 ku / l , respectively .
a subsequent upper gastrointestinal endoscopy revealed a hemorrhagic and fungating tumor in the remnant stomach , near the previous gastrojejunostomy site ( fig .
an abdominal computed tomography ( ct ) scan showed a heterogeneous enhanced wall thickening at the suspected gastroenterostomy site combined with several small lymph nodes along the left gastric vessels , retroperitoneal space , and gastrocolic trunk without any evidence of intra - abdominal distant metastasis ( fig .
2 ) . positron emission tomography ( pet ) ct of whole body was performed to exclude the possibility of another primary tumor or distant metastasis .
a hypermetabolic mass was observed in the body of the stomach ( maximum standard uptake value : 21.7 ) without distant metastasis ( fig .
complete total gastrectomy was performed with standard d2 dissection of the lymph nodes and roux - en - y esophagojejunostomy .
gross distant metastasis , peritoneal seeding , or direct invasion into the adjacent organs was not observed .
when the resected specimen was opened , an approximately 10-cm ulcerofungating mass was observed just above the previous gastrojejunostomy site with a clear resection margin ( fig .
pathologic examination of the resected specimen revealed a keratinized well - differentiated scc with keratin pearl in the remnant stomach ( fig .
the tumor extended into the subserosal layer without lymphovascular invasion or metastasis to th5e9 regional lymph nodes ( t3n0m0 , tnm stage iia ) .
immunohistochemistry staining showed that the tumor cells were positive for p63 , k903 , and cytokeratin ( ck ) 5/6 ; and negative for ck 7 and ck 20 .
the patient received systemic adjuvant chemotherapy with 6 cycles of 5-fu and cisplatin regimen ( 1,000 mg / m of 5-fu on day 1~3 , 800 mg / m of cisplatin on day 2 , every 4 weeks ) and is still alive and recurrence - free at the 54-month follow - up .
primary scc of the stomach is a very rare malignant tumor that accounts for 0.04% to 0.07% of all gastric carcinomas.1678 since the first case of primary gastric scc was described in 1905 , less than 100 cases have been reported in the literature to date.1 in addition , scc of the remnant stomach following gastrectomy is extremely rare , and has been described in less than 5 reported cases.2345 because most reports on the primary gastric sccs are restricted to single case reports , the clinical features , pathologic characteristics , pathogenesis , optimal treatment method , and prognosis associated with the disease are controversial and remain to be elucidated .
parks9 proposed that primary gastric scc should satisfy the following diagnostic criteria : ( 1 ) the tumor must not be located in the cardia ; ( 2 ) the tumor must not extend into the esophagus ; and ( 3 ) there should be no evidence of scc in any part of the body.10 other diagnostic criteria were proposed by the japanese gastric cancer association , which included the following : ( 1 ) all tumor cells are scc cells , with no adenocarcinomatous components in any sections and ( 2 ) distinct evidence that scc arises directly from the gastric mucosa.11 the pathologic cell type , tumor location , and pet - ct findings of our patient were consistent with both diagnostic criteria .
although the pathogenesis of primary gastric sccs is still unknown , several hypotheses concerning the origin of the squamous cancer cell have been proposed , and are as follows : ( 1 ) squamous differentiation in the preexisting adenocarcinoma ; ( 2 ) squamous metaplasia of the gastric mucosa before malignant transformation ; ( 3 ) multipotent stem cells capable of differentiation into any cell type ; ( 4 ) nest of ectopic squamous epithelium in gastric mucosa ; ( 5 ) gastric vascular endothelial cell ; and ( 6 ) epstein - barr virus or human papilloma virus in some patients.157812131415 it has been reported that squamous metaplasia of the normal gastric mucosa could arise in special circumstances ( gastric ulcer , corrosive burn , congenital syphilis , chemoradiotherapy , and long - term treatment with cyclophosphamide).1617 for our patient , we carefully assumed that squamous metaplasia of the remnant gastric mucosa might have occurred owing to the continuous irritation from the bile as a result of gastrojejunostomy , from which cancer cells could have developed subsequently .
he reported that the mean age at onset was 64.7 years ( range , 29~81 years ) and the male - to - female ratio was 44:12 .
the tumor was most commonly located at the upper third of the stomach ( 57.1% ) .
the mean tumor size was 6.6 cm and the type 2 was most frequent macroscopic type .
more than half of the cases showed extension beyond t4 invasion ( t4a , 14% and t4b , 45% ) , which resulted in poor surgical curability .
gao et al.1 reported , through the review of the most recent 11 cases , that abdominal pain was the most frequently observed clinical presentation , the mean age was 63.8 years , and the mean tumor size was 8.2 cm .
recent studies suggested that the clinical characteristics of the primary gastric sccs are more evident in the 6th to 7th decades of life , show male predominance , are commonly located in the upper stomach , and have large tumor size and advanced stage at the time of diagnosis .
nevertheless , a case of a primary gastric scc in a 17-year - old boy has been reported.18 although the clinical manifestations of primary gastric sccs are similar to those of adenocarcinoma of the stomach , it might have unusual features .
our patient was admitted to the hospital owing to symptoms of chronic hemorrhage of the tumor .
other researchers have also reported hemorrhage to be the chief clinical presentation in patients with primary gastric scc.1619 primary gastric scc might resemble a submucosal mass on endoscopy ; therefore , it could be misdiagnosed as gastrointestinal stromal tumor or malignant lymphoma of the stomach.72021 huge exophytic growth , paraneoplastic leukocytosis , and hypercalcemia in primary gastric sccs also have been reported as rare clinical manifestations.10222324 histopathological criteria for the diagnosis of a primary gastric scc was defined by boswell and helwig6 in 1965 .
at least one of these criteria should be satisfied for the confirmation of diagnosis , which include keratinizing cell masses with keratin pearl , a mosaic cell arrangement , intercellular bridges , and high concentrations of sulfhydryl or disulphide bonds .
keratin pearl arranged in a mosaic pattern in the squamous cell masses confirmed the diagnosis of primary scc in the patient .
in addition , immunohistochemical staining of the squamous tumor cells revealed that they were positive for p63 , k903 , and ck 5/6 , which are indicative of scc and are negative for ck 7 and ck 20 ( for adenocarcinoma ) .
the standard treatment for primary gastric scc is radical gastrectomy with adequate lymph node dissection .
however , prognosis seems unfavorable compared to adenocarcinoma of the stomach , because primary gastric sccs are usually in the advanced stage at the time of diagnosis.178 surgery alone might be insufficient for achieving disease - free survival ; therefore , various adjuvant therapy regimens were administered for supportive treatment .
most results were not promising and an ideal chemotherapy regimen for the treatment of gastric scc has not been identified .
marubashi et al.25 and modi et al.26 reported the effectiveness of neoadjuvant chemotherapy for gastric scc , and yanagisawa et al.27 reported a complete response of primary gastric scc to chemotherapy with docetaxel and cisplatin plus 5-fluorouracil .
the patient is still alive after receiving adjuvant chemotherapy with fp and he was recurrence - free at the 54-month follow - up . considering the favorable response of scc to radiotherapy , chemoradiotherapy could be one of the treatment options . in conclusion ,
primary scc of the stomach is rare ; however , it might be aggressive , and its pathogenesis and the optimal treatment option remain to be elucidated . according to the treatment principles of gastric cancer | primary squamous cell carcinoma ( scc ) of the stomach is a very rare disease .
however , the pathogenesis , clinical characteristics , and prognosis of gastric scc are controversial and remain to be elucidated .
herein , we report a case of primary gastric scc of the remnant stomach after subtotal gastrectomy .
a 65-year - old man was admitted to our hospital due to epigastric discomfort and dizziness .
he had undergone subtotal gastrectomy 40 years previously for gastric ulcer perforation .
endoscopy revealed a normal esophagus and a large mass in the remnant stomach .
abdominal computed tomography revealed enhanced wall thickening of the anastomotic site and suspected metachronous gastric cancer .
endoscopic biopsy revealed scc .
total gastrectomy was performed with roux - en - y esophagojejunostomy .
a 10-cm tumor was located at the remnant stomach just proximal to the previous area of anastomosis .
pathologic examination showed well - differentiated scc extended into the subserosa without lymph node involvement ( t3n0m0 ) .
the patient received adjuvant systemic chemotherapy with 6 cycles of 5-fu and cisplatin regimen , and he is still alive at the 54-month follow - up . according to the treatment principles of gastric cancer , early detection and radical surgical resection can improve the prognosis . |
the development of t - cell - based interferon - gamma ( ifn- ) assays ( igras ) for mycobacterium tuberculosis ( mtb)-specific antigens represents a significant advance that is expected to replace the tuberculin skin test ( tst ) in screening for active tb disease or latent tuberculosis infection ( ltbi ) [ 13 ] .
these igras have demonstrated excellent specificity and shown a closer correlation with the exposure gradient than the tst [ 46 ] .
however , it is generally assumed that these tests , like tst , can not discriminate between active tb disease and ltbi .
the utility of these assays for monitoring disease activity and treatment response , or as predictors of the progression of ltbi to active tb disease , is currently the subject of ongoing research .
two commercial igras have recently become available , quantiferon - tb gold in - tube(cellestis ltd . , victoria , australia ) with elisa used to measure ifn- concentrations in supernatants , and the t-spot.tb test ( oxford immunotec , oxford , uk ) with an enzyme - linked immunospot ( elispot ) assay used to detect individual t cells producing ifn- [ 1 , 7 ] .
quantiferon tb-2 g ( qft-2 g ) is commonly used for the diagnosis of active tb disease or ltbi , but t-spot.tb or qft gold in - tube has not yet been approved in japan .
we therefore compared quantitative t - cell responses to mtb - specific antigens between cohorts of contacts with ltbi and patients with active tb disease using the commercial qft-2 g test .
one hundred eighty patients confirmed to be positive for mtb on culture of sputum , bronchoalveolar lavage fluid , peritoneal fluid , or lymph node tissue samples and a cohort of 50 screening contacts with ltbi ( positive qft-2 g response with or without a positive tst result ) drawn from the community were prospectively enrolled starting in january 2005 .
screening contacts with ltbi all had exposure histories to their index case 812 weeks earlier and all index cases were smear- and culture - positive for mtb using sputum specimens . however , none of these subjects with ltbi showed any clinical symptoms ( fever , cough , or sputum ) , abnormal inflammatory responses , or abnormal radiological findings suggesting pulmonary tb .
all patients with active tb disease showed negative findings on enzyme - linked immunosorbent assay ( elisa ) testing for hiv .
regarding subjects screened for contact with the index case , hiv testing was not performed , but subjects with a history of hiv infection were excluded from data analyses .
demographic data from patients with active tb disease and screening contacts with ltbi were collected , including any history of previous tb or antituberculous treatment , other underlying diseases , and administration of immunosuppressive drugs within 3 months before enrolment in this study .
a heparinized blood sample was collected by venipuncture from each patient for whole - blood ifn- assay .
0.1 ml of tuberculin ppd [ nippon bcg , equivalent to three tuberculin units ( tu ) of purified protein derivative solution ( ppd - s ) ] was injected intradermally into the volar aspect of the forearm , and the transverse induration diameter was measured 48 h later .
the results of the test were interpreted by hospital staff based on the patient s degree of risk , according to current guidelines
. a lower cutoff of 5 mm for a positive test was used for individuals .
the qft-2 g test was performed according to the manufacturer s recommendations , and the test result was judged according to cdc guidelines .
the test result was considered positive if the ifn- level in the sample well after stimulation with esat-6 and/or cfp-10 was 0.35 iu / ml , irrespective of the result for the positive control well .
the test was considered negative if the ifn- level was < 0.35 iu / ml and the ifn- level of the positive control well was 0.35 iu / ml .
the test result was considered indeterminate if the ifn- level was < 0.35 iu / ml in both antigen wells and < 0.5 iu / ml in the positive control well .
the qft-2 g test was performed for all patients before initiating the administration of antituberculous drugs .
redmond , wa ) and then transferred to santa software , version 7.0 ( santa , vienna , austria ) , for statistical analysis .
pearson s test was used to compare data from the two groups and mcnemar s test was used to compare paired data . the mann
one hundred eighty patients confirmed to be positive for mtb on culture of sputum , bronchoalveolar lavage fluid , peritoneal fluid , or lymph node tissue samples and a cohort of 50 screening contacts with ltbi ( positive qft-2 g response with or without a positive tst result ) drawn from the community were prospectively enrolled starting in january 2005 .
screening contacts with ltbi all had exposure histories to their index case 812 weeks earlier and all index cases were smear- and culture - positive for mtb using sputum specimens . however , none of these subjects with ltbi showed any clinical symptoms ( fever , cough , or sputum ) , abnormal inflammatory responses , or abnormal radiological findings suggesting pulmonary tb .
all patients with active tb disease showed negative findings on enzyme - linked immunosorbent assay ( elisa ) testing for hiv .
regarding subjects screened for contact with the index case , hiv testing was not performed , but subjects with a history of hiv infection were excluded from data analyses .
demographic data from patients with active tb disease and screening contacts with ltbi were collected , including any history of previous tb or antituberculous treatment , other underlying diseases , and administration of immunosuppressive drugs within 3 months before enrolment in this study .
a heparinized blood sample was collected by venipuncture from each patient for whole - blood ifn- assay .
, 0.1 ml of tuberculin ppd [ nippon bcg , equivalent to three tuberculin units ( tu ) of purified protein derivative solution ( ppd - s ) ] was injected intradermally into the volar aspect of the forearm , and the transverse induration diameter was measured 48 h later .
the results of the test were interpreted by hospital staff based on the patient s degree of risk , according to current guidelines
. a lower cutoff of 5 mm for a positive test was used for individuals .
the qft-2 g test was performed according to the manufacturer s recommendations , and the test result was judged according to cdc guidelines .
the test result was considered positive if the ifn- level in the sample well after stimulation with esat-6 and/or cfp-10 was 0.35 iu / ml , irrespective of the result for the positive control well .
the test was considered negative if the ifn- level was < 0.35 iu / ml and the ifn- level of the positive control well was 0.35 iu / ml .
the test result was considered indeterminate if the ifn- level was < 0.35 iu / ml in both antigen wells and < 0.5 iu / ml in the positive control well .
the qft-2 g test was performed for all patients before initiating the administration of antituberculous drugs .
redmond , wa ) and then transferred to santa software , version 7.0 ( santa , vienna , austria ) , for statistical analysis .
pearson s test was used to compare data from the two groups and mcnemar s test was used to compare paired data . the mann
one hundred thirty subjects screened after contact with index cases were included in this study protocol .
they consisted of 70 males and 60 females , and the mean age was 41.8 9.8 years ( range = 1876 ) .
the comparison of tst and qft-2 g test results for all contacts screened is shown in table 1 .
the tst induration diameter was larger than 5 mm in 78 ( 60% ) subjects , and 50 ( 38% ) showed positive qft-2 g test results .
while both tst and qft-2 g tests were positive in 34 screening contacts ( 26% ) , only the qft-2 g test was positive in 16 ( 12% ) and only the tst was positive in 44 ( 34% ) .
of all screening contacts , 50 subjects ( 38% ) fulfilled the inclusion criteria for ltbi in this study.table 1comparison of tst and qft-2 g test results for all contacts screened ( 130 cases)qft-2 g testtstpositivenegativetotalpositive34 ( 26%)16 ( 12%)50 ( 38%)negative44 ( 34%)31 ( 24%)75 ( 58%)indeterminate05 ( 4%)5 ( 4%)total78 ( 60%)52 ( 40%)130 ( 100%)tst tuberculin skin test , qft-2 g quantiferon tb-2 g comparison of tst and qft-2 g test results for all contacts screened ( 130 cases ) tst tuberculin skin test , qft-2 g quantiferon tb-2 g a comparison of tst and qft-2 g test results for patients with active tb disease is shown in table 2 . the positive response rate on tst did not significantly differ between all subjects screened after contact ( 60% ) and those with active tb disease ( 63% ) . the positive response rate to the qft-2 g test was significantly higher in patients with active tb disease ( 83% ) than in all screening contacts ( 38% ) .
the positive response rate to the qft-2 g test ( 83% ) was significantly higher than to the tst ( 63% ) in patients with active tb disease .
the positive response rate to the qft-2 g test ( 38% ) was significantly lower than to the tst ( 60% ) in all screening contacts.table 2comparison of tst and qft-2 g test results for patients with active tb disease ( 180 cases)qft-2 g testtstpositivenegativetotalpositive114 ( 63%)36 ( 20%)negative011 ( 6%)indeterminate019 ( 11%)total114 ( 63%)66 ( 37%)tst tuberculin skin test , qft-2 g quantiferon tb-2 g comparison of tst and qft-2 g test results for patients with active tb disease ( 180 cases ) tst tuberculin skin test , qft-2 g quantiferon tb-2 g in 180 patients with active tb disease , acid - fast smear results of samples were positive in 93 patients ( 52% ) and negative in the remaining 87 patients . the clinical characteristics of the 50 screening contacts with ltbi and the 180 patients with active tb disease are shown in table 3 . there were no significant differences in the clinical characteristics between ltbi and active tb disease patients except for age , sex , and underlying disease including respiratory disease.table 3clinical characteristics of 50 screening contacts with latent tuberculosis infection ( ltbi ) and 180 patients with active tuberculosis ( tb ) diseaseclinical characteristicsltbi ( n = 50)active tb disease ( n = 180)p valueage ( years ) ( mean sd)41.6 9.563.8 10.60.010sex ( male : female)24:26140:400.022smoking history30 ( 60%)120 ( 67%)0.768alcohol abuse history6 ( 12%)32 ( 18%)0.356underlying disease18 ( 36%)133 ( 74%)0.035 respiratory disease5 ( 12%)61 ( 34%)0.038 healed pulmonary tb0 ( 0%)20 ( 11%)0.008 copd2 ( 4%)13 ( 7%)0.320 others4 ( 8%)28 ( 16%)0.101 nonrespiratory disease13 ( 26%)72 ( 40%)0.070 gastrointestinal disease4 ( 8%)18 ( 10%)0.755 diabetes mellitus3 ( 6%)15 ( 8%)0.842 cancer1 ( 2%)14 ( 8%)0.084 cardiovascular disease3 ( 6%)13 ( 7%)0.893 collagen vascular disease1 ( 2%)7 ( 4%)0.396 chronic renal failure0 ( 0%)5 ( 3%)0.108immunosuppressive treatment1 ( 2%)13 ( 10%)0.061received bcg vaccination34 ( 63%)116 ( 64%)0.867received tb treatment0 ( 0%)29 ( 16%)0.008laboratory data wbc count ( cells/l)4620 5434058 5180.350 lymphocyte count ( cells/l)1036 92916 870.402 total protein ( g / dl)6.9 1.06.4 0.80.346 albumin ( g / dl)3.7 0.83.3 0.60.367with hemodialysisall patients received corticosteroid therapy clinical characteristics of 50 screening contacts with latent tuberculosis infection ( ltbi ) and 180 patients with active tuberculosis ( tb ) disease all patients received corticosteroid therapy concerning the comparison of qft-2 g test results related to combined and separate responses to esat-6 and cfp-10 antigens for ltbi and active tb disease , the positive response rate for both esat-6 and cfp-10 antigens was significantly lower in community contacts with ltbi than that in patients with active tb disease . the positive response rates for esat-6 only and for cfp-10 only were lower in patients with active tb disease than in screening contacts with ltbi ( table 4).table 4comparison of the qft-2 g test results related to the combined and separate responses to esat-6 and cfp-10 antigens for patients with ltbi and active tb diseaseqft-2 g testltbi ( n = 50)active tb disease ( n = 180)p valueesat-6 only positive22 ( 44%)49 ( 27%)0.077cfp-10 only positive24 ( 48%)51 ( 28%)0.048esat-6 and cfp-10 positive4 ( 8%)50 ( 28%)0.026total50 ( 100%)150 ( 83%)0.564qft-2 g quantiferon tb-2 g comparison of the qft-2 g test results related to the combined and separate responses to esat-6 and cfp-10 antigens for patients with ltbi and active tb disease qft-2 g quantiferon tb-2 g the ifn- level in the response to esat-6 and cfp-10 antigens for screening contacts with ltbi and patients with active tb disease is shown in table 5 .
the ifn- levels for esat-6 and cfp-10 antigens were significantly higher in patients with active tb disease ( ifn- level for esat-6 : 1.24 0.30 iu / ml , ifn- level for cfp-10 : 1.58 iu / ml ) than in screening contacts with ltbi ( ifn- level for esat-6 : 0.61 0.20 iu / ml , ifn- level for cfp-10 : 0.72 0.21 iu / ml).table 5ifn- level ( u / ml ) in response to esat-6 and cfp-10 antigens for patients with ltbi and active tb diseaseqft-2 g testltbi ( n = 50)active tb disease ( n = 180)p valueesat-60.61 0.20 ( 0.354.25)1.24 0.30 ( 0.2010.62)0.010cfp-100.72 0.21 ( 0.354.60)1.58 0.36 ( 0.2411.90)0.008qft-2 g quantiferon tb-2 g ifn- level ( u / ml ) in response to esat-6 and cfp-10 antigens for patients with ltbi and active tb disease qft-2 g quantiferon tb-2 g
we noted a significant reduction in the positive response rate for both esat-6 and cfp-10 antigens in screening contacts with ltbi than in patients with active tb disease , and the quantitative t - cell responses to esat-6 and cfp-10 antigens were significantly higher in patients with active tb disease than in those with ltbi using the qft-2 g assay . in previous reports , janssens et al . and
chee et al . reported a significant difference in the quantitative values of t-spot.tb responses between active tb cases and contacts with positive t-spot.tb responses , with a large overlap in the range of values .
although chee et al . did not identify a significant difference in the quantitative values using the qft gold - in - tube assay in previous reports , we found a significant difference in quantitative qft-2 g responses between the two groups in this study , consistent with the findings in a previous report by higuchi et al . .
higuchi et al . also indicated that the geometric mean of the ifn- production level in the active tb disease group was significantly larger than that in the ltbi group , and the combined parameters of esat-6 and cfp-10 significantly contribute to the active tb disease risk for infected subjects using the qft-2 g test .
differences in the sensitivity of t-spot.tb and qft-2 g assays in immunocompromised patients have been well reported .
although both assays measure t - cell ifn- responses to the mycobacterium tuberculosis ( mtb)-specific antigens esat-6 and cfp-10 after overnight stimulation , the measurement of ifn- levels in whole blood in the qft-2 g assay [ as opposed to measuring the number of ifn--producing t cells in a standardized number of peripheral blood mononuclear cells ( pbmcs ) using t-spot.tb ] may render this assay less sensitive than t-spot.tb .
regardless of this hypothesis , there was a significant difference in quantitative qft-2 g responses between active tb cases and screening contacts with ltbi in this study .
while the median ifn- level in response to esat-6 and cfp-10 antigens in patients with active tb disease was more than two times higher than that of screening contacts with ltbi , the large overlap in the range of values between these two groups suggests that isolated qft-2 g results would not be useful as a diagnostic method to discriminate between active tb disease and ltbi .
first , because there is no gold standard for the diagnosis of ltbi , cases with active tb disease may have been missed among screening contacts with presumed ltbi .
however , this is highly unlikely since all of the subjects demonstrated normal clinical and radiological findings .
indeed , there were no missed cases of active tb disease detected during the subsequent 3 years of follow - up .
second , because there were significant differences in the frequency of patients with underlying disease and mean age of both groups ( table 3 ) , these factors have influenced the quantitative response of ifn- for both mtb - specific antigens in this study .
third , the present definition of ltbi is arbitrary . indeed , there is no gold standard for defining ltbi .
igra results correlate better with exposure than tst results ; the lifetime risk of active tb disease based on igra results only currently remains unknown .
the clinical situation resulting from the present cdc recommendations was investigated ; subjects considered as having probable ltbi were detected by a positive qft-2 g test result despite negative tst results . although the t-spot.tb test has been used as an igra , janssens et al . indicated that studying only t-spot.tb-positive subjects or t - spot.tb- and tst - positive subjects did not significantly alter the results according to prevailing guidelines .
fourth , we used the qft-2 g test as an igra in this study because the qft-2 g assay is currently the only igra commercially available in japan .
newer commercial assays such as t-spot.tb ( oxford - immunotec ) and quantiferon - tb gold in - tube ( cellestis ) have many differences and may provide higher levels of sensitivity . indeed , harada et al .
reported that the sensitivity of the qft gold in - tube test ( 93% ) was significantly higher than that of the qft-2 g test ( 81% ) , although the specificities of both tests were the same ( 99% ) .
we think that the qft gold in - tube or t-spot.tb should be approved and made commercially available for the supportive diagnosis of active tb disease and ltbi . in conclusion
, we demonstrated significant differences in the quantitative responses of ifn- to mtb between patients with active tb disease and those with ltbi in this study .
however , there is an overlap in the ifn- levels between active tb disease and ltbi groups .
therefore , it would be difficult to use the qft-2 g test to completely discriminate active tb disease from ltbi .
a large - scale longitudinal study that investigates this important potential use of igras test is awaited . | through the use of quantiferon - tb gold , a commercial ifn- assay , we compared differences in quantitative t - cell responses to mycobacterium tuberculosis ( mtb)-specific antigens [ quantiferon tb-2 g ( qft-2 g ) ] between patients with active tuberculosis ( tb ) disease and those with latent tb infection ( ltbi ) .
the patient group consisted of 180 patients with active tb disease ( culture - positive for mtb ) and 50 screening contacts with ltbi - positive response to the qft-2 g test .
we prospectively performed a tuberculin skin test ( tst ) and a qft-2 g test for all subjects .
the median ifn- levels upon the application of both antigens , esat-6 and cfp-10 , were significantly higher in patients with active tb disease than in those with ltbi . a combined positive response to both antigens occurred at a higher rate in patients with active tb disease than in those with ltbi .
there were no significant relationships between the quantitative responses of ifn- to both antigens and the maximum induration on tst in both patient groups .
we demonstrated significant differences in the quantitative responses of ifn- to mtb between patients with active tb disease and those with ltbi in this study .
however , there was an overlap in the ifn- levels between active tb disease and ltbi groups .
therefore , it would be difficult to use the qft-2 g test to completely discriminate active tb disease from ltbi . |
during brain development , postmitotic neurons migrate from their site of origin to distant places , differentiate , and make connections forming different layers of the cortex .
defects in this process results in abnormal neuronal positioning and connections in the brain , which may cause neurobehavioral problems later in life .
neuritogenesis , an early step of neuron differentiation , is the synthesis of multiple growth cone tipped extensions ( neurites ) that ultimately form the axons and dendrites of neurons .
cell surface integrin receptors , each consisting of an and a subunit , play critical roles in the glial - guided migration of neurons in the brain .
the extracellular domains of the receptor subunits bind with extracellular matrix ( ecm ) proteins ( such as fibronectin and laminin ) and the cytosolic domains of subunits interact with kinases , adaptor molecules , and the cytoskeleton .
these interactions facilitate the outside - in and the inside - out signaling across the cell membrane by the integrin heterodimers that may lead to cell migration and neuritogenesis .
integrin receptors with explicit combinations of and subunits interact with specific ecm proteins .
developing brains express 1 , 1 , 3 , 4 , 5 , 6 , and v integrin subunits which may form 11 , 31 , 41 , 51 , 61 , and v1 integrin receptors [ 8 , 9 ] .
of all these receptors , the 11 , 31 , and 61 receptors interact with laminin , whereas 41 , 51 , and v1 receptors interact with fibronectin .
manipulation of integrin subunits 3 and 5 genes in mice causes abnormal positioning of neurons in the cerebral cortex , and nullifying the 6 gene results in cortical laminar defects [ 3 , 1012 ] .
these studies suggest that integrin receptors consisting of 1 subunit ( 31 , 51 , and 61 ) are involved in the migration of neurons in the brain .
this is also in accordance to a large number of reports describing the role of integrin receptors consisting of 1 subunit in neuron migration and neuritogenesis [ 1316 ] .
however , studies involving the ablation of 1 integrin subunit gene in mice [ 1720 ] suggest that this integrin subunit is required for the glial end feet anchorage and is not essential for neuron - glia interactions and glial - guided migration of neurons during brain development .
moreover , additional studies indicate that 1 integrin subunit is involved not in the migration but the differentiation of glia and neurons [ 2 , 2022 ] .
therefore , to date , the studies on the role of 1 subunit containing integrins ( 31 , 51 , and 61 ) in the migration of fetal brain neurons have been largely inconclusive . experiments with antibodies against integrin subunits or inhibitors of integrin signaling in slice cultures [ 2326 ] are also not free from the indirect effects that may influence the migration and differentiation of neurons .
therefore , in the present study , neurons were isolated from 16.5 gestation days fetal cerebral cortices of rats for the direct examination of the role of molecules that are known to regulate the integrin - mediated cell migration . because different ecm molecules are secreted by radial glial cells during development [ 27 , 28 ] , initially different concentrations of laminin and fibronectin were examined on the migration of fetal cortical neurons .
the propensity of subunits forming integrin receptor / s with the 1 subunit to support migration was examined by using the same concentration of antibodies against different subunits at which the migration of neurons was significantly inhibited by antibody against 1 subunit .
roles of different intracellular molecules ( src kinase , phospholipase c , calcium , protein kinase c , mek kinase , and microtubules ) that are known to support integrin - mediated migration of different cell types [ 2931 ] were examined on neuron migration by using pharmacological inhibitors or intracellular calcium chelator .
the roles of 1 and 3 integrin subunits , the intracellular molecules , and the calcium chelator were also examined on neuritogenesis .
time pregnant long - evans rats were obtained from charles river ( boston , ma ) .
animals were housed in the animal facility of the university of mississippi medical center on chow and water ad libitum and used for studies according to a protocol approved by the institutional animal care and use committee of the university of mississippi medical center .
hanks ' balanced salt solution ( hbss ) , dulbecco 's modified eagles medium and f12 medium ( df ) , b-27 , trypsin inhibitor , mouse laminin , bovine fibronectin , nuclear stain hoechst 33342 , magnesium sulphate , trypsin , and cell culture tested dimethyl sulfoxide were purchased from sigma - aldrich chemical company , st .
molecular weight markers used in western blot studies were obtained from bio - rad laboratories ( hercules , ca ) .
monoclonal antibodies against the extracellular domains of integrin subunits were obtained from different commercial sources in no - azide formulations or freed from sodium - azide using nanosep centrifugal devices ( pall life sciences , ann arbor , mi ) .
additional information on these antibodies as well as those used in the immunofluorescent staining and western blotting experiments ( see below ) is provided in table 1 .
inhibitors against different enzymes that are known to regulate integrin signaling in different cell types and modulators of intracellular calcium levels are mentioned in table 2 .
briefly , on gestation days 16.5 , pregnant rats were deeply anesthetized with isoflurane , fetuses were removed from uteri , and cerebral cortices of fetal brains were dissected out as described previously .
cerebral cortices were incubated in hbss containing 0.1% trypsin for 15 min at 37c .
cortices were triturated in hbss containing 0.025% dnase i , 0.2% trypsin inhibitor , 0.2% bsa , and 12 mm mgso4 and centrifuged at 160 g. the resulting pellet was suspended in hbss and centrifuged .
supernatant was discarded and the pellet was suspended in the culture medium dmem / f-12 ( 1 : 1 ) containing 0.2% b-27 to estimate the number using a hemacytometer ( hausser scientific , horsham , pa ) . the neurons were used for migration assays and also cultured on laminin - coated wells of 8 chambered glass slides ( thermo fisher scientific , houston , tx ) for immunofluorescent microscopy and neuritogenesis assays or in flasks ( fisher scientific ) for western blotting and rna isolation .
the boyden chamber assay that has been successfully used for estimating the migration of fetal brain neurons previously by different laboratories [ 39 , 4143 ] was used for this study .
specifically , the boyden chamber assay for studying fetal cerebral cortical neurons of maeda and noda ( 1998 ) was used with some modifications .
transwell inserts ( diameter 6.5 mm ) , each consisting of polycarbonate membranes with 3.0 m pore size with pore density 2 10/cm ( fisher scientific ; pittsburgh , pa ) were used for migration assays .
undersurface of membranes of transwell inserts was first coated with poly d lysine ( 10 g / ml ) overnight and then with solution ( 100 l ) of laminin , fibronectin , or only water ( diluent of laminin or fibronectin solutions ) and dried overnight in sterile conditions prior to use . in all migration assays ,
the lower chamber contained 500 l of culture medium ( controls ) or medium containing antibody against integrin subunit , inhibitor , or calcium chelator ( see below ) and the upper chamber contained 200 l of medium containing 150,000 dissociated neurons .
plates containing the boyden chamber assemblies were incubated for 18 h in an incubator ( 37c , 5% co2 , humidity 99% ) . at the end of incubation ,
membranes were treated with chilled 4% paraformaldehyde solution for 20 min and the neurons on the upper surface of the membranes were removed by rubbing with cotton swabs twice .
preliminary experiments were conducted to ensure that rubbing technique removes all neurons from the upper surface of membrane and the incubation time that provided adequate number of neurons for migration assays .
membranes were cut and processed for the immunofluorescent detection of neuronal nuclei and neuronal marker map2 expression as described below ( see section 2.10 ) .
all migration assays were performed at least three times with two boyden chamber assemblies per experimental conditions .
images of different fields vertically and across ( total 9 ) of each membrane were captured at 10x magnification .
total numbers of nuclei from each image of controls and experimental groups were counted using the counting tool of the metamorph software to determine the number of nuclei per membrane for analysis .
relative roles of ecm proteins ( laminin and fibronectin ) on the migration of dissociated neurons were examined by coating poly - d lysine treated membranes with different concentrations of laminin ( 1 , 5 , 10 , 20 , and 50 g / ml ) or fibronectin ( 10 , 20 , 50 , 100 , and 200 g / ml ) in sterile water .
medium containing neurons ( 150,000 ) were added in the upper chamber and the lower chambers contained medium only .
chambers were incubated for 18 h and the neurons on the undersurface of the membranes were counted as described above .
relative roles of different integrin subunits with respect to 1 subunit on the migration of neurons were examined using functional blocking antibodies .
azide - free monoclonal antibody against different integrin subunits , control igg , or igm were added in the medium of lower chamber .
upper chamber contained neurons ( 150,000 ) in the medium ( 200 l ) .
neurons on the lower surface of membranes were counted at the end of 18 h incubations as described above .
initial experiments were conducted with monoclonal antibodies against 1 integrin subunit to determine the concentration ( 50 nmole ) that significantly inhibited the migration of neurons at p < 0.05 on laminin ( 10 g / ml ) .
relative effects of monoclonal antibodies against additional integrin subunits at ( 50 nmole ) were tested on the migration of neurons on laminin ( 10 g / ml ) or fibronectin ( 100 g / ml ) coated membranes . these antibodies ( see table 1 ) are tested for their efficacy by the supplier and also reported for their interaction with integrin subunits on cell surface and inhibition of cell adhesion [ 4450 ] .
involvements of different intracellular signaling molecules in the migration of neurons were examined using pharmacological inhibitors .
this included inhibitors pp2 , u-73122 ( u2 ) , pd98059 ( pd ) , calphostin c , 2-apb , and ruthenium red against src family of tyrosine kinases , plc activation , map kinase kinase , protein kinase c , ip3-induced calcium release , and calcium induced calcium release from ryanodine receptors , respectively
. role of intracellular calcium on migration was examined using the chelator bapta - am .
inhibitors ( pp2 , u2 , 2-apb , and pd ) or control compounds u-73343 ( u3 ) and pp3 and intracellular calcium regulators ( bapta - am and ruthenium red ) were added in the medium of lower chamber .
the concentrations of these pharmacological compounds , their target and relevant references , are mentioned in table 2 .
roles of integrin subunits , intracellular signaling molecules and calcium on neuritogenesis were examined using antibodies , pharmacological inhibitors , and calcium chelators . wells of 8 chambered glass slides were coated with gelatin ( 12 h at 4c ) followed by laminin ( 10 g / ml ) ( 12 h at 4c ) . dissociated neurons ( 100,000 ) were cultured in wells in the absence ( control ) or presence of monoclonal antibody ( table 1 ) , inhibitor , or calcium modulators ( table 2 ) for 20 h and bright - field images ( 6/well = 3 vertical and 3 across ) of neurons were captured .
high contrast images were captured for visualization and tracing of neurites with the tools of metamorph software .
experiments were repeated to collect data from at least 3 wells per control and treatment conditions ( 18 images / treatment condition ) .
role of intracellular calcium on the expression of microtubules was examined using different concentrations of calcium chelator bapta - am ( 0 , 5 , 10 , and 20 m ) by immunofluorescent microscopy ( see below ) .
expression of neuron markers ( neun and map2 ) and microtubules were examined in the dissociated neurons by immunofluorescent microscopy .
briefly , at the completion of paraformaldehyde treatments , neurons on the undersurface of membranes or in the wells of eight chambered slides were treated with triton ( 0.1% ) for 10 min and rinsed with pbs prior to incubating with the primary antibody solution in phosphate buffer saline ( pbs ) containing bovine serum albumin ( bsa ) ( 1 mg / ml ) overnight at 4c
. dilution of primary antibodies for the detection of neun , microtubules , and map2 in pbs - bsa solutions were 1 : 10 , 1 : 200 , and 1 : 1000 , respectively . membranes or wells were rinsed with pbs three times ( 15 min each ) and then incubated with alexa dye conjugated secondary antibody ( 10 g / ml ) and nuclear stain hoechst 33342 ( dilution 1 : 200 ) .
fluorescent images were captured using a nikon eclipse ( te-2000 u ) microscope .
expression of transcripts representing different integrin subunits in the fetal cortical neurons , cultured on laminin - coated flasks for 7 h , was examined using rt - pcr in three occasions . in each experiment , the total rna ( 1 g ) isolated from the neurons using trizol - reagent ( invitrogen , carlsbad , ca ) was subjected to complementary dna ( cdna ) synthesis using a reverse transcription iii kit ( invitrogen ) .
equal amounts ( 50 ng equivalent ) of cdna samples were amplified by pcr . the primer sequences ( table 3 ) were either obtained from the literature [ 5153 ] or subjecting the rat or homologous regions of mice and human cdna sequences ( genbank ) to primer3 software ( http://flypush.imgen.bcm.tmc.edu/primer/primer3_www.cgi/ ) .
authenticity of these primers was tested by pcr using cdna from rat and human cell lines ( rat pc12 and cardiac myoblasts ; human trophoblast and colon cancer cell lines ) that produced expected size amplicons with no spurious bands .
identity of amplicons representing 3 and 9 integrin subunit was confirmed by commercial sequencing ( retrogen , inc . , sandiego , ca ) .
a previously described western blotting methodology was used to examine the expressions of phosphorylated plc-1 in the dissociated neuronal preparations cultured on laminin - coated flasks for 6 h. clear lysatefrom neurons containing 10 g proteins were denatured by boiling in the presence of lane marker buffer ( pierce ) and subjected to electrophoresis on a 7.5% polyacrylamide gel containing sodium dodecyl sulphate .
molecular weight markers ( bio - rad ) were also loaded in adjacent lanes . at the end of electrophoresis separated proteins
were transferred on to nitrocellulose membranes and probed with primary antibodies against phosphorylated plc-1 and -actin ( table 1 ) .
the experiment for the detection of phosphorylated plc- was tested using 3 different neuron preparations .
analysis of the neuronal migrations and neuritogenesis was conducted by anova using spss software ( spss , chicago , il ) .
neuron migrations were assayed by comparing the mean standard errors of mean values of the number of neuronal nuclei from 9 fields under each boyden membrane of total 6 to 9 membranes per treatment group .
the neuritogenesis was examined by comparing the mean standard errors of mean values of the neurite lengths from 6 fields per well ( total 3 wells of each control and treated groups ) .
differences in mean standard errors of mean values at p < 0.05 were considered significant .
the number of neurons isolated per pair of cortices by the described method was approximately 5 10 neurons ( n = 7 ) .
these neurons attached with the laminin - coated wells and majority ( approximately 95% ) expressed neuronal marker neun ( figure 1 ) , and when incubated in boyden chambers for 18 h , migrated at the undersurface of the membranes and expressed neuronal marker map2 ( figure 2 ) .
migration of cortical neurons was higher on membranes coated with 5 , 10 , 20 , or 50 g / ml laminin than those coated with only 1 g / ml laminin or no laminin .
highest migration of neurons occurred on membranes coated with 10 g / ml laminin .
the migration of neurons on membranes coated with 20 , 50 , 100 , or 200 g / ml fibronectin was higher than those coated with 10 g / ml fibronectin or no fibronectin .
the migration of neurons on membrane coated with 100 or 200 g / ml fibronectin was not significantly different ( p > 0.05 ) .
further studies on the migration of neurons were conducted with membranes coated with poly - d lysine followed by 10 g / ml laminin or 100 g / ml fibronectin ( see below ) .
antibody against 1 or 3 integrin subunit significantly decreased migration of neurons on laminin - coated membranes ( p < 0.05 ) .
antibody against 6 subunit did not alter the migration of neurons on laminin - coated membranes .
moreover , the migration of neurons was not altered by control antibody ( igg or igm ) or the antibody against the v subunit ( negative control on laminin ) on laminin - coated membranes .
on fibronectin - coated membranes , only antibody against 1 subunit inhibited the migration ( p < 0.05 ) .
the migration of neurons on fibronectin - coated membranes was not altered by control antibodies ( igg or igm ) , and antibodies against 3 ( negative control since not expressed ) , 4 , 5 , or v subunits .
pp2 ( the inhibitors of src kinase activation ) , u2 ( the inhibitor of plc activation ) , and the light - activated calphostin ( the inhibitor of pkc activation ) inhibited the migration of neurons on both laminin- and fibronectin - coated membranes ( p < 0.05 )
. migrations of neurons were not significantly altered in the presence of map kinase kinase ( mapk / erk kinase or mek ) inhibitor pd , control compounds u3 or pp3 on laminin , or fibronectin - coated membranes ( p > 0.05 ) .
the inhibitor of ip3 receptor - induced calcium release from intracellular stores ( 2-apb ) and the intracellular calcium chelator bapta - am inhibited the migration both on laminin- and fibronectin - coated membranes .
ruthenium red , the inhibitor of intracellular calcium - induced calcium release from ryanodine receptor containing calcium stores , did not alter the migration of neurons .
neuritogenesis was not inhibited in the presence of control antibodies ( igg ) at 50 nm ( figure 6(a ) ) and even at higher concentration ( 100 nm ) , ( figure 6(b ) ) .
bapta - am completely abolished the neurite formation at higher concentration ( 10 m ) , ( figure 6(a ) ) .
the inhibitors of src kinase ( pp2 ) , plc- respectively ( u2 ) , ip-3 induced calcium release ( 2-apb ) , protein kinase c ( activated calphostin ) , map kinase kinase ( pd ) , and the calcium chelator ( bapta - am ) significantly reduced the neurite lengths ( figure 6(c ) ) .
neuritogenesis was not inhibited in the presence of control compounds of pharmacological inhibitors ( pp3 and u3 ) or the inhibitor of ryanodine receptor mediated release of intracellular calcium ( ruthenium red ) ( figure 6(c ) ) .
bapta - am decreased the expression of microtubules in cortical neurons ( figure 7 ) .
western blotting experiments with lysate prepared from neurons at 6 h of culture provided evidence for the presence of plc-1 in its phosphorylated state at tyrosine 783 ( figure 8) .
neurons at 6 h of culture expressed mrna for 1 , 1 , 3 , 4 , 5 , v , and 9 integrin subunits ( figure 9 ) .
cortical neurons isolated from rat fetal ( gd16.5 ) brains expressed subunits for integrin receptors and responded to cues of both laminin and fibronectin during their migration in vitro .
these neurons utilized the intracellular signaling molecules and cytoskeletal elements that are known to transmit integrin receptor signaling during cell migration and differentiation . at the same concentrations ,
the effects of inhibitors and intracellular calcium modulators were more robust on neuritogenesis than on migration .
membranes coated with laminin or fibronectin enhanced the migration of fetal cortical neurons ( figure 3 ) .
it was evident that laminin at a 10-fold lower concentration supported the migration better than fibronectin suggesting that laminin may be a better substrate for the migration of fetal brain neurons .
this observation is consistent with the migration pattern of neuronal precursors derived from embryonic stem cells .
optimum adhesion with the ecm is critical for the normal migration of cells [ 54 , 55 ] .
therefore , the enhanced migration of neurons with the increased concentration of laminin and its downregulation with further increase in laminin ( figure 3(a ) ) indicates that the pace and the direction of neuron migration in the fetal brain may be regulated by the amount of specific ecm molecule secreted by glial cells on the migratory route .
inhibition studies with monoclonal antibodies to examine the relative roles of different integrin subunits on migration suggested that the receptor consisting of 3 and 1 subunits ( 31 ) primarily regulates the migration of fetal cortical neurons on laminin ( figure 4(a ) ) .
this is also in accordance with previous observations [ 3 , 10 , 15 ] .
in addition , the lack of effects of antibody against the 6 integrin subunit on the 61 mediated migration is also consistent with the absence 6 subunit in fetal cortical neurons ( figure 9 ) and the lack of any direct evidence for its role in the migration of fetal cortical neurons .
on fibronectin - coated membranes , only the antibody against 1 subunit inhibited the migration of neurons and antibodies against the subunits ( 3 , 4 , 5 , or v ) that are the constituent of fibronectin - binding receptors ( 31 , 41 , 51 , and v1 ) did not inhibit the migration ( figure 4(b ) ) although the rt - pcr ( figure 9 ) results confirmed their expression .
this finding indicates that the migration of fetal cortical neurons on fibronectin may be regulated by 1 subunit containing integrin receptor / s other than 31 , 41 , 51 , and v1 .
the role of tenascin in the glial guided migration of fetal cortical neurons is further supported by the fact that tenascin is expressed by the radial glia in the developing brain and transcripts of 9 subunits are expressed in fetal cortical neurons ( figure 9 ) , which also forms the tenascin interacting 91 integrin receptor .
while the antibody against v subunit is reported to inhibit the migration of fetal cortical neurons in an imprint assay , it failed to inhibit the migration on fibronectin - coated membranes in the boyden assay ( figure 4(b ) ) .
the role of integrin receptors consisting of v subunits ( v1 , v5 , or v8 ) in the migration of fetal cortical neurons is further lessened by the fact that vitronectin , the substrate for these receptors , is primarily expressed in the proximity of blood capillaries and the ablation of v subunit expression by gene manipulation only disturbs the development of blood vessels and axonal survival but not neuronal positioning .
it is surprising , however , to find no effect of antibody against 5 subunit on migration of neurons ( figure 4(b ) ) because its genetic manipulation at gd15.5 in mice causes laminar defects .
application of different pharmacological inhibitors revealed that the intracellular molecules that mediate integrin signaling ( figure 10 ) and known to regulate migration of various cell types are fully functional in the fetal cortical neurons .
these included src kinase , that is activated by focal adhesion kinase following the interaction of integrin receptors with the ecm ; phospholipase c , that is activated by the activated src kinase , and hydrolyses membrane protein pip2 ( phosphotidal inositol biphosphate ) into inositol ( 1,4,5)-triphosphate ( ip3 ) and diacylglycerol ( dag ) [ 60 , 61 ] ; protein kinase c , that is activated by the dag , and the calcium released from the ip3 receptor containing stores .
the plc-1 interacts directly with the cytoplasmic tail of the 1 integrin subunit and induces cytoskeletal organization and integrin mediated migration of cells .
integrin mediated cell adhesion promotes rapid autophosphorylation of tyr-397 residue in focal adhesion kinase ( fak ) promoting its interaction with the c - terminal sh2 domain of plc-1 and associating with the src kinases at the site of integrin - ecm interactions .
this causes phosphorylation of tyrosine residue 783 ( tyr783 ) and the activation of plc-1 required for the integrin mediated upregulation of intracellular calcium and migration of cells .
western blotting data ( figure 8) confirmed the presence of the activated form of plc-1 isoform in the fetal cortical neurons suggesting its possible interaction with the cytoplasmic tail of the 1 integrin subunit in fetal cortical neurons .
previous studies report that pkc and atypical pkc regulate migration of neuronal precursors in the fetal cerebral cortex [ 66 , 67 ] and different pkc isoforms ( pkc , pkci , pkcii , pkc , pkc , and pkc ) support migration of cells by associating with 1 integrin subunit
. robust reduction of migration in the presence of pkc inhibitor ( calphostin c ) ( figure 5 ) shows that the activated state of pkc isoform / s in fetal cortical neurons is required for their migration on both laminin and fibronectin . even though the integrin and growth factor receptor cross - talk
is reported to play a significant role in the migration of various cell types , the mek inhibitor pd98059 did not alter the migration of fetal cortical neurons significantly ( figure 5 ) but rigorously reduced neuritogenesis ( approximately 14 fold ) ( figure 7(c ) ) .
this suggests that the migration of fetal cortical neurons is primarily regulated by integrin mediated pathways , whereas the differentiation of these neurons is regulated by both integrin and growth factor signaling ( figure 10 ) .
the sustained expression of certain adaptor / s ( such as ilk , pinch , and paxillin ) that are required for cross - talk between integrin and growth factor receptors during differentiation but not migration of fetal cortical neurons may instruct such effects .
interestingly , ilk is required for the differentiation of bergmann glia during the cerebellar development .
the reduced migration of neurons in the presence of bapta - am ( figure 5 ) confirmed previous observations that intracellular calcium is an indispensable mediator for the migration of fetal brain neurons . on the other hand ,
no effects of high concentration ( 50 m ) of ruthenium red on migration are in contrast to the finding that integrin - mediated signaling mobilizes calcium from the ryanodine receptor gated stores .
the neuritogenesis data showed that the integrin receptor consisting of 3 and 1 subunits also regulates neuritogenesis in rat fetal cortical neurons .
the present study further shows that the signaling molecules that mediate the migration of fetal cortical neurons ( src kinase , plc- , protein kinase c , ip-3 induced calcium release , and the intracellular calcium itself ) also regulate the process of neuritogenesis albeit more robustly than migration ( figures 5 and 6(c ) ) .
furthermore , inhibition of neuritogenesis by bapta at a moderate concentration ( 2.5 m ) , its total abolition at higher concentration ( 10 m ) ( figure 6(a ) ) , and reduction in microtubule expression ( figure 7 ) suggest that intracellular calcium not only regulates the dynamics of microtubule dynamics but may also maintain its intracellular levels .
rat fetal cortical neurons ( isolated at gd16.5 ) are fully equipped with the integrin receptor and the classical intracellular signaling cascade ( figure 10 ) to maneuver their migration and neuritogenesis in vitro .
precisely , the laminin - binding 31 integrin receptor and intracellular signaling molecules drive both the migration and neuritogenesis while the cross - talk of integrin with growth factor signaling may add to more robust signaling towards the differentiation process .
the detection of 9 subunit transcripts in fetal cortical neurons indicates that migration of fetal cortical neurons on radial glia may be supported by tenascin via the 91 integrin receptor .
these results suggest that the composition of extracellular matrix in the path of migration and specific repertoire of integrin receptors regulates the dynamics of migration of neuronal precursors in the developing brains .
the present study also indicates that calcium may regulate the migration of fetal cortical neurons also by maintaining the optimum supply of microtubules .
additional studies are now required to delineate the exclusive role of each downstream molecule in the outside - in and inside - out integrin signaling that mediates the migration and neuritogenesis of fetal cortical neurons .
this includes estimating the surface expression of each integrin subunit by flow cytometry and to examine the relevant concentrations of each antibody in the presence or absence of different combinations of pharmacological inhibitors as well as sirna manipulation of components of integrin and growth factor signaling .
moreover , restoring the migration and neuritogenesis of neurons by activating different kinases following their inhibition by antibodies and/or pharmacological inhibitors may also be required to further ascertain their role .
additional studies are also required to identify the pkc isoform / s that regulates the migration and neuritogenesis of fetal cortical neurons , the roles of 1 and 9 integrin subunits , that are the constituent of laminin - binding 11 and tenascin - binding 91 integrin receptors respectively , the manipulation of molecules that regulate cross - talk between integrin and growth factor signaling ( such as ilk , paxillin , and pinch ) , and the semaphorins ( specifically of semaphorin 7a ) that influence axon outgrowth and activation of mapk .
finally , in the perspective of results obtained by experimenting directly with fetal cortical neurons in culture and those describing no changes in the migration of neurons in 1 integrin mutant ( in vivo studies ) mice [ 18 , 19 ] , it is conceivable that the acute effects of monoclonal antibody on the neurons in culture ( an in vitro test ) may not be compensated which may occur in gene manipulation ( in vivo ) studies .
it is also possible that the migration machinery of fetal cortical neurons in mice , which was used for gene manipulation studies by other investigators , may not be exactly similar to rat that was used in the current study .
even though the findings of in vitro studies presented here have their limitations , conclusions of previous gene manipulation studies [ 1719 ] indicating that the 1 subunit is involved in glial differentiation but not in the glial - guided migration of neurons may not be stringent as data presented here show that fetal cortical neurons do utilize 1 and 3 integrin subunits and the intracellular molecules , that are known to support integrin signaling , for their migration . | the roles of integrin subunits and intracellular molecules in regulating the migration and neuritogenesis of neurons isolated from 16.5 gestation days rat fetal cortices were examined using in vitro assays .
results showed that laminin supported the migration of fetal cortical neurons better than fibronectin and that the fetal cortical neurons migrated on laminin using 1 and 3 integrin subunits which make up the 31 integrin receptor .
on fibronectin , the migration was mediated by 1 integrin subunit .
perturbation of src kinase , phospholipase c , or protein kinase c activity , inhibition of ip3 receptor mediated calcium release , or chelation of intracellular calcium inhibited both migration and neuritogenesis , whereas inhibition of growth factor signaling via mek inhibited only the neuritogenesis .
the detection of 1 and 9 transcripts suggested that the migration of fetal cortical neurons may also be mediated by 11 and 91 integrin receptors .
results showed that calcium may regulate migration and neuritogenesis by maintaining optimum levels of microtubules in the fetal cortical neurons .
it is concluded that the fetal cortical neurons are fully equipped with the integrin signaling cascade required for their migration and neuritogenesis , whereas crosstalk between the integrin and growth - factor signaling regulate only the neuritogenesis . |
metastatic tumours to the oral cavity from distant organs are uncommon and represent approximately 1 - 3% of all oral malignancies .
such metastases can occur to the bone or to the oral soft tissues [ 1 - 4 ] .
the mandible is affected more frequently than the maxilla , with a predilection for the areas distal to the canines , including the body and ramus
. however , primary metastases to the soft tissues are extraordinarily rare , about 0.1% of oral malignancies .
the most common site for oral soft tissue metastases is the gingiva , which accounts for slightly more than 50% of all cases .
this is followed by the tongue , which is the site for 25% of cases , lips , and the buccal and palatal mucosa .
almost any malignancy from any site is capable of metastasizing to the oral cavity , and a wide variety of tumours has been reported to spread to the mouth .
furthermore , organs of the gastrointestinal tract , particularly the stomach , have been described in few instances .
in this article , we present three clinical cases , a female with invasive lobular breast carcinoma and two males with gastric adenocarcinoma and small cell lung carcinoma respectively , which metastasized to the oral cavity .
a 68-year - old female was referred to the department of oral and maxillofacial surgery of
theageneio cancer hospital of thessaloniki , complaining of pain over the right half of the mandible .
intraoral examination showed a hard swelling over the posterior corpus and the ramus of the mandible . in the radiological examination with orthopantomographic radiograph ( figure 1 ) ,
the trabecular pattern and bone density of the right mandibular body and ramus were distinctly altered .
diffuse osteolytic defect sites in the right half of the mandible were observed on the computed tomography ( ct ) of the head and face ( figure 2 ) .
orthopantomographic radiograph , showing the radiolucent lesion at the right mandibular body and ramus ( arrows ) .
a computed tomography cross section of skull showing the diffuse osteolytic defect sites in the right half of mandible .
patient s medical history revealed that a partial mastectomy with axillary node dissection of levels i and ii for the treatment of invasive lobular carcinoma was performed about 9 years before .
the postoperative histology report showed an invasive lobular carcinoma with metastatic infiltration in 15 of 22 lymph nodes .
both estrogen ( er ) and progesterone ( pr ) receptors were positive and c - erbb-2 negative .
overall , the carcinoma was staged as t2n3m0 and was treated with postoperatively chemotherapy and radiotherapy . under local anaesthesia
the histological results supported evidence of metastatic invasive lobular carcinoma ( figure 3 ) . subsequently , a static scintigraphic image of the whole body was obtained .
bone scintigraphy showed isotope ( technetium tc 99 m ) accumulation in the right half of the mandibular body , and occipital bone .
a = the neoplasm was composed of atypical non - cohesive cells individually arranged in a single - file linear pattern immersed in a fibrous stroma ( hematoxylin and eosin stain , original magnification x200 ) .
b = single - file linear cords of atypical cells with plenty of pale cytoplasm and typical lack of cohesion were observed throughout the lesion ( hematoxylin and eosin stain , original magnification x400 ) .
c = immunohistochemical staining for low - molecular - weight keratin confirmed the nature of the neoplastic cells ( original magnification x200 ) .
d = strong estrogen receptor , immunohistochemical expression in many neoplastic cells ( original magnification x200 ) .
follow - up radiological examination by means of orthopantomography , almost 2 years after the mandibular metastases showed a pathologic fracture near the angle of the mandible without any other clinical findings , pain or movement ( figure 4 ) .
orthopantomographic radiograph , showing the pathologic fracture near to the angle of the mandible ( arrows ) .
a 71-year - old male patient was referred to our department for consultation presenting with a main complaint of swelling in the anterior teeth space in the mandible .
about 1 month earlier the patient visited his dentist because of a small swelling at the same region and mobility of the left mandibular central incisor .
this was treated as a periodontal lesion by his dentist and the tooth was extracted .
the patient s previous medical history included subtotal gastrectomy with billroth ii anastomosis about 2 years before due to gastric adenocarcinoma .
of 52 dissected nodes of omentum ( greater and lesser ) , 26 nodes were cancer positive .
the patient received continuous 5-fluorouracil in combination with cisplatin postoperatively . under oral examination the patient presented with poor oral hygiene and a soft exophytic swelling over gingival , measuring 2 x 2 cm with pinkish white colour , presenting a necrotic area of the distal margin and irregular surface .
it was attached to the alveolar mucosa by a wide base ( figure 5 ) .
simple radiological study by means of orthopantomography highlighted ( figure 6 ) a radiolucent lesion of the mandible in the left anterior teeth space .
intraoral photography showing the metastatic lesion in the anterior teeth space of the mandible .
orthopantomographic radiograph , showing the radiolucent lesion of the mandible in left anterior teeth space .
the patient was admitted to the hospital and a marginal mandibulectomy in the anterior aspect of the oral cavity was performed ( figure 7 , figure 8) .
the surgical defect was repaired by primary closure of the mucosa of the floor of the mouth to the mucosa of the lower lip .
marginal mandibulectomy specimens : a = anterior - inferior surface ; b = posterior surface ; c = superior surface .
a = the tumour infiltrates the mucosa in the form of irregular islands and sheets ( yellow arrow ) .
lobules of minor salivary glands ( red arrow ) ( hematoxylin and eosin stain , original magnification x40 ) .
b = low magnification showing a poorly differentiated adenocarcinoma , characterized by solid and trabecular growth with isolated glandular structures ( hematoxylin and eosin stain , original magnification x100 ) .
c = the tumour infiltrates beneath a surface squamous epithelium ; the mucosa at the right is partly ulcerated ( hematoxylin and eosin stain , original magnification x100 ) .
the mitotic rate is high ( hematoxylin and eosin stain , original magnification x200 ) .
a clinical and radiological follow - up examination yielded no complication almost 2 months after the surgery ( figure 10 and figure 11 ) .
a 69-year - old male patient was referred to the theageneio cancer hospital of thessaloniki with a complaint of increasing dyspnea and right - sited pleurodynia in august 2014 .
the ct scan of the chest revealed a right lung mass invading the mediastinum and the subcarinal bronchial obstruction .
an abdominal ct scan showed multiple focal hypodense lesions of the liver and a solitary lesion of the spleen .
bone scintigraphy showed isotope ( technetium tc 99 m ) accumulation in the 5th lumbar ( l5 ) vertebra .
fiberoptic bronchoscopy revealed an endobronchial mass in the bronchus of the right superior and middle lobes .
after confirmation of diagnosis , a chemotherapeutic regime of carboplatin and etoposide was selected . during his hospitalization
the patient presented continuous epigastric pain and a gastroscopy was performed which showed a gastric polypoid lesion .
this lesion was histologically reported to be a metastasis from sclc with identical morphological and immunohistochemistry pattern to the lung tumour ( lmw - keratin + , ck7 + , ttf1 + , focally positive for chromogranin and synaptophysin ) .
unfortunately following the treatment , the patient presented to our department for consultation showing a swelling of the anterior gingival of the mandible .
this was a self - reported rapid growing lesion over two weeks time enlarged to the point that interfered with his mastication , causing bleeding and pain .
the patient presented with poor oral hygiene and a soft exophytic lesion over gingival , measuring 4 x 5 cm with pinkish white colour and irregular surface .
it was attached to the alveolar mucosa with a wide base ( figure 12 ) .
simple radiological study by means of orthopantomography highlighted a radiolucent lesion in the right site of the mandible and anterior teeth dislocation ( figure 13 ) .
orthopantomographic radiograph , showing the radiolucent lesion of the mandible and anterior teeth dislocation .
the intraoral lesion was biopsied under local anaesthesia and the histopathology report revealed a high grade neuroendocrine carcinoma with elements of both small and large cell lung carcinoma ( figure 14 ) . due to the development of the oral metastasis , the patient exhibited a marked inability to masticate
however , due to patient s deterioration of the general clinical condition the surgery was postponed .
tumour cells are densely packed , with scant cytoplasm , finely granular nuclear and absence of nucleoli ( hematoxylin and eosin stain , original magnification x400 ) .
c = large cell component of the neoplasm has more cytoplasm and prominent nucleoli ( hematoxylin and eosin stain , original magnification x400 ) .
the oral cavity is an uncommon site for metastatic tumours and it may occur both in the oral soft tissues or the jawbones .
because of their rarity , metastatic tumours to the oral region , pose a challenge for accurate diagnosis [ 4,8 - 12 ] . not infrequently , metastatic lesions are the first indication of an undiscovered primary malignancy .
hirshberg et al . showed in a review of 673 cases with metastatic oral lesions that these were the first indication of an undiscovered primary malignancy in 23% of cases . in our cases the primary tumour was already diagnosed before the oral metastatic lesion appeared .
metastatic tumours to the jawbones are more frequently reported than those in the oral mucosa [ 3,8,12 - 15 ] and the ratio is approximately 2.5:1 . in zachariades review of 422 metastatic oral cavity lesions , only 12 ( 2.8% ) involved soft tissues of the oral cavity .
however , patients with metastases to the jawbones are younger than those with metastases to the oral soft tissues . according to some metaanalyses ,
the gender distribution of oral metastases is either predominantly male , approximately 2:1 , respectively or almost equal , approximately 1.1:1 .
the range of time between diagnosis of the primary tumour and detection of oral metastatic disease is from 2 months to 3 years .
the clinical presentations of the metastases include the pain , swelling , ulcer , trismus , paraesthesia , increasing tooth mobility , loose teeth , delayed healing of an extraction socket , masticatory difficulties , dysphagia , dyspnoea and pathological fracture .
paraesthesia in the mandibular metastasis is reported to be located in the area innervated by the mandibular alveolar dental nerve .
gingival metastases usually appear as a polypoid or exophytic mass , highly vascularized and hemorrhagic [ 4,6,7,10,17,19 - 28 ] .
the differential diagnosis includes hemangioma , pyogenic granuloma , giant - cell granuloma , peripheral fibroma , adenoid squamous cell carcinoma , polymorphous low - grade adenocarcinoma that affects the minor salivary glands of the mouth [ 2,4,9,11,12,14,15,19,21,22,27,29 - 41 ] . in our second case ,
the gingival lesion was first diagnosed as an inflammatory lesion and treated with tooth extraction and antibiotics , but the patient s symptoms deteriorated despite the treatment . because such symptoms can mimic both benign and malignant lesions , biopsy and radiographic examination are indicated .
primary malignancies from immediately adjacent tissues might be able to spread by a lymphatic route as well .
however , such a mechanism can not explain metastases of tumours from lower parts of the body , which are almost certainly blood - borne and should be filtered out by the lungs .
batson proposed the valveless vertebral venous plexus as a mechanism for bypassing filtration through the lungs .
namely an increase in the intrathoracic pressure directs the blood flow into this system from the caval and azygous venous system and accounts for the increased distribution of axial skeleton and head and neck metastasis .
the pathogenesis of the metastatic process in the jawbones is not clear , since they do not have much of active bone marrow , especially in elderly persons .
additionally , remnants of hematopoietic marrow can be found in an edentulous jaw in cases of focal osteoporotic bone marrow defects .
these hematopoietically active sites may attract metastatic tumour cells . in the oral soft tissues the metastatic tumours to the oral soft mucosa
are found in the attached gingiva , whereas in edentulous patients , metastatic lesions are equally distributed between the tongue and the alveolar mucosa .
the rich capillary network of chronically inflamed gingiva has been suggested as a mechanism that entraps malignant cells .
the most common histological type of metastatic tumours to the oral and maxillofacial region is adenocarcinomas , particularly breast adenocarcinoma which often metastasizes to the mandible or maxilla . on the other hand , gastric adenocarcinoma infrequently metastasizes to the oral cavity with an extremely rare incidence . in the last 5 decades only 19 cases ,
the prognosis for metastatic neoplasms to the oral cavity is poor with an average survival period of about several months [ 6 - 9,16,22,23,30,35,37 - 39,44 - 47 ] .
a local excision may be performed to control pain , prevent bleeding and infection , and restore function .
radiotherapy can potentially aid in local symptoms control for a few months , while some cases may benefit from chemotherapy , even in disseminated disease .
a complete evaluation of other organs is also important to formulate a treatment plan , as oral lesions may represent part of multiple metastases .
they usually present with symptoms similar to odontogenic infections and benign tumours , causing a delayed diagnosis and treatment .
consequently , careful examination and a high degree of clinical suspicion as well as a multidisciplinary approach are suggested , when examining patient with a personal history of malignancy .
| abstractbackgroundmetastatic tumours to the oral cavity from distant organs are uncommon and represent approximately 1 - 3% of all oral malignancies .
such metastases can occur to the bone or to the oral soft tissues .
almost any malignancy from any site is capable of metastasis to the oral cavity and a wide variety of tumours have been reported to spread to the mouth.methodscareful examination of the oral cavity and a high degree of clinical suspicion as well as a multidisciplinary approach are suggested.resultsin this article we present three patients , a female and two males with metastatic tumours to the oral cavity , who were referred to our department .
the primary tumours were invasive lobular breast carcinoma , gastric adenocarcinoma and small cell lung carcinoma respectively.conclusionsmetastases to the oral cavity are quite uncommon among population .
they usually present with symptoms similar to odontogenic infections and benign tumours , causing a delayed diagnosis and treatment . |
antitubercular therapy with the first line drugs is very effective and well - tolerated with only few major adverse reactions .
cutaneous adverse drug reactions ( cadr ) with antitubercular treatment ( att ) can make further management of tb challenging .
isoniazid is the first - line antitubercular drug par excellence and an essential component of all antitubercular regimens unless the patient is intolerant to it , or bacilli show resistance .
most common adverse effects of isoniazid are peripheral neuritis and hepatitis , which are more common in alcoholics and older patients , but cadr are rare with incidence of < 0.001% to maximum of 3/1000 patients treated .
a 63-year - old indian woman was diagnosed as a case of pulmonary tb when she was evaluated for fever and cough with expectoration .
she was started on the first - line antitubercular drugs as per directly observed treatment short course regimen for tb .
after 8 weeks of att , she reported to dermatology department of our hospital , for complaints of acute onset erythema along with severe itching all over the body for the last 710 days .
dermatological examination revealed generalized involvement of the body with extensive nonuniform dusky erythematous scaly plaques involving the scalp , face , nape of the neck , trunk , arms , legs , palms , and soles [ figure 1 ] .
furthermore , the pruritic plaques were first noted on trunk and legs which increased in size and coalesced to involve the entire body in a few days .
scalp lesions formed red - yellow scales with hair loss [ figure 1 ] . on palms and soles ,
erythematous scaly plaques on legs and scalp with hair loss there was no history of any other drug intake , or history of jaundice , chest pain , palpitation , and dyspnea on exertion .
there was no preexisting dermatosis or prior exposure to chemical precipitants of dermatitis or any other medical problem .
the patient improved over a period of 12 weeks with decreased erythema and a significant reduction in scaling [ figure 2a ] .
( a ) dechallenge showing improvement ( b ) rechallenge fresh lesions with isoniazid on rechallenge after 2 weeks of stopping att , individual drugs were reintroduced in a sequential manner starting with ethambutol , followed by pyrazinamide , then rifampicin , and isoniazid at last at an interval of 1 week between the drugs .
prior to isoniazid rechallenge , she did not develop any signs of cadr but on introducing isoniazid , she rapidly developed similar erythematous lesions with intense itching within 48 h [ figure 2b ] .
isoniazid was withdrawn and diagnosis of isoniazid induced erythroderma was made . at present , the patient was given symptomatic treatment with topical emollients and oral antihistaminics .
the lesions subsided in 1 week , and the patient was prescribed alternative regimen of att excluding isoniazid .
the causality assessment was certain on who - umc causality assessment scale ; whereas probable on naranjo 's scale ( score 7 ) for isoniazid .
the severity of adr was found to be moderate ( level 3 ) as per the modified hartwig and siegel scale .
erythroderma is an intense generalized redness of the skin , first described by von hebra in 1868 .
it is an inflammatory disorder and an extreme state of dysmetabolism characterized by extensive erythema and scaling all over the body classically involving more than 90% of the body surface .
it is of great concern because of significant risk of morbidity and mortality owing to dysmetabolism and its complications , in addition to the risks inherent to the underlying disease and its therapy .
various causes of erythroderma in adults include pre - existing eczema , psoriasis , lymphoma , leukemia , and drugs such as phenylbutazone , hydantoin derivatives , carbamazepine , sulfonamides , penicillins , cimetidine , diltiazem , dapsone , allopurinol , gold salts , and lithium .
exposure to the causative drug may last for 2 weeks to several months before the reaction emerges .
drug - induced erythroderma has the best prognosis among all the causes of erythroderma often resolving in 26 weeks . in the present case ,
the patient presented with erythema and scaling involving more than 90% of the body surface area along with itching within 8 weeks of att .
however , the patient developed exfoliative dermatitis again after rechallenge test with isoniazid and improved after stopping it leading to the diagnosis of isoniazid - induced erythroderma .
prompt resolution of the lesions after withdrawal of the att and start of oral antihistaminics further supported the diagnosis .
the patient was now prescribed rifampicin 450 mg , pyrazinamide 1500 mg , ethambutol 1000 mg , and levofloxacin 750 mg for a period of 2 months in intensive phase followed by levofloxacin 750 mg , rifampicin 450 mg for a period of 4 months in continuation phase .
the underlying pathogenesis of this hypersensitivity , whether immune - mediated and/or toxic in nature , is unclear .
predisposing factors for hypersensitivity reactions to att include hiv infection , polypharmacy , advanced age , autoimmune disease , and renal or liver impairment . in a large tertiary care center study on cadr with antitubercular drugs , pyrazinamide was the most common offending drug ( 2.38% ) , followed by streptomycin ( 1.45% ) , ethambutol ( 1.44% ) , rifampicin ( 1.23% ) , and isoniazid ( 0.98% ) .
in contrast to the findings of the above - mentioned study , pyrazinamide , ethambutol , and rifampicin were well - tolerated by our patient ; however , she developed reaction to isoniazid .
there are many case reports of exfoliative dermatitis with other antitubercular drugs ; but , to the best of our knowledge , only 3 cases of erythroderma induced by isoniazid alone is reported so far .
higher incidence of tb and cadr in hiv - infected persons poses a challenge for clinicians , particularly in high hiv - prevalence settings .
it is important to recognize the cadrs to att so that severe and potentially life - threatening adverse reaction can be identified and managed early .
it is equally important to continue att in minor cadrs so that patients suffering from tb can be cured and rendered noninfectious as early as possible from uninterrupted att along with prevention of development of drug resistance . to conclude , erythroderma as a rare but potentially fatal drug reaction with isoniazid .
hence , cautious use of isoniazid can help in early identification and management of this adr .
| tuberculosis is a common infectious disease in developing countries .
isoniazid is established the first - line antitubercular drug and an essential component of all antitubercular regimens .
erythroderma caused by isoniazid is an uncommon but serious adverse drug reaction .
we report here a case of a 63-year - old female patient who presented with generalized redness and scaling with itching after 8 weeks of antitubercular treatment ( att ) .
att was stopped immediately , and antihistaminics were started . the patient improved over a period of 2 weeks . on sequential rechallenge
, she developed similar lesions all over the body with isoniazid , hence confirming the diagnosis of isoniazid - induced erythroderma . |
anaesthesia for pituitary tumours booked for non neurosurgical surgeries is a challenge to an anaesthesiologist with the risk of sudden change in intracranial dynamics during administration of spinal anaesthesia or during laryngoscopy , intubation and extubation .
here we report anaesthetic management for elective lower segment caesarian section ( lscs ) with previous pituitary tumour resection one with residual tumour done under general anaesthesia .
a 24-year - old female weighing 65 kg and height of 156 cm , with 38 weeks of gestation with history of complete transphenoidal resection of functioning pituitary macroadenoma ( growth hormone and prolactin secreting ) two years ago was posted for elective lscs .
airway examination done two days prior to lscs suggested a difficult intubation with mallampati class iii , macroglossia , prominent neck fold in the nape and a protruding mandible .
she had no history of snoring . all heamatological , biochemical and hormonal investigations were unremarkable .
magnetic resonance imaging ( mri ) of the brain done at 30 weeks showed tumour encasing left internal carotid artery with no evidence of raised intra cranial pressure ( icp ) .
monitors ( pulse - oximeter , electrocardiogram , capnometer and non invasive blood pressure ) were attached .
rapid sequence induction was done using thiopentone sodium and rocuronium , intravenous lignocaine 1.5 mg / kg was used to suppress the stress response .
laryngoscopy was done using macintosh blade size 4 to find cormacke lehane grade ii and cuffed endotracheal tube ( i d 7.0 mm ) was passed .
intravenous lignocaine 1.5 mg / kg was used for smooth emergence and patient was extubated once fully awake .
the pituitary gland is located at the base of the skull in the sella turcica .
the hypothalamus regulates hormone release from the anterior pituitary through hypothalamic releasing and inhibiting factors that reach the anterior pituitary by a complex portal vascular system .
the anterior pituitary secretes at least seven hormones while the posterior pituitary stores and secretes two hormones , antidiuretic hormone and oxytocin . functioning pituitary adenomas produce an excess of the anterior pituitary hormones .
other less common pituitary tumours are growth hormone secreting lesions resulting in acromegaly ; adenocorticotropic hormone ( acth ) secreting tumours causing cushing 's disease and a very rare thyroid - stimulating hormone ( tsh ) secreting lesion resulting in hyperthyroidism .
prolactinomas may produce the amenorrhea - galactorrhea syndrome in females . as the pituitary lesion compresses the pituitary tissue , the sequence in which hormonal function is lost is gonadotrophins ; growth hormone ; acth and tsh .
patients with acromegaly exhibit a general overgrowth of skeletal , connective and soft tissues leading to enlargement of hands , prognathism and macroglossia .
thickening of laryngeal and pharyngeal soft tissues and vocal cords , reduction in size of laryngeal aperture , hypertrophy of uvula , epiglottic fold and recurrent laryngeal nerve palsy also occur .
all major organs increase in size , including the heart , lungs , liver , thyroid and kidneys .
these patients require preoperative evaluation and management of coronary artery disease , cardiomyopathy with arrhythmias , hypertension ( 30% ) , diabetes ( 25% ) and electrolyte imbalances .
upper airway obstruction with sleep apnoea is a major cause of laryngeal airway obstruction and central depression .
therefore , the risk of death from respiratory failure is threefold greater in patients with acromegaly .
as glucocorticoids are also necessary to facilitate renal excretion of a water load , diabetes insipidus is usually not observed in the patient with pituitary insufficiency until cortisol replacement therapy is instituted .
preoperatively , the patient with panhypopituitarism will be receiving oral steroid and levothyroxine therapy and , when indicated , intranasal instillation of synthetic vasopressin .
other signs and symptoms in prolactin secreting microadenoma include amenorrhea , galactorrhea , anovulation , decreased libido , gynaecomastia and osteoporosis .
tumour cells in patients with prolactinomas and that with gh secreting tumours may exhibit symptomatic enlargement during pregnancy , probably due to the growth - promoting effect of estrogens .
this may be because of an increase in either peritumoural edema secondary to increased sodium and water retention or blood volume in vascular tumours such as meningiomas .
accelerated tumour growth during pregnancy is likely , owing in part to the high levels of circulating progesterone that occur with gestation . as pregnancy itself is an insulin - resistant state , the pregnant acromegalic patient is at greater risk for hyperglycemia .
there is also an increased incidence of hypertension and coronary artery disease in acromegalic patients , which poses potential risks to the fetus .
however , none of these potential complications of elevated gh have been shown to have a deleterious effect in pregnant acromegalic patients .
active acromegaly during pregnancy does increase insulin resistance and thus increase the risk of gestational diabetes and hypertension .
underlying cardiac disease , from metabolic syndrome , hypertension , or acromegaly - associated cardiomyopathy , may become symptomatic during pregnancy .
pregnancy has not been found to alter the course of acromegaly other than in rare , reported cases of asymptomatic tumour enlargement . whether tumour enlargement is more common in lesions that co
if left untreated for the duration of pregnancy , it is thought not to have any adverse effects on the course of acromegaly , which otherwise is a chronic disease that can be addressed after delivery .
diabetes insipidus ( di ) can occur de novo during pregnancy or in the postpartum period , while pre - existing di may be exacerbated during pregnancy .
in addition , a transient di may occur during pregnancy in the absence of a known defect in arginine vasopressin ( avp ) secretion .
glucocorticoid dose does not usually need to be changed during pregnancy , although symptoms occasionally indicate that a mild increase is required .
stress levels of cortisol or its equivalent are needed for labour and for any intercurrent major stress during the pregnancy .
the blood supply to the already enlarged pituitary gland is seriously compromised in times of acute volume depletion compounded by vasospasm due to circulating vasoconstrictors .
the enlarged gland and low pressure in the portal system cause susceptibility to tissue hypoperfusion and infarction and it leads to an atrophic , hypofunctioning and a scarred gland .
it has been suggested that patients with sheehan syndrome have a small , rigid sella from the outset .
the hyperplastic pituitary in this sella may be more likely to compress its blood supply , predisposing the gland to infarction if hypotension occurs .
pregnant women with type 1 diabetes , especially those with preexisting vascular disease , seem to be particularly at risk .
the pre - anaesthetic considerations are related to the endocrine and the tumour status . during the pre - anaesthetic evaluation , the size and location of the tumour and its effect on intracranial dynamics
there are four grades of airway involvement described in acromegaly ; grade 1- no significant involvement ; grade 2- nasal and pharyngeal mucosa hypertrophy but normal cords and glottis ; grade 3- glottic involvement including glottic stenosis or vocal cord paresis ; grade 4- combination of grade 2 and grade 3 . for patients with difficult airway and glottic abnormalities ,
the intubating laryngeal mask airway is another alternative in a patient with acromegaly . raised icp can result in either reduction in perfusion pressure with concomitant ischaemic injury or herniation of brain tissue causing brain injury .
the main aim of the anaesthesiologist is smooth induction of anaesthesia by avoiding coughing , straining by maintaining patient in deeper plane of anaesthesia , avoiding hypo or hypertension .
it will produce a fall in icp by lowering the cerebral metabolic rate ( cmro2 ) and the cerebral blood flow ( cbf ) .
it is essential for pregnant patients to undergo mri after four months gestation especially those who have undergone pituitary surgery in the past to look for any residual tumour which can increase in size . unlike computerized tomography ( ct ) ,
we suggest that any pregnant patient with history of pituitary tumour or resection of the same should undergo preoperative extensive evaluation and those with acromegaly for detailed airway assessment . | successful anaesthetic management for caesarean section in a case with previous pituitary tumour resection , with residual tumour , is reported .
the pituitary gland undergoes global hyperplasia during pregnancy .
functional pituitary tumours may exhibit symptomatic enlargement during pregnancy .
growth hormone secreting tumour is associated with acromegaly which has associated anaesthetic implications of difficult airway , systemic hypertension , and diabetes and electrolyte imbalance .
intracranial space occupying lesions can increase intra cranial pressure and compromise cerebral perfusion or cause herniation .
we report management of this case . |
health is the fundamental rights of every human being and improvement of educational methods is a public duty ( 1 ) . considering the limited research in this field , a programmed approach to learning is evident in various cycles of life including menopause as the most critical period of women s life ( 2 ) .
lack of knowledge and access to relevant information is the major challenge faced by menopausal women intensified by contradictory information ( 3 ) .
women s awareness of learning styles consistent with social norms and context is the key to solving this problem ( 4 ) .
quality of life and menopausal symptoms are closely related concepts ( 5 ) and would affect women s quality of life ( physiological and psychosocial ) ( 6 ) .
health education intervention strategy is one of the alternative strategies ( 7 ) for improving women s attitudes and coping with menopause symptoms ( 8) identified as one of the sub - categories of health promotion programs ( 9 ) .
this may promote the health behavior of the patients and their families and will change life threatening life styles ( 10 ) . in a group discussion considering post - menopausal women s opinion about application of instructional methods , 83% of participants were demanding information about menopause and strategies to deal with it through educational methods .
there was significant relationship between severity of menopausal symptoms and decreasing level of life quality , too ( 11 ) .
a group expressed willingness to apply several instructional methods to overcome these symptoms ( 12 ) .
one of these methods is support group which can be developed in different populations that , with regard to this issue and social and cultural context , is reflected in the focus of health interventions ( 13 ) .
this method is an efficient tool in quality of life research due to mutual exchange of experiences , promotion of critical thinking and verbal skills ( 14 ) .
rotem examined the effectiveness of an instructional program on support group to cope with physical , sexual , psycho - social menopause symptoms ; the intervention effect was significant ( 8) .
rostami performed an educational program using the lecture and the q & a methods that led to improvement of menopausal symptoms including physical , sexual and psycho - social aspects ( 12 ) .
the support group of mental and physical health of alzheimer s caregivers had a minor impact on the burden of care and would only increase their knowledge ( 15,16 ) . however , according to some studies using this method on caregivers of patients with psychotic disorders and schizophrenia would lead to increased awareness as well as reducing stress , easing burdens of care and enabling them to better deal with the patient ( 17 ) . considering low number of studies investigating proper instructional methods lack of educational support group programs , disregarding women as emotional or psychological center of family life and especially great effect of improving the quality of life on promoting family and , consequently , community health ( 18 , 19 ) this study examined the effect of structured curriculum by using support group , on quality of life in postmenopausal women .
a single - blind trial was conducted in august to december 2010 at saadatmandi health center ( robatkarim , iran ) .
the study population included 110 healthy postmenopausal iranian , literate , muslim and married women .
with ci of 95% and power of 80% the maximum sample size was obtained by using s=1.01 and quality of life scores on physical dimension ( 8) . the total sample was estimated to be 110 cases .
the minimum number of samples in each group was 55 ( predicted 10% drop ) .
first the subjects were selected using non probability - convenient sampling and then were randomly divided into two test and control groups .
inclusion criteria were as follows : not using hormone replacement and no smoking within 6 months and till the end of the study period , no history of hysterectomy , body mass index ( bmi ) less than 30 ( kg / m ) and not employed in any health systems .
criteria for exclusion of the study were subject s unwillingness to continue participation in the trial , not answering the questions , not ongoing participation in the sessions , presence of physical or mental diseases during the intervention period , possible incidence of adverse events during intervention and before collecting the second questionnaire data ( three months after completing the intervention ) .
the support group program was developed for 6 groups ( five nine - member and one ten - member groups ) .
this program was performed for each of the groups on a particular day of the week ( ten sessions of 120 minutes each ) . to interact and communicate effectively with the participant , the researcher explained the pre - designed research objectives and methods 30 minutes before the program began .
then participants discussed the subject for about 70 minutes ; during the last 20 minutes of the session the researcher classified the subjects . due to importance of face - to - face communication ,
topics of the sessions included :
_ the first session : the menopause and its symptoms , stress , memory problems during menopause_the second session : the meaning of happiness and social relationships and the effect of menopause on them_the third session : purpose of the menopausal vasomotor symptoms and causes of them_the forth session : the importance of sex with spouse in islam , sexual signs in menopause period including abstain from sexual relations and pain during sexual intercourse_the fifth session : vaginal dryness , consistency and appearance of the skin after menopause_the sixth session : incontinence of urine while coughing or sneezing and frequent urination in postmenopausal women_the seventh session : sleep disorders and their causes after menopause_the eighth session : reduced physical strength and joint problems associated with menopause_the ninth session : relaxation techniques , importance of relaxation training_the tenth session : the importance of aerobic exercises and training _
the first session : the menopause and its symptoms , stress , memory problems during menopause _ the second session : the meaning of happiness and social relationships and the effect of menopause on them _ the third session : purpose of the menopausal vasomotor symptoms and causes of them _ the forth session : the importance of sex with spouse in islam , sexual signs in menopause period including abstain from sexual relations and pain during sexual intercourse _ the fifth session : vaginal dryness , consistency and appearance of the skin after menopause _ the sixth session : incontinence of urine while coughing or sneezing and frequent urination in postmenopausal women _ the seventh session : sleep disorders and their causes after menopause _ the eighth session : reduced physical strength and joint problems associated with menopause _ the ninth session : relaxation techniques , importance of relaxation training _ the tenth session : the importance of aerobic exercises and training three of the sample in support group ( 2 cases due to lack of attending the sessions and 1 due to moving to the other city ) and 2 cases in control group ( 1 participant due to divorce and 1 due to use of hormone therapy during intervention ) were lost ; the number of participants in test and control group decreased to , respectively , 52 and 53 .
data gathering tool was menopause specific quality of life ( menqol ) questionnaire ; demographic information was added to it , too .
demographic questions were closed questions and short answers about demographic variables including age and menopausal age of the case , height and weight , bmi , number of children ( living or dead ) , education level , employment and economic status .
this is a reliable and standardized questionnaire for assessing quality of life post - menopausal women , designed and standardized by hiditch et al . in toronto , canada
menqol consisted of 99 closed questions ( ratings rate from zero to six ) in likert scale which included 4 dimensions ( 3 questions on vasomotor , 7 questions on psychosocial dimension , 16 questions on physical dimension , 3 questions on sexual dimension ) .
content validity was used to assess validity and the test - retest analysis was used to assess reliabilities of the questionnaire ( r=0.084 ) . according to scoring and points and number of questions ( 29 questions ) , minimum and maximum scores for vasomotor , psychosocial , physical and sexual dimensions were , respectively , ( 3 to 24 ) , ( 7 to 56 ) , ( 16 to 128 ) , ( 3 to 24 ) ; the total for life quality was ( 29 to 232 ) .
scores close to maximum criterion indicated severity of the menopause symptoms and low quality of life . demographic data and
the questionnaire were prepared before the training started and three months after the last training session by going to participants houses .
qualitative variables were analyzed using chi - square tests and quantitative variables were analyzed using mann - whitney and wilcoxon test , paired t - test and independent t - test the wilcoxon test and paired t - test were respectively used to compare before and after scores of ( respectively ) vasomotor and psychosocial , physical and sexual dimensions .
the first was used to kolmogorov - smirnov test ( ks ) for testing normality , based on scores before & after vasomotor dimension had abnormal distribution , so was used non parametric tests ( mann - whitney and wilcoxon test ) .
psychosocial , physical and sexual scores had normal distribution , so was used parametric tests ( paired t - test and independent t - test ) .
the ethical issues in this study included introducing the researcher to the subjects , giving necessary explanation on content , getting written consent from the participants , informing them of the voluntary nature of participation in or withdrawal from the study and ensuring the confidentiality and privacy of information .
the two test and control groups were matched in age , menopause age , bmi , education , employment and economic status , number of children ( live or dead ) before intervention and there were no significant differences ( table 1 ) .
but after intervention there were great differences in scores of vasomotor ( p=0.001 , z=1.58 ) , psychosocial ( p=0.007 , t=0.743 ) , physical ( p= 0.001 , t= 3.797 ) , sexual ( p=0.001 , t=0.383 ) , and qol score ( p= 0.001 , t= 4.422 ) .
regarding support group participations , there was significant difference between the scores of these dimensions before and after comparison and qol score after three months , but no significant difference was found in control group ( table 2 ) .
this survey demonstrated the positive impact of 10-week consecutive structural program by using support group on quality of life and symptoms of menopause ( vasomotor and psychosocial , physical , sexual dimensions ) .
a positive effect of using support group method on promoting women s attitudes towards menopause and its physical and psychosocial signs is reported .
the current research evaluated the effect of support group intervention on vasomotor , psychosocial , physical , sexual dimensions ; the effect of educational intervention on these 4 dimensions was positive . although evaluating the effect of the intervention on women s attitude was not primary goal of the recent intervention .
the effectiveness of this method was studied in postpartum distress physical and mental health of alzheimer and psychotic patients caregivers ( 8,15 ) .
hey - chung investigated the impact of support group program of postpartum distress of 60 women within 23 days of delivery ( 15 ) , where implementation of this kind of intervention ( similar to hey - chung s study in intervention method ) has led to significant differences in vasomotor ( hot flashes and night sweats ) and sexual symptoms ( vaginal dryness , abstain from sexual relations and changes in sexual desire ) , psychosocial and physical dimensions and quality of life .
so it can be said that support group intervention not only has a positive effect on women on reproductive age but is effective in promoting qol of postmenopausal ones and can help improve its signs .
the problems of the research by hey - chung included lack of control group , difficulty of the content presented in the sessions ; besides , as the authors acknowledged , content of the study was not proportionate to maternal educational level . while in current study appropriateness of the content with educational level has been taken into account , it was written in a clear manner with no medical terms .
herbert s study on physical and mental health of alzheimer s caregivers indicated that , despite the 8-week intervention program , the participants showed a slight increase in knowledge and the intervention did not affect the other variables including behavioral indicators optimization ( 16 ) .
tong chen conducted a systematic review of researches on the effect of using support group method on psychotic patients caregivers ( caregivers of patients with schizophrenia and other psychotic disorders ) and reported that instructional support group design had significant effect in mean score of stress , knowledge increase and better deal with these patients ( 20 ) .
rostami made a semi - empirical study of direct education effect on the quality of life of postmenopausal women ; the results indicated positive effect of lecture on promoting scores of sexual , physical and psychosocial dimensions but had no significant impact on vasomotor score ( 12 ) .
measured variables were similar to current research although the method used by rostami was direct learning method .
the difference between rostami s study and ours included lack of control group , using direct method of teaching , impossibility of active participation of the samples in the issues , low education level of participants for implementation of educational program .
rostami used menqol questionnaire with 26 components . in most societies specific attention is focused on the problems of women during pregnancy but not on menopause problems in middle - aged and elderly women .
regarding constantly increasing number of this group of women ( 18,21 ) and lack of studies on proper learning styles ( based on cultural and social context ) it will be necessary to address the personal and social aspects of menopause problems which then helps to relieve its signs .
life style differences among participants , effectiveness of mass media educational programs , lack of knowledge about family structure such as marital life , nuclear and extended families as well as family conflicts . considering the lack of research in this area and , also , increasing number of postmenopausal women ,
it is recommended to use available low - cost training methods including booklets and pamphlets .
life style differences among participants , effectiveness of mass media educational programs , lack of knowledge about family structure such as marital life , nuclear and extended families as well as family conflicts . considering the lack of research in this area and , also ,
increasing number of postmenopausal women , it is recommended to use available low - cost training methods including booklets and pamphlets .
using the support group method will help to reduce the bothersome signs of menopause as well as vasomotor , physical , psychosocial and sexual symptoms .
this will subsequently improve the quality of life . considering the growing population of postmenopausal women , as the most vulnerable groups in society , it is recommended to uses
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors . | backgroundquality of life in post - menopausal women and menopausal symptoms are closely related concepts .
influence health education policy in order to promote health and adopt a menopause lifestyle requires alternative strategies , including health training programs with community based interventions .
the current study aims to survey the effects of support groups on quality of life of post - menopausal women.methods:a blind field trial ( 2010 ) was conducted at saadatmandii clinical center ( robat karim , iran ) .
110 women were selected randomly divided into test and control groups ( consisting of 55 ones ) .
menopause specific quality of life questionnaire ( menqol ) was used for evaluation of life quality before and three months after intervention ; there was no intervention in the control group .
data were analyzed by using spss/16 .
qualitative variables were analyzed using chi - square tests and quantitative variables were analyzed using mann - whitney and wilcoxon test , paired t - test and independent t-test.results:there was significant difference between vasomotor , psychosocial , physical , sexual aspects and life quality of this group pf women ( p<0.001 ) .
there was no statistically significant difference in the quality of life of women in control group.conclusion:according to the results method of support group can lead to improved quality of life for post - menopausal ones and it can be appropriate healthcare policy to promote health and improve life quality of this group of women . |
the analysis of native and underivatized lipids within body fluids as well as cell and tissue extracts is still a challenging task , in particular , if the molecular structure of individual components needs to be identified in decently short time .
the lipid composition consists of different main classes such as fatty acids , neutral lipids , and lipids with positively or negatively charged head groups with manifold subclasses of structural diversity .
variations within the lipid composition were attributed to different pathologies such as neoplastic and neurodegenerative diseases , diabetes mellitus , and many others .
furthermore , some lipid classes are involved in cell death ( apoptosis , necrosis ) , cellular signaling and are precursors for lysophospholipids ( i.e. , lysophosphatidylcholine ) , diacylglycerols , and phosphatic and arachidonic acid [ 125 ] .
1,2-diacyl - sn - glycero-3-phosphatidylcholine ( pc ) represents a major constituent of cell membranes .
it consists of the polar head group phosphorylcholine attached to the sn-3 position of glycerol and differing saturated and unsaturated fatty acids esterified to the sn-1 and sn-2 position , whereby fatty acids in position sn-1 are preferentially saturated as a rule .
numerous studies dealt with pcs in the past because of their utmost biochemical and clinical importance and many different analytical techniques have been proposed to get an insight into metabolic turnover or to characterize pathophysiological deviations of the native lipid composition .
most of these techniques suffer from various drawbacks as being time - consuming , insensitive , destructive , or not related to individual substructures .
gas chromatography ( gc ) [ 2628 ] , thin layer chromatography ( tlc ) [ 2931 ] , and high - performance liquid chromatography ( hplc ) [ 3237 ] are commonly used for lipid analysis .
the spots on a tlc plate are scratched out and their fatty acid residues are analyzed upon derivatization into a volatile substrate and recorded by gc .
however , the precise molecular structure of an individual lipid is lost because of the preceding hydrolysis of the lipids .
enzymatic cleavage of the ester bond using phospholipases allows a successive hydrolysis of the sn-2 and sn-1 fatty acid , but it is rather time - consuming due to intense laboratory work and already minor contamination of the enzyme leads to false results .
hplc offers the separation of lipid classes using the normal phase mode ( np ) and additionally the separation according to the different fatty acid residues of an individual lipid in the reversed phase mode ( rp ) . in this case , a successful separation depends distinctly on the appropriate selection of the stationary phase .
alternatively , ms - based techniques are widely used , as they are fast , sensitive and require only minor sample preparation . the use of high resolution ms systems give access to the molecular formula .
in addition , characteristic fragmentations identify the lipid class and molecular structure . when coupled with a hplc - system
especially p - nmr is well - suited to quantify phospholipid class analysis and needs only less sample preparation [ 3944 ] .
h - nmr measurements are also widely used , as they contain more information about the fatty acids in general , but the connection to the glycerol backbone is missing due to massive signal overlap .
2d - nmr involving the c nucleus provides a lot more resolution and more information about individual species , but the low nmr sensitivity of the c isotope prevents a fast and wide application of this technique in a routine analysis [ 4448 ] .
this paper presents an efficient rp - hplc setup to separate phosphatidylcholines , which ultimately will be extendable to separate other polar phospholipids .
subsequently the hplc tool is combined with the highly informative molecular assignment potentials of ms and nmr .
five different types of silica - based reversed phase modifications were tested with respect to their capability to separate lipids containing fatty acids with an equivalent carbon number ( ecn ) , which is the number of carbon atoms within a fatty acid chain minus twice the number of double bonds .
the extension of a lipid by a c = c double bond will not change the hydrophobicity .
the performance of all columns was tested on a mixture of five pcs with the same ecn whereas two of them are even constitutional isomers concerning the 1,2-positions of glycerol , which hampers the separation even more .
then , the hplc column with best performance was used to achieve an efficient baseline separation of three native pc extracts ( soy bean , bovine brain , and egg yolk ) .
furthermore , the ms fragmentation behavior in the positive and negative ion mode is investigated for individual pcs to identify characteristic fragmentation patterns for this lipid class and its fatty acid residues .
1d and 2d high - resolution nmr spectra were also acquired to confirm the molecular structure .
methanol - d4 and deuterated chloroform , methanol ( lc - ms grade ) , all fatty acids , the test mixture compounds dipalmitoyl - phosphatidylcholine ( dppc ) , palmitoyl - oleoyl - phosphatidylcholine ( popc ) , oleoyl - palmitoyl - phosphatidylcholine ( oppc ) , dioleoyl - phosphatidylcholine ( dopc ) , stearoyl - linoleoyl - phosphatidylcholine ( slpc ) , and also the soy bean , bovine brain , and egg yolk extracts were purchased from sigma - aldrich chemie gmbh ( taufkirchen , germany ) .
the double distilled water was taken from the in - house system . a hp 1100 series hplc system ( agilent technologies , waldbronn , germany )
five columns with different stationary phases were tested with respect to their separation performance for lipid analysis : type a silica - based endcapped c18 ( nucleosil 100 - 5 c18 , 250 3 mm ) , type a silica - based phenyl ( nucleosil 100 - 5 c6h5 , 250 4 mm ) , type b silica - based high density c18 ( nucleodur c18 gravity , 5 m , 250 3 mm ) , type b silica - based polymer / cross linked c18 ( nucleodur c18 isis , 5 m , 250 3 mm ) , type b silica - based mixed mode phenyl / c18 ( nucleodur sphinx rp , 5 m , 250 3 mm ) .
all hplc columns and materials were a kind gift of macherey - nagel ( dren , germany ) .
the 3 mm columns were operated at flow rate of 0.6 ml / min and the 4 mm column at 1 ml / min .
the mobile phase was optimized by adapting the methanol content in different runs between 90% and 100% for the alkyl phases and between 80% and 100% for the phenyl phase with respect to the hydrophobic interaction of the analytes with the rp packing .
an 8 mm nucleodur sphinx rp was operated under isocratic conditions at 4.1 ml / min flow with a mobile phase consisting of methanol and water ( 90 : 10 ) for the semi preparative approach . to collect the individual species for nmr measurements a gilson 215 liquid handler ( gilson international b.v .
an esquire lc iontrap system ( bruker daltonik gmbh , bremen , germany ) was used for mass spectrometric detection for positive and negative ion mode mass and ms / ms spectra of each pc compound were recorded .
the capillary voltage was set to 3800 v and the end plate offset to 500 v in positive ion mode .
for the hplc the nebulizer gas was set to 40 psi , dry gas and dry heat were set to 10 l / min and 300c , respectively . in case of direct infusion via a syringe pump , the dry and nebulizer gases were reduced to 5 l / min and 5 psi , respectively .
the collision energy for ms / ms experiments was optimized with respect to the precursor ion stability .
a microtof - q - equipped with the apollo esi ion source ( bruker daltonik gmbh , bremen , germany ) was used for precision mass detection .
the capillary voltage was set to 4500 v and the end plate offset to 500 v in negative ion mode .
the nebulizer gas was set to 0.4 bar , dry gas and dry heat were set to 4 l / min and 200c , respectively .
for ms / ms experiments the collision energy of the quadrupole was 42 ev / z .
the molecular formula was generated by matching high mass accuracy and isotopic pattern ( sigmafit , bruker daltonik gmbh , bremen , germany ) .
all samples were stored at 80c before the measurements . in case of dissolved samples ,
the solvents were evaporated by a gentle stream of nitrogen and redissolved in cdcl3/ cd3od ( 2 : 1 ) .
1d ( h , c ) and high - resolution 2d ( hsqc , hsqc - tocsy , hmbc ) nmr spectra with a digital resolution of 1k data points in f1 and 4k data point in f2 dimension of each pc species were acquired on a bruker
drx 600 mhz nmr spectrometer equipped with 5 mm txi probe ( bruker biospin gmbh , rheinstetten / karlsruhe , germany ) .
a comparison of five different reversed phase columns revealed the following behavior : the separation of the test mixture on type a silica - based materials showed only poor results for all pc compounds . although , it seems that the nucleosil material separates all peaks very well ( see table 1 ) , the extreme peak broadening and a distinct tailing spoils the pretended peak separation .
in contrast , the type b silica based materials separated dppc , dopc , slpc , and popc or oppc very well .
however , the two lipid isomers popc and oppc were only well separated ( table 1 ) on the polymer cross link rp packing ( isis ) . with all rp materials it was possible to separate lipids containing two monounsaturated fatty acids from lipids with one or two saturated or one polyunsaturated fatty acid .
the shortest separation times with sharp chromatographic peaks were achieved by the mixed mode stationary phase ( sphinx ) .
therefore , this stationary phase was selected to separate the individual compounds within the lipid extracts of natural sources .
the mixed mode stationary phase ( sphinx ) and mobile phase of 90% methanol and 10% water allows the baseline separation of all species within the three different extracts ( i.e. , extraction residues ) .
the separation of the pc species is not influenced by the type or contaminations of the extract .
altogether , twelve pc components and one plasmalogene ( bovine brain extract ) were identified .
( i.e. , myristic ( 1 species ) , palmitic ( 7 species ) or stearic acid ( 4 species ) . palmitic or stearic acid were esterified to the sn-2 position within three compounds .
the other nine compounds contained a mono- ( four times ) or polyunsaturated fatty acid ( five times ) in position sn-2 .
most species were identified in bovine brain extract ( 11 + 1 ) and the fewest in the egg yolk extract ( 8) . the same mobile phase ( 90% methanol and 10% water ) and column type ( mn sphinx ) were used for the semipreparative hplc runs as for the analytical measurements . however , the hplc column dimension was upscaled ( 8 mm instead of 3 mm ) .
the flow was splitted after the column and a small amount was used for peak detection and identification into the micro - tof - q .
the ionization efficiencies of all equimolar concentrated saturated fatty acids were recorded relative to the internal standard undecanoic acid in different measurements using the negative esi ion mode .
the ion counts of undecanoic acid were set to 100 percent in all cases and the ion counts of all other fatty acids were recalculated with respect to this value ( table 3 ) .
all fatty acids with a shorter chain length as the internal standard show lower ionization efficiencies and all fatty acids with 12 or more carbon atoms show higher ionization efficiencies .
the positive ion mode ms spectra showed better signal to noise ratios than in the negative ion mode .
in positive ion mode , the base peak results from the adsorption of a sodium ion . in negative ion mode , the base peak results from the demethylation of the parent ion during the transfer into the ion trap mass spectrometer .
[ m + a ] , whereby a is chloride or formate , was observed to a small extent only . in positive ion mode ,
ms / ms the polar headgroup of phosphorylcholine was cleaved off . in negative ion mode ,
ms / ms spectra the fatty acids of each pc were assigned by detection of their [ m h ] ion accompanied by a neutral loss of the fatty acid ketene .
the sn-2 fatty acid of every pc species shows always the more intense signal compared to the sn-1 fatty acid signal .
figure 1 shows several overlaid ms / ms iontrap spectra of popc , but with increasing fragmentation energy to show the energy dependence of the different fragment ions .
negative ion mode ms and auto - ms / ms q - tof spectra were recorded during the hplc runs .
the fatty acid residues of each individual pc component was assigned by its relative fragment ion intensities .
furthermore , the molecular formula of each detected ion was generated by matching high mass accuracy and isotopic pattern to confirm the results .
the lipid class was confirmed by the molecular formula and reconstructing the precursor ion of the fragment ions .
1d-(h and c ) and 2d-(hsqc , hsqc - tocsy , and hmbc ) nmr spectra of the five reference pcs were recorded for peak assignment .
lipids with saturated ( dppc ) , mono unsaturated fatty acids ( mofa ) as in popc , oppc , dopc , or polyunsaturated fatty acids ( pufa ) as in slpc show zero , two or four carbon signals between 120 and 130 ppm . the mofa and pufa show unambiguously different chemical shifts for the olefinic carbons ; however , the three lipids with mofas have nearly identical olefinic carbon shifts respectively the distance between the double bond signals depends on the mofa location ( sn-1 or sn-2 ) .
figure 2 shows the overlaid c nmr spectra of popc , oppc , and dopc .
the chemical shift difference between these two signals is about 50 hz for popc and about 47 hz for oppc .
the corresponding h - nmr spectra show identical signals for the olefinic protons ( not shown ) .
nonetheless , a lipid with two mofas can be deduced from the intensity ratio of the olefinic protons to the glycerol protons in the h - nmr spectra .
hplc - ms structural results were confirmed for all molecular species using 1d-(h ) and 2d-(hsqc , hsqc - tocsy , and hmbc ) nmr techniques .
the nmr parameter of unsaturated fatty acids have been measured separately ( see supplement ) and are identical within the mixtures .
lipids with equal ecn should have the same hydrophobicity , which is the discriminating factor in reversed phase chromatography .
this holds for pcs with the same ecn within a mixture and even more , if they are stereoisomers such as popc and oppc . the successful reversed phase separation of hydrophobic and zwitterionic molecules like phosphatidylcholines depends on very well endcapped silica materials , as coulomb interactions of the choline group with the silica gel lead to peak broadening , retention time shifts ( data not shown ) , and peak tailing . packing materials with hydrophobic van der waals interactions only ( i.e. , high density c18 materials ) show no separation of isomeric lipids .
additional interactions like steric effects by polymer cross - linked rp packings can overcome this problem .
stationary phases with only aromatic modifications are not hydrophobic enough to achieve a good phospholipid separation .
the mixed mode stationary phase contains additionally alkyl ligands and offers therefore more hydrophobic interactions and good silica gel coverage .
this column showed the shortest phospholipid retention times for all alkyl stationary phases and a good separation with narrow chromatographic peaks .
saturated lipids have the lowest and polyunsaturated lipids the highest retention times . comparing lipids of the same ecn with two mofas or one pufa and one saturated fatty acid
the retention of the lipid with the pufa is higher , as their spatial demand is larger and the - interactions with a pufa residue is not affected by the other fatty acid . by means of the hplc separation it was possible to get semiquantitative information of the individual compounds in the extracts . referring to the results of the separation of the lipid standard mixture it was possible to separate all species within the extracts .
the elution order of lipids with the same ecn is in the same line as for the reference mixture ( lipids with saturated fatty acids , one mofa , two mofas , one pufa ) .
however , in case of pufas with four double bonds ( i.e. , arachidonic acid ; 20 : 4 ) the - interactions become so strong that this compound elutes as last compound in the next higher ecn group ( see table 2 ) . nonetheless , they are unambiguously identified by means of their ms fragmentation or nmr spectra .
the upscaling with the same type of rp packing of the newest generation is no problem , although a peak broadening can occur because of the higher sample load .
the results can be correlated with the molecules hydrophobicity , which shows the same progression .
the hydrophobicity is obtained from the octanol - water partitioning coefficient ( log pow ) ( data not shown ) .
there are no differences between the pka values of the individual fatty acids ( table 3 ) , so that the ionization efficiency of the fatty acids depends only on the molecules hydrophobicity , which increases by the number of carbon atoms .
as popc and oppc or slpc and dopc , respectively , have the same molecular weight / precision mass , they can not be assigned based on their mol peak only . however , they are distinguished by ms / ms spectra , as the sn-2 fatty acid is always cleaved off at lower fragmentation energies due to sterical effects .
in addition , the intensity ratio of the sn-2 fatty acid anion to the sn-1 fatty acid anion is constant for a particular fragmentation energy . a semiquantitative or even quantitative analysis of stereoisomeric pcs within a mixture ( f.e . ,
popc and oppc ) still is difficult , because the anion signal of an individual fatty acid will be the same regardless the position on the glycerol backbone and no other distinguishing signal is observed for one of the isomers . however , using the intensity ratio of the sn-2 fatty acid anion to the sn-1 fatty acid anion for the pure reference compound one can calculate the approximate popc to oppc ratio .
the ms detection limits also benefits from the isocratic hplc method with high - organic solvent concentration in the mobile phase . in case of gradient hplc ,
furthermore , the risk of ion suppression during the ionization process is minimized by the sample introduction after hplc separation .
the identification of the individual species in the different extracts was achieved by ms / ms and comparing the individual fragment intensities as described earlier .
the use of high - resolution spectra acquired by the micro - tof - q allows the generation of the compound 's molecular formula by matching high mass accuracy and isotopic pattern .
abnormalities like oxidation of the double bond , and so forth . were not observed .
it may be noted , that not only diacyl pls can be identified within a mixture , but also alkyl / alkenyl , acyl pls because of the different fragmentation pattern of the fatty acid residue compared to an ether link .
the hplc and ms results were confirmed by nmr spectroscopy , especially the configuration and location of double bonds in the fatty acid residues .
only nmr having the highest qualitative and quantitative structure elucidation potential allows a complete structure elucidation .
h- , c- , or p - nmr spectra are capable to identify the various lipid classes . beyond this
, the degree of unsaturation is obtained from the proton signal intensity ratio of the double bond signal versus the choline group signal .
mofas and pufas are differentiated by the number of carbon signals within the double bond region .
the location ( sn-1 or sn-2 ) of the mofa follows from the c - nmr spectra or from esi - ms .
the risk of peak overlapping in the nmr spectra was avoided by recording 2d - nmr spectra by preceding separation of individual phosphatidylcholines by hplc .
the separation of lipids with equivalent chain lengths in complex mixtures can be improved using rp - hplc packings of the newer generation containing additional discriminators .
already simple pc mixture can not be assigned by a single analytical technique , while the combination of hplc separation power , ms sensitivity with accurate mass measurement of molecular and fragment ions and nmr structure elucidation power will meet most suitably the challenge .
they overcome the limits of any single technique and also proof the potential of their combination ultimately to analyze native ( lipid ) mixtures .
the molecular structure of a novel compound may not be evaluated by nmr alone , if the native concentration is very low .
conversely , ms data may give molecular weight , fragmentation and molecular formulae that may be insufficient to assign ambiguously the molecular structure of an unknown compound .
however , online nmr and ms detections in parallel provide complementary data and minimize ambiguities between lc - ms and lc - nmr systems very efficiently . combination of these data allows the identification of a lipid class , reconstruction of the lipid structure , and both the location of an individual fatty acid to the sn-1 or sn-2 position in the glycerol moiety or the location of double bond within the fatty acid chains . | in respect of the manifold involvement of lipids in biochemical processes , the analysis of intact and underivatised lipids of body fluids as well as cell and tissue extracts is still a challenging task , if detailed molecular information is required .
therefore , the advantage of combined use of high - pressure liquid chromatography ( hplc ) , mass spectrometry ( ms ) , and nuclear magnetic resonance ( nmr ) spectroscopy will be shown analyzing three different types of extracts of the ubiquitous membrane component phosphatidylcholine . at first , different reversed phase modifications were tested on phosphatidylcholines ( pc ) with the same effective carbon number ( ecn ) for their applicability in lipid analysis .
the results were taken to improve the separation of three natural pc extract types and a new reversed phase ( rp)-hplc method was developed .
the individual species were characterized by one- and two - dimensional nmr and positive or negative ion mode quadrupole time of flight ( q - tof)-ms as well as ms / ms techniques . furthermore , ion suppression effects during electrospray ionisation ( esi ) , difficulties , limits , and advantages of the individual analytical techniques are addressed . |
malnutrition is common in patients with end stage renal disease ( esrd ) on hemodialysis ( hd ) .
this may be associated with insufficient dietary intake , medication , inflammation , and/or their uremia status , which contribute to anorexia ( 1 - 4 ) .
loss of appetite reduces the intake of dietary energy and other nutrients and leads to weight loss and malnutrition progression ( 4 ) . nevertheless , uremic toxins stimulate disorders of the central nervous system and adipose tissue ( 2 ) , which may affect diminished appetite ( 2 , 5 , 6 ) .
leptin , a negative acute phase protein , is secreted by adipose tissue and acts on the hypothalamus in order to regulate food intake and energy expenditure ( 2 , 3 , 7 ) .
it has been postulated that leptin plays an important role in inducing anorexia and malnutrition in uremic patients ( 2 ) , but the mechanisms by which it affects progressive malnutrition in kidney failure and its clinical significance are not clearly understood ( 3 ) .
several studies have reported that serum levels of leptin are significantly increased in patients with chronic renal failure ( 3 , 9 ) . in a recent study ,
leptin level in a hd patient was not significantly different from the control ( 2 ) .
some studies demonstrated that the high serum levels of c - reactive protein ( crp ) and cytokines , such as interleukin-1 ( il-1 ) and tumor necrosis factor- ( tnf- ) elevate leptin gene expression ( 3 , 4 , 10 ) , which may , in turn , play a role in inhibiting appetite during acute inflammatory conditions in renal failure patients ( 11 , 12 ) .
in other studies , no correlation was identified between leptin level and body weight or nutritional status ( 4 , 13 , 14 ) .
since data on the relationship between serum leptin and nutritional status in hemodialysis patients are limited , the present study was performed to investigate the association between serum leptin and crp levels and some nutritional factors in hemodialysis patients .
forty - five patients with esrd ( 20 male and 25 female subjects , aged 43.2 13.1 years ) who were referred to the hemodialysis center of the imam ali teaching hospital , which is affiliated to the zahedan university of medical sciences ( zahedan , iran ) , were enrolled in this analytical descriptive study .
all of the patients were dialyzed three times a week ( each session lasting 3 - 4 hours ) for at least three months with a minimum kt / v of 1.2 .
a group of 40 healthy subjects ( 17 male and 23 female subjects , aged 38 12.6 years ) , who were matched for sex and age , were selected as controls during a medical visit to the internal clinic .
the participants were not hospitalized or diagnosed with any infectious and inflammatory diseases , diabetes mellitus , cardiovascular ( cvd ) , liver , thyroid diseases , or cancer , in the past 3 months immediately prior to study enrollment .
the nutritional status of the subjects was evaluated using both the food frequency questionnaire ( ffq ) and the calculation of the body mass index ( bmi ) .
the ffq s reliability and validity as well the fewest intakes of daily serving of the various food groups represented in the food guide pyramid have been reported previously ( 15 ) .
body weight and height were measured in the control group after 12 hours of fasting , and after hemodialysis in hd patients .
bmi was categorized in accordance with the recommendations of the world health organization ( 16 ) . a bmi < 18.5
biochemical parameters including serum levels of blood urea nitrogen ( bun ) , uric acid , creatinine , total cholesterol , triglyceride , low density lipoprotein - cholesterol ( ldl - c ) , high density lipoprotein - cholesterol ( hdl - c ) , and albumin were measured with standard techniques by an automatic analyzer .
serum leptin levels were assessed using commercial elisa ( enzyme linked immunosorbent assay ) kit ( human leptin elisa kit , ( biovendor [ cat no : rd191001100 ] , usa ) .
this study was approved by the ethics committee of zahedan university of medical sciences ( approval date 4 january 2014 , number 6697 ) .
the analysis was carried out using the spss statistical software package program ( version 18 for windows , chicago , usa ) .
data were expressed as mean sd and mean sem with range , as appropriate .
correlations among leptin and different parameters were determined using the spearman s correlation coefficient . a p value of < 0.05 was considered significant .
the nutritional status of the subjects was evaluated using both the food frequency questionnaire ( ffq ) and the calculation of the body mass index ( bmi ) .
the ffq s reliability and validity as well the fewest intakes of daily serving of the various food groups represented in the food guide pyramid have been reported previously ( 15 ) .
body weight and height were measured in the control group after 12 hours of fasting , and after hemodialysis in hd patients .
bmi was categorized in accordance with the recommendations of the world health organization ( 16 ) . a bmi < 18.5
after fasting overnight , blood samples were collected from all healthy subjects and patients immediately before hd .
biochemical parameters including serum levels of blood urea nitrogen ( bun ) , uric acid , creatinine , total cholesterol , triglyceride , low density lipoprotein - cholesterol ( ldl - c ) , high density lipoprotein - cholesterol ( hdl - c ) , and albumin were measured with standard techniques by an automatic analyzer .
serum leptin levels were assessed using commercial elisa ( enzyme linked immunosorbent assay ) kit ( human leptin elisa kit , ( biovendor [ cat no : rd191001100 ] , usa ) .
this study was approved by the ethics committee of zahedan university of medical sciences ( approval date 4 january 2014 , number 6697 ) .
the analysis was carried out using the spss statistical software package program ( version 18 for windows , chicago , usa ) .
data were expressed as mean sd and mean sem with range , as appropriate . variables with normal distribution were compared using the student s t - test .
correlations among leptin and different parameters were determined using the spearman s correlation coefficient . a p value of < 0.05 was considered significant .
demographic and biochemical parameters of the hd patients and control group are exhibited in table 1 .
serum leptin ( 16.3 2.7 ng / ml vs 23 5.2 ng / ml ; p < 0.05 ) and albumin ( 3.4 0.4 g / dl vs. 4.5 0.76 g / dl ; p < 0.0001 ) levels and bmi ( 22 2.1 kg / m vs. 24.7 4.9 kg / m ; p <
0.001 ) of hd patients were significantly lower , whereas serum crp ( 11.1 2.4 mg / l vs. 2.4 0.17 mg / l ; p < 0.0001 ) , bun ( 60.4 24.5 vs. 12.8 3.3 ; p < 0.0001 ) , creatinine ( 8.7 3.6 vs. 0.78 0.18 ; p < 0.0001 ) , and uric acid ( 6.3 1.7 vs. 5.7 1.5 ; p < 0.01 ) levels were higher than those in the control subjects .
no significant differences in the lipid profile and blood pressure ( p > 0.05 ) readings were observed between the patients and controls .
the causes of esrd were hypertension ( n = 16 ) , kidney stone ( n = 4 ) , lupus erythematosus ( n = 2 ) , polycystic kidney disease ( n = 4 ) , glomerulonephritis ( n = 8) , and unknown ( n = 11 ) .
abbreviations : bmi , body mass index ; bun , blood urea nitrogen ; crp , c - reactive protein ; hdl - c , high - density lipoprotein - cholesterol ; ldl - c , low - density lipoprotein - cholesterol ; ns , not significant .
crp and leptin levels were reported as mean sem and range because the data were not normally distributed .
as shown in table 2 , hd patients consumed less daily servings of the food groups compared to controls except for bread and cereals ( p < 0.0001 ) .
there was positive correlation between serum levels of leptin and bmi ( r = 0.52 , p < 0.0001 ) ( figure 1 ) and albumin ( r = 0.71 , p < 0.05 ) ( figure 2 ) .
serum leptin levels were not significantly correlated with crp level ( r = 0.11 , p = 0.46 ) , age ( r = 0.22 , p = 0.14 ) , duration of dialysis ( r = 0.21 , p = 0.16 ) , systolic blood pressure ( r = 0.02 , p = 0.91 ) , diastolic blood pressure ( r = 0.07 , p = 0.64 ) , and serum levels of bun ( r = 0.11 , p = 0.45 ) , creatinine ( r = -0.095 , p = 0.53 ) , uric acid ( r = 0.24 , p = 0.11 ) , cholesterol ( r = 0.05 , p = 0.72 ) , ldl ( r = 0.09 , p = 0.55 ) , hdl ( r = -0.18 , p = 0.24 ) , and triglycerides ( r = 0.03 , p = 0.86 ) .
protein energy malnutrition ( pem ) is common in renal failure patients and progresses during the dialytic stage .
mechanisms causing malnutrition in uremia are complex ( 1 , 3 , 17 ) . to date , many studies have demonstrated that insufficient weight gain , hypoalbuminemia , inflammation as well as calorie and protein metabolism disorders and low food intake are important markers , which are strongly associated with mortality risk in hemodialysis patients ( 1 - 4 , 6 , 18 ) .
however , there have been few published studies on the relationship between serum leptin and nutritional factors in patients with chronic renal failure .
thus , the objective of this study was to assess serum leptin level and its relationship with some nutritional factors in hemodialysis patients . in the present study ,
body weight and bmi of hd patients were significantly lower than those of controls , similar to previous studies ( 1 , 19 ) .
serum albumin is also one of the other nutritional factors , which is sensitive to changes in nutritional intake ( 16 ) . in our study , albumin level was markedly lower than controls .
some studies in hd patients have demonstrated a potential relationship between malnutrition and hypoalbuminemia , which depends on both nutrition and inflammation ( 1 , 3 , 17 , 20 , 21 ) . the excretion of albumin into the urine due to impaired renal function ( 16 ) and its leakage via the dialysis membrane are also independent factors that affect serum albumin level ( 1 ) . some studies have suggested that leptin may be associated with anorexia and protein energy loss that are frequently observed in patients with end - stage renal disease ( 3 , 17 ) . in this study ,
the mean serum leptin level was significantly decreased in hd patients , particularly in subjects with bmi < 18.5 kg / m and serum albumin level < 3.5 g / dl .
additionally , serum leptin levels were found to positively correlate with bmi and serum albumin levels .
similar data were previously obtained in other studies ( 2 , 3 , 22 ) , while several studies showed varying results . in some studies , no correlation was found between serum leptin levels and changes in body weight ( 12 - 14 , 19 , 23 ) and serum albumin ( 4 ) in patients with renal failure . in several reports ,
a positive correlation between the body fat value , especially abdominal fat accumulation as a source of pro - inflammatory adipokine , and serum leptin has been demonstrated in hd patients ( 24 , 25 ) .
inadequate food intake is also recognized as one of the important causes of malnutrition in hemodialysis patients ( 20 , 26 ) .
earlier studies have reported that a majority of uremic patients undergoing hemodialysis suffer from nutritional disorders ( 1 , 2 , 4 , 20 ) .
similarly , in the present study , patients consumed lower daily servings of milk and dairy products , fruit and vegetable compared to the control group , which might be associated with restriction of potassium and phosphorous intake in hd patients ( 27 ) .
however , our previous findings also indicated that the intake of energy and protein was significantly decreased in hd patients compared to that in the control group ( 28 ) .
leptin is one of the pituitary appetite regulating peptides , and its levels generally change in renal failure patients ( 3 , 11 , 12 ) .
it has been suggested that the low levels of serum leptin may lead to a reduced appetite during hemodialysis treatment ( 2 ) .
however , the role of leptin in regulating nutritional intake and energy expenditure has not been fully characterized . in our study
, no correlation was found between leptin level and nutrient intake in hd patients , in agreement with earlier studies ( 4 , 13 , 14 ) .
c - reactive protein ( crp ) is a positive acute phase protein and can be increased with any kind of infection / inflammation ( 1 , 3 ) .
since increased serum crp inhibits the serum albumin generation in hemodialysis patients ( 1 ) , it may be a powerful determinant for anorexia , hypoalbuminemia , and the diagnosis of malnutrition in renal failure patients ( 1 , 3 , 21 ) .
( 3 ) reported that the mean crp levels in hd patients was higher than the upper limit of normal , while some patients with high leptin levels had low crp .
although inflammatory marker levels are clearly increased in hd patients , this may be related to the exposure of blood to bioincompatible dialysis membranes ( 17 ) .
other causes , including dietary and behavioral factors , cardiovascular diseases ( 29 ) , and high serum leptin levels ( 10 , 12 ) are also associated with an increase in crp levels . in recent years , the association between inflammation and serum leptin levels in dialysis patients has been established .
some studies have reported that inflammatory process may contribute to the stimulation of leptin mrna , which leads to an increase in the circulating leptin levels ( 10 , 12 ) .
the findings of the present study demonstrated that although the patients with elevated crp levels had markedly increased leptin concentration compared to patients with normal crp , this was similar to control subjects ( data not shown ) .
however , no correlation was found between serum levels of crp with leptin and other nutritional factors , suggesting that crp is a poor predictor of malnutrition in dialysis patients .
the limitations of our study included the small sample size and lack of longitudinal data .
the findings suggest that low levels of leptin may contribute to malnutrition in hd patients .
further studies are required in order to ascertain the significance of leptin in relation to nutritional factors in hemodialysis patients . | background : leptin is secreted by adipose tissue and decreases appetite .
however , the role of leptin in the pathogenesis of hemodialysis ( hd)-related malnutrition has not been fully evaluated.objectives:the aim of study was to investigate the association between the serum leptin levels , serum c - reactive protein ( crp ) levels , and nutritional status in hemodialysis patients.patients and methods : this analytical descriptive study included 45 hemodialysis patients and 40 healthy subjects . biochemical parameters and serum leptin levels were measured .
the nutritional status was evaluated using a food frequency questionnaire ( ffq ) and the calculation of the body mass index ( bmi).results : serum leptin ( p < 0.05 ) and albumin ( p < 0.0001 )
levels and bmi ( p < 0.001 ) of hd patients were significantly lower , while crp levels were significantly higher than those of controls ( p < 0.0001 ) .
hd patients consumed the lower daily servings of the food groups compared to the control subjects ( p < 0.0001 ) . a significant positive correlation between serum levels of leptin and albumin and bmi
was demonstrated .
no significant correlations were identified between leptin level , crp level , and other variables.conclusions:the findings suggest that low levels of leptin may be a contributory factor for malnutrition in hd patients .
further studies are required to ascertain the significance of leptin levels in relation to nutritional factors in hemodialysis patients . |
cystis fibrosis ( cf ) is a fatal autosomal genetic disorder caused by mutations in the cystic fibrosis transmembrane conductance regulator ( cftr ) gene .
the cftr protein provides camp - regulated chloride conductance and acts as a regulator of apical na absorption .
although many organs are affected in cf , lung disease is the major cause of morbidity and of virtually all mortality . in cf , loss of cftr function results in altered ion transport of the airway epithelium and
increased mucus viscosity with reduced mucociliary clearance is a critical event in the susceptibility to bacterial infections [ 24 ] .
a pathological feature of lung disease in cf is the presence of early and excessive inflammation [ 3 , 5 ] .
however , following the finding of neutrophil dominated inflammation in the absence of detectable bacterial or viral pathogens in bronchial lavages obtained from cf infants , the sequence of events at the onset of airway inflammation has been the subject of debates , hence , the proposal that inflammation could precede infection by some direct contribution of the defective cftr [ 7 , 8 ] . furthermore , in vitro data have shown that lung epithelial cells , which express defective cftr , produce high level of proinflammatory cytokines , especially il-8 chemokine as compared to control cells [ 913 ] .
this high il-8 production can participate in the pulmonary neutrophil infiltration that occurs in cf . in the cf disease
, many factors can contribute to oxidative stress as the disease combines increased production of reactive oxygen species ( ros ) and impaired antioxidant protection . in cf
a massive infiltration of neutrophils leads to the generation of ros that are produced by the phagocytic nadph oxidase and are largely responsible for patients ' lung injuries .
recently , homologs of the catalytic subunit of the phagocytic nadph oxidase ( gp91phox , now renamed nox2 ) have been identified in humans .
they form the nadph oxidase ( nox ) family , which encompasses 7 members : nox1 , nox2 , nox3 , nox4 , nox5 , and dual oxidases , ( duox1 , duox2 ) [ 1719 ] . besides their predominant location or initial discovery in some tissues ( nox2 was the prototypic nox in phagocytes and duoxs were initially identified in the thyroid tissue )
in fact , duoxs as well as nox1 , nox2 , and nox5 have been found in airway epithelial cells [ 14 , 15 , 20 , 21 ] .
noxs are dedicated to the production of reactive oxygen species ( ros ) , such as superoxide anions ( o2 ) and hydrogen peroxide ( h2o2 ) , by means of the single - electron reduction of molecular oxygen using nadph as the electron donor .
ros play a critical role in host defense against pathogens and are also important mediators in cellular signaling [ 23 , 24 ] .
in particular , ros are involved in cytokine synthesis , such as tnf , il-1 , il-6 , and il-8 , by phagocytes and epithelial cells [ 2527 ] .
therefore , depending on the concentration , duration , and localization of their production , ros either play a beneficial role by participating in tissue homeostasis or , when inappropriate or excessive production occurs , can directly damage surrounding tissues and participate in inflammatory disorders [ 22 , 28 ] . in this context , oxidative stress has been shown to increase erk1/2 map kinase activity in cf lung epithelial cells , which could explain excessive il-8 production by these cells . however ,
the role and mechanisms of oxidative stress in early inflammation occurring in cf are not fully understood and arouse controversy .
the aim of this study was to investigate the involvement of noxs in the ib3 - 1 defective cftr epithelial cell line in terms of oxidative stress and cytokine production in environmental conditions that could mimic cf conditions .
initial studies suggested that the absence of cftr led to a change in the composition of the airway surface fluid ( asl ) , namely an increase in nacl concentration . in parallel
hypothesis resulting in a decrease of periciliary fluid volume that leads to airway surface dehydration and mucociliary clearance decrease . as it is difficult to reproduce dehydration conditions in vitro ,
we used a model using various nacl concentrations in accordance with previous studies that have shown that increased nacl concentrations in the environment of cftr defective human epithelial cells induced an increased production of cytokines such as il-8 .
we hypothesized that ros production depending on the modulation of nox activity in cf cells could induce cytokine production participating to early inflammation in cf .
eagle 's minimal essential medium ( mem ) , fetal calf serum ( fcs ) , l - glutamine , penicillin , streptomycin , hank 's balanced salt solution ( hbss ) and phosphate buffered saline ( pbs ) were purchased from gibco - brl ( invitrogen , cergy , france ) .
luminol , lucigenin , n - ethylmaleimide ( nem ) and tert - butylhydroperoxide ( t - bhp at 70% ( v / v ) in aqueous solution were purchased from sigma chemical co. ( st - quentin - fallavier , france ) .
diphenyleneiodonium ( dpi ) , apocynin and calcium ionophore ( a 23187 ) were obtained from calbiochem ( san diego , ca , usa ) .
5-chloromethyl fluorescein diacetate ( cmf - da ) , monobromobimane ( mbrb ) , and yopro-1 were purchased from molecular probes ( eugene , or , usa ) .
the horseradish peroxidase- ( hrp- ) conjugated goat anti - rabbit , goat anti - mouse , and the ecl western blot detection system came from santa cruz biotechnology ( santa cruz biotechnology , santa cruz , california ) .
the polyclonal rabbit antibody directed against the intracellular domain of human duox1/2 was a gift from dr . c. dupuy ( villejuif , france ) .
the rabbit polyclonal antibodies directed against noxa1 and noxo1 were produced in the laboratory as well as the recombinant human proteins noxa1 and noxo1 .
the rabbit polyclonal antibody anti - nox1 was from abcam ; the monoclonal mouse anti - gp91phox antibody ( 54.1 ) , the rabbit polyclonal anti - p22phox , and anti - nox5 antibodies were from santa cruz biotechnology ; the rabbit polyclonal anti - nox3 and anti - nox4 antibodies were from abnova and novus biologicals , respectively .
88081201 ) ( bronchial epithelial cells from cystic fibrosis patient immortalized by viral transformation using adeno-12-sv-40 with the cftr genotype of 508/w1282x ) and s9 cell line ( ecacc reference no .
85011431 ) ( corrected cftr cells 508/w1282x + wild - type cftr ) generated from ib3 - 1 cells by transfection with a recombinant adeno - associated viral vector encoding full - length , wild - type cftr were used ; ib3 - 1 cells have the trafficking defect that characterizes primary cf cells .
cells were cultured in mem medium supplemented with 10% heat - inactivated fcs , antibiotics ( 100 g / ml streptomycin , 100 u / ml penicillin ) and 2 mm l - glutamine and cultured in a humidified atmosphere containing 5% co2 at 37c .
the cells were cultured either into 75 cm tissue culture flasks at the initial concentration of 3.10 cells / ml or in 96-well flat bottom microplates at 3.10 cells / well . for these experiments ,
both cell types were grown near confluence ( 80% ) . for cytokine release , 10 cells were plated and grown overnight in 300 l medium in 24-well plates .
cell viability was assessed using the alamar blue assay . only cell populations with at least 95% viability
cells were exposed to mem without phenol red adjusted with nacl solutions to obtain hypotonic , isotonic , or hypertonic media , respectively .
ionic concentrations were calibrated with a ph / ionometer ( radiometer analytical , hach lange gmbh ) . for all cases
the ib3 - 1 and s9 cells were cultured until sub - confluence in a complete mem medium and incubated at 37c , 5% co2 , and 95% air to ensure cells would adhere and proliferate .
after that , subconfluent monolayers of ib3 - 1 and s9 cells were exposed to the three nacl - containing solutions used in this study at ph 7.4 for different time periods according to the analyzed parameters . in some experiments ,
tert - butyl hydroperoxide ( t - bhp ) , n - ethylmaleimide ( nem ) , diphenyliodonium ( dpi ) , apocynin , or calcium ionophore ( a 23187 ) were added to the cultures .
prior studies ( time and concentration relationship ) were carried out to determine the optimal concentrations required in terms of activity and viability . in all experiments , especially using dpi , cell viability was checked by alamar blue assay .
oxidative stress depends on an imbalance between ros production and antioxidant systems . to assess the oxidative stress induced by the different culture media in ib3 - 1 and s9 cells , we measured ros production intra- and extracellularly and the levels of glutathione , a major antioxidant compound , as well as total thiol content .
to assess the source of ros generated in the different experimental conditions , ib3 - 1 cells and s9 cells were preincubated for 15 min with dpi ( 2.5 m ) , which is an inhibitor of flavoproteins , namely , the catalytic subunit of nadph oxidase .
briefly , cell suspension ( 10 cells in 500 l hbss ) was preincubated without or with 2.5 m dpi or 200 m apocynin for 15 min , then 10 m luminol and 5 u / ml peroxidase were added to react in the thermostated chamber ( 37c ) of the luminometer ( berthold - biolumat lb937 ) and allowed to stabilize .
after a baseline reading was established , cells were incubated with the different nacl media .
changes in chemiluminescence were measured over a 2-hour period in accordance with previous kinetic experiments .
results were expressed in terms of area under the curve ( cpm/10 cells ) and the percentage between hypotonic and hypertonic treatment as compared to isotonic medium was calculated .
glutathione and thiol level measurements were performed using the 5-chloromethyl - fluorescein diacetate ( cmf - da , 10 m ) and the monobromobimane ( mbrb , 40 m ) probes , respectively .
the glutathione transferase catalyses the reaction between cmf and the intracellular thiols retained inside the cell , whereas the unconjugated probe is released in the medium and eliminated .
the monobromobimane probe , which forms a fluorescent adduct with sulfhydryl groups , allows measuring total thiols [ 33 , 35 ] .
after 30 min of incubation at 37c , fluorescence intensity was measured at ex 485 nm and em 538 nm ( fluostar , bmg labtechnologies , champigny - sur - marne , france ) .
reduced glutathione ( gsh ) or total thiol contents were expressed as the percentage of fluorescence intensity in each cell type incubated with hypotonic and hypertonic treatment as compared to isotonic medium .
experimental control thiol depletion was obtained by treatment of cells with the alkylating reagent n - ethylmaleimide ( nem ) , used at 0.2 mm for 15 min .
cells cultured in 96-well plates were labeled with fluorogenic yopro-1 ( 20 m ) probe . in these conditions , viable cells excluded yopro-1 whereas apoptotic cells took up the probe by intercalating into dna .
microscopic examination was performed and fluorescence intensity was measured using fluostar ( bmg labtechnologies , champigny - sur - marne , france ) at ex 485 nm and em 538 nm , which are optimum wavelengths for yopro-1 .
results were expressed as the percentage of fluorescence intensity in each cell type incubated with hypotonic and hypertonic treatment as compared to isotonic medium .
the mitochondrial apoptotic pathway was detected as a loss of the mitochondrial transmembrane potential ( m ) , measured as a reduction of the dioc6 incorporation .
the cells , treated or not with the direct oxidant t - bhp ( 2 mm ) , used as a control of induced oxidative stress or nacl media were loaded with dioc6 ( 40 nm ) for 15 min at 37c .
then , they were incubated for 15 min with 1 mg / ml propidium iodide to gate out dead cells .
samples were then suspended in pbs and analyzed immediately by flow cytometry ( beckman coulter ) .
il-6 and il-8 were measured using bd cytometric bead array soluble protein flex set assays ( beckton dickinson , bd biosciences , europe ) by flow cytometric analysis .
the secretion of il-6 and il-8 in the culture supernatants of ib3 - 1 and s9 bronchial epithelial cells was measured 18 hours after treatment with the different extracellular nacl solutions in 24-well plastic tissue culture plates ( 10 cells / well ) .
flow cytometric analysis was performed with a becton dickinson facscanto ii immunocytometry system ( bd biosciences ) .
the data were analyzed using the fcap array software ( becton dikinson ) and expressed as pg / ml using the standard flex set concentration curve . to keep the same cell density as in other experiments , 10 cells of s9 or ib3 - 1 were plated in 25 cm polystyrene flask with complete mem . in preliminary experiments , we tested duox1/2 and nox2 expression after 5 h and 18 h of incubation . in our experimental model , the optimal expression of these proteins was obtained after 18 h of incubation .
after the different extracellular nacl treatments , the cells were washed with pbs ca / mg free and scrapped in presence of a cocktail of proteinase inhibitors and fractionated under reducing conditions .
protein determination was carried out after sonicating each sample in ice by using bio - rad assay and 0.1 mg / ml bsa as standard .
samples containing 60 g of each extract from s9 and ib3 - 1 cells incubated with the different nacl media were separated by 8% sds - page and blotted onto nitrocellulose membrane .
the membranes were then blocked at room temperature for 1 hour with 5% milk prepared in 25 mm tris cl , ph 7.5 , 150 mm nacl ( tbs ) , and containing 0.05% tween-20 ( tbs - t ) .
the membranes were incubated overnight at 4c with the antibodies directed against nox1 , its regulators noxo1 and noxa1 , nox2 , its regulators p47phox and p67phox , nox3 , nox4 , nox5 , duox1/2 and p22phox at previously determined concentrations .
after three washes in 0.05% tbs - tween , the incubation with the secondary antibody ( hrp - goat anti - rabbit or hrp - goat anti - mouse ) was performed for 1 hour in blocking buffer . after washing revelation
significant differences were identified using a student 's t - test . values of p inferior to 0.05 were considered statistically significant .
in addition , the cells were pretreated or not for 15 min with 2.5 m dpi , an nadph oxidase inhibitor . as shown in figure 1(a ) , both airway epithelial cell lines ib3 - 1 and s9 show basal production of ros in isotonic conditions .
there was no significant difference between both cell lines ( mean sem = 11.4 10 1.2 10 cpm/10 cells/2 h and 11.3 10 1.5 10 cpm/10 cells/2 h for s9 and ib3 - 1 , resp .
, both cell lines increased their ros production approximately two- and three - fold as compared to isotonic medium for s9 and ib3 - 1 , respectively .
ib3 - 1 ros production was significantly higher than that obtained with s9 cells , p < 0.05 , n = 5 .
hypotonic medium also slightly increased ros production by ib3 - 1 as compared to s9 cells whose production did not differ from that obtained in isotonic medium .
the pretreatment with dpi revealed strong inhibition of ros production that could suggest the implication of an nadph oxidase in this process .
similar inhibition was obtained using apocynin ( data not shown ) . to determine the role of thiols in cell defense against ros production ,
the effects of ionic variations on gsh and total thiol contents after 2-hour - incubation time on s9 and ib3 - 1 cell lines were assessed using the cmf - da ( figure 1(b ) ) and the monobromobimane fluorescent probes , respectively . as shown in figure 1(b ) , hypo- and hypertonic media significantly decreased gsh intracellular content in the ib3 - 1 cell line as compared to ib3 - 1 cells maintained in isotonic conditions ( 100% ) . in hypertonic conditions , gsh content was significantly lower in ib3 - 1 cells than in s9 cells .
noteworthy , hypertonic medium also induced increased ros generation and reduced gsh content in the control s9 cells .
however , the hypertonic medium - induced alteration was significantly higher in the cftr - deficient ib3 - 1 cells than in control s9 cells .
these results are in accordance with chan et al . who also showed an increased response of control cells to high salt concentrations .
nem treatment used as a common control to block sulfhydryls groups dramatically decreased gsh in both cell lines , as expected .
hypertonic conditions induced similar variations on the total thiol content although no significant decrease was observed between ib3 - 1 and s9 cells ( data not shown ) .
treatment with dpi suppressed the differences in gsh content induced by hypertonic medium ( figure 1(b ) ) .
altogether , variations in nacl concentrations , especially the hypertonic conditions , induced a significant increase in ros production associated with a tendency to decrease in gsh and thiol contents in ib3 - 1 as compared to s9 cell lines .
these results suggest that hypertonic conditions induced a more important oxidative stress in defective cftr ib3 - 1 cells than in control s9 cells . a pre - treatment with the dpi inhibitor suppressed these modulations , thus suggesting the involvement of nox(s ) in the induction of oxidative stress
. cell viability of both cell lines was checked to be higher than 90% by alamar blue assay in all experimental conditions as indicated in section 2 . as oxidative stress has been described to induce or accelerate cell apoptosis , we tested the effect of ionic variations in extracellular medium on the apoptosis of ib3 - 1 cells as compared to that of s9 cells .
we used the fluorescent probe yopro-1 , as described in section 2 , to test the rate of apoptosis of both cell lines in these conditions .
the level of apoptosis in isotonic conditions was low ( < 5% of the cells ) and no difference between s9 and ib3 - 1 epithelial cells was noted ( figure 2(a ) ) . in contrast ,
culture for five hours in hypertonic medium induced a higher level of fluorescence of the majority of ib3 - 1 cells as compared to s9 cells ( figures 2(a ) and 2(b ) ) .
in hypertonic conditions apoptosis level of s9 cells did not significantly differ from that observed in isotonic conditions ( figure 2(a ) ) .
treatment with t - bhp used as a control of oxidative stress also showed that ib3 - 1 cells are significantly more sensitive to oxidant - induced apoptosis than s9 cells . to further identify this hypertonic - induced apoptosis of ib3 - 1 cells
, we measured the effects of the different nacl containing media on mitochondrial apoptotic pathway by measuring m .
the proportion of dioc6 ( loss of m ) ib3 - 1 cells was significantly higher than that of s9 cells after culture in hypertonic and hypotonic media , as compared to the value obtained in isotonic conditions ( figure 2(c ) ) .
furthermore , the proportion of dioc6 ib3 - 1 cells was also significantly higher than that of s9 cells at the basal level in isotonic condition .
the differences obtained between yopro-1 and dioc6 techniques in isotonic medium could be explained by a higher sensitivity of reduction of the dioc6 incorporation in relation to the loss of mitochondrial transmembrane potential .
these results suggest that apoptosis was triggered , at least in part , through an effect at / or upstream the mitochondrial membrane permeabilization .
the increase percentage in dioc6 ib3 - 1 cells observed in all ionic conditions was significantly inhibited by dpi , thus reinforcing the hypothesis of the involvement of nox(s ) in the induction of apoptosis via ros production . to evaluate the effect of nacl treatments on il-6 and il-8 release , s9 and ib3 - 1 cell supernatants
the results presented in figures 3(a ) and 3(b ) , confirmed previous data showing an increased basal production of il-6 and il-8 by ib3 - 1 cells as compared to s9 cells that was further increased by hypertonic media .
dpi significantly inhibited basal as well as hypertonic - induced il-6 and il-8 increased production by ib3 - 1 cells ( figures 3(a ) and 3(b ) ) .
as dpi significantly inhibits oxidative stress , increased apoptosis as well as increased il-8 and il-6 production in cftr - deficient cells cultured in hypertonic medium but also at the basal level for apoptosis and cytokine production , we examined the nox protein expression that was a major source of ros in airway epithelial cells . using antibodies which recognize nox1 , its regulators noxo1 and noxa1 , nox2 , its regulators p47phox and p67phox , nox3 , nox4 , nox5 , duox1/2 , and p22phox , we showed by sds / page and western blot analysis that in basal isotonic conditions ib3 - 1 and s9 cells expressed duox1/2 as well as gp91phox ( nox2 ) and its partners p47phox , p67phox and the widely expressed p22phox ( figures 4(a ) and 4(b ) ) .
the human lung mucoepidermoid carcinoma derived cell line nci - h292 ( crl 1848 ; american type culture collection ( atcc ) , manassas , va ) known to express duoxs was used as positive control for duox1/2 testing and lysates from neutrophils isolated from human blood , as usually performed in the laboratory , were used as controls for phagocytic nadph oxidase compounds : nox2 , p22phox , p47phox , and p67phox [ 39 , 40 ] .
nox1 , noxo1 , noxa1 , nox3 , nox4 , and nox5 could not be detected in both cell lines as compared to cell lines expressing these noxs and recombinant proteins noxo1 and noxa1 produced in the laboratory ( data not shown ) .
the expression level of duoxs , nox2 , and its partners was not significantly different between s9 and ib3 - 1 cells .
after culture for 18 hours in presence of media containing various nacl concentrations , duox1/2 and nox2 protein expression was not modulated by ionic variations ( data not shown ) .
the intracellular presence of two ef - hand motifs in duox proteins suggests that calcium may directly regulate these enzymes , which is consistent with the observations showing that calcium ionophore stimulates ros production in thyroid and airway epithelial cells [ 15 , 41 , 42 ] .
is altered in cf cells and could be implicated in duoxs and nox2 regulation , we tested the effect of calcium ionophore ( a23187 ) on the oxidative stress markers of both s9 and ib3 - 1 cells as compared to their respective control in isotonic conditions .
a23187 significantly increased ros production , apoptosis commitment , and il-6 and il-8 production by ib3 - 1 cells as compared to the untreated ib3 - 1 cells and to a23187-treated s9 cells ( figures 5(a ) , 5(b ) , 5(c ) , and 5(d ) ) .
in addition , the a23187-increased parameters were strongly suppressed by dpi in ib3 - 1 cells ( figures 5(a ) , 5(b ) , 5(c ) , and 5(d ) ) .
this study showed that diphenyleneiodonium , a commonly used inhibitor of flavoenzymes such as noxs , inhibited several parameters known as participating in oxidative stress in ib3 - 1 defective cftr epithelial cells cultured in hypertonic environment .
in fact , increased ros production and decreased antioxidant component level such as reduced glutathione ( gsh ) and total thiol contents , which were altered in ib3 - 1 defective cftr epithelial cells cultured in hypertonic environment , were inhibited by pretreatment of the cells with dpi .
these results were confirmed using apocynin known as noxs inhibitor and radical scavenger . in addition , the increased involvement of the mitochondrial apoptotic pathway which was observed in ib3 - 1 defective cftr epithelial cells cultured in basal isotonic conditions as well as in hypotonic and hypertonic conditions as compared to the s9 control cells in the similar conditions was also suppressed by dpi .
furthermore , calcium ionophore ( a23187 ) , which is known to upregulate some nadph oxidase activities , strongly enhanced ros production by ib3 - 1 cells and triggered their apoptosis as well as their il-6 and il-8 production and these events were suppressed by pretreatment of the cells with diphenyleneiodonium .
the increased il-8 and il-6 production by defective cftr epithelial cells in basal conditions , which has already been described [ 10 , 11 , 31 ] , was also inhibited by dpi .
the inhibitory effect of dpi supports the involvement of nadph oxidases in all these events occurring in cf airway epithelial cells .
the results showed the expression of duox protein as well as nox2 and its classical phagocytic partners .
variations of ionic conditions in the culture medium did not significantly modify the nox expression .
these results suggest the intrinsic role of cftr deficiency in inducing oxidative stress and increased cytokine production via nox activity leading to early inflammatory events in the cf disease .
the dysfunction of cftr leads to increased mucus viscosity via periciliary liquid layer depletion and therefore abnormal environment of the epithelial airway cells . as it was difficult to reproduce these pathologic features in vitro , we chose the model of ionic variations in relation to various concentrations of nacl as a stress model of the cells .
in fact , the alterations of the different parameters tested were often modified in hypotonic as well as in hypertonic conditions .
we showed here for the first time that ib3 - 1 defective cftr cells express duoxs and nox2 .
we used antibody directed against the intracellular domain of duox1 and 2 ( a gift from c. dupuy ) , as commercial antibodies against duox1 and duox2 did not give accurate results .
recent works have demonstrated the presence of duox proteins in the respiratory tract epithelium and have shown that duox proteins are an important source of ros production in the respiratory tract [ 14 , 15 ] .
in addition , other nox isoforms have been detected in aiway epithelial cells such as nox1 , nox2 , and nox5 [ 20 , 21 ] . investigating by immunoblotting the presence of the 5 other noxs only showed the presence of nox2 , its regulators p47phox and p67phox , and the widely distributed p22phox .
interestingly , calcium ionophore a23187 significantly enhanced ros production , apoptosis , and cytokine production by ib3 - 1 cells , as compared to untreated cells , as well as a23187-treated s9 cells .
furthermore , studies have linked altered intracellular calcium mobilization , nf-b activation with inflammatory response in several cell systems in cf [ 5 , 46 ] .
in particular , an increase in il-8 secretion in cf cells was mediated by an increased intracellular calcium mobilization .
these events are in accordance with the presence in ib3 - 1 cells of both nadph oxidases , duox1/2 and nox2 whose activities are regulated by calcium ions [ 15 , 17 , 41 , 43 ] .
the a23187-induced upregulation of ros production , apoptosis , and cytokine production by ib3 - 1 cells were strongly inhibited by dpi , suggesting a relationship between intrinsic defect in cftr and nox protein activity .
our results suggest that ib3 - 1 defective cftr cells are highly susceptible to ionic variations via duox and nox2 activities generating ros production . increased ros production and modulation in gsh epithelial transport as well as increased susceptibility to apoptosis
have already been described in cftr - deficient cells but their mechanism was unclear [ 2 , 46 ] .
our results confirm an increased production of the proinflammatory cytokines il-6 and il-8 by ib3 - 1 defective cftr cells in basal isotonic medium , as well as in various ionic conditions , as already described [ 5 , 10 , 11 ] .
we showed here that dpi significantly reduces this production , suggesting also the involvement of duox and nox2 in this process and therefore in the early inflammatory status of the lung in cf patients .
in conclusion , we have shown that inhibition of catalytic subunit of nadph oxidases isoforms , that is , duox and nox2 detected in ib3 - 1 defective cftr cells , suppresses features of oxidative stress , which are observed in hypertonic conditions as well as the increased il-6 and il-8 production that could be responsible for neutrophil migration and early inflammation in the course of the cf disease . | in cystic fibrosis ( cf ) patients , pulmonary inflammation is a major cause of morbidity and mortality .
the aim of this study was to further investigate whether oxidative stress could be involved in the early inflammatory process associated with cf pathogenesis .
we used a model of cftr defective epithelial cell line ( ib3 - 1 ) and its reconstituted cftr control ( s9 ) cell line cultured in various ionic conditions .
this study showed that ib3 - 1 and s9 cells expressed the nadph oxidases ( noxs ) duox1/2 and nox2 at the same level .
nevertheless , several parameters participating in oxidative stress ( increased ros production and apoptosis , decreased total thiol content ) were observed in ib3 - 1 cells cultured in hypertonic environment as compared to s9 cells and were inhibited by diphenyleneiodonium ( dpi ) , a well - known inhibitor of noxs ; besides , increased production of the proinflammatory cytokines il-6 and il-8 by ib3 - 1 cells was also inhibited by dpi as compared to s9 cells .
furthermore , calcium ionophore ( a23187 ) , which upregulates duox and nox2 activities , strongly induced oxidative stress and il-8 and il-6 overexpression in ib3 - 1 cells .
all these events were suppressed by dpi , supporting the involvement of noxs in the oxidative stress , which can upregulate proinflammatory cytokine production by the airway cftr - deficient cells and trigger early pulmonary inflammation in cf patients . |
we investigated 9 small - holding duck farms that reported bird deaths during september 12november 5 , 2012 ( 6 ) .
cloacal swab samples were collected from sick birds , placed in 1,000 l of viral transport medium , and sent for testing at laboratories of the regional ministry of agriculture disease investigation center , jogjakarta .
seventeen a(h5n1)positive samples were forwarded to the national animal health laboratory , indonesian research center for veterinary science ( ircvs ) , for virus isolation and genome sequencing .
in addition , ircvs collected 122 cloacal swab samples from birds and 58 environmental swab samples ( from defeathering machines ) at 5 live - bird markets ( lbms ) in east java province during november 58 , 2012 .
rna extracted from farm and lbm specimens was tested for influenza a matrix gene to identify presumptive a(h5n1)-positive samples ( 7 ) .
select positive samples were inoculated in 911-day - old embryonated , specific pathogen free eggs .
allantoic fluid was harvested 36 h postinfection and tested for ha with chicken erythrocytes to confirm virus isolation ( 8) .
samples showing suspected a(h5n1 ) infection were propagated in a biosafety level-3 laboratory at ircvs in compliance with biosafety regulations .
ten virus isolates ( 7 from duck farms , 3 from lbms ) were chosen for full - length ha gene sequencing ( genbank accession nos .
results of reverse transcription pcr and sequencing primers are available on request . sequencing and consensus sequence generation
phylogenetic trees were generated by using mega4 ( 10 ) ( figure ;
technical appendix 1 ) .
the phylogenetic tree was generated in mega version 4 ( www.megasoftware.net ) , using neighbor - joining analysis with 1,000 bootstrap replicates and the kimura 2-parameter model .
phylogenetic analysis revealed that a(h5n1 ) isolates from samples collected from duck farm outbreaks and an lbm were not related to isolates in long - established indonesian clade 2.1 ; rather , the ha genes closely resembled those of clade 2.3.2.1 viruses recently found in vietnam , china , and hong kong ( figure ) .
full - length ha genes showed 97%98%-nt identity with recent viruses from vietnam and clustered in a larger group containing viruses from many asian regions during 20092012 .
the environmental sample from an east java lbm shared > 99% nt similarity with viruses from samples at duck farms , indicating spread of this a(h5n1 ) clade into the marketing chain .
a poultry sample from the same district as the 2.3.2.1 virus was identified as clade 2.1.3.2 ( figure ) , indicating likely cocirculation .
the 8 clade 2.3.2.1 ha genes analyzed possessed a multibasic amino acid cleavage site ( table 1 ) .
the cleavage site sequence of the clade 2.3.2.1 viruses from indonesia ( pqrerrrkrg ) differed from recent clade 2.1.3.2 viruses ( pqresrrkkrg ) by a ser deletion at position 325 and a k328r substitution . like other serotype h5n1 ha proteins ,
all isolates possessed a conserved glutamine at position 222 ( equivalent to h3 position 226 ) and glycine at position 224 ( h3 position 228 ) , indicating no substantial changes in avian receptor - binding specificity ( table 1 ) ( 11 ) .
the clade 2.3.2.1 viruses from indonesia possessed 6 or 7 potential n - linked glycosylation sites ( 7 in clade 2.1.3.2 viruses ) , but unlike 2.1.3.2 viruses , all 2.3.2.1 viruses lacked the potential glycosylation site at position 154 . * ha , hemagluttinen ; na , neuraminidase ; m2 , matrix 2 ; ns , nonstructural ; nd , not determined .
numbering of the first and last nucleotide position of the gene that was sequenced is as follows : pb2 , 16182192 ; pb1 , 130632 ; pa , 34429 ; ha , 11710 ; np , 268755 ; na , 551314 ; m , 55919 ; ns , 25690 . glycosylation motif at 154 was absent for all strains .
up to 29 conserved amino acid changes occurred in the mature ha1 protein between clade 2.3.2.1 and clade 2.1.3.2 viruses found recently in indonesia , indicating these a(h5n1 ) virus subgroups probably diverged substantially in antigenicity .
in contrast , the ha1 of the new viruses collected in indonesia differed by 810 aa from a / hubei/1/2010 , the most closely related clade 2.3.2.1 a(h5n1 ) candidate vaccine virus recommended by the world health organization ( technical appendix 2 ) ( 12 ) . to test the antigenic relationship of the clade 2.3.2.1 virus to the endemic clade 2.1.3.2 virus
, we conducted a hemagglutination - inhibition test with ferret antiserum raised against viruses from these and other h5n1 clades ( table 2 ) ( 8) . as the ha1 protein sequence differences suggest , clade 2.1.3.2 antiserum did not inhibit hemagglutination by a representative clade 2.3.2.1 virus from indonesia , a / environment / east java / lbm - lm13/2012 .
in contrast , this virus cross - reacted with antiserum to clade 2.3.2.1 viruses from other countries at heterologous titers generally within 2-fold of or equivalent to the homologous virus titer .
the indonesian clade 2.3.2.1 virus was most closely related antigenically to viruses that clustered genetically into the a / hong kong/6841/2010-like group of clade 2.3.2.1 ( table 2 ) .
strains : vn/1203 , a / vietnam/1203/2004 ; eg/321 , a / egypt/2321-namru3/2007 ; anh/1 , a / anhui/1/2005 ; ind/12379 , a / indonesia / nihrd12379/2012 ; ch/1 rg30 , a / hubei/1/2010 idcdc - rg30 ; bs / hk/1161 , a / barn swallow / hong kong/1161/2010 ; bhg / mg / x53 , a / barheaded goose / mongolia / x53/2009 ; hk/6841 , a / hong kong/6841/2010 ; dk / vn/1584 , a / duck / vietnam / ncvd-1584/2012 .
all 4 isolates exhibited the typical 20-aa deletion in the stalk region ( residue 4868 ) of the neuraminidase gene ( na ) .
although 1 sample had an ile203val substitution in the na , which has been associated with reduced susceptibility to oseltamivir , no other markers of resistance in the na or m2 were identified ( table 1 ) .
all 4 viruses had ns1 protein sequences with the typical deletion at position 8084 and an intact h5n1 consensus pdz binding motif ( esev ) . a truncated form ( 57 aa ) of the pb1-f2 protein
although the functional consequences of this truncation are unknown , this represents a change from the typical full - length 90-aa protein found in most a(h5n1 ) viruses ( 13 ) .
all other amino acid residues and motifs of interest in the internal genes of the 4 viruses sequenced in this study represented avian consensus sequences .
phylogenetic comparison of the na and internal gene segments revealed ancestral origins of the new viruses similar to those of the ha gene ( technical appendix 1 ) .
although partial nucleotide sequences from some genes were available for analysis ( table 1 ) , sequence identities and phylogenetic comparisons to other clade 2.3.2.1 genomes in genbank and global initiative on sharing avian influenza data databases confirmed their relatedness to viruses circulating recently in china , vietnam , and hong kong .
individual gene sequence analysis did not show reassortment between these clade 2.3.2.1 viruses and the previously identified clade 2.1.3.2 genotype virus in indonesia .
detection of a novel clade of a(h5n1 ) virus in indonesia marks a potential turning point in the molecular epidemiology of this virus .
indonesia has the highest number of human a(h5n1 ) infections because of ongoing outbreaks in poultry ( 14,15 ) .
whether this new virus will become entrenched , as did clade 2.1.3 viruses over the past decade , remains to be seen , as do its effects on the incidence of human infection .
potential cocirculation of subtypes of 2 different clades warrants review of diagnostic methods and vaccination strategy to maximize effectiveness of disease control interventions .
the lack of antigenic relatedness between the clade 2.3.2.1 and 2.1.3.2 viruses must be considered when evaluating a(h5n1 ) serologic diagnostic reagents used in indonesia .
this change also may have implications in selecting prepandemic candidate vaccine virus for the region .
furthermore , poultry vaccines may need to be matched antigenically to circulating virus if clade 2.3.2.1 virus continues to circulate in indonesia .
introduction of this virus is a stark reminder of the value of control measures to reduce the spread of subtype h5n1 and the need for enhanced surveillance of humans and poultry to monitor changes in its genetic and immunologic features .
a g . phylogenetic tree of pb2 , pb1 , pa , np , na , m , ns ( a = pb2 ; b = pb1 ; c = pa ; d = np ; e = na ; f = m ; g = ns ) .
the phylogenetic tree was generated in mega version 4 , using neighbor - joining analysis with 1000 bootstrap replicates using the kimura-2 parameter model .
viruses characterized in this study are indicated with a bar showing samples collected in indonesia from september to november 2012 .
phylogenetic tree of pb2 , pb1 , pa , np , na , m , ns ( a = pb2 ; b = pb1 ; c = pa ; d = np ; e = na ; f = m ; g = ns ) . from bird samples collected in indonesia during september | after reports of unusually high mortality rates among ducks on farms in java island , indonesia , in september 2012 , influenza a(h5n1 ) viruses were detected and characterized .
sequence analyses revealed all genes clustered with contemporary clade 2.3.2.1 viruses , rather than enzootic clade 2.1.3 viruses , indicating the introduction of an exotic h5n1 clade into indonesia . |
helicobacter pylori ( h. pylori ) is a gram - negative bacillus that inhabits the gastric mucosa and mucus .
h. pylori infection is now known to be a risk factor of a wide range of diseases , such as atrophic gastritis , gastroduodenal ulcer , mucosa - associated lymphoid tissue ( malt ) lymphoma , gastric cancer , and idiopathic thrombocytopenic purpura ( itp ) [ 14 ] .
furthermore , the recurrence of early gastric cancer after its endoscopic resection was reported to be reduced to almost one - third if h. pylori was successfully eradicated . in japan
150,000 deaths from gastric cancer will be prevented over 5 years if all h. pylori is eliminated .
the first - line eradication therapy of h. pylori in japan is triple therapy , consisting of a proton pump inhibitor ( ppi ) , amoxicillin ( ampc ) , and clarithromycin ( cam ) .
this regimen has been covered by the national health insurance system since december 2000 . however , due to the increase of cam - resistant h. pylori strains , the eradication rate of first - line therapy is reported to be as low as 75% .
second - line eradication therapy , consisting of ppi , ampc , and metronidazole ( mnz ) , has been approved in japan for those who fail the first - line therapy .
the eradication rate of the second - line therapy has been reported to be around 90% [ 8 , 9 ] .
these results indicate that about 3% of h. pylori positive patients fail in both first- and second - line therapy . from 2013 , the eradication treatment for h. pylori infection with chronic gastritis
as the number of the patients who are eligible for the eradication of h. pylori is estimated to be increasing , it is becoming more important to establish standard third - line eradication therapy .
the guidelines of the japanese society of helicobacter research suggest ppi + ampc + levofloxacin ( lvfx ) or high - dose ppi + ampc as the third - line eradication regimen in 2009 . in the former regimen ,
the rate of eradication was reported to be 43.170.0% if it was used as third - line therapy [ 10 , 11 ] . in the latter regimen ,
the rate of eradication was reported to be 54.3% if it was used as third - line therapy . until now , which regimen is more effective for third - line eradication therapy has not been clarified sufficiently .
the aim of this study was to investigate and compare the eradication rate of third - line triple therapy with rabeprazole ( rpz ) + ampc + lvfx to high - dose rpz + ampc which were suggested in the guidelines of the japanese society of helicobacter research in 2009 .
this was a prospective , randomized , controlled study conducted in chiba university hospital . from june 2011 to june 2013 , patients who failed japanese first - line ( ppi + ampc + cam ) and second - line ( ppi + ampc + mnz ) eradication therapy were randomly assigned to one of the following third - line eradication groups at a 1 : 1 ratio using random number tables : ( 1 ) ral group : rpz 10 mg ( b.i.d . ) , ampc 750 mg ( b.i.d . ) , and lvfx 500 mg ( o.d . ) for 10 days ; ( 2 ) ra group : rpz 10 mg ( q.i.d . ) and ampc 500 mg ( q.i.d . ) for 14 days .
patients ( 1 ) who had a past history of allergy to the study drugs , ( 2 ) who had severe liver dysfunction , ( 3 ) who were undergoing treatment of malignant disease , ( 4 ) who were pregnant or lactating , or ( 5 ) who were ineligible to participate in this study according to the decision of a physician were excluded from this study .
the secondary endpoints were the safety of treatment and the efficacy of fourth - line treatment . before being randomized
, all patients underwent upper endoscopy and we performed h. pylori sensitivity testing for the antibiotics ( ampc , cam , mnz , and lvfx ) .
six to twelve weeks after the end of the third - line eradication therapy , a c - urea breath test ( ubt ) was performed .
patients who failed to respond to third - line eradication therapy received salvage therapy as the fourth - line one . in this regimen , patients who were treated with ral received ra ( salvage ra group ) and those treated with ra received ral ( savage ral group ) .
six to twelve weeks after the end of the salvage therapy , h. pylori eradication was assessed again with ubt . during the study ,
blood samples were taken from the patients to analyze the cytochrome p450 2c19 ( cyp2c19 ) polymorphism .
the study protocol was approved by chiba university institutional review board and registered ( clinical registration number , umin000005373 ) .
all patients underwent ubt before third - line eradication to check for the presence of h. pylori . at 612 weeks after the third - line therapy and salvage therapy , the patients whose ubt results were negative were considered to have eradicated the infection . before ubt , ppi , which may influence the test results , was discontinued for at least 2 weeks .
h. pylori strains were isolated from tissue samples from the gastric corpus and antibiotic sensitivity testing was performed using the e - test .
the breakpoints were 1.0 g / ml for abpc , cam , and lvfx and 8.0 g / ml for mnz .
an h. pylori strain was judged resistant to the antibiotics when its minimum inhibitory concentrations ( mic ) value was equal to or beyond the breakpoint .
genotyping of the two mutated genes was performed using the gene analysis by fluorescence correlation spectroscopy ( gfcs ) method with blood serum samples from the patients .
the cyp2c19 gene polymorphisms were classified into three types : cyp2c19 wild type gene ( cyp2c191 ) and two mutated genes ( cyp2c192 and cyp2c193 ) .
patients with ( 1/1 ) were categorized as the homogeneous extensive metabolizers ( em ) .
patients with ( 1/2 ) or ( 1/3 ) were categorized as the heterogeneous em . and patients with ( 2/3 ) , ( 2/2 ) , or ( 3/3 ) were categorized as the poor metabolizers ( pm ) .
adverse events ( ae ) were evaluated by asking the patients about their condition and laboratory evaluation of liver and renal function , which was performed two weeks after the end of the third - line eradication therapy .
statistical analysis of the third and overall eradiation rates was performed between two groups using the chi - square test .
each parameter of the patient background was analyzed using the chi - square test or unpaired t - test .
, chicago , il , usa ) , with p < 0.05 considered statistically significant .
fifty - one patients were enrolled in this study and the study flow of the patients is shown in figure 1 .
the 51 patients were randomly assigned to the ral group ( n = 24 ) or ra group ( n = 27 ) ( intension to treat ( itt ) analysis subjects set ) .
three patients in the ra group were excluded from the per - protocol ( pp ) analysis because two refused treatment and one did not visit the hospital . as a result ,
twelve patients in the ral group and eleven patients in the ra group underwent salvage therapy .
one patient in the ral group and two patients in the ra group did not consent to salvage therapy .
one patient in the salvage ral group who refused treatment was excluded from pp analysis .
consequently , twelve patients in the ral group and ten patients in the ra group were included in the pp analysis .
h. pylori was eradicated from six patients in the ral group ( salvage ra group ) and five patients in the ra group ( salvage ral group ) .
the backgrounds of the patients , based on pp analysis , are shown in table 1 .
the two groups had similar characteristics with respect to age , sex , body mass index ( bmi ) , reasons for the eradication , and success rate of the drug sensitivity test .
the success rate of the drug sensitivity testing was defined as the ratio of number of cases with them to all cases .
the number of cyp2c19 em was significantly higher in the ral group than in the ra group ( p < 0.05 ) .
the rates of eradication , based on itt analysis , were 45.8% for the ral group and 40.7% for the ra group and there was no significant difference ( p = 0.71 ) .
in the pp analysis , the rates of eradication were the same ( 45.8% ) in both groups .
table 2 shows a comparison , based on pp analysis , of the patients ' backgrounds , between the success and failure groups in the third - line eradication therapy .
there was no difference with respect to sex , bmi , eradication therapy , drug resistance , and cyp2c19 polymorphism .
the age ( mean s.d . ) of the success group was 64.1 10.0 , which was significantly higher than that of the failure group ( 56.2 13.5 , p < 0.05 ) .
the success rate of the drug sensitivity test was significantly higher for the failure group than for the success group ( 80.0% versus 36.4% , p < 0.05 ) .
the rates of eradication success in salvage eradication therapy were 50.0% in the ral group ( salvage ra group ) and 45.5% in the ra group ( salvage ral group ) , based on itt analysis .
the overall eradication rate ( third - line and salvage therapy eradication rate ) was 73.9% in the ral group and 64.0% in the ra group , based on itt analysis ( p = 0.46 ) . in pp analysis , the overall eradication rate was 73.9% in the ral group and 76.2% in the ra group ( p = 0.86 ) , which showed no significant difference ( chi - square test , figure 2 ) .
ae of the third - line eradication therapy is shown in table 3 . in both groups , the
most frequently observed ae was soft stool / diarrhea ( 20.8% in both groups ) .
a rash was observed in one patient ( 4.2% ) in the ral group and one patient in the ra group ( 4.2% ) had nausea .
there was no significant difference between the two groups regarding any ae and all ae were reversible .
recently , sitafloxacin- ( stfx- ) based third - line eradication therapy has been reported to be effective , with an eradication rate of 7083.6% [ 1113 ] .
the reasons for the relatively high eradication rate might be attributable to the following factors .
the dna gyrase subunit a ( grya ) mutation is known to be responsible for the resistance of h. pylori to quinolones .
it was reported that the mic ( 50 ) ( mic for 50% of the organisms ) of stfx against gyra mutants is 0.12 g / ml , significantly lower than that of lvfx ( 8 g / ml ) .
furthermore , the h. pylori resistance rate to stfx was 7.7% , which was lower than that of lvfx .
although stfx has some benefits , it is available only in japan and thailand now . taking this current state into consideration , lvfx - based triple therapy and high - dose ppi and ampc dual therapy may be widely available in many countries , as well as in japan . in a previous study ,
stfx - based third - line therapy was superior to that based on lvfx but the regimen requires patients to take lvfx 300 mg ( b.i.d ) . in our lvfx - based triple therapy ,
the patients take lvfx 500 mg ( o.d . ) . because lvfx is dependent on concentration ,
the eradication rate of the ral group was 45.8% on itt analysis , which was almost the same as the ra group ( 40.7% ) .
the third - line ral or ra may be inferior to stfx - based therapy . in this study ,
lvfx and ampc were selected as the antibiotics for the third - line and salvage eradication therapy .
currently , lvfx is used for a wide range of infectious diseases and is the most frequently used quinolone for h. pylori eradication . as a result ,
the resistance rate of h. pylori to lvfx has been reported to be 3957% [ 11 , 15 ] . in this study
on the other hand , the resistance rate of h. pylori to ampc has been reported to be low in japan , the united states , europe , and china .
consequently the eradication rate of a high - dose ppi + ampc regimen has been reported to be 90.9 to 100% when used as second - line eradication therapy [ 17 , 18 ] .
reported that the resistance rate of h. pylori to ampc in patients who failed both first- and second - line ampc - based eradication therapy was 8.2% and the eradication rate of a high - dose ppi + ampc regimen as the third - line therapy was 54.3% .
it is possible that a proportion of h. pylori strains acquire resistance to ampc during first- and second - line eradication therapy . in our study , although the rate of resistance of h. pylori to ampc was 0% , 40.4% of the patients had failed the drug sensitivity test and , in some of these cases , ampc - resistant h. pylori strains may have been present .
this could be a cause of the low eradication rate ( 40.7% on itt analysis ) .
increased ppi dosing was reported to be critical for the success of h. pylori eradication .
the percentages of the em and pm genotypes of cyp2c19 are 89% and 11% , respectively .
reported that patients with the pm genotype of cyp2c19 achieved a high h. pylori eradication rate compared to those with em . among the many ppis
, rabeprazole is mainly reduced to rabeprazole thioether by a nonenzymatic pathway and partially metabolized to demethylated rabeprazole by cyp2c19 .
rabeprazole was used in this study and the ratio of em did not differ significantly between the success and failure groups in third - line eradication therapy .
secondly , a comparison with stfx - based therapy was not implemented . in the future ,
a large scale prospective study , including other suggestive regimens , should be carried out to establish standard third - line eradication therapy for h. pylori .
thirdly , in spite of randomization , there exists some difference of the clinical background between ral and ra groups .
because the success rate of h. pylori eradication with third - line therapy or salvage therapy did not show the difference between ral and ra groups , we speculated that the influence of this uneven distribution might be low . in conclusion , as the third - line triple therapy , the eradication rate with rabeprazole , ampc , and lvfx for 10 days was equal to that with high - dose rabeprazole and ampc for 14 days .
these efficacy rates were not high but can be an alternative therapy after second - line failure because these therapies seemed free from severe adverse events . | objectives . the aim of this study was to investigate and compare the eradication rate of helicobacter pylori as the third - line triple therapy with rabeprazole ( rpz ) + amoxicillin ( ampc ) + levofloxacin ( lvfx ) and high - dose rpz + ampc . methods .
51 patients who failed japanese first - line ( proton pump inhibitor ( ppi ) + ampc + clarithromycin ) and second - line ( ppi + ampc + metronidazole ) eradication therapy were randomly assigned at a 1 : 1 ratio to one of the following third - line eradication groups : ( 1 ) ral group : rpz 10 mg ( b.i.d . ) , ampc 750 mg ( b.i.d . ) , and lvfx 500 mg ( o.d . ) for 10 days ; ( 2 ) ra group :
rpz 10 mg ( q.i.d . ) and ampc 500 mg ( q.i.d . ) for 14 days .
patients who failed to respond to third - line eradication therapy received salvage therapy . results .
the rates of eradication success , based on intention to treat ( itt ) analysis , were 45.8% in the ral group and 40.7% in the ra group .
the overall eradication rates were 73.9% in the ral group and 64.0% in the ra group .
there was no significant difference between the two groups .
conclusions . the third - line triple therapy with rpz , ampc , and lvfx was as effective as that with high - dose rpz and ampc . |
hepatocellular carcinoma ( hcc ) is the fifth most common cancer worldwide and the third most common cause of cancer - related deaths .
furthermore , hcc is currently the leading cause of death among patients with liver cirrhosis .
intermediate - stage hcc is defined as an extensive multifocal disease without vascular invasion in patients with preserved liver functions and absence of cancer - related symptoms .
transarterial chemoembolization ( tace ) is considered the standard treatment for intermediate - stage hcc .
hepatic failure after tace is expected even in patients with relatively good hepatic reserve , significantly impairing the outcome of tace , including patient survival [ 4 , 5 ] .
the maintenance of hepatic functional reserve is a major concern in patients with hcc who , in general , are treated repeatedly with tace .
l - carnitine ( 4-n - trimethyl ammonium 3-hydroxybutyric acid ) is a conditionally essential amino acid synthesized from essential amino acids methionine and lysine in human liver , kidneys , and brain but principally obtained from diet .
l - carnitine functions by transferring long - chain fatty acids across the mitochondrial membrane , enabling the oxidative release of energy .
l - carnitine deficiency is associated with liver cirrhosis because of limited dietary intake , absorption , and endogenous hepatic synthesis .
the protective role of l - carnitine against hepatotoxicity has been proposed in many studies [ 1012 ] .
oral l - carnitine supplementation improved liver functions and histological patterns in patients with nonalcoholic steatohepatitis ( nash ) .
cirrhotic patients with minimal hepatic encephalopathy achieved improved quality of life with l - carnitine supplementation .
l - carnitine was an effective adjuvant to interferon and ribavirin in patients with chronic hepatitis c viral infection ( hcv ) .
branched - chain amino acids ( bcaa ) are essential amino acids and include l - valine , l - leucine , and l - isoleucine .
several studies demonstrated that bcaa nutritional therapy decreased the risk of hepatic failure and improved general outcome in hcc patients undergoing variable treatment options . in this study , we examined the protective effects of l - carnitine regarding liver dysfunction after tace in intermediate - stage hcc patients when administered alone or in combination with bcaa .
the study included 53 hcc patients who underwent tace between december 2012 and november 2013 at osaka medical college hospital .
study protocol conformed to the ethical guidelines of the declaration of helsinki ( 1975 ) and was approved by the osaka medical college ethical review committee .
all patients were japanese and had liver cirrhosis diagnosed by abdominal ultrasound and liver functions tests .
hcc diagnosis was based on data obtained by contrast - enhanced computed tomography and hepatic - artery angiography .
no patients had vessel invasion at the time of study enrollment , and none had been prescribed l - carnitine supplements before enrollment to the study .
the study was prospective , and the patients were randomly assigned into two groups ; the l - carnitine group included twenty - seven consecutive hcc patients who received a 300 mg tablet of l - carnitine twice daily starting from 2 weeks before tace to week 12 after tace .
the control group included 26 consecutive hcc patients who did not receive l - carnitine supplementation .
thirty - one of the study patients had already been supplemented by late evening snacks of bcaa granules ( livact granules containing l - isoleucine 952 mg , l - leucine 1,904 mg , and l - valine 1,144 mg ) prior to enrolment in this study and continued throughout study duration ( we identified these patients as bcaa+ patients ) while 22 patients did not receive bcaa granules ( identified as bcaa ) .
all patients were followed up in osaka medical college hospital including clinical follow - up and laboratory measurements .
the primary end point was improvement in child - pugh ( cp ) score and serum albumin .
tace for hcc was performed in conformity with japanese guidelines by catheterization via femoral artery with superselective cannulation to the hcc hepatic feeding artery .
the infused agent was an emulsion of 50 mg of cisplatin ( ia - call , nihon - kayaku ) or 50 mg of farmorubicin ( epirubicin hydrochloride , pfizer ) or other anticancer agents and 5 ml of lipiodol ( iodine addition products of ethyl esters of fatty acids obtained from poppy seed oil ; mitsui , japan ) .
laboratory measurements were performed 2 weeks before and 1 , 4 , and 12 weeks after tace .
laboratory measurements included serum albumin , total bilirubin , prothrombin time ( pt ) , alanine aminotransferase ( alt ) , gamma - glutamyl transpeptidase ( ggtp ) , and aspartate aminotransferase ( ast ) in addition to calculation of cp scores .
differences in laboratory data between study groups and differences within groups were analyzed using the mann - whitney u test and the t - test .
three patients were withdrawn from the study because of non - liver - related deaths .
there were no statistically significant differences between the two groups regarding demographic characteristics , tumor staging , and anticancer drugs used during tace and baseline laboratory tests ( table 1 ) .
similarly , no such differences were observed between l - carnitine and control groups in bcaa+ patients and bcaa patients . in the l - carnitine group in this study ,
cp scores showed significant improvement at 4 weeks after tace ( p < 0.01 compared with 1 week after tace scores ) ; cp scores at 4 and 12 weeks after tace were better than baseline scores ( table 2 ) .
in contrast , the control group experienced a significant deterioration in cp scores at 1 week after tace ( p < 0.05 compared to baseline ) , reaching cp scores at 4 weeks after tace worse than at baseline ; cp scores at 12 weeks after tace were significantly worse than baseline scores ( p < 0.05 ) ( table 2 ) .
there were significant differences between the l - carnitine and control groups in cp score mean changes from baseline to 4 and 12 weeks after tace ( p < 0.05 ) ( figure 1(a ) ) . to investigate the combined effects of bcaa granules and l - carnitine , we evaluated bcaa+ and bcaa patients .
l - carnitine group in bcaa+ patients achieved significant cp score improvement from week 1 to week 4 after tace ( p < 0.05 ) ( table 3 ) .
there were significant differences between the l - carnitine and control groups in mean cp score changes from baseline to 4 weeks after tace ( p < 0.05 ) and 12 weeks after tace ( p < 0.05 ) ( figure 1(b ) ) .
l - carnitine group of bcaa patients showed no significant changes in cp scores ( table 4 ) .
comparison between the l - carnitine and the control groups revealed no significant differences in bcaa patients . in the l - carnitine group , serum albumin
had significantly decreased by the first week after tace ( p < 0.05 ) ; serum albumin had significantly improved at 4 weeks after tace ( p < 0.05 compared to baseline and p < 0.01 compared to week 1 after tace ) .
moreover , serum albumin at 12 weeks after tace was higher than baseline and significantly higher than albumin level at 1 week after tace ( p < 0.05 ) ( table 2 ) .
nevertheless , in the control group , serum albumin had significantly decreased by the first week after tace ( p < 0.01 ) ; serum albumin was kept at levels lower than baseline at 4 weeks and 12 weeks after tace ( table 2 ) .
comparison between the l - carnitine and control groups regarding the means of serum albumin changes from baseline to 1 week and 4 weeks after tace displayed significant differences ( p < 0.05 ) ( figure 1(c ) ) . at 4 and 12 weeks following tace ,
the l - carnitine group in bcaa+ patients had serum albumin levels higher than baseline values .
conversely , in the control group , serum albumin levels had significantly declined at 1 week after tace ( p < 0.01 ) ; serum albumin levels at 12 weeks after tace were lower than at baseline ( table 3 ) .
there were significant differences between the l - carnitine and control groups in mean serum albumin decline from baseline to 1 week after tace ( p < 0.05 ) ( figure 1(d ) ) .
in bcaa patients , serum albumin at 1 week after tace showed a significant decline from baseline in the control group ( p < 0.01 ) ( table 4 ) .
however , no significant differences were observed between the l - carnitine and control groups . in the l - carnitine group ,
pt was elevated at week 1 after tace and significantly higher than baseline at week 4 after tace ( p < 0.05 ) .
l - carnitine maintained better pt values at week 12 after tace compared with baseline values ( table 2 ) .
conversely , the control group displayed a significant pt decline at week 1 following tace ( p < 0.05 ) ( table 2 ) .
there were significant differences between the l - carnitine and control groups in mean pt changes from baseline to 1 week after tace ( p < 0.05 ) and 4 weeks after tace ( p < 0.05 ) ( figure 2(a ) ) .
at 1 , 4 , and 12 weeks after tace , l - carnitine group of bcaa+ patients reported higher pt values compared with baseline .
conversely , the control group demonstrated a significant pt decline at 1 week after tace ( p < 0.05 ) ; pt values at 12 weeks after tace were lower than baseline values ( table 3 ) .
there were also significant differences between the l - carnitine and control groups in pt mean changes from baseline to 1 week after tace ( p < 0.05 ) ( figure 2(b ) ) . in bcaa patients ,
l - carnitine maintained pt values higher than at baseline at all follow - up intervals ( table 4 ) , but there were no significant differences between the groups .
the current study demonstrated that l - carnitine prevented total bilirubin elevation at 1 week after tace ; total bilirubin at 12 weeks after tace showed nonsignificant elevation over baseline values ( table 2 ) . on the contrary , the control group exhibited total bilirubin levels significantly higher than baseline at the first week after tace ( p < 0.01 ) .
furthermore , total bilirubin at week 12 after tace was significantly higher than at baseline ( p < 0.05 ) and at 4 weeks after tace ( p < 0.05 ) ( table 2 ) .
a comparison between the l - carnitine and control groups revealed significant differences in mean total bilirubin changes from baseline to 1 week after tace ( p < 0.05 ) ( figure 2(c ) ) . in bcaa+ patients , we observed no significant differences between l - carnitine and control groups ( table 3 ) . in bcaa patients ,
l - carnitine maintained total bilirubin at levels lower than baseline level at 1 , 4 , and 12 weeks after tace ; on the contrary , total bilirubin levels at week 1 after tace were significantly higher than baseline level in the control group ( p < 0.05 ) ( table 4 ) .
comparison between the l - carnitine and control groups revealed significant differences in mean total bilirubin changes from baseline to 1 week after tace ( p < 0.01 ) ( figure 2(d ) ) . a week after tace ,
however , l - carnitine limited alt elevation at 1 week following tace ( table 2 ) . in the control group ,
ggtp levels were significantly higher than baseline levels at week 1 ( p < 0.05 ) and week 4 after tace ( p < 0.01 ) ( table 2 ) .
conversely , in the l - carnitine group , elevated ggtp levels did not differ significantly from baseline levels ( table 2 ) .
there were no significant changes in ast patterns in this study ( table 2 ) . in the control group of bcaa+ and bcaa patients ,
ggtp levels were significantly higher than baseline levels at week 4 after tace ( p < 0.01 ) ; l - carnitine did not affect alt and ast patterns in both bcaa+ and bcaa patients ( tables 3 and 4 ) .
the protective effects of l - carnitine in preventing occurrence and deterioration of ascites were shown at follow - up of study patients . in l - carnitine group ,
the number of ascites patients was fewer than baseline at 1 week after tace and no ascites was detected at 4 weeks after tace . on the contrary , the number of ascites patients in control group elevated at all follow - up periods with increased observation of massive ascites ( table 2 ) .
similar results were shown in l - carnitine and control groups in both bcaa+ patients and bcaa patients ( tables 3 and 4 ) . in this study ,
the previously mentioned follow - up results of cp score , serum albumin , and pt demonstrated the additive beneficial effects of combining bcaa and l - carnitine .
patients who received combination of l - carnitine and bcaa achieved better post - tace liver functions compared to patients who received monotherapy of bcaa or l - carnitine ( tables 3 and 4 ) .
subgroup analysis of data obtained from bcaa+ and bcaa patients in the current study irrespective of l - carnitine therapy revealed that bcaa+ patients achieved improvement of cp score at 4 weeks after tace compared to baseline and significant improvement compared to 1 week after tace ( p < 0.05 ) , while no significant improvement was observed in bcaa patients ( table 5 ) .
bcaa+ patients achieved significant improvement of serum albumin at 4 and 12 weeks after tace ( p < 0.001 and p < 0.05 , resp . , compared to 1 week after tace ) . on the other hand ,
less significant improvement of serum albumin was shown in bcaa patients at 4 and 12 weeks after tace ( p < 0.01and
p < 0.05 , resp . , compared to 1 week after tace ) ( table 5 ) .
moreover , patients who did not receive l - carnitine or bcaa showed highly significant deterioration of serum albumin at 1 week after tace compared to baseline ( p < 0.001 ) and showed pt deterioration at 4 weeks after tace compared to baseline and 1 week after tace ( table 4 ) .
conversely , patients who received bcaa alone achieved less significant deterioration of serum albumin at 1 week after tace ( p < 0.01 ) and accomplished pt improvement at 4 weeks after tace compared to baseline and 1 week after tace ( table 3 ) .
total bilirubin showed significant elevation at 1 week after tace compared to baseline in patients who received neither bcaa nor l - carnitine therapy while no significant elevation was reported in patients who received bcaa ( tables 4 and 3 ) .
hepatic failure after tace is expected and is proportional to pre - tace synthetic liver functions status . in this study ,
l - carnitine exhibited hepatoprotective effects following tace evinced by accomplishing improved cp scores and preventing deterioration of serum albumin , total bilirubin , and pt . to the best of our knowledge ,
this is the first study evaluating the effects of l - carnitine on liver functions following tace .
the current study clarified early and late post - tace improvement in liver functions by l - carnitine therapy .
the present study reported very beneficial effects of l - carnitine on cp score showing a significant improvement at 4 and 12 weeks following tace .
these effects may be attributed to the combination of the favorable l - carnitine effects on serum albumin , pt , total bilirubin , and ascites . as regards ascites ,
better results were observed in l - carnitine group compared to control group that may be justified by less deteriorated serum albumin profile after tace with l - carnitine intake .
l - carnitine plays an important role in energy production by transporting long - chain fatty acids across mitochondrial membranes in skeletal muscles .
this l - carnitine deficiency inhibits fatty acid mobilization and hence oxidation for energy in skeletal muscles ; skeletal muscles are presumed to utilize bcaa as a substitute for fatty acids to produce energy .
bcaa usage as energy source in skeletal muscles adds an additional burden to cirrhotic patients , rendering them more albumin deficient .
l - carnitine supplementations correct l - carnitine deficiency ; thus , it may preserve bcaa for albumin synthesis and improve serum albumin profiles .
in the current study , l - carnitine suppressed early deterioration of serum albumin and maintained its levels better than at baseline . in a similar fashion , malaguarnera and his colleagues , in a study evaluating l - carnitine as an adjuvant therapy for interferon plus ribavirin - treated hcv patients , demonstrated that l - carnitine inhibited serum albumin decline at the end of treatment course .
conversely , there was no significant effect of l - carnitine supplementation for 6 months on serum albumin levels in nash patients .
mean baseline serum albumin levels in l - carnitine - supplemented nash patients ( 4.7 0.5 g / dl ) were optimal and much better than mean baseline levels in l - carnitine - supplemented cirrhotic patients in our study ( 3.2 0.5 g / dl ) ; that difference may explain why l - carnitine had no effects on serum albumin levels in patients with nash .
l - carnitine in this study had improved pt at all follow - up intervals .
these finding are in concordance with the effects of l - carnitine on pt reported in children with acute lymphoblastic leukemia receiving chemotherapy .
in addition , l - carnitine improved total bilirubin profiles , resembling the observed effect of l - carnitine on total bilirubin in hepatic encephalopathy patients .
conversely , l - carnitine showed no effects on total bilirubin in interferon plus ribavirin - treated patients with hcv
. this controversy may be due to long duration of follow - up for hcv patients as total bilirubin was evaluated at 12 months after treatment initiation , while the adverse effect of ribavirin elevating total bilirubin because of hemolysis was usually observed within 3 months from treatment initiation .
the favorable effects of l - carnitine on pt and total bilirubin may be due to its ability to relieve hepatic oxidative stress .
l - carnitine significantly improved liver antioxidant capacity in cisplatin - treated rats by increasing the glutathione pool , blockage of the free radical production , and regulation of peroxisome proliferator - activated receptor alpha .
bcaa granules therapy for decompensated cirrhotic patients revealed improvement in event - free survival , quality of life , and serum albumin concentrations .
reported that bcaa granules significantly suppressed the deterioration in hepatic functional reserve ( serum albumin and cp score ) at 3 and 6 months after tace . in our study , l - carnitine combination with bcaa revealed more pronounced effects on cp scores , serum albumin , and pt than observed effects in bcaa patients .
we found no available data of previous studies evaluating bcaa and l - carnitine combination therapy .
this study is also the first report of the combination effect of l - carnitine and bcaa on liver functions . on the other hand , comparison between bcaa+ and bcaa patients regardless of l - carnitine therapy revealed lesser post - tace deterioration of cp score , serum albumin , and liver enzymes in bcaa+ patients .
the beneficial effects of bcaa therapy without l - carnitine intake were more cleared up in the present study by analyzing data obtained from patients who received neither bcaa nor l - carnitine compared to patients who received bcaa alone .
these data demonstrated favorable effects of bcaa on serum albumin , pt , and total bilirubin .
there were no adverse effects by l - carnitine intake in any of study patients .
this study has the following limitations : ( 1 ) the relatively small number of patients may inflate the beneficial effects of l - carnitine on liver functions after tace .
( 2 ) oral administration may decrease the l - carnitine efficacy as it has low oral bioavailability and poor absorption in cirrhotic patients .
the hepatoprotective effects of l - carnitine in this study were enhanced by bcaa granules combination .
l - carnitine and bcaa combination therapy may be offered as a new liver support tool in patients with hcc . | transarterial chemoembolization ( tace ) is usually followed by hepatic dysfunction .
we evaluated the effects of l - carnitine on post - tace impaired liver functions . methods .
53 cirrhotic hepatocellular carcinoma patients at osaka medical college were enrolled in this study and assigned into either l - carnitine group receiving 600 mg oral l - carnitine daily or control group .
liver functions were evaluated at pre - tace and 1 , 4 , and 12 weeks after tace . results .
the l - carnitine group maintained child - pugh ( cp ) score at 1 week after tace and exhibited significant improvement at 4 weeks after tace ( p < 0.01 ) .
conversely , the control group reported a significant cp score deterioration at 1 week ( p < 0.05 ) and 12 weeks after tace ( p < 0.05 ) .
l - carnitine suppressed serum albumin deterioration at 1 week after tace . there were significant differences between l - carnitine and control groups regarding mean serum albumin changes from baseline to 1 week ( p < 0.05 ) and 4 weeks after tace ( p < 0.05 ) .
l - carnitine caused prothrombin time improvement from baseline to 1 , 4 ( p < 0.05 ) , and 12 weeks after tace .
total bilirubin mean changes from baseline to 1 week after tace exhibited significant differences between l - carnitine and control groups ( p < 0.05 ) .
the hepatoprotective effects of l - carnitine were enhanced by branched chain amino acids combination .
conclusion .
l - carnitine maintained and improved liver functions after tace . |
the early diagnosis of colorectal and pancreatic cancers remains an area of high unmet medical need , as underscored by the u s estimated combined , annual death rate of > 89,000 .
although the serum marker ca19 - 9 is elevated in the majority of pancreatic cancer patients , the specificity of ca19 - 9 is limited .
ca19 - 9 is frequently elevated in patients with various benign pancreaticobiliary disorders [ 24 ] . as a result of all of these issues ,
the american college of gastroenterology ( acg ) recommends colonoscopy as the preferred screening / prevention test for colorectal cancer .
currently , there is no consensus for screening for the early detection of pancreatic cancer . unlike colorectal cancer
, the majority cases of pancreatic cancer are detected when a patient is symptomatic which often times represents late stage cancer , resulting in an overall 5 year survival of less than 5% .
the majority of colorectal and pancreatic cancer patients are diagnosed utilizing invasive procedures that are expensive , and usually reveal the diagnosis later in the disease process .
newer approaches are being investigated that could allow for earlier detection of disease , in a cost - effective manner , that furthermore could result in better outcomes for patients with these diseases . as an alternative diagnostic approach , we developed an elisa using a promising novel tumor - specific monoclonal antibody generated against a clinically tested human colon cancer vaccine .
npc-1 is a monoclonal antibody that was derived from a tumor associated antigen- ( taa- ) based vaccine that was previously tested in phase i - ii clinical trials performed in the united states [ 79 ] .
the taa utilized in these studies was derived from pooled allogeneic colon cancer specimens from multiple patients , which was obtained postoperatively .
cell membranes were isolated from the tumor , and proteins from solubilized membranes were prepared by sonication and sephadex g-200 chromatography .
semipurified taas were identified by in vitro and in vivo testing in colon cancer patients and healthy volunteers for cell - mediated immunoreactivities .
the colon taa was detected in fetal intestine and cell membranes , and was localized on tumor cell membranes . using discontinuous , gradient gel electrophoresis , both colon taa and cea were separated and cross - compared .
the cdna encoding the npc-1 antibody was cloned from hybridoma cells , chimerized by genetic engineering , and expressed in a heterologous expression system ( chinese hamster ovary cells ) .
the npc-1c antibody binds to a protein antigen biomarker expressed by human colorectal and pancreatic tumors . in immunohistochemical testing
, npc-1c did not react significantly with tissues from healthy donors or other types of cancer .
furthermore , as discussed below , the npc-1c antibody elisa developed can distinguish serum of patients with colorectal or pancreatic cancer from healthy volunteers , thereby providing the rationale for accelerated development and testing of the variant muc5ac ( npc-1c antigen ) detection assay .
the test may have application in diagnosis and treatment monitoring of patients with pancreatic or colorectal cancers .
this homologous antibody format was possible due to the discovery of multiple npc-1c antigen - binding sites expressed by the cancer - associated muc5ac - related ( npc-1c ) antigen .
serum samples were procured from various commercial and private sources under appropriate irb - reviewed protocols . the assay developed here used serum from colorectal and pancreatic cancer patients , and serum from healthy blood donors .
microtiter plates ( 96-well nunc maxisorp ) were coated with purified unlabeled npc-1c antibody at 10 g / ml in 0.5 m sodium carbonate ph 9.5 overnight at 25c .
plates were then blocked with 1% skim milk made in tris - buffered saline ( tbs ) containing 5 mm edta and 1% sucrose for 4 hours at 25c .
plates prepared in this manner could be stored dried and sealed for at least 12 months .
all dilutions were made in immunobooster buffers ( bioworld consulting laboratories , llc ) supplemented with 20 mm edta .
a detergent extract of cultured human ls174 t colorectal tumor cells was used as a source of npc-1c antigen to derive a standard curve .
extracts derived from human pancreatic cfpac-1 tumor cells or human lung a549 tumor cells were generated similarly .
all tumor cell lines were purchased from american type culture collection ( manassas , va ) and grown in rpmi medium containing 10% fbs ( heat - inactivated ) with 8 mm glutamine . to measure direct binding of npc-1c antibody to the variant muc5ac ( npc-1c ) antigen , cfpac-1 cells were grown in serum - free medium for 5 days and the conditioned medium was filtered and stored in one large lot at 4c .
the sandwich elisas were performed by diluting the cell extract standard on each plate , next to patient or normal serum samples diluted 1 : 24 in the diluent .
all incubations were performed at 25c and all volumes were 100 ul per well .
the biotin - labeled npc-1c antibody was then added to the wells at 1 g / ml , incubated for 15 minutes , and plates were washed three times .
peroxidase - conjugated streptavidin ( 1 : 5,000 dilution ) was added to the plates for 15 minutes , and plates were washed three times with wash buffer and two times with tbs .
the assay was developed by the addition of tmb substrate ( biofx laboratories inc . ) to the plates , incubation for 15 minutes , then the color reaction was stopped with the addition of 0.5 m sulfuric acid .
npc-1c antibody - binding competition assays were performed by coating microtiter plates with serum - free conditioned medium from cfpac-1 tumor cells shown to secrete the variant muc5ac antigen into the culture medium . following a blocking step as described above , a solution of 1 g / ml npc-1c antibody was mixed with serial dilutions of conditioned medium from cfpac-1 , ls174 t , and a549 tumor cells .
the elisa was developed using anti - human igg peroxidase - conjugated antibody followed by tmb substrate incubation as described above .
tumor biopsy specimens from colorectal , pancreatic , or lung cancer patients were deparaffinized at 60c for 30 minutes prior to staining with npc-1c antibody .
slides ( 4 microns thick ) were blocked with peroxo - bloc inhibitor ( zymed laboratories ) for 2 minutes , rinsed with phosphate - buffered saline ( pbs ) , and blocked with cas ( zymed laboratories ) for an additional 10 minutes .
slides were stained with 10 g / ml of biotin - labeled npc-1c antibody for 1 hour , and washed three times with pbs containing 0.05% tween-20 nonionic detergent .
previous titration of biotinylated - npc-1c antibody demonstrated 10 g / ml to be an optimal concentration for immunohistochemical detection of the variant muc5ac antigen .
a 1 : 400 dilution of peroxidase - conjugated streptavidin ( dako north america , inc . )
was then applied to the slides for 30 minutes and slides were washed 3 times . a solution of dab ( zymed laboratories )
a solution of hematoxylin was then applied for 3 minutes and rinsed with tap water until clear .
the slides were dehydrated with xylene and a coverslip was added using permount mounting medium .
additional consecutive slides were stained with human cytokeratin ae1/ae3 ( abcam plc ) as a positive control , and human igg1 isotype as a negative control ( axxora , llc ) .
the anti - muc5ac antibody ( clone 45m1 ) used to stain lung tumor tissue ( 10 g / ml ) was purchased from abcam plc .
the npc-1 antibody was generated in mice immunized with a preparation of pooled human colon tumor tissue extract .
hundreds of hybridomas were screened for cancer - specific characteristics such as binding to tumor tissues and cell lines , with no cross - reactivity to normal human tissues .
the original murine igg , npc-1 , was cloned and chimerized by genetically engineering the mouse variable regions of heavy and light chains with human igg1 constant regions of the heavy and light chains . the resulting chimeric antibody , npc-1c ,
was then expressed in a recombinant chinese hamster ovary cell clone for further preclinical and clinical development .
the npc-1c antibody was used as an affinity chromatography tool to isolate and identify the target antigen expressed by colorectal and pancreatic tumor cells .
it was shown early that although the murine npc-1 antibody was generated against a preparation of colorectal tumor - associated antigens , the npc-1 antibody cross - reacted with pancreatic cancer tissues and cell lines . the target antigen recognized by npc-1c was determined to be related to the mucin 5ac ( muc5ac ) protein , a member of the secreted mucin family of glycoproteins ( reviewed in ) .
we rapidly determined that the variant muc5ac antigen was shed into the supernatant of many cultured human colorectal and pancreatic tumor cells , but not by other tumor cell lines such as prostate or lung tumor cells .
we therefore examined whether the npc-1c antibody could be useful to detect the target muc5ac - related antigen in humans afflicted with colorectal or pancreatic cancer .
to demonstrate by example that the secreted variant muc5ac antigen recognized by npc-1c antibody was expressed specifically by colorectal and pancreatic tumor cells , supernates from ls174 t , and cfpac-1 were admixed with npc-1c in a competitive elisa format .
figure 1 shows that the soluble variant muc5ac antigen secreted by ls174 t and cfpac-1 tumor cells could compete effectively with binding to npc-1c antibody when the variant muc5ac antigen was coated on microtiter plates .
in contrast , supernates from human lung a549 tumor cells that are known to secrete normal muc5ac did not compete for binding to npc-1c antibody .
similar competition curves were shown with other colorectal and pancreatic tumor cell lines , but not with another squamous tumor cell line ( data not shown ) .
together the results demonstrate that npc-1c binds specifically to a variant muc5ac antigen expressed by colorectal and pancreatic tumor cells , but not muc5ac secreted by other tumor cell types . chemical and enzymatic digestion of the npc-1c antibody purified variant muc5ac antigen revealed that each molecule of the npc-1c target contained multiple epitopes for npc-1c binding ( data not shown ) .
therefore , we reasoned that it would be possible to use npc-1c as a specific reagent for both the capture and detection antibody in a homologous format elisa .
biotin - labeled npc-1c antibody was prepared as the detection reagent and tested with variant muc5ac antigen expressed by ls174 t cells .
figure 2 shows that npc-1c antibody was capable of measuring the cognate antigen expressed by ls174 t in this elisa format .
in contrast , muc5ac expressed by lung a549 tumor cells was not detected in the elisa .
thus , a surrogate standard muc5ac - related antigen reagent was generated , frozen , and used for all subsequent elisa tests .
the npc-1c antibody immunoreactive antigen is reported here in units of ls174 t cells / well equivalent .
the proof - of - concept to demonstrate that the npc-1c antibody elisa test could be utilized to detect the variant muc5ac antigen in human serum specimens was demonstrated with a small number of serum samples from colorectal cancer patients .
figure 3 shows the results from five serum specimens collected from colorectal cancer patients compared to pooled ab serum from healthy donors .
the results demonstrate a range of variant muc5ac antigen shed into the blood of these colorectal cancer patients .
in contrast , pooled ab serum from healthy donors did not yield a significant signal and was similar to the background levels for the elisa . following this , and other preliminary tests , an optimum serum dilution of 1 : 24
a larger number of serum samples were procured to test the utility of the serum - based elisa in detecting the variant muc5ac antigen .
a sampling of 41 colorectal or pancreatic cancer patient sera was compared with sera collected from 28 normal healthy blood donors . in this population of cancer patients ,
blood was collected serially during an approximately 3-month period for several of the patients while they were undergoing various treatment regimens with a medical oncologist . for multiple reasons ,
thus , there were 41 patients that donated blood at their first evaluation by the medical oncologist , followed by 33 patients that donated their blood at the second visit , and 25 patients who completed all three blood donations at the third visit .
the majority of specimens tested in this preliminary study were from patients diagnosed with stage iii or iv disease .
figure 4 shows the results of testing this larger panel of colorectal and pancreatic cancer patient serum specimens , compared to a group of normal healthy blood donors .
analysis of the results demonstrated approximately a 0.7 log difference between the cancer patients and the healthy donors at each of the three blood draws .
the mean and standard error of the mean for each control group for the assays are normals ( 355 60 ) , col / pan ca : 1-month ( 1,757 580 ) , col / pan ca : 2-month ( 1,894 671 ) , col / pan ca : 3-month ( 1,293 390 ) .
using the unpaired t - test ( 2-tailed ) method to evaluate the difference between the normal sera group and the cancer sera groups , the differences for each comparison were normal versus 1-month : p = .0511 ; normal versus 2-month : p = .0397 ; normal versus 3-month : p = .0153 .
furthermore , using a cutoff value of 355 cells / well derived from the normal sera average , 73% of col / pan ca , 1-month sera were above the cutoff ( 30 of 41 samples ) , and 88% were above the cutoff in each of the 2-month ( 29 of 33 samples ) , and 3-month ( 22 of 25 samples ) in those groups .
overall , the samples represent an average of 82% positive above the cutoff established for the assay .
these results show that the npc-1c antibody elisa can distinguish differences between serum from normal donors and colorectal or pancreatic cancer patients , with a promising level of confidence .
the cancer patient population tested in this study was further stratified by disease type .
figure 5 shows that there was no difference distinguished by the mean npc-1c antibody elisa results among those patients diagnosed with colorectal cancer ( n = 36 ) from those patients diagnosed with pancreatic cancer ( n = 5 ) .
both groups separately demonstrated approximately 0.7 log units higher variant muc5ac antigen expression levels compared to the group of healthy donors . from patients that donated multiple serum samples , the amount of variant muc5ac biomarker detected in the assay was plotted versus the time of the blood draw . as shown in figure 6 , some patients appeared to express similar amounts of the variant muc5ac antigen during the 2- or 3-month period when blood was drawn ( subjects 5 , 14 , 15 , 19 , 25 , 28 , 29 ) , whereas some patients appeared to experience an increase in this tumor - specific antigen expression ( subjects 1 , 2 , 7 , 33 , 39 ) or a decrease in the biomarker expression ( subjects 18 , 22 , 23 , 28 , 34 , 36 , 40 ) .
the significance of these shifts over time are presently unclear , but may be related to the tumor burden of the patient at the time the blood was drawn , which may be directly related to the specific treatment regimen of individual patients .
thus , the npc-1c antibody elisa may be a useful tool as a treatment monitoring biomarker assay .
it was not possible within the 3-month time period of the blood collections to determine whether a correlation exists between the rate of variant muc5ac increase or decrease and the outcome of the disease in these patients .
a number of tumor tissue specimens were procured to examine the level and incidence of variant muc5ac antigen expression in colorectal and pancreatic cancer patients .
biotin - labeled npc-1c antibody was used at 10 g / ml , detected with streptavidin - horseradish peroxidase conjugate , and mounted on glass slides . a positive staining scale ranging from + 1 to + 5
representative examples of the staining results to detect the variant muc5ac antigen are shown in figure 7 .
tissues from normal pancreas and colon showed no cross - reactive staining with npc-1c antibody ( panels ( a ) and ( c ) resp . ) .
in contrast , tissues from pancreatic and colorectal tumor biopsies demonstrated specific staining of both cytoplasmic and membrane associated antigen ( panels ( b ) and ( d ) resp . ) . in the colorectal cancer tissues ,
frequent staining of secreted variant muc5ac antigen was observed in the luminal spaces of the tissues ( panel ( d ) ) .
the tissue specificity of npc-1c binding was demonstrated by the lack of positive staining of lung adenocarcinoma tissue ( panel ( f ) ) , whereas a commercially available anti - muc5ac antibody shows that the lung tumor tissue expresses muc5ac ( panel ( e ) ) .
thus , while muc5ac is known to be expressed by lung cells , the npc-1c antibody does not react with the muc5ac expressed by lung tumor tissue .
tissues stained with npc-1c antibody were considered positive ( + 1 to + 5 ) for 79% of the tumor samples procured and stained ( 30 of 38 ) .
these staining results are similar to results from several other studies completed with npc-1c antibody using tissue array slides , and both frozen and paraffin - embedded surgical specimens .
the proof of concept has been established for the value of the npc-1c antibody in the detection of the tumor - associated muc5ac antigen recognized by npc-1c antibody .
this development suggests a new effective , scalable serum biomarker elisa for the potential diagnosis and immunoregulatory monitoring of patients with colorectal and pancreatic cancer .
these results also support further development and large - scale early noninvasive diagnostic screening of healthy populations for colorectal and pancreatic cancer .
the preliminary results described here demonstrate that the npc-1c antibody can distinguish normal / healthy serum from serum derived from patients with colorectal or pancreatic cancer .
a better defined cohort of healthy serum donors may permit improved comparisons regarding assay specificity and sensitivity .
interestingly , should the assays be predictive in diagnosing colorectal and/or pancreatic cancer , some of the normal donors tested in the assays described here may be predisposed to developing cancer , and the potential utility of these elisas may be underestimated , if they could detect cancer in asymptomatic persons . indeed ,
while the patient population studied in this report was predominantly from stage iii and iv cancer patients , we are currently procuring serum specimens from earlier stage colorectal and pancreatic cancer patients ( stage i and ii ) as well as serum from asymptomatic persons at risk for developing these types of cancer .
several research laboratories have demonstrated the association of aberrantly expressed muc5ac in colorectal and pancreatic cancers [ 11 , 12 ] .
however , none of these appear as specific as the npc-1c antibody in defining the variant muc5ac antigen expressed in colorectal and pancreatic patient serum as compared with normal healthy donors , or as compared with muc5ac antigen expressed by other tumor types .
the reason for this difference may be due , in part , to the specific epitope that the npc-1c antibody recognizes , which is currently an area of active investigation .
the assay specificity using the normal serum samples presented in this interim report are 71% ( 8/28 normal samples above the mean cutoff ) .
the sensitivity for the npc-1c antibody elisa was 82% ( 18/99 cancer samples below the mean normal cutoff ) .
future testing and data analysis with new serum from healthy donors should increase the specificities of both serum assays .
importantly , testing earlier stage cancer patient ( stage i - ii ) will shed light on the application of this elisa to detect cancers earlier , which will allow earlier interventions and improve treatment outcomes . reviewing the ihc results for each antibody ,
the tumor biopsy specimens were collected from patients diagnosed pathologically with stage iii and iv colorectal and pancreatic cancer .
the chimeric npc-1c therapeutic antibody ( ensituximab ) is currently being tested in a phase i dose escalation clinical trial . as part of the eligibility criteria for the study
, patients with advanced pancreatic or colorectal cancers must have their tumor biopsy stain positive for the npc-1c antigen to be considered eligible for treatment .
the preliminary immunohistochemical data presented here suggests that approximately 80% of patients may be treated with the therapeutic biological npc-1c .
this truly represents the new frontier of theranostics , where a biomarker can act as a companion to a specific therapeutic product .
the serum elisa described here may have utility in monitoring colorectal or pancreatic cancer patients during the course of a treatment regimen .
patients with pancreatic cancer are typically treated with gemcitabine , whereas the treatment options for colorectal cancer patients can include chemotherapies ( 5-fluorouracil , folfox , or folfiri ) or biologics such as cetuximab and bevacizumab .
the npc-1c antibody elisa may be useful to aid in monitoring the patient responses to such therapies .
the results shown in figure 6 demonstrate trends for certain patients that may reflect cancer regression , progression , or stable disease .
once these data are coupled with the disease status in patients , the correlation may become apparent .
serum - based detection of colorectal and pancreatic cancer biomarkers will improve the chances for early detection of these deadly diseases .
the preliminary results with the npc-1c elisa to specifically detect tumor - associated muc5ac may improve the diagnosis of these solid tumors as well as aid in the immune monitoring and prognosis of patients undergoing treatment of their disease . | a serum elisa using a monoclonal antibody that detects a muc5ac - related antigen ( npc-1c antigen ) expressed by pancreatic and colorectal cancer was developed .
the npc-1c antibody reacts with specific epitopes expressed by tumor - associated muc5ac that does not appear on muc5ac from normal tissues .
based on observations of a highly specific antibody , we tested the elisa to differentiate serum from healthy blood donors compared to serum from patients with colorectal or pancreatic cancer .
additionally , patient tumor tissue was stained to examine the expression pattern of muc5ac - related antigen in pancreatic and colorectal cancers .
the results indicate the npc-1c antibody elisa distinguished serum of cancer patients from normal donors with very good sensitivity and specificity .
most patient 's tumor biopsy exhibited npc-1c antibody reactivity , indicating that tumor - associated muc5ac antigen from tumor is shed into blood , where it can be detected by the npc-1c antibody elisa .
this serum test provides a new tool to aid in the diagnosis of these cancers and immune monitoring of cancer treatment regimens . |
rupture of mycotic cerebral aneurysms is associated with significant morbidity and mortality ; however , unlike cerebral aneurysms from noninfectious causes , unruptured mycotic aneurysms can resolve with medical treatment.1
2 management of cerebral mycotic aneurysms requires an understanding of their pathogenesis , natural history , and treatment options .
the need for heparinization for cardiac surgery in patients with cardiovascular compromise due to septic endocarditis must also be considered .
the following case highlights the benefit of a multimodal therapeutic approach tailored to individual aneurysm morphology .
a 29-year - old man with a history of drug abuse , right parietal abscess status post craniotomy and resection , and endocarditis status post bioprosthetic valve replacement presented to an area hospital with generalized aches and malaise .
broad - spectrum antibiotics were started and tailored after repeat blood cultures were positive for staphylococcus haemolyticus .
neuroimaging for transient aphasia revealed a distal left middle cerebral artery ( mca ) aneurysm , occlusion of the left internal carotid artery ( ica ) , and vasospasm in the bilateral mcas and basilar artery .
the patient 's neurologic examination was significant for 4/5 motor strength on the left hemibody secondary to his old abscess .
magnetic resonance imaging / magnetic resonance angiography ( mri / mra ) and cerebral angiogram demonstrated a large ( 11 9 mm ) multilobulated mycotic aneurysm at the left m2m3 junction involving the origin of both m3 branches and the distal aspect of the m2 branch ( fig .
1a , b ) , with surrounding susceptibility artifact and edema consistent with prior hemorrhage ( fig .
complete occlusions of the left ica and multiple branches of the left external carotid artery were noted .
the left mca and anterior cerebral artery ( aca ) distributions filled via the posterior communicating artery and the anterior communicating artery ( acom ) and leptomeningeal collaterals .
( a ) lateral left vertebral injection demonstrating an 11 9 mm multilobulated mycotic aneurysm ( white arrow ) at the left m2m3 junction .
the left hemisphere relied predominantly on a left posterior communicating artery for collateral supply due to chronic left internal carotid artery occlusion .
( b ) three - dimensional reconstruction demonstrating involvement of the bilateral m3 origins as well as the distal aspect of the m2 branch , with proximal stenosis noted .
( c ) t2-weighted magnetic resonance imaging demonstrating perianeurysmal susceptibility artifact and edema ( white arrow ) consistent with prior hemorrhage .
intervention was initially deferred due to the potential need for m3 branch sacrifice , with external carotid occlusions preventing bypass .
the patient remained a poor surgical candidate due to ongoing treatment for sepsis , vasospasm , and cerebral salt wasting , as well as multiple venous and bilateral arterial thrombi obstructing femoral access .
surveillance computed tomography angiography ( cta ) 6 days after admission demonstrated a new 7 7 mm saccular aneurysm at the junction of the left a1 segment and acom ( fig .
2a , b ) .
rapidly arising anterior cerebral artery / anterior communicating artery ( aca / acom ) mycotic aneurysms .
( a ) initial magnetic resonance angiography and ( b ) computed tomography angiography 6 days later demonstrating a rapidly arising 7 7 mm saccular aneurysm ( red arrow ) arising from the junction of the left a1 segment and the acom that developed despite aggressive broad - spectrum antibiotic administration .
the distal left middle cerebral artery aneurysm is readily visualized on both scans ( white arrows ) .
the patient concurrently developed high - output congestive heart failure ( chf ) due to perivalvular mitral leak , necessitating immediate repair .
given the unsecured , ruptured , and rapidly growing mycotic aneurysms , however , heparinization was felt to be unsafe . a combined approach to secure both cerebral aneurysms
on postadmission day 10 , iliac artery embolectomy and permanent coil embolization of the left mca aneurysm was performed , with the likely chronic left ica occlusion requiring microcatheterization of the left mca from the right side via the acom ( fig .
c ) . a px slim microcatheter ( penumbra inc . , alameda , california , united states ) and fathom 0.16 guidewire ( boston scientific , marlboro , massachusetts , united states ) were used for microcatheterization , with the diameter of the px slim allowing for meaningful angiographic runs . to ensure a high degree of control with coil contouring and preserve distal branch flow , three coils of varying lengths and stiffness
were used for embolization ( 9 mm 25 cm and 6 mm 15 cm complex soft , and 4 mm 8 cm complex extra soft penumbra 400 coils ; penumbra inc . ) .
subsequent angiography demonstrated patency of all m3 vessels and complete aneurysmal occlusion , a raymond 0 result ( fig .
the left aca / acom aneurysm could not be accessed via microcatheterization without parent artery compromise due to diffuse disease of the a1/a2 junction and the acom .
four days later , the saccular aca / acom aneurysm was visualized and clipped via a minimally invasive right supraorbital craniotomy .
( a ) right internal carotid artery ( ica ) anteroposterior angiogram demonstrating contralateral middle cerebral artery ( mca ) filling due to chronic left ica occlusion , and left anterior cerebral artery / anterior communicating artery ( aca / acom ) ( red arrow ) and distal middle cerebral artery ( mca ) ( white arrow ) mycotic aneurysms .
( b ) redemonstration of the left aca / acom aneurysm ( red arrow ) following right ica injection .
this aneurysm could not be accessed endovascularly and was subsequently clipped via a minimally invasive right supraorbital craniotomy .
( c ) left mca lateral microcatheter angiogram performed before coil embolization of the left mca aneurysm ( white arrow ) , accessed after crossing the acom aneurysm due to rupture status and left ica occlusion .
( d ) multiple views of a selective left mca angiogram performed after coil embolization of the left mca aneurysm via microcatheter placed across the acom , demonstrating patency of all left m3 vessels and a raymond 0 occlusion of the aneurysm ( white arrow ) .
the patient tolerated these procedures well and received a mitral valve replacement 6 days after aneurysm clipping .
the patient 's chf completely resolved , and he was discharged 2 days later to a skilled nursing facility , with his neurologic examination at baseline from admission .
they are caused by septic microemboli to the vasa vasorum or direct bacterial migration from an occluding septic embolus,1 with the resulting inflammation causing localized vessel wall weakness .
the most common source of emboli is bacterial endocarditis , as seen in this case .
the most common pathogens are streptococcus and staphylococcus species.1
3 mycotic aneurysms are most common within cerebral arteries , specifically at distal branch points of the mca,1
4 and they often occur at multiple sites .
cerebral arterial imaging is recommended for infectious endocarditis only in the presence of neurologic symptoms.4 visualization of an aneurysm ( typically fusiform or saccular , with multiplicity , eccentricity , and/or a multilobed structure with surrounding inflammation ) with positive blood cultures and an embolic source are often cited criteria for diagnosis.3
5 ct - cta and mra are typical first - line imaging tests , yet digital subtraction angiography remains the gold standard.3
4 in this case , the patient had vegetative endocarditis with positive blood cultures .
cerebral imaging was obtained for transient aphasia , revealing a single eccentric saccular aneurysm , with subsequent growth of a second , more proximal aneurysm in the face of optimized antibiotic therapy .
the preferred treatment for mycotic cerebral aneurysms lacks level 1 evidence and is confounded by the potential for unruptured aneurysms to resolve with antibiotic therapy .
stable unruptured mycotic aneurysms were traditionally managed with antibiotics alone ; ruptured or enlarging unruptured aneurysms were thought to require intervention.1
6 recently proposed guidelines advocate for intervention for all but the highest risk mycotic aneurysms , however , regardless of rupture status.3 in this patient , both aneurysms required intervention given their previous rupture and rapid growth , respectively , as well as the need for anticoagulation for mitral valve replacement .
when deciding between an open and endovascular approach , standard considerations in the treatment of cerebral aneurysms are relevant .
older patient age , morbidity , and surgically inaccessible sites favor endovascular techniques , whereas younger age , morbidity , and the presence of hematoma with mass effect favor surgical resection .
surgical management of mycotic aneurysms is nonetheless complicated by the friability of infected vessels , and it may increase the complication rate of subsequent cardiac valve replacement that requires heparinization and anticoagulation.3
the goal of either approach is to secure the at - risk aneurysm and prevent strokes .
decisions regarding primary or secondary preservation of distal flow are based on individual aneurysm characteristics and the presence of eloquent tissue distally.6 endovascular options include selective or parent artery coil embolization .
although there is no definitive answer regarding the timing of intervention , prior antibiotic treatment is thought to decrease interventional risk by allowing the aneurysm to become more fibrotic.3 this potential must be balanced with the ongoing interval hemorrhage risk from an unsecured aneurysm . in the present case ,
early endovascular intervention of the mca saccular aneurysm was not performed because selective embolization was not possible in the setting of acute infection , and sacrifice of the two m3 branches with parent vessel occlusion was unpalatable .
occlusion of extracranial donor bypass vessels prevented early surgical intervention with preservation of distal perfusion via extracranial to intracranial bypass , and the long axial nature of the aneurysm made in situ end - to - end anastomosis challenging .
concerns over vessel friability in the setting of local infection further dampened enthusiasm for other surgical approaches , such as mca - mca bypass . during the patient 's subsequent sepsis management , bilateral occlusion of the iliac arteries
following medical stabilization and antibiotic treatment , iliac artery embolectomy and selective endovascular embolization of both aneurysms was attempted via a contralateral acom approach due to chronic left ica occlusion .
this maneuver limited the vascular territories placed at risk from catheter manipulation to those with existing disease .
the acom aneurysm was then surgically clipped through a small supraorbital craniotomy , minimizing risk for subsequent cardiac valve replacement .
although endovascular techniques have improved our ability to manage mycotic cerebral aneurysms , their heterogeneous nature may still necessitate a combined approach . ultimately , aneurysm rupture status , technical risks of neurosurgical management , response to antibiotics , and urgency of cardiac surgery requiring heparinization will be decisive elements of a treatment plan .
patient comorbidities and the heterogeneous nature of mycotic cerebral aneurysms may require creative therapeutic approaches to enable critical cardiac interventions . | mycotic cerebral aneurysms can present unique neurosurgical challenges .
we report a patient with left carotid occlusions , a ruptured left middle cerebral artery mycotic aneurysm , and a rapidly appearing unruptured left anterior cerebral artery / anterior communicating artery ( aca / acom ) mycotic aneurysm in the setting of mitral valve endocarditis with a perivalvular leak and evolving congestive heart failure . following medical stabilization and antibiotic administration , a combined endovascular ( with contralateral access via the acom ) and open surgical approach
was used to selectively secure both aneurysms with preservation of distal flow , allowing lifesaving cardiac valve replacement .
this case illustrates the therapeutic complexity of mycotic cerebral aneurysms , which we discuss in the context of an increasing reliance on endovascular approaches . |
menkes disease ( md ) is a disorder of copper metabolism due to atp7a gene mutation that leads to severe copper deficiency .
deformed blood vessels can be found in many parts of the body , and intracranial hematoma is generally reported .
we report a taiwanese boy with md who had recurrent spontaneous subserosal hematoma of ileum presenting as intestinal obstruction , with the 2 episodes 23 months apart .
the defective copper metabolism causes dysfunction of a plenty of copper - dependent enzymes , giving rise to unique kinky hair appearance , progressive neurodegeneration , and connective tissue abnormalities . to our knowledge , this is the first report on recurrent subserosal hemorrhage of intestine in md .
owing to the fragile structure of blood vessels , subserosal hematoma should be considered when patients with md having intestinal obstruction .
menkes disease ( md ) is a rare neurodegenerative disorder caused by dysfunctional copper - transporting adenosine triphosphatase ( atpase ) , atp7a .
multisystemic manifestations result from severe copper deficiency as the reduced copper ion within the enteral cell failed to be pumped into the peripheral circulation .
lacking of copper - depending lysyl oxidase leads to unstable structure of connective tissues , and abnormal blood vessels at various sites including brain , neck , and limbs had been reported .
subserosal hematoma is a relatively rare cause of intestinal obstruction , and most of the cases were related to coagulopathies or anticoagulants use .
this is the first case of md with recurrent spontaneous subserosal hematoma of ileum , which induced intestinal obstruction .
the institutional review board of mackay memorial hospital approved this study ( 16mmhis062 ) , and a written informed consent was obtained from the participant .
a 3-year-1-month - old taiwanese boy was born to a 37-year - old g2p2 mother at 36 3/7 weeks gestation with the birth weight of 2620 g via cesarean section .
the apgar score was 9 and 10 at 1 and 5 minutes , respectively . the prenatal examination and the result of newborn screening tests were normal .
he has medical history of md confirmed by molecular study which showed atp7a gene point mutation [ c.3502 c > t ] when he was 7-month - old .
the initial presentation which led to this diagnosis were focal seizure , hypotonia , and hypopigmented curly scalp hair when he was 5-month - old .
tortuosity of bilateral internal carotid arteries and right middle cerebral artery were demonstrated by magnetic resonance angiography .
other documented history in the previous hospitalizations included global developmental delay , hyperbilirubinemia , bilateral inguinal hernias , pectus excavatum , microcytic anemia , left side grade iii vesicoureteral reflux , diffuse multiple urinary bladder diverticula , gastroesophageal reflux , and osteopenia - related left distal femur fracture . when he was 1-year-2-month - old , the first episode of intestinal obstruction was presented as postprandial vomiting for 3 days .
exploratory laparoscopy was performed , and a large subserosal hematoma was found at the ileum with proximal intestinal dilatation .
feeding was started with extensive hydrolysate formula since the eleventh post - operative day and he was discharged 18 days after the operation .
he was admitted again due to nonbilious vomiting for 3 times and decreased activity for 1 day this time .
there was no fever , cough , bowel habit change , or contact history to persons with fever or gastroenteritis .
physical examination showed soft but distended abdomen with visible bowel loops over the abdominal wall ( fig .
1 ) , decreased bowel sounds , regular heart beats with grade i systolic murmur , severely depressed sternum , and normal skin turgor .
vital signs at admission were : body temperature 37.9 c , pulse rate 120/min , respiratory rate 26/min , and blood pressure 86/52 mm hg .
initial laboratory data showed normocytic anemia ( hemoglobin 10.7 g / dl , mean corpuscular volume 85.6 fl ) , leukopenia ( 3.010/l ) , hypokelemia ( 3.3 meq / l ) , and slightly elevated c - reactive protein ( 1.3 mg / dl ; normal range < 0.8 mg / dl ) .
support was conducted , and nasogastric tube was placed for decompression while the boy was kept nil per os .
abdominal sonography showed diffused intestinal ileus with bowel wall thickening , but no intussusception or intra - abdominal mass was demonstrated .
serial plain abdominal film revealed total obstruction of the intestine ; thus , ampicillin ( 200 mg / kg / day ) and cefotaxime ( 150 mg / kg / day ) were administered and exploratory laparotomy was done 1 day after admission .
a large subserosal hematoma with proximal dilated bowel loop was found at the ileum approximate the site of the first hematoma ( fig .
the hematoma was evacuated and the intestine looked healthy after releasing the mass ( fig .
3b ) . there was no laboratory evidence of bleeding tendency ( platelet count 14010/l , prothrombin time 11.5 seconds , inr 1.10 , activated partial thromboplastin time 29.5 seconds , bleeding time 330 ) .
parenteral nutrition was started 2 days post - operation , and enteral feeding was started since the 12th post - operation day .
full feeding was achieved 16 days after the operation and he was discharged 17 days after the operation .
distended abdomen with visible bowel loops on the abdominal wall . plain abdominal film at admission showed segmental dilatation of jejunal loops .
( a ) a large subserosal hematoma with proximal dilated bowel loop at the ileum .
md , also known as kinky hair disease , is a rare x - linked recessive disorder of copper metabolism caused by atp7a gene mutation , result in deficiency or dysfunction of the copper - transporting atpase , atp7a .
progressive neurodegeneration is the main symptom , which included hypotonia , generalized myoclonic seizures , mental retardation , and prominent feeding difficulties .
atp7a functions as an intracellular pump to transport copper into the trans - golgi network for incorporation into copper requiring enzymes , and also mediates copper exodus from cells . owing to the wide distribution of copper - requiring proteins ,
the impact of atp7a dysfunction is multisystemic . for the intestinal tract , the uptake of the reduced copper ion ( cu ) from the bowel lumen to the enteral cell via the high - affinity cu transporter
is not changed , but failure to pump cu across the basolateral membrane into the peripheral circulation leads to the intestinal copper hyperaccumulation with severe copper deficiency in peripheral tissues .
the formation , maturation , and stabilization of connective tissue are also affected by copper deficiency .
copper plays a role in lysyl oxidase , which catalyzes the cross - linking of elastin and collagen fiber .
aortas from copper - deficient animals and humans exhibit fissures and rupture due to altered architecture of elastic fiber , and tortuosity of the cerebral vessels is frequently noted in md .
vascular events had been reported in various sites in md , including different pictures of intracranial hemorrhage , internal jugular phlebectasia presenting as unilateral neck masses , and brachial and iliac artery aneurysms . to our knowledge , this is the first report on recurrent subserosal hemorrhage of intestine in md .
compared to the traumatic etiology , spontaneous intramural small bowel hematoma is rare , and most of the reported cases were related to coagulopathies or anticoagulants use .
dieulafoy 's lesion , presenting as an ulcerated or polypoid lesion containing the caliber - persistent left gastric artery , can produce severe and even fatal hemorrhages . in 1 study describing the characteristics of small intestinal diseases on single - balloon enteroscopy , a total of 186 patients underwent 196 procedures .
thirteen patients were found to have vascular malformation , with the mean age of 57.6 years old and the most common location of the lesions was in the jejunum . in 1956 ,
white and wollenman reported a 6-year - old boy with congenital hemangiomatous malformation with spontaneous subserosal hemorrhage of the jejunum , resulted in chronic intestinal obstruction .
another 11-month - old boy presenting with subserosal hematoma leading to marked narrowing of the lumen and to intestinal obstruction was reported in 1960 by martins .
our case is another one of the rarely reported case of spontaneous subserosal hematoma induced by the anomalous blood vessel .
in md , although feeding difficulty is frequently encountered , any symptoms and signs of intestinal obstruction should be carefully observed and managed promptly and correctly .
subserosal hematoma should be taken as one of the differential diagnosis of intestinal obstruction in these patients because of the fragile structure of blood vessels derived from copper deficiency . | abstractbackground : menkes disease ( md ) is a disorder of copper metabolism due to atp7a gene mutation that leads to severe copper deficiency .
deformed blood vessels can be found in many parts of the body , and intracranial hematoma is generally reported.methods:we report a taiwanese boy with md who had recurrent spontaneous subserosal hematoma of ileum presenting as intestinal obstruction , with the 2 episodes 23 months apart .
the patient returned to the usual physical status after surgical removal of the hematoma.results:the defective copper metabolism causes dysfunction of a plenty of copper - dependent enzymes , giving rise to unique kinky hair appearance , progressive neurodegeneration , and connective tissue abnormalities . to our knowledge , this is the first report on recurrent subserosal hemorrhage of intestine in md.conclusion:owing to the fragile structure of blood vessels , subserosal hematoma should be considered when patients with md having intestinal obstruction . |
the main manifestations of the lipodystrophy ( ld ) syndrome in patients with normal serum cortisol levels are fat accumulation in the dorsocervical spine ( also known as buffalo hump ) , in the breasts , and in the abdomen or fat reduction in the face and in the limbs .
these body changes are accompanied by dyslipidemia and hyperglycemia . however , there are only few reports of hyperlipidemia and lipodystrophy associated with haart without pi [ 2 , 3 ] . a recent study by smith et al
. demonstrated an excess of cardiovascular risk factors in hiv patients receiving haart , and lipodystrophy syndrome has been considered a worrisome factor .
this study was performed to analyze the body composition and metabolic variations in hiv-1 infected individuals during treatment with haart of different art regimen and without haart in the north - eastern part of india .
a hospital based cross - sectional study conducted from october 2011 to september 2013 included random 101 seropositive hiv-1 male patients aged more than 15 years who are attending medicine out - patient department ( opd ) and art centre , centre of excellence , regional institute of medical sciences , for routine check - up on opd basis .
these patients were categorised into the following groups : art nave patients ( n = 22 ) , hiv patients on zidovudine based regimen ( azt and 3tc and nvp or efv , n = 22 ) , stavudine based regimen ( d4 t and 3tc and nvp or efv , n = 18 ) , tenofovir based regimen ( tdf and 3tc and nvp or efv , n = 15 ) , and protease inhibitors based regimen ( atazanavir 300 mg boosted with low dose ritonavir 100 mg , n = 24 ) .
the art was given to patients according to national aids control organization ( naco ) guidelines , india .
patients who were known case of diabetes mellitus , chronic kidney disease , congestive cardiac failure , already on hypolipidemic drugs before starting art , and suffering from tuberculosis and other active opportunistic infections were excluded from the study . detailed history regarding clinicoepidemiological data including , facial dysmorphism ( lipoatrophy of face ) , exposure , hiv infection duration , duration of the present regimen ,
alcoholism ( > 80 gms / day ) , and cigarette smoking ( > 5 cigarettes / day ) were recorded in a preformed pro forma .
anthropometric measurements , like body mass index ( bmi ) and waist - hip ratio , were measured .
waist circumference was measured at midpoint between lowermost palpable rib and topmost point of iliac crest along midaxillary line , and hip circumference was measured at widest portion of buttocks .
waist - hip ratio > 0.9 indicates truncal obesity and high risk for cardiovascular complications .
total body water ( in percentage ) , bone mass ( in kgs ) , visceral fat ( in kgs ) , body fat ( in percentage ) , and muscle mass ( in kgs ) were analysed using tanita machine , a body composition guide for inner scan manufactured by tanita india private limited , mumbai .
visceral fat ranging from 1 to 12 kgs was considered as healthy range and more than 12 as excess .
blood biochemistry including lipid profile , kidney function test , and blood sugar levels ( random , fasting and postprandial ) was performed .
anova and post hoc dunnet 's t3 test were used to determine significant difference among study population .
the age range of study population was art nave patients , 24 to 51 years ; zidovudine based patients , 26 to 53 years ; stavudine based patients , 32 to 52 years ; tenofovir based patients , 37 to 60 years ; and protease inhibitors patients , 32 to 60 years .
the mean duration of hiv infection and the present art regimen ( in months ) is shown in table 1 .
lipoatrophy of face was most prevalent in hiv - positive population who are on stavudine based regimen ( 15 out of 18 patients , 83.3% ) and protease inhibitors based regimen ( 20 out of 24 patients , 83.3% ) .
three patients ( 13.6% ) on zidovudine based regimen and 3 patients ( 20.0% ) on tenofovir based regimen had lipoatrophy of face ( refer table 2 ) .
mean bmi of different categories of study population were in normal range , and there was no significant difference in mean bmi among different categories of study population ( p = 0.917 ) . among study population ,
excess visceral fat was most prevalent in protease inhibitors group ( 4 out of 24 patients , 16.7% ) .
the mean total visceral fat among study population was in healthy range , and there was statistically insignificant difference among study population .
though statistically insignificant , mean difference of total visceral fat between pis ( 6.21 4.79 ) and art nave ( 4.09 3.66 ) patients was about 2.11 .
mean body fat percentage was in normal range among study population and did not vary significantly among different study groups ( p = 0.172 ) .
the mean total body water percentage was relatively higher in zidovudine based regimen ( 61.98 7.86 ) and stavudine based regimen ( 61.4 6.63 ) than other groups ( art nave regimen was 59.80 9.73 , tenofovir based regimen was 58.90 4.9 , and protease inhibitors regimen was 57.64 6.99 ) , and there was no significant difference among study population ( p = 0.318 ) .
there was no statistically significant difference among study population in terms of mean bone mass ( p = 0.200 ) and mean muscle mass ( p = 0.070 ) .
waist - hip ratio ( mean ) in protease inhibitors group was 0.91 0.04 , indicating central obesity .
the mean waist - hip ratio significantly varied among study population , being higher in hiv patients receiving protease inhibitors ( p = 0.001 ) .
hypertriglyceridemia was found in stavudine ( 173.06 48.11 ) , tenofovir ( 164.07 77.40 ) , and protease inhibitors ( 249.83 125.3 ) based regimens .
low hdl was found in zidovudine ( 32.75 7.19 ) , stavudine ( 26.72 7.12 ) , and protease inhibitors ( 32.79 11.0 ) based regimens .
patients with protease inhibitors were found to have both fasting ( 118.04 46.03 ) and postprandial ( 205.38 105.26 ) hyperglycemia .
there was a significant difference in total cholesterol ( p = 0.001 ) , triglycerides ( p = 0.000 ) , hdl ( p = 0.003 ) , ldl ( p = 0.009 ) , vldl ( p = 0.001 ) , rbs ( p = 0.000 ) , fbs ( p = 0.001 ) , and ppbs ( p = 0.000 ) among study population .
the present study is a cross - sectional comparative data regarding body composition and metabolic parameters derangements among hiv patients receiving protease inhibitors and nrtis .
83.3% patients receiving protease inhibitors had facial dysmorphism in form of lipoatrophy and 16.7% patients had excess visceral fat with normal total body fat percentage .
in addition to this , there was increased waist - hip ratio , more than 0.90 , indicating truncal obesity .
there were also metabolic abnormalities in the form of hypertriglyceridemia , low hdl , high vldl , and fasting and postprandial hyperglycemia .
these features indicate regional fat redistribution from periphery to visceral resulting in insulin resistance rather than mere fat loss or fat gain .
similar finding was also described by previous study by dinges et al . and carr et al . .
analysed the paired data in hiv infected patients before and after initiating pis ( n = 20 ) .
they also found significant increase in glucose ( + 9 3 mg / dl , p = 0.0136 ) , insulin ( + 12 4.9 mg / dl , p = 0.023 ) , triglycerides ( + 53 17 mg / dl , p = 0.0069 ) , and total and ldl cholesterol ( + 32 11 mg / dl and + 18 5 mg / dl , p = 0.0082 and 0.0026 , resp . ) .
in present study , there was no significant difference between the study groups in terms of bmi , total body water , bone mass and muscle mass , and visceral and body fat .
788 cohorts of hiv patients on haart noticed 14% prevalence of metabolic syndrome according to international diabetic federation criteria and 18% prevalence of the same , according to us national cholesterol education program adult treatment panel iii ( atp iii ) criteria , in patients receiving pis , the highest being in indinavir and the least in amprenavir .
49% of patients had at least 2 features of metabolic syndrome but did not meet the diagnostic criteria .
in present study also , it is emphasising the same fact of insulin resistance in the form of truncal adiposity and hyperglycemia in patients receiving pis .
studied 148 hiv-1 patients ( 116 patients were on protease inhibitors and 32 had never taken protease inhibitors ) and in 47 healthy men found that development of syndromic features like central adiposity along with hypertriglyceridemia , hypercholesterolemia , and insulin resistance with type 2 diabetes mellitus occurred mainly with the use of all potent protease inhibitors and hence concluded it to be a class effect .
current data suggests that abnormal fat distribution occurs in hiv patients receiving non - pis based regimen .
peripheral fat wasting was noticed in clinically stable asymptomatic hiv patients and may be due to long term use of nrtis especially stavudine .
lipoatrophy of face ( buccal pad fat atrophy ) was observed in 83.3% of patients receiving stavudine based haart , 13.6% of patients in zidovudine group , 20.0% of patients on tenofovir group , and none in art nave group . along with this , stavudine subgroup also had hypertriglyceridemia , low hdl , and postprandial hyperglycemia , which were almost absent in other nrtis groups . on the contrary , hypertriglyceridemia was also found in the tenofovir group .
saint - marc et al . in their cross - sectional data on 43 hiv patients on nrti found peripheral lipodystrophy ( bichat atrophy ) in 17 patients ( 63% ) receiving stavudine , 3 patients ( 18.75% ) receiving zidovudine and none in art nave .
along with lipodystrophy , patients on stavudine had hypertriglyceridiemia which is similar to result of the present study .
domingo et al . , in his study involving 150 hiv patients receiving haart , 75 stavudine based patients , and 75 zidovudine based patients noticed significant lower body fat in patients taking stavudine .
analysed regional fat measured by dual energy x - ray absorptiometry ( dexa ) in 161 hiv patients and found progressive subcutaneous fat wasting occurring in stavudine - containing regimens compared with zidovudine - containing regimens ( relative risk was 1.085 per month ; p < 0.0001 ) and concluded that nrtis especially stavudine do have an independent contribution to fat wasting .
other body composition parameters like total body water , muscle mass , and bone mass are not significantly affected among study population .
hdl was significantly low in art nave and all nrti groups except for tenofovir group .
though ldl was in normal range , it differed significantly ( p = 0.009 ) among study population , being high in stavudine based regimen ( 94.11 12.4 ) and protease inhibitors ( 98.3 27.8 ) . | background . hiv patients on highly active antiretroviral therapy ( haart ) containing protease inhibitors ( pis ) had been often associated with lipodystrophy
. however , there are only few studies on association of nucleoside and nonnucleoside reverse transcriptase inhibitors ( nrti and nnrti ) with lipodystrophy . study design .
one hundred and one hiv male patients were categorised into art nave ( n = 22 ) , zidovudine ( n = 22 ) , stavudine ( n = 18 ) , tenofovir ( n = 15 ) , and pis ( n = 24 ) based haart . their clinicoepidemiological data had been entered in preformed pro forma . the body composition , using tanita machine and metabolic parameters like lipid profile , blood sugars was analysed
. results .
clinically , lipoatrophy of face was most prevalent in hiv patients on stavudine ( 15 patients , 83.3% ) and pis ( 20 patients , 83.3% ) based haart .
the mean bmi among study population was in normal range .
excess visceral fat was most prevalent among patients on pis , 4 patients ( 16.7% ) .
the waist - hip ratio was significantly higher in pis ( p = 0.01 ) based haart .
there was no significant difference among different study populations in terms of bmi ( p = 0.917 ) , body water ( p = 0.318 ) , body fat ( p = 0.172 ) , bone mass ( p = 0.200 ) , and muscle mass ( p = 0.070 ) .
hypertriglyceridiemia was found in stavudine , tenofovir , and protease inhibitors regimens .
low levels of high density lipoprotein ( hdl ) was found zidovudine , stavudine , and pis regimens .
fasting and postprandial hyperglycaemia was found pis and impaired glucose tolerance in stavudine regimen . conclusion .
patients on pis were associated with truncal obesity and lipoatrophy of face , along with dyslipidemia and hyperglycaemia .
stavudine based regimen is associated with hypertriglyceridiemia and low hdl along with lipoatrophy of face . |
seaweeds are key ecological factors in shallow marine areas forming the base of the trophic web and structuring ecosystems especially on consolidated substrata .
hence , the pharmaceutical and the cosmetics industries have a special interest in algae as sources of specific molecules [ 14 ] .
also , several works have investigated their value in human and animal nutrition [ 58 ] . among the algae - derived compounds , polyunsaturated fatty acids are especially important as they act as antioxidant agents involved in many physiological processes [ 9 , 10 ] .
the studies to determine the fatty acids profiles started some years before and many of them focused on the use of these compounds as biomarkers for chemotaxonomy , though their concentration may be susceptible to environmental interference [ 1114 ] .
some of the main important factors that influence the algae fatty acid concentration are the temperature , [ 15 , 16 ] , types of habitat [ 15 , 17 ] , and presence of metals and pollutants [ 12 , 13 , 18 ] .
although less common , other approaches using fatty acids have explored the effects of industrial effluents and environmental variables on the amount and quality of fatty acids produced [ 19 , 20 ] and their role in food assimilation by herbivorous invertebrates .
fernando de noronha archipelago is an isolated group of islands formed by relatively recent volcanic processes .
the islands are located approximately 350 km off the northeastern brazilian coast and are part of pernambuco state . the archipelago was established as a marine protected area since 1988 , and its marine flora is composed of 128 taxa , including 44 species of chlorophyta , 62 of rhodophyta , and 22 of phaeophyta .
the most abundant benthic algae groups found in the archipelago are represented by the families dictyotaceae and sargassaceae .
other seaweeds also commonly found are the green algae caulerpa verticillata and red algae galaxaura spp . [ 23 , 24 ] . as part of a broader research project aimed to study chemical compounds of seaweeds from fernando de noronha ,
herein is provided baseline information on the fatty acids produced by eleven species commonly found in the archipelago .
samples were collected between february and march 2006 at two sites of the main island , caieiras beach ( 35018.8s , 322357.3w ) and sueste bay ( 3521.2s , 322519.7w ) .
research permit from the brazilian environmental agency ( ibama ) to collect algae was registered under number 050/2006 .
seaweeds were randomly collected by hand by uprooting the whole plant , which were placed in labeled plastic bags , frozen , and sent to the laboratory .
the algae were identified , cleaned from epiphytes , animals , and sediment , washed with distilled water , and in an oven at 40c dried for seven days .
ten milliliters ( 10 ml ) of dichloromethane ( j. t. baker , phillipsburg , nj , usa ) were added to 1 g ( dried weight ) of each species of algae and submitted to ultrasonic bath for 30 minutes .
this procedure was repeated three times and the total extract was concentrated on nitrogen gas .
subsequently , 2.0 ml of 1.0 m sodium methoxide were added to the extract and shaken occasionally during five minutes at 65c .
after cooling the extract , 1.0 ml of water and three samples of 1.0 ml of chloroform ( j. t. baker , phillipsburg , nj , usa ) was added to each sample , shaken for one minute , and centrifuged at 3000 rpm , or 1612.8 g , to extract methyl esters of the fatty acids .
the chloroform phase ( 3.0 ml ) , was removed and nitrogen gas was used to evaporate the solvent .
samples were suspended in 1.0 ml ethyl acetate ( j. t. baker , phillipsburg , nj , usa ) , and sodium sulphate anhydrous ( sigma inc . , st .
samples were analyzed through gc - ms ( gas chromatography coupled to mass spectrometer detector ) in a shimadzu qp2010 with ionization source of 70 ev and fragmentation by electronic ionization ( ei ) .
the volume of 1.0 l for each sample was injected at 220c in a dbwax column ( 30 m 0.25 mm 0.25 m ) .
the analysis occurred with 1-minute sample time in the splitless mode , a column flow of 1.3 ml min , a linear velocity of 41.4 cm s , and scan between m / z 40 and m / z 500 .
oven 's temperature started with 50c , increasing to 20c min until 200c , kept in this temperature for 5 minutes , then increased to 5c min until 230c and kept in this temperature for 30 minutes .
for identification of compounds , the peaks were compared with some standards and always consulting the libraries wiley version no . 7 and nist version nos .
the gc - ms analysis had excellent resolution , and the characteristics of the detected unsaturated and saturated fatty acids are given in tables 2 and 3 .
the eleven species have myristic acid ( 14 : 0 ) , pentadecanoic acid ( 15 : 0 ) , palmitic acid ( 16 : 0 ) , stearic acid ( 18 : 0 ) , oleic acid ( 18 : 1 , n ) , linoleic acid ( 18 : 2 ) , arachidonic acid ( 20 : 4 ) , and eicosapentaenoic acid ( 20 : 5 ) .
the major compounds were hexadecanoic acid methyl ester and phytol , which were detected in all samples analyzed .
other apolar compounds , mainly alcohols , were also identified and are provided in table 4 .
the only seaweed in which 20 : 0 fatty acid was absent was the green algae , c. verticillata , and the acid 17 : 0 was absent in only one red algae .
there were problems in isomer identification while conducting tentative taxonomic analysis , especially in double and triple bonds of c16 and c18 fatty acids , due to great similarity in retention time and in the molecular fragmentation in mass spectrum .
few differences were observed in the production of fatty acids by brown , green , and red algae .
also , as only one species of green seaweed was analyzed , this prevents further taxonomic comparisons with brown and red algae . in spite of the fact that gc - ms is a highly efficient and sensitive method of analysis
, it was unable to precisely determine which of the polyunsaturated fatty acids with 16 or 18 atoms of carbon was present in each species .
other apolar compounds detected had a more restrict distribution among species , and although most of them were detected in only one species , it was not possible to use them as chemotaxonomy markers , that is , phytol or loliolide .
moreover , the fatty acids referred to as chemotaxonomic agents in previous investigations [ 14 , 17 ] did not allow discerning brown , green , and red algae in the present study .
fernando de noronha is an area subjected to low levels of pollution because it is a marine protected area where anthropic activities are controlled .
hence , it would be interesting to compare the fatty acid profiles obtained in this study with the ones from coastal areas of the main land near of the archipelago region that has different degrees of pollution .
fatty acid profiles or other algae species , which are widely distributed and resistant to environmental changes , might be compared to the profiles of specimens collected in areas subjected to agrotoxics , solvents , and metals , as already done by tewari et al . with mercury .
in addition , the baseline information obtained may also be applicable to a long - term ongoing research focusing on the sea urchins , which are important grazers in the archipelago , in order to determine possible relationships between the algae species consumed and their assimilation efficiency by those invertebrates .
the methodology used allowed determining the fatty acid profile of eleven seaweed species from fernando de noronha archipelago .
as no specificity was found in the presence of a particular set of fatty acids , these compounds could not be used as taxonomic indicators in this case .
| hyphenated techniques of gas chromatography coupled to mass spectrometer were used to determine fatty acids in eleven species of seaweeds from fernando de noronha archipelago .
the main compounds detected in all studied species were the alcohol phytol and the fatty acids 14 : 0 ; 15 : 0 ; 16 : 0 ; 18 : 0 ; 18 : 1 n9 ; 18 : 2 9,12 ; 20 : 4 ; 20 : 5 .
these fatty acids are commonly found in seaweeds present in warm regions .
thus , we found no specificity in the presence of a particular set of fatty acids and the studied species indicating that they are not useful as taxonomic indicators .
however , they could be used in a comparative study with algae found in polluted area because many of the studied seaweeds are widespread and fernando de noronha has low human influence . |
the stroke volume ( sv ) response to exercise is considered one of the most important indices of heart function.1 unfortunately , its direct measurement during exercise requires intravascular catheterization , and therefore is rarely performed in the clinical setting .
consequently , several noninvasive methods to estimate exercise sv have been developed.2 recently , attention has been given to the oxygen pulse ( o2 pulse ) , a readily available variable obtained during cardiopulmonary exercise testing ( cpx ) , calculated by the ratio of oxygen uptake ( vo2 ) and heart rate ( hr ) .
the o2 pulse has been demonstrated to be a powerful predictor of mortality in patients with cardiovascular diseases3,4 and it has been associated to the onset of exercise - induced ischemia.5,6 although clinically useful , the o2 pulse is not a simple variable to consider , since it is influenced by many factors that can confound its interpretation , including the presence of diastolic dysfunction,7 valvular regurgitation,8 fitness level ( athletes may exhibit a plateau in oxygen pulse at higher levels of exercise , likely reflecting a physiological limitation of sv at the upper limits of hr),9 testing protocol10 and body dimensions.11 rearranging the terms in the modified fick equation , we have ; vo2/hr = ( co cao2)/hr ( co cvo2)/hr , where co is cardiac output and cao2 and cvo2 are the arterial and mixed venous o2 contents , respectively .
whipp et al.11 postulated that o2 pulse , when plotted as a function of 1/hr , results in a linear relationship that extrapolates to the asymptotic o2 pulse .
in other words , during progressive exercise , when vo2 changes as a linear function of hr , the o2 pulse equals the slope of the vo2-hr relationship .
this relationship only holds true however , if it is assumed that the product of co and cvo2 is constant during steady - state work rates as seen in graded exercise testing protocols ( e.g. : bruce protocol ) and also that cao2 is normally constant during exercise . to our knowledge ,
the o2 pulse curve pattern during the now - commonly used non - steady - state ( ramp protocol ) incremental exercise test has not been well described .
in addition , since sv is directly influenced by body dimensions12,13 and o2 pulse is related to the sv response to exercise , adjustments for body dimensions or weight should be included in studies aiming to evaluate the o2 pulse response to exercise .
if only maximal values are considered , overweight or obese subjects would have a superior o2 pulse response , which is likely misleading considering the higher prevalence of cardiovascular disease in this particular group .
this aspect has been an important limitation of both clinical6,14 and physiological studies15,16 and requires further exploration . in the present study , we tested the hypothesis that o2 pulse corrected for body weight ( hereafter termed relative o2 pulse ) in response to
non - steady - state incremental exercise testing demonstrates a linear pattern in a well controlled data set of subjects referred for exercise testing at our institution .
in addition , we tested the hypothesis that the relative o2 pulse curve pattern during progressive exercise , expressed by its slope and intercept , remains stable during serial testing under the same clinical conditions and similar drug regimens .
we retrospectively studied a sample consisting of 502 adult non - athletes referred , at least twice , for exercise testing for clinical and/or exercise pre - participation reasons at our clinic from january 02 , 2001 to october 31 2009 .
the study was designed to conform to the declaration of helsinki and approved by the institutional ethics committee .
inclusion criteria consisted of patients who : a ) performed two maximal cycling ramp protocol cpx at least 3 months apart ; b ) did not change clinical status and regular use of medications that might have affected the cardiovascular response to exercise ( such as beta - blockers ) at both cpxs . subjects with valvular heart disease , lung disease , anemia and those who exhibited o2 desaturation ( more than 4% at maximal effort ) during exercise were excluded from the study . in addition , all cpxs stopped early for clinical indications were not considered maximal and were excluded . after applying all inclusion and exclusion criteria ,
100 subjects were considered for final analyses ( 80 men ) , of whom 50% had coronary artery disease .
after undergoing the first cpx , 75% of the subjects attended a supervised exercise program at our clinic at least three times a week , while the remaining 25% received advice regarding exercise . after providing written informed consent
, all subjects underwent a symptom - limited cpx using an electronically - braked cycle ergometer ( ec-1600 ; cat eye ; , japan or cg-04 , inbrasport , brazil ) , according to an individualized ramp protocol designed to allow patients to reach maximum exercise within the desirable range of 8 to 12 minutes.17,18 the patients were verbally encouraged to exercise to volitional fatigue , regardless the maximal hr attained .
no medications were stopped before the cpx . the electrocardiogram ( ecg ) ( cardiolife tec 7100 ; nihon - kohden , japan ; or elite ergo pc 3.2.1.5 ; micromed , brazil ) was continuously monitored via a single lead ( cc5 or cm5 ) .
ventilatory expired gas analysis was obtained by a metabolic system ( vo2000 ; medgraphics , us ) .
the air flow and oxygen and carbon dioxide sensors were calibrated before each test using 2-liter syringes and gases with known volumes of oxygen , nitrogen , and carbon dioxide concentrations .
all exercise tests were performed , analyzed and reported according to a standardized protocol by a single experienced physician .
the age - predicted maximum hr was also calculated by the equation [ 210-(0.65 age ) ] .
maximum vo2 ( vo2max ) was expressed as the highest 60-s average value obtained during the cpx .
19 delta vo2/workload was calculated as : vo2max resting vo2 divided by maximum workload and expressed in ml.min.watts . for practical purposes , the resting vo2 while sitting on the cycle ergometer was considered to be 3.5 ml.kg.min for all subjects .
maximum o2 pulse was expressed as the highest 60-s average value and was expressed in milliliters per beat .
in addition , this value was expressed as a percentage of age - predicted achieved , which corresponds to the ratio between the predicted values for maximum vo2 and maximum hr . in order to remove the influence of body weight on the magnitude of o2 pulse response during cpx , its values
were then divided by weight in kilograms ( relative o2 pulse ) . in order to make the mathematical manipulations of the study easier ,
one of the strategies for testing our hypothesis was to divide the sample into quintiles , according to the results of maximum relative o2 pulse obtained during the first cpx . dividing the sample by quintiles allowed us to compare the stability of relative o2 pulse in subjects with different fitness levels and values of maximum relative o2 pulse .
paired students t - tests were used to assess the differences for key variables between the first and second cpx , when comparisons were made for the entire sample .
a statistics was used for comparisons of categorical variables among quintiles of relative o2 pulse . for comparisons made on key variables among quintiles of maximum relative o2 pulse ,
a repeated - measures two - way anova with greenhouse - geisser correction 20 was performed , in which cpx ( i.e. , first versus second cpx ) and quintiles of maximum relative o2 were the main factors .
after excluding the first minute ( rest - exercise transition ) of the cpx , pearson 's product - moment correlations between relative o2 pulse and cpx duration were performed for each cpx , in order to test the linearity of the relative o2 pulse curve during progressive exercise .
after testing the adequacy of linear regression by the magnitude of coefficient of determination of the relative o2 pulse , we then calculated the slopes and intercepts among quintiles for both cpx . to compare the slopes and intercepts , a paired student t - test was performed .
we retrospectively studied a sample consisting of 502 adult non - athletes referred , at least twice , for exercise testing for clinical and/or exercise pre - participation reasons at our clinic from january 02 , 2001 to october 31 2009 .
the study was designed to conform to the declaration of helsinki and approved by the institutional ethics committee .
inclusion criteria consisted of patients who : a ) performed two maximal cycling ramp protocol cpx at least 3 months apart ; b ) did not change clinical status and regular use of medications that might have affected the cardiovascular response to exercise ( such as beta - blockers ) at both cpxs . subjects with valvular heart disease , lung disease , anemia and those who exhibited o2 desaturation ( more than 4% at maximal effort ) during exercise were excluded from the study . in addition , all cpxs stopped early for clinical indications were not considered maximal and were excluded . after applying all inclusion and exclusion criteria ,
100 subjects were considered for final analyses ( 80 men ) , of whom 50% had coronary artery disease .
after undergoing the first cpx , 75% of the subjects attended a supervised exercise program at our clinic at least three times a week , while the remaining 25% received advice regarding exercise .
after providing written informed consent , all subjects underwent a symptom - limited cpx using an electronically - braked cycle ergometer ( ec-1600 ; cat eye ; , japan or cg-04 , inbrasport , brazil ) , according to an individualized ramp protocol designed to allow patients to reach maximum exercise within the desirable range of 8 to 12 minutes.17,18 the patients were verbally encouraged to exercise to volitional fatigue , regardless the maximal hr attained .
no medications were stopped before the cpx . the electrocardiogram ( ecg ) ( cardiolife tec 7100 ; nihon - kohden , japan ; or elite ergo pc 3.2.1.5 ; micromed , brazil ) was continuously monitored via a single lead ( cc5 or cm5 ) .
ventilatory expired gas analysis was obtained by a metabolic system ( vo2000 ; medgraphics , us ) .
the air flow and oxygen and carbon dioxide sensors were calibrated before each test using 2-liter syringes and gases with known volumes of oxygen , nitrogen , and carbon dioxide concentrations .
all exercise tests were performed , analyzed and reported according to a standardized protocol by a single experienced physician .
the age - predicted maximum hr was also calculated by the equation [ 210-(0.65 age ) ] .
maximum vo2 ( vo2max ) was expressed as the highest 60-s average value obtained during the cpx .
19 delta vo2/workload was calculated as : vo2max resting vo2 divided by maximum workload and expressed in ml.min.watts . for practical purposes , the resting vo2 while sitting on the cycle ergometer was considered to be 3.5 ml.kg.min for all subjects .
maximum o2 pulse was expressed as the highest 60-s average value and was expressed in milliliters per beat .
in addition , this value was expressed as a percentage of age - predicted achieved , which corresponds to the ratio between the predicted values for maximum vo2 and maximum hr . in order to remove the influence of body weight on the magnitude of o2 pulse response during cpx , its values
were then divided by weight in kilograms ( relative o2 pulse ) . in order to make the mathematical manipulations of the study easier ,
one of the strategies for testing our hypothesis was to divide the sample into quintiles , according to the results of maximum relative o2 pulse obtained during the first cpx . dividing the sample by quintiles allowed us to compare the stability of relative o2 pulse in subjects with different fitness levels and values of maximum relative o2 pulse .
paired students t - tests were used to assess the differences for key variables between the first and second cpx , when comparisons were made for the entire sample .
a statistics was used for comparisons of categorical variables among quintiles of relative o2 pulse . for comparisons made on key variables among quintiles of maximum relative o2 pulse ,
a repeated - measures two - way anova with greenhouse - geisser correction 20 was performed , in which cpx ( i.e. , first versus second cpx ) and quintiles of maximum relative o2 were the main factors .
after excluding the first minute ( rest - exercise transition ) of the cpx , pearson 's product - moment correlations between relative o2 pulse and cpx duration were performed for each cpx , in order to test the linearity of the relative o2 pulse curve during progressive exercise .
after testing the adequacy of linear regression by the magnitude of coefficient of determination of the relative o2 pulse , we then calculated the slopes and intercepts among quintiles for both cpx . to compare the slopes and intercepts , a paired student t - test was performed .
the median time between the first and second cpx was 15 months ( minimum and maximum of 5 and 62 months , respectively ) .
table 1 presents the baseline clinical characteristics of all patients divided by quintiles of maximum relative o2 pulse . except for the higher proportion of apparently healthy subjects and lower proportion of coronary artery bypass surgery in the 5 quintile compared to the 2 quintile ( p<0.05 ) ,
the proportion of subjects taking beta - blockers differed only between the 4 quintile versus 1 and 3 quintiles ( p<0.05 for both comparisons ) .
demographic characteristics and exercise responses for both cpx are shown in table 2 for the entire sample .
no significant differences were found for body weight ( p = 0.76 ) . except for maximum hr ( p = 0.53 ) , diastolic blood pressure ( p = 0.53 ) and delta vo2/workload ( p = 0.14 ) , significant differences were found for all other maximum results when the first and second cpxs were compared ; the average increases were 11% and 10% for vo2max and maximum relative o2pulse , respectively .
table 3 presents the results of selected key variables divided by quintiles for maximum relative o2 pulse .
no interactions between factors ( quintiles and cpx ) were found for any of the variables ( p>0.05 ; table 3 ) .
no significant differences were found for body weight , maximum hr and delta vo2/workload in each quintile ( p>0.05 for all comparisons ) , except for body weight between first and second cpx in the 5 quintile ( p<0.05 ) .
in contrast , when the first and second cpxs were compared in each quintile , significant differences were found for vo2max , maximum o2 pulse and maximum relative o2 pulse ( p<0.05 for all comparisons ) .
when the respective cpx between 1st and 5 quintiles were compared , significant differences were found for all variables ( p<0.05 for all comparisons ) , except for body weight .
vo2 increased in a linear manner relative to hr in both cpx from the second minute to maximum exercise ( average r = 0.84 for both cpx in the entire sample ) .
the average r between vo2 and hr from the onset to the second minute of exercise in both cpx was 0.53 .
the results of the linear regression between relative o2 pulse and cpx time divided by quintiles of maximum relative o2 pulse are shown in table 4 .
the high coefficient of determination ( r ) in each quintile reveals the linearity of relative o2 pulse , after exclusion of the first minute of cpx .
after a median time of 15 months , no significant differences were found for the slopes and intercepts between the first and second cpx in each quintile of maximum relative o2 pulse ( p>0.05 for all comparisons ; except for intercept comparison in the 5 quintile , p = 0.007 ) . when extremes of quintiles for maximum relative o2 pulse ( i.e. , 1 versus 5 quintiles ) were compared , its respective slopes were significantly different ( p<0.05 ) . in a subset analysis ,
similar results were found when the slopes between the first and second cpx were compared separately in men ( p = 0.75 ) and women ( p = 0.24 ) ; among subjects taking beta - blockers ( p = 0.78 ) and in subjects with known coronary artery disease ( p = 0.31 ) .
figure 1 shows the relative o2 pulse curves as a function of percentage time during first and second cpx for 1 and 5 quintiles .
the vertical line highlights the linearity of the curves after exclusion of the first 10% of the cpx time .
the results of the present study add to the existing body of research showing a linear increase in o2 pulse throughout maximal incremental non - steady - state exercise testing .
in addition , to our knowledge , this is the first study to demonstrate the stability of the o2 pulse curve pattern in a large group of subjects under identical clinical status , who served as their own control in a test - retest design .
our results are in agreement with previous studies , 3,5,10,21 in that vo2max and maximum o2 pulse were within normal limits and were significantly higher in the second cpx ( p<0.05 ; table 2 and 3 ) . even though the purpose of our study was not to assess the influence of exercise training , the higher values observed for vo2max and maximum o2 pulse between tests probably occurred because of the training influence , since almost all the subjects increased their physical activity levels .
in addition , an effect due to counseling may have occurred since the remaining 25% of the patients were underwent activity counseling after undergoing their initial cpx . a strong debate regarding
9,22 - 24 variations in these studies include a decrease , 25 a plateau 26 or an increase in sv when approaching volitional exhaustion 27 when untrained , moderately trained or heart disease patients are considered .
24 the prospective design and complexity of methods for measuring sv in most studies has generally limited sample sizes , and thus limited the external validity of the results .
in addition , different testing protocols ( graded or constant ) , type of ergometer ( treadmill or cycle ) , criteria for termination of the test ( exhaustion or pre - determined % of age - predicted maximum hr ) and also the lack of control of confounding variables such as body weight have limited the interpretation of previous results .
our results support the concept that sv , estimated by relative the o2 pulse response to maximum exercise , increases in a linear fashion throughout exercise in non - athletes as shown by the high r ( table 4 ) .
a decrease or a plateau in relative o2 pulse would lead to a reduced r which was not the case in our results .
our approach was novel in that we excluded the first minute of cpx to calculate the linearity and slopes of relative o2 pulse . at the onset of a ramp protocol
, the lack of linearity in the intensity increment affects the linear increase of hr as a function of vo2 ( average r = 0.53 for both cpx ) .
28 as a consequence , an artificial upward shift in o2 pulse slope occurs at the onset of exercise , as seen in figure 1 during the first 10% of the test ( the slopes are visually different before and after the vertical line ) .
thus , excluding the first minute of the cpx has an advantage in that it allows the direct use of the o2 pulse slope , obviating the need to calculate the vo2 and hr slopes .
although linearity was present irrespective of quintile of maximum relative o2 pulse ( high r in all quintiles ) it is clear that the higher the slope of the relative o2 pulse , the higher will be its linearity , as demonstrated by the positive trend shown in the results of r among quintiles of relative o2 pulse ( table 4 ) .
data have recently emerged in regard to the association between the o2 pulse pattern during cpx and the presence of ischemia during exercise 5,6,29 .
belardinelli et al . 5 studied 202 patients with known coronary heart disease who underwent both myocardial scintigraphy and cycle cpx .
by logistic regression analysis , the only independent predictors of a positive myocardial scintigraphy were o2 pulse flattening duration ( calculated from the inflection point occurring in vo2 as related to work ) and the slope of vo2/workload .
the slope of vo2/workload was within normal limits from the start of exercise to a point corresponding to the onset of myocardial ischemia .
however , as work rate increased further , an inflection point was evident in most patients with detectable myocardial ischemia , with the cutoff of 3.9 ml.min.watts being the strongest independent predictor according to a hierarchical model . supporting these results , chaudhry et al . , 29 showed that at the onset of myocardial ischemia , a decrease in the o2 pulse with increasing work rate and a abrupt decrease in the slope of vo2/workload occurred in a 68 year old woman referred for cpx as part of a preoperative evaluation .
the o2 pulse patterns observed in these studies are most likely explained by reduced stroke volume at higher intensity exercise due to myocardial ischemia .
in contrast , this was not the case in our relatively normal subjects , since delta vo2/workload was within normal limits in all quintiles of maximum relative o2 pulse ( table 3 ) and the slopes were significantly different from zero ( table 4 ) .
a novel finding shown by the present study was that , after a median time of 15 months in between first and second cpxs , the relative o2 pulse curve pattern remained unchanged as demonstrated by the lack of significant differences in slopes and intercepts regardless the maximum relative o2 pulse presented in each quintile ( table 4 ) .
the slopes and intercepts were similar despite the significantly higher values of vo2max in second cpx in each quintile of maximum relative o2 pulse ( on average 1% to 20% higher on the second cpx ) .
this may have occurred because of the lower sub - maximal hr values during the second cpx , as a result of the improved vo2max ( possible training or counseling effect ) .
in fact , three possible combinations of vo2 and hr kinetics may occur after a period of exercise training , the first being that only the vo2 kinetics is modified with training , the second being that only the hr kinetics is modified with training and the third being that both vo2 and hr kinetics are modified with training .
the first two cases imply that modifications of o2 pulse slope only mirrors the modification of vo2 or hr kinetics ; if such is the case , the relevance of the o2 pulse kinetics is limited . on the other hand , as may have occurred in our study ( tables 3 and 4 ) ; when both vo2 and hr kinetics are modified , the o2 pulse kinetics do not correlate highly with any of these two variables .
the results for the o2 pulse slopes were similar when comparisons between the first and second cpxs were performed , and were also similar when subsets of subjects were analyzed with known coronary artery disease and those taking beta - blockers , which extend the clinical applications of our results to these subgroups . finally , our study adjusted o2 pulse by body weight .
given the close relationship between sv and body dimensions , 12,13 consideration of body dimensions is necessary when evaluating the o2 pulse pattern to exercise . otherwise , an obese subject might misleadingly have a superior o2 pulse response when compared , for example , to a lean marathoner .
to our knowledge , few studies have taken into account the influence of weight on o2 pulse responses to exercise .
30 - 32 this aspect has been an important limitation of both clinical 6,14 and physiological studies .
15,16 in a study by munhoz et al.,6 87 patients underwent both myocardial scintigraphy and treadmill cpx in order to compare the o2 pulse response to incremental exercise in patients with and without ischemia as detected by myocardial scintigraphy .
although a flattening of the o2 pulse response occurred in patients with extensive myocardial ischemia when compared to those with mild ischemia , the authors concluded that o2 pulse responses during exercise were not able to discriminate those with and without myocardial ischemia .
caution is in order , however , when interpreting these results , since there were significant differences in the weight of the subjects , which was heavier in those with ischemic responses .
it is possible then , that patients with ischemic responses performed better in terms of o2 pulse simply because they were heavier .
unfortunately , the authors did not provide information on the relative o2 pulse responses , which limits comparisons between subjects with different body weights .
the sub - maximal o2 pulse has also been reported to be similar between trained and untrained men , when trained men were on average 14 kg lighter than untrained men.16 similarly , o2 pulse was not significantly different between obese and leaner women when obese women were 18 kg heavier on average than leaner women.15 some limitations are of note in the present study . even though direct measurements of sv were not made , collectively , the evidence is convincing that o2 pulse correlates well with direct measurements of sv .
11,16,21,33,34 according to the modified fick equation , o2 pulse equals the product of sv and arterio - venous oxygen difference .
since the assessment of arterio - venous oxygen difference requires the placement of invasive catheters , we assumed that arterio - venous oxygen difference increases in a predictable way with respect to workload , reaching an approximate constant peak value at close to maximal intensity.25,35 therefore , after the point where arterio - venous oxygen difference tends to reach its maximum value , any further increase in o2 pulse will reflect changes in sv .
finally , although the aim of the present study was not to assess the influence of exercise training of key dependent variables , we can not exclude the possible influence of the supervised exercise program or counseling on our results .
considering all the above , some caution should be made when interpreting the results of the present study .
the novelty of our study lays in the fact that it was the first study to demonstrate the stability of o2 pulse . by showing the o2 pulse curve stability after a median time of 15 months in subjects under similar clinical conditions and drug regimens
, we reject the hypothesis that factors such as measurement variability inherent to any test ( in our case cpx ) , could affect the o2 pulse pattern .
this increases in importance considering the established association between o2 pulse curve pattern and myocardial ischemia .
in other words , if such variability in the o2 pulse curve pattern was present , rejecting our hypothesis , it could be difficult to discriminate those with a flat o2 pulse curve truly caused by myocardial ischemia from those with a flat curve caused just by variations in measurements inherent to cpx .
the novelty of our study lays in the fact that it was the first study to demonstrate the stability of o2 pulse . by showing the o2 pulse curve stability after a median time of 15 months in subjects under similar clinical conditions and drug regimens
, we reject the hypothesis that factors such as measurement variability inherent to any test ( in our case cpx ) , could affect the o2 pulse pattern .
this increases in importance considering the established association between o2 pulse curve pattern and myocardial ischemia .
in other words , if such variability in the o2 pulse curve pattern was present , rejecting our hypothesis , it could be difficult to discriminate those with a flat o2 pulse curve truly caused by myocardial ischemia from those with a flat curve caused just by variations in measurements inherent to cpx .
after excluding the first minute of cpx ( rest - exercise transition ) , the relative o2 pulse exhibited a linear increase throughout maximum exercise .
in addition , in a test - retest design , where subjects served as their own controls , the pattern of relative o2 pulse remained stable .
claudio gil arajo is a recipient of research fellowships from capes and faperj ( brazil ) | introduction : exercise oxygen pulse ( o2 pulse ) , a surrogate for stroke volume and arteriovenous oxygen difference , has emerged as an important variable obtained during cardiopulmonary exercise testing.objectives:we hypothesized that the o2 pulse curve pattern response to a maximal cycling ramp protocol exhibits a stable linear pattern in subjects reevaluated under the same clinical conditions.methods:we retrospectively studied 100 adults ( 80 males ) , mean age at baseline of 59 12 years , who performed two cardiopulmonary exercise testings ( median interval was 15 months ) , for clinical and/or exercise prescription reasons
. the relative o2 pulse was calculated by dividing its absolute value by body weight .
subjects were classified into quintiles of relative o2 pulse .
cardiopulmonary exercise testing results and the o2 pulse curve pattern , expressed by its slope and intercept , were compared among quintiles of relative o2 pulse at both cardiopulmonary exercise testings.results:after excluding the first minute of cpx ( rest - exercise transition ) , the relative o2 pulse curve exhibited a linear increase , as demonstrated by high coefficients of determination ( r2 from 0.75 to 0.90 ; p<0.05 for all quintiles ) .
even though maximum oxygen uptake and relative o2 pulse were significantly higher in the second cardiopulmonary exercise testing for each quintile of relative o2 pulse ( p<0.05 for all comparisons ) , no differences were found when slopes and intercepts were compared between the first and second cardiopulmonary exercise testings ( p>0.05 for all comparisons ; except for intercept in the 5th quintile).conclusion : excluding the rest - exercise transition , the relative o2 pulse exhibited a stable linear increase throughout maximal exercise in adults that were retested under same clinical conditions . |
castor bean oil contains ricinoleic acid , a hydroxy monounsaturated fatty acid as main constituent of its fatty acid profile .
ricinoleic acid , cis-12-hydroxy-9-octadecenoic acid , has an unusual polarity due to position of hydroxyl group .
castor oil is the only commercially available vegetable oil containing hydroxy functionality of a fatty acid present abundantly ( 7090% ) .
its various derivatives like ricinoleyl alcohol , methyl ricinoleate , azelaic acid , and ricinenic acid are used as plasticizer and emulsifier .
ricinoleic acid derivatives are used in pigment , printing ink , and textile finishing . however , its main use is as chemical intermediate to produce various oleochemicals .
estolides and estolide esters from castor oil , or any source of hydroxy fatty acids , have been explored and show promise as cosmetics , coatings , and biodegradable lubricants .
estolides are formed when the carboxylic acid functionality of one fatty acid links to the site of unsaturation of another fatty acid to form oligomeric esters .
complex estolides have been synthesized by where oleic acid and various saturated fatty acids , butyric through stearic , were treated with 0.4 equivalents of perchloric acid at either 45 or 55c to produce a new class of saturated estolides with superior low - temperature properties .
the current work involves the synthesis of a new series of estolide ester from ricinoleic acid and various fatty acids .
the effect of fatty acid carbon chain length on physical characterization of these estolide esters was determined .
castor beans from experimental plot ukm were used to extract castor oil . concentrated sulphuric acid ( 98% ) and potassium hydroxide ( koh ) were purchased from j. t. baker inc .
caprylic acid ( 98% ) , capric acid ( 98% ) , lauric acid ( 98% ) , myristic acid ( 99% ) , palmitic acid ( 98% ) , stearic acid ( 96% ) , 2-hexyldecanoic acid ( 96% ) , and 2-butyloctanoic acid ( 96% ) were purchased from sigma aldrich .
ethanol ( 95% ) and hydrated sodium sulphate ( 99% ) were purchased from systerm .
estolide ester was synthesized in a one - step reaction in a 250 ml three - neck round bottom flask with a magnetic stirrer .
the heating mantel was used to maintain the temperature of reaction constant at 60c 3c .
ricinoleic acid ( 50 g , 0.1678 mol ) and branched fatty acid ( 0.0839 mol ) were combined and heated to 60c temperature . once the temperature reached 60c , acid catalyst ( 5% )
was added into reaction and the flask was placed under vacuum and stirred for 24 h. after 24 hours , ethanol ( 34 ml , 0.7391 mol ) was added into the flask and reaction was continued for additional 2 hours in vacuum . as the reaction completed , it was neutralized with koh ( 10 ml , 2 mol ) in 90% ethanol .
the round bottom flask was disconnected from the heating mantel and the solution was left to cool down to room temperature .
the organic layer was transferred to a separation funnel and was washed with distilled water to remove any excess ethanol used to neutralize .
the organic layer was then distilled using the simple distillation method at 80140c to remove any lactone , byproducts , excess ethanol and water .
( a ) fourier transform infrared spectroscopyfourier transform infrared spectroscopy ( ftir ) has been carried out according to .
ftir of the products was recorded by prkin elmer spectrum gx spectrophotometer in the range 4004000 cm . a very thin film of products covered the nacl cells ( 25 mm i.d 4 mm thickness ) and was used for analysis .
ftir of the products was recorded by prkin elmer spectrum gx spectrophotometer in the range 4004000 cm . a very thin film of products covered the nacl cells ( 25 mm i.d 4 mm thickness ) and was used for analysis .
( b ) viscosityviscosity test , astm d445 - 04 , was done in a brookfield viscometer using a number 3 spindle .
the speed was set to 100 rpm a minute and was done in room temperature .
viscosity test , astm d445 - 04 , was done in a brookfield viscometer using a number 3 spindle .
the speed was set to 100 rpm a minute and was done in room temperature .
( c ) pour pointthe pour point test , astm d97 - 05a , was done by using a u - tube .
the pour point test , astm d97 - 05a , was done by using a u - tube .
( d ) flash pointthe flash point test , astm d92 - 05a , was conducted by adding 5 ml sample into a small ceramic bowl .
the sample in the small container was partially emerged into a glass bowl of silicon oil and was heated on the heating mantel .
the heating process will produce gas clouds which were trapped in the ceramic bowl . starting from 100c
if there is no spark , the process will be repeated until there is spark .
the flash point test , astm d92 - 05a , was conducted by adding 5 ml sample into a small ceramic bowl . the sample in the small container was partially emerged into a glass bowl of silicon oil and was heated on the heating mantel .
the heating process will produce gas clouds which were trapped in the ceramic bowl . starting from 100c
if there is no spark , the process will be repeated until there is spark .
a series of estolide ethyl esters were synthesized from ricinoleic acid and a series of saturated fatty acids with sulphuric acid catalyst at 60c for 24 h. the structures are shown in figure 1 .
esterification process was continued with synthesis of estolide ester by adding an alcohol , ethanol to stop the estolide chain by capping it .
the temperature of the process should be kept stable and not exceed 70c because the productions of byproducts such as lactone will increase and decrease the temperature to less than 45c because of the slower rate of estolide formation .
ftir spectra of ricinoleic acid and reaction products were compared to show that condensation had occurred . as a result ,
the ftir spectrum of ricinoleic acid shows c = o stretching band at 1713 cm wavenumber and the presence of a hydroxyl group in the ricinoleic acid structure is shown 3445 cm wavenumber where else the reaction product , a sharp and long carbonyl c = o ester transmittance peak was observed at 1737 cm .
the presence of ch2 bending at 723 cm wavenumber indicates long - chain compound .
the , c = c transmittance peak are pot clearly presence because it , showed a weak transmittance peak due to only a small amount of alkene was present . from the observation ,
no lactones were present because of there is no transmittance peak at 1790 cm .
other absorbance indicates c h alkane bond and bend alkane at transmittance peaks 2926 cm , 2854 cm and 1464 cm , respectively .
the yield of these estolides increased from 52.51 0.03% to 96.57 0.05% for the neat and capped estolide esters .
this estolide was synthesized with ricinoleic acid and capric acid . the pour point of saturated estolide ethyl esters
pour point is the lowest point or temperature where the sample sustains in liquid form .
this property is important because low pour point enables the sample usage in cold countries and in low - temperature machineries .
low pour point helps in keeping the estolides in liquid condition which makes transportation and storage easy .
it is because the longer estolide esters have bigger molecular structure and bulky which makes them easier to solidify at a higher temperature compared to small compounds .
even though the pour point pattern is increasing , the values of pour point are still negative and are low .
it also determines fluid properties involved in lubricant , resistant to the initiation of relative movement of moving part .
the highest viscosity is obtained at 86 0.01 cp for ee18 and the lowest at 51 0.08 cp for ee16 .
the value of viscosity reduces as the length of fatty acid increases . the flash point , or the temperature at which a lubricant momentarily flashes in the pressure of a test flame , aids in evaluating fire - resistance properties .
it also shows that there is a possibility that there are hazardous gasses in the sample .
it is important to have a high flash point to ensure it will not harm the user or the environment by releasing gas emission at low - temperature .
the flash point temperature should also be high to ensure its usage is commercially accepted .
they are high and are not easily to emit any dangerous gaseous or potential fire occurrence during usage of the estolides .
these new estolide esters were compared with saturated branched - chain estolide esters . ee12 and
the comparison of physical characterisations between these estolide ethyl esters is shown in table 2 .
saturated branched - chain estolide ester has lower pour point and viscosity especially if ee16-compared to eehd .
this may be caused by the addition of branched fatty acid that causes the structure to become asymmetric thus reduces the pour point tremendously and increases the viscosity value .
. branched molecules can not be arranged very neatly because of its jagged structure .
this condition will lower the freezing temperature of the estolide ester because more energy is used to freeze it .
longer saturated branched - chain has a bigger molecule weight which makes it is easier to lose intramolecule force , leading the solution to have a small viscosity value .
the value of viscosity reduces as the length and quantity of branched fatty acid increase .
estolide ethyl esters from ricinoleic acid and saturated fatty acid have excellent low - temperature properties and high flash points . | a study was conveyed to produce estolide ester using ricinoleic acid as the backbone .
the ricinoleic acid reacted with saturated fatty acid from c8c18 .
these reactions were conducted under vacuum at 60c for 24 h without solvent .
the reaction used acid catalyst , sulphuric acid . the new saturate ricinoleic estolide esters show superior low - temperature properties ( 52 0.08c ) and high flash point ( > 300c ) .
the yield of the neat estolide esters ranged from 52% to 96% .
the viscosity range was 51 0.08 to 86 0.01 cp .
these new saturated estolide esters were also compared with saturated branched estolide esters . |
urinary tract infection ( uti ) is one of the most prevalent infections in human beings ( 1 ) .
community acquired uti and nosocomial infection are two types of urinary tract infections ( 2 ) .
most of the cases of uti are commonly caused by gram negative bacteria ; escherichia coli is responsible for 80% of infections ( 3 ) followed by klebsiella pneumonia , acinetobacter spp and enterobacter spp ( 4 ) .
the uropathogenic escherichia coli ( upec ) strains are the most important causes of utis ( 5 , 6 ) .
however , the gram - positive bacteria , staphylococcus saprophyticus , can cause uti in young females ( 7 ) .
increasing resistance to antibiotics by uti - causing organisms is a serious public health problem ( 8 , 9 ) .
high levels of resistance to antibiotic agents that are frequently used to treat uti infections have been reported in uti - causing e. coli ( 10 , 11 )
. horizontal gene transfer ( hgt ) has an important role in spreading resistance genes among bacteria through mobile genetic elements such as , plasmids , transposons and integrons ( 12 ) .
integrons are genetic elements that are capable of integration of resistance gene cassettes in their structure and subsequently denote resistance phenotype to their bacterial host ( 13 ) .
integrons can be located within transposons or conjugated plasmids and transfer along with them , facilitating the dissemination of antibiotic resistance genes between bacteria ( 14 ) .
structurally , integrons consist of two 5 ' conserved segments ( 5'-cs ) and 3 ' conserved segments ( 3'-cs ) that flank the central variable region or gene cassettes , which encode antibiotic resistance traits ( 15 ) .
the 5'-cs of integrons encode the integrase ( inti ) gene , the recombination site ( atti ) and the common promoter ( pc ) , while the 3'-cs harbors the qace1 gene and sul1 gene that mediate resistance to certain detergents and sulphonamides , respectively ( 16 ) .
in addition to encoding resistance genes by gene cassettes , they include a recombination site ( attc ) .
recombination between the attl and attc sites leads to insertion of the gene cassette downstream of a resident promoter , which mediated by the inti gene ( 17 ) .
based on the homology of the inti gene , four classes ( 1 - 4 ) of integrons have been identified ( 18 ) ; class 1 integrons are the most prevalent followed by class 2 integrons ( 19 ) .
more than 194 gene cassettes encode antibiotic resistance to aminoglycoside , -lactams , chloramphenicol , quinolones and trimethoprim ( 20 ) .
one or more gene cassette can be incorporated in integrons , however usually less than five cassettes with numerous combinations are carried by isolated bacteria ( 20 - 22 ) . hence , the presence of integrons among bacteria is associated with multiple drug resistance ( mdr ) , especially in enteric bacteria such as e. coli ( 23 ) .
the mdr enterobacteriaceae serve as a major public health problem and a strong association between mdr and the presence of integrons has been shown in enterobacteriaceae , independent of species or strain origin ( 24 ) .
many studies have investigated the presence of integrons in e. coli isolated from patient with uti , and they reported a significant association between antimicrobial resistance and existence of integron ( 23 - 28 ) .
pattern of resistance to antibiotics change continuously in uti - causing organisms , therefore appropriate information about local and national antimicrobial resistance will be needed for empirical therapy of uti ( 28 ) .
considering the importance of regional and local information about antibiotic resistance pattern among e. coli isolated from patients with utis , and the association between integrons and mdr among gram negative bacteria , the aim of this study was to determine the pattern of antibiotic resistance to commonly used antimicrobial agents , and to investigate the presence of class 1 , 2 and 3 integrons and their association with antibiotic resistance in e. coli isolated from patient with utis in yasuj , iran .
in this cross - sectional study , midstream urine samples of 1820 patients diagnosed with utis were collected in sterile universal containers from february 2013 to november 2014 .
exclusion criteria were having an indwelling urinary catheter , being pregnant , having genitourinary abnormalities and antibiotics therapy within the previous two weeks .
urine samples were inoculated on macconkey agar and blood agar plates using calibrated loops ( 0.001 ml ) and incubated at 37c for 18 to 24 hours . the number of colony forming units ( cfu ) was counted .
a growth of > 10 colony forming units / ml of one type of organism was considered as significant bacteriuria .
the isolates were identified to the species level using conventional biochemical tests , such as indole production , methyl red , voges - proskauer , simmons citrate , hydrogen sulfide , and urea hydrolysis ( 29 ) .
all of the isolates were stored at 20c in trypticase soy broth ( mast group ltd .
uk ) containing 15% glycerol ( 29 ) . disks containing antibiotics ( himedia , india ) were used to determine the susceptibility of e. coli isolates to the following antibiotics , according to the clinical and laboratory standards institute ( clsi ) guidelines ( 30 ) : amoxicillin ( 25 g ) , gentamycine ( 10 g ) , amikacin ( 30 g ) , co - trimoxazole ( 25 g ) , tetracycline ( 30 g ) , ciprofloxacin ( 5 g ) , nalidixic acid ( 30 g ) , imipenem ( 10 g ) , cephalothin ( 30 g ) , chloramphenicol ( 30 g ) , ceftazidime ( 30 g ) .
this study was approved by the ethical committee of yasuj university of medical sciences ( ethical code number : 20.11.91 - 91011020 ) .
briefly , three to five colonies of overnight culture of e. coli on brain heart infusion agar was suspended in 300 l of sterile distilled water and boiled at 95c for ten minutes then cell debris was removed by centrifugation for tenminutes at 13000 rpm , and 200 l of the supernatant was stored at 20 c for dna amplification .
the inti1 , inti2 and inti3 genes were amplified by a multiplex - polymerase chain reaction ( pcr ) method using primers described by goldstein et al .
( 8) ( table 1 ) . the pcr amplification was performed in a total volume of 25 l containing 12.5 l of master mix ( cinnagen , iran ) , 25 pmol of each primer and 3 l of dna template .
expected amplified products , 280 bp for integron class 1 , 233 bp for integron class 2 and 600 bp for integron class 3 were separated by electrophoresis on 1% agarose gel containing 0.5 g / ml ethidium bromide and photographed under uv illumination . abbreviations : f , forward ; r , reverse . the spss software ( version 16 , chicago , il , usa )
the association between presence of integrons and antibiotic resistance was determined by or fisher s exact test . a p value of < 0.05 was considered statistically significant .
in this cross - sectional study , midstream urine samples of 1820 patients diagnosed with utis were collected in sterile universal containers from february 2013 to november 2014 .
exclusion criteria were having an indwelling urinary catheter , being pregnant , having genitourinary abnormalities and antibiotics therapy within the previous two weeks .
urine samples were inoculated on macconkey agar and blood agar plates using calibrated loops ( 0.001 ml ) and incubated at 37c for 18 to 24 hours . the number of colony forming units ( cfu ) was counted .
a growth of > 10 colony forming units / ml of one type of organism was considered as significant bacteriuria .
the isolates were identified to the species level using conventional biochemical tests , such as indole production , methyl red , voges - proskauer , simmons citrate , hydrogen sulfide , and urea hydrolysis ( 29 ) .
all of the isolates were stored at 20c in trypticase soy broth ( mast group ltd .
uk ) containing 15% glycerol ( 29 ) . disks containing antibiotics ( himedia , india ) were used to determine the susceptibility of e. coli isolates to the following antibiotics , according to the clinical and laboratory standards institute ( clsi ) guidelines ( 30 ) : amoxicillin ( 25 g ) , gentamycine ( 10 g ) , amikacin ( 30 g ) , co - trimoxazole ( 25 g ) , tetracycline ( 30 g ) , ciprofloxacin ( 5 g ) , nalidixic acid ( 30 g ) , imipenem ( 10 g ) , cephalothin ( 30 g ) , chloramphenicol ( 30 g ) , ceftazidime ( 30 g ) .
this study was approved by the ethical committee of yasuj university of medical sciences ( ethical code number : 20.11.91 - 91011020 ) .
, three to five colonies of overnight culture of e. coli on brain heart infusion agar was suspended in 300 l of sterile distilled water and boiled at 95c for ten minutes then cell debris was removed by centrifugation for tenminutes at 13000 rpm , and 200 l of the supernatant was stored at 20 c for dna amplification .
the inti1 , inti2 and inti3 genes were amplified by a multiplex - polymerase chain reaction ( pcr ) method using primers described by goldstein et al .
the pcr amplification was performed in a total volume of 25 l containing 12.5 l of master mix ( cinnagen , iran ) , 25 pmol of each primer and 3 l of dna template .
expected amplified products , 280 bp for integron class 1 , 233 bp for integron class 2 and 600 bp for integron class 3 were separated by electrophoresis on 1% agarose gel containing 0.5 g / ml ethidium bromide and photographed under uv illumination . abbreviations : f , forward ; r , reverse .
the spss software ( version 16 , chicago , il , usa ) was used for statistical analysis .
the association between presence of integrons and antibiotic resistance was determined by or fisher s exact test . a p value of < 0.05 was considered statistically significant .
among the 200 uti e. coli strains , 144 ( 72% ) strains were isolated from females and 56 ( 28% ) strains were isolated from males .
high frequencies of resistance were observed toward cephalothin ( 99% ) and amoxicillin ( 76% ) while only two ( 1% ) isolates showed resistance to imipenem .
the e. coli isolates were also resistant to co - trimoxazole ( 62% ) , tetracycline ( 50% ) , nalidixicacid ( 48.5% ) , ceftazidime ( 40.5% ) , ciprofloxacin ( 29% ) , gentamicin ( 15.5% ) , chloramphenicol ( 13% ) and amikacin ( 3% ) .
of the 200 tested e. coli isolates , 158 ( 79% ) were mdr and were resistant to three or more antibiotics .
none of the isolates were fully susceptible or resistant to all of the tested antibiotics .
sixty - six antibiotic resistance patterns were observed in e. coli isolates , yet 30 resistance phenotypes were presented by only one isolate
. resistance to cephalothin was the most common phenotype , which was detected in 27 isolates .
the second resistance phenotype was towards 13 isolates , including resistance to cephalothin , amoxicillin , co - trimoxazole and tetracycline .
class 1 and 2 integrons were detected in 104 ( 52% ) and 5 ( 2.5% ) isolates , respectively , while none of isolates were positive for class 3 integrons .
ninety - three of the isolates ( 46.5% ) did not contain any classes of integrons . among the 158 mdr e. coli , 101 ( 63.9% )
harbored class 1 or class 2 integrons yet only 5 ( 11.9% ) of the 42 non - mdr isolates had integrons .
the carriage of class 1 integron was found to be significantly higher in co - trimoxazole ( p < 0.001 ) , nalidixic acid ( p < 0.001 ) , ciprofloxacin ( p < 0.015 ) , amoxicillin ( p < 0.001 ) , ceftazidime ( p <
0.003 ) and tetracycline ( p < 0.012 ) resistant isolates ( table 3).there was no significant association between resistance to chloramphenicol , amikacin and gentamicin with the presence of class 1 integrons . abbreviation : na , not available .
consistent with previous reports , in this study class 1 integrons were the most prevalent compared to the other tested integrons . in accordance with our study , chang et al . from taiwan and li et al . from china detected class 1 integrons in 64% and 66.5% of e. coli isolated from different clinical specimens and blood stream infections , respectively ( 31 , 32 ) .
many reports have shown the prevalence rate of integrons to be between 6.25% and 54.6% of clinical isolates ( 33 - 38 ) .
there have been various studies from different cities of iran : fallah et al . from tehran
detected class1 integrons in 50.3% of isolates ( 37 ) while rezaee et al . from tabriz , and japoni et al . and farshad et al . from shiraz identified this class of integrons in 22.05% , 33.34% and 6.25% of e. coli , respectively ( 33 - 35 ) .
detected integrons in only 6.25% of e. coli isolated from children with uti and suggested that antibiotic resistance cassettes may be carried on transposable elements or other plasmids rather than integrons .
class 2 integrons were detected in 2.5% of isolates in this study , which is lower than that reported by other studies , such as fallah et al .
similar to previous studies we could nt find class 3 integrons in the present study ( 31 - 39 ) .
antibiotic resistance encoding gene cassettes for fluoroquinolones , -lactams , aminoglycosides , trimethoprim and chloramphenicol have been detected in integrons ( 20 ) .
a significant association between presence of class 1 integrons and resistance to co - trimoxazole , nalidixic acid , ciprofloxacin , amoxicillin , ceftazidime and tetracycline was shown in this study . in accordance with our study ,
a significant association between presence of class 1 integrons and resistance tociprofloxacin , nalidixic acid and co - trimoxazole was reported by japoni et al , to co - trimoxazole , nalidixic acid and ceftazidime by fallah et al . and to nalidixic acid and tetracycline by mathai et al .
while in many studies resistance to other antibiotics such as gentamicin , amikacin , cephalothin ( 35 ) and chloramphenicol ( 34 ) were correlated with class 1 integrons . in spite of many resistance gene cassettes including aada , aadb , aada7 , aada4 and aaca1 , which confer resistance to aminoglycosides like amikacin and gentamicin , in our study this association was not significant .
this may be due to the low resistance rate to amikacin ( 2.5% ) , or other resistance mechanisms ( mutation in the rrna gene , efflux and permeability mechanisms ) to aminoglycosides rather than integrons by bacteria in this study .
sincemost of the isolates ( 99% ) were resistant to cephalothin and only 1% were resistant to imipenem , no significant association was found between presence of integrons and resistance to these antibiotics , similar to many previous studies ( 33 , 34 ) . in this study ,
79% of isolates were mdr , which is approximately similar to other reports from iran that showed 77% and 84.2% mdr in isolated e. coli ( 33 - 37 ) , while in the usa and slovenia this was 7.1% and 42% , respectively ( 39 , 40 ) .
empirical therapy for mdr isolates is a major concern ; hence a periodical local study will be needed to assess the antibiotic susceptibility pattern . in the present study a high resistance rate
was seen towards cephalothin ( 99% ) , which is higher than other studies that reported 77.8% , 60% and 40% ( 34 , 35 , 37 ) .
. showed similar results ( 33 - 35 , 41 ) while , fallah et al . reported that 27.1% of their isolates were sensitive to imipenem ( 37 ) .
although this antibiotic may be used as a drug of choice for treatment of uti caused by e. coli , yet it is only recommended for complicated urinary tract infections . resistance to ciprofloxacin and nalidixic acid was 29% and 48.5% in this study , which was lower than the studies of fallah et al . and rezaee et al .
( 34 , 37 ) , yet higher than other studies ( 35 , 42 , 43 ) .
these two antibiotics are among the drugs of choice for treatment of uti , hence increased use of these antibiotics without knowledge about the pattern of antibiogram may gradually lead to a rise in antibiotic resistance . sixty - two percent of the isolates were resistant to co - trimoxazole , which was similar to the study of fallah et al .
( 67.7% ) but higher than the study of japoni et al . and lower than rezaee et al . and farshad et al .
( 33 - 35 , 37 ) . a large number of mdr isolates of e. coli were observed in this study , among which 62.6% had class 1 integrons.the significant association between class 1 integrons and resistance to ciprofloxacin , nalidixic acid , co - trimoxazole , amoxicillin , ceftazidime and tetracycline suggests that class 1 integrons have an important role in resistance to these antibiotics .
we suggest that further research should be done on the association between antibiotic resistance and presence of integrons , integrase genes and gene cassettes .
a large number of mdr isolates of e. coli were observed in this study , among which 62.6% had class 1 integrons.the significant association between class 1 integrons and resistance to ciprofloxacin , nalidixic acid , co - trimoxazole , amoxicillin , ceftazidime and tetracycline suggests that class 1 integrons have an important role in resistance to these antibiotics .
we suggest that further research should be done on the association between antibiotic resistance and presence of integrons , integrase genes and gene cassettes . | background : most urinary tract infections ( uti ) are caused by escherichia coli .
integrons have an important role in distributing antibiotic resistance genes among bacteria.objectives:the aim of this study was to investigate the presence of class 1 , 2 and 3 integrons and their association with antibiotic resistance in e. coli isolated from patient with uti in yasuj , iran.patients and methods : in this cross - sectional study a total of 200 e. coli were collected from 1820 patients diagnosed with uti that had been referred to two clinical laboratories between february 2013 and november 2014 in yasuj city , southwest of iran .
susceptibility of isolates to 11 different antibiotics was determined by the disk agar diffusion method .
multiplex - polymerase chain reaction ( pcr ) was used for detection of class 1 , 2 and 3 integrons .
the data were analyzed using the spss software ( version 16 ) and the chi - square test .
a p value of < 0.05 was considered statistically significant.results:the highest rate of resistance was observed toward cephalothin ( 99% ) and amoxicillin ( 76% ) while only two ( 1% ) isolates showed resistance to imipenem .
overall , 79% of isolates were multi drug resistant ( mdr ) .
class 1 and 2 integrons were detected in 104 ( 52% ) and 5 ( 2.5% ) isolates respectively , while none of the isolates were positive for class 3 integrons .
a significant association was observed between the presence of integrons and resistance to co - trimoxazole , nalidixic acid , ciprofloxacin , amoxicillin , ceftazidime and tetracycline ( p < 0.05).conclusions : high mdr isolates of e. coli were observed in this study .
the significant association between class 1 integrons and resistance to ciprofloxacin , nalidixic acid , co - trimoxazole , amoxicillin , ceftazidime and tetracycline showed that class 1 integrons have an important role in resistance to these antibiotics in this region . |
lymphocyte apoptosis has been increasingly recognized as an important step in the pathogenesis of sepsis , by inducing a state of ' immune paralysis ' that renders the host vulnerable to invading pathogens .
sepsis is an important clinical problem , affecting more than 700,000 people each year in the united states alone , of whom 20% to 30% die .
this paradigm led to the development of agents aimed at blocking key mediators of inflammation , such as bacterial lipopolysaccharide , interleukin-1 , and/or tumor necrosis factor- among others .
however , when many of these agents were tested in large phase iii randomized controlled trials they failed to demonstrate a beneficial effect [ 4 - 6 ] .
thus , therapeutic strategies aimed at suppressing inflammation in sepsis have been disappointing . over the past decade
, studies in experimental models and in patients suggested that the immune response of sepsis follows a biphasic pattern , with an initial ' hyperinflammatatory ' phase characterized by high levels of pro - inflammatory cytokines , and a second phase characterized by decreased responsiveness of immune cells to inflammatory stimuli the ' immunoparalysis ' phase .
the immunoparalysis phase is an extremely vulnerable period when patients are at particular risk from invading bacteria .
the mechanism for this immune paralysis appears to involve apoptosis of immune cells , in particular lymphocytes . in a seminal study , wang et al
. found that the intra - peritoneal injection of gram - negative bacteria to mice was followed by apoptosis of cd4+cd8 + lymphocytes in the thymus .
hotchkiss et al . used a murine model of cecal ligation and puncture to show that lymphocyte apoptosis also involves lymphocytes from the spleen and most other vital organ systems , and later demonstrated that extensive lymphocyte apoptosis is also present in humans with sepsis .
studies using loss - of - function approaches suggested that the mechanisms of lymphocyte apoptosis in sepsis involve both the receptor - mediated and the mitochondrial pathways of apoptosis , with the later playing the predominant role ( reviewed in ) .
now extend these laboratory observations to the bedside , by demonstrating accelerated apoptosis in circulating lymphocytes ( cd4 , cd8 and cd19 ) from patients with severe sepsis , but not in non - septic , critically ill patients .
this study is important because it confirms a pattern of activation of bcl-2 family members predicted by animal studies , and sets the basis for further studies aimed at modulating lymphocyte apoptosis in sepsis .
one particularly interesting finding in weber and colleagues ' study is that the pro - apoptotic molecule bim was markedly upregulated in the lymphocytes of patients with severe sepsis .
this is important because , of the different components of the apoptosis cascade that have been tested in animal models ( fadd , bid , bcl2 , caspases ) , only deletion of bim is associated with complete protection from apoptosis .
however , it is important to note that blockade of lymphocyte apoptosis is not always protective in sepsis .
for example , septic mice lacking myd88 have decreased lymphocyte apoptosis but a significant increase in mortality .
myd88 is an important proximal component of the main pathogen recognition pathways , suggesting that inhibition of lymphocyte apoptosis is protective only when the ability of the host to identify and respond to pathogens is preserved .
patients were enrolled 4 hours after presentation , which may have been too early in the hospital course to catch the period of maximal apoptosis .
also , information on the effects of severe sepsis on the receptor - mediated pathway of apoptosis , particularly fadd and caspase 8 , would have been interesting . in summary
, the study by weber and colleagues reaffirms and advances our knowledge of specific pathways involved in lymphocyte apoptosis in patients suffering from severe sepsis , raising hopes for potential therapeutic targets that improve mortality in this patient population .
| sepsis is an important clinical problem with a mortality rate of 20% to 30% .
lymphocyte apoptosis has been recognized as an important step in the pathogenesis of experimental sepsis , by inducing a state of ' immune paralysis ' that renders the host vulnerable to invading pathogens .
the importance of lymphocyte apoptosis in human disease is now confirmed by weber and colleagues , who demonstrate extensive apoptosis in circulating lymphocytes from patients with severe sepsis .
weber and colleagues ' data set the basis for further studies aimed at modulating lymphocyte apoptosis in sepsis . |
cell lines and denv-3 strain - bhk-21 cells were propagated at 37c in
a humidified incubator with 5% co 2 in minimum essential medium supplemented
with 10% foetal bovine serum ( fbs ) .
mosquito c6/36 cells were cultured at 30c in
leibovitz s medium ( l-15 ) with 5% fbs .
both growth media were supplemented with 1%
antibiotic solution ( containing penicillin and streptomycin ) .
95016/br - pe/02 strain is a
denv-3 clinical sample isolated from an 11-year - old female patient during the denv-3
epidemics in the state of pernambuco , brazil in 2002 ( cordeiro et al .
virus was isolated in mosquito c6/36 cells
( passage 1 ) and virus serotype confirmed by reverse transcription - polymerase chain
reaction ( rt - pcr ) .
the infectious clone and replicon described herein were derived from passage 3
in insect cells .
e. coli strain , yeast strains and yeast transformation -
electrocompetent electromax dh10b e. coli cells were acquired from
invitrogen .
saccharomyces cerevisiae rfy206 ( mata trp1::hisg
his3200 ura3 - 52 lys2201 leu2 - 3 ) strain ( finley jr & brent 1994 ) was
grown in ypd media and made competent by lithium acetate treatment ( sambrook & russell 2001 ) .
s.
cerevisiae yph252 ( mat ura3 - 52 lys2 - 801 ade2 - 101 trp1-1 his3-200
leu2-1 ) strain ( sikorski & hieter
1989 ) was purchased from atcc .
yph252 transformation was carried out by
electroporation as previously described ( meilhoc et al .
plasmid constructions - plasmid psvjs01 , a newly designed shuttle
vector , was constructed as follows : a 2-kb fragment was amplified by pcr from prs414
( atcc ) .
it contains necessary elements to allow replication ( cen6/ars h1 ) and selection
( trp1 ) in yeast .
the 5-end primer used on this pcr reaction included a t7 promoter
recognition site and a multiple cloning site ( mcs ) .
to assemble psvjs01 , the 2-kb
fragment was inserted into not i - linearised pbelobac11 vector ( new
england biolabs ) by homologous recombination ( polo et
al .
purified plasmid dna was amplified in dh10b e. coli strain
in selective medium and analysed by restriction pattern on agarose gel
electrophoresis . denv-3
denv-3 genome was amplified in five overlapping subgenomic fragments
( table ) using the klentaq la polymerase mix
( clonetech ) , a high fidelity dna polymerase enzymes mix .
the first fragment ( f1 ) was
amplified using primers psvjs01-f and denv-3 - 1860-r .
the forward primer used on this pcr
reaction included an rsr ii restriction site , a t7 promoter recognition
site and an additional g immediately before the first base of denv-3 genome .
this reaction used as
template a rt product derived from a denv-3 infectious clone recovered by in vitro
ligation ( jjs santos & lhvg gil , unpublished observations ) and introduced a unique
bam hi site into the denv-3 infectious clone sequence reported on
this paper . the third fragment ( f3 )
was amplified with primers denv-3 - 3481-f and
denv-3 - 4570-r while primer set denv-3 - 4370-f and denv-3 - 6700-r was used to amplify
fragment f4 .
the last fragment ( f5 ) was amplified using primers denv-3 - 6521-f and
psvjs01-r .
tableprimer set for construction of the dengue virus type 3 ( denv-3 ) infectious
clone and replicon pcr fragment primer i d primer sequence ( 5-3 ) primer annealing position ( nt )
gene region f1 psvjs01-f
cggtccgtaatacgactcactatagagttgttartctacgtggaccga 1 - 23 5-utr denv-3 - 1860-r tctttcttcaacacaaaggtattc 1,837 - 1,860 e f2 denv-3 - 1141-f aactgactcaagatgtcctacc 1,141 - 1,162 e denv-3 - 3521-r ggattgccaaacacaagacac
3,501 - 3,521 ns2a f3 denv-3 - 3481-f ggtggacaacttcacaatgg 3,481 - 3,500 ns2a denv-3 - 4570-r ttccagttctgctttctgtgtc 4,549 - 4,570 ns3 f4 denv-3 - 4370-f acaatgagaataaaagatgatgaga 4,370 - 4,394 ns2b denv-3 - 6700-r gactatagccgacgcgatccat 6,679 - 6,700 ns4a f5 denv-3 - 6521-f acaatggaaacactcctactct 6,521 - 6,542 ns4a psvjs01-r
ttcaacatttccgtgtcgcgcggccgcagaaccrgttgattcaacagcaccatt 10,681 - 10,707 3-utr rf1 psvjs01-f
cggtccgtaatacgactcactatagagttgttartctacgtggaccga 1 - 23 5-utr rep - prm- bam
hi - e - r
gttttttggggatcctcgtgaagtcaagtggaaag 435 - 454 c / prm rf2 rep - prm- bam
hi - e - f
gacttcacgaggatccccaaaaaacacatccatgtcat 2,336 - 2,357 e denv-3521-r ggattgccaaacacaagacac 3,501 - 3,521 ns2a
a : nucleotide ( nt ) numbering refers to denv-3 full - length
genome ; ns : nonstructural ; utr : untranslated region .
a : nucleotide ( nt ) numbering refers to denv-3 full - length
genome ;
denv-3 replicon was generated by a pcr - mediated deletion , eliminating almost the entire
structural coding region [ from nucleotide ( nt ) 454-nt 2336 ) ] , as depicted in fig . 2 , and
cloned as a set of five fragments ( table ) ,
the first fragment ( rf1 )
was amplified using primers psvjs01-f and rep - prm- bam hi - e - r ,
generating a 0.5-kb pcr product that retained the first six codons of prm .
the second
fragment ( rf2 ) was amplified with primers rep - prm- bam hi - e - f and
denv-3521-r , producing a 1.3-kb pcr product carrying the last 26 codons of e protein .
primers rep - prm- bam hi - e - f and rep - prm- bam hi - e - r
were engineered to insert a single bam hi site in the denv-3 replicon
sequence .
both constructs were assembled into not i - linearised psvjs01
vector by homologous recombination ( polo et al .
1997 , gibson 2009 ) in yph252 yeast
strain .
recombinant clones were selected in drop - out ynb agar plates , and then screened
by pcr and dna sequencing .
functional clones were maintained in yeast to prevent any
instability of sequences in bacteria .
genome sequence was deposited in the genbank under
the accession kc425219 .
in vitro transcription and transfection - full - length pcr product from
denv-3 infectious clone
full - length rna transcripts were in vitro synthesised using the
megascript t7 kit ( ambion ) with the addition of a 7-methyl - guanosine cap analog
( ambion ) , following manufacturer s instructions .
an aliquot from the reaction was
analysed by formaldehyde - agarose gel electrophoresis and rna transcripts were used
without further processing .
full - length rna transcripts were introduced into bhk-21
cells by electroporation using the ecm 830 electro cell manipulator ( btx harvard
apparatus ) .
2 x 10 bhk-21 cells were trypsinised and washed twice with
serum - free medium , resuspended in 100 l cytomix solution ( ansari et al . 2004 ) and mixed with 5 g of transcribed rna .
electroporation
was performed with two pulses of 100 s at 1,200 v separated by 1 s interval . as
negative control
, bhk-21 cells were transfected under the same conditions except no rna
was added ( mock ) .
after electroporation , cells were allowed to recover for 10 min at
room temperature and resuspended in complete growth medium .
immunofluorescence assay ( ifa ) - to detect denv-3 virus antigen ,
transfected cells were seeded onto glass coverslips . at different time points ,
rna - transfected cells in glass coverslips were rinsed with phosphate buffered saline
( pbs ) , fixed with 50% cold acetone ( v / v ) in pbs for 5 min at 4c and air - dried .
fixed
cells were incubated with a 1:100 dilution of a polyclonal hyperimmune mouse ascitic
fluid ( hmaf ) for 1 h at 37c .
this hmaf was raised against group b flaviviruses ,
including yfv and the four denv serotypes .
while its reactivity has not been fully
tested , this hmaf reacts predominantly to e protein .
after incubation with primary
antibody , cells were rinsed twice with pbs and incubated for 1 h at 37c with a 1:100
dilution of fluorescein isothiocyanate ( fitc)-conjugated anti - mouse igg antibody
( sigma - aldrich ) , developed in goat .
then , cells were rinsed twice with pbs and the
nuclei stained with a hoechst 33258 solution ( sigma - aldrich ) .
prior visualisation by
fluorescent microscopy , cell were washed twice with ddh 2 0 , air - dried and
mounted .
immunofluorescence analyses were carried out on a dmi 4000b inverted microscope
( leica ) .
stability of denv-3 infectious clone in yeast - to evaluate genome
stability , cloned denv-3 infectious clone was repeatedly propagated in yeast .
recombinant clones were grown in drop - out ynb agar plates at 30c for three days . grown
colonies were streaked out in fresh selective agar plates and incubated at 30c for
other three days .
after 10 consecutive passages , plasmid dna was purified and genome
integrity was assessed by dna sequencing and virus rescue .
denv-3 replicon rna transcription and transfection - the entire denv-3
replicon sequence was amplified by a high - fidelity full - length pcr .
the pcr product was
purified by phenol - chloroform extraction and ethanol precipitation and used as a
template for in vitro transcription .
replicon transcripts were synthesised using the
mega- script t7 kit ( ambion ) with the addition of a 7-methyl - guanosine cap analog
( ambion ) .
denv-3 replicon transient replication assessed by rt - pcr - at different
time points , total rna was purified from bhk-21 cells transfected with denv-3 replicon
using the invisorb spin cell rna mini kit ( invitek ) , according to manufacturer s
instructions .
total rna isolation from mock - transfected bhk-21 cells was used as
negative control . quantified rna preparations served as templates to rt using
superscript iii reverse transcriptase ( invitrogen ) with reverse primer denv-3 - 3521-r
( 5-ggattgccaaacacaagacac-3 ) , following the manufacturer s protocol .
standard pcr
amplifications were carried out using rt products as templates and specific primers :
denv-3 - 1-f ( 5-agttgttagtctacgtggaccg-3 ) and denv-3 - 3521-r ( table ) .
virus titration and growth curves - virus titration was determined by
focus -forming essay in mosquito c6/36 cells , as described
previously ( das et al .
briefly , 2 x 10 cells per well were seed in 24-well cell
culture dishes 48 h prior to the assay was conducted .
cell monolayers were incubated at
30c with 0.2 ml of serial dilutions of each virus . after removing the inocula ,
cells
were covered with 1 ml of l-15 overlay medium , containing 1% carboxymethyl cellulose , 2%
fbs and 1% antibiotic solution and incubated at 30c . on day 5 ,
cells were fixed with 30% cold acetone ( v / v ) in pbs for 13 min at room
temperature and washed once with pbs .
fixed cells were incubated for 1 h at 37c with a
hmaf diluted 1:100 in ligation buffer .
cells were rinsed with wash buffer and incubated
with a 1:500 dilution in ligation buffer of a horseradish peroxidase - conjugated
recombinant protein g ( invitrogen ) for 1 h at 37c .
cells were rinsed with wash buffer
and foci developed by adding 3-amino-9-ethylcarbazole substrate buffer .
foci were counted and virus titres , expressed in
focus -forming unit per ml , determined by standard methods . for
growth curves ,
5 x 10 mosquito c6/36 cells per well in a 24-well cell
culture dishes were infected in duplicate with wild - type denv-3 ( wt - denv-3 ) and
transcript - derived denv-3 at a multiplicity of infection ( moi ) of 0.1 .
cells were
incubated at 30c for 1 h. after inocula removal , cells were washed twice with pbs and 1
ml of growth medium was added to each well .
aliquots of the supernatant of infected
cells were removed daily and stored at -70c .
denv-3 titres in each sample were
determined by titration in mosquito c6/36 cells .
statistical analysis - statistical analyses were performed using the
graphpad prism 4 for macintosh ( graphpad software , inc ) .
growth kinetics differences
were analysed by a two - way anova with a mixed linear model for repeated measures ,
followed by a bonferonni s corrected post hoc test for pairwise
comparisons at each time point .
construction of a newly designed shuttle vector psvjs01 - plasmid
vectors and cloning hosts are critical to successful development of flavivirus
infectious clone ( ruggli & rice 1999 ) .
many
strategies to stabilise flavivirus genome aim to reduce plasmid copy number in
e. coli by using low - copy plasmid or bac vectors .
we sought a
similar approach to lower plasmid copy number in yeast by using a chromosome - derived
origin of replication .
the psvjs01 backbone is based on pbelobac11 , a bac vector . to
create the new shuttle vector ,
a 2-kb fragment was amplified by pcr from prs414
containing cen6/ars h1 and trp1 .
a t7 promoter recognition site and a mcs were also
engineered into this fragment .
plasmid psvjs01 was assembled by inserting 2-kb fragment
into not i - linearised pbelobac11 vector by homologous recombination .
purified plasmid dna was amplified in dh10b e. coli strain and correct
cloning of inserts was confirmed by restriction pattern on agarose gel electrophoresis
( data not shown ) .
denv-3 genome was amplified from independent isolated cdna
clones in five overlapping subgenomic fragments .
all five fragments required to produce
denv-3 infectious clone along with not i - linearised psvjs01 vector were
introduced into yph252 yeast strain by electroporation and a full - length infectious
clone ( psvjs01-ic - denv-3 ) was assembly by homologous recombination .
sequence analysis
confirmed the successful construction of denv-3 infectious clone and identified one
silent mutation at position 9490 ( a9490 g ) in denv-3 coding region .
denv-3 genome
was amplified in five overlapping subgenomic fragments : f1 , f2 , f3 , f4 and f5 .
full - length denv-3 infectious clone was assembled into psvjs01 vector by
homologous recombination , generating psvjs01-ic - denv-3 .
a single
bam hi site was engineered and incorporated into denv-3
infectious clone sequence .
virus rescue and in vitro characterisation of transcript - derived denv-3
- full - length pcr amplicons derived from psvjs01-ic - denv-3 # 3 were in vitro synthesised
and resulting rna transcripts were electroporated into bhk-21 cells .
cells expressing
denv-3 proteins were easily detected four days after electroporation with denv-3
full - length transcripts , as demonstrated by ifa ( fig .
were observed over time
clearly showing rna transcripts derived from psvjs01-ic - denv-3 # 3 are infectious in
bhk-21 cells . on day 8 ,
pronounced signs of cytopathic effect were visible in bhk-21
cell monolayers . in vitro characterisation by focus -forming assay of
the rescued virus showed no significant difference between wt - denv-3 ( fig .
transcript - derived denv-3 grew
slightly slowly than wt - denv-3 , but this difference was not statistically significant ( p
> 0.05 at each time point ) .
stability of the denv-3 infectious clone in yeast - in order to further
characterise denv-3 infectious clone , the genome stability of functional cdna clones was
examined in yeast .
recombinant clones were grown in drop - out ynb agar plates for 10
subsequent passages separated by three days interval each .
no alteration in growth
characteristics , colony morphology or coloration was observed during these passages .
rna
transcripts derived from denv-3 infectious clone after repeated passages of the plasmid
in yeast remained infectious upon transfection into bhk-21 cells , as shown in fig . 3b .
more importantly , sequence analysis
identified no additional mutation in the cloned genome , indicating denv-3 infectious
clone could be stably propagated in yeast for at least 10 passages .
construction and characterisation of a denv-3 replicon - denv-3
replicon was generated by an in - frame deletion removing almost the entire prm - e conding
region ( from nt 454-nt 2336 ) , as illustrated in fig .
2 . only the first six codons of prm and the last 26 codons of e were retained
in the replicon sequence , as previously described ( pang
et al .
denv-3 replicon was cloned into not
i - linearised psvjs01 as a set of five fragments by homologous recombination technique in
yph252 yeast strain , generating plasmid psvjs01-rdenv-3prme . as part of the cloning
strategy ,
a bam hi site was engineered into psvjs01-rdenv-3prme
sequence to serve as a genetic marker .
pcr amplification and digestion by restriction
enzyme confirmed the successful deletion of the target structural protein coding region
( data not shown ) .
full - length pcr product derived from psvjs01-rdenv-3prme was in vitro
transcribed and resulting denv-3 replicon transcript was electroporated in bhk-21 cells .
total rna was purified and replication of denv-3 replicon monitored by rt - pcr over time .
on day 3
6b , lane 2 ) , a band corresponding
to 1,646-bp in length was amplified by rt - pcr .
band size is coherent with the in - frame
deletion in denv-3 replicon ( fig .
6b , lane 3 ) ,
but the intensity of the band was much higher than observed on day 3 , showing denv-3
replicon is functional and capable of autonomous replication in bhk-21 cells .
this peak
in replication of denv-3 replicon on day 4 is consistent with published results in the
literature ( alcaraz - estrada et al .
however , replication of denv-3 replicon is transient and no pcr amplification was
observed on day 10 ( fig 6b , lane 4 ) .
digestion
of rt - pcr product from day 4 with bam hi ( lane 5 ) generated fragments
of 1,192-bp and 454-bp , confirming the genetic marker was retained in denv-3
replicon .
2schematic diagram for the construction of a dengue virus type 3 ( denv-3 )
replicon with the yeast shuttle vector psvjs01 .
denv-3 replicon was generated
by a polymerase chain reaction - mediated deletion into the structural proteins
coding region [ from nucleotide ( nt ) 454-nt 2336 ] .
denv-3 replicon was assembled
into psvjs01 vector by homologous recombination , creating psvjs01-rdenv-3prme .
a unique bam hi site was inserted into denv-3 replicon
sequence as a genetic marker .
3transcript - derived ic - dengue virus type 3 ( denv-3 ) # 3 protein expression in
bhk-21 cells analysed by immunofluorescence assay .
bhk-21 cells were
electroporated with in vitro transcribed rna from ic - denv-3 # 3 infectious
clone . on day 4 after electroporation ,
cells were fixed and incubated with a
polyclonal hyperimmune mouse ascitic fluid raised against group b flaviviruses ,
followed by an anti - mouse igg antibody conjugated to fluorescein
isothiocyanate .
images
were captured in a dmi 4000b inverted microscope ( leica ) with a 200x
magnification factor .
a : bhk-21 cells electroporated with transcript - derived
ic - denv-3 # 3 ; b : transcript - derived ic - denv-3 # 3 remains infectious after 10
repeated passages of the plasmid in yeast .
mosquito c6/36 cells were infected with either wild - type dengue virus type 3
( wt - denv-3 ) or transcript - derived ic - denv-3 # 3 . after removing the inocula ,
cells were
fixed and incubated with a polyclonal hyperimmune mouse ascitic fluid raised
against group b flaviviruses , followed by a horseradish peroxidase - conjugated
recombinant protein g. foci were developed by adding
3-amino-9-ethylcarbazole substrate .
a : wt - denv-3 foci in
mosquito c6/36 cells ; b : transcript - derived ic - denv-3 # 3 foci
in mosquito c6/36 cells .
fig .
5transcript - derived ic - dengue virus type 3 ( denv-3 ) # 3 and wild - type
( wt)-denv-3 growth kinetics in mosquito c6/36 cells .
mosquito c6/36 cells were
infected in duplicate at multiplicity of infection ( moi ) of 0.1 with wt - denv-3
or transcript - derived denv-3 .
a sample of the supernatant of infected cells was
collected daily and virus titres were determined by titration in mosquito c6/36
cells .
no statistically significant difference in virus titre ( p > 0.05 ) was
found between the viruses at different time points .
a : wt - denv-3 growth curve
in mosquito c6/36 cells ; b : transcript - derived ic - denv-3 # 3 growth curve in
mosquito c6/36 cells ; ffu : focus -forming unit .
6kinetics of dengue virus type 3 ( denv-3 ) replicon rna synthesis in
transfected bhk-21 cell .
a unique bam hi site was inserted
into denv-3 replicon sequence during molecular cloning and used as a genetic
marker .
a : schematic diagram of rdenv-3prme in - frame deletion and genetic
marker analysis ; b : at different time points , total rna was purified from
bhk-21 cells transfected with rdenv-3prme replicon . an 1,646-bp fragment
spanning the bam hi site was amplified by reverse
transcription - polymerase chain reaction ( rt - pcr ) on day 3 ( lane 2 ) and 4 ( lane
3 ) and analysed on agarose gel electrophoresis .
the rt - pcr product on day 4 was
digested with bam hi ( lane 5 ) generating fragments of 1,192-bp
and 454-bp .
no amplification was observed on day 10 ( lane 4 ) . an 1 kb plus dna
ladder ( invitrogen ) was loaded on lane 1
; mw : molecular weight ; ns :
nonstructural ; utr : untranslated region .
flaviviruses research has experienced a remarkable progress by the advent of reverse
genetics systems in the past decades . however , obtaining flavivirus infectious clones
has not been an easy task .
the single most reported hurdle in the establishment of these
systems is an inherent instability of flavivirus genome in e. coli (
pu et al .
2011 ) . in this paper , the
successful construction and characterisation of a complete reverse genetics system for
denv-3 has been described .
infectious cdna clone methodology has been developed for all four denv
serotypes and other major flaviviruses , but most systems utilised established strains or
laboratory - adapted clinical isolates as parental virus . even though the value of these
studies is unquestionable , it is important to point out the need to expand this
methodology for low passage clinical isolates to gain a complete picture in flavivirus
biology , particularly in virus pathogenesis , virulence determinants and vector
competence ( ubol et al . 2008 , tuiskunen et al . 2011 , cox et al . 2012 ) .
our strategy employed the use of homologous recombination in yeast cells to assemble
denv-3 infectious clone and replicon .
yeast strains are versatile and convenient cloning
hosts , frequently used in the construction of reverse genetics systems for denv ( polo et al .
homologous recombination in yeast is also a
simple and robust method with higher cloning efficiency when compared to standard
cloning procedures in e. coli ( gibson
2009 , shanks et al .
we have
also demonstrated the utility of psvjs01 vector for stable propagation of denv-3 genome
in yeast .
several reverse genetics systems were established using low - copy plasmid or
bac vectors in an effort to lower plasmid copy number in e. coli and ,
as consequence , achieve stability of cloned genomes . in a previous attempt , we were only
able to recovery a denv-3 infectious clone by an in vitro ligation strategy using the
pbsc shuttle vector ( jjs santos & lhvg gil , unpublished observations ) . despite this
2006 ) , pbsc vector carries a 2 m high copy number origin of
replication .
we hypothesised that reducing plasmid copy number in yeast using a
chromosome - derived origin of replication would allow the successful assembly of a
full - length denv-3 infectious clone .
( 2011 ) , no silent
mutations were necessary to be introduced to circumvent sequence instability and
recovery a functional infectious clone .
rna transcripts derived from denv-3 infectious
clone were infectious upon transfection into bhk-21 cells .
transcript - derived denv-3
exhibited growth kinetics , focus formation and size comparable to
wt - denv-3 in mosquito c6/36 cell culture .
of paramount importance , rna transcripts
remained infectious even after repeated passages of the plasmid in yeast .
the long - term
stability of many infectious clones previously described remains largely undetermined
after serial passages of the cloned genome in the harbouring host .
only few reports have
more closely investigated this stability of continuing propagated flavivirus infectious
clones ( hurrelbrink et al .
most of their assessment relies on virus rescue
from or restriction pattern of passaged plasmid .
our work went one step further showing
not only the ability of rescuing virus , but also that the nucleotide sequence of denv-3
viral genome remain unchanged after successive passages of the plasmid in yeast .
we
used an approach previously described for a denv-2 replicon by selectively removing
almost the entire prm - e coding region ( pang et al .
denv-3 replicon was also easily assembled into psvjs01 shuttle vector .
in vitro characterisation of denv-3 replicon
, we describe an alternative and effective strategy to bypass flavivirus
genome instability commonly observed in e. coli by using homologous
recombination in yeast and a newly designed psvjs01 vector .
this reverse genetics system
will be a valuable tool for studying the molecular mechanisms involved in viral genome
replication , virion assembly , virus pathogenesis and vaccine development . | dengue virulence and fitness are important factors that determine disease outcome .
however , dengue virus ( denv ) molecular biology and pathogenesis are not completely
elucidated .
new insights on those mechanisms have been facilitated by the development
of reverse genetic systems in the past decades .
unfortunately , instability of
flavivirus genomes cloned in escherichia coli has been a major
problem in these systems . here
, we describe the development of a complete reverse
genetics system , based on the construction of an infectious clone and replicon for a
low passage denv-3 genotype iii of a clinical isolate .
both constructs were assembled
into a newly designed yeast- e. coli shuttle vector by homologous
recombination technique and propagated in yeast to prevent any possible genome
instability in e. coli .
rna transcripts derived from the infectious
clone are infectious upon transfection into bhk-21 cells even after repeated passages
of the plasmid in yeast .
transcript - derived denv-3 exhibited growth kinetics ,
focus formation size comparable to original denv-3 in mosquito
c6/36 cell culture . in vitro characterisation of denv-3 replicon confirmed its
identity and ability to replicate transiently in bhk-21 cells .
the reverse genetics
system reported here is a valuable tool that will facilitate further molecular
studies in denv replication , virus attenuation and pathogenesis . |
several observations of the coexistence of endometriosis
and cancer have been published [ 1 , 2 ] .
we report a case of clear cell adenocarcinoma
derived from
pathologically confirmed endometriosis in the abdominal wall .
we discuss the
epidemiological and clinicopathological features of malignancy arising in
abdominal wall endometriosis .
a 49 year - old woman ,
gravida 3 , para 0 , underwent a myomectomy , 20 years before , for uterus
leiomyoma through a midline incision .
she is presented with a painful large abdominal wall
mass . on physical examination , a firm indurated mass was palpated in the lower
abdominal wall .
abdominal and pelvic ultrasounds followed by computed tomography showed a
heterogeneous intramuscular mass of 8.5 cm diameter without local extension ( figure
1 ) .
the clinical impression was of desmoid tumor and the patient taken to
surgery and the tumor was resected without rupture .
the surgeon did not perform
any peritoneal washing or biopsies because of the absence of widespread tumor
in the peritoneal cavity .
the surgical specimen consisted of 11 cm cutaneous and
muscular tissues , occupied by ill - defined white tumor , which contained cystic
cavities and abundant foci of necrosis .
microscopically , the tumor showed a predominant papillary and tubulocystic
growth pattern ( figure 2 ) .
the tumor cells were round or polygonal most with
hobnail configuration ( figure 3 ) .
benign
endometriotic foci were observed in the proximity of the tumor ( figure 4 ) .
immunohistochemically ,
tumor cells showed diffuse and strong cytoplasmic positivity with vimentin ,
epithelial membrane antigen , and cytokeratin 7 , but no staining for cytokeratin
20 progesterone and estrogen receptor .
the diagnosis of
clear cell adenocarcinoma arising from abdominal endometriosis foci was
retained .
ultrasound and computed
tomography showed a recurrent mass at the abdominal wall with extension to the
bladder .
three cycles of combination chemotherapy with cyclophosphamide and cisplatin
were given , but the tumor did not regress .
she underwent surgery again with a
resection of 5 cm encapsulated nodule . at that time ,
three cycles of chemotherapy were also given but
failed to control the disease ; the chemotherapy she got is not precised .
the
computed tomography showed again a recurrent mass with extension to the bladder
and pelvic bone , and adjuvant radiotherapy was indicated .
endometriosis ,
defined as the presence of endometrial - like tissue outside the uterine cavity ,
is usually located in the ovaries and pelvic peritoneum [ 2 , 3 ] .
parietal
endometriosis is very rare and constitutes 1 to 2% of endometriosis cases .
it arises usually in a surgical scar of cesarean section or hysterectomy , and
less frequently in a surgical scar of hernia or of appendicectomy [ 1 , 4 ] . cases
of endometriosis without scar have been described .
the incidence of
abdominal wall endometriomas is of 0.04% among
parturients undergoing cesarean section and it is more frequent than
endometriosis following conventional gynaecologic surgery [ 4 , 5 ] . in our case ,
the etiopathogenetic mechanism is more likely related to iatrogenic
transplantation of endometrium during gynecological surgery rather than hematogenous
dissemination or metaplasia [ 4 , 6 ] .
women with pelvic endometriosis have a higher frequency of malignancy , but
malignant change in extrapelvic endometriosis is a rare event [ 1 , 2 , 4 , 7 ]
.
twenty percent of malignancy in endometriosis occurs in extragonadal site [ 1 , 8 , 9 ] .
there is extensive clinicopathological , molecular , and genetic evidence
supporting the hypothesis that endometriosis is a neoplastic process with a
potential for malignant transformation .
the natural course of malignant
transformation of endometriosis is long and can be explained by estrogenic
stimulation [ 8 , 1012 ] .
malignant
transformation
in endometriosis was first described by sympson in 1925 in
, who
proposed three criteria for diagnosis : demonstration of a clear example of the
endometriosis in proximity to the tumor , no other primary site for the tumor ,
and histologic appearance consistent with an origin from endometriosis .
scott
in [ 1 , 8 ] recommended the presence of transitional area between endometriosis and
cancer .
atypical endometriosis , a term first coined by lagrenade and silvergerg
in 1988 in [ 8 , 13 ] , is rare and is characterized by endometriotic glands with cytological
and/or architectural atypia ( hyperchromatic or pale nuclei with moderate to marked
pleomorphism increased nuclear to cytoplasmic ratio , cellular crowding , stratification ,
or tufting ) .
fukunaga et al . demonstrated that atypical endometriosis in ovary is
often associated with epithelial neoplasm and showed direct transition from
atypical epithelium to malignant tumor . in our case , the criteria of sympson
were fully satisfied .
the demonstration of endometriosis might require the
examination of multiple levels and sections , that is why preoperative biopsy can not
make the diagnosis of malignancy arising in endometriosis .
tumors that can
arise in endometriosis include in decreasing order : endometrio i d carcinoma
( 75.969.1% ) , sarcoma
( 2511.6% ) , clear
cell carcinoma ( 13.54.5% ) , and
mucinous or serous carcinoma ( 4.6%1% ) . in
extrapelvic localization ,
clear cell carcinoma is the most common histological
subtype , followed by endometrioid carcinoma . due to the rarity of malignant
transformation of endometriosis at extragonadal sites , it is difficult to
establish a treatment protocol .
first - line treatment is surgery , removing as
much endometriosis as possible , staging at this point is also necessary .
second - line treatment , with chemotherapy , radiotherapy , and even hormonotherapy
may be needed .
prognosis is variable from 10 to 100% five - year survival ,
depending on histological type and localization of the disease .
cutaneous
localization of endometriosis is unusual and appears most frequently in
surgical scars from obstetric or gynecological interventions .
it is important
to recognize the possibility of tumors arising from endometriosis when the
pathologist is confronted to an extraovarian tumor with endometrial appearance . | endometriosis is a frequent benign disorder . malignancy arising in extraovarian endometriosis is a rare event .
a 49-year - old woman is presented with a large painful abdominal wall mass .
she underwent a myomectomy , 20 years before , for uterus leiomyoma . computed tomography suggested that this was a desmoid tumor and she underwent surgery .
histological examination showed a clear cell adenocarcinoma associated with endometriosis foci .
pelvic ultrasound , computed tomography , and endometrial curettage did not show any malignancy or endometriosis in the uterus and ovaries .
adjuvant chemotherapy was recommended , but the patient was lost to follow up .
six months later , she returned with a recurrence of the abdominal wall mass .
she was given chemotherapy and then she was reoperated . |
breast cancer is the most common cancer in women worldwide . because of the lack of formal cancer registration in iran , there are no valid and reliable statistics about the incidence and mortality from breast cancer .
however , informal statistics show the incidence rate is about 24 and prevalence rate 120 per 100,000 women per year . considering the population of 35 million women in iran
it is realized that factors like age , race , ethnicity , and socioeconomic status can influence the incidence and mortality.[35 ] one of the most basic factors that can affect mortality from breast cancer is the stage of cancer disease that women are in when they present for medical care .
results of a study in iran showed that among 1500 women , 78.3% were at stage 2 or more at the first visit , which means they had at least one involved lymph node .
the most common reason that brought patients under medical attention was masses discovered in the breast .
another study found that among 2946 females with breast cancer , 76.8% were t2 or higher and 65.3% had positive lymph nodes and were in the last phase .
these findings indicate the vast majority of breast cancer patients in iran are diagnosed in advanced stages of the disease . while the chance of developing breast cancer increases as a woman gets older in western countries , raafat 's study revealed the mean age of iranian patients was about 49 years and 15% were under 40 years .
mean age at the time of disease emergence in iran is lower than in western countries .
this low age presentation of breast cancer among iranian women is likely related to race or low age at menarche and having an overall younger population than in developed countries .
breast cancer survival varies by the stage at diagnosis ; the later the stage of the disease at diagnosis , the lower the survival rate .
because of improvements in treatment , more women with breast cancer have been cured and the number of women dying due to breast cancer is decreasing .
however , many iranian women with breast cancer delay their first visit to a medical professional .
there is also lower compliance among iranian women for regular breast cancer testing and a lack of specific national breast cancer screening programs .
all of these factors result in often late breast cancer detection and subsequent increased mortality rate in this population .
it is therefore necessary to create interventions aimed at increasing adherence to breast cancer screening among iranian women .
when undertaking breast cancer screening behaviors , it is important that theoretically based factors are employed to maximize the impact of the intervention . the health belief model ( hbm ) has been used to explain factors influencing breast cancer screening behaviors and to plan and implement breast cancer screening programs in various populations.[41719 ] the hbm is based on the theory that a person 's willingness to change a health behavior is primarily due to the following factors : ( 1 ) perceived susceptibility ( i.e. , women 's opinion of the chances of getting breast cancer ) , ( 2 ) perceived severity ( i.e. , a person 's opinion of the seriousness of the condition ) , ( 3 ) perceived benefits ( i.e. , the opinion of the effectiveness of some advised action to reduce the risk , such as mammography ) , and ( 4 ) perceived barriers to having a mammography .
another model that can be applied to this research area is the stage of change model ( scm ) which includes the stages of change that a person moves through when adopting a behavior .
the scm framework proposes that individuals move through a temporal sequence of five stages : pre - contemplation ( never having a mammogram and not planning to get one within the next 12 years ) , contemplation ( never having a mammogram but intends to get one within the next 12 years ) , action ( having one mammogram on schedule and intends to get another on schedule ) , maintenance ( having at least two mammograms and intends to get another on schedule ) , and relapse ( having one or more mammograms but is now off schedule and does not plan to have a mammogram in the next 12 years ) .
many researchers have applied the scm to identify and promote breast cancer screening.[2125 ] although both these models offer unique theoretical strengths for studying breast cancer screening behaviors , few researchers have conducted theoretically based studies of iranian women 's participation in breast cancer screening behaviors such as mammography . therefore , the aims of the current study were to use hbm and scm constructs to examine : 1 ) associations between individual characteristics and stages of mammography behavior ; 2 ) relationships between the related beliefs ( perceived susceptibility , severity , benefits and barriers ) while controlling for socio - demographic factors and stages of mammography behavior associations ; and 3 ) socio - demographic factors and the health beliefs that predict stages of mammography behavior among a cluster random sample of iranian women .
we hypothesized that 1 ) there will be significant socio - demographic and belief differences in the women in each of the scm stages related to mammography and 2 ) the socio - demographic factors will predict stages of mammography behavior .
participants were from sanandaj , iran , which is a city with diverse socioeconomic status with 28 primary health care centers .
all health care centers were considered as clusters and 30 women were randomly selected from each .
if they were interested in participating , they were asked to sign an enclosed consent form and return it to the study investigators .
a total of 810 women had agreed to participate and a questionnaire was sent to them .
seventy - five women were excluded because they did not meet these criteria . of these 712 participants ,
23 cases with incomplete or missing data were deleted , yielding a final sample size of 689 .
the socio - demographic items included in the survey were age , marital status , employment status , educational status , family history of breast cancer , and health insurance .
the questionnaire used in the current study was based on champion 's revised health belief model scale ( chbms ) .
the chbms was tested in a previous study to assess perceived severity and susceptibility to mammography , with the cronbach 's alpha reliability coefficients 0.82 and 0.84 , respectively , in iranian women .
further , the cronbach 's alpha coefficients were 0.72 and 0.73 for the perceived benefits and barriers , respectively .
belief statements were rated on a 5-point scale ( 1=not at all sure to 5=very true ) and scored by calculating the means of all item scores . perceived benefits of mammography
are defined as positive or reinforcing aspects of getting mammography and were measured on 6-items scale .
perceived barriers refer to real or imagined impediments that prevent , or make participation in mammography difficult and were measured by a 10-item instrument .
perceived susceptibility reflects individuals feeling of personal vulnerability to chances of a specific health problem .
stage of mammography ( som ) adoption was assessed by an adapted measure recommended by rakowski et al .
the test retest reliability of the staging algorithm in the current study within a 2-week interval was 0.94 ( n=48 ) .
the women were classified based on frequency and regularity of current screening behavior and future intention to get mammography as follows : pre - contemplation : never had a mammogram and not planning to get one within the next 12 years .
contemplation : never had a mammogram but intends to get one within the next 12 years .
action : had one mammogram on schedule and intends to get another on a time frame that will keep the women on schedule .
maintenance : had at least two mammograms on schedule and intends to get another on a time frame that will keep the women on schedule .
relapse : had one or more mammograms in the past but is now off schedule and does not plan to have a mammogram within 12 years . the statistical package for the social sciences ( spss )
version 16 was used for all statistical analyses . in order to test hypothesis 1 ,
chi - square tests were used to examine associations between stage of mammography adoption and socio - demographic factors .
one - way analysis of covariance ( ancova ) which considered socio - demographic variables as covariates was used to assess differences in the outcome variables ( perceived severity , susceptibility , benefits , and barriers ) across the stages with tukey
kramer tests to identify the stage differences of the outcome variables . to test multivariate relationships ,
we used the pre - contemplation stage as the reference group to compare separately with contemplation , relapse , action , and maintenance stages .
outcome variables and socio - demographic factors were entered independently into the multinomial logistic regression .
participants were from sanandaj , iran , which is a city with diverse socioeconomic status with 28 primary health care centers .
all health care centers were considered as clusters and 30 women were randomly selected from each .
if they were interested in participating , they were asked to sign an enclosed consent form and return it to the study investigators .
a total of 810 women had agreed to participate and a questionnaire was sent to them .
seventy - five women were excluded because they did not meet these criteria . of these 712 participants ,
23 cases with incomplete or missing data were deleted , yielding a final sample size of 689 .
the socio - demographic items included in the survey were age , marital status , employment status , educational status , family history of breast cancer , and health insurance .
the questionnaire used in the current study was based on champion 's revised health belief model scale ( chbms ) .
the chbms was tested in a previous study to assess perceived severity and susceptibility to mammography , with the cronbach 's alpha reliability coefficients 0.82 and 0.84 , respectively , in iranian women .
further , the cronbach 's alpha coefficients were 0.72 and 0.73 for the perceived benefits and barriers , respectively .
belief statements were rated on a 5-point scale ( 1=not at all sure to 5=very true ) and scored by calculating the means of all item scores . perceived benefits of mammography
are defined as positive or reinforcing aspects of getting mammography and were measured on 6-items scale .
perceived barriers refer to real or imagined impediments that prevent , or make participation in mammography difficult and were measured by a 10-item instrument .
perceived susceptibility reflects individuals feeling of personal vulnerability to chances of a specific health problem .
stage of mammography ( som ) adoption was assessed by an adapted measure recommended by rakowski et al .
the test retest reliability of the staging algorithm in the current study within a 2-week interval was 0.94 ( n=48 ) .
the women were classified based on frequency and regularity of current screening behavior and future intention to get mammography as follows : pre - contemplation : never had a mammogram and not planning to get one within the next 12 years .
contemplation : never had a mammogram but intends to get one within the next 12 years .
action : had one mammogram on schedule and intends to get another on a time frame that will keep the women on schedule .
maintenance : had at least two mammograms on schedule and intends to get another on a time frame that will keep the women on schedule .
relapse : had one or more mammograms in the past but is now off schedule and does not plan to have a mammogram within 12 years .
the statistical package for the social sciences ( spss ) version 16 was used for all statistical analyses . in order to test hypothesis 1 ,
chi - square tests were used to examine associations between stage of mammography adoption and socio - demographic factors .
one - way analysis of covariance ( ancova ) which considered socio - demographic variables as covariates was used to assess differences in the outcome variables ( perceived severity , susceptibility , benefits , and barriers ) across the stages with tukey
kramer tests to identify the stage differences of the outcome variables . to test multivariate relationships ,
we used the pre - contemplation stage as the reference group to compare separately with contemplation , relapse , action , and maintenance stages .
outcome variables and socio - demographic factors were entered independently into the multinomial logistic regression .
participants had a mean age of 55.72 ( sd=7.42 ) years ( range=4072 years ) ; 46.9% were single and 53.1% were married ( divorced or common - law is not an option in iran ) ; 53.6% did not work outside of the home ; 48.2% had less than a high school education , 32.7% had a high school education , and 19.2% had attended university . in terms of income , 10.45% perceived their income as bad or very bad , 23.8% as middle , and 65.75% as good or very good .
94.8% of the participants reported no history of family breast cancer and 18.4% were uninsured . among the 689 participants , 40.1% were in pre - contemplation stage , 34.7% in contemplation , 7.5% in relapse , 12% in action , and 5.7% in maintenance stage of mammography adoption
age groups , marital status , and health insurance were significantly associated with the stage of adoption ( p<0.001 ) .
there were more number of older women in the pre - contemplation stage ( 44.5% ) and action stage ( 16.7% ) compared with those in the other age groups .
the middle - aged ( 5059 ) women were more than the other two age groups in the maintenance stage ( 9.4% ) .
the youngest women were most likely to be in the relapse stage ( 19% ) .
bivariate relationships between participants socio - demographic factors and stage of mammography married women were more likely to be in the action stage compared to single women .
because age , marital status , and health insurance were significantly associated with the stage of mammography adoption , these variables were included as covariates in the ancova .
differences between stages of adoption were found for all psychosocial factors ( all p<0.001 ) .
the results of the ancova are presented in table 2 . as hypothesized , among the health beliefs variables , perceived susceptibility , severity , and benefits
were positively associated with the stage of adoption while perceived barriers were negatively associated with the stage of adoption .
it was found that the women in the relapse group had the lowest scores for perceived barriers , followed by the women in the maintenance group .
adjusted marginal means ( sd ) on perceived benefits , barriers , susceptibility , and severity for the five stages of mammography in addition , the relationships between demographic factors as covariates and health beliefs were examined .
health insurance was associated with higher perceived susceptibility , greater benefits , and lower barriers ( p<0.030.001 ) .
age and marital status were associated with higher perceived benefits , greater susceptibility , and fewer perceived barriers ( p<0.010.001 ) .
results of the multinomial logistic regression and pair - wise comparison across stages of mammography adoption on socio - demographic variables and the health beliefs are reported in tables 3 and 4 , respectively .
women were more likely to be in the maintenance stage than in the pre - adoption stage if they were in the middle age group ( 5059 years ) [ or=4.96 , 95% confidence interval ( ci)=1.8513.33 ] , than in the youngest age group ( or=1.98 , 95% ci=0.566.80 ) .
the younger women ( < 50 years ) compared to older women were about 26 times more likely to be in the relapse stage and the odds for middle age were about 9 times compared to women more than 60 years old .
married women had higher odds of being in the action group than in the pre - contemplation stage compared with single women ( 96% vs. 0.4% ) , although the odds of being in the maintenance stage were lower for married women ( 37% vs. 63% ) .
no significant differences were found across the stages of mammography adoption on employment status , education level , income level , family history of breast cancer , and health insurance except for those women with a family history of breast cancer , who were more likely in the maintenance than in the pre - contemplation stage ( 99% ) compared with those not having this family history .
odds of being in stage of mammography screening by socio - demographic factors odds of being in stage of mammography screening by health beliefs among the health beliefs examined , all were significantly different between stages ( p<0.040.001 ) .
those who were in relapse , action , and maintenance stages had higher perceived benefits and susceptibility scores than those in pre - adoption stages .
women in pre - adoption stages were 4 times in maintenance stage if they had lower perceived susceptibility ( p<0.001 ) .
women in maintenance , action , and relapse stages had lower barriers to mammography and were less likely to be in pre - contemplation stage . interestingly , the odds of being in adoption stages ( action and maintenance ) were no different than of women being in the relapse stage ( or=0.06 ) .
it means the odds of being in adoption or relapse stages compared to being in pre - adoption stages ( pre - contemplation , contemplation ) were higher for women with fewer barriers compared with those who had higher barriers to mammogram .
results of the multinomial logistic regression and pair - wise comparison across stages of mammography adoption on socio - demographic variables and the health beliefs are reported in tables 3 and 4 , respectively .
women were more likely to be in the maintenance stage than in the pre - adoption stage if they were in the middle age group ( 5059 years ) [ or=4.96 , 95% confidence interval ( ci)=1.8513.33 ] , than in the youngest age group ( or=1.98 , 95% ci=0.566.80 ) .
the younger women ( < 50 years ) compared to older women were about 26 times more likely to be in the relapse stage and the odds for middle age were about 9 times compared to women more than 60 years old .
married women had higher odds of being in the action group than in the pre - contemplation stage compared with single women ( 96% vs. 0.4% ) , although the odds of being in the maintenance stage were lower for married women ( 37% vs. 63% ) .
no significant differences were found across the stages of mammography adoption on employment status , education level , income level , family history of breast cancer , and health insurance except for those women with a family history of breast cancer , who were more likely in the maintenance than in the pre - contemplation stage ( 99% ) compared with those not having this family history .
odds of being in stage of mammography screening by socio - demographic factors odds of being in stage of mammography screening by health beliefs among the health beliefs examined , all were significantly different between stages ( p<0.040.001 ) . those who were in relapse , action , and maintenance stages had higher perceived benefits and susceptibility scores than those in pre - adoption stages .
women in pre - adoption stages were 4 times in maintenance stage if they had lower perceived susceptibility ( p<0.001 ) .
women in maintenance , action , and relapse stages had lower barriers to mammography and were less likely to be in pre - contemplation stage .
interestingly , the odds of being in adoption stages ( action and maintenance ) were no different than of women being in the relapse stage ( or=0.06 ) .
it means the odds of being in adoption or relapse stages compared to being in pre - adoption stages ( pre - contemplation , contemplation ) were higher for women with fewer barriers compared with those who had higher barriers to mammogram .
among the 689 participants , 75% were in pre - contemplation and contemplation stages of mammography adoption compared with only 17.5% in action and maintenance stages , leaving 7.5% in the relapse stage .
the low rate of mammography adoption behavior is consistent with previous research with iranian women .
aalvi found that even among female iranian gynecologists , only 27% had regularly mammogram testing .
another study showed 12% of women had gotten a mammogram within the previous 3 years .
low adherence to recommended screening behaviors has similarly been demonstrated in iranian women . when compared to other studies , iranian women were found to be less likely to be in maintenance and action stages than asian american , indian and filipino , cambodian , chinese , or chinese and filipino women .
this likely reflects greater acculturation to regular -mammography -testing than is found among iranian women .
we found that the stage distribution varied by age , marital status , and health insurance coverage .
the largest group in the pre - contemplation stage was the oldest women , which is likely to be due to cultural beliefs like not needing a routine mammogram done if one is old and related health beliefs to getting a mammogram done .
although older women were the most likely to be in the action stage , they also formed the lowest numbers in the maintenance stage .
the odds of being in the maintenance stage were more likely in the middle age , followed by the youngest women ( or=4.96 and 1.96 , respectively ) .
these findings could help with the creation of interventions tailored to encourage older women to progress toward maintenance stage .
the normative belief among iranians is that older women should spend more time on family issues rather than on themselves .
so , it would be helpful if other family members , such as husbands , were informed about the risk of developing breast cancer and the importance of regular mammogram screening to detect early diagnosis .
our results are similar to those reported for cambodian , korean , chinese , filipino american , and swiss women , but inconsistent with studies on chinese and korean immigrants who were not found to differ across stages by marital status . considering the high percent of married women in the action stage
, our results again suggest that spouses may be a useful source of social support .
the number of married women in the action stage dropped from 21 to 5% in the maintenance stage .
there is a need to motivate married women and their family members to adhere to regular mammography .
women with a history of breast cancer in their families compared to those without such history were more likely to be in the maintenance stage than in the pre - contemplation stage .
however , sometimes family history can create fear and apprehension to impede getting a mammogram done and it can become a barrier rather than a facilitator , although our findings do not support this idea . there is a need to further explore the cultural beliefs to find out why despite the positive perceived outcomes when breast cancer is diagnosed in an early stage , having a history becomes a barrier in some women .
unlike other findings , health insurance did not predict the stage of adoption for mammography.[222328 ] these results may be related to the difference in insurance coverage in iran compared to other countries .
there are several different types of insurance in iran that provide rather similar services , so we integrated them into one category .
further , even with insurance coverage , one must pay a high cost to visit a physician , so this issue may influence regular physician visits which will subsequently result in not receiving a physician 's recommendation for regular mammography .
in addition , insurance pays only a small part of mammography costs , so there is not a salient difference between insured and uninsured women in this regard .
the results proved our hypothesis that health beliefs will be related to the stage of adoption of mammography .
for women in the relapse stage , it seems that they retained their beliefs regarding mammography but did not act accordingly .
it is not clear if when one recycles to pre - adoption stages , beliefs undergo salient changes such as decreasing perceived threats and increasing barriers or if there are other factors influencing the health behaviors .
contrary to results from previous studies conducted in rural korea and on korean immigrants to the usa which reported that perceived susceptibility predicted the stage of mammography or recent mammogram , our findings were more similar to those of kathleen that there is not greater likelihood of being in action than in relapse stage due to perceived susceptibility .
it must be noted that perceived threat about developing breast cancer is an overall concept while risk appraisal goes beyond the perceived threat .
this may be a reason for there not being different perceived severity for women in the different stages .
there is a need to further explore the risk appraisal according to normative beliefs , characteristic culture , socio - demographic status , and access to effective screening and treatment services related to breast cancer among iranian women .
hbm and scm postulate that people will take action for healthy behavior if they believe in the efficacy of action and if the barriers are outweighed by perceived positive outcomes .
contrary to these hypotheses , our results did not show any significant differences between those who were in relapse and action stages given perceived benefits , but differed between pre - adoption and adoption stages as reported by other researchers.[17283335 ] the women in the maintenance stage even had lower benefits than those in the relapse and action stages . according to scm
, all beliefs will not differ by stage , as supported by our results ; women in the relapse stage reported the highest perceived benefits to getting a mammogram done than the women in all other stages .
there is the possibility that despite someone not acting on a recommended health behavior , they still may acknowledge and express the benefits of that behavior .
the odds were greater in the adoption than in the pre - adoption stages when adding the perceived benefits , as reported in other studies .
women in the relapse stage had the lowest barriers compared to those who were in action and maintenance stages .
the prior experiences with getting a mammogram done may have influenced the current and future intentions and attitudes related to breast cancer screening .
it may be that women in the relapse stage experienced some barriers like pain , embarrassment , or fear .
these feelings may have been normalized explaining why women in the relapse stage had lower perceived barriers than those in the adoption stages . except those who were in the relapse stage , there were important differences between pre - contemplators and those in the adoption stages related to perceived barriers to getting a mammogram done .
similar to other findings , our results revealed that when stages progress from early to advanced , perceived barriers decreased .
the findings of the current study indicate that women in the relapse stage reported the highest perceived benefits , rather higher perceived susceptibility , severity , and the lowest barriers .
it is a unique finding that needs further research to detect the other factors that may impact having a regular mammogram .
for example , interpersonal influences including social support , exposure to models , and interpersonal norms are likely to be important correlates , particularly within the iranian cultural context
. it must be realized which specific changes at an item level regarding perceived beliefs predict progress across stages .
for example , if a woman in the pre - adoption stages declares that getting a mammogram done is painful , it means this belief is influenced by vicarious learning rather than her own prior experience . exploring item - level beliefs would help to plan and conduct effective interventions tailored to the stage of mammography adoption .
this study provides the first test of the associations between stages of mammography adoption based on scm combined with selected aspects of the hpm among iranian women .
results indicate differences across stages of change were found for related beliefs , and also for current and future intentions for all participants , except for those in the relapse stage .
thus , iranian women in the relapse stage of mammography do not significantly differ in beliefs , but in their intention to getting a mammogram done compared to women in the action and maintenance stages .
given the lack of population - based mammography and clinical breast exam screening programs , the rate of relapse as well as the low adherence to regular screening behavior for breast cancer among the women in this sample and other iranian women , there is a need to conduct further research in theoretically based interventions designed to decrease relapse , especially in younger iranian women .
if the intervention programs achieve success to keep the same number in the adoption stages and prevent relapse , it is worth it .
further , it is important to understand why older women are less likely to maintain the behavior .
it is important that the distinction between perceived related beliefs to mammography according to age is better understood .
therefore , intervention programs aimed at increasing mammogram behavior must be tailored to the stage of change , age , and other socioeconomic factors . | objective : despite evidence that screening for breast cancer is effective , adherence with screening recommendations in iranian women is low . the purposes of this study were to ( 1 ) identify the associations between individual characteristics , related health beliefs , and stages of mammography behavior and ( 2 ) examine the socio - demographic factors and the health beliefs that predicate stages of mammography behavior.design:all health care centers were considered as clusters and 30 women were randomly selected from each of them .
a sample of 689 iranian women completed a questionnaire.materials and methods : the questionnaire used was based on champion 's revised health belief model scale ( chbms ) .
one - way analysis of covariance ( ancova ) was used to assess differences in the outcome variables ( perceived severity , susceptibility , benefits , and barriers ) across the stages .
multinomial logistic regression was conducted to test multivariate relationships.results:the percentage of participants in each stage was : 40.1% in pre - contemplation , 34.7 in contemplation , 7.5% in relapse , 12% in action , and 5.7% in maintenance stage of mammography adoption .
older women were most likely to be in the pre - contemplation stage and action stage , and the youngest women were most likely to be in the relapse stage .
differences across stages of change were found for related beliefs for all participants except those in the relapse stage.conclusion:iranian women are less likely to be in maintenance and action stages than ot er asian women and this study identifies constructs that may be targeted in interventions . |
glucose-6-phosphate dehydrogenase ( g6pd or g6pdh ) deficiency was first identified by dr . ernest beutler in 1953 .
it is an x - linked recessive hereditary disease characterized by abnormally low levels of g6pd , a metabolic enzyme involved in the pentose phosphate pathway , especially important in red blood cell metabolism .
g6pd deficiency is a prime example of a hemolytic anemia ( ha ) due to interaction between an intracorpuscular and an extracorpuscular cause , because in the majority of cases hemolysis is triggered by an exogenous agent .
thus , the acute ha of g6pd deficiency is largely preventable by avoiding exposure to triggering factors of previously screened subjects .
g6pd deficiency is the most common human enzyme defect , yet , there has been no reported case of g6pd deficiency associated with pancytopenia and bone loss .
a 34-year - old female patient prediagnosed with g6pd deficiency complaining of gingival swelling and bleeding since 9 years and progressive spacing between maxillary and mandibular anterior teeth reported to the outpatient department of periodontology of the college .
history dates back to the year 2002 when the patient developed some bleeding complications during her pregnancy and was admitted in the hospital . during her stay in the hospital , the patient showed signs of petechiae and ecchymosis on the extremities .
it was then that she was diagnosed with aplastic anemia / pancytopenia with hypocellular bone marrow and g6pd deficiency .
her platelet count kept decreasing and at the time of delivery her platelet count was 5000 only .
the patient was then hospitalized for another 6 months after delivery during which her physical condition and her platelet count improved . since then the patient experienced gingival swelling and bleeding and progressive spacing between her upper and lower anterior teeth .
she visited several general dentists but because of her underlying medical problem she was refused treatment by some while some provided her oral prophylaxis on her written consent .
she developed some improvement in the oral condition but finally she was referred to the department of periodontology of the college for expert opinion .
intra - oral examination showed signs of gingival inflammation , the changes being more pronounced in the maxillary and mandibular anterior region .
the gingiva was dark pink , edematous , and enlarged with rolled and rounded margins with less pronounced scalloping .
also , gingival recession and clefting was present on the palatal aspects of maxillary anterior teeth [ figures 1 and 2 ] .
preoperative photograph showing papillary swelling and inflammation preoperative palatal view of maxillary arch showing clefting and inflammation of marginal gingiva and petechiae on palatal surface radiographically , generalized bone loss was evident which was more pronounced in the maxillary and mandibular anterior region [ figure 3 ] .
preoperative opg showing bone loss mainly in upper and lower anterior teeth clinically , deep periodontal pockets were present in the maxillary and mandibular anterior teeth on probing using a periodontal probe with willams markings .
g6pd deficiency , resulting from mutations in the g6pd gene , is well known in humans as a common cause of pathology , specifically of ha .
all mutations that cause g6pd deficiency are found on the long arm of the x chromosome , on band xq28 . in many of these mutants ,
g6pd deficiency is not extreme and the clinical manifestations are limited , as they occur only when an exogenous agent triggers hemolysis .
the clinical picture can develop upon ingestion of fava beans ( favism ) , during the course of infection , or after exposure to certain oxidative agents .
g6pd - deficient red blood cells ( rbcs ) are more susceptible to oxidative stress and have a shorter lifespan .
if a considerable proportion of hemolysis takes place in the spleen , as is often the case , splenomegaly may become a prominent feature and hypersplenism may develop , with consequent neutropenia and/or thrombocytopenia resulting in pancytopenia .
oral changes include pale discoloration of the oral mucosa , increased susceptibility to infections , and bleeding spontaneously or on slightest provocation .
gingival tissues represent an abnormal response to local irritation , the severity of which is dramatically alleviated by the removal of local irritant .
studies have shown that accumulation of microbial biofilm , dental plaque , on tooth surfaces results in the development of an inflammatory process around gingival and periodontal tissues leading to their breakdown .
also , increase in number of certain anaerobic bacteria in subgingival plaque due to hormonal changes occurs in pregnancy .
moreover , maternal immune system is suppressed during pregnancy . thus , pregnancy and pancytopenia followed by hospitalization deteriorated the oral tissues of the patient .
lack of proper dental treatment by the general dentists due to the patient 's underlying medical condition for about 9 years further exacerbated the oral problem of the patient to the present status .
the treatment in the present scenario included proper oral prophylaxis , soft tissue debridement and surgical therapy after consultation and clearance from the hematologist and written consent from the patient .
special care was taken regarding her current blood profile including all the relevant blood tests and individual cell counts , which were discussed in detail with her hematologist .
all the drugs that are contraindicated in g6pd - deficient patients were avoided [ table 1 ] and only those drugs which are safe in g6pd - deficient patients were given [ table 2 ] .
drugs and chemicals that should be avoided by persons with g6pd deficiency some common drugs that can be safely administered in therapeutic doses to glucose-6-phosphate dehydrogenase - deficient subjects without nonspherocytic hemolytic anemia the surgical therapy included open flap debridement and regenerative periodontal therapy wherever required and possible .
the postoperative presentation included resolution of the patient 's symptoms of gingival bleeding and swelling .
the clinical presentation shows reduction in the signs of gingival swelling , with reduction in size of tissues , reduction in probing depths and a significant gain in clinical attachment levels .
there was no bleeding on probing and the signs of gingival inflammation were also resolved [ figures 46 ] . | glucose-6-phosphate dehydrogenase ( g6pd ) deficiency is the most common enzyme defect in humans .
g6pd deficiency is widely distributed in tropical and subtropical parts of the world and a conservative estimate is that at least 500 million people have a g6pd deficient gene . in several of these areas , the frequency of a g6pd deficiency gene may be as high as 20% or more .
the vast majority of people with g6pd deficiency remain clinically asymptomatic throughout their lifetime
. however , all of them have an increased risk of developing neonatal jaundice and a risk of developing acute hemolytic anemia when challenged by a number of oxidative agents .
the most important treatment measure is prevention : avoidance of the drugs and foods that cause hemolysis . |
vibrio cholerae is a curved , rod - shaped , gram - negative bacterium that causes the severe diarrhoeal disease cholera .
two major virulence factors of v. cholerae are cholera toxin ( ct ) and an intestinal colonization factor known as the toxin coregulated pilus ( tcp ) .
recent studies show that v. cholerae has developed a survival strategy to grow and survive inside the free - living amoeba acanthamoeba castellanii [ 13 ] .
vibrio cholerae responds to environmental changes by altering the protein composition of its outer membrane ( om ) .
this om is composed of protein and lipopolysaccharide ( lps ) [ 4 , 5 ] .
however , it has been found that ompa of v. cholerae shares 47.8% similarity with that of escherichia coli .
ompa is a -barrel protein in the membrane and is highly conserved among gram - negative bacteria .
it is expressed to very high levels and is tightly regulated at the posttranscriptional level . it can function as an adhesin and invasin , participate in biofilm formation , act as both an immune target and evasin , and serve as a receptor for several bacteriophages [ 7 , 8 ] .
it has been shown that e. coli utilizes ompa for adhesion to hela epithelial cells and caco-2 colonic epithelial cells .
the vesicles contain outer membrane proteins , lipopolysaccharides , and phospholipids and , as they are being released from the surface , the vesicles entrap some of the underlying periplasm .
they can deliver toxins and other virulence factors to the host at relatively high concentrations , without requiring close contact between the bacterial and target human cells , and are believed to represent a key factor in effecting an inflammatory response in the host to bacterial pathogens [ 1116 ] .
omvs are released by gram - negative bacteria as a novel stress response [ 14 , 17 ] , whereas outer membrane proteins ( omp ) play a major role in adherence to mucosal membrane in the small intestine and possible protective antigens .
the aim of this study was thus to examine the role and influence of ompa and omvs in the survival of v. cholerae alone and its interaction with a. castellanii .
the bacterial strains used in this study were wild - type vibrio cholerae strain a1552 o1 el tor inaba and its ompa mutant by internal in - frame deletion of ompa gene , kindly provided by dr
it has been proven that the ompa mutant bacterium fails to produce ompa protein , unlike the wild - type strain .
acanthamoeba castellanii was obtained from the american type culture collection ( atcc 30234 ) , manassas , va , usa .
v. cholerae strains were stored frozen in luria - bertani ( lb ) medium with 15% glycerol at 80c .
both bacterial strains were grown overnight at 37c on lb plates and thereafter in lb broth , with shaking to an absorbance600 of 0.6 .
a. castellanii was grown without shaking at 30c to a final concentration of 10/ml in atcc medium number 712 .
axenically maintained amoebae were grown at 30c to a final concentration of 2 10 cell / ml in atcc medium , as described above .
cocultivations of v. cholerae with a. castellanii were incubated in nunc tissue culture flasks ( 75 cm ) purchased from vwr international ( stockholm , sweden ) .
each flask contained 50 ml atcc medium 712 containing a. castellanii at a concentration of 2 10 cell / ml and the particular v. cholerae species at a concentration of 2 10 cell / ml .
control flasks containing bacteria or amoebae only were prepared in the same way and with the same initial concentration as the coculture flasks .
samples were taken and plated on blood agar plates regularly to study the growth and survival of v. cholerae .
broth cultures were then centrifuged at 8,000 g ( 30 min , 4c ) in a ja-25.50 rotor ( beckman instruments inc . ) . filtered ( 0.22 m ; millipore ) supernatants were centrifuged at 85,000 g ( 2 h , 4c ) in a 70 ti rotor ( beckman instruments inc . ) to collect omvs .
pellets were washed twice with pbs , suspended in pbs to a total volume of 500 l , and used as the omvs preparation .
concentration of total protein in the om vesicles was measured spectrophotometrically by the bradford assay ( bio - rad ) .
the effect of outer membrane vesicles on the viability of a. castellanii was examined by incubation of 50 l amoeba cell suspension containing 10 cell / ml with 50 l om vesicle preparation from each bacterial strain or with 50 l bps for controls .
triplicate experiments were performed and the viability of amoebae was examined after 2 hours by viable count utilizing erythromycin b stain ( atcc ) .
cocultures of the v. cholerae a1552 and ompa mutant strains with a. castellanii were incubated in 75 cm cell culture flasks containing 50 ml atcc medium number 712 with an initial concentration of 10 cells of a. castellanii / ml and 10 cells of each v. cholerae strain / ml . the flasks were incubated without shaking at 30c and samples were withdrawn after 1 h to determine the percentage of bacteria adhering to the amoeba cells .
this was done by dividing the number of amoebae with adhered bacteria by the total number of amoebae with and without adhered bacteria and multiplying by 100 .
the ability of a. castellanii to take up v. cholerae a1552 strains and the effect of the ompa mutant on uptake and intracellular growth of the bacterial strains were examined by comparing the interactions of wild - type a1552 and ompa mutant with the amoebae .
cocultures of each bacterial strain with a. castellanii were incubated in 75-ml cell culture flasks containing 50 ml atcc medium number 712 with an initial concentration of 10 cells of a. castellanii / ml and 10 cells of each bacterial strain / ml .
the flasks were incubated without shaking at 30c for 2 h. each cell suspension was centrifuged for 10 min at 300 g in a labofuge gl centrifuge ( vwr international ) and washed six times in pbs to remove nonadhered extracellular v. cholerae .
the samples were then diluted in 9 ml pbs and centrifuged for 10 min at 300 g. each pellet was resuspended in a volume of 50 ml atcc medium in a 75 cm culture flask to analyse uptake , intracellular growth , and survival of v. cholerae strains .
a 1 ml portion from each flask was centrifuged for 10 min at 300 g and each pellet was diluted twofold with 0.1% sodium deoxycholate to permeabilize the amoeba cells .
a series of 10-fold dilutions of the sample from 10 to 10 was prepared and spread on blood agar plates .
all plates were incubated overnight at 37c , and viable counts were performed for the engulfed bacteria .
the reculture flasks were incubated without shaking at 30c to investigate the intracellular growth and survival of v. cholerae strains using a gentamicin assay and by viable counts for 15 days .
to estimate adherence of v. cholerae wild - type and ompa mutant strain to amoeba cells , the percentage of each bacterial strain adhering to a. castellanii was determined and found to be 83.3 2.1% and 73.3 3.5% , respectively . the difference in adherence between the wild - type and ompa mutant of v. cholerae was not statistically significant ( t - test , p = 0.29 ) . to estimate growth and survival of the engulfed bacteria following gentamicin treatment and recultivation ,
the viable count of uptaken wild - type and ompa mutant of v. cholerae was 3.2 10 1.6 10 cell / ml and 4.0 10 5.0 10 cell / ml , respectively ( figure 1 ) .
the viable counts of intracellular wild - type and ompa mutant of v. cholerae after 2 hours were 1.7 10 1.2 10 cell / ml and 1.4 10 2.0 10 cell / ml , respectively , while after 24 hours they were 3.0 10 1.0 10 cell / ml and 1.5 10 5.0 10 cell / ml , respectively ( figure 1 ) .
the uptake and intracellular growth of the wild - type and ompa mutant v. cholerae were not significantly different ( t - test , p = 0.68 ) .
viable counts of wild - type and ompa mutant v. cholerae cultivated alone in the absence of a. castellanii showed 10-fold increases after 1 day for both .
surprisingly , the wild - type strain survived for only 3 days , while the ompa mutant of v. cholerae survived more than 2 weeks , with a viable count of 1.7 10 2.1 10 cell / ml at day 15 ( figure 2 ) .
the survival rates of the wild - type and ompa mutant of v. cholerae were significantly different ( t - test , p = 0.005 ) .
viable counts of wild - type and ompa mutant v. cholerae cocultivated with a. castellanii showed 10-fold increases after 1 day for both strains .
surprisingly , both wild - type and ompa mutant v. cholerae survived more than 2 weeks , but their viable counts were different ( 2.0 10 1.0 10 cell / ml and 4.1 10 2.6 10 cell / ml at day 15 , resp . ) ( figure 3 ) .
the presence of a. castellanii enhanced survival and growth of both wild - type and ompa mutant stains of v. cholerae ( figure 3 ) compared with that in the absence of a. castellanii ( figure 2 ) .
growth of the cocultivated wild - type and ompa mutant strains of v. cholerae differed significantly ( t - test , p = 0.0004 ) , with growth of the ompa mutant being higher than that of the wild - type strain ( figure 3 ) .
the number of viable a. castellanii alone and cocultivated with wild - type v. cholerae increased from 2.0 10 0.0 cell / ml to 1.8 10 4.2 10 and 9.3 10 1.8 10 cell / ml , respectively , after 15 days .
in contrast , the number of viable a. castellanii cocultivated with the ompa mutant v. cholerae decreased from 2.0 10 0.0 cell / ml to 1.3 10 1.0 10 cell / ml after 15 days ( figure 4 ) .
cocultivation of the amoebae with v. cholerae strains showed that the growth rate of a. castellanii alone and in the presence of wild - type or ompa mutant v. cholerae was significantly different ( t - test , p = 0.00020 and p = 0.00024 , resp . ) .
however , the difference between the growth rate of a. castellanii cocultivated with wild - type or ompa mutant of v. cholerae was less significant ( p = 0.04 ) .
omvs were isolated from the wild - type and ompa mutant strains as described in section 2 .
the amount of vesicles released from the two strains was compared by measuring protein concentration , which was found to be 510 24 g / ml for the wild - type and 1550 51 g / ml for the ompa mutant strain ( figure 5 ) .
this difference in protein concentration was statistically significant ( t - test , p = 0.0001 ) .
treatment of the amoebae with bacterial vesicles showed that the omvs lowered the viability of the amoeba cells after 2 hours of incubation .
thus the viable count of a. castellanii incubated with omvs from wild - type v. cholerae , omvs from the ompa mutant strain , and pbs was 8.7 10 2.3 10 , 8.1 10 7.8 10 cell / ml , and 1.1 10 1.3 10 cell / ml , which represent 79% , 74% , and 100% viability , respectively ( figure 6 ) .
the viable count decreased significantly compared with the pbs treatment for the amoebae treated with omvs from ompa mutant v. cholerae ( t - test , p = 0.02 ) , but the decrease was less significant for the amoebae treated with omvs from wild - type v. cholerae ( t - test , p = 0.05 )
. however , this difference in amoeba viability might be due to the ability of the ompa mutant of v. cholerae to produce more omvs , as demonstrated here and by song et al . .
v. cholerae utilizes several survival strategies in aquatic environments , such as biofilm formation , switching from smooth to rugose colony morphotypes , and association with free - living amoebae .
studies have shown that v. cholerae has enhanced growth in association with a. castellanii [ 13 ] and both microorganisms have been detected in the same water samples from cholera endemic areas .
this study investigated the role of ompa protein and the outer membrane vesicles released by v. cholerae in survival and interaction of the bacterium with the eukaryotic host a. castellanii .
the results demonstrated that , in the absence of a. castellanii , the ompa mutant v. cholerae survived for much longer ( > 15 days ) than wild - type v. cholerae ( 3 days ) . in this context , loss of all cfu from wild - type v. cholerae cultivated in this rich medium in the absence of amoebae was observed not only in this paper but also previously for other bacteria such as francisella tularensis , shigella dysenteriae , and s. sonnei .
francisella and shigella species are facultative intracellular bacteria multiplying inside amoeba cells and remaining cultivable during the experiment time compared to the bacteria in absence of the amoebae that became noncultivable . moreover ,
interaction of the extracellular bacterium pseudomonas aeruginosa with a. castellanii showed that growth and survival of p. aeruginosa were the same during the experiment time whether the amoebae were present or absent .
however , v. cholerae o1 , v. cholerae o139 , and v. mimicus lost all cfu from the wild - types cultivated in absence of the amoebae from day 4 of cultivation [ 22 , 2426 ] and it was proven that v. cholerae died and did not enter the viable but nonculturable ( vbnc ) state after the loss of all cfu from the wild type .
the question is how the ompa mutant of v. cholerae survived longer than the wild - type strain . in the present study
, it was found that the ompa mutant of v. cholerae produced significantly more omvs than the wild - type strain , confirming previous findings by song et al . that the lack of ompa protein leads to production of more omvs .
an interesting observation in the present study was that significant production of omvs might have enriched the cultivation medium and supported longer survival of the mutant strain compared with the wild - type v. cholerae . to investigate the effect of omvs on the amoebae
, a. castellanii cells were incubated in a suspension of omvs isolated from each v. cholerae strain .
the viable counts demonstrated a decreased viability of a. castellanii in both cases ; this might indicate a virulence role of the omvs towards the amoebae , in agreement with other studies [ 7 , 27 ] .
interaction of v. cholerae strains with a. castellanii involves attachment of bacteria to the amoeba cells , engulfment , intracellular growth , and survival inside the amoebae .
the engulfment , intracellular growth , and intracellular survival of the wild - type and ompa mutant v. cholerae were not significantly different . in this context ,
abd et al . found that the capsule and lps o - side chain did not affect engulfment , intracellular growth , and intracellular survival of v. cholerae o139 when interacted with a. castellanii .
the results also showed that the presence of a. castellanii enhanced survival of both wild - type and ompa mutant strains of v. cholerae .
this was in agreement with previous findings that interaction of a. castellanii with wild - type v. cholerae o139 , the capsule mutant strain , and the capsule / lps double mutant strain enhanced survival of all these bacterial strains .
moreover , in spite of the fact that v. cholerae o1 el tor possesses a mannose - sensitive haemagglutinin fimbria and v. cholerae o1 classical does not , they have enhanced survival and their intracellular growth in a. castellanii is not significantly different .
all these facts may indicate that the intracellular behaviour of v. cholerae is a new survival strategy [ 1 , 2 ] . in this study ,
the presence of the ompa mutant v. cholerae decreased viability of a. castellanii significantly more than the wild - type v. cholerae did ; this might be due to overproduction of omvs by the mutant strain .
the omvs of v. cholerae have been suggested to promote the delivery of virulence factors to bacterial or eukaryotic cells .
however , our results showed that omvs decreased viability of the amoebae , which might indicate that vesicles are a virulence factor .
it has been observed previously that ompa level is inversely correlated with the amount of omvs and that the srna of v. cholerae , which is called vibrio regulatory rna of ompa ( vrra ) , increases omvs production at a rate comparable to the loss of ompa , since vrra positively regulates omvs release through downregulation of ompa protein .
however , inactivation of vrra resulted in increased colonization of v. cholerae in an infant mouse colonization assay .
thus , ompa protein is important for the colonization of v. cholerae , and vrra rna may be considered a regulator that modulates the virulence of v. cholerae .
omvs formation has been suggested to be linked to turgor pressure of the cell envelope during bacterial growth .
gram - negative bacteria have developed many strategies to enable active virulence factors to gain access to the extracellular environment , typically the tissues or bloodstream of the host organism .
vesicles are the means by which bacteria interact with prokaryotic and eukaryotic cells in their environment .
biochemical analysis and functional characterization of pathogen - derived outer membrane vesicles have demonstrated that this secretory pathway has been taken by pathogens for the transport of active virulence factors into host cells .
however , the ability of omvs to fuse with bacterial membranes and of host cells to deliver content into the cytosol means that these vesicles may be described as bacterial
bombs for directed intercellular transport of particular bacterial virulence factors into host cells and tissues [ 14 , 3032 ] .
further investigations are needed to learn more about the function of the vesicles and their interaction with host cells .
finely , the results showed that when both strains were cultivated alone , the ompa mutant of v. cholerae expressed more omvs and survived for longer than the wild - type .
moreover , the amount of omvs isolated from the ompa mutant strain was sufficiently high to decrease viability of amoebae .
cocultivation with a. castellanii enhanced survival of both wild - type and ompa mutant strains of v. cholerae . in conclusion
, ompa might have a regulating role in survival of v. cholerae since it suppressed its survival while the lack of ompa enhanced release of omvs .
the omvs might act as a virulence factor when they supported a long survival of the bacterium and decreased viability of the interacted amoebae . | vibrio cholerae , the causative agent of the diarrhoeal disease cholera , survives in aquatic environments .
the bacterium has developed a survival strategy to grow and survive inside acanthamoeba castellanii .
it has been shown that v. cholerae expresses outer membrane proteins as virulence factors playing a role in the adherence to interacted host cells .
this study examined the role of outer membrane protein a ( ompa ) and outer membrane vesicles ( omvs ) in survival of v. cholerae alone and during its interaction with a. castellanii .
the results showed that an ompa mutant of v. cholerae survived longer than wild - type v. cholerae when cultivated alone .
cocultivation with a. castellanii enhanced the survival of both bacterial strains and ompa protein exhibited no effect on attachment , engulfment , and survival inside the amoebae . however , cocultivation of the ompa mutant of v. cholerae decreased the viability of a. castellanii and this bacterial strain released more omvs than wild - type v. cholerae .
surprisingly , treatment of amoeba cells with omvs isolated from the ompa mutant significantly decreased viable counts of the amoeba cells . in conclusion
, the results might highlight a regulating rule for ompa in survival of v. cholerae and omvs as a potent virulence factor for this bacterium towards eukaryotes in the environment . |
parenting interventions hold great promise for the promotion of healthy children , healthy families , and healthy societies , in ways that comprehensively impact the social , physical , and mental dimensions of human wellbeing ( olds , sadler , & kitzman , 2007 ; panter - brick & leckman , 2013 ) .
issues related to fathers were hardly discussed in a recent literature review of early child development programs , which assessed the effectiveness of 15 parenting interventions in low - income and middle - income countries and formulated research priorities and programmatic recommendations ( engle , fernald , alderman , behrman , & al , 2011 ) .
similarly , very few references to engaging fathers were made in policy documents that reviewed the clear economic , health , and education arguments for investing in early child development programs worldwide ( naudeau , kataoka , valerio , neuman , & elder , 2011 ) .
programmatic approaches to early child development have recently called for a paradigm shift in global policy , to foster more effective interventions and systemic approaches to relevant health , education , child protection , and financing agenda ( britto & ulkuer , 2012 ) .
this demands a careful evaluation of how issues of father participation and impact are articulated in approaches to ( a ) research , ( b ) intervention , and ( c ) policy .
this review aims to engage with academic researchers who involve themselves in program design and/or evaluation , and with stakeholders who define the parameters , fund programs , or direct the implementation of parenting interventions .
our purpose is to distill the ingredients that matter for including fathers in a range of settings , in order to best promote the social , physical , and mental health of children and caregivers .
we respond to a need to disseminate evidence , flag problematic issues , and encourage best practice , regarding the effectiveness of parenting interventions on family dynamics and child wellbeing .
globally , we know that father child relations vary across time and cultures , and have differential impact on families and children ( cabrera & tamis - lemomda , 2013 ; gray & anderson , 2010 ; hewlett , 2011 ; shwalb , shwalb , & lamb , 2013 ) .
we also know that men 's parenting styles ( e.g. , authoritarian , authoritative , permissive , indifferent , protective , negligent ) are more variable and nuanced than commonly thought ( selin , 2014 ) , and that traditional values pertaining to motherhood and fatherhood can exist alongside counter - cultural values that engage men in supporting mothers and children ( solis - camara , fung , & fox , 2014 ) .
an empirical , theoretical , and programmatic lens on gender equity is here needed to move beyond the one - size - fits - all parenting programs that essentially work to reproduce the social constructs of mother - based childrearing practices . like mothers , fathers
have roles and impacts that prove both positive and negative for child wellbeing and family functioning : fatherhood is an important aspect of child development ( lamb , 2010 ; lamb & lewis , 2013 ; pleck , 2010 ) .
cohort studies have revealed the overall protective and positive effect of father involvement on offspring social , educational , behavioral , and psychological outcomes throughout infancy , childhood , adolescence and adulthood .
short- and long - term positive outcomes include those pertaining to psychological health , externalizing and internalizing behavioral problems , substance misuse , criminality or delinquency , economic disadvantage , capacity for empathy , peer relationships , nontraditional attitudes to earning and child care , satisfaction with adult sexual partnerships , and self - esteem and life - satisfaction ( fatherhood institute , 2013b ; feldman , bamberger , & kanat - maymon , 2013 ; flouri , 2005 ; flouri & buchanan , 2004 ; kim , mayes , feldman , leckman , & swain , 2013 ; martin , ryan , & brooks - gunn , 2007 ; pattnaik & sriram , 2010 ; pleck & masciadrelli , 2004 ; sarkadi , kristiansson , oberklaid , & bremberg , 2008 ) . disengaged and remote father child interactions ,
as early as the third month of life , have been found to predict externalizing problems in children longitudinally ( ramchandani et al . , 2013 ) .
fathers sensitivity in free play with their 2 year - olds was found to be pivotal to child adjustment at age ten , and more predictive than early mother
in one prospective longitudinal study of 100 families , early - life maternal and paternal reciprocity were shown to each uniquely predict children 's social competence and aggression in preschool , while father adolescent and mother adolescent reciprocity each predicted different aspects of dialogical negotiation ( feldman et al . , 2013 ) .
a select body of literature has now evidenced the neuroendocrine and neurobiological changes associated with specific male and female parental behaviors ( atzil , hendler , zagoory - sharon , winetraub , & feldman , 2012 ; kim et al .
paternal psychopathology , evidenced in antisocial behavior , substance misuse , and depression , has demonstrable impacts on child and adolescent functioning ( phares , rojas , thurston , & hankinson , 2010 ) .
moreover , fathers are key to coparenting interactions that impact family dynamics in ways related to , but distinct from , parent child or marital relationships ( fivaz - depeursinge & corboz - warnery , 1999 ; mchale & lindahl , 2011 ) . in sum , an emergent but substantial body of research highlights how critical fathers can be to child wellbeing , and why it seems good science and good practice to involve fathers in preventive interventions to foster healthy child development .
the evidence base on parenting interventions that exploit these benefits of paternal engagement , however , is quite limited . specifically , one systematic review of early childhood programs identified only 14 intervention studies that included fathers , 11 of them conducted in the united states ( magill - evans , harrison , rempel , & slater , 2006 ) . in a metaanalysis of interventions for parents of children with developmental disabilities , singer , ethridge , and aldana ( 2007 ) identified 17 interventions ( again mainly us - based ) , only three of which included impact data in relation to fathers .
a systematic review of behavioral parent training for attention - deficit / hyperactivity disorder ( adhd ) studies found only 13% included information on father - related outcomes ( fabiano , 2007 ) . and in a systematic review of fathers involvement in programs for the primary prevention of child maltreatment ( most of which were
also us - based ) , only two of the 16 interventions that met eligibility criteria reported father - specific data ( smith , duggan , bair - merritt , & cox , 2012 ) .
overviews that take a global perspective are currently confined to the gray literature ( i.e. , published material that has not undergone formal peer review ) , namely conference proceedings , databases , programs implemented by non - governmental organizations and diverse charities worldwide ( burgess , 2009 ; mcallister , burgess , kato , & barker , 2012 ) .
( 2012 ) reviewed current issues , discussed best practice , and listed a total of 43 international father - focused or father - friendly programs , detailing case studies with the best evidence base for interventions from the prenatal period through the first 8 years of children 's lives .
their report made three crucial observations regarding the nature and scope of the evidence base .
first , the evidence base is methodologically weak , in the sense that very few interventions dealing with father engagement have undergone robust evaluation anywhere in the world .
parenting interventions disaggregate findings by gender , and most are limited to short - term impacts on family lives and self - reported beliefs and behaviors . taking
this step would allow sound conclusions to be drawn regarding the relative effectiveness of mothering , fathering , or coparenting interventions .
third , on a global scale , the evidence base on parenting roles and parenting interventions is heavily tilted toward fathers , mothers , and children living in the global north . in the global south
, there exists some evidence regarding interventions with men to promote reproductive health and prevent gender - based violence or hiv transmission , but little evaluation conducted with fathers in their role as caregivers for promoting child health and development .
father - focused interventions encompass programs commonly set to increase the quantity and improve the quality of fathers involvement with their children . in this respect ,
parenting is considered a core mediator in the design of many interventions , given its putative influence on a wide range of child outcomes ( olds et al .
an increased quantity of the time men spend interacting with their children thus serves as an important proxy for positive child outcomes .
exemplars of interventions which pay attention to fathers time commitments include , in the united states , a range of early years father child activity programs , such as in head start ( fagan & iglesias , 1999 ) and early head start ( vogel et al . , 2011 ) and , in peru , proyecto papa in accin ( mcallister et al . , 2012 ) .
of course , the time that fathers spend in parenting activities varies considerably worldwide both in absolute terms , and relative to mothers ( miranda , 2011 ) . based on oecd data ,
scandinavian countries emerge as the most gender - equal in time spent on child care ( fatherhood institute , 2010 ) . in middle- and low - income countries , father - inclusive programs
have often explicitly or implicitly encouraged increased male involvement in child care and domestic labor as part of a wider promotion of gender equality ( bhandari & karkara , 2006 ; barker , doruz , & rogow , 2009 ; mcallister et al . ,
child interaction is commonly addressed in programs by focusing on fathers understanding of child development and/or their skills in child - behavior management .
for example in turkey , the community - based father support program aims to enhance awareness in fathers regarding their importance in child care and child development , and to reduce harsh parenting ( barker et al . , 2009 ) .
such types of father - focused interventions are promoted in a wide range of settings , including jails , centers fostering early child development , and centers for child and adolescent mental health , where fathers , as target participants , are often not well acquainted with parenting literature , receive little social support , or have little experience as primary caregivers .
interestingly , in cultures that favor a gender division of reproductive and productive tasks , such as turkey and pakistan , impetus for involving men in both parenting programs and violence prevention programs has come from women themselves ( aev , 2009 ; bhandari & karkara , 2006 ) , as well as from international organizations .
some unicef programs have begun with the premise that men have limited knowledge of child health and development , while fathers , being prime decision - makers in the home and community , are crucial to improved maternal - child health outcomes .
while engaging fathers in such contexts presents challenges , the demand by women for father engagement is apparent .
more holistic parenting interventions have addressed wider aspects of coparenting and family life known to impact child health and development ( feinberg , kan , & goslin , 2009 ; hawkins , lovejoy , holmes , blanchard , & fawcett , 2008 ) .
thus cowan , cowan , pruett , pruett , and wong ( 2009 ) identified five aspects of family life relevant to father engagement : caregiver mental health , the quality of relationships between parents , the quality of father child or mother child relationships , the pattern of caregiver child relationships transmitted across generations , and the balance of stressors and social supports outside the immediate family . because parental mental health and the social architecture of family life can be important predictors of child health , the design and evaluation of some parenting interventions have sought to address those wider dimensions . indeed , a us program such as family foundations has strategically focused on the coparenting relationship of couples expecting their first child , in order to prevent the kind of stresses and early parenting difficulties that may lead to a negative developmental cascade in children ( brown , feinberg , & kan , 2011 ; feinberg , jones , kan and goslin , 2010 ; feinberg & kan , 2008 ) .
this approach is in stark contrast to the nurse - family partnership ( nfp ) program , in place for more than three decades , but targeted at first - time mothers ( donelan - mccall , eckenrode , & olds , 2009 ) . in the united kingdom , where this program is known as the family nurse partnership ( fnp ) , relatively more attention has been paid to engaging with fathers alongside vulnerable teenage mothers , providing early professional help at a time when new parents redefine themselves as caregivers and as a couple ( ferguson & gates , 2013 ) .
there are substantial weaknesses in program evaluation related to coparents , namely program engagement with two parents rather than one .
few studies have sought to examine whether fathers are effective change agents ( elder et al . ,
2011 ) , or as effective as mothers in implementing change ( adesso & lipson , 1981 ; cia , barham , & fontaine , 2010 ) .
some studies indicate that , even where only one parent participates in the intervention , gains in family functioning are greater or better maintained when there is another parent in the home ( bagner & eyberg , 2003 ; hahlweg , heinrichs , kuschel , bertram , & naumann , 2010 ; webster - stratton , 1985 ) .
another - parent - in - the - home also seems to be protective against program drop - out ( bagner , 2013 ) .
( 2013 ) found this to be the case , as did lundahl , tollefson , risser , and lovejoy ( 2008 ) and bakermans - kranenburg , van ijzendoorn , and juffer ( 2003 ) in metaanalyses .
the quality of evidence to - date , however , is highly variable : thus while bakermans - kranenburg et al .
significantly more effective than interventions with mothers alone , the studies involved only 81 fathers , and were not randomized . without randomization , we can not be sure whether positive effects have more to do with the nature of families in which both parents participate , than with fathers participation per se .
the very few studies that have randomized participants to test this important proposition have found that engaging with both parents , rather than one , may indeed deliver benefits ( besnard , capuano , verlaan , poulin , & vitaro , 2009 ; cia et al . , 2010 ; cowan et al . , 2009 ; may et al . , 2013 ; rienks , wadsworth , markman , einhorn , & etter , 2011 ) .
in sum , most parenting evaluations have not been gender - disaggregated , nor has the impact of delivering a program to both parents vs. one individual parent been measured .
most global overviews have focused attention on identifying strategic entry points for early child development investments , to include center - based programs , home - based programs , and media campaigns ( naudeau et al . ,
for instance , if a significant percentage of the parents attending are couples , and if couple participation enhances outcomes , does a positive evaluation stem from program design and delivery , or from the fact that many parents attended deux ?
similarly , given that fathers do not seem to benefit as much as mothers from program participation ( arguably due to program design , rather than father deficits ) , are findings skewed by participant gender , even when parents attend solo ?
in their review of parenting interventions targeting competencies relevant to child health and development , olds et al .
( 2007 ) emphasized that the evidence base on parenting interventions will only be improved if research projects adhere to the highest standards of randomization in controlled trials , and in particular , to the consort standards for reporting evidence . without robust evidence , the considerable promise of parenting programs for improving the life course of children will remain undocumented .
policies relevant to men as fathers are often focused on specific social or health outcomes , rather than holistically and synergistically geared to improving family level caregiving environments . in the global north , such policies are most often found in the design of paternity and parental leave systems and in the allocation of parenting time after divorce or separation . in the global south , most of the funding to engage men in programmatic interventions has been in the areas of intimate partner violence , sexual and reproductive health , and hiv prevention , including prevention of mother to child transmission . even there ,
engagement with men may be limited or even counter - productive ( sherr & croome , 2012 ) .
policies on parenting tend to reflect and perpetuate , implicitly or explicitly , the gender biases that prevail in cultural stereotypes and mainstream parenting practices . in the realm of social welfare policies , conditional cash transfers or other income support programs for low - income families
have often excluded men , on the grounds that women devolve more of their income to the household than do men .
recent critiques of income support programs are instructive : to focus exclusively on women may inadvertently contribute to a gender divide , in which women are viewed as caregivers and responsible , while men are seen as inherently derelict in their capacity for family support .
similarly , strong gendering biases in parenting policies tend to reproduce a mothering rather than fathering cultural model of childrearing : these tilt programmatic interventions toward mothers , rather than toward both fathers and mothers as coparents .
indeed , policy frameworks underpinning family - based interventions are often predicated on a father deficit model , one that sees fathers as ineffective or neglectful in the arena of child health and development ( hawkins & dollahite , 1997 ; maxwell , scourfield , featherstone , holland , & tolman , 2012 ) .
such a deficit model of father involvement is widespread in the social construction of parenting interventions in countries such as the united kingdom and the united states , but also in the global south .
a more productive framework would espouse a socioecological model that focuses attention on the social , economic , and political environments that shape the quality or quantity of father engagement with their children and their commitment to coparenting ( cowan et al .
, there is little evidence of a virtuous cycle in the evidence base , given the gender biases that are often manifested in policy frameworks , parenting interventions , and even basic research .
we know that gaps in the evidence base are best addressed by grounding parenting interventions in theory , as well as in epidemiology and developmental research .
( 2007 ; p. 357 ) , this includes a theory of program engagement , with a clear understanding of what drives beliefs and behavior , including the fundamental question of why would parents want to spend their time participating in [ a given ] program. olds et al .
( 2007 ) did not highlight issues pertaining to father or couple involvement . however , such issues lie at the heart of biases implicitly or explicitly embedded in most parenting interventions . program engagement is certainly a critical element of successful implementation .
yet there is scant research relating how participant engagement relates to program outcomes ( daniel et al . , 2011 ; scourfield , cheung , & macdonald 2014 ) . a growing number of studies are adopting more proactive approaches to engaging fathers , spurring a deeper reflection on how best to engage with men in programmatic interventions ( holmes , galovan , yoshida , & hawkins , 2010 ; maxwell , scourfield , holland , featherstone , & lee , 2012 ; palm & fagan , 2008 ) . in sum ,
when it comes to fathers , our knowledge on the empirical associations between fathers involvement in raising children and the health or educational outcomes of children is quite consistent fathers have a substantial impact on child development and wellbeing .
what is missing is a systematic evaluation of the global evidence base regarding fathers impact on child wellbeing outcomes via the interventions which involve or could involve them .
this paper offers a systematic review of father - inclusive parenting and coparenting interventions undertaken across the world .
this step identifies the main obstacles to their inclusion and engagement , in terms of existing programs as well as everyday parenting activities .
second , what improvements can be made in the design , implementation , and evaluation of parenting programs to effectively engage with fathers and assess related impacts ?
we considered preventive programs related to prenatal health and sexual health ; harm - reduction programs that addressed child maltreatment , domestic violence , or alcohol abuse ; behavioral training programs , such as those for teenage parents , first - time parents , and parents of children with developmental or medical conditions ; programs that engaged men in settings such as jails or early years centers ; and programs that involved men in child care and promoting gender equality .
father / men - only programs are not necessarily the best programmatic strategy , but they are often the only place in which to find evidence on father participation or effectiveness .
like mothers , fathers have roles and impacts that prove both positive and negative for child wellbeing and family functioning : fatherhood is an important aspect of child development ( lamb , 2010 ; lamb & lewis , 2013 ; pleck , 2010 ) .
cohort studies have revealed the overall protective and positive effect of father involvement on offspring social , educational , behavioral , and psychological outcomes throughout infancy , childhood , adolescence and adulthood .
short- and long - term positive outcomes include those pertaining to psychological health , externalizing and internalizing behavioral problems , substance misuse , criminality or delinquency , economic disadvantage , capacity for empathy , peer relationships , nontraditional attitudes to earning and child care , satisfaction with adult sexual partnerships , and self - esteem and life - satisfaction ( fatherhood institute , 2013b ; feldman , bamberger , & kanat - maymon , 2013 ; flouri , 2005 ; flouri & buchanan , 2004 ; kim , mayes , feldman , leckman , & swain , 2013 ; martin , ryan , & brooks - gunn , 2007 ; pattnaik & sriram , 2010 ; pleck & masciadrelli , 2004 ; sarkadi , kristiansson , oberklaid , & bremberg , 2008 ) .
disengaged and remote father child interactions , as early as the third month of life , have been found to predict externalizing problems in children longitudinally ( ramchandani et al . , 2013 ) .
fathers sensitivity in free play with their 2 year - olds was found to be pivotal to child adjustment at age ten , and more predictive than early mother
in one prospective longitudinal study of 100 families , early - life maternal and paternal reciprocity were shown to each uniquely predict children 's social competence and aggression in preschool , while father adolescent and mother adolescent reciprocity each predicted different aspects of dialogical negotiation ( feldman et al . , 2013 ) .
a select body of literature has now evidenced the neuroendocrine and neurobiological changes associated with specific male and female parental behaviors ( atzil , hendler , zagoory - sharon , winetraub , & feldman , 2012 ; kim et al .
paternal psychopathology , evidenced in antisocial behavior , substance misuse , and depression , has demonstrable impacts on child and adolescent functioning ( phares , rojas , thurston , & hankinson , 2010 ) .
moreover , fathers are key to coparenting interactions that impact family dynamics in ways related to , but distinct from , parent child or marital relationships ( fivaz - depeursinge & corboz - warnery , 1999 ; mchale & lindahl , 2011 ) . in sum , an emergent but substantial body of research highlights how critical fathers can be to child wellbeing , and why it seems good science and good practice to involve fathers in preventive interventions to foster healthy child development .
the evidence base on parenting interventions that exploit these benefits of paternal engagement , however , is quite limited . specifically , one systematic review of early childhood programs identified only 14 intervention studies that included fathers , 11 of them conducted in the united states ( magill - evans , harrison , rempel , & slater , 2006 ) . in a metaanalysis of interventions for parents of children with developmental disabilities , singer , ethridge , and aldana ( 2007 ) identified 17 interventions ( again mainly us - based ) , only three of which included impact data in relation to fathers .
a systematic review of behavioral parent training for attention - deficit / hyperactivity disorder ( adhd ) studies found only 13% included information on father - related outcomes ( fabiano , 2007 ) . and in a systematic review of fathers involvement in programs for the primary prevention of child maltreatment ( most of which were also us - based ) , only two of the 16 interventions that met eligibility criteria reported father - specific data ( smith , duggan , bair - merritt , & cox , 2012 ) .
overviews that take a global perspective are currently confined to the gray literature ( i.e. , published material that has not undergone formal peer review ) , namely conference proceedings , databases , programs implemented by non - governmental organizations and diverse charities worldwide ( burgess , 2009 ; mcallister , burgess , kato , & barker , 2012 ) . for example , mcallister et al .
( 2012 ) reviewed current issues , discussed best practice , and listed a total of 43 international father - focused or father - friendly programs , detailing case studies with the best evidence base for interventions from the prenatal period through the first 8 years of children 's lives .
their report made three crucial observations regarding the nature and scope of the evidence base .
first , the evidence base is methodologically weak , in the sense that very few interventions dealing with father engagement have undergone robust evaluation anywhere in the world .
parenting interventions disaggregate findings by gender , and most are limited to short - term impacts on family lives and self - reported beliefs and behaviors . taking
this step would allow sound conclusions to be drawn regarding the relative effectiveness of mothering , fathering , or coparenting interventions .
third , on a global scale , the evidence base on parenting roles and parenting interventions is heavily tilted toward fathers , mothers , and children living in the global north . in the global south
, there exists some evidence regarding interventions with men to promote reproductive health and prevent gender - based violence or hiv transmission , but little evaluation conducted with fathers in their role as caregivers for promoting child health and development .
father - focused interventions encompass programs commonly set to increase the quantity and improve the quality of fathers involvement with their children . in this respect ,
parenting is considered a core mediator in the design of many interventions , given its putative influence on a wide range of child outcomes ( olds et al .
an increased quantity of the time men spend interacting with their children thus serves as an important proxy for positive child outcomes .
exemplars of interventions which pay attention to fathers time commitments include , in the united states , a range of early years father child activity programs , such as in head start ( fagan & iglesias , 1999 ) and early head start ( vogel et al . , 2011 ) and , in peru , proyecto papa in accin ( mcallister et al . , 2012 ) .
of course , the time that fathers spend in parenting activities varies considerably worldwide both in absolute terms , and relative to mothers ( miranda , 2011 ) . based on oecd data ,
scandinavian countries emerge as the most gender - equal in time spent on child care ( fatherhood institute , 2010 ) . in middle- and low - income countries ,
father - inclusive programs have often explicitly or implicitly encouraged increased male involvement in child care and domestic labor as part of a wider promotion of gender equality ( bhandari & karkara , 2006 ; barker , doruz , & rogow , 2009 ; mcallister et al . , 2012 ) .
the quality of father child interaction is commonly addressed in programs by focusing on fathers understanding of child development and/or their skills in child - behavior management .
for example in turkey , the community - based father support program aims to enhance awareness in fathers regarding their importance in child care and child development , and to reduce harsh parenting ( barker et al . ,
such types of father - focused interventions are promoted in a wide range of settings , including jails , centers fostering early child development , and centers for child and adolescent mental health , where fathers , as target participants , are often not well acquainted with parenting literature , receive little social support , or have little experience as primary caregivers .
interestingly , in cultures that favor a gender division of reproductive and productive tasks , such as turkey and pakistan , impetus for involving men in both parenting programs and violence prevention programs has come from women themselves ( aev , 2009 ; bhandari & karkara , 2006 ) , as well as from international organizations .
some unicef programs have begun with the premise that men have limited knowledge of child health and development , while fathers , being prime decision - makers in the home and community , are crucial to improved maternal - child health outcomes .
while engaging fathers in such contexts presents challenges , the demand by women for father engagement is apparent .
more holistic parenting interventions have addressed wider aspects of coparenting and family life known to impact child health and development ( feinberg , kan , & goslin , 2009 ; hawkins , lovejoy , holmes , blanchard , & fawcett , 2008 ) .
thus cowan , cowan , pruett , pruett , and wong ( 2009 ) identified five aspects of family life relevant to father engagement : caregiver mental health , the quality of relationships between parents , the quality of father child or mother child relationships , the pattern of caregiver child relationships transmitted across generations , and the balance of stressors and social supports outside the immediate family . because parental mental health and the social architecture of family life can be important predictors of child health , the design and evaluation of some parenting interventions have sought to address those wider dimensions .
indeed , a us program such as family foundations has strategically focused on the coparenting relationship of couples expecting their first child , in order to prevent the kind of stresses and early parenting difficulties that may lead to a negative developmental cascade in children ( brown , feinberg , & kan , 2011 ; feinberg , jones , kan and goslin , 2010 ; feinberg & kan , 2008 ) .
this approach is in stark contrast to the nurse - family partnership ( nfp ) program , in place for more than three decades , but targeted at first - time mothers ( donelan - mccall , eckenrode , & olds , 2009 ) . in the united kingdom , where this program is known as the family nurse partnership ( fnp ) , relatively more attention has been paid to engaging with fathers alongside vulnerable teenage mothers , providing early professional help at a time when new parents redefine themselves as caregivers and as a couple ( ferguson & gates , 2013 ) .
there are substantial weaknesses in program evaluation related to coparents , namely program engagement with two parents rather than one .
2011 ) , or as effective as mothers in implementing change ( adesso & lipson , 1981 ; cia , barham , & fontaine , 2010 ) .
some studies indicate that , even where only one parent participates in the intervention , gains in family functioning are greater or better maintained when there is another parent in the home ( bagner & eyberg , 2003 ; hahlweg , heinrichs , kuschel , bertram , & naumann , 2010 ; webster - stratton , 1985 ) .
another - parent - in - the - home also seems to be protective against program drop - out ( bagner , 2013 ) .
( 2013 ) found this to be the case , as did lundahl , tollefson , risser , and lovejoy ( 2008 ) and bakermans - kranenburg , van ijzendoorn , and juffer ( 2003 ) in metaanalyses .
the quality of evidence to - date , however , is highly variable : thus while bakermans - kranenburg et al .
significantly more effective than interventions with mothers alone , the studies involved only 81 fathers , and were not randomized . without randomization , we can not be sure whether positive effects have more to do with the nature of families in which both parents participate , than with fathers participation per se .
the very few studies that have randomized participants to test this important proposition have found that engaging with both parents , rather than one , may indeed deliver benefits ( besnard , capuano , verlaan , poulin , & vitaro , 2009 ; cia et al .
, 2010 ; cowan et al . , 2009 ; may et al .
, 2013 ; rienks , wadsworth , markman , einhorn , & etter , 2011 ) . in sum ,
most parenting evaluations have not been gender - disaggregated , nor has the impact of delivering a program to both parents vs. one individual parent been measured .
strategic entry points for early child development investments , to include center - based programs , home - based programs , and media campaigns ( naudeau et al . , 2011 ) .
skew findings . for instance , if a significant percentage of the parents attending are couples , and if couple participation enhances outcomes , does a positive evaluation stem from program design and delivery , or from the fact that many parents attended deux ?
similarly , given that fathers do not seem to benefit as much as mothers from program participation ( arguably due to program design , rather than father deficits ) , are findings skewed by participant gender , even when parents attend solo ?
in their review of parenting interventions targeting competencies relevant to child health and development , olds et al .
( 2007 ) emphasized that the evidence base on parenting interventions will only be improved if research projects adhere to the highest standards of randomization in controlled trials , and in particular , to the consort standards for reporting evidence . without robust evidence ,
the considerable promise of parenting programs for improving the life course of children will remain undocumented .
policies relevant to men as fathers are often focused on specific social or health outcomes , rather than holistically and synergistically geared to improving family level caregiving environments . in the global north , such policies are most often found in the design of paternity and parental leave systems and in the allocation of parenting time after divorce or separation . in the global south ,
most of the funding to engage men in programmatic interventions has been in the areas of intimate partner violence , sexual and reproductive health , and hiv prevention , including prevention of mother to child transmission . even there ,
engagement with men may be limited or even counter - productive ( sherr & croome , 2012 ) . policies on parenting tend to reflect and perpetuate , implicitly or explicitly , the gender biases that prevail in cultural stereotypes and mainstream parenting practices . in the realm of social welfare policies , conditional cash transfers or other income support programs for low - income families
have often excluded men , on the grounds that women devolve more of their income to the household than do men .
recent critiques of income support programs are instructive : to focus exclusively on women may inadvertently contribute to a gender divide , in which women are viewed as caregivers and responsible , while men are seen as inherently derelict in their capacity for family support .
similarly , strong gendering biases in parenting policies tend to reproduce a mothering rather than fathering cultural model of childrearing : these tilt programmatic interventions toward mothers , rather than toward both fathers and mothers as coparents .
indeed , policy frameworks underpinning family - based interventions are often predicated on a father deficit model , one that sees fathers as ineffective or neglectful in the arena of child health and development ( hawkins & dollahite , 1997 ; maxwell , scourfield , featherstone , holland , & tolman , 2012 ) .
such a deficit model of father involvement is widespread in the social construction of parenting interventions in countries such as the united kingdom and the united states , but also in the global south .
a more productive framework would espouse a socioecological model that focuses attention on the social , economic , and political environments that shape the quality or quantity of father engagement with their children and their commitment to coparenting ( cowan et al .
in sum , there is little evidence of a virtuous cycle in the evidence base , given the gender biases that are often manifested in policy frameworks , parenting interventions , and even basic research .
we know that gaps in the evidence base are best addressed by grounding parenting interventions in theory , as well as in epidemiology and developmental research . as highlighted by olds et al .
( 2007 ; p. 357 ) , this includes a theory of program engagement , with a clear understanding of what drives beliefs and behavior , including the fundamental question of why would parents want to spend their time participating in [ a given ] program. olds et al .
however , such issues lie at the heart of biases implicitly or explicitly embedded in most parenting interventions .
yet there is scant research relating how participant engagement relates to program outcomes ( daniel et al . , 2011 ; scourfield , cheung , & macdonald 2014 ) . a growing number of studies are adopting more proactive approaches to engaging fathers , spurring a deeper reflection on how best to engage with men in programmatic interventions ( holmes , galovan , yoshida , & hawkins , 2010 ; maxwell , scourfield , holland , featherstone , & lee , 2012 ; palm & fagan , 2008 ) . in sum ,
when it comes to fathers , our knowledge on the empirical associations between fathers involvement in raising children and the health or educational outcomes of children is quite consistent fathers have a substantial impact on child development and wellbeing .
what is missing is a systematic evaluation of the global evidence base regarding fathers impact on child wellbeing outcomes via the interventions which involve or could involve them .
this paper offers a systematic review of father - inclusive parenting and coparenting interventions undertaken across the world .
this step identifies the main obstacles to their inclusion and engagement , in terms of existing programs as well as everyday parenting activities .
second , what improvements can be made in the design , implementation , and evaluation of parenting programs to effectively engage with fathers and assess related impacts ?
we considered preventive programs related to prenatal health and sexual health ; harm - reduction programs that addressed child maltreatment , domestic violence , or alcohol abuse ; behavioral training programs , such as those for teenage parents , first - time parents , and parents of children with developmental or medical conditions ; programs that engaged men in settings such as jails or early years centers ; and programs that involved men in child care and promoting gender equality .
father / men - only programs are not necessarily the best programmatic strategy , but they are often the only place in which to find evidence on father participation or effectiveness .
we conducted a systematic search of standard literature databases and a thematic hand search of the global literature on parenting interventions , to include studies that offered data on father participation and impact .
this search strategy enabled us to identify the most widely used and best - documented parenting programs world - wide , and to include studies of programs in the global south that would not have been captured by systematic searches of peer - reviewed journals .
we identified both single studies and reviews that indicated successful strategies in father engagement and that evidenced links between fathers program participation and child outcomes . the term
father designated all men who are socially significant to children or assume actual fatherly roles in taking care of children , whether or not the birth father , married to the mother , or coresident with the child .
for the systematic database search , we targeted articles from medline , psychinfo , ssci , and the cochrane library . using the appropriate proximity operators and ( un)limited truncation characters for each respective database , our search strategy was as follows . in step 1 ,
our search terms were : parent * with ( program or intervention or engage or evaluation ) , father * with ( program or intervention or engage or inclusion ) , men * with intervention , gender , partner , or coparent . in step 2 , we narrowed the pool of results to necessarily include one search term designated by steps ( a c ) , as follows : we combined step 1 and ( 2a ) father and ( 2b ) ( intervention or program ) and ( 2c ) ( parent or coparent ) and ( 2d ) ( evaluation or review ) . thus results from step 1 were narrowed such that the final set of results necessarily included at least one search term from step 2a , one search term from step 2b , and so on .
we imposed no date or language limits on our database searches , which were finalized in october 2013 .
we supplemented the above searches with a thematic hand search of the gray literature on parenting programs , such as those conducted by unicef worldwide and available databases on the topic of fatherhood and child neglect .
we also examined books on fatherhood or parenting , conference proceedings from voluntary organizations , research networks such as childwatch , and the websites of oecd , the global child development network , the african child policy forum , who , the world bank , fatherhood.gov , and acf / opre . finally , we contacted authors of sourced articles , and fathers and men 's organizations worldwide .
two authors removed duplicate records obtained from systematic database and thematic searches , then screened all papers on the basis of their abstracts and/or full - length text .
three coauthors independently assessed all papers with respect to three exclusion criteria , to exclude material that ( a ) provided insufficient gender - disaggregation in program evaluation , ( b ) duplicated information presented elsewhere , or ( c ) did not include process evaluation or impact evaluation of family dynamics or child wellbeing .
the remaining papers constituted the final set of full - text documents selected for this review . to evaluate quality and scope within this literature
, we then identified a small number of studies on the basis of their empirical and/or thematic contribution to father - inclusive parenting interventions .
we searched for exemplars of diverse settings , target group , mode of program delivery , and outcome indicators , in order to characterize , on a global scale , current efforts to engage with fathers and evaluate their impact on child and family wellbeing .
four authors , working in pairs , independently assessed all papers selected for review , with respect to three inclusion criteria , to capture studies ( a ) situated in the global south as well as the global north , ( b ) including both process data on father participation and outcome data on father or child impact , and ( c ) exemplifying diverse modes of program delivery and target populations .
where several potential exemplars existed of a given program , we selected the parenting intervention that had benefited from the most comprehensive and high - quality evaluation .
our review thus focused attention on research design and evaluation , rather than findings per se . on a global scale , the lack of gender - differentiated data essentially precluded a useful metaanalysis based on actual findings .
metaanalyses , however , are not the sole form of systematic reviews ( gough , oliver , & thomas , 2012 ; petticrew & roberts , 2006 ; uman , 2011 ) .
first , we comprehensively identified all the studies relevant to answering two specific research questions ( on engaging fathers in parenting interventions worldwide , and evaluating the soundness of program design and implementation ) .
second , we tabulated single programs and created a coding scheme to explicitly assess the evidence base with respect to caregiver demographics , sample size , group comparison , and measures on family and child outcomes .
figure1 shows the steps of our literature searches . from a total 31,586 articles that mentioned fathers , we identified 868 articles that engaged with fathers in parenting or coparenting interventions and mentioned program evaluation or review , and an additional 153 publications from hand searches of the gray literature , many of which concerned the global south . in total , we screened 786 nonduplicate records .
we then excluded 472 records on the basis of abstracts and 115 papers on the basis of full - text articles , following our three exclusion criteria .
to the best of our knowledge , we identified the best - known parenting interventions or studies that included some evidence of father inclusion or father impact on child or family outcomes ( n = 199 publications ) .
we categorized the results of our final search according to whether this material consisted of ( a ) publications ( n = 113 ) assessing a given father - inclusive parenting program , or ( b ) reviews , commentaries , book chapters , and working papers ( n = 86 ) potentially useful for thematic discussion .
literature search prisma diagram we present a global overview of the evidence base in table1 and online supplementary table s1 .
table1 focuses on 34 exemplars ( n = 52 publications ) to capture the diverse range of father - inclusive parenting interventions , in order to draw thematic conclusions on the nature of the evidence base regarding gender - disaggregated parenting interventions .
table s1 reviews an additional 58 programs ( n = 61 evaluations ) , including 36 us - based programs ( 39 publications ) and 22 programs from other countries . upon examination ,
these were programs with smaller sample sizes , less rigorous evaluation of father participation or father impact , and/or interventions highly similar to chosen exemplars . in selecting our exemplars
given the state of the evidence base , programs from the global south were often less rigorously evaluated than those from the global north ; nonetheless , they were included to provide geographical spread .
in all , we list 92 programs ( n = 113 publications ) from 20 different countries australia ( n = 9 ) , brazil ( n = 1 ) , canada ( n = 5 ) , china ( n = 1 ) , finland ( n = 1 ) , germany ( n = 1 ) , iran ( n = 1 ) , israel ( n = 1 ) , jordan ( n = 1 ) , mexico ( n = 2 ) , niger ( n
= 1 ) , the netherlands ( n = 1 ) , new zealand ( n = 1 ) , pakistan ( n = 1 ) , peru ( n = 1 ) , sweden ( n = 2 ) , turkey ( n = 2 ) , ukraine ( n = 1 ) , united kingdom ( n = 7 ) , and usa ( n = 52 ) . while table s1 details , by country , the types of program , their settings , target group , father sample size , and data availability on father participation and impact , table1 provides detailed information on process and impact data , in addition to information on program type , mode of delivery , and target group .
global overview of parenting programs that evaluated father impact and participation ( 34 exemplars ) global programs are designated to a specific country where impact evaluation took place .
process data describe the extent to which fathers were included in the deliverables of the intervention ; impact data describe outcomes related to effectiveness .
most program evaluations are situated in the global north parenting interventions in the global south are rarely captured by systematic database searches , while parenting interventions captured by thematic hand searches rarely involve fathers .
these include programs targeting vulnerable families at risk of various negative outcomes ( e.g. , programs such as head start in the usa , directed at low - income parents to mitigate the effects of poverty on parenting and child outcomes ) .
they also include programs specifically targeting men with a history of violent behavior , or fathers of vulnerable children ( e.g. , born prematurely , with disabilities or conduct disorders ) , for prevention of future harm and/or improvement of parenting skills and child and family outcomes .
few programs aim to strengthen family - level resilience to enhance better - quality parenting .
regarding our first question ( how fathers are currently involved in parenting interventions ) , posed to evaluate the extent to which fathers are targeted for inclusion , the cases in table1 and table s1 demonstrate a wide range of program design and relatively low coherence overall .
some interventions target just one parent , most often the mother by default , as does , for example the positive parenting program ( triple p ) developed in australia ( fletcher , freeman , & matthey , 2011 ) .
others are designed to engage with mothers and fathers in separate groups , such as the proyecto papa in accin in peru , aiming to increase the quantity of father child engagement and fathers sensitivity to understanding child health and development issues ( mcallister et al . , 2012 ) .
still others , such as the fatherhood relationship and marriage education intervention ( frame ) work only with couples ( rienks et al .
some programmatic interventions are designed for high - risk families such as the australian dads on board intervention with fathers who have undertaken behavior - change programs due to their use of violence , while others are universal programs such as the leksand models in sweden , a maternity services - based intervention ( hoskings & walsh , 2010 ; johansson , 2012 ) .
we found noteworthy exemplars of parenting interventions offering relatively good designs as well as promising outcomes from addressing or including fathers ( table1 ) .
thus the supporting father involvement program in the united states focuses explicitly on fathers roles and coparenting : remarkably , this intervention tested whether men - only or coparent groups were the most effective means of supporting fathers participation in the lives of their children ( cowan , cowan , kline pruett , pruett , & gillette , 2014 ; knox , cowan , cowan , & bildner , 2011 ) .
other initiatives have been developed to support positive coparenting , taking this as a leverage point for the enhancement of family functioning and child outcomes ( feinberg & kan , 2008 ) . also from the united states ,
head start exemplifies the type of intervention that focuses explicitly on the father - preschooler dyad , looking to improve child behavior , social skills , and school readiness by increasing fathers engagement with their children and enhancing their support and childrearing skills ( fagan & iglesias , 1999 ) . in niger , ecole des maris characterizes a community - based program that encourages men to advocate for and help develop health services to be accessed by mothers and children .
this program , funded by the united nations population fund ( unfpa ) , is based on the theoretical premise that traditional male social power can act as a brake on rates of improvement in maternal and child health .
because men in niger dominate household and community decision - making , the program explicitly involved men to transform attitudes and behaviors of whole communities , training
model husbands to enhance women 's access to local health services , especially assisted childbirth . similarly in turkey ,
the father support program ( fsp ) run by the anne ocuk egitim vakfi ( aev ) or mother child education foundation , was established when the foundation realized that fathers would benefit from the kind of support that had hitherto focused on the mothers of preschool children ; indeed , the mothers enrolled in aev 's mother support program had reported that their husbands were obstacles in supporting what women were learning to foster positive child development ( barker , doruz , & rogow , 2009 , p.8 ) .
the sessions targeted at fathers were thus designed to foster family - level communication and move beyond authoritarian models of fatherhood .
unsurprisingly , there exist few randomized - control trials and quasi - experimental evaluations of parenting programs that have included fathers . among the 34 programs in table1 , eleven ( eight of them in the united states ) benefited from a randomized controlled trial evaluation , and nine ( four of them in the united states ) from quasi - experimental evaluation .
even among these robustly evidenced programs , sample sizes can be tiny : for example just 27 intervention and 26 control fathers were included in the australian child obesity program ( healthy dads , healthy kids ) , while others ( e.g. , supporting father involvement and family foundations , both united states ) were couple interventions . among 14 of our tabulated programs ,
evaluations took the form of simple pre / post surveys , based on interviews with mixed groups of participants , while in some cases ( e.g. , proyecto papa in accin , peru ) , the evaluation was a cross - sectional survey , postintervention .
for example , in jordan , while 93% of participants reported that the unicef - led better parenting program was highly useful in conveying the role of fathers in children 's lives , the evaluation survey data contained only 18 fathers out of a total 336 participants so fathers views are essentially missing ( al - hassan & lansford , 2011 ) . and
while the turkish mother support program ( aev ) is internationally renowned because of its long - term evaluation ( yielding key evidence of lifetime effects and multilevel benefits ) , the associated turkish fathers support program has received limited evaluation , namely a pre- and postcourse attitude survey to parenting roles , behavior , and communication ( barker et al . , 2009 ) . in looking at the evidence from table1 , which includes some of the best - known and best - evaluated programs for parents in which fathers are known to have participated
, it is striking to find that ( a ) the evidence relating to fathers , where presented , is commonly secondary to the evidence pertaining to mothers , and that ( b ) the evidence relating to couple v. individual participants is , with one exception , missing altogether . indeed , the consort standards designed to provide a systematic and explicit framework for reporting quasi - experimental or experimental data are far from attentively adhered to . we indicate in table1 and table s1 a range of process and impact outcomes .
the process data describe the activities , schedules , and deliverables of the intervention , while the impact data describe outcomes related to effectiveness per se . in most cases ,
the lack of robust evaluation makes it difficult to evaluate findings and substantiate the claims that programs have made for positive outcomes of father engagement ; for this reason , we do not tabulate empirical findings .
the evidence base on fathers is both patchy and limited , reflecting the fragmented nature of data collection and program design . while relevant outcomes of parenting interventions include both parent - focused and child - focused variables , many of the interventions in table1 include only parent - focused variables , rather than comprehensive measures of family functioning and child developmental outcomes . as for research methods ,
only eight of the interventions ( e.g. , the home visiting program in canada ) include observation , rather than just parental reports , to capture the quality of parent child interactions .
few assessment periods extend to 6 months postintervention , although exemplar cohort studies with several - wave data such as family foundations , the leksand model and the oregon model of parent management training ( stepfathers ) are able to shed light on longer - term birth outcomes and school or family functioning .
few studies have included measures of mental health in their evaluation ; the family foundations program is one example of couple - based prevention program that explicitly examined the protective or buffering effects on stress and maternal depression ( feinberg , jones , kan , and goslin , 2010 ) .
some interventions have focused specifically on violence prevention , including reduced harsh parenting by fathers ( examples include triple p and dads on board in australia , and unicef 's better parenting program in jordan ) . and while outcomes in table1 encompass both father impact and father participation , some parenting interventions ( e.g. , celebrating fatherhood in the united kingdom and aangan in pakistan ) were designed principally to increase fathers engagement with local services , rather than to assess the impact of this on family or child wellbeing .
well - evaluated parenting interventions ( e.g. , incredible years , triple - p , family nurse partnership ) typically report moderate effects on parent and child outcomes , including parents knowledge acquisition , health behaviors and children 's externalizing behavior . however ,
father effects may remain elusive where reporting is not gender - disaggregated , where sample sizes of mothers or fathers are not equivalent , or when different procedures are used for fathers and mothers in data collection .
figure1 shows the steps of our literature searches . from a total 31,586 articles that mentioned fathers , we identified 868 articles that engaged with fathers in parenting or coparenting interventions and mentioned program evaluation or review , and an additional 153 publications from hand searches of the gray literature , many of which concerned the global south . in total , we screened 786 nonduplicate records .
we then excluded 472 records on the basis of abstracts and 115 papers on the basis of full - text articles , following our three exclusion criteria .
to the best of our knowledge , we identified the best - known parenting interventions or studies that included some evidence of father inclusion or father impact on child or family outcomes ( n = 199 publications ) .
we categorized the results of our final search according to whether this material consisted of ( a ) publications ( n = 113 ) assessing a given father - inclusive parenting program , or ( b ) reviews , commentaries , book chapters , and working papers ( n = 86 ) potentially useful for thematic discussion .
literature search prisma diagram we present a global overview of the evidence base in table1 and online supplementary table s1 .
table1 focuses on 34 exemplars ( n = 52 publications ) to capture the diverse range of father - inclusive parenting interventions , in order to draw thematic conclusions on the nature of the evidence base regarding gender - disaggregated parenting interventions .
table s1 reviews an additional 58 programs ( n = 61 evaluations ) , including 36 us - based programs ( 39 publications ) and 22 programs from other countries . upon examination ,
these were programs with smaller sample sizes , less rigorous evaluation of father participation or father impact , and/or interventions highly similar to chosen exemplars . in selecting our exemplars
given the state of the evidence base , programs from the global south were often less rigorously evaluated than those from the global north ; nonetheless , they were included to provide geographical spread .
in all , we list 92 programs ( n = 113 publications ) from 20 different countries australia ( n = 9 ) , brazil ( n = 1 ) , canada ( n = 5 ) , china ( n = 1 ) , finland ( n = 1 ) , germany ( n = 1 ) , iran ( n = 1 ) , israel ( n = 1 ) , jordan ( n = 1 ) , mexico ( n = 2 ) , niger ( n
= 1 ) , the netherlands ( n = 1 ) , new zealand ( n = 1 ) , pakistan ( n = 1 ) , peru ( n = 1 ) , sweden ( n = 2 ) , turkey ( n = 2 ) , ukraine ( n = 1 ) , united kingdom ( n = 7 ) , and usa ( n = 52 ) . while table s1 details , by country , the types of program , their settings , target group , father sample size , and data availability on father participation and impact , table1 provides detailed information on process and impact data , in addition to information on program type , mode of delivery , and target group .
global overview of parenting programs that evaluated father impact and participation ( 34 exemplars ) global programs are designated to a specific country where impact evaluation took place .
process data describe the extent to which fathers were included in the deliverables of the intervention ; impact data describe outcomes related to effectiveness .
most program evaluations are situated in the global north parenting interventions in the global south are rarely captured by systematic database searches , while parenting interventions captured by thematic hand searches rarely involve fathers .
these include programs targeting vulnerable families at risk of various negative outcomes ( e.g. , programs such as head start in the usa , directed at low - income parents to mitigate the effects of poverty on parenting and child outcomes ) .
they also include programs specifically targeting men with a history of violent behavior , or fathers of vulnerable children ( e.g. , born prematurely , with disabilities or conduct disorders ) , for prevention of future harm and/or improvement of parenting skills and child and family outcomes .
few programs aim to strengthen family - level resilience to enhance better - quality parenting .
regarding our first question ( how fathers are currently involved in parenting interventions ) , posed to evaluate the extent to which fathers are targeted for inclusion , the cases in table1 and table s1 demonstrate a wide range of program design and relatively low coherence overall .
some interventions target just one parent , most often the mother by default , as does , for example the positive parenting program ( triple p ) developed in australia ( fletcher , freeman , & matthey , 2011 ) .
others are designed to engage with mothers and fathers in separate groups , such as the proyecto papa in accin in peru , aiming to increase the quantity of father child engagement and fathers sensitivity to understanding child health and development issues ( mcallister et al . , 2012 ) .
still others , such as the fatherhood relationship and marriage education intervention ( frame ) work only with couples ( rienks et al .
some programmatic interventions are designed for high - risk families such as the australian dads on board intervention with fathers who have undertaken behavior - change programs due to their use of violence , while others are universal programs such as the leksand models in sweden , a maternity services - based intervention ( hoskings & walsh , 2010 ; johansson , 2012 ) .
we found noteworthy exemplars of parenting interventions offering relatively good designs as well as promising outcomes from addressing or including fathers ( table1 ) .
thus the supporting father involvement program in the united states focuses explicitly on fathers roles and coparenting : remarkably , this intervention tested whether men - only or coparent groups were the most effective means of supporting fathers participation in the lives of their children ( cowan , cowan , kline pruett , pruett , & gillette , 2014 ; knox , cowan , cowan , & bildner , 2011 ) .
other initiatives have been developed to support positive coparenting , taking this as a leverage point for the enhancement of family functioning and child outcomes ( feinberg & kan , 2008 ) .
also from the united states , head start exemplifies the type of intervention that focuses explicitly on the father - preschooler dyad , looking to improve child behavior , social skills , and school readiness by increasing fathers engagement with their children and enhancing their support and childrearing skills ( fagan & iglesias , 1999 ) . in niger , ecole des maris characterizes a community - based program that encourages men to advocate for and help develop health services to be accessed by mothers and children .
this program , funded by the united nations population fund ( unfpa ) , is based on the theoretical premise that traditional male social power can act as a brake on rates of improvement in maternal and child health .
because men in niger dominate household and community decision - making , the program explicitly involved men to transform attitudes and behaviors of whole communities , training
model husbands to enhance women 's access to local health services , especially assisted childbirth . similarly in turkey ,
the father support program ( fsp ) run by the anne ocuk egitim vakfi ( aev ) or mother child education foundation , was established when the foundation realized that fathers would benefit from the kind of support that had hitherto focused on the mothers of preschool children ; indeed , the mothers enrolled in aev 's mother support program had reported that their husbands were obstacles in supporting what women were learning to foster positive child development ( barker , doruz , & rogow , 2009 , p.8 ) .
the sessions targeted at fathers were thus designed to foster family - level communication and move beyond authoritarian models of fatherhood .
unsurprisingly , there exist few randomized - control trials and quasi - experimental evaluations of parenting programs that have included fathers . among the 34 programs in table1 , eleven ( eight of them in the united states ) benefited from a randomized controlled trial evaluation , and nine ( four of them in the united states ) from quasi - experimental evaluation .
even among these robustly evidenced programs , sample sizes can be tiny : for example just 27 intervention and 26 control fathers were included in the australian child obesity program ( healthy dads , healthy kids ) , while others ( e.g. , supporting father involvement and family foundations , both united states ) were couple interventions . among 14 of our tabulated programs , evaluations took the form of simple pre / post surveys , based on interviews with mixed groups of participants , while in some cases ( e.g. , proyecto papa in accin , peru ) , the evaluation was a cross - sectional survey , postintervention .
for example , in jordan , while 93% of participants reported that the unicef - led better parenting program was highly useful in conveying the role of fathers in children 's lives , the evaluation survey data contained only 18 fathers out of a total 336 participants so fathers views are essentially missing ( al - hassan & lansford , 2011 ) . and
while the turkish mother support program ( aev ) is internationally renowned because of its long - term evaluation ( yielding key evidence of lifetime effects and multilevel benefits ) , the associated turkish fathers support program has received limited evaluation , namely a pre- and postcourse attitude survey to parenting roles , behavior , and communication ( barker et al . , 2009 ) . in looking at the evidence from table1 , which includes some of the best - known and best - evaluated programs for parents in which fathers are known to have participated
, it is striking to find that ( a ) the evidence relating to fathers , where presented , is commonly secondary to the evidence pertaining to mothers , and that ( b ) the evidence relating to couple v. individual participants is , with one exception , missing altogether . indeed , the consort standards designed to provide a systematic and explicit framework for reporting quasi - experimental or experimental data are far from attentively adhered to .
we indicate in table1 and table s1 a range of process and impact outcomes . the process data describe the activities , schedules , and deliverables of the intervention , while the impact data describe outcomes related to effectiveness per se . in most cases ,
the lack of robust evaluation makes it difficult to evaluate findings and substantiate the claims that programs have made for positive outcomes of father engagement ; for this reason , we do not tabulate empirical findings .
the evidence base on fathers is both patchy and limited , reflecting the fragmented nature of data collection and program design . while relevant outcomes of parenting interventions include both parent - focused and child - focused variables , many of the interventions in table1 include only parent - focused variables , rather than comprehensive measures of family functioning and child developmental outcomes . as for research methods ,
only eight of the interventions ( e.g. , the home visiting program in canada ) include observation , rather than just parental reports , to capture the quality of parent child interactions .
few assessment periods extend to 6 months postintervention , although exemplar cohort studies with several - wave data such as family foundations , the leksand model and the oregon model of parent management training ( stepfathers ) are able to shed light on longer - term birth outcomes and school or family functioning .
few studies have included measures of mental health in their evaluation ; the family foundations program is one example of couple - based prevention program that explicitly examined the protective or buffering effects on stress and maternal depression ( feinberg , jones , kan , and goslin , 2010 ) . some interventions have focused specifically on violence prevention , including reduced harsh parenting by fathers ( examples include triple p and dads on board in australia , and unicef 's better parenting program in jordan ) . and while outcomes in table1 encompass both father impact and father participation , some parenting interventions ( e.g. , celebrating fatherhood in the united kingdom and aangan in pakistan ) were designed principally to increase fathers engagement with local services , rather than to assess the impact of this on family or child wellbeing .
well - evaluated parenting interventions ( e.g. , incredible years , triple - p , family nurse partnership ) typically report moderate effects on parent and child outcomes , including parents knowledge acquisition , health behaviors and children 's externalizing behavior . however , father effects may remain elusive where reporting is not gender - disaggregated , where sample sizes of mothers or fathers are not equivalent , or when different procedures are used for fathers and mothers in data collection .
our evidence base shows that systematic evaluation of father engagement and father effectiveness is stymied by the way parenting interventions are designed and delivered .
we turn to the second question guiding this review : what improvements can be made ? thus far , our results show that an overhaul of program design and delivery is required to obtain the necessary good - quality data on father and couple participation and impact . in
both research and community - based practice , a game change in this field would consist in engaging unequivocally with coparents rather than include just mothers and explicitly or implicitly marginalize fathers and other coparents , as in the bulk of parenting interventions implemented to - date .
table2 offers a guide to best practice to help rethink issues of ( a ) design , ( b ) delivery , and ( c ) evaluation on a global or local scale .
we identified , from our reading of the literature , key issues at each of these three stages of parenting interventions ; specifically , our research and clinical experience led us to highlight issues that present themselves as programmatically related to engaging coparents .
first , with respect to design , we identified seven major issues in terms of cultural , institutional , professional , operational , content , resources , and policy biases that work to marginalize fathers from the outset .
we have already raised some of the gender biases in cultural , institutional , and professional practices predicated on a deficit model that sees fathers as ineffective or neglectful as parents . because the impact of fathers on child wellbeing and family functioning , either positive or negative , is incontrovertible , it is short - sighted to sideline fathers , or indeed other coparents , and to ignore their contributions by focusing only on mothers .
asking the question how to make parenting interventions culturally compelling to both fathers and mothers as coparents? is a good starting point . the next fundamental requirement for
a game change in parenting interventions would be to pay attention to the necessity of gender - disaggregated data collection and data reporting
namely , exactly how many fathers , mothers , and coparents participated in a given program to render analyses by subgroup possible . a guide to best practice for building the evidence base of coparenting interventions second , with respect to delivery , we highlight key programmatic and logistic issues that can work to systematically disengage fathers from parenting interventions . for example
the timing and the location of program delivery can be obvious deterrents to fathers , and to working parents generally . the case of family foundations presents a good example of a method of delivering a program to first - time parents in a nonstigmatizing way , with 8-week sessions provided through an existing institutional niche , namely a hospital 's childbirth education department ( brown , feinberg & kan , 2011 ) .
involving fathers early on , offering flexible hours or visiting at home , being persistent in communicating the positive gains to children of father involvement , being explicit in welcoming them personally to participate ( not simply through the mothers ) , are all essential steps that remove barriers to father engagement ( maxwell , scourfield , featherstone , et al . , 2012 ) .
how programs are best implemented still remain unanswered : depending on cultural norms , risk profiles , financing and flexibility , programs might work best when targeting mothers and fathers during home visits or when delivering group - based parenting programs in health , community or employment settings , and might be most effective when reaching out to an individual parent or to two or more family members involved in coparenting .
finally , with respect to evaluation , key issues include moving beyond the evaluation of process data ( for example how many fathers or mothers participated in program activities and how and when impacts were measured ) .
what is needed is more robust and longer - term evaluation of outcome data , to include parenting quality , coparenting quality , family functioning , parental stress / depression , as well as child outcomes in relation to health , education , psycho - social development and maltreatment . at best
, this evidence is provided through randomized controlled trials , cohort studies , observations , or third - party reports .
we highlight here issues of reach and sustainability , rather than just effectiveness or impact .
these are important components of programmatic success that raise issues regarding possible tradeoffs between effectiveness , efficiency , and equity .
for example they raise questions as to whether the needs of harder - to - reach fathers are served in parenting interventions , and whether psycho - education programs targeting behavior change , in the absence of structural interventions to benefit vulnerable families , benefit mostly those who are already advantaged .
one of the most neglected aspects of evaluation relates to economic arguments , in terms of comparing the benefits of targeted versus holistic interventions or engaging with one parent versus coparents .
a comprehensive framework would include cost - effectiveness analyses , evaluating alternative yet comparable programs , and cost - benefit analyses , weighing tradeoffs of alternative investments for maximum social gain ( naudeau et al .
1602 ) , to allow better financing allocation mechanisms and scale - up of initiatives with demonstrable short- and long - term benefits .
p. 381 ) cited estimates from the washington state institute for public policy showing that two programs parents as teachers ( home visits and 3-year parent - group meetings ) and the nurse - family partnership program ( tested in three separate randomized controlled trials , rcts ) respectively produced a $ 800-per - family and a $ 17,000-per - family return on investment .
importantly , heckman and colleagues have argued that traditional equity - efficiency tradeoffs are not pertinent to interventions delivered to disadvantaged children in the early years of life : early child development programs offer both a cost - efficient way to produce a capable workforce and an equity - gain in helping those at greatest disadvantage ( heckman , 2009 ; heckman & masterov , 2007 ; campbell et al . , 2014 ) . from a policy point of view , it is not enough to know that early - life conditions matter .
it is important to know the costs and benefits of remediating early - life deficits at different stages of the life cycle ( conti & heckman , 2013 ) , as well as the longer - term benefits of enhancing the capabilities of children .
this review has fore - grounded discussion of parenting interventions that include fathers as significant actors in the lives of children .
it makes a threefold contribution to the extant literature : we provide a global and comparative overview of the evidence base , highlight why there are weaknesses in this field , and offer recommendations on father inclusion and engagement .
first of all , our review demonstrates a current lack of synthesis and coherence in the global evidence base . to - date the literature on father engagement
is highly fragmented across education , gender , social work , and health - related fields , with patchy synthesis therein .
it lacks a comparative perspective as well as global representation , which makes it difficult to extrapolate relevant data from the experience of practitioners and participants in the high - income north , and from the initiatives emerging from the global south .
second , our review highlights a number of reasons why the evidence base on parenting interventions that have included fathers is often of poor quality .
there are few exemplars using an overarching theoretical model or an integrated operational strategy from design through to evaluation .
most reviews to - date have included studies in which the small numbers of participating fathers were excluded from analysis , in which
parents were undifferentiated by gender , and in which the participation of couples versus individual parents was not accounted for .
our understanding of fathers participation and impact in parenting interventions is therefore still in its infancy , and the generalizability of findings far weaker for fathers than for mothers .
third , we make recommendations on father inclusion and engagement in parenting programs , but caution that these must be respectful of cultural values and consonant with structural constraints that shape everyday behavior .
some of the evidence presented in this review comes from father - only programs , with only a few focused more comprehensively on coparenting relationships . while this evidence is important , one must not be drawn into thinking that father - only programs are the best way forward
some noteworthy research suggests that they are not ( cowan et al . , 2009 ; spaulding , grossman , & wallace , 2009 ; wadsworth et al . , 2011 ) .
indeed , many men are extremely unwilling to attend men / father - only groups ( russell et al . , 1999 ) , while from a programmatic point of view , men - only services are often an add - on to other programs , deemed unsustainable when resources are short .
furthermore , behavioral change within families seems unlikely to be sustained when only one parent , whether the mother or father , is the sole target of a parenting intervention .
we need to comprehensively understand the community of care provided to children , and the sensitivity of children to a range of caregiving contexts .
a body of cross - cultural research thus reminds us of the significance of alloparents ( including grandparents , other blood relatives , and community neighbors ) as alternative caregivers with a stake in the everyday responsibilities of parenting , beyond sole consideration of the mother or biological parent ( bentley , 2009 ) .
in fact , children may be raised by several generations of female relatives , as in mexico ( solis - camara et al .
, 2014 ) , or placed under the care of different relatives in response to changing socioeconomic demands , as in afghanistan ( panter - brick , goodman , tol , & eggerman , 2011 ) .
this raises questions regarding which program modalities are the most compelling in which contexts , focusing attention on the means of program delivery ( group - based vs. home visits , universal v. targeted , mother - only , father - only , or coparents ) , above and beyond attention to program content .
recent advances in the field of child health and development have also reminded us that we need to rethink interventions in terms of the best leverage points to build family - level resilience , not just minimize risk to children ( panter - brick & leckman , 2013 ) .
they also challenge us to rethink the kind of evidence needed to detect differential susceptibility to context, regarding both adverse and beneficial effects of parenting ( pluess & belsky , 2010 ) .
understanding the fundamental dimension of gender in parenting programs is as significant as current efforts to target the different subgroups of mothers ( lone parent , teenage mothers , low - income mothers , minority - group mothers , substance - abusing mothers , and/or incarcerated mothers ) in the global north , or indeed to recognize the caregiving importance of grandmothers , mothers - in - law , and other relatives in the global south .
the gendered and social nature of parenting means that fathers , mothers , and other caregivers arrive with distinct expectations , assets , constraints , and experiences : these can not be homogenized or overlooked . in lower - income countries , women ( e.g. , in the aev - led initiatives in turkey , aangan in pakistan ) and professionals ( e.g. , healthcare and development workers in niger , jordan , ukraine ) have actively sought methods of engaging men in family issues .
they work to mobilize men 's interest and to engage men in private and public spaces , in order to enhance interpersonal communication , family - level care , community action , and child outcomes .
parenting interventions thus need to be compelling to all stakeholders and decision - makers , namely fathers and other significant caregivers as well as mothers , program directors , and funders .
more specifically , resources can be unnecessarily wasted where there is no effective engagement with fathers in their roles as caregivers , because this may undermine a range of existing parenting activities and negate additive or synergistic impacts in the lives of children . whether absent or present ,
fathers have an impact on children , mothers , and family dynamics , for better and for worse .
it may also undermine practitioners and policy makers duty of care , in failing to assess risk , enhance resilience , and optimize the positive impacts on family and child wellbeing that are aspired to in parenting interventions .
key priorities are to engage fathers and coparenting couples successfully , to disaggregate process and impact data by fathers , mothers , and coparents , and to pay greater attention to issues of reach , sustainability , cost , equity , and scale - up .
fathers have substantial impact on child development , wellbeing , and family functioning , yet parenting interventions rarely target men , or make a dedicated effort to include them.our review of the global evidence on parenting interventions that have included men as parents or coparents shows that insufficient attention is given to reporting father participation and impact.a fundamental change in the design and delivery of parenting interventions is required to overcome pervasive gender biases and to generate robust evidence on outcomes , differentiated by gender and by couple effects in evaluation .
fathers have substantial impact on child development , wellbeing , and family functioning , yet parenting interventions rarely target men , or make a dedicated effort to include them .
our review of the global evidence on parenting interventions that have included men as parents or coparents shows that insufficient attention is given to reporting father participation and impact .
a fundamental change in the design and delivery of parenting interventions is required to overcome pervasive gender biases and to generate robust evidence on outcomes , differentiated by gender and by couple effects in evaluation .
fathers have substantial impact on child development , wellbeing , and family functioning , yet parenting interventions rarely target men , or make a dedicated effort to include them.our review of the global evidence on parenting interventions that have included men as parents or coparents shows that insufficient attention is given to reporting father participation and impact.a fundamental change in the design and delivery of parenting interventions is required to overcome pervasive gender biases and to generate robust evidence on outcomes , differentiated by gender and by couple effects in evaluation .
fathers have substantial impact on child development , wellbeing , and family functioning , yet parenting interventions rarely target men , or make a dedicated effort to include them .
our review of the global evidence on parenting interventions that have included men as parents or coparents shows that insufficient attention is given to reporting father participation and impact .
a fundamental change in the design and delivery of parenting interventions is required to overcome pervasive gender biases and to generate robust evidence on outcomes , differentiated by gender and by couple effects in evaluation .
| backgrounddespite robust evidence of fathers impact on children and mothers , engaging with fathers is one of the least well - explored and articulated aspects of parenting interventions .
it is therefore critical to evaluate implicit and explicit biases manifested in current approaches to research , intervention , and policy.methodswe conducted a systematic database and a thematic hand search of the global literature on parenting interventions .
studies were selected from medline , psychinfo , ssci , and cochrane databases , and from gray literature on parenting programs , using multiple search terms for parent , father , intervention , and evaluation .
we tabulated single programs and undertook systematic quality coding to review the evidence base in terms of the scope and nature of data reporting.resultsafter screening 786 nonduplicate records , we identified 199 publications that presented evidence on father participation and impact in parenting interventions . with some notable exceptions , few interventions disaggregate father or
couple effects in their evaluation , being mostly driven by a focus on the mother child dyad .
we identified seven key barriers to engaging fathers in parenting programs , pertaining to cultural , institutional , professional , operational , content , resource , and policy considerations in their design and delivery.conclusionsbarriers to engaging men as parents work against father inclusion as well as father retention , and undervalue coparenting as contrasted with mothering .
robust evaluations of father participation and father impact on child or family outcomes are stymied by the ways in which parenting interventions are currently designed , delivered , and evaluated .
three key priorities are to engage fathers and coparenting couples successfully , to disaggregate process and impact data by fathers , mothers , and coparents , and to pay greater attention to issues of reach , sustainability , cost , equity , and scale - up .
clarity of purpose with respect to gender - differentiated and coparenting issues in the design , delivery , and evaluation of parenting programs will constitute a game change in this field . |
oxidation of lipids is widely regarded
as a contributing factor
to neurodegeneration , inflammation , and cancer .
the polyunsaturated
fatty acid residues of membrane phospholipids are prime targets for
oxidative attack , as these molecules possess multiple bis - allylic hydrogens , which are sensitive to abstraction by oxidizing
agents .
abstraction of a labile hydrogen in the presence of o2 leads to a radical chain oxidation mediated by lipid peroxyl
radicals , which consumes multiple fatty acid moieties and generates
a panoply of products . among these
are reactive aldehydes [ e.g. , 4-hydroxynonenal
( hne ) , figure 1a ] , which are capable of protein ,
dna , and rna modification .
lipid electrophile modification of nucleic
acids can induce base - pair substitutions , frameshift mutations , and
strand breaks , whereas modification of proteins distorts tertiary
structure and alters protein function .
furthermore , free radical species
can recycle to oxidize neighboring phospholipids in a continuum until
the radical is intercepted .
pin1 binds
the cis - phosphorylated serine - proline moiety via a ww binding domain .
the ppiase domain of pin1 catalyzes the conversion of the prolyl bond
from cis to trans .
hne is generated in vivo at low micromolar levels
endogenously and is elevated in tissues experiencing an oxidative
insult , such as the brains of alzheimer s disease ( ad ) patients
and the lungs of patients with chronic obstructive pulmonary disease . in these and other conditions , hne modification of cellular constituents
is associated with disease pathogenesis . however , the contribution
of hne to cellular fate is complex and incompletely understood . to
gain an understanding of the spectrum of biochemical consequences
of hne production , our laboratory used a multipronged approach to
compile an inventory of protein signaling networks activated by hne .
using click chemistry and mass spectrometry , an inventory of protein
targets of hne was generated ; separately ,
microarray analysis of hne - treated cells revealed up- or down - regulated
genes in response to treatment .
using
bioinformatic analysis , protein targets of hne were linked to differentially
regulated genes via specific transcription factors .
analysis of the protein
adduction inventory revealed that peptidyl - prolyl cis / trans - isomerases ( ppiases ) are a class
of proteins modified by hne .
peptidylprolyl cis / trans - isomerase a1 ( pin1 ) is a unique ppiase that catalyzes only phosphoserine-
and phosphothreonine - proline conversions from cis to trans ( figure 1b ) .
this enzyme is
particularly important in phosphorylation - dependent signaling pathways ,
as proline - directed phosphatases are trans - specific .
molecules that covalently modify pin1 s catalytic
or binding site residues have been previously demonstrated to induce
apoptosis and inhibit cell proliferation , possibly due to inhibition
of pin1 s actions on the cell cycle .
epigallocatechin gallate
( egcg ) , an anticancer polyphenol in green tea , inhibits cancer cell
growth by interacting with arg-17 of pin1 in the ww domain , preventing
pin1substrate interactions .
additionally , pib , a derivative of juglone ( 1,4-naphthoquinone ) ,
has been reported to induce cell death in a pin1-dependent fashion .
the chemistry and biology of pin1 modification
by lipid electrophiles
have not been investigated .
pin1 contains multiple exposed cys , his ,
and lys residues capable of reacting with hne . using maldi - tof mass
spectrometry , we mapped the hne adduction sites on pin1 .
data from
maldi - tof and maldi - tof / tof analysis with purified pin1 treated with
hne support the adduction of critical active site residues , with cys-113
being the most reactive .
treatment of mda - mb-231 cells with hne , followed
by immunoprecipitation and high - resolution ms / ms analysis , also revealed
the presence of a cys-113hne michael adduct within the active
site of the protein .
sirna - mediated knockdown of pin1 afforded protection
from hne - induced cell death .
these studies demonstrate that pin1 is
an important target for modification by lipid electrophiles , and this
leads to alteration in cell signaling and viability .
mda - mb-231 cells , a triple - negative
human breast carcinoma cell line , were obtained from the american
type culture collection ( atcc ) and were cultured in rpmi1640 medium
( gibco ) supplemented with 10% fetal bovine serum ( fbs ) .
mda - mb-231
cells were maintained at 37 c in a humidified cell culture incubator
under 5% co2 and 95% air .
ahne , hne , or dmso ( vehicle control ) was added to cell culture medium
to achieve a final dmso concentration of less than 1% .
purified
pin1 was obtained from genway biosciences ( gwb-523efe ) and was buffer - exchanged
once with dulbeccos - modified pbs ( gibco ) before use .
protein
( 2.5 g ) was diluted to 25 l with pbs and incubated for
the indicated times with hne at 37 c with agitation .
reactions
were terminated with nabh4 and rotated end - over - end for
30 min at room temperature ( rt ) .
samples were dried with a speedvac
and reconstituted in 10 l of 6 m guanidine hydrochloride for
45 min at rt .
each sample was incubated with dtt ( 150 m ) for
30 min at 37 c , followed by 750 m iodoacetamide for 15
min at rt in the dark .
samples were diluted 20-fold with 20 mm nh4hco3 and digested with 500 ng of chymotrypsin for
24 h at 37 c . the following day , chymotryptic digests were desalted
using c18 ziptips , followed by elution with 60% acetonitrile/0.1%
trifluoroacetic acid .
samples were mixed 1:1 by volume with matrix
[ 20 mg / ml -cyano-4-hydroxycinnamic acid ( chca ) in 60% acetonitrile ]
and subjected to maldi mass spectrometry .
mda - mb-231 cells were treated with
ahne for 1 h in serum - free medium . following treatment ,
cells were
washed with pbs and collected by scraping and centrifugation for 5
min at 1000 g .
cell pellets were lysed in buffer containing
50 mm hepes , ph 7.5 , 150 mm nacl , 0.5% igepal , and mammalian protease
inhibitor cocktail ( sigma - aldrich ) .
suspended cell pellets were sonicated
by 10 1 s pulses with a virsonic cell disruptor and then cleared by
centrifugation at 16000 g for 10 min .
bicinchoninic
acid ( bca ) assay was used to determine the protein concentration and
was performed according to the manufacturer s instructions
( thermo ) .
each sample was diluted to 2 mg / ml in 3 ml of lysis buffer
and reduced with 2 mm nabh4 for 1 h at rt with agitation
to stabilize adducts .
unreacted nabh4 was quenched with
3 l of acetone , and reduced lysates were subjected to huisgen
1,3-cycloaddition chemistry by the addition of 0.2 mm biotin benzoin
( n3-biotin linker , porter laboratory ) , 1 mm tris(2-carboxyethyl)phosphine
( tcep ) , 0.1 mm ligand tris((1-benzyl-1h-1,2,3-triazol-4-yl)methyl)amine
( triazole ligand , porter laboratory ) , and 1 mm cuso4 . tubes
containing samples were covered with foil and rotated end - over - end
for 2 h at rt .
proteins were precipitated by the addition of 6 ml
( twice the volume of sample ) of ice - cold methanol for 30 min on ice
and pelleted by centrifugation
. pellets were washed twice with cold
methanol , resuspended in 1 ml of 0.5% sds , and boiled for 5 min .
after
they were boiled , 50 l of sample was aliquotted to serve as
the input fraction to demonstrate equal protein loading onto streptavidin
beads .
the remaining 950 l was diluted to 10 ml with pbs containing
1 ml of streptavidin - agarose beads and 0.1% sds .
the following day , beads were
washed with 1% sds , 4 m urea , pbs containing 1 m nacl , and pbs each .
to elute ahne - modified proteins from the streptavidin beads , samples
were incubated under 365 nm uv light with rotation for 90 min at rt .
during this step
eluted proteins
were separated from beads by centrifugation , concentrated , and subjected
to sds - page and western blot .
samples for sds - page
were mixed 1:1 by volume with laemmli buffer containing 5% ( w / v ) -mercaptoethanol
and boiled for 5 min .
proteins in the gel were transferred onto a
0.45 m nitrocellulose membrane and blocked with 5% nonfat dry
milk for 1 h. primary antibodies were incubated ( 1:1000 for pin1 ,
flag , and gapdh ) with membranes overnight at 4 c .
the following
day , blots were washed with tris - buffered saline containing 0.1% tween-20
( tbst ) three times and then incubated with secondary antibody for
1 h at rt with shaking .
blots were washed three times with tbst and
developed using luminol - based detection .
flag and pin1 antibodies
were obtained from cell signaling , while gapdh antibody was obtained
from santa cruz biotechnology .
all spectra were acquired
in positive ion mode on either an autoflex speed tof ms or an ultraflextreme
tof / tof ms ( bruker daltonics ) , both equipped with a nd : yag ( solid
state ) laser operating at 355 nm .
peptide - chca solutions ( 1 l )
were deposited on maldi target plates and air - dried prior to analysis .
full mass spectra of digested peptides were obtained in reflectron
mode on the ultraflextreme , using a 5004000 mass range .
peptide
masses and sequence ions were manually examined for mass shifts of
+ 158 m / z or + 141 m / z , corresponding to reduced hne
michael
adducts or reduced schiff base adducts , respectively . selected peptide
ions were dissociated using lift on the tof / tof .
tof / tof fragmentation
data were interrogated using flexanalysis software and analyzed against
a theoretical peptide digest using protein prospector .
a cdna clone of
pin1 ( mammalian gene collection accession number bc002899 ) was obtained
from the vanderbilt microarray shared resource cdna clone collection .
pin1 was pcr - amplified from potb7 using the primers 5-cctgctagctccaccatggattacaaggatgacgacgataaggcggacgaggagaagctgccgc-3
( includes an n - terminal flag tag ) and 5-cctggtacctcactcagtgcggaggatga-3.
the pcr product was digested with nhei and kpni and
ligated into pcdna3.1 hygro(+ ) ( invitrogen ) .
mda - mb-231 cells at 80%
confluency were transfected using 10 g of expression construct
and 20 l of lipofectamine ( thermo - scientific , lafayette , co )
for 24 h. after 24 h , cells were incubated with fresh medium for an
additional 48 h at 37 c before treatment and collection .
the direct immunoprecipitation
kit ( pierce ) was used to immunoprecipitate flag - pin1 from mda - mb-231
cells .
eighty microliters of anti - flag resin ( sigma - aldrich ) was loaded
onto columns and washed once with pbs .
one milligram of protein lysate
was added per column in 500 l of total volume .
columns were
plugged and rotated end - over - end overnight at 4 c .
the following
day , columns were unplugged and centrifuged at 1000 rpm to elute nonspecific
proteins .
beads containing flag - pin1 were washed three times with
ip / lysis wash buffer and once with conditioning buffer containing
0.5% protease inhibitors ( pierce ) .
eluents were neutralized with the
addition of 1 m naoh and treated with nabh4 to stabilize
hne - adducted proteins . because multiple columns were necessary to
achieve sufficient protein quantities for proteomics , samples were
pooled and concentrated to 50 l using 3 kda molecular weight
cutoff filters immediately prior to sds - page . following sds - page of immunoprecipitated
flag - pin1
, the gel was stained with colloidal coomassie blue , and
the pin1 band was excised from the gel and cut into 1 mm pieces .
the gel pieces were treated with 45 mm dtt for 45 min , and
available cys residues were carbamidomethylated with 100 mm iodoacetamide
for 45 min .
after the gel pieces were destained with 50% acetonitrile
in 25 mm ammonium bicarbonate , pin1 was digested with endoproteinase
aspn ( 10 ng/l ) in 25 mm nh4hco3 overnight
at 37 c .
peptides were extracted by gel dehydration ( 60% acetonitrile ,
0.1% tfa ) , the extract was dried by vacuum centrifugation , and the
peptides were reconstituted in 0.1% formic acid .
the peptide solution
was loaded onto a capillary reversed - phase analytical column ( 360
m o.d .
the analytical column was packed with 20 cm
of c18 reversed - phase material ( jupiter , 3 m beads , 300 ,
phenomenex ) , directly into a laser - pulled emitter tip .
peptides were
gradient - eluted at a flow rate of 500 nl / min , and the mobile phase
solvents consisted of water containing 0.1% formic acid ( solvent a )
and acetonitrile containing 0.1% formic acid ( solvent b ) .
a 90 min
gradient was performed , consisting of the following : 010 min ,
2% b ; 1050 min , 245% b ; 5060 min , 4590%
b ; 6065 min , 95% b ; 6570 min 952% b ; and 7090
min , 2% b. eluting peptides were mass analyzed on an ltq orbitrap
velos mass spectrometer ( thermo scientific ) , equipped with a nanoelectrospray
ionization source .
the instrument was operated using a data - dependent
method with dynamic exclusion enabled .
full - scan ( m / z 3002000 ) spectra were acquired with the
orbitrap ( resolution 60,000 ) , and the top 16 most abundant ions in
each ms scan were selected for fragmentation in the ltq .
an isolation
width of 2 m / z , activation time
of 10 ms , and 35% normalized collision energy were used to generate
ms2 spectra .
dynamic exclusion settings allowed for a repeat count
of 2 within a repeat duration of 10 s , and the exclusion duration
time was set to 15 s. for identification of pin1 peptides , tandem
mass spectra were searched with sequest ( thermo fisher scientific )
against a human subset database created from the uniprotkb protein
database ( www.uniprot.org ) . variable modifications of + 57.0214
on cys ( carbamidomethylation ) , + 15.9949 on met ( oxidation ) , + 141.1279
on lys and arg ( corresponding to reduced schiff base ) , and + 158.1306
on cys , lys , and his residues ( corresponding to reduced hne modification )
were included for database searching .
spectra acquired of pin1 peptides
of interest were then inspected using xcalibur 2.1 qual browser software
( thermo scientific ) .
tandem mass spectra of hne - modified peptide precursors
and the spectra acquired of the corresponding unmodified peptide forms
were examined by manual interrogation .
sirna was diluted
1:200 in optimem ( gibco ) for 5 min , and separately , dharmafect was
diluted 1:40 in optimem .
after 5 min , solutions were combined and
incubated for 20 min at rt .
the solution containing optimem , dharmafect ,
and sirna was added to 4 ml of medium containing 2 10 mda - mb-231 cells and incubated overnight at 37 c .
the medium
was changed the following day , and cells were incubated for an additional
48 h at 37 c .
cells were lysed and processed for western blot .
for viability assays , 7500 cells / well
were seeded in 96-well plates ,
and wells were incubated with 3.75 l of sirna / dharmafect / optimem
solution for 24 h before the medium was changed . after an additional
48 h ,
the cell viability was assessed using
the calcein am assay , whereby a cell - permeable substrate ( calcein
am ) penetrates live cells and is converted to fluorescent calcein
by intracellular esterases . just prior to the assay ,
mda - mb-231 medium
was removed , and cells were washed twice with pbs .
calcein am ( invitrogen )
was dissolved in dmso for a stock concentration of 2 mm .
calcein am
stock was diluted to 2 m in pbs and added to cells for 30 min
at rt .
after incubation , the solution was removed from the wells ,
and fluorescence was quantified using a spectramax plate reader ( excitation
= 494 nm , and emission = 517 nm ) .
a one - way anova for treatment
followed by tukey posthoc test was used to assess statistical significance .
to map the adduction sites
of pin1 by hne , we adapted a previously reported protocol for determining
the adduction sites of cytochrome c. purified pin1 was treated with a high concentration of
hne ( 2 mm ) for 3 h at 37 c , followed by nabh4-mediated
aldehyde reduction . although 2 mm greatly exceeds the pathophysiological
range of hne concentrations reported in cells , the aim of this experiment
was to compile all of the potential pin1 modification sites .
samples
were carboxamidomethylated by treatment with iodoacetamide , then digested
with chymotrypsin , and analyzed by maldi - tof ms .
several peaks with
mass shifts of + 158 m / z relative
to theoretical pin1 chymotryptic peptides were present in the digest ,
corresponding to reduced michael adducts of hne ( figure 2a ) . in the case of hne modification at a cys residue , the
peak shift occurs + 101 m / z relative
to the alkylated peptide because of the replacement of the carboxamidomethyl
group ( figure 2a ) .
michael adducts , as well as unmodified peptides ,
were fragmented by maldi - tof / tof to confirm peptide identification
and identify the site of hne modification .
tof / tof analysis of peak
1643 m / z revealed the presence of
an hne cys reduced michael adduct occurring at cys-113 ( figure 2b , bottom panel ) , while his-157 adduction was observed
upon fragmentation of peak 2372 m / z ( figure s1 , bottom panel , in the supporting
information ) .
interestingly , both cys-113 and his-157 are located
in the pin1 active site and are involved in its catalytic function .
lys-132 adduct was also detected ( table 1 and figure s2 in the supporting
information ) .
because peaks of modified and corresponding unmodified
pin1 peptides are detectable simultaneously in the maldi - tof spectra ,
the relative reactivity of recovered peptides can be ascertained.as shown in figure 2a and table 1 , the intensities
of peaks corresponding to cys-113 and his-157 are increased approximately
3-fold relative to their respective unmodified peaks . by contrast ,
the adducted to unadducted peak ratio corresponding to lys-132 adduction
was 0.23 , indicating a relatively lower sensitivity to hne modification .
these data support the hypothesis that active site residues in pin1
are particularly susceptible to modification by hne .
( a ) maldi - tof
spectrum of chymotryptic digest from hne - treated pin1 .
two peptides
are indicated , and arrows represent peaks with shifts of + 158 m / z from native pin1 chymotryptic digests .
peak 1643 is shifted 101 m / z from
the cysteine - containing alkylated peptide indicated .
( b ) maldi - tof / tof
spectrum of peaks 1542 ( top ) and 1643 m / z ( bottom ) from hne - treated pin1 chymotryptic digest .
spectral interrogation
reveals the presence of a mass shift of + 158 m / z between y12 and y13 ( or + 101 m / z as compared to top spectrum containing
alkylated cys-113 ) in the bottom spectrum corresponding to a reduced
michael adduct occurring at cys-113 .
matched masses of b and y ions
in the spectrum to corresponding theoretical masses of pin1 peptide
sdcssakargdlgaf and sdc(+158 m / z)ssakargdlgaf are indicated by arrows . the asterisk within the peptide
sequence indicates the site of modification .
we investigated the relative rate and extent of
adduction of the
two active site residues .
purified pin1 was incubated with 25 , 100 ,
or 200 m hne for 3 h , followed by nabh4 reduction ,
digestion , and analysis by maldi - tof ms .
spectral investigation revealed
that the formation of the cys-113 adduct increased with hne concentration ,
whereas his-157 adduct formation was minimal ( figure 3a ) .
incubation of pin1 with hne for increasing times revealed
complete modification of cys-113 by hne before any his-157 modification
was observed ( figure 3b ) .
this indicates that
the catalytic cysteine of pin1 is the primary target for hne modification .
relative
rate of formation of michael adducts with c113 vs h157
( a ) as a function of hne concentration and ( b ) as a function of time
of hne incubation .
for the graph in panel a , various concentrations
were incubated for 3 h before termination of the reaction with nabh4 . for function of time experiments , 200 m hne was incubated
with pin1 for indicated times .
previous studies have
demonstrated that administration of hne to cells results in extensive
protein adduction . the use of alkynylated analogues
as taggable surrogates for electrophiles allows for the separation
of adducted proteins from unadducted proteins .
cells treated
with ahne are lysed and exposed to click chemistry , in which the alkyne
at positions 89 of ahne reacts with an azido - biotin tag bearing
a uv - cleavable linker .
only hne - adducted proteins are biotinylated ,
so these targets can be purified by binding to streptavidin - coated
beads , followed by elution from the beads with uv light .
western blotting of eluted fractions with antibodies
allows for detection of specific proteins that are adducted by ahne .
mda - mb-231 cells were chosen as the model cell line for this study
because of a previously reported dependence on pin1 for cell proliferation .
western blots of lysates from mda - mb-231 cells
dosed with 2.550 m ahne for 1 h revealed a dose - dependent
increase in pin1 adduction as a function of concentration ( figure 4b ) .
a blot of the input fraction indicated equal
loading of cell lysate onto streptavidin beads , as well as an absence
of changes in pin1 protein levels with ahne treatment ( figure 4b ) .
( a ) schematic of detection of hne - adducted proteins in vitro , whereby
targets of ahne are separated from nontargets via click chemistry ,
followed by streptavidin purification , uv light - induced elution , subject
to western blot , and probed with anti - pin1 antibody .
treatment of mda - mb-231 cells with ahne and subjection
to click - mediated separation of electrophile - modified proteins followed
by western blot with anti - pin1 antibody reveal a concentration - dependent
adduction of pin1 in this cell line ( top blot ) ; the lower blot is
shown to demonstrate equal protein loading onto streptavidin beads .
identification of electrophile - modified residues of pin1
in cells treated with hne would provide critical information into
the role the adduct plays in altering pin1 biochemical functions .
our laboratory previously elucidated the hne adduction sites of hsp90
via geldanamycin - biotin affinity capture and lc - coupled tandem mass
spectrometry ( lc - ms / ms ) . in the current
study , we employed a similar strategy of pin1 affinity purification
and lc - ms / ms analysis to examine hne adduction of pin1 . to facilitate
isolation of pin1 from cells treated with hne ,
a flag - pin1 plasmid
was generated and transfected into mda - mb-231 cells ( figure 5a ) .
immunoprecipitation using anti - flag resin enabled
purification of sufficient protein to observe with sds - page analysis
and subsequent colloidal coomassie staining ( figure 5b ) .
the resolved pin1 band was excised and in - gel digested
with endoproteinase aspn , and then , peptides were extracted and analyzed
on an ltq - orbitrap velos mass spectrometer .
the lc - ms base peak chromatogram
demonstrates thorough proteolytic digestion of the excised pin1 gel
band ( figure 5c , top panel ) .
following lc - ms / ms
analysis , the resulting tandem mass spectra were searched via sequest
against a human database , and assigned spectra corresponding to aspn - derived
pin1 peptides of interest were validated via manual examination . among
those peptides detected ,
pin1 peptides containing cys-113 ( dcssakarg ,
residues 112120 ) and his-157 ( dsgihiilrte- , residues 153163 )
were identified ( figure 5c and figure s3 in
the supporting information ) . upon mass
spectral interrogation , no michael adducts of the peptide containing
his-157 were detected ( figure s3 in the supporting
information ) .
however , in addition to detecting the unmodified
peptide containing cys-113 , an hne - adducted species of this peptide
was also observed ( figure 5c ) .
relative to
the unmodified ( and reduced ) theoretical mass of the peptide , the
adducted peptide contained a mass shift of 158.13 da , corresponding
to reduced hne adduction having an elemental composition c9h18o2 .
the theoretical m / z values of the observed peptide precursors were used to
generate extracted ion chromatograms ( xics figure 5c ) for each peptide form .
the calculated mass errors of the
unmodified and hne - adducted peptide were each within 1 part per million
( ppm ) of theoretical values , adding high confidence in the identification
of the hne - adducted peptide .
in addition , the hne - adducted peptide
displayed the expected shift in retention time due to increased hydrophobicity ,
relative to the unmodified peptide ( figure 5c ) .
tandem mass spectra acquired from the modified peptides were
manually interrogated to determine the site of adduction , and for
comparison , the acquired ms / ms spectrum of the unmodified peptide
was also examined .
michael adducts or schiff bases ,
further demonstrating the sensitivity of the catalytic cysteine of
pin1 to electrophile adduction .
pin1 is covalently modified at cys-113
in mda - mb-231 cells treated
with hne .
( a ) western blot of pin1 ( top ) and flag from mda - mb-231
cells transfected with flag - pin1 .
( b ) 1d gel of flag - pin1 immunoprecipitation
from mda - mb-231 cells treated with hne .
( c ) base peak chromatogram
of peptides derived from immunoprecipitated and in - gel - digested flag - pin1
and extracted ion chromatograms of observed forms of pin1 peptide ,
dcssakarg .
the base peak chromatogram ( top ) shows the lc - ms elution
profile of peptides generated with endoproteinase aspn digestion of
the excised pin1 band .
the observed m / z values of a selection of peptides are provided above their corresponding
chromatographic peaks .
extracted ion chromatograms ( xics ) of the in
vivo unmodified and hne - modified peptide dcssakarg , residues 112120 ,
are shown in middle and lower panels , respectively .
a tolerance of
10 ppm around the theoretical m / z values of the precursor ions observed for peptide forms of dcssakarg
was used to generate the xics .
the theoretical
values of these precursor ions are adjacent to the observed peaks
and were used to calculate ppm mass errors ( shown in parentheses )
for the monoisotopic ions of the identified peptide forms .
note that
the pin1 gel band was treated with dtt and iodoacetamide , resulting
in carbamidomethylation of available cys residues .
thus , the in vivo
unmodified form of the peptide dcssakarg contains a carbamidomethyl
group on cys-113 .
( d ) ms / ms spectra of in vivo unmodified ( top ) and
hne - modified peptide ( bottom ) , dcssakarg . the [ m + 2h ] precursor ions with m / z values
476.21 and 526.77 , respectively , were selected for fragmentation .
the observed singly and doubly protonated b- and y - type product ions
are assigned to their corresponding m / z peaks in the tandem mass spectra .
the amino acid sequence is provided
above the annotated spectra , and the interresidue - placed brackets
denote sites of fragmentation that occurred with collision - induced
dissociation ( cid ) to produce the observed product ions . an asterisk
is used to indicate the localization of the cysteine residue ( cys-113 )
modified by hne .
egcg and pib are pharmacological agents
capable of suppressing proliferation of some cell types in a pin1-dependent
manner .
hne , which is produced endogenously and
appears to modify the catalytic cysteine of pin1 , is also cytotoxic .
although hne has many targets besides pin1 , we reasoned that the toxicity
of hne in mda - mb-231 cells may be partly due to modification of this
protein .
we used sirna to knock down pin1 in cells and verified the
knockdown by western blot ( figure 6a ) .
cells
transfected with scrambled sirna and pin1 sirna were treated with
increasing doses of hne or the pin1 inhibitor egcg for 48 h , at which
point cell viability was measured .
unsurprisingly , pin1 sirna - transfected
mda - mb-231 cells were less sensitive to egcg - induced growth inhibition
as compared to scrambled sirna - transfected cells ( ic50 values
for scrambled and pin1 sirna - tranfected cells were 21.53 and 34.80 ,
respectively ) ( figure 6b ) .
cell viability was
statistically higher in egcg - treated pin1 sirna cells as compared
to scrambled control cells at 25 , 30 , and 40 m ( figure 6b ) .
interestingly , pin1 knockdown also afforded
protection from hne toxicity relative to scrambled sirna - transfected
( control ) cells .
the percent viability of pin1 sirna cells treated
with hne was statistically increased at 20 , 25 , and 30 m as
compared to scrambled control sirna cells , resulting in an increase
in the ic50 for hne ( 21.29 m for scrambled vs 29.24
m hne for pin1 sirna cells , respectively ) ( figure 6c ) .
these data support the hypothesis that hne modification
of pin1 at cys-113 plays a role in the cellular response to lipid
electrophile production during conditions of oxidative stress .
knockdown of
pin1 partially protects mda - mb-231 cells against hne - induced
growth inhibition .
( a ) western blot of pin1 sirna and scrambled control
( gapdh loading control ) .
( b ) viability assay of scrambled and pin1
sirna - transfected mda - mb-231 cells treated with the pin1 inhibitor
egcg .
knockdown of pin1 in mda - mb-231 cells results in protection
from egcg - induced growth inhibition ( 21.53 m for scrambled
vs 34.80 m for pin1-sirna transfected cells ) . ( c )
viability
assay of scrambled and pin1 sirna - transfected mda - mb-231 cells treated
with hne .
knockdown of pin1 in mda - mb-231 cells results in a shift
in the ic50 of hne ( 21.29 m for scrambled vs 29.24
m for pin1-sirna transfected cells ) .
n = 8/group ;
error bars represent standard deviation ; * p <
0.05 , * * p < 0.01 , and * * * p <
0.001 .
the cis isomer of peptidyl - prolyl motifs
in protein sequences occurs
with a frequency of approximately 56% , a large majority of which appear at surface - exposed bend , coil ,
or turn conformations .
phosphorylation of serine or threonine preceding
proline renders the peptide bond resistant to conventional ppiases ,
such as cyclophilin ( cyp18 ) and fkbp ( fkbp12 ) enzymes , while simultaneously
generating a pin1-bindable motif .
the
tertiary structure and activity of proteins containing multiple ps - p
or pt - p motifs can be largely dictated by whether these bonds are
present in cis or trans .
therefore , pin1 maintenance in cells is of
great importance , as protein substrate activity and/or stability can
be directly dependent on pin1 catalysis of pser - pro and pthr - pro bonds . here , we investigated the susceptibility of pin1 to modification
by hne .
hne is a reactive aldehyde generated from the nonenzymatic
oxidation of arachidonic acid or linoleic acid .
although hne is produced
endogenously at low micromolar concentrations , elevated levels of
hne are associated with a variety of diseases such as ad , carcinogenesis , and diabetes , among others .
previous work from
our laboratory has shown that hne administration to cells activates
multiple signaling networks , such as the dna damage , antioxidant ,
and heat shock response pathways .
additionally ,
hne modifies proteins at exposed nucleophilic sites , altering tertiary
structure and ultimately modifying activity . because of the importance
of pin1 to the stability of transcription factors ( e.g. , p53 , -catenin ,
c - myc ) as well as its effects on cell cycle checkpoint kinetics , the
susceptibility of pin1 to modification during conditions of oxidative
stress warrants investigation .
results of our experiments using
purified protein incubated with
hne , as well as from cells treated with hne , support that pin1 is
sensitive to electrophile adduction .
we chose mda - mb-231 breast cancer
cells as our model to study the susceptibility of pin1 to hne modification ,
as previous studies have reported suppressed growth rates of small
interfering rna ( sirna)-silenced pin1 mda - mb-231 cells in vitro and
decreased volume of tumors following orthotopic injection of short
hairpin rna ( shrna)-silenced pin1 mda - mb-231 cells into
the mammary fat pad of immunodeficient mice .
mda - mb-231 cells incubated with ahne and subject to click chemistry
revealed a concentration - dependent increase in ahne adduction of pin1 ,
with increasing modification observed as low as 2.5 m . in resting
cells ,
concentrations of hne are reported to range from 0.5 to 3 m ; however , in tissues and fluids experiencing
oxidative stress , levels of hne are elevated as much as 10-fold .
levels of hne in ad ventricular fluid have been
reported at 15.2 m , and coincidentally ,
pin1 has been identified as an excessively carbonylated ( 2,4-dinitrophyenylhydrazine - reactive ,
dnph - reactive ) protein in brains of patients with ad and mild cognitive
impairment ( mci ) . although the site of pin1 modification
and adducting carbonyl - containing species was not determined in these
studies , hne adduction of pin1-active site residues is a possible
scenario .
nevertheless , our data support that pin1 is covalently modified
by lipid electrophiles under conditions that mimic a pathogenic level
of oxidative stress .
elucidation of amino acid sites of modification
by hne is critical
to determining the effect the modification has on cellular signaling
pathways .
experiments incubating purified protein with electrophiles
have been valuable in categorizing proteins with hne - sensitive active
sites ( e.g. , thioredoxin and thioredoxin reductase ) and those whose modification occurs at residues outside
of the active site ( e.g. , hsp90 ) .
active
site modifications of proteins by hne would theoretically have a greater
impact on protein function relative to modifications that occur outside
of the active site . our data from experiments incubating purified
pin1 with 2 mm hne revealed the presence of three michael adducts ,
with two ( cys-113 and his-157 ) occurring at surface - exposed active
site residues .
no schiff base modifications were observed , and although
a third michael adduct was detected ( lys-132 ) , the relative extent
of modification was significantly lower as compared to cys-113 and
his-157 adduction .
data from time - dependent experiments support the
saturation of cys-113 by hne before quantifyable levels of his-157
adduction were observed .
furthermore , cys-113 adduction was detectable
at lower concentrations of hne incubated with pin1 .
we suspect that
the equivalent relative reactivity of cys-113 and his-157 observed
in mapping the amino acid modification sites ( figure 2a and table 1 ) is due to a stepwise
saturation of cys-113 , followed by modification of his-157 , resulting
from the large amount of hne used ( 2 mm ) in this experiment .
this
suggestion is supported by results of the concentration - dependent
hne incubation experiments , in which the maximal concentration was
10-fold lower ( 200 m ) and revealed minimal his-157 adduction .
cys-113 is the most important amino acid to pin1 function , and
cysteine residues are the most reactive amino acids with hne .
cys-113
of pin1 is surface exposed , thereby accessible to electrophiles such
as hne ( figure 7a ) .
a proposed mechanism of
isomerase action has suggested that his-59 abstracts a proton from
cys-113 , and the resulting thiolate interacts with the carbonyl carbon
of proline from the substrate , although
this mechanism has been challenged .
mutagenesis
experiments have revealed that mutation of cys-113 to ala results
in 123-fold loss of protein activity .
furthermore , this conserved cysteine is essential for inhibition
of parvulin ppiases by juglone . upon
observing
that cys-113 is the primary site of adduction of purified
pin1 incubated with hne , we examined whether similar modifications
to pin1 would be observed in cells treated with hne .
our proteomics
data of pin1 immunoprecipitated from flag - pin1 transfected mda - mb-231
cells treated with hne support that cys-113 is the primary site of
modification of pin1 upon cellular generation of hne .
evidence of
adduction of this peptide is supported by low ppm ( 1.1 ) mass error
as well as a large shift in retention time of peptide elution ( resulting
from increased hydrophobicity of the reduced hne - bound peptide relative
to the unadducted peptide ) .
furthermore , multiple chromatographic
peaks each having equivalent mass ( figure 5c ) were observed .
it is likely that this is due to chiralty conferred
on the modified peptide by the reduced hne
michael adduct ,
causing slight but noticeable differences in retention time , as previously
reported .
no other modified pin1 peptides were observed ,
including his-157 , although the unmodified species of this peptide
was recovered ( figure s3 in the supporting information ) .
our data support that pin1 is covalently modified in cells primarily
at the catalytic cysteine upon generation of hne .
pymol image of pin1 surface
( left ) and active site ( right ) including
hne adducted to cys-113 .
( a ) cys-113 , a surface exposed residue , is
indicated by the arrow and labeled in orange .
also in ad , pin1 is oxidatively modified , down - regulated ,
and has decreased activity as compared to brains from normal elderly
controls . in cancer ,
egcg , a green
tea polyphenol with potent anticancer activity , has recently been
identified as a pin1 inhibitor .
egcg
interacts with both the ww and the ppiase domains of pin1 , interfering
with pin1-substrate binding and catalytic activity .
furthermore , pin1
knockout mouse embryonic fibroblasts ( mefs ) were protected from egcg - induced
cell death as compared to pin1-expressing ( wt ) mefs .
we observed that pin1 sirna partially protected mda - mb-231
cells against hne toxicity as compared to scrambled control sirna
cells .
the magnitude of the increase in the ic50 of pin1
sirna cells treated with hne was less than the increase observed with
egcg ( figure 6b , c ) .
this is likely due to the
fact that hne only modifies the catalytic cysteine , whereas egcg binds
to both the active site and the ww domain and to the fact that hne
does not modify all of the pin1 in the mda - mb-231 cells at the concentrations
used for the toxicity experiment .
in addition , hne modifies many protein
targets so that pin1 is not the sole determinant of toxicity . unlike the pharmacological agents
egcg , pib , and juglone , hne is
produced endogenously by cells and is elevated in conditions of oxidative
stress .
the results presented demonstrate the modification of the
catalytic cysteine of pin1 by an endogenously produced species that
may have potential implications in disease where oxidative stress
and deregulation of pin1 coexist . | oxidation of membrane phospholipids is associated with
inflammation ,
neurodegenerative disease , and cancer .
oxyradical damage to phospholipids
results in the production of reactive aldehydes that adduct proteins
and modulate their function .
4-hydroxynonenal ( hne ) , a common product
of oxidative damage to lipids , adducts proteins at exposed cys , his ,
or lys residues . here ,
we demonstrate that peptidyl - prolyl cis / trans - isomerase a1 ( pin1 ) , an enzyme
that catalyzes the conversion of the peptide bond of pser / pthr - pro
moieties in signaling proteins from cis to trans , is highly susceptible
to hne modification .
incubation of purified pin1 with hne followed
by maldi - tof / tof mass spectrometry resulted in detection of michael
adducts at the active site residues his-157 and cys-113 .
time and
concentration dependencies indicate that cys-113 is the primary site
of hne modification .
pin1 was adducted in mda - mb-231 breast cancer
cells treated with 8-alkynyl - hne as judged by click chemistry conjugation
with biotin followed by streptavidin - based pulldown and western blotting
with anti - pin1 antibody . furthermore
, orbitrap ms data support the
adduction of cys-113 in the pin1 active site upon hne treatment of
mda - mb-231 cells .
sirna knockdown of pin1 in mda - mb-231 cells partially
protected the cells from hne - induced toxicity .
recent studies indicate
that pin1 is an important molecular target for the chemopreventive
effects of green tea polyphenols .
the present study establishes that
it is also a target for electrophilic modification by products of
lipid peroxidation . |
isolates of n. meningitidis from persons with invasive disease are forwarded to the state health department bureau of laboratories for serogrouping by slide agglutination .
isolates from outbreaks or clusters are further characterized by pulsed - field gel electrophoresis ( pfge ) by using nhei and spei restriction enzymes and methods consistent with standard protocols ( 2 ) . from december 2008 through april 2009 , we observed an increase of invasive meningococcal disease caused by serogroup w135 in southeastern florida totaling 13 patients , of whom 9 had indistinguishable pfge patterns ( figure 1 ) .
isolates from the 4 other case - patients had pfge patterns differing by 1 ( pattern ii ) , 2 ( pattern iii ) , and 5 bands ( pattern iv ) , making them > 94% related to the dominant pattern .
a retrospective review of all 5 w135 isolates in florida from january 2007 through november 2008 identified 1 additional isolate matching the dominant pattern from a resident of southeastern florida with illness onset in may 2008 .
the 4 other isolates from 20072008 had pfge patterns < 80% related ( figure 1 ) and occurred before may 2008 in residents of central and northern florida .
pulsed - field gel electrophoresis ( pfge ) patterns for 14 related and 4 unrelated isolates of neisseria meningitidis serogroup w135 , florida , usa . of the 14 case - patients with matching or near - matching pfge patterns ( table 1 ) , 13 denied recent foreign travel .
one patient with disease onset in april 2009 was a tourist visiting miami from the united kingdom .
eleven ( 79% ) case - patients resided in or were visiting miami - dade county , 2 ( 14% ) resided in broward county , and 1 ( 7% ) was a resident of palm beach county .
of the 14 case - patients , the median age was 45 years ( range 184 ) .
eight ( 57% ) case - patients were female , 7 ( 50% ) were hispanic ; 8 were white , and 6 were black .
twelve patients had a bacteremia syndrome , 2 had meningitis , and 1 had pneumonia in addition to bacteremia .
the epidemiologic investigation has not identified any common exposures , social settings , or other connections among patients in this series .
six ( 43% ) case - patients had onset of illness within 10 days of their birthdays ( binomial probability , p<0.0001 ) , but no obvious detailed exposures were identified related to this observation . *
i d , identification ; pfge , pulsed - field gel electrophoresis ; b , bacteremia ; m , meningitis ; csf , cerebrospinal fluid ; p , pneumonia .
illness onset for the 14 w135 patients in this cluster is shown in relation to onset for all 38 meningococcal disease patients with other serogroups identified in florida during the same 12-month period ( figure 2 ) .
demographic and clinical factors were also compared between these serogroup w135 and non - w135 patients ( table 2 ) . as a group ,
serogroup w135 patients were older , were more likely to be hispanic and to reside in or be visiting the southeastern 3-county region , were more likely to have bacteremia , and had higher mortality rates than non - w135 serogroup patients . however , other than hispanic ethnicity and residence in the southeastern region , none of these differences were significant
. confirmed meningococcal disease cases , by month of onset , florida , usa , may 2008april 2009 . * by 2-sided fisher exact test used for categorical variables ; wilcoxon rank - sum test used for age .
median age for w135 patients , 45 years ; median age for non - w135 patients , 27 years ; p value = 0.07 .
twelve isolates from the florida cluster were forwarded to centers for disease control and prevention laboratories for antimicrobial susceptibility testing .
all 12 isolates were sensitive to all antimicrobial agents tested ( penicillin g , ceftriaxone , ciprofloxacin , rifampin , azithromycin ) .
seven of these isolates underwent additional molecular characterization with pcr and multilocus sequence typing by using methods previously described ( 1,3 ) .
the isolates were confirmed as serogroup w135 by real - time pcr with primers specific for serogroups a , b , c , w135 , x , and y. these isolates were also found to belong to the sequence type ( st)-11/electrophoretic type 37 clonal complex . the dominant pfge pattern seen in the florida cluster is designated h46n06.0068 , and is closely related to the pattern observed in the large multicountry outbreak associated with hajj pilgrims occurring in 2000 ( 1 ) .
the 2000 outbreak involved > 400 cases and was caused by a single clone of the st-11 clonal complex . in recent years
, increases in serogroup w135 have been noted in northern argentina ( 4 ) and southern brazil ( 5 ) . among serogroup
w135 isolates in these countries , the most common clone has been the hypervirulent st-11 complex ( 4,5 ) . from 1997 through 2006 ,
the annual incidence of meningococcal disease in florida declined gradually from 1.2 to 0.4 cases per 100,000 population ( 6 ) .
historical trends of surveillance data in florida suggest seasonal peaks of meningococcal disease during november may , corresponding to the winter dry season , when tourist visitors and part - time residents are most likely to visit .
the 3-county region of southeastern florida in which this w135 cluster occurred had an estimated population in 2008 of > 5.5 million inhabitants ; 2.4 million of these reside in miami - dade county , where > 60% of residents are hispanic . during december 2008 through april 2009 , the 32 total patients with meningococcal disease reported in the state represent an annual incidence of 0.41 cases/100,000 florida residents .
the 19 total cases ( 13 serogroup w135 ) in the 3-county region during this period represent an annual population incidence of 0.82 cases/100,000 residents in these counties .
for the 13 total cases occurring in miami - dade county during this period ( 11 serogroup w135 ) , the annual incidence would be 1.26 cases/100,000 residents in the county . during may 2009 , no cases of serogroup w135 meningococcal disease
were reported anywhere in the state . in the absence of a more narrowly defined risk group ,
the cluster of serogroup w135 case - patients described in this report is still far below the threshold for recommending vaccination control efforts ( 10 cases/100,000 over 3 months ) ( 7 ) .
southeastern florida is considered the gateway to the americas , with extensive social , cultural , and commercial ties to central and south america and the caribbean .
the dominant clonal complex observed in the florida cluster matches the dominant type recently observed in argentina and brazil , raising the possibility of introduction to southeastern florida from south america .
taken together , these observations suggest the possible establishment of a clonal complex of serogroup w135 meningococci in southeastern florida with subsequent endemic transmission . | recently , 14 persons in southeastern florida were identified with neisseria meningitidis serogroup w135 invasive infections .
all isolates tested had matching or near - matching pulsed - field gel electrophoresis patterns and belonged to the multilocus sequence type 11 clonal complex .
the epidemiologic investigation suggested recent endemic transmission of this clonal complex in southeastern florida . |
cysticercosis , caused by encysted larva of taenia solium , is the most common parasitic infestation of the central nervous system , but spinal cysticercal infection is relatively rare with the incidence reported as only 0.75.85% .
majority of the reported cases of intramedullary cysticercosis ranged in age between 20 and 45 years and the condition is very rare in the pediatric age group .
although surgery is the mainstay of treatment , magnetic resonance imaging ( mri ) can help in preoperative diagnosis , thus avoiding the high morbidity and mortality associated with the surgery .
we hereby report a case of a 10-year - old female patient with isolated intramedullary cysticercosis , who responded dramatically to medical treatment .
a 10-year - old female patient presented with gradual weakness in both lower limbs and numbness from lower thorax to foot for 3 months .
neurological examination revealed spastic paraplegia ( motor power 3/5 ) , brisk b / l deep tendon reflexes with extensor plantar and loss of sensations to pinprick bilaterally below t5 dermatomes .
contrast - enhanced mri of the spine revealed an isolated , well - defined , intramedullary cystic lesion measuring 1.8 1.0 cm at the level of d2 vertebral body . on t1-weighted imaging ,
the lesion was hyperintense on t2-weighted image with an isointense mural nodule [ figure 1b and c ] .
csf examination done revealed elevated protein and normal glucose levels with increased lymphocytes , and few eosinophils and positive enzyme - linked immunosorbent assay ( elisa ) for anti - t .
( b ) sagittal and ( c ) axial t2-weighted images showing a well - defined cystic hyperintense lesion with isointense mural nodule ( scolex ) opposite d2 vertebrae associated with adjacent cord edema .
( d ) contrast - enhanced mr images showing peripheral enhancement of lesion keeping the provisional diagnosis of cysticercosis in mind , empirical treatment with antihelminthic along with steroids was started .
marked clinical improvement was seen within a few days in the form of increase in limb power and return of tendon reflexes .
cysticercosis is endemic in most of the developing countries like brazil , mexico , korea and south asian countries .
intramedullary cysticercosis is rare even in endemic areas , with an incidence reported between 0.7% and 5.85% .
four forms of spinal neurocysticercosis have been identified : vertebral , extradural , intradural extramedullary and intramedullary , the commonest being intradural extramedullary region .
extramedullary form occurs due to csf dissemination ( ventriculo ependymal migration ) of focus in brain , whereas intramedullary forms result due to hematogeneous spread of the parasitic larvae .
intramedullary cysticercosis is most common in the thoracic spine due to high vascularity of this spinal segment .
neurological manifestations can be produced by the parasite itself causing mechanical compression and obstruction , surrounding inflammation , cord edema and residual scarring , pachymeningitis or syrinx formation .
usual mr findings include a cystic lesion with signal intensity similar to csf on t1-weighted and t2-weighted mri .
a mural nodule , which represents the scolex , appears isointense or hyperintense on t1-weighted mri and reverse on t2-weighted mri .
the thickened capsule is hyperintense on t1 wi and hypointense on t2 wi.[57 ] the role of mri in the diagnosis of neurocysticercosis is well documented .
it helps not only in the diagnosis but also in the preoperative localization of the lesion and the extent of involvement .
mri findings in neurocysticercosis can be non - specific , especially when scolex is not seen and the differentials for an intramedullary cystic lesion include hydatid cyst , dermoid cyst , post - traumatic syrinx , metastases and granulomatous diseases .
but the presence of scolex and history of origin from endemic area enables differentiation from other disease processes .
csf examination in patients with neurocysticercosis usually reveals moderate lymphocytic pleocytosis , variable eosinophilic pleocytosis , elevated protein , and low / normal glucose levels .
surgery can eliminate the compressive element , especially in patients presenting with acute onset of symptoms , and in cases wherein the diagnosis is doubtful , surgical excision should be done .
however , operative mortality is reported to be 15% and the morbidity is reported to be 85% , but excellent results can be obtained with microneurosurgery . based on mri findings , some authors now recommend the use of antihelminthic drugs along with steroids without resorting to surgery .
treated their patients with drug therapy for 75 days and found that intramedullary cysticercosis resolved completely in a patient who was on albendazole treatment for cerebral neurocysticercosis .
found that out of four patients in his series , two reported complete resolution of the cyst on mri , and marked clinical improvement was seen in all the four patients .
ahmad et al . reported successful treatment of a case of intramedullary cysticercosis with a 2-week course of medical therapy .
ahmad et al . reported achievement of cure within 2 weeks ; however , some authors suggest 48 weeks treatment . our patient was treated with albendazole and steroids for 4 weeks and showed marked clinical improvement .
isolated cysticercosis of spine is difficult to suspect ; however , correlation of clinical findings , history of endemic area origin and typical mri findings can help in making the diagnosis , thus obviating the need for surgery which is associated with high morbidity and mortality . | neurocysticercosis is the most common parasitic infection of the central nervous system caused by larvae of taenia solium .
spinal cysticercosis is an uncommon site of cysticercal infection , and isolated intramedullary involvement is even rarer . we present a case of 10-year - old girl who presented with gradual onset paraparesis with sensory loss and bowel and bladder incontinence .
magnetic resonance imaging ( mri ) of spine revealed a cystic lesion with mural nodule ( scolex ) which was diagnostic for cysticercosis .
patient was treated with antihelminthic , which led to marked clinico - radiological improvement . |
we firstly compared published resequenced genomes of three wolves and ten dogs ( including five ancient dogs and five modern dogs , supplementary material , supplementary material online ) to identify the most significant genetic legacy in the dogs deviating from their progenitors . to avoid inaccurate estimation of population differentiation due to small sample size
, we only count the single nucleotide polymorphisms ( snps ) that differentiate extremely between the wolves and the dogs ( allele frequency is 1 in wolves but 0 in dogs , or vice versa ) , which were defined as fixed snps .
we identified 204 genes that have at least six fixed snps ( within the 95% percentile rank ) .
these genes showed an extremely significant lower level of nucleotide diversity and tajima s d values ( p = 5.22e-05 and 1.23e-30 , respectively , mann
1a ) , suggesting a potential selection effects on the divergence observed here . because only a very small number of fixed snps ( totally 26 ) were nonsynonymous substitutions
, this may indicate that the positive selection operated mainly on expressional regulation . actually , the 204 genes showed appreciable changes in expression patterns between dogs and wolves than others for two different measurements : absolute expression change and fold change ( p = 0.022 and p = 0.005 , respectively ) ( fig .
1b ) , based on the transcriptome data for the frontal cortex ( albert et al .
these results suggest that expressional variation rather than structural variation in protein sequence is the major contributor to the currently observed differentiation between dogs and wolves .
( a ) comparisons of the nucleotide diversity ( left ) and tajima s d values ( right ) between genes containing large numbers of fixed snp differences and other genes s.d . were presented .
( b ) comparisons of the difference in expression levels between wolves and dogs between genes containing large numbers of fixed snp differences and other genes .
left : expression difference of each gene between the wolf and the dog was calculated by the transformed value in the dog minus the transformed value in wolf .
right : difference of each gene between the wolf and the dog was calculated by the transformed value in the dog divided by the transformed value in the wolf .
( c ) left : negative correlation between fst values and recombination rates of genome wide snps .
right : positive correlation between fst values and recombination rates of snps at genes in go categories : go : 0001640 and go : 0007216 , both of which contain only one gene : grik3 in the ensembl 72 dog annotation .
( a ) comparisons of the nucleotide diversity ( left ) and tajima s d values ( right ) between genes containing large numbers of fixed snp differences and other genes s.d . were presented .
( b ) comparisons of the difference in expression levels between wolves and dogs between genes containing large numbers of fixed snp differences and other genes .
left : expression difference of each gene between the wolf and the dog was calculated by the transformed value in the dog minus the transformed value in wolf .
right : difference of each gene between the wolf and the dog was calculated by the transformed value in the dog divided by the transformed value in the wolf .
( c ) left : negative correlation between fst values and recombination rates of genome wide snps .
right : positive correlation between fst values and recombination rates of snps at genes in go categories : go : 0001640 and go : 0007216 , both of which contain only one gene : grik3 in the ensembl 72 dog annotation .
go ( gene ontology ) analysis of the 204 genes revealed most overrepresentation in categories referring to multicellular organismal response to stress
( p = 1.41e-3 , table 1 ) , thus supporting the hypothesis that positive selection caused a behavioral shift as dogs diverged from wolves .
the first category , multicellular organismal response to stress , contained five genes : grik3 , mecp2 , bcl2 , grik2 , and gabra5 , whereas the other two categories each contained these same genes except grik3 .
all five of these genes are associated with the metabolism of glutamate ( table 2 ) , which is an important neurotransmitter in the brain ( purves et al .
2001 ) . because none of the fixed snps detected within these five genes were nonsynonymous
, this suggests that shifted fear behavior that occurred during the initial domestication of the dog might be an outcome of a change in expression of the glutamate - related genes .
in addition to the above genes , the gene htr2c ( 5-hydroxytryptamine receptor 2c ) , which is involved in serotonin and dopamine pathway ( stam et al . 1994 ; alex et al .
2005 ) , has ten fixed snps differences between dogs and wolves , and also belongs to the behavioral fear response categories in the go annotation ( www.geneontology.org ) .
it shared interacting genes with its paralogue htr2a , which has been suggested to modulate cognitive process by enhancing glutamate release ( feng et al .
table 1go analysis of genes containing large numbers of fixed snp differences between wolves and dogsp valuegene numberterm idterm typeterm name9.87e-045go:0033555bpmulticellular organismal response to stress1.41e-034go:0001662bpbehavioral fear response1.41e-034go:0002209bpbehavioral defense response3.51e-034go:0042596bpfear response6.82e-0315go:0005975bpcarbohydrate metabolic process1.94e-022go:0014041bpregulation of neuron maturation3.16e-023go:0042551bpneuron maturation4.18e-023go:0005605ccbasal lamina4.78e-0210hp:0001417hpx - linked inheritance5.00e-0210hp:0010985hpgonosomal inheritance2.29e-036kegg:04973kecarbohydrate digestion and absorption3.52e-035go:0019903mfprotein phosphatase binding6.91e-033go:0017046mfpeptide hormone binding5.00e-025go:0019902mfphosphatase bindingnote.bp , biological process ; cc , cellular component ; mf , molecular function ; hp , human phenotype ; ke , kegg pathway .
table 2description of the functions of five genes potentially under selection in the doggenesperformance in functional assayreferenceobserved expression profiles estimated by the fpkm valuechanging direction of expression patternwolfdogobserved directionassumed direction for enhanced synaptic plasticity or learning and memory abilityassumed direction for reduced fear or anxietygrik2grik2 deficiency showed significant reduction in anxiery and fear memory.(ko , et al .
2005)23.88 ( 1.22*)29.86 ( 5.70*)++grik2 knock - out animals showed deficits in mossy fiber ltp.(breustedt and schmitz 2004 ; contractor , et al .
1999)15.24 ( 1.08*)16.35 ( 1.15*)++grik3 knock - out animals showed deficits in mossy fiber ltp.(contractor et al .
2007)mecp2mecp2 deficiency related with increased anxiety , reduced learning , memory , and ltp ; over expression show reduced anxiety , enhanced learning , memory , synaptic plasticity , and ltp ( but see tau - mecp2).(na et al .
1997)6.43 ( 0.88*)5.71 ( 0.91*)+reduced bcl2 levels with significant increase of anxiety - like ( fear ) behaviors.(einat et al .
1996)transgenic mice with overexpression of bcl2 have learning deficits.(rondi - reig et al . 1997 ; rondi - reig and mariani 2002)negative correlation between the bcl2 expression and glutamate concentration.(schelman et al .
represents decreased expression level in dog relative to wolf . * in the blanket stands for the z - score .
go analysis of genes containing large numbers of fixed snp differences between wolves and dogs note.bp , biological process ; cc , cellular component ; mf , molecular function ; hp , human phenotype ; ke , kegg pathway . description of the functions of five genes potentially under selection in the dog note.+ represents increased expression level in dog relative to wolf . represents decreased expression level in dog relative to wolf . * in the blanket stands for the z - score .
if selection for stress response was an initial target during domestication , then these fixed alleles should keep in a near fixed state even with amplified sampling . to test this , we resequenced the genomes of an additional three wolves and three chinese native dogs presenting very rich genetic diversity ( see supplementary material , supplementary material online , for more details ) .
the fixed snps in the five genes : mecp2 , bcl2 , grik2 , gabra5 , and grik3 identified above were present as a single allele or singleton in dogs .
furthermore , we calculated fst for each snp between dogs and wolves to evaluate the population differentiation , and identified go categories for genes containing snps with fst values statistically significantly higher than the average for snps for genome - wide genes .
the go categories showing the greatest statistical significance were adenylate cyclase inhibiting g - protein coupled glutamate receptor activity ( go : 0001640 ) and g - protein coupled glutamate receptor signaling pathway ( go : 0007216 ) .
similarly , two pathways involved in glutamate receptor activity , glutamate receptor signaling pathway ( go : 0007215 ) and adenylate cyclase - inhibiting g - protein coupled glutamate receptor signaling pathway ( go : 0007196 ) , were also among the top ten categories with greatest significances .
because the fst parameter does not show the direction of selection , and can not identify upon which lineage , dog or wolf , explains the divergence for these categories , we applied the parameter xp - ehh ( sabeti et al .
2007 ) to evaluate selection on the snps in the dog lineage after divergence form the wolf .
xp - ehh values on the dog lineage for genes involved in the glutamate receptor pathway retained statistically significant high values , suggesting that positive selection on these glutamate receptor pathway genes potentially occurred during the domestication of dog from wolf , and account for their change in behavior .
a considerable proportion of selective signatures was due to hitchhiking accompanied with the high intensity of artificial selection on a selected few genes .
accordingly , we next examined whether the observed signature of selection seen in glutamate metabolism genes was due to selection or hitchhiking . the hill
robertson effect states that selection is most effective when variants freely recombine ( hill and robertson 1966 ) .
selective sweeps are expected to extend less far in regions of higher recombination rate , and thus allele frequency differentiation is expected to be negatively correlated with recombination rate under hitchhiking . at the genomic level in dogs ,
1c , r = 6.096e-04 , p < 2e-16 ) , which is consistent with the overall pattern observed in rice ( lu et al .
in contrast , snps within go : 0001640 category ( the most divergent category ) showed positive correlation between evolutionary rate and recombination rate , although the correlation was not statistically significant as it referred to only one gene ( fig .
furthermore , go:0007216 category from ensembl version 74 ( containing four genes : grik3 , grm5 , grm6 , and trpm1 ) showed a statistically significant positive correlation ( r = 0.014 , p = 0.00133 ) .
thus , our result indicated that positive selection occurred on glutamate metabolism genes during the domestication of the dog .
glutamate is the major excitatory neurotransmitter in the brain that regulates many kinds of behaviors and emotions and plays a key role in cognitive ability , including learning and memory through influencing short- and/or long - term potentiation ( ltp ) ( purves et al .
both grik2 ( glutamate receptor , ionotropic , kainate 2 ) and grik3 ( glutamate receptor , ionotropic , kainate 3 ) are glutamate receptors . grik2
knock - out mice exhibit significant reduction in anxiety and fear memory ( ko et al .
although no clear function has been identified for grik3 , it coassembles with grik2 to form the kainate glutamate receptor ( dingledine et al .
1999 ) , and deficits in mossy fiber ltp were observed in grik2 and grik3 knock - out animals ( contractor et al .
2001 ; schmitz et al . 2003 ; breustedt and schmitz 2004 ; pinheiro et al .
our analysis of the frontal cortex transcriptome data showed that grik2 is expressed at a significantly higher level in the frontal cortex of the dog than in the wolf ( p = 0.0006 by the mann
intriguingly , we also found a consistent up - regulation of grik2 in other domesticated animals compared with wild counterpart ( student s t - test ) , including chicken ( p = 0.249 ) , rat ( p = 0.068 ) , guinea pig ( p = 0.045 , data from albert et al . ) , and rabbit ( p = 0.381 , data from albert et al . )
( supplementary table s1 , supplementary material online ) , which showed a convergent evolution among domesticated animals .
consistent with the changes in grik2 , bcl2 , and gabra5 also present changes ( but no statistical significance ) in their levels of expression in dogs compared with wolves that should increase the fear response in dogs ( table 2 ) .
we note that the changes in expression levels for these divergent genes were moderate , but they presented changes that contradict the expected expression pattern by the correlated by - product hypothesis , which proposed the fear reduction in the primary dogs to explain the prerequisite of the domestication .
these moderate changes may be attributed to the minor effects of many genes underlying the selective targets , which may often occurred during the initial phase of domestication . actually , according to the weighted gene coexpression network analysis ( wgcna ) analysis ( langfelder and horvath 2008 ) , grik2 , grik3 , gabra5 , and mecp2 showed coexpression pattern and belonged to the same gene coregulatory network ( e.g. , module ) which presented special positive correlation with the frontal cortex of wolf and dog ( p = 4e-05 and 6e-05 , respectively ) ( see supplementary fig .
s1 and material , supplementary material online , for details ) . moreover , grik2 , grik3 , and gabra5 all present to be hub genes in this module ( mm = 0.943 , 0.914 , and 0.917 , respectively ) , indicating their important functions within this module on nervous system .
it should be noted that the roles predicted for these genes in the fear response research ( table 2 ) were all tested under pavlovian fear conditioning , from which fear ( the conditioned response ) was trained to accompany a noxious stimuli .
these pavlovian tests contrast with both the fox experiment ( trut 1999 ) and dog domestication , where punishments were not received when the animals became close to humans . additional pleiotropic functions of glutamate may have also contributed to the successful domestication of the wolf .
the direction of change in the expression of the five genes should tend to cause excitatory synaptic plasticity in neural cells and/or benefit memory ability ( although gene mecp2 locates in x chromosome , the equal sex ratio for both the domesticated and wild groups should eliminate the sex - linked effects on dosage ) .
consistent with this suggestion , dogs exhibit more excitatory behaviors than wolves , which sometimes becomes an overreaction yielding anxiety , or even obsessive - compulsive disorder , which may be associated with glutamate - related genes ( sampaio et al .
changes in synaptic plasticity are thought to be associated with changes in learning and memory abilities , by affecting short- and ltp ( purves et al .
thus , our results partially support the selection for communication hypothesis , where a strengthened learning ability should help the skill of reading human communicative behaviors .
however , interspecific communication would only begin after a long period of scavenging life that enhanced the interactions between humans and wolves . in the self - domestication model , wolves domesticated themselves into dogs overtime of scavenging lifestyle ( coppinger and coppinger 2001 ) .
in such a wild environment , the reduced fear response proposed by the correlated by - product hypothesis may be hard for these dog progenitors to survive .
it therefore could be reasoned that during the early stages , the wolves with better learning and memory abilities would come close to human settlements more frequently , acquire greater food resources , and thus had greater opportunities to survive ( with little disadvantage ) .
these individuals would perform nonaggressive response because they would understand that the presence of humans was harmless , and thus would have a weakened fear reaction .
hypothesis to account for the successful domestication of dogs from wolves . following this hypothesis , affected learning and memory abilities
would facilitate the behavioral shift , prolonged exposure to humans , and helped the dogs to understand the meaning of our gestures .
comparison of the genome of experimental foxes that have been tamed , and the unselected controls , may be an approach to test this hypothesis .
reads of genome sequences were mapped onto the reference genome by using bwa - mem ( bio-bwa.sourceforge.net ) , and snps were calling by genome analysis toolkit ( mckenna et al .
2010 ) ( genomeanalysistk-2.6 - 4-g3e5ff60 ) . the rna - seq data from the frontal cortex of the wolf and the dog were from albert et al .
tophat ( trapnell et al . 2009 ) and cufflinks ( trapnell et al . 2010 ) were used to assemble transcripts and calculate the expression value of genes .
weighted gene coexpression networks were performed by wgcna package implemented in r ( langfelder and horvath 2008 ) .
supplementary material , table s1 , and figure s1 are available at genome biology and evolution online ( http://www.gbe.oxfordjournals.org/ ) . | dogs shared a much closer relationship with humans than any other domesticated animals , probably due to their unique social cognitive capabilities , which were hypothesized to be a by - product of selection for tameness toward humans . here , we demonstrate that genes involved in glutamate metabolism , which account partially for fear response , indeed show the greatest population differentiation by whole - genome comparison of dogs and wolves .
however , the changing direction of their expression supports a role in increasing excitatory synaptic plasticity in dogs rather than reducing fear response . because synaptic plasticity are widely believed to be cellular correlates of learning and memory
, this change may alter the learning and memory abilities of ancient scavenging wolves , weaken the fear reaction toward humans , and prompt the initial interspecific contact . |
corticosteroids are a versatile option for treatment of many pathologies , including dermatological conditions , due to their availability in a wide range of potencies and formulations.13 betamethasone valerate ( bmv ) is a medium - potency corticosteroid without mineralocorticoid properties.4 bmv has been successfully used in a lotion formulation for treatment of seborrheic dermatitis and scalp psoriasis.57 furthermore , the bmv foam formulation has been found effective and safe for treatment of several dermatological pathologies , such as moderate - to - severe scalp psoriasis,4 scalp seborrheic dermatitis,8 mild - to - moderate plaque psoriasis ( not affecting the scalp),9 alopecia areata,10 and stasis dermatitis.11 a ready - to - use medicated plaster for continuous and sustained transdermal delivery of bmv , betesil ( ibsa farmaceutici italia , lodi , italy ) , has recently been developed to treat several cutaneous inflammatory conditions .
the transdermal therapeutic system is a very popular modality of drug administration whose pharmacokinetics has gained wide acceptance by avoiding hepatic first - pass metabolism and fluctuation in plasma drug concentration observed following oral therapies .
the administration is easier , and it is possible to interrupt treatment immediately , if necessary . although the transdermal therapeutic system is an attractive alternative to oral administration , only a limited number of drugs are available in the form of transdermal plasters.12 many studies have confirmed the superiority of bmv plasters over the cream formulation . in 2006 , pacifico et al13 enrolled 42 patients with mild - to - moderate psoriasis .
the patients involved in this study were treated , in a half - side distribution , with a bmv 0.1% tape and bmv 0.12% cream for 30 days . after a 4-week therapy , both bmv 0.1% tape and bmv 0.12% cream were found effective in decreasing lesion size , but the tape caused a greater decrease in psoriasis area and severity index ( pasi ; 39.5% reduction ) , if compared with the bmv 0.12% cream ( 62% reduction ) , indicating a higher efficacy of the tape formulation . in a prospective , randomized , assessor - blind , parallel - group , active - controlled , multicenter phase iii study , naldi et al14 evaluated the efficacy and safety of a new plaster containing bmv 0.1% and a bmv 0.1% cream , in patients affected by mild - to - moderate chronic plaque psoriasis .
a total of 231 patients were randomized to receive bmv 0.1% plaster ( 116 patients ) or bmv 0.1% cream ( 115 patients ) for 35 weeks .
plasters were applied once daily , and they were worn for at least 20 consecutive hours .
the plaster displayed a greater efficacy in decreasing the total size of target plaques , if compared with the cream .
bmv plaster was also used with positive results in subjects with relapses of chronic tendinopathies , as shown by salini and abate.15 in that study , 15 patients affected by this condition were treated with a bmv plaster applied to the affected tendon . after 28 days of treatment , pain significantly decreased either at rest or during activities , and a significant improvement in functional limitation was also observed .
saraceno et al investigated the effects of bmv 0.1% tape in patients with prurigo nodularis , a chronic skin condition characterized by pruriginous nodules.16 twelve patients were treated with the bmv tape or a moisturizing itch - relief cream containing feverfew , over a period of 4 weeks .
the tape was applied once a day for 24 hours to the nodular lesions in the left side of the body and changed every morning , while the cream was applied to the lesions present in the right side twice a day . over the 4-week treatment period ,
lesions treated with the tape showed a greater reduction in itching , excoriation , and infiltration from baseline , if compared with those lesions treated with the cream . to date , no study has investigated the clinical efficacy of bmv medicated plaster in improving facial swelling , edema , inflammation , ecchymosis , and hematoma following facial rejuvenation procedures .
in the present study we tested the hypothesis that a new bmv medicated plaster can safely reduce facial swelling , edema , inflammation , ecchymosis , and hematoma in a series of healthy patients who underwent an intradermal hyaluronic acid - based facial rejuvenation procedure with the aim of erasing facial wrinkles of the perioral and nasolabial folds and improving chin and eye contour . addressing the above mentioned complications is crucial due to the increase in the clinical use of hyaluronic acid , not only in the aesthetic medicine clinic,17,18,19 but also in restorative medicine20 and for the treatment of other pathologies , such as lower - leg telangiectasia,21 premature ejaculation,22 and osteoarthritis.23,24,25
the present study was performed at the poliambulatorio del secondo parere ( modena , italy ) . this study was designed and performed according to the declaration of helsinki and approved by the local institutional review board .
forty patients ( 8 males and 32 females ) , aged between 37 and 65 ( mean 52.04 1.4 years ) , participated in the study .
the patients underwent a rejuvenation procedure to erase facial wrinkles of the perioral and nasolabial folds and improve chin and eye contour .
after this procedure , the patients were randomized to receive either a bmv plaster ( betesil ; n=20 ) applied immediately after the procedure for 12 hours or an aescin 10% cream ( ndema crema gel ; agave farmaceutici , prato , italy ; n=20 ) applied immediately after the procedure , in the evening and the morning after ( control group ) .
aescin cream was chosen since this compound possesses well - documented anti - edematous and anti - inflammatory properties.26 after cooling the skin , the subjects were injected ( total of 5.21 0.2 injections varying according to the individual patient s medical needs ) with 2 ml of cross - linked hyaluronic acid ( aliaxin global performance ; ibsa farmaceutici italia ; 25 mg / ml ; molecular weight 10002000 kda ; extrusion force 23 3 newton ) with free contents of 1,4-butanediol diglycidyl ether ( bdde ) ( < 0.1 ppm ) , using a 27 g needle and cannula , in the deep malar areas , followed by a single mesotherapy injection , using a 27 g needle , into the cheeks , chin , and mandible line , with 2 ml of a compound composed of 32 mg non - cross - linked hyaluronic acid ( 700800 kda ) plus a complex including ammonium molybdate , ammonium metavanadate , calcium chloride , iron sulphate , potassium chloride , copper sulphate , magnesium chloride , manganese sulphate , sodium acetate , sodium hydrogen carbonate , sodium chloride , sodium hydrogen phosphate , sodium metasilicate , sodium selenite , stannous chloride , zinc sulphate , alanine , arginine , asparagine , aspartic acid , cysteine , glutamine , glutamic acid , glycine , histidine , isoleucine , leucine , lysine , methionine , phenylalanine , proline , serine , threonine , tryptophan , tyrosine , valine , adenine ( vitamin b4 ) , biotin ( vitamin b8 ) , calcium pantothenate ( vitamin b5 ) , choline chloride , folic acid ( vitamin b9 ) , inositol ( vitamin b7 ) , nicotinammide ( vitamin b3 ) , pyridoxine ( vitamin b6 ) , riboflavin ( vitamin b2 ) , thiamine ( vitamin b1 ) , vitamin b12 , deoxythymidine , glucose , putrescine , sodium pyruvate , and lipoic acid ( viscoderm skinko e ; ibsa farmaceutici italia ) .
a mesotherapy injection of the same compound was repeated once a month for 2 months with the aim of prolonging the effect of the first injection of cross - linked hyaluronic acid .
this particular combination of the two different hyaluronic acid products had produced successful results in previous unpublished rejuvenation procedures performed at the poliambulatorio del secondo parere ( modena , italy ) . at the end of the procedure , a betesil ( ibsa farmaceutici italia ) plaster was applied to the face over the treated areas , and cut to shape to adequately cover the injected surfaces ( figures 1 and 2 ) , and no other oral or topical medication was allowed .
betesil is a 75 100 mm transparent medical plaster , with an adhesive layer containing 30 g / cm bmv .
the plaster is self - adhesive and waterproof and can be cut in order to be properly adapted to the treated skin area .
the adhesive layer of the plaster contains sodium hyaluronate , 1,3-butylene glycol , glycerol , disodium edetate , tartaric acid , aluminum glycinate , polyacrylic acid , sodium polyacrylate , hydroxypropylcellulose , caramellose sodium , methyl parahydroxybenzoate , propyl parahydroxybenzoate , and purified water .
the day after the procedure , the patients were individually admitted to a follow - up examination where the following parameters were quantitatively evaluated : overall facial swelling / edema / inflammation ( scored on a 04 scale ) : 0 = no swelling / edema / inflammation ; 1 = minimal swelling / edema / inflammation ; 2 = slight swelling / edema / inflammation ; 3 = moderate swelling / edema / inflammation ; and 4 = severe swelling / edema / inflammation .
ecchymosis and hematoma around the needle injection track ( scored on a 04 scale ) : 0 = no ecchymosis / hematoma ; 1 = minimal ecchymosis / hematoma ; 2 = slight ecchymosis / hematoma ; 3 = moderate ecchymosis / hematoma ; and 4 = severe ecchymosis / hematoma .
subjective satisfaction of the patient after the procedure ( scored on a 03 scale ) : 1 = not satisfied ; 2 = quite satisfied ; and 3 = very satisfied .
time out from daily activities due to adverse reactions and patients compliance with the plaster , based on adhesiveness , skin reaction , and comfort , were also documented .
forty patients ( 8 males and 32 females ) , aged between 37 and 65 ( mean 52.04 1.4 years ) , participated in the study .
the patients underwent a rejuvenation procedure to erase facial wrinkles of the perioral and nasolabial folds and improve chin and eye contour .
after this procedure , the patients were randomized to receive either a bmv plaster ( betesil ; n=20 ) applied immediately after the procedure for 12 hours or an aescin 10% cream ( ndema crema gel ; agave farmaceutici , prato , italy ; n=20 ) applied immediately after the procedure , in the evening and the morning after ( control group ) .
aescin cream was chosen since this compound possesses well - documented anti - edematous and anti - inflammatory properties.26
after cooling the skin , the subjects were injected ( total of 5.21 0.2 injections varying according to the individual patient s medical needs ) with 2 ml of cross - linked hyaluronic acid ( aliaxin global performance ; ibsa farmaceutici italia ; 25 mg / ml ; molecular weight 10002000 kda ; extrusion force 23 3 newton ) with free contents of 1,4-butanediol diglycidyl ether ( bdde ) ( < 0.1 ppm ) , using a 27 g needle and cannula , in the deep malar areas , followed by a single mesotherapy injection , using a 27 g needle , into the cheeks , chin , and mandible line , with 2 ml of a compound composed of 32 mg non - cross - linked hyaluronic acid ( 700800 kda ) plus a complex including ammonium molybdate , ammonium metavanadate , calcium chloride , iron sulphate , potassium chloride , copper sulphate , magnesium chloride , manganese sulphate , sodium acetate , sodium hydrogen carbonate , sodium chloride , sodium hydrogen phosphate , sodium metasilicate , sodium selenite , stannous chloride , zinc sulphate , alanine , arginine , asparagine , aspartic acid , cysteine , glutamine , glutamic acid , glycine , histidine , isoleucine , leucine , lysine , methionine , phenylalanine , proline , serine , threonine , tryptophan , tyrosine , valine , adenine ( vitamin b4 ) , biotin ( vitamin b8 ) , calcium pantothenate ( vitamin b5 ) , choline chloride , folic acid ( vitamin b9 ) , inositol ( vitamin b7 ) , nicotinammide ( vitamin b3 ) , pyridoxine ( vitamin b6 ) , riboflavin ( vitamin b2 ) , thiamine ( vitamin b1 ) , vitamin b12 , deoxythymidine , glucose , putrescine , sodium pyruvate , and lipoic acid ( viscoderm skinko e ; ibsa farmaceutici italia ) .
a mesotherapy injection of the same compound was repeated once a month for 2 months with the aim of prolonging the effect of the first injection of cross - linked hyaluronic acid .
this particular combination of the two different hyaluronic acid products had produced successful results in previous unpublished rejuvenation procedures performed at the poliambulatorio del secondo parere ( modena , italy ) . at the end of the procedure , a betesil ( ibsa farmaceutici italia ) plaster was applied to the face over the treated areas , and cut to shape to adequately cover the injected surfaces ( figures 1 and 2 ) , and no other oral or topical medication was allowed .
betesil is a 75 100 mm transparent medical plaster , with an adhesive layer containing 30 g / cm bmv .
the plaster is self - adhesive and waterproof and can be cut in order to be properly adapted to the treated skin area .
the adhesive layer of the plaster contains sodium hyaluronate , 1,3-butylene glycol , glycerol , disodium edetate , tartaric acid , aluminum glycinate , polyacrylic acid , sodium polyacrylate , hydroxypropylcellulose , caramellose sodium , methyl parahydroxybenzoate , propyl parahydroxybenzoate , and purified water .
the day after the procedure , the patients were individually admitted to a follow - up examination where the following parameters were quantitatively evaluated : overall facial swelling / edema / inflammation ( scored on a 04 scale ) : 0 = no swelling / edema / inflammation ; 1 = minimal swelling / edema / inflammation ; 2 = slight swelling / edema / inflammation ; 3 = moderate swelling / edema / inflammation ; and 4 = severe swelling / edema / inflammation .
ecchymosis and hematoma around the needle injection track ( scored on a 04 scale ) : 0 = no ecchymosis / hematoma ; 1 = minimal ecchymosis / hematoma ; 2 = slight ecchymosis / hematoma ; 3 = moderate ecchymosis / hematoma ; and 4 = severe ecchymosis / hematoma .
subjective satisfaction of the patient after the procedure ( scored on a 03 scale ) : 1 = not satisfied ; 2 = quite satisfied ; and 3 = very satisfied .
time out from daily activities due to adverse reactions and patients compliance with the plaster , based on adhesiveness , skin reaction , and comfort , were also documented .
all data are represented as the means standard error of the mean ( sem ) and were checked for normality using the anderson darling test , using minitab 15 ( minitab inc , state college , pa , usa ) .
data were then analyzed using graphpad prism 5 software ( graphpad software inc , san diego , ca , usa ) .
facial swelling / edema / inflammation , ecchymosis / hematoma , and patient satisfaction score data were analyzed using a two - sample unpaired student s t - test .
betesil application resulted in a significant improvement in the swelling / edema / inflammation score ( 0.3 0.17 ) , if compared with aescin 10% cream ( 1.3 0.28 ) ( p < 0.01 ) ( figure 3 ) . among the 20 patients receiving betesil , a patient presented minimal inflammation , a patient showed slight edema , and a patient displayed moderate swelling . among the 20 patients receiving aescin 10% cream , seven reported no swelling , edema , or inflammation , five reported minimal edema and inflammation , four patients showed slight swelling , three had moderate swelling and inflammation , and a patient reported a severe degree of inflammation that resolved with ice application within 24 hours .
when analyzing ecchymosis and hematoma around the needle injection track , using the ecchymosis / hematoma score , no difference was observed between the groups ( figure 4 ) . in the group treated with betesil plaster , 18 patients did not show any ecchymosis or hematoma around the needle injection track a day after treatment , while two patients had minimal ecchymosis and hematoma ( 0.1 0.06 ) ( figure 4 ) . in the control group
, 15 patients did not show any ecchymosis or hematoma , while two patients had minimal ecchymosis and three patients slight hematoma ( 0.4 0.16 ) ( figure 4 ) .
patient satisfaction score was significantly higher in patients receiving betesil ( 2.9 0.06 ) versus subjects receiving aescin 10% cream ( 2.4 0.16 ) ( p < 0.01 ) ( figure 5 ) . among 20 patients from the betesil group ,
18 were very satisfied with the procedure and two were quite satisfied . in the control group ,
eleven patients were very satisfied with the procedure , six were quite satisfied , and three were not satisfied ( figure 5 ) .
in the betesil-treated group , there was no withdrawal from daily activities , while in the control group , treatment caused absence from work activity for a day in two patients due to a severe degree of skin inflammation ( first case ) and ecchymosis ( second case ) .
the plaster was well tolerated by all patients except for a case of skin rash , which resolved without any treatment within 24 hours .
all the patients declared that the plaster was comfortable to wear and showed good adhesiveness to the skin .
the present study shows that betesil plaster can be safely applied to the skin of patients undergoing facial rejuvenation procedures .
its application significantly reduced facial swelling , edema , and inflammation compared with aescin 10% cream . in the betesil group , only two patients showed minimal ecchymosis and hematoma , while in the control group , two patients had minimal ecchymosis and three slight hematoma , with no significant difference between groups .
the few cases presenting ecchymosis and hematoma in both groups are explained by the safety profile of aliaxin global performance and viscoderm skinko e that we previously observed in our clinic ( unpublished observation ) . in the present study ,
this is the first study testing the clinical effectiveness of the betesil plaster in cosmetic medicine .
the scientific interest in transdermal therapeutic systems has significantly increased in the last two decades because it represents a valid alternative to oral and hypodermic administration
. however , currently , only a limited number of drugs are available as transdermal plasters .
indeed , the necessity for the drug released from a transdermal plaster to permeate through the stratum corneum and epidermis , in order to be taken up by capillary loops in the dermal papillae for systemic distribution , represents a rate - limiting step.27 furthermore , previous studies also reported adverse effects caused by transdermal plasters , such as contact dermatitis , sensitization , and delayed hypersensitivity.2844 as far as bmv plaster safety is concerned , pacifico et al13 reported no serious local or systemic treatment - related adverse effects during 30 days of treatment in patients affected by mild - to - moderate psoriasis .
no adverse effects were also reported by saraceno et al16 in patients affected by prurigo nodularis treated for 4 weeks with bmv plasters , and by naldi et al14 in patients affected by mild - to - moderate chronic plaque psoriasis treated with bmv plaster for 35 weeks . in our experience , betesil medicated plaster was well tolerated and contributed to the prevention of swelling , edema , and inflammation after hyaluronic acid - based facial rejuvenation procedure .
bmv plaster has the advantages of an occlusive therapy , such as increased local hydration and rapid therapeutic response .
bmv can also be applied to areas where the use of conventional occlusive bandages would not be possible .
the plaster can be cut to fit specific areas that need pharmacological treatment . in this way , it is possible to avoid the use of cosmetically unappealing ointments that may also stain clothes .
furthermore , the high adherence of the plaster to the skin results in a longer persistence of the active ingredient in this location , without the need for continuous application of cream or ointment that can also be absorbed by clothing . in conclusion , the present study supports the use of betesil plaster immediately after facial cosmetic procedures in order to safely control facial swelling , edema , and inflammation . | background and aimthe use of transdermal therapeutic systems has spread worldwide since they allow effective local drug delivery . in the present study , we investigated the efficacy and safety of a new betamethasone valerate medicated plaster ( betesil ) to manage facial swelling , edema , inflammation , ecchymosis , and hematoma , when applied immediately after a facial rejuvenation procedure.materials and methodswe applied the plaster to the skin of 20 healthy patients for 12 hours immediately after hyaluronic acid - based procedure performed with the aim of erasing facial wrinkles of perioral and nasolabial folds and improving chin and eye contour .
a further 20 patients underwent the same cosmetic procedure , but they were treated with an aescin 10% cream ( applied immediately after the procedure , in the evening , and the morning after ) and served as control group.resultsbetesil application resulted in a significant improvement in swelling / edema / inflammation score , if compared with aescin 10% cream ( p < 0.01 ) . as for facial ecchymosis and hematoma around the needle injection track , only two patients in the active treatment group displayed minimal ecchymosis and hematoma . in the control group , two patients presented minimal ecchymosis and three slight hematoma .
however , using the ecchymosis / hematoma score , no significant difference between betesil and aescin 10% cream groups was observed .
patients satisfaction was significantly higher among subjects receiving betesil , if compared to patients receiving aescin 10% cream ( p < 0.01).conclusionthe present study supports the use of betesil plaster immediately after facial cosmetic procedures in order to safely control swelling , edema , and inflammation . |
a 34-year - old lady was referred to our clinic with a history of progressive , painless swelling over the right lateral upper eyelid , for the past 1 year .
there were no systemic symptoms including loss of appetite , loss of weight , fever or a headache .
no significant medical , surgical or family history could be elicited . on examination , her uncorrected vision in the right eye was 6/10 , while in the left eye was 6/6 .
intraocular pressures in the right and left eyes were 12 mmhg and 14 mmhg , respectively .
there was a prominent swelling over the superotemporal aspect of the right eyebrow measuring 3 cm 2 cm in size [ fig
palpation of the mass indicated a smooth surface , firm in consistency , and nontender .
it was not attached to the skin but was adherent to the underlying structures , rendering it relatively immobile .
fullness of the right eye upper lid anterior and posterior segment examination was normal in both eyes .
the provisional diagnosis was a benign lacrimal gland tumor due to the long history , absence of pain , or any systemic features .
a computed tomography ( ct ) scan of the orbit and brain , with contrast , showed a well - defined regular homogenous enhancement of lacrimal gland mass measuring 2.8 cm 1.8 cm 2.0 cm within the superolateral part of the right orbit [ fig . 2 ] .
there was no extraconal , intraconal , intracranial , intraocular , or paranasal sinus involvement .
computed tomography - scan showing the lacrimal gland tumor a resection of the tumor and the lacrimal gland was performed on february 8 , 2013 , through a subbrow incision .
subsequent histopathological examination ( hpe ) demonstrated nodules of tumor cells with large , vesicular nuclei , and prominent nucleoli with frequent mitoses within the central area of the collecting lacrimal ducts [ fig .
the tumor cells were positive for epithelial membrane antigen ( ema ) , ckit ( cd117 ) , and periodic acid - schiff ( pas / d ) but negative for s100 protein , cytokeratin-20 and melan a. thus , a diagnosis of primary adenocarcinoma of the lacrimal gland was made .
histopathological examination of the lacrimal gland tumor ( 10 ) postoperatively , the right upper eyelid swelling resolved uneventfully .
two months postexcision , a repeat ct brain , and orbit were done and showed diffuse enhancing soft tissue around the right orbit , which suggested inflammatory activity [ fig . 4 ] .
so far , the patient has been well , and there is no sign of recurrence or metastasis .
lacrimal gland fossa lesions may be divided into three categories : inflammatory , lymphoproliferative , and epithelial lesions . among epithelial lesions ,
furthermore , among the malignancies , adenoid cystic carcinoma is the most frequently found ( 66% ) , followed by a carcinoma - ex - pleomorphic adenoma ( 18% ) , primary adenocarcinoma ( 9% ) , and mucoepidermoid carcinoma ( 3% ) , in that order .
primary ductal adenocarcinoma in the lacrimal glands is extremely rare , very aggressive and carries a poor prognosis .
this tumor arises in the upper eyelid and usually presents as a mass accompanied by symptoms such as rapid growth , pseudoptosis , exophthalmos , dystopia , pain , and reduced visual acuity .
however , patients with this disease are usually symptomless initially , leading them to be diagnosed at an advanced stage .
radiological features which suggest malignancy are bony erosion , the irregular margin of the mass and focal calcification within the lesion . however , primary adenocarcinomas frequently present as well demarcated cystic lesions misleading the examiner into diagnosing it as benign . in this case , the patient did not have typical clinical features of a lacrimal gland malignancy .
usually , malignant lesions of the lacrimal gland are characterized by a rapid growth in < 6 months , ptosis , ocular motility disturbances , diplopia , and bone erosion on radiographs .
her ct orbit had shown a well - defined regular homogenous enhancement of lacrimal gland mass but with no radiological features of malignancy . in this case
immunohistochemistry has been successfully utilized in the diagnosis of many adnexal tumors . however , since , primary ductal adenocarcinoma of the lacrimal gland is very rare , only a few markers have been reported .
these include ema , carcinoembryonic antigen , matrix metalloproteins-2 , 9 , and 13 , cytokeratin 7 and proto - oncogene human epidermal growth factor receptor-2/neu .
currently , there is no clear protocol for treatment of primary ductal adenocarcinoma of the lacrimal gland due to the infrequent occurrence of this disease .
however , in the majority of cases of lacrimal gland malignancies , the optimal treatment plan is complete removal of the tumor , orbital bone resection , and maintaining health and intact vision of the patient 's eye . in cases , where the tumor extends outside
the orbit or is widely infiltrating the orbital structures , palliative treatment in the form of radiotherapy , or local resection can be done .
if incompletely removed , the recurrence rate is high , and the disease can progress rapidly and may be fatal .
thus , it has been recommended that radical excision of the lesion is essential to prevent such recurrence or progression .
an en bloc resection of the orbital tumor and contents , together with orbitectomy , is considered to be the most logical and effective method of treatment . in our case , as the tumor was suspected to be benign we performed a local resection of the tumor along with the lacrimal gland .
this case report seems to confirm the features of primary adenocarcinoma of the lacrimal gland , which is an extremely rare tumor .
however , it also shows that this condition can have features mimicking a benign tumor .
the authors certify that they have obtained all appropriate patient consent forms . in the form , the patient(s )
has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal .
the patients understand that their names and initials will not be published , and due efforts will be made to conceal their identity , but anonymity can not be guaranteed there are no conflicts of interest .
the authors certify that they have obtained all appropriate patient consent forms . in the form , the patient(s )
has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal .
the patients understand that their names and initials will not be published , and due efforts will be made to conceal their identity , but anonymity can not be guaranteed
| a 34-year - old patient with a swelling over the upper eyelid for nearly 1 year was seen in our clinic .
the history , examination and investigations were suggestive of a benign lacrimal gland tumor .
the tumor and lacrimal gland were resected .
subsequent histopathological examination revealed the tumor was a primary ductal adenocarcinoma of the lacrimal gland .
this is a very rare tumor with less than half a dozen cases reported so far .
this case report is being presented to highlight an unusual presentation of this rare malignancy . |
celiac disease ( cd ) results from damage to the small intestinal mucosa due to an inappropriate immune response to a cereal protein .
belly. the disorder was previously called celiac sprue , based on the dutch word
sprue , which was used to describe a disease similar to tropical sprue that is characterized by diarrhea , emaciation , aphthous stomatitis , and malabsorption .
cd is a common condition that may present at any age after weaning with a spectrum of symptoms .
treatment with a strict gluten - free diet is mandatory and leads to a reduced risk of associated complications .
the diagnosis of cancer could be after the diagnosis of cd or simultaneous ( during the same month or at admission ) or more frequently before the diagnosis . in 1962 , gough et al . suggested , for the first time , that lymphoma occurs as a complication of cd . an increase in gastrointestinal adenocarcinoma
carcinoma of the small intestine in association with cd was first reported in 1958 and is now known to be the second most common invasive malignancy after lymphoma .
a celiac ( diagnosis 2 years before ) 46-year - old woman on a gluten - free diet , without any other past medical history , presented with a six - month history of projectile vomiting , postprandial fullness and 13 kg weight loss .
she proceeded to gastroduodenal endoscopy : the stomach was dilated and revealed retained gastric fluid . in the duodenum a loss of folds , scalloping of folds ,
furthermore , the presence of a stricturing tumor was observed in the third part of the duodenum ( fig .
the biopsy specimens of the lesion showed the typical appearances of cd with total villous atrophy .
thus , the patient underwent computed tomography , which showed a long segmental stenosis from the third duodenal portion to the duodenal - jejunal junction ( fig .
the patient proceeded to laparotomy , where a 8 5 1 cm duodenal tumor was seen close to the duodenal - jejunal flexure , and a segmental duodenal - jejunal resection was performed ( fig .
3 ) . histopathology confirmed a stricturing duodenal signet ring adenocarcinoma with clear resection margins , limited to the muscular wall , with histological signs of cd in the specimen around the tumor ( fig .
a normal gastrografin study was done on the 7th postoperative day before discharge ( inpatient day 15 ) .
adjuvant chemotherapy was performed with uftm protocol ( uracil , ftorafur and mitomycin c ) and was associated with normalization of cea and ca 19 - 9 .
6-month follow - up is uneventful ( endoscopy and pathological findings confirmed the disappearance of the cancer ) .
malignant diseases that are more frequent in patients with cd include non - hodgkin lymphoma , esophageal and oropharyngeal squamous carcinoma , and small bowel adenocarcinoma [ 1 , 4 ] .
small bowel carcinoma is well recognized in association with long - standing gluten enteropathy , particularly in patients in whom the mucosa remains flat even after appropriate dietary treatment .
however , a gluten - free diet is thought to be protective against the development of malignancy in cd , although this might not be the case for the development of non - hodgkin lymphoma [ 5 , 6 ] .
duodenal adenocarcinoma accounts for less than 0.5% of all gastrointestinal cancers and for 3045% of small intestinal cancers .
enteropathy - associated t cell lymphoma occurs in approximately 1 per million population per year in the uk and is rapidly fatal with approximately 20% survival at 2 years
patients with cd have a risk of small bowel adenocarcinoma that is about 4080 fold greater than that of the general population , but only around 10% of patients with this tumor are celiac [ 9 , 10 , 11 , 12 ] .
the diagnosis of carcinoma can be after the diagnosis of cd or simultaneous ( during the same month or at admission ) or more frequently before the diagnosis .
the development of carcinoma may bring a patient with cd to diagnosis or provoke symptoms in a patient previously well controlled on a gluten - free diet .
the diagnostic modalities have evolved over time , from upper gastrointestinal series with small bowel follow - through to computed tomography , ultrasound , and endoscopic biopsy .
the mucosal damage in cd may make the small intestine more permeable to environmental carcinogens .
known predisposing factors for the development of small intestinal adenocarcinoma include crohn 's disease , adenomatous polyps and peutz - jeghers syndrome .
malignancy in cd can be diagnosed by biopsy at endoscopy , but there is no precise histopathological description nor specificity for these carcinomas .
anemia is the most common presenting feature and is associated with either overt or occult gastrointestinal bleeding .
weight loss with worsening anorexia , nausea , abdominal pain or abdominal mass and small bowel obstruction are other prominent complains .
rarely , a perforated viscera can be the initial complication leading to a cancer diagnosis .
other atypical presentations such as shortness of breath , generalized lymphadenopathy , and neurologic signs and symptoms account for the remainder of clinical manifestations [ 12 , 13 ] .
a number of investigators stated that t stage , nodal status , degree of differentiation and the use of adjuvant chemoradiation therapy did not influence survival , whereas negative resection margins and tumor site ( i.e. first and second portions of the duodenum ) are favorable predictors of long - term survival .
in contrast , others authors have shown that survival is only dependent on the presence or absence of nodal involvement at presentation [ 7 , 8 ] .
in fact , kalamanos et al . found that the presence of lymph node involvement is associated with a truncated survival and node positivity was the only independent negative prognostic factor for survival among patients who underwent resection ( n+ : 15% 5-year survival vs. n : 60% 5-year survival ) .
showed that the size of neoplasm is not a determinant of resectability of duodenal carcinoma ; on the contrary , he found that small tumors tended to be more aggressive than larger tumors .
there are no confirmed statistical data in the literature on the degree of differentiation of neoplasm on the correlation with patient survival [ 7 , 10 , 14 ] .
chemotherapy can be administered after surgical resection , particularly in patients with lymphoma , or as the sole treatment in patients with advanced or inoperable disease . at present , surgical resection is the only available option for cure of this disease [ 15 , 16 ] .
complete resection remains the only option for cure , but this is not always feasible in case of locally advanced tumors or in case of tumors invading the root of the mesentery .
the choice of surgical resection depends on the site of the tumor [ 17 , 18 ] .
pancreaticoduodenectomy ( pd ) is the only appropriate operation to achieve a complete resection when the neoplasm is located in the second part of the duodenum , close to the papilla of vater and the pancreatic head [ 19 , 20 ] . for neoplasm located in the first , third or fourth portions of the duodenum
, complete resection may be achieved with removal of the affected segment [ 7 , 21 ] . with aggressive lymph node dissection , pd for a tumor in the proximal duodenum or pancreas - sparing duodenectomy for a tumor in the distal duodenum
are the most common surgical treatments for duodenal adenocarcinoma , and they may provide a curative option for these patients [ 7 , 14 ] .
as to the correct approach , some surgeons have suggested that all cancers should be treated by pd , citing the principle that regional lymph node dissection is more complete .
it has been argued that segmental duodenal resection results in inadequate resection margins and an incomplete regional lymphadenectomy [ 9 , 10 ] . on other hand , the segmental resection appears to be equally extensive as pd in terms of clearance of regional lymph node .
thus , as there are not uniform opinions on the surgical management of duodenal adenocarcinoma , and as several follow - up studies suggest that a gluten - free diet protects from cancer development , especially if started during the first years of life , strict adherence to a gluten - free diet seems to be the only possibility of preventing a subset of rare but very aggressive forms of cancer .
actually , from the review of the literature , numerous are the conflicting opinions about prognostic survival factors in duodenal adenocarcinoma .
ultimately the goal in surgical treatment is to achieve clear margins . particularly for tumors arising in the third and fourth segment of the duodenum confined to the duodenal wall , complete resection with microscopic negative margins
can frequently be accomplished with a segmental duodenal resection that should include removal of the periduodenal lymph node .
otherwise , pd remains the procedure of choice for tumors located in the second portion of the duodenum and for locally advanced distal tumor . in conclusion ,
all celiac patients with duodenal carcinoma fit for surgery should be given the option of curative treatment by surgical resection regardless of tumor size , tumor invasion , or appearance of positive lymph nodes . | celiac disease results from damage to the small intestinal mucosa due to an inappropriate immune response to a cereal protein .
long - standing or
refractory celiac disease is associated with an increased risk of autoimmunity and malignancy .
we produced a brief literature review starting from a case of duodenal cancer in a celiac patient .
the patient with an history of celiac disease since six months presented with acute manifestation of gastric outlet syndrome .
a duodenal stricture was diagnosed at upper gastrointestinal endoscopy and confirmed by abdominal computed tomography .
he was successfully treated by segmental duodenal resection . in the resected specimens ,
the diagnosis was duodenal signet cell adenocarcinoma .
6-month follow - up is uneventful .
primary carcinoma of the duodenum is rare ( duodenal adenocarcinoma accounts for less than 0.5% of all gastrointestinal cancers and 3045% of small intestinal cancers ) .
some patients with duodenal carcinoma are potentially curable by surgery , but conflicting opinions exist on the factors influencing the survival rate and on surgical treatment as the gold standard .
nevertheless , the goal in surgical treatment is to achieve clear margins . at present , surgical resection ( pancreaticoduodenectomy or pancreas - sparing duodenal segmental resection )
is the only available option for cure of this disease . |
celiac disease ( cd ) is a t - cell - mediated disorder , which is induced by gluten ingestion in genetically predisposed individuals .
different studies showed that the prevalence of cd is approximately 1% in many populations worldwide .
new diagnostic tools increased the consciousness and improved the diagnosis of the disease , thus causing an apparent real increase in the incidence of cd .
cd is diagnosed by abnormal histology of duodenal biopsy specimens as well as with diagnostic tools , including serologic tests for antibodies against tissue transglutaminase ( anti - ttg ab ) and deamidated gliadin peptide ( dgp ) . in suspicious cases for example in first degree relatives of patients with cd and in patients with autoimmune disorders , evaluation of hla - dq2 and hla - dq8 haplotypes are useful tools . according to recent guidelines by paediatric gastroenterology hepatology and nutrition ( espghan ) , clinical symptoms of cd and other gluten related disorders can be relieved by adherence to a gluten - free diet and a diagnosis can be made without biopsy taking in certain circumstances , especially in those cases with an increase value of anti - ttg antibodies ( iga ) more than 10 time than upper limit .
helicobacter pylori ( h. pylori ) , the causative agent in more than 90% of patients with gastroduodenal disorder , is responsible for many disorders ranging from asymptomatic histological chronic gastritis to some histologically important disorders such as peptic ulcer , upper gastrointestinal bleeding , primary gastric mucosa - associated lymphoid tissue ( malt ) lymphoma , chronic gastritis with atrophy , intestinal metaplasia , and adenocarcinoma . to date
although native immune inflammatory response is identified in both h. pylori infection and cd , systemic humoral immune reaction is also involved .
increased numbers of intestinal intraepithelial lymphocytes ( iels ) and subsequently villous atrophy , are not specific histological findings in h. pylori infection or cd .
they may be found in a large number of other disorders , such as giardia infection , iga deficiency , and crohn s disease .
patients with increased iels without serology confirmation do not have cd , but those with positive serological tests and suggestive symptoms are considered as potential cases of cd .
various studies reported a high prevalence of h. pylori infection in patients with cd and vice versa .
some studies reported that a clinical presentation like atrophic gastritis is common in patients with cd , but others have found poor evidence to support this presentation .
different studies reported that number of intraepithelial lymphocytes in the duodenal mucosa are more likely to be increased in patients with h. pylori gastritis , and this can be controlled by the eradication of h. pylori , although epidemiological investigations have failed to show the association between gastritis and cd .
other reports have focused on h. pylori - related lymphocytic gastritis and anemia in patients with cd .
the following keywords were selected and searched alone or in combination in pubmed ( pmc central ) , medline , and google scholar for articles published in english , from january 1985 to october 2015 : celiac disease ,
pathogenesis , helicobacter pylori , lymphocytic gastritis , lymphocytic duodenitis ,
, clinical presentation , and epidemiology . using the mentioned keywords , only those articles , which reported controversial issues on pathological and clinical aspects of cd and h. pylori infection were assessed .
based on the above - reported controversial point of views , in this article we describe an updated review about pathological and clinical correlation between cd and h. pylori infection .
lymphocytic gastritis ( lg ) is defined by the presence of 25 - 30 iels per 100 epithelial cells , without accounting the mononuclear inflammatory cell infiltration of the lamina propria .
studies showed that lg may be associated with both cd and h. pylori infection even if this evidence is not unanimously recognized .
lg was reported in 36 - 45% of children with cd , but h. pylori infection was reported only in 13% of patients .
about 38% and 13% of lg cases were associated with cd and h. pylori gastritis respectively .
previous studies confirmed that lg was more common in h. pylori positive children than in h. pylori negative ones , both without cd .
they reported that duodenal intraepithelial lymphocytosis persisted but lg counts decreased after treatment of h. pylori infection . in a study by broide and colleagues on 40 patients who were candidate for endoscopy , only iels positive for peculiar cd3 and cd8 intraepithelial t - lymphocyte population increased significantly in cd patients with or without h. pylori infection .
drut and co - workers concluded that lg was associated with cd in children with iels positive for cd8 , but was not associated with substantial damage to the epithelial cells .
nenna and others suggested that exposure to gluten for long time was a possible trigger of lg .
lg was reported in 7% of the patients with cd and no control subjects , while h. pylori infection was found in 6 ( 2.7% ) children with cd ( 16.7% had lg ) .
in other two studies on children and adults , the prevalence of lg was reported 42% and 84% , respectively .
similar to nenna and colleagues , prasad and co - workers reported that the prevalence of h. pylori in patients with cd and lg was 6% .
in contrast to previous studies , in 1999 wu and colleagues showed that out of 103 patients with lg , 33% had concomitant cd compared with only 4.1% with h. pylori and therefore declined any association .
nielsen and co - workers recently supported these data and demonstrated that lymphocytic gastritis was not associated with active h. pylori infection .
these inconsistent outcomes could also be attributable to different variability of h. pylori virulence genes .
so , as demonstrated by genta and colleagues , a particular attention must be paid to other causes of gastric inflammation , and cd must be taken into account when h. pylori - negative gastritis is confirmed .
in the duodenum
, the increased number of iels , lymphocytic duodenitis , can be a primary presentation of cd as well as the epiphenomenon of h. pylori infection itself . in accordance with
the interpretations of goldstein , memeo and colleagues , determined that the patterns of distribution of duodenal iels in patients with h. pylori gastritis overlap to a significant range with the patterns described for cd .
remarkably goldstein reported the non - gluten - sensitive groups with increased iels , included patients with h. pylori gastritis .
guz - mark et al . proposed that in children with negative cd , lymphocytic duodenitis is common and is not expressively affected by h. pylori infection .
however , this explanation is somehow doubtful as they have evaluated the children with functional recurrent abdominal pain as normal control group .
recent study by simondi and others , showed that h. pylori infection is associated with an increase in iels count in both patients with cd and in subjects with duodenal intraepithelial lymphocytosis .
losurdo and colleagues demonstrated that , during a 2-year follow - up of 81 patients affected by non - specific duodenal lymphocytosis , 5 ( 6.1% ) were exclusively related to h. pylori infection . in contrast ilus and co - workers reported that co - morbidities such as h. pylori gastritis did not contribute to the persistent intraepithelial lymphocytosis among patients with normal villous structure who adhere to a long - term strict gluten - free diet .
several reports have rejected any correlation between severe abnormal histology and severe clinical and typical presentation like diarrhea , abdominal pain , and malabsorption in patients with cd .
in the study by nielsen and colleagues ,
the most common presenting symptoms were gerd / reflux ( 35% ) , followed by abdominal pain ( 31% ) , and anemia ( 22% ) .
spee and co - workers undertook a meta - analysis of 38 studies to examine the relationship between h. pylori , functional recurrent abdominal pain , and other gastrointestinal symptoms in children .
they concluded that h. pylori was not associated with functional recurrent abdominal pain .
in our previous study , out of 450 dyspeptic patients , 91.3% had histology - based evidence of h. pylori infection , and the most prevalent symptoms were abdominal discomfort ( 78% ) , bloating ( 71.1% ) , and heartburn ( 58% ) .
our recent study also confirmed the previous one and showed that among the 250 studied patients , 232 ( 93% ) were h. pylori positive and high prevalent symptoms including abdominal discomfort ( 80% ) , and bloating ( 73% ) were reported in the infected patients . in other study , on 226 children with cd , nenna and colleagues , demonstrated that the most frequent symptoms were abdominal pain , diarrhea , abdominal distension , and poor weight gain .
aydogdu and colleagues , showed that bloating was more common at the time of admission of patients with cd and h. pylori gastritis and a gluten - free diet recovers the symptoms in all patients regardless of the presence of h. pylori infection . on the other hand
, it has been shown that an increased number of iels can be associated with a variety of other gastrointestinal disorders such as syphilis , hypertrophic gastropathy , mntrier s disease , and crohn s disease .
evidence suggests a controversial relationship between h. pylori infection and cd ( table 1 ) .
lebwohl and colleagues , have recently proposed the hypothesis of decreased risk of cd in patients with h. pylori infection . in their cross - sectional study ,
the authors found contrariwise association and showed that h. pylori was significantly prevalent in controls compared with patients with cd ( 8.8% vs 4.4% respectively , p<0.0001 ) .
, did not show a significant difference in h. pylori infection between patients with cd ( 36% ) and controls ( 41% ) .
na : not available ; iddm : insulin - dependent diabetes mellitus
eighty - one children with cd and 81 matched children without cd were studied by luzza and co - workers .
the result of this study indicated that 18.5% of patients with cd and 17.3% of controls had h. pylori infection and therefore the prevalence and clinical presentation of h. pylori infection is not increased in children with cd .
similar prevalence have been reported by diamanti et al.(89% vs. 97% ) and rostami - nejad et al.(82% vs. 86% ) . despite a high prevalence of h. pylori infection found in these two studies ,
the researchers did not find any relationship between h. pylori infection and cd in their study population .
crabtree and other specified that although h. pylori positivity in patients with cd increased with age , the percentage of h. pylori seropositivity was not different from similarly blood donors of the same geographic area .
also nenna , jozefczuk and their colleagues , recently confirmed that h. pylori infection was more prevalent in controls than in pediatric patients with cd .
lasa and co - workers , showed that out of 312 patients who underwent endoscopy , 12.5% of patients with cd compared with 30% of patients without cd were infected with h. pylori infection .
on the other hand konturek and colleagues reported a higher frequency of h. pylori in patients with cd than in controls ( 26% vs. 20% ) , while ciacci and co - workers found that 21% of patients with cd and normal diet , 32% with gluten - free diet , and 55% of controls were infected by h. pylori .
data of 96 children with cd and 235 control children who underwent endoscopy showed that 21.8% of patients with cd and 23.8% of controls were infected by h. pylor infection .
they concluded that cd might be associated with h. pylori gastritis , and it affected only bloating as associated presentation .
lymphocytic gastritis ( lg ) is defined by the presence of 25 - 30 iels per 100 epithelial cells , without accounting the mononuclear inflammatory cell infiltration of the lamina propria .
studies showed that lg may be associated with both cd and h. pylori infection even if this evidence is not unanimously recognized .
lg was reported in 36 - 45% of children with cd , but h. pylori infection was reported only in 13% of patients .
about 38% and 13% of lg cases were associated with cd and h. pylori gastritis respectively .
previous studies confirmed that lg was more common in h. pylori positive children than in h. pylori negative ones , both without cd .
they reported that duodenal intraepithelial lymphocytosis persisted but lg counts decreased after treatment of h. pylori infection . in a study by broide and colleagues on 40 patients who were candidate for endoscopy , only iels positive for peculiar cd3 and cd8 intraepithelial t - lymphocyte population increased significantly in cd patients with or without h. pylori infection .
drut and co - workers concluded that lg was associated with cd in children with iels positive for cd8 , but was not associated with substantial damage to the epithelial cells .
nenna and others suggested that exposure to gluten for long time was a possible trigger of lg .
lg was reported in 7% of the patients with cd and no control subjects , while h. pylori infection was found in 6 ( 2.7% ) children with cd ( 16.7% had lg ) .
in other two studies on children and adults , the prevalence of lg was reported 42% and 84% , respectively . similar to nenna and colleagues , prasad and co - workers reported that the prevalence of h. pylori in patients with cd and lg was 6% .
in contrast to previous studies , in 1999 wu and colleagues showed that out of 103 patients with lg , 33% had concomitant cd compared with only 4.1% with h. pylori and therefore declined any association .
nielsen and co - workers recently supported these data and demonstrated that lymphocytic gastritis was not associated with active h. pylori infection .
these inconsistent outcomes could also be attributable to different variability of h. pylori virulence genes .
so , as demonstrated by genta and colleagues , a particular attention must be paid to other causes of gastric inflammation , and cd must be taken into account when h. pylori - negative gastritis is confirmed .
in the duodenum , the increased number of iels , lymphocytic duodenitis , can be a primary presentation of cd as well as the epiphenomenon of h. pylori infection itself . in accordance with the interpretations of goldstein , memeo and colleagues ,
determined that the patterns of distribution of duodenal iels in patients with h. pylori gastritis overlap to a significant range with the patterns described for cd .
remarkably goldstein reported the non - gluten - sensitive groups with increased iels , included patients with h. pylori gastritis .
guz - mark et al . proposed that in children with negative cd , lymphocytic duodenitis is common and is not expressively affected by h. pylori infection . however , this explanation is somehow doubtful as they have evaluated the children with functional recurrent abdominal pain as normal control group .
recent study by simondi and others , showed that h. pylori infection is associated with an increase in iels count in both patients with cd and in subjects with duodenal intraepithelial lymphocytosis .
losurdo and colleagues demonstrated that , during a 2-year follow - up of 81 patients affected by non - specific duodenal lymphocytosis , 5 ( 6.1% ) were exclusively related to h. pylori infection . in contrast ilus and co - workers reported that co - morbidities such as h. pylori gastritis did not contribute to the persistent intraepithelial lymphocytosis among patients with normal villous structure who adhere to a long - term strict gluten - free diet .
several reports have rejected any correlation between severe abnormal histology and severe clinical and typical presentation like diarrhea , abdominal pain , and malabsorption in patients with cd .
in the study by nielsen and colleagues , the most common presenting symptoms were gerd / reflux ( 35% ) , followed by abdominal pain ( 31% ) , and anemia ( 22% ) .
spee and co - workers undertook a meta - analysis of 38 studies to examine the relationship between h. pylori , functional recurrent abdominal pain , and other gastrointestinal symptoms in children .
they concluded that h. pylori was not associated with functional recurrent abdominal pain .
in our previous study , out of 450 dyspeptic patients , 91.3% had histology - based evidence of h. pylori infection , and the most prevalent symptoms were abdominal discomfort ( 78% ) , bloating ( 71.1% ) , and heartburn ( 58% ) .
our recent study also confirmed the previous one and showed that among the 250 studied patients , 232 ( 93% ) were h. pylori positive and high prevalent symptoms including abdominal discomfort ( 80% ) , and bloating ( 73% ) were reported in the infected patients . in other study , on 226 children with cd , nenna and colleagues , demonstrated that the most frequent symptoms were abdominal pain , diarrhea , abdominal distension , and poor weight gain .
aydogdu and colleagues , showed that bloating was more common at the time of admission of patients with cd and h. pylori gastritis and a gluten - free diet recovers the symptoms in all patients regardless of the presence of h. pylori infection . on the other hand
, it has been shown that an increased number of iels can be associated with a variety of other gastrointestinal disorders such as syphilis , hypertrophic gastropathy , mntrier s disease , and crohn s disease .
evidence suggests a controversial relationship between h. pylori infection and cd ( table 1 ) .
lebwohl and colleagues , have recently proposed the hypothesis of decreased risk of cd in patients with h. pylori infection . in their cross - sectional study ,
the authors found contrariwise association and showed that h. pylori was significantly prevalent in controls compared with patients with cd ( 8.8% vs 4.4% respectively , p<0.0001 ) .
, did not show a significant difference in h. pylori infection between patients with cd ( 36% ) and controls ( 41% ) .
na : not available ; iddm : insulin - dependent diabetes mellitus
eighty - one children with cd and 81 matched children without cd were studied by luzza and co - workers .
the result of this study indicated that 18.5% of patients with cd and 17.3% of controls had h. pylori infection and therefore the prevalence and clinical presentation of h. pylori infection is not increased in children with cd .
similar prevalence have been reported by diamanti et al.(89% vs. 97% ) and rostami - nejad et al.(82% vs. 86% ) . despite a high prevalence of h. pylori infection found in these two studies ,
the researchers did not find any relationship between h. pylori infection and cd in their study population .
crabtree and other specified that although h. pylori positivity in patients with cd increased with age , the percentage of h. pylori seropositivity was not different from similarly blood donors of the same geographic area .
also nenna , jozefczuk and their colleagues , recently confirmed that h. pylori infection was more prevalent in controls than in pediatric patients with cd .
lasa and co - workers , showed that out of 312 patients who underwent endoscopy , 12.5% of patients with cd compared with 30% of patients without cd were infected with h. pylori infection .
they established that h. pylori infection was less frequent in patients with cd .
on the other hand konturek and
colleagues reported a higher frequency of h. pylori in patients with cd than in controls ( 26% vs. 20% ) , while ciacci and co - workers found that 21% of patients with cd and normal diet , 32% with gluten - free diet , and 55% of controls were infected by h. pylori .
data of 96 children with cd and 235 control children who underwent endoscopy showed that 21.8% of patients with cd and 23.8% of controls were infected by h. pylor infection .
they concluded that cd might be associated with h. pylori gastritis , and it affected only bloating as associated presentation .
h. pylori is a frequent etiological agent of upper gastrointestinal disorders such as gastritis and peptic ulcer .
examinations of the correlation between h. pylori infection and cd have yielded discordant outcomes , undoubtedly because of the diverse frequency of h. pylori prevalence in different studies .
intraepithelial lymphocytosis may remain unchanged for a long time despite a strict gluten - free diet and normalization of the small intestinal villous structure .
for this reason , a careful clinical and laboratory examination of cases of intraepithelial lymphocytosis must be performed to distinguish between gluten - related disorders ( cd , gluten sensitivity or seronegative cd ) and non - gluten - related conditions .
indeed , h. pylori gastritis , drugs such as non - steroidal anti - inflammatory drugs , olmesartan , proton pump inhibitors , and viral gastroenteritis are often associated with increasing intraepithelial lymphocytosis .
it was illustrated that h. pylori infection may be the cause of pathogenesis of lg in patients with cd , and its treatment may reduce the number of iels , and inflammation of the intestine , thus leading to an improvement of dyspeptic symptoms .
in conclusion ,
different studies demonstrate the prevalence of h. pylori infection in cd population is similar to control subjects .
various investigations suggested that histological abnormalities including villous atrophy and endoscopic markers are similar in patients with and without h. pylori infection .
although some evidence show a potential preventive role of h. pylori in the pathogenesis of cd , further studies are needed to clarify some controversial points about this topic .
| there are overwhelming reports and descriptions about celiac associated
disorders .
although there is a clear genetic association between celiac disease
( cd ) and some gastrointestinal disorders , there are controversial reports
claiming an association between cd and helicobacter pylori ( h. pylori ) infection .
different studies indicated the possible association between lymphocytic
gastritis and both cd and h. pylori infection , although this evidence is
not consistently accepted .
also it was shown that an increase in intraepithelial
lymphocytes count is associated with both h. pylori infection and celiac disease .
therefore the following questions may raise : how far is this infection
actually related to cd ?
, which are the underlying patho - mechanisms for these
associations ?
what are the clinical implications ? what is the management ?
and what would be the role of gluten free diet in treating these conditions ?
pubmed ( pubmed central ) , ovid , isi of web knowledge , and google scholar
were searched for full text articles published between 1985 and 2015 .
the associated
keywords were used , and papers described particularly the impact of
pathological and clinical correlation between cd and h. pylori infection were
identified . in this review
we tried to answer the above questions and discussed
some of the recent developments in the pathological and clinical aspects of cd
and h. pylori infection . |
in a recent issue of critical care , hermans and colleagues showed that intensive insulin therapy ( iit ) significantly reduces the incidence of electrophysiologic detection of neuromuscular complications in critically ill patients .
these findings are consistent with data obtained from two randomized controlled trials using iit , which showed that iit decreases the incidence of critical illness polyneuropathy / critical illness myopathy ( cip / cim ) diagnosed by electroneuromyography as well as reducing the duration of mechanical ventilation and shortening the length of stay in the intensive care unit ( icu ) .
improvements in electrophysiology presumably translate into improvements in respiratory muscle strength , decreasing the duration of mechanical ventilation and the length of icu stay
it is important to note that our understanding of the mechanisms that lead to cip / cim is substantially limited .
abundant data suggest that sepsis induces a myopathy characterized by reductions in muscle force - generating capacity ( force generation per cross - sectional area ) , loss of muscle mass and altered bioenergetics , but the mechanisms by which acute hyperglycemia induces prolonged or sustained alterations in the peripheral nervous system and in skeletal muscle are largely unknown . how does glucose damage tissues ?
glucose toxicity has been explained by increased cellular glucose flux and mitochondrially generated oxidative stress .
for example , nishikawa and colleagues showed that excessive mitochondrial superoxide generation is responsible for hyperglycemia - induced damage in endothelial cells .
vincent and colleagues showed recently that 2 hours of high glucose exposure results in severe oxidative stress , mitochondrial disruption , activation of caspase 3 and apoptosis in cultured neurons .
glucose overload and subsequent oxidative stress , therefore , may account for damage to neuronal tissue during acute hyperglycemia .
this mechanism can not account for acute hyperglycemia - induced changes in skeletal muscle , however , because glucose uptake in skeletal muscle is insulin dependent whereas glucose flux in neurons is insulin independent .
in fact , if the skeletal muscle glucose uptake was sufficient , hyperglycemia would not occur .
as such , it is reasonable to postulate that the mechanisms of hyperglycemia - induced muscle dysfunction are likely to be different from those that mediate hyperglycemia - induced neuronal injury .
what is the evidence that hyperglycemia produces derangements in skeletal muscle that result in weakness ?
it is critical to understand that overall muscle strength depends on muscle - specific force generation ( that is , force generation per muscle mass or force per cross - sectional area ) and on total muscle mass .
these two parameters represent distinct aspects of muscle function , and the processes that modulate force generation and muscle mass are different . in this context
, only a few studies have examined the effects of more prolonged hyperglycemia on skeletal muscle contractile function , with some showing reductions in muscle - specific force generation whereas others show no change .
it is therefore unclear whether hyperglycemia alters muscle force generation . on the other hand , du and colleagues have shown that hyperglycemia results in skeletal muscle caspase 3 activation , degradation of myofibrillar proteins ( specifically actin ) , and subsequent activation of the ubiquitin proteasomal degradation pathway , leading to muscle atrophy .
similarly , russell and colleagues recently demonstrated in cultured myotubes that high glucose induces protein loss via activation of caspase 3 , oxidative stress , and decreased protein synthesis .
in addition , studies evaluating hyperglycemia - induced mitochondrial alterations in skeletal muscle reveal inconsistent data with some showing normal function , while other studies show decrements in oxidative phosphorylation .
moreover , data suggest that mitochondrial ultrastructure , complex activity , and muscle protein content are preserved in patients treated with iit .
does acute hyperglycemia alter neurons and skeletal muscle in such a way as to produce sustained weakness in patients who survive critical illness ?
cheung and colleagues show that many acute respiratory distress syndrome survivors have persistent functional impairment with decreased exercise tolerance , muscle weakness and muscle wasting up to 2 years after icu discharge . over the past decade , the concept of metabolic memory has described the phenomenon that hyperglycemia produces ongoing sustained damage in target tissues even after blood glucose levels are normalized .
is it possible that acute hyperglycemia induces metabolic memory in neurons and/or in skeletal muscle and produces the prolonged weakness we see in our patients ?
it is conceivable that hyperglycemia - induced mitochondrial free radical generation , irreversible modification of mitochondrial proteins and mitochondrial dna damage might induce ongoing injury in neurons and skeletal muscle .
if this is true , perhaps cip / cim develops because of an acquired mitochondrial myopathy . while entirely speculative , such possibilities should be entertained . in summary
, substantial evidence supports that iit reduces the incidence of cip / cim . the proposed mechanisms by which insulin therapy protects neurons and skeletal muscle are related to its anabolic effects and anti - inflammatory effects . while iit remains the only intervention shown to reduce the occurrence of cip / cim , many patients develop prolonged weakness even with iit , indicating that other processes are involved .
future studies to elucidate the mechanisms responsible for cip / cim should also address the role of hyperglycemia in these processes .
importantly , if ongoing trials reveal that iit imparts a prohibitive risk in icu patients , then this information is crucial .
cip / cim : critical illness polyneuropathy / critical illness myopathy ; icu : intensive care unit ; iit : intensive insulin therapy .
the present work was supported by nih grants r01 hl80609 ( lac ) , r01 hl80429 ( gss ) , and r01 hl081525 ( gss ) . | critical illness polyneuropathy / critical illness myopathy ( cip / cim ) is a major cause of mortality and long - term morbidity in critically ill patients , but the true incidence and prevalence of these syndromes are not known .
hermans and colleagues show that when intensive insulin therapy is used as part of routine clinical practice in the intensive care unit , the incidence of cip / cim as determined by electrophysiologic testing is reduced .
our understanding of the mechanisms responsible for inducing prolonged weakness in intensive care unit patients is limited , and the role of hyperglycemia in modulating these processes is unknown .
intensive insulin therapy currently remains the only effective therapeutic intervention that has been shown to reduce the incidence of cip / cim . |
some studies postulate a mechanism of molecular mimicry or heterologous immunity following viral infections triggering autoimmunity . apart from infections , other exogenous factors such as visible light or x - rays
we report a case of histologically and serologically confirmed subacute lupus erythematosus ( scle ) following radiotherapy for breast cancer .
the close temporal and spatial correlation between radiotherapy and onset of scle in this patient suggests that an autoimmune reaction may have been triggered locally by functionally altering the immune system and breaking self - tolerance .
a 72-year - old woman underwent breast cancer surgery and received adjuvant systemic treatment with the estrogen receptor antagonist tamoxifen 20 mg / day , which was discontinued after the patient developed a generalized skin rash about two weeks after the initiation of tamoxifen .
this rash was clinically and histologically diagnosed as erythema exsudativum multiforme , which rapidly resolved under systemic treatment with prednisolone .
a cumulative dose of 40 gy in 15 fractions was administered and was initially well tolerated by the patient . after finishing radiotherapy , our patient developed a painless maculopapular erythema on the left breast limited to the irradiated area .
histology of a skin biopsy taken from the left breast showed an acute interface dermatitis with vacuolization of the dermo - epidermal junction , apoptotic keratinocytes in the basal epidermis and a mild , predominantly lymphocytic , infiltrate within the superficial dermis and with few admixed neutrophils and eosinophilic granulocytes .
these histological changes were consistent with subacute cutaneous lupus erythematosus ( scle ) . because of the presence of eosinophilic granulocytes in the inflammatory infiltrate , a fixed drug eruption was considered a differential diagnosis .
an allergic reaction to tamoxifen was ruled out by a negative scratch - patch test .
serology revealed elevated titers for antinuclear antibodies 1:2,560 , anti - ss - a at > 3,400 u / ml , anti - ss - b at > 3,400 u / ml and rheumatoid factor at 41 iu / ml .
complement components ( c3 and c4 ) were within normal limits and urine analysis was unremarkable . based on the patient 's history , the clinical presentation of the skin lesions , serologic results , histopathology and allergy testing , a diagnosis of scle presumably triggered by radiotherapy was made .
the administration of topical corticosteroids and systemic hydroxychloroquine at 400 mg / day led to a total disappearance of the lesions on the left breast within 6 weeks .
scle was first characterized by sontheimer et al . in 1979 as a recurring , nonfixed , superficial , nonscarring , photosensitive form of lupus erythematosus with a papulosquamous or an anular pattern , lupus - specific histopathology , lack of systemic involvement and a high association with circulating antinuclear and anti - ss - a in 80% antibodies , the latter occurring of the cases .
direct immunofluorescence remains negative in up to 40% of the cases [ 1 , 2 ] . triggering agents for scle
best described is the impact of uv light on the development of scle . regarding our patient , this important trigger could be ruled out .
previously described two cases of tamoxifen - induced scle starting after several years of treatment with tamoxifen .
tamoxifen seems to be an unlikely trigger factor for scle in our patient because tamoxifen had been discontinued two months before the appearance of the skin lesions on the breast . additionally , scratch - patch testing for tamoxifen was negative .
another differential diagnosis includes a rare and controversial entity called rowell 's syndrome , which describes the clinical association of lupus erythematosus with erythema multiforme - like lesions and a speckled pattern of antinuclear antibodies ( major criteria ) .
the minor criteria include chilblains , anti - ro and/or anti - la antibodies and positive rheumatoid factor .
all three major criteria and at least one minor criteria are required to establish the diagnosis of rowell 's syndrome .
the clinical and serological criteria ( histological findings consistent with erythema multiforme and scle , elevated titers for antinuclear antibodies 1:2,560 , anti - ss - a at > 3,400 u / ml , anti - ss - b at > 3,400 u / ml and rheumatoid factor at 41 iu / ml ) provide strong evidence for the diagnosis of rowell 's syndrome in our case but would not explain the limitation of scle to the irradiation site on the left breast two months after the appearance of the erythema multiforme .
other acute cutaneous reactions to radiotherapy are contact dermatitis , sweet 's syndrome , lichen planus , pemphigus , cutaneous hypersensitivity syndromes such as erythema multiforme as well as nonspecific hypersensitivity reactions like urticaria , localized stevens - johnson syndrome or even toxic epidermal necrolysis .
radiation recall dermatitis refers to the rare appearance of a maculopapular rash in previously irradiated skin after the administration of drugs , especially chemotherapeutic agents or antibiotics [ 5 , 6 ] .
radiation recall dermatitis typically develops within days or weeks after the administration of the drug .
the diagnosis of radiation recall dermatitis in our case can be ruled out as tamoxifen was stopped prior to radiotherapy .
reported the association of radiotherapy with collagen vascular disorders such as crest , discoid lupus , acute lupus erythematosus , sjgren 's syndrome and dermatomyositis in patients with preexisting collagen diseases .
so far , radiotherapy inducing scle has been described in the literature only once before : balabanova et al
. reported on an elderly female patient suffering from nondifferentiated lobular breast carcinoma with metastases in the axillary lymph nodes who developed an erythematous scaly eruption of the left thoracic area following radiotherapy of the area and was clinically , immunologically and histologically diagnosed as having scle .
the ethiopathogenesis of scle skin lesions is the result of 4 sequential stages : ( 1 ) inheritance of susceptibility genes ; ( 2 ) loss of tolerance / induction of autoimmunity ; ( 3 ) expansion / maturation of autoimmune responses , and ( 4 ) tissue injury / disease induction resulting from various autoimmune effector mechanisms . it has been described that ionizing radiation can functionally alter the immune system and break self - tolerance . in our case , the close temporal and spatial correlation between radiotherapy and onset of scle suggests that an autoimmune reaction may have been triggered locally , e.g. by the presentation of an auto - antigen and the induction of a danger milieu favoring immune recognition in the setting of radiodermatitis .
while we lack formal proof for this interpretation , the patient 's history and further workup exclude most other reported associations , leaving us with radiotherapy as the most likely trigger of scle in this case .
| backgroundthe origin of collagen autoimmune diseases is not fully understood .
some studies postulate a mechanism of molecular mimicry or heterologous immunity following viral infections triggering autoimmunity . apart from infections , other exogenous factors such as visible light or x - rays
have been reported to incite autoimmunity.case reportwe report a case of histologically and serologically confirmed subacute lupus erythematosus ( scle ) following radiotherapy for breast cancer.discussionthe close temporal and spatial correlation between radiotherapy and onset of scle in this patient suggests that an autoimmune reaction may have been triggered locally by functionally altering the immune system and breaking self - tolerance . |
reductions in vocational physical activity and the availability and consumption of energy - dense foods are often cited as primary culprits of the rising incidence of obesity observed throughout the world [ 16 ] .
the increased incidence of obesity has presented both health - related and economic challenges which exceed $ 110 billion dollars per year in the us alone , a level which surpasses any other country in the world .
one of the conventional consequences of obesity ( especially centrally distributed adiposity ) is an increase in triglyceride ( tg)-rich lipoproteins ( trls ) and associated hypertriglyceridemia .
trls ( very low - density lipoprotein ( vldl ) and chylomicrons ( cm ) ) reduce cholesterol content of high - density lipoproteins ( hdl ) and decrease the size of low - density lipoproteins ( ldl ) which increase the propensity for vascular endothelial infiltration and oxidation
. fasting hdl - c concentrations often account for a greater amount of variance in the risk of cardiovascular disease ( cvd ) compared to tgs leading to their dismissal as a primary risk factor for atherosclerosis [ 911 ] . while the contribution of fasting tgs and hdl - c to the overall risk of cvd remains controversial
[ 12 , 13 ] , accumulating evidence suggests that exaggerated postprandial lipemia produces rapid derangements of lipid / lipoprotein metabolism , vascular endothelial dysfunction , hypercoagulability , and sympathetic hyperactivity that is strongly linked to atherogenesis [ 10 , 1420 ] . a randomized clinical trial of 602 men and women illustrated that asymptomatic carotid atherosclerosis was positively correlated with postprandial lipemia .
despite comparable fasting lipids , male offspring of men with cvd had significantly higher serum tgs up to 12 hours following a high - fat meal , indicative of a delayed clearance of tgs .
furthermore , postprandial hyperlipemia increased the number of myocardial infarctions by 40% for every 100 mg / dl increase in physician 's health study and multiple risk factor intervention trials [ 17 , 23 ] .
the relationship between postprandial lipid metabolism and atherosclerosis is not surprising when one considers that the majority of individuals following a typical western diet consume 3 to 5 meals per day .
since each meal requires 612 hours to fully dissipate tgs in circulation , the implication is that most individuals spend over two - thirds of the day in a postprandial state with elevated trls ( postprandial hyperlipidemia ) [ 24 , 25 ] .
the capacity to regulate incoming chylomicrons from exogenous sources , tasked with counterregulation of the endogenous production and secretion of vldl - tg , may offer a more valid investigation of the capacity of tissues to appropriately regulate lipid metabolism .
therefore , interventions which improve the capacity to regulate tissue and blood lipid metabolism following a meal would be expected to lower cvd risk .
the purpose of the current review is to ( 1 ) provide a qualitative analysis of the available literature examining the dysregulation of postprandial lipid metabolism in the presence of obesity , ( 2 ) inspect the role of adiposity distribution and sex on postprandial lipid metabolism , and ( 3 ) examine the role and mechanisms by which energy deficit produced via exercise and/or energy restriction , isoenergetic low - carbohydrate diets , and n-3 fatty acid supplementation improves postprandial lipid metabolism .
systematic abnormalities in fasting and postprandial blood lipid and lipoprotein metabolism have been well documented in obesity and other conditions which produce hyperinsulinemia / insulin resistance .
insulin resistance produces de novo lipogenesis , increases microsomal triglyceride transfer protein , and enhances intracellular apolipoprotein b48 stability in the intestine [ 27 , 28 ] .
along with increased free fatty acid loading , increases in intestinal de novo lipogenesis increase the secretion of apolipoprotein b48 from enterocytes which increases the absorption and circulating concentrations of chylomicrons .
the increase in secretion is accompanied by a reduction in the fractional catabolic rate of apolipoprotein b48 .
reductions in adipose tissue lipoprotein lipase ( lpl ) mass and activity [ 26 , 29 , 30 ] have also been observed in the presence of obesity - mediated insulin resistance .
furthermore , downregulation of ldl - receptor expression leads to reductions in remnant lipolysis and removal .
concurrently , obesity associated hepatic insulin resistance dampens the repression of vldl - tg secretion normally observed in the presence of hepatic insulin sensitivity . the additional vldl - tg competes with chylomicrons for hydrolysis by lpl and hepatic receptors , thereby reducing the overall clearance of serum tgs [ 28 , 29 ] .
subsequent studies have attempted to address the precise role of adiposity distribution on postprandial lipemia .
overall , visceral adipose tissue distribution appears to be a better predictor of postprandial tg responses than body mass index ( bmi ) alone or gynoid distribution of adipose tissue [ 3235 ] .
since the distribution and magnitude of visceral adiposity is greater in men than in women , some have proposed that these differences may be responsible for gender dimorphisms in postprandial lipemia and rates of cvd [ 34 , 36 ] . in agreement with this interpretation ,
variation in postprandial tg responses between men and women was abrogated after controlling for visceral adiposity suggesting that the distribution of body fat is responsible for postprandial tg responses as opposed to sex differences [ 34 , 37 ] .
furthermore , mekki et al . showed that android obese women had greater postprandial lipemia than women who were lean or exhibited a gynoid distribution of excess adiposity despite the presence of comparable bmi and fasting tgs .
in addition , postprandial lipemia was similar between normolipidemic lean and gynoid obese groups , suggesting that excess adipose tissue distribution away from the viscera is insufficient to alter postprandial lipid metabolism .
when men with impaired or normal glucose tolerance were individually matched for visceral adipose tissue accumulation , no significant differences were found in postprandial responses of all trl - tg fractions between groups .
additional studies [ 39 , 40 ] showed similar results suggesting that visceral adipose tissue accumulation may be a more important determinant of postprandial lipemia than impaired glucose tolerance .
these findings suggest that insulin resistance / hyperinsulinemia - mediated increases in visceral adiposity may be responsible for postprandial hyperlipemia .
future studies are needed to address cause and effect between visceral adiposity and insulin resistance per se . taken together
, abnormal postprandial lipemia can be detected in the presence of excess visceral adiposity with comparable bmi and in the absence of fasting hypertriglyceridemia , providing further support that postprandial lipemia is a more sensitive predictor of metabolic and cvd risk than fasting parameters .
cross - sectional and longitudinal studies show that regular aerobic exercise reduces postprandial lipemia in the presence or absence of weight loss [ 4151 ] .
however , the effects of aerobic exercise training on postprandial lipemia are diminished when blood sampling occurs 48 hours after the most recent bout of exercise suggesting that exercise produces acute effects that are rapidly reversed [ 49 , 50 ] .
detraining studies provide further support for the concept that exercise performed in the hours prior to a mixed or high - fat meal is responsible for generating a metabolic environment which leads to postprandial lowering of tgs .
indeed , endurance - trained individuals who discontinued training for more than 60 hours had postprandial circulating tgs that were over 35% higher than levels following the last exercise training session .
direct evidence for this phenomenon has been observed in multiple populations following single sessions of exercise to provide unequivocal evidence that exercise training produces important acute metabolic responses that reduce postprandial lipemia .
although the nutrient composition of test meals , populations studied , and exercise conditions / modalities employed are highly variable throughout the literature , several conclusions can be drawn that support the therapeutic benefits of consistent exercise participation as a means to improve metabolic health in the postprandial state .
for instance , significant disparities exist between studies regarding the type of test meals employed to evaluate the impact of exercise on postprandial lipemia .
the literature is split regarding the use of mixed high - fat meals and exclusively high - fat meals to explore these effects .
although the validity of high - fat diets exclusively as a test meal has come into question , what is important is that , in the majority of cases , a single session of aerobic exercise robustly lowers postprandial lipemia regardless of the composition of the test meal .
it is important to point out that the amount of dietary fat in the test meal required to increase plasma tg concentrations appears to be dose - dependent .
absolute doses of 515 g do not increase postprandial lipemia ( 2932 ) ; whereas doses of 3050 g increase postprandial lipemia by 75 to 110 mg / dl above baseline
. doses above 80 g exaggerate postprandial lipemia but are similar in magnitude to the increase with 50 g of dietary tg suggesting that a threshold is achieved beyond a certain dose of tgs consumed .
another important aspect regarding test meal design and administration that should be considered is the fact that although the single test meal provides a powerful laboratory design , it may not reflect a real - world situation that occurs as additional meals are consumed .
farah and colleagues addressed the question of how subsequent meals impact the capacity of exercise to lower postprandial lipemia and reported that prior exercise lowered the overall tg response to 3 meals .
these results indicate that aerobic exercise reduces the postprandial tg response to multiple meals suggesting that the observed effects are not limited to effects on a single meal or the laboratory setting .
the majority of investigations which have examined the effects of exercise on postprandial lipemia have been designed where a single session of aerobic exercise is conducted 1120 hours prior to the test meal in a 2-day design . on day 1 , participants perform a prescribed exercise modality and on day 2 they receive a test meal followed by temporal blood sampling for up to 8 hours [ 16 , 5364 ] . in contrast , others have used exercise sessions conducted 3060 minutes before [ 6567 ] , 4 hours before , or 6090 minutes after a meal [ 65 , 66 ] to examine the effects of a single bout of exercise on postprandial lipemia .
aerobic exercise conducted 1120 hours before the test meal appears to produce the greatest magnitude of reduction in postprandial lipemia compared to aerobic exercise conducted 30 minutes to 4 hours before a test meal [ 65 , 66 ] .
finally , aerobic exercise conducted 1 hour following a high - fat meal produced only modest reductions in postprandial lipemia suggesting that prior exercise is superior to exercise conducted after a meal .
early studies demonstrate that total energy expenditure achieved through isoenergetic low- or moderate - intensity aerobic exercise produces similar reductions in postprandial lipemia [ 54 , 55 ] , with exceptions .
tsetsonis reported that normolipidemic young men and women had lower postprandial lipemia after walking on a treadmill for 90 minutes at 61% of vo2max and that 90 minutes of walking at 31% of vo2max elicited little effect providing initial evidence that the effects of aerobic exercise on postprandial lipemia were due to either greater intensity or to greater energy expenditure at a higher intensity . in an attempt to answer this question
, the authors conducted a follow - up study where they compared the effects of isoenergetic low- and moderate - intensity walking on postprandial lipemia .
the authors reported that 3 hours of walking at low - intensity ( 32% vo2max ) or walking for 1.5 hours at moderate - intensity ( 63% ) ( ~1000 kcal energy expenditure for both ) decreased postprandial lipemia to a similar extent .
further evidence that the beneficial effects of aerobic exercise on postprandial lipemia are related to the magnitude of energy expended come from studies which show that the accumulation of aerobic exercise throughout the day in multiple bouts produces similar benefits as a single session of isoenergetic aerobic exercise conducted at the same intensity [ 56 , 58 , 6163 , 7074 ] .
in contrast , a single session of aerobic exercise at 65% vo2max designed to expend ~1100 kcals reduced postprandial tg area under the curve ( auc ) by 39% whereas isoenergetic exercise at 25% vo2max produced a statistically insignificant 9% decrease .
a recent study by kim and colleagues showed that isoenergetic low ( 25% vo2max ) and moderate ( 65% vo2max ) intensity aerobic exercise both lowered the tg auci , but moderate intensity was over 17% more effective than low - intensity exercise .
available evidence suggests that energy deficit may be the most important determinant of the magnitude of reduction in postprandial lipemia with exercise . however , multiple investigations suggest that single or accumulated bouts of moderate - intensity exercise lower postprandial lipemia to a greater extent than isoenergetic exercise of low intensity [ 61 , 69 , 75 ] .
although total energy expenditure achieved during and after an exercise bout may outweigh the role of intensity in low- to moderate - intensity aerobic exercise , an interesting observation from emerging studies is that high - intensity , short - duration interval exercise may yield results which are at least as effective as low- to moderate - intensity exercise of longer duration despite lower energy expenditure .
high intensity interval ( hii ) exercise consists of multiple short - term ( 30 s240 s ) bouts at > 85% vo2max followed by 60 s180 s of active or passive recovery periods . indeed , moderate - intensity walking for 30 minutes at an energy expenditure of 240 kcals produced no effect on postprandial lipemia whereas hii exercise expending 103 kcals produced reductions in the tg auc .
. found that moderate - intensity and hii exercise both decreased the auci , but reported that hii exercise was more effective than moderate - intensity exercise for lowering postprandial lipemia despite identical energy expenditure during the exercise session .
in contrast , isoenergetic ( 500 kcal ) moderate - intensity and hii exercise decreased tg concentrations to a similar extent
. these differences may be due to disparities in the timing of test - meals as the meals were delivered 30 minutes after exercise in the latter study versus 1216 hours in the former study .
additional studies show that sprint interval cycling produced no effects on postprandial lipemia [ 78 , 79 ] .
while additional studies are needed to sort out the role of hii exercise on postprandial lipemia , the notion that prior hii exercise can lower postprandial lipemia to a similar extent as moderate - intensity exercise , despite lower energy expenditure and time commitment , has important practical implications for individuals with limited access to exercise opportunities .
a growing number of investigations have examined the effects of resistance training on postprandial lipemia and its efficacy in comparison to traditional aerobic exercise training .
available evidence suggests that resistance exercise is an effective strategy to reduce postprandial lipemia [ 8084 ] , although exceptions exist [ 8587 ] .
in fact , burns and colleagues showed that resistance training actually increased postprandial lipemia following a test meal .
studies which show a reduction in postprandial lipemia with resistance exercise observe these changes in recreationally active normal weight , normolipidemic males and females [ 8082 ] and sedentary obese females .
parallel comparisons of aerobic and resistance exercise have been somewhat disappointing on the surface in the sense that each of the studies conducted showed that aerobic exercise produced no effect on postprandial lipemia ( which is inconsistent with the aerobic exercise literature ) . some have suggested that although energy expenditure was similar in magnitude to levels which have previously shown reductions , it is possible that an intensity threshold was not met ( ~30% vo2peak ) .
however , it is important to note that reductions in postprandial lipemia were observed at a similar energy expenditure as that conducted for aerobic exercise suggesting that resistance training may be more effective than aerobic exercise at lowering postprandial lipemia .
support for this comes from a recent study in obese premenopausal women where the authors had the same group of women complete 2 separate 60 minute trials ( aerobic exercise at 6065% vo2peak and resistance training exercise ) .
although they did not measure energy expenditure , it would be predicted that energy expenditure in the resistance training condition was approximately 50% lower than the aerobic exercise group .
taken together , these results suggest that resistance training exercises that work the upper and lower body may be more efficacious than aerobic exercise at lowering postprandial lipemia .
overall , the literature suggests that the energy expenditure requirements to produce reductions in postprandial lipemia occur at a minimum of 250 kcals , but occur more consistently at 400 kcals and greater during low- to moderate - intensity aerobic exercise .
zhang et al . showed that 400 kcals produced similar results to that of ee over 700 kcals suggesting that an upper capacity may be achieved where only limited returns are produced beyond a certain level of energy expenditure .
future studies will be required to examine the effects of hii exercise ( > 85% ) and resistance training to provide additional evidence that energy expenditure requirements are different with higher intensity exercise .
prior exercise reduces postprandial lipemia by three possible mechanisms acting alone or in combination : ( 1 ) decreased appearance of chylomicron - tg concentrations from the gut , ( 2 ) increased clearance of trls ( vldl and/or cm ) via exercise - mediated increases in skeletal muscle and/or adipose tissue lpl activity , and ( 3 ) decreased hepatic vldl - tg secretion ( figure 1 ) .
although studies are limited , available evidence indicates that aerobic exercise does not reduce gastric emptying , as determined by paracetamol administration [ 8991 ] and does not delay the time to achieve peak tg concentrations compared to control conditions [ 89 , 91 , 92 ] which would be expected to occur if exercise altered the rate of gastric emptying .
in contrast , numerous investigations have reported that exercise produces a delayed and transient increase in lpl protein expression and activity that occurs within 4 to 8 hours after exercise and remains elevated for up to 24 hours [ 93100 ] .
these results are metabolically relevant as skeletal muscle lpl activity increases the hydrolysis of tg and clearance of free fatty acids in the postabsorptive state when serum insulin concentrations are relatively low .
therefore , an increase in skeletal muscle lpl activity produced by exercise would be expected to increase the clearance of circulating tg in the postabsorptive state .
there is a strong association between the elevation in lpl activity and reductions in fasting serum tgs in most [ 96 , 97 , 100102 ] but not all investigations [ 97 , 103 , 104 ] . studies which have examined the effects of aerobic exercise on postprandial lipemia when exercise was performed 1218 hours before a meal consistently show significant reductions in tgs .
however , the effects of exercise on lpl and tg clearance are unclear . for example , 90 minutes of walking reduced postprandial lipemia in men , but the same amount of exercise did not increase clearance of an intravenous lipid emulsion .
herd and colleagues showed that 90 minutes of moderate - intensity aerobic exercise conducted 18 h before a meal reduced postprandial lipemia but did not produce statistically significant increases in lpl activity ( although the individuals who experienced increases in lpl activity after exercise had the greatest reduction in tgs ) .
an additional study showed that 2 hours of moderate - intensity exercise did not significantly increase tg clearance across the leg 18 hours after exercise despite lowering postprandial tg concentrations . while a role for skeletal muscle lpl in the reduction of postprandial lipemia can not be ruled out , multiple factors suggest that other mechanisms must be involved .
for example , it is well known that postprandial hyperinsulinemia promotes the storage of tg in adipose tissue by increasing lpl activity [ 106 , 107 ] and that skeletal muscle lpl activity and tg storage are minimal [ 105 , 108 , 109 ] . the question is whether exercise - mediated increases in skeletal muscle lpl activity are maintained in the presence of hyperinsulinemia as in the postabsorptive state or if exercise increases adipose tissue lpl activity .
furthermore , the increase in skeletal muscle lpl activity is likely to have dissipated in most protocols where exercise is conducted the day before the test meal .
early studies in rodents revealed that aerobic exercise training reduced the secretion of hepatic vldl - tg by decreasing serum nefas and de novo lipogenesis [ 110112 ] . while direct evidence in humans is limited ,
emerging studies indicate that reductions in serum tg produced by aerobic and resistance exercise are attenuated by reductions in either hepatic vldl - tg secretion or clearance .
indeed , 5070% of the reduction in postprandial lipemia produced by aerobic exercise was accounted for by reductions in hepatic vldl - tg secretion [ 105 , 113 , 114 ] . in one of the most elegant investigations conducted to date , davitt and colleagues provided evidence using stable isotopes that the reduction in postprandial lipemia with aerobic and resistance training was not achieved by enhanced clearance of dietary fat , but instead by reduced abundance of endogenous fatty acids in circulating tgs .
others reported that a single session of aerobic exercise reduced postprandial lipemia by decreasing hepatic secretion and increasing clearance in women whereas in men , the reduction in postprandial lipemia was due to increased clearance alone .
from the available literature , it is difficult to draw strong conclusions about the specific roles and magnitude of reduction in postprandial lipemia produced by hepatic tg secretion and clearance . nonetheless , it seems plausible that reductions in vldl - tg secretion may be the primary mechanism by which exercise reduces postprandial lipemia . a role for postprandial tg
for example , beta - hydroxybutyrate ( bohb ) concentrations were not different from control following a single hii exercise bout suggesting that the reduction in tg was not due to reductions in hepatic production of vldl .
while this conclusion should be reached with caution due to the equivocal role of bohb as a valid marker of vldl production [ 116 , 117 ] , it does suggest that reductions in postprandial lipemia may be attributed , at least in part , to increased clearance .
it is possible that hii exercise may more effectively alter lpl mass and activity than low- to moderate - intensity exercise .
the mechanisms by which aerobic and resistance exercise decrease vldl - tg secretion and postprandial lipemia is unclear .
we propose the possibility that aerobic exercise - mediated reductions in hepatic and skeletal muscle glycogen content is part of a metabolic program produced by exercise which preferentially shuttles fatty acids to oxidation as a strategy to spare glucose for storage and to reestablish intracellular atp concentrations , thereby lowering the packaging / secretion of vldl - tg and potentially increasing clearance .
evidence for this hypothesis is supported by the finding that a prior bout of endurance or resistance exercise increases whole body fatty acid oxidation [ 80 , 91 , 118 , 119 ] and increases glycogen synthase activity and protein expression in skeletal muscle .
this hypothesis is also supported by the findings of some studies which show that moderate - intensity exercise produces greater reductions in postprandial lipemia than low - intensity exercise ( where carbohydrate oxidation would presumably be lower than moderate intensity exercise ) [ 61 , 69 , 75 ] .
in contrast , if moderate - intensity exercise produces similar reductions in postprandial lipemia as isoenergetic low - intensity exercise as previously reported this would suggest an alternative possibility . this possibility is further suggested by the observation that aerobic exercise produced similar reductions in postprandial lipemia in the presence or absence of pharmacological inhibition of adipose tissue lipolysis by acipimox .
if the increase in glycogen oxidation is correct , then it would be expected that exercise in the presence of acipimox would produce a greater reduction in postprandial lipemia , but this was not the case .
overall , these results suggest that regardless of the substrate used , the hepatic and skeletal muscle program following exercise is to preferentially use fatty acids from trls to replenish atp thus sparing glucose for glycogen storage as part of the training adaptation for subsequent exercise bouts .
this is in agreement with studies which show that exercise increases glycogen synthase activity and protein expression in skeletal muscle .
an important question arising from acute exercise studies is whether the accompanying energy deficit is responsible for the reduction in postprandial lipemia . to address this question , gill and hardman compared an energy deficit of 500 kcals produced by exercise with an equivalent deficit produced by energy restriction .
exercise decreased total and incremental tg concentrations while decreasing energy intake an equivalent amount produced only mild reductions in serum tg concentrations that were 3-fold lower than that produced by exercise . in a similar fashion , maraki and
colleagues reported that isoenergetic deficits created by energy restriction or aerobic exercise decreased postprandial lipemia to a similar extent statistically , with a numerically stronger effect elicited by exercise compared to energy restriction .
the interpretation of the results is complicated by the fact that gill and hardman reported that the energy deficit caused by energy restriction was 17% lower than that induced by exercise .
based on limited evidence , it appears that greater amounts of energy restriction are required to produce reductions in postprandial lipemia compared to the energy deficit created by exercise . using a different approach , burton et al
. showed that moderate - intensity aerobic exercise producing an energy deficit of ~668 kcal lowered postprandial lipemia as expected .
however , when an isoenergetic mixed meal was provided shortly after exercise to achieve energy balance , the effects of aerobic exercise on postprandial lipemia were dramatically attenuated .
additional evidence in men using a combination of moderate- and high - intensity exercise showed that aerobic exercise produced a profound reduction in postprandial lipemia which was ameliorated when glucose was consumed shortly after exercise to reestablish energy balance .
the results of these studies suggest that dietary and exercise - induced reductions in postprandial lipemia may be mediated through both common and different pathways [ 16 , 123 ] .
these differences may be related to the fact that moderate - intensity exercise produces quantitatively larger deficits in skeletal muscle and liver glycogen than energy restriction alone .
as described above , the reduction in glycogen content in both tissues would be expected to preferentially partition intracellular glucose to storage as glycogen and increase the hydrolysis and uptake of circulating tg to provide fatty acids as a substrate for oxidation .
in contrast , energy restriction - mediated deficits would likely use a greater proportion of adipose tissue tgs which would not generate an equivalent reduction in skeletal muscle and liver glycogen content . while the energy deficit created by exercise appears to be a primary mediator of the exercise - induced reduction in postprandial lipemia , energy balance created by carbohydrate replacement alone abolished the reduction in postprandial lipemia by exercise providing further support that glycogen resynthesis and energy balance are driving forces in this process .
additional studies are required to further evaluate the role of carbohydrate and other dietary macronutrients such as protein or fat to determine the interaction between macronutrient replacement , energy balance , and exercise - mediated reductions in postprandial lipemia .
accumulating evidence indicates that negative energy balance , achieved through increases in energy expenditure or decreases in energy intake , decrease postprandial lipemia [ 89 , 125 ] .
while studies to date have focused on assessing the absolute energy deficit on postprandial lipemia , it has been suggested that the improvements from either diet or exercise may be greater when there is a larger carbohydrate deficit .
indeed , this is supported by dietary studies that demonstrate greater improvements in fasting serum lipids and significantly greater reductions in postprandial lipemia following a very low - carbohydrate diet as compared to a low - fat diet , and exercise studies that have shown that acute improvements in postprandial tg metabolism is abolished if a carbohydrate rich postexercise meal is consumed [ 124 , 126 ] .
thus , it is possible that a low - carbohydrate diet may be more beneficial than a low - fat diet for improving both fasting plasma lipids and postprandial lipemia .
a reduction in the intake of dietary fat has long been recommended as a means to reduce risk factors associated with metabolic and cvd .
however , it is generally thought that a significant amount of weight loss must occur to appreciate the beneficial effects of a low - fat diet .
furthermore , it has been shown that low - fat diets lower hdl - c concentrations and increase fasting plasma tg concentrations [ 128 , 129 ] , which is associated with an increased risk of development and mortality from cvd . while it has been suggested that hypertriglyceridemia is a relatively short - term adaptive response to the increase in dietary carbohydrate ,
results from epidemiological studies show that this response may actually be a longer lasting phenomenon .
thus , it remains to be determined whether or not carbohydrate - induced hypertriglyceridemia is transient in nature or can be avoided .
an overview of the literature suggests that the carbohydrate - induced hypertriglyceridemic response can only be partially normalized if there is a significant ( at least 10% ) amount of weight loss that accompanies the low - fat high - carbohydrate diet .
given these observations , more recent studies have begun to focus on the potential benefit of reducing carbohydrate content in the diet as a means to improve fasting and postprandial lipid metabolism [ 125 , 126 , 129 , 134 ] .
carbohydrate restriction has been adopted by a large number of people ; however , because carbohydrate restriction can increase the production of ketone bodies , there has been caution issued by the scientific community in regard to the safety of these diets .
this concern has prompted the usda to call for further research into the safety and efficacy of low - carbohydrate diets .
thus , in recent years a number of well - designed studies have tested the effects and safety of a low - carbohydrate diet on reducing biomarkers for cvd risk , and improving fasting and postprandial lipid metabolism .
there have been several well - controlled randomized studies comparing the effects of a carbohydrate - restricted diet with a fat - restricted diet on weight loss , blood lipids , and other cvd risk markers .
given that responses may differ between genders , weight status , and blood lipid profile , there have been several investigations assessing a number of different cohorts , including men and women with atherogenic dyslipidemia , normal weight - normolipidemic men [ 136 , 137 ] , normal weight - normolipidemic women , and overweight men . in a cohort of normal weight men and women assigned to an isoenergetic diet comprised of a low - carbohydrate diet or low - fat diet ,
there was a reduction in fasting tg , postprandial lipemia , and fasting insulin compared to low - fat diet in men and a significant increase in postprandial lipemia compared to low - fat diet in women .
however , in a cohort of overweight men that incorporated a hypocaloric diet , both a low - carbohydrate and a low - fat diet led to a reduction in total cholesterol , fasting insulin , and homa - ir .
in contrast , fasting tag , fasting glucose , and increases in mean and peak ldl particle size were only reduced by the low - carbohydrate diet .
overall , the authors concluded that the hypocaloric low - carbohydrate diet had a similar or better effect on overall blood lipids compared to the low - fat diet . in a more recent study in men and women with mets , volek et al
. found that carbohydrate restriction led to a two - fold greater weight loss as compared to the low - fat control .
additionally , carbohydrate restriction resulted in a significantly greater reduction in fasting glucose and homa - ir , lower total postprandial tg auc following an oral fat load , reduction in fasting tg and total cholesterol , and increased circulating hdl and ldl particle size as compared to a fat restricted diet .
thus , carbohydrate restriction provided a more comprehensive improvement in clinical risk factors associated with mets than fat restriction at a reduced caloric intake .
in summary , it appears that a very low - carbohydrate diet may represent an alternative and safe strategy for metabolic and cardiovascular health that extends beyond weight regulation .
in addition to the theory that insulin resistance may exacerbate both fasting and ppl , there is also accumulating evidence that the type of sugar may differentially regulate these effects .
fructose , in particular , has been given a great deal of attention due to its potential role for improving glucose tolerance and attenuating the postprandial insulin response [ 139 , 140 ] .
however , these responses have been shown in smaller doses of dietary fructose ( 7.5 g ) , whereas higher doses have been shown to increase postprandial lipemia .
thus , while fructose may attenuate the postprandial glucose response it may potentiate postprandial hyperlipemia [ 138 , 142 ] . while the exact mechanism in which fructose potentiates postprandial
lipemia remains to be determined , current data in humans suggests a decrease in activation of adipose tissue lpl activity due to a lower postprandial insulin excursion .
it is also possible that fructose - mediated increases in hepatic de novo lipogenesis [ 143 , 144 ] increase postprandial vldl synthesis and secretion .
the role of fructose consumption on postprandial lipemia is an area that warrants further investigation and may explain why high - carbohydrate diets can exaggerate postprandial lipemia in individuals that are insulin sensitive . in order to discuss potential mechanisms in which carbohydrate restriction
improves fasting and postprandial lipemia , it is important to first discuss potential ways in which carbohydrate consumption can induce lipemia and increase fasting tg .
simply put , an increase in the fasting tg and postprandial lipemia response is a result of either an increase in hepatic de novo lipogenesis or a reduction in skeletal muscle and/or adipose tissue tg clearance .
carbohydrate - induced lipemia was first recognized in the early 1950s , where low - fat diets were prescribed to lower blood cholesterol levels [ 146 , 147 ] .
the proposed mechanisms for postprandial hyperlipemia in early studies of low - fat / higher carbohydrate diets were that higher carbohydrate promoted hepatic tg synthesis and a net decrease in tg removal rates leading to a more pronounced lipemia .
shortly thereafter , it was recognized that the carbohydrate - induced hypertriglyceridemic response was exacerbated in individuals that were insulin resistant .
performed a number of studies demonstrating that even mild peripheral insulin resistance could result in failure of an inhibition of lipolysis when insulin is elevated , and also increases hepatic tg secretion due to a reduction of insulin 's ability to inhibit liver tg secretion when hepatic insulin resistance was present .
given these observations , peripheral insulin resistance has become one of the prevailing theories in which high - carbohydrate diets increase fasting and postprandial lipemia . over the ensuing years , a number of mechanisms
have been identified that may explain carbohydrate - induced lipemia , including increased secretion of hepatic vldl particles and/or upregulation of apolipoprotein synthesis and tg packaging per vldl particle , or a reduction in clearance due to a decrease in lpl activity .
additionally , while the lipemic response to high carbohydrate has been clearly demonstrated , it is important to note that evidence exists that reveals lower lipemia when weight loss occurs or less fat composition is included in the diet .
thus , hyperinsulinemia , hepatic and peripheral insulin resistance , and body weight all appear to be critical factors associated with the magnitude of carbohydrate - induced lipemia . while the paradoxical postprandial lipemia response following a high - carbohydrate / low - fat diet was observed over 50 years ago , the idea of lowering carbohydrate and increasing fat composition in the diet has only begun to gain traction over the last 510 years .
the precise mechanisms in which a low - carbohydrate diet improves postprandial lipemia remain to be determined .
however , it is currently thought that reducing carbohydrate intake reduces fasting and postprandial tg by reducing vldl production rate and increasing tg removal by increasing both plasma and skeletal muscle lpl activity [ 135 , 152 ] .
it has also been shown that carbohydrate restriction can decrease fasting and postprandial insulin concentrations .
this is important since insulin suppresses skeletal muscle and adipose tissue lipolysis and increases de novo lipogenesis . in the presence of insulin resistance , an increase in skeletal muscle lipolysis and a decrease in hepatic lipid storage
would be expected , leading to increased production of larger tg - enriched ldl particles , an increased formation of small ldl particles , and a decrease in hdl - c .
in addition to the effects of insulin on hepatic lipid production , it is also possible that there is greater lipid clearance due to a shift towards fat oxidation and a lower reliance on insulin for skeletal muscle glucose uptake when fat content is increased in the diet .
the role of insulin resistance in determining lipemia has been shown by petersen et al . .
dietary carbohydrate substrate partitioning , liver and muscle tg and glycogen synthesis , and de novo lipogenesis were determined using h and c nmr spectroscopy and deuterium enrichment .
they found that insulin resistant men had impaired skeletal muscle and hepatic glycogen formation following carbohydrate intake , directed dietary carbohydrate toward hepatic de novo lipogenesis , and tg synthesis and produced an overall increase in plasma tg concentrations .
thus , it is likely that the benefits of carbohydrate restriction would be greater in individuals with insulin resistance .
indeed , it has been shown that carbohydrate restriction can decrease malonyl - coa concentrations , removing the disinhibition of carnitine acetyltransferase and enabling greater fatty acid transport and fatty acid oxidation .
furthermore , lowering carbohydrate intake for as few as three days has been shown to upregulate genes associated with fatty acid oxidation .
the omega-3 ( n-3 ) fatty acids , docosahexaenoic acid ( dha ) , and eicosapentaenoic acid ( epa ) beneficially modify fasting / postprandial blood lipid and lipoprotein metabolism and independently decrease mortality due to myocardial infarction and sudden death .
an analysis of 72 placebo - controlled human studies of at least 2 weeks in length providing 2 to 7 grams of n-3 fatty acids per day found that fish oils dose - dependently decrease serum fasting tg concentrations in normo- and hypertriglyceridemic individuals by 4% to 40% [ 155 , 156 ] .
the effects of n-3 fatty acids have also been explored to determine their impact on postprandial lipid / lipoprotein metabolism .
tinker and colleagues showed that a liquid fish oil supplement containing 5.2 g of epa and dha decreased postprandial tgs in hypertriglyceridemia participants .
similar results have been observed by others in both normo- and hypertriglyceridemic participants [ 158160 ] with exceptions [ 161 , 162 ] .
although the precise mechanisms are unknown , fish oil supplementation has been shown to decrease hepatic triglyceride synthesis via inhibition of diacylglycerol transferase ( dgat ) , fatty acid synthase , and acetyl coenzyme a carboxylase acc activities [ 163 , 164 ] .
fish oils also enhance fatty acid oxidation by stimulating peroxisome proliferator - activated receptor ( ppar ) .
each of these mechanisms would be expected to reduce hepatic apolipoprotein b-100 synthesis and reduce vldl synthesis and secretion .
indeed , a number of studies show that reductions in postprandial lipemia with n-3 fatty acids are associated with lower synthesis of apolipoprotein b-100 [ 160 , 166168 ] .
a more recent study showed that n-3 fatty acids decreased postprandial apolipoprotein b-48 concentrations by 22% suggesting that the reduction in postprandial lipemia with n-3 fatty acids are also related to improvements in chylomicron metabolism .
potentially overlapping mechanisms have prompted some to explore the combined effects of n-3 fatty acids and aerobic exercise on postprandial lipemia .
an early investigation by thomas et al . showed that a combination of short - term n-3 fatty acids ( 4 g / d ) and a single bout of exercise failed to reduce postprandial lipemia in sedentary individuals .
the authors suggested that the reduction in fasting tgs by n-3 fatty acids reduced the postprandial tg - lowering effects of exercise . in a follow - up study by the same group , aerobic exercise and n-3 fatty acids reduced postprandial lipemia in recreationally active individuals in an additive fashion .
it was hypothesized that trained and untrained individuals may respond differently to n-3 fatty acid and aerobic exercise interventions and that if sedentary individuals were to become trained , that they might benefit from the combination of exercise and n-3 supplementation . to test this hypothesis , the authors examined the effects of 4 weeks of training in previously sedentary overweight men and women .
n-3 fatty acids reduced fasting and postprandial tg concentrations , but the addition of exercise training produced no additional benefits . in a more recent study , n-3 fatty acid supplementation for 16 weeks with an exercise intervention ( which did not produce weight loss ) provided significantly greater reductions in tg auci compared to n-3 fatty acids alone in viscerally obese individuals .
from the available literature , it is difficult to form a straightforward conclusion about the effects of combining n-3 fatty acids and exercise on postprandial lipemia .
future studies will be required to examine whether combination therapy is superior in hypertriglyceridemic versus normotriglyceridemic individuals and/or if the disparity in results are due to differences in the duration of treatment .
assessment of postprandial lipemia has traditionally occurred over the course of 68 hours in laboratory settings .
the extensive length of time and variety of macronutrient manipulations used has hindered the transition of oral fat tolerance tests to the clinic .
furthermore , the optimal mathematical representation for reporting postprandial lipemia with multiple time points continues to be debated . the traditional approach has been to report the absolute increase in tg concentrations that occur over the course of 68 hours with measurements conducted at 1 - 2 hour intervals .
this technique is complemented by using a summary measurement referred to as the auc which uses the trapezoidal rule to calculate the average area under the absolute curve . while this strategy provides a valid assessment of the absolute response to the test meal , it does not factor in effects of interventions which influence baseline fasting tg concentrations .
since fasting tg concentrations are highly associated with the absolute hourly response and total tg auc , it can be argued that absolute reductions in the postprandial response to a meal challenge are due to the reduction in fasting tgs as opposed to effects of the intervention during the postprandial period . to account for the effects of an intervention on fasting concentrations prior to a meal
, the incremental auc has been used as a method to control for reductions in fasting tg concentrations .
the incremental auc factors out the fasting tg concentration from the hourly responses and produces a curve that strictly reflects the success of the intervention on postprandial serum tg concentrations .
however , it should be cautioned that one study reported that the reproducibility of the incremental tg auc is relatively low when compared to the total tg auc suggesting this as a limitation for incremental auc .
while it seems clear that the most effective mathematical strategy at this point is to use both the total and incremental auc , we still have not adequately dealt with the clinical utility of these tests as it relates to the length of time required to conduct the tests .
it is well known that tg concentrations peak in most individuals within a 4-hour period [ 173 , 174 ] ( although it may occur sooner in women than men ) and that the 4-hour peak is highly related to the total 8 h postprandial lipemia response , which can be used for accurate estimation of the postprandial response in healthy and at - risk individuals .
additional studies provide evidence that an abbreviated 4 h test is appropriate and is highly correlated with the results of full length tests [ 172 , 175 , 176 ] with the caveat that it may be a better predictor in healthy lean or obese populations but not in individuals with hypertriglyceridemia . while the effects of a lifestyle intervention on the postprandial response to a high fat or mixed meal is most often measured by the magnitude and duration of the tg response , these responses provide little information about the source of lipids ( exogenous or endogenous ) . as described above , a primary objective of current research programs is to determine the mechanisms by which aerobic exercise and dietary interventions reduce postprandial lipemia .
one of the earliest methods used to evaluate the source of tgs following a meal is retinyl palmitate .
retinyl palmitate is the ester of retinol ( vitamin a ) and palmitate which is given in concert with a test meal . in the intestinal mucosa
, retinyl palmitate is incorporated into the chylomicron core where it is thought to remain during triglyceride hydrolysis [ 35 , 178180 ] .
this method assumes that the retinyl ester remains associated with apolipoprotein b-48 and does not exchange with other lipoproteins .
numerous challenges [ 181184 ] to this assumption have been observed suggesting that retinyl palmitate may not be an ideal approach to evaluate the contribution of exogenous and endogenous sources of lipoproteins following a meal . a more accurate approach to quantifying the source of trls may lie in the direct measurement of apolipoprotein b-48 .
apolipoprotein b-48 has a molecular weight ( mw ) of 264 kda and is approximately 48% the mass of apolipoprotein b-100 with a mw of 550 kda . in this technique
, trls are separated from plasma by ultracentrifugation and the concentrations of apolipoprotein b-48 and b-100 are quantified by hplc or densitometry [ 8 , 35 , 186 ] .
the postprandial apolipoprotein concentrations are subsequently reported in relative units or considered as auc responses in a similar fashion to that used for tgs .
more sophisticated approaches to apolipoprotein quantification and kinetics have been employed using stable isotopes to examine whether defects in secretion and/or catabolism of apolipoproteins are responsible for hypertriglyceridemia following a meal .
for example , wong and colleagues used a bolus of d3-leucine ( 5 mg / kg bw ) with a high - fat meal in obese and lean individuals to evaluate chylomicron metabolism . using this approach , the authors were able to show that central obesity results in an overproduction and impaired catabolism of apolipoprotein b-48 containing lipoproteins .
additional studies have used stable isotopes to label test meal fatty acid content to differentiate between exogenous and endogenous tgs where [ u - c ] palmitate ( 5 mg / kg ffm ) was administered in a liquid test meal .
lipids were isolated using a heptane / isopropanol extraction procedure and analyzed by lc / ms .
moderate - high intensity aerobic and resistance exercise produce consistent reductions in postprandial lipemia when performed 30 minutes to 20 hours prior to mixed or high - fat meals .
energy deficits created by moderate - intensity exercise appear to be responsible for a considerable proportion of the decrease in postprandial tgs with exercise .
however , studies using resistance and hii exercise suggest that other factors may be involved .
future studies are needed to compare the effects of resistance exercise and hii in men and women .
furthermore , studies are required to determine the impact of weight loss ( produced by energy restriction and/or increased energy expenditure ) on the acute postprandial lipemia response to exercise . on a practical level
, the minimum threshold of exercise energy expenditure to lower postprandial lipemia in sedentary and active populations is crucial .
additional studies using innovative approaches are also needed to more thoroughly evaluate the mechanisms by which exercise lowers postprandial tgs and if these mechanisms are different between obese and nonobese populations , sex , and race / ethnicity .
future studies will be needed to determine the mechanisms by which low - carbohydrate ( glucose and/or fructose ) diets work . | postprandial hyperlipemia produces long - term derangements in lipid / lipoprotein metabolism , vascular endothelial dysfunction , hypercoagulability , and sympathetic hyperactivity which are strongly linked to atherogenesis .
the purpose of this review is to ( 1 ) provide a qualitative analysis of the available literature examining the dysregulation of postprandial lipid metabolism in the presence of obesity , ( 2 ) inspect the role of adiposity distribution and sex on postprandial lipid metabolism , and ( 3 ) examine the role of energy deficit ( exercise- and/or energy restriction - mediated ) , isoenergetic low - carbohydrate diets , and omega-3 ( n-3 ) fatty acid supplementation on postprandial lipid metabolism .
we conclude from the literature that central adiposity primarily accounts for sex - related differences in postprandial lipemia and that aerobic exercise attenuates this response in obese or lean men and women to a similar extent through potentially unique mechanisms .
in contrast , energy restriction produces only mild reductions in postprandial lipemia suggesting that exercise may be superior to energy restriction alone as a strategy for lowering postprandial lipemia . however , isoenergetic very low - carbohydrate diets and n-3 fatty acid supplementation reduce postprandial lipemia indicating that macronutrient manipulations reduce postprandial lipemia in the absence of energy restriction .
therefore , interactions between exercise / energy restriction and alterations in macronutrient content remain top priorities for the field to identify optimal behavioral treatments to reduce postprandial lipemia . |
this prospective cross - sectional observational study was conducted in the department of pharmacology and department of medicine over a period of 12 months ( may 2013may 2014 ) .
prior to initiation of the study , approval of the research protocol evaluation committee and the institutional ethics committee was obtained .
the schedule contained information on demographic variables along with a format for assessing the utilization of anti - diabetic drugs .
patients included in this study were conclusively diagnosed to be diabetics and were receiving antidiabetic medication .
patients with gestational diabetes and those below 18 years of age were excluded from the study .
data were obtained twice a week at the medicine opd , and all diabetic patients admitted in the in - patient facility were screened at least once a week .
patients were explained about the purpose of the study and strict confidentiality was ensured . written informed consent was taken from each participant .
all the anti - diabetic agents were classified into six major groups and one miscellaneous group .
these included the biguanides ( anatomical - therapeutic - chemical classification code - a10ba ) , sulfonylureas ( atc code - a10bb ) , alpha - glucosidase inhibitor ( atc code - a10bf ) , dipeptidyl peptidase 4 inhibitor ( dpp-4 ) ( atc code - a10bh ) , thiazolidinediones ( atc code - a10bg ) , insulin and analogues ( atc code - a10a ) , and other blood glucose lowering drugs ( e.g. , nateglinide , exenatide , repaglinide , etc . ) excluding insulins ( atc code - a10bx ) .
the generic names of drugs prescribed by brand names were obtained from the recent editions of current index of medical specialty and indian drug review .
the data thus obtained were sorted and categorized on the basis of demographic characteristics ( male vs. female ) , hospital setting ( outpatient vs. inpatient ) , and number of drugs prescribed ( monotherapy vs. combination therapy ) . the national list of essential medicines of india ( nlem ) , 2011 which is published by the ministry of health and family welfare , government of india , was referred .
the data collected were analyzed for frequency , percentage , mean , and standard deviation .
statistical software used was microsoft office excel 2007 and ibm spss statistics version 20 ( statistical package for the social sciences ibm corporation ) .
chi - square test was used where applicable and p < 0.05 was considered significant .
this prospective cross - sectional observational study was conducted in the department of pharmacology and department of medicine over a period of 12 months ( may 2013may 2014 ) .
prior to initiation of the study , approval of the research protocol evaluation committee and the institutional ethics committee was obtained .
the schedule contained information on demographic variables along with a format for assessing the utilization of anti - diabetic drugs .
patients included in this study were conclusively diagnosed to be diabetics and were receiving antidiabetic medication .
patients with gestational diabetes and those below 18 years of age were excluded from the study .
data were obtained twice a week at the medicine opd , and all diabetic patients admitted in the in - patient facility were screened at least once a week .
patients were explained about the purpose of the study and strict confidentiality was ensured . written informed consent was taken from each participant .
all the anti - diabetic agents were classified into six major groups and one miscellaneous group .
these included the biguanides ( anatomical - therapeutic - chemical classification code - a10ba ) , sulfonylureas ( atc code - a10bb ) , alpha - glucosidase inhibitor ( atc code - a10bf ) , dipeptidyl peptidase 4 inhibitor ( dpp-4 ) ( atc code - a10bh ) , thiazolidinediones ( atc code - a10bg ) , insulin and analogues ( atc code - a10a ) , and other blood glucose lowering drugs ( e.g. , nateglinide , exenatide , repaglinide , etc . ) excluding insulins ( atc code - a10bx ) .
the generic names of drugs prescribed by brand names were obtained from the recent editions of current index of medical specialty and indian drug review .
the data thus obtained were sorted and categorized on the basis of demographic characteristics ( male vs. female ) , hospital setting ( outpatient vs. inpatient ) , and number of drugs prescribed ( monotherapy vs. combination therapy ) . the national list of essential medicines of india ( nlem ) , 2011 which is published by the ministry of health and family welfare , government of india , was referred .
the data collected were analyzed for frequency , percentage , mean , and standard deviation .
statistical software used was microsoft office excel 2007 and ibm spss statistics version 20 ( statistical package for the social sciences ibm corporation ) .
chi - square test was used where applicable and p < 0.05 was considered significant .
a total of 310 diabetic patients were included in this study , out of which 307 were suffering from type 2 diabetes mellitus ( t2 dm ) , while three patients had t1 dm .
diabetes was found to be more common in females ( 52.3% ) than in males ( 47.7% ) .
patients were observed to be mostly in the 6170 years age range ( 27.1% ) followed by 5160 years ( 22.9% ) . as a whole , 71.3% of the patients were above the age of 50 years .
disease and demographic characteristics of diabetic patients a total of 560 antidiabetic agents were prescribed during the study period ( 1.84/prescription ) [ table 2 ] .
metformin ( biguanide antidiabetic class ) was the single most prescribed antidiabetic agent ( 66.8% of patients ) .
glimepiride ( 32.9% ) was the sulfonylureas used most commonly , while glibenclamide was used in 2.6% of the patients .
association between the duration of diabetes and insulin usage was found to be significant ( p < 0.05 ) .
the utilization of voglibose and sitagliptin was similar ( 21.6% and 21.9% , respectively ) . in terms of total number of antidiabetic units prescribed ( n = 560 ) [ figure 1 ] , the drug share of metformin ( 37% ) was more than that of the sulfonylureas ( 20.7% ) .
the utilization of drugs from the nlems was 51.2% , while 11% of antidiabetics were prescribed by their generic name .
overall utilization of antidiabetic agents overall utilization of antidiabetics on the basis of total number of units prescribed ( n = 560 ) table 3 depicts the pattern of antidiabetic drug use on the basis of gender .
biguanides were prescribed more commonly in males than in females ( = 2.93 ; p = 0.08 ) .
sulfonylureas ( = 0.34 ; p = 0.55 ) , insulin ( = 0.002 ; p = 0.95 ) , and thiazolidinediones ( = 2.79 ; p = 0.09 ) were prescribed more commonly in females than in males . however , gender - based differences in the use of the antidiabetic agents were not significant ( p > 0.05 for all groups ) .
pattern of antidiabetic drug use on the basis of gender combination antidiabetic drug therapy ( 65.1% ) was used more frequently than monotherapy ( 34.8% ) .
a combination of 2 drugs was used in 75.7% of the patients whereas three drug combinations were used in 24.2% of all the patients receiving combination therapy .
the most commonly used two drug combinations were metformin + glimepiride ( n = 74 ) and metformin + pioglitazone ( n = 47 ) .
the three drug combination of metformin + voglibose + sitagliptin was used in 21 patients , followed by metformin + voglibose + glimepiride , which was used in 13 patients [ figure 2 ] .
metformin was a component of 94.7% of all two drug combinations and 100% of all three drug combinations .
a total of 48% of all antidiabetic combinations used , comprised both metformin and a sulfonylureas ( n = 96 ) .
insulin has been used in combination with metformin and/or a sulfonylureas in eight patients . the use of biguanides ( = 35.68 ; p < 0.0001 ) , sulfonylureas ( = 4.89 ; p = 0.02 ) , and dpp-4 inhibitors ( = 8.1 ; p = 0.004 ) in combination therapy was significant as compared to their use as monotherapy .
insulin , on the other hand , was predominantly used as monotherapy in comparison to combination therapy ( = 257.1 ; p < 0.0001 ) [ table 4 ] .
relative frequency of anti - diabetic drug combinations used ( n = 202 ) pattern of antidiabetic drug use on the basis of type of therapy table 5 depicts the relative use of antidiabetics in outpatients ( 55.5% ) and inpatients ( 44.5% ) .
the use of the thiazolidinedione ( pioglitazone ) was more in outpatients in comparison to that in inpatients , and this difference was highly significant ( p < 0.0001 ; = 29.25 ) . the biguanides ( p = 0.65 ; = 0.2 ) and sulfonylureas ( p = 0.08 ; = 2.9 ) group of antidiabetics were also predominantly used in outpatients as compared to that of inpatients .
insulin use was more in inpatients as compared to that of outpatients ( = 44.08 ; p < 0.0001 ) and the difference was highly significant . pattern of antidiabetic drug use on the basis of hospital setting a total of 278 patients had associated comorbidities , the single most common one being hypertension ( 34.5% ) .
hypertension alone and comorbid with other conditions / complications such as nephropathy , cerebrovascular accident ( cva ) , and ihd were seen in 74% of the diabetic patients .
cva and ihds were seen in 9% and 5.2% of the patients , respectively . other less frequent comorbidities included dyslipidemia , ccf , and copd
a total of 310 diabetic patients were included in this study , out of which 307 were suffering from type 2 diabetes mellitus ( t2 dm ) , while three patients had t1 dm .
diabetes was found to be more common in females ( 52.3% ) than in males ( 47.7% ) .
patients were observed to be mostly in the 6170 years age range ( 27.1% ) followed by 5160 years ( 22.9% ) . as a whole , 71.3% of the patients were above the age of 50 years .
a total of 560 antidiabetic agents were prescribed during the study period ( 1.84/prescription ) [ table 2 ] .
metformin ( biguanide antidiabetic class ) was the single most prescribed antidiabetic agent ( 66.8% of patients ) .
glimepiride ( 32.9% ) was the sulfonylureas used most commonly , while glibenclamide was used in 2.6% of the patients .
association between the duration of diabetes and insulin usage was found to be significant ( p < 0.05 ) .
the utilization of voglibose and sitagliptin was similar ( 21.6% and 21.9% , respectively ) . in terms of total number of antidiabetic units prescribed ( n = 560 ) [ figure 1 ] ,
the drug share of metformin ( 37% ) was more than that of the sulfonylureas ( 20.7% ) . human insulin comprised 12.8% of the total drug share .
the utilization of drugs from the nlems was 51.2% , while 11% of antidiabetics were prescribed by their generic name .
overall utilization of antidiabetic agents overall utilization of antidiabetics on the basis of total number of units prescribed ( n = 560 )
biguanides were prescribed more commonly in males than in females ( = 2.93 ; p = 0.08 ) .
sulfonylureas ( = 0.34 ; p = 0.55 ) , insulin ( = 0.002 ; p = 0.95 ) , and thiazolidinediones ( = 2.79 ;
. however , gender - based differences in the use of the antidiabetic agents were not significant ( p > 0.05 for all groups ) . pattern of antidiabetic drug use on the basis of gender
combination antidiabetic drug therapy ( 65.1% ) was used more frequently than monotherapy ( 34.8% ) .
a combination of 2 drugs was used in 75.7% of the patients whereas three drug combinations were used in 24.2% of all the patients receiving combination therapy .
the most commonly used two drug combinations were metformin + glimepiride ( n = 74 ) and metformin + pioglitazone ( n = 47 ) .
the three drug combination of metformin + voglibose + sitagliptin was used in 21 patients , followed by metformin + voglibose + glimepiride , which was used in 13 patients [ figure 2 ] .
metformin was a component of 94.7% of all two drug combinations and 100% of all three drug combinations .
a total of 48% of all antidiabetic combinations used , comprised both metformin and a sulfonylureas ( n = 96 ) .
insulin has been used in combination with metformin and/or a sulfonylureas in eight patients . the use of biguanides ( = 35.68 ; p < 0.0001 ) , sulfonylureas ( = 4.89 ; p = 0.02 ) , and dpp-4 inhibitors ( = 8.1 ; p = 0.004 ) in combination therapy was significant as compared to their use as monotherapy .
insulin , on the other hand , was predominantly used as monotherapy in comparison to combination therapy ( = 257.1 ; p < 0.0001 ) [ table 4 ] .
relative frequency of anti - diabetic drug combinations used ( n = 202 ) pattern of antidiabetic drug use on the basis of type of therapy
table 5 depicts the relative use of antidiabetics in outpatients ( 55.5% ) and inpatients ( 44.5% ) .
the use of the thiazolidinedione ( pioglitazone ) was more in outpatients in comparison to that in inpatients , and this difference was highly significant ( p < 0.0001 ; = 29.25 ) . the biguanides ( p = 0.65 ; = 0.2 ) and sulfonylureas ( p = 0.08 ; = 2.9 ) group of antidiabetics were also predominantly used in outpatients as compared to that of inpatients .
insulin use was more in inpatients as compared to that of outpatients ( = 44.08 ; p < 0.0001 ) and the difference was highly significant .
a total of 278 patients had associated comorbidities , the single most common one being hypertension ( 34.5% ) .
hypertension alone and comorbid with other conditions / complications such as nephropathy , cerebrovascular accident ( cva ) , and ihd were seen in 74% of the diabetic patients .
cva and ihds were seen in 9% and 5.2% of the patients , respectively . other less frequent comorbidities included dyslipidemia , ccf , and copd .
the who defines drug utilization studies as the marketing , distribution , prescription , and the use of drugs in a society , with special emphasis on the resulting medical , social , and economic consequences .
prescription pattern surveys are an important methodological instrument of drug utilization research , which help to provide an in - depth insight into the disease profile of patients and prescribing behavior of clinicians .
such studies can contribute to the promotion of rational , evidence - based drug therapy that can in turn help to improve patient care and treatment .
a relative preponderance of diabetes was observed in females , a finding similar to that of studies conducted in nepal and chennai .
a study in mysore reported the mean age of diabetics as 56.5 13.2 years , while another study in spain reported it to be 60.5 12.8 years in type 2 diabetics .
patients in our study were observed to be mostly in the 6170 years age range ( 27.1% ) followed by 5160 years ( 22.9% ) . in a study done in nepal
, most of the patients belonged to the 5160 years age group ( 37.9% ) whereas 21.9% of the patients belonged to the 6170 years age range . all together , the population of diabetics above 50 years of age was 73.63% which was similar to that seen in our study ( 71.3% ) .
the findings support the fact that the risk of diabetes tends to increase with age .
the mean duration of diabetes was observed to be 9.52 6.5 years which is comparable to the findings of a study done in spain in which the mean duration of diabetes was 11.8 8.0 years . in another study done by john et al .
, the mean duration of diabetes was 4.3 4.2 years which was much less than that reported in our study .
in the same study , the average number of drugs per prescription was 3.2 1.3 as compared to 4.92 2.5 observed in our study .
other factors , such as high number of inpatients and comorbid hypertension , are likely to have had an impact on number of drugs prescribed .
it is recognized that patients with dm are generally prescribed more drugs as compared to other patients .
metformin monotherapy and combination therapy was used in 66.8% of the patients and was additionally the single most frequently prescribed anti - diabetic drug .
this finding is in line with that of upadhyay et al . , where biguanides accounted for 51.2% of the total antidiabetic medications .
a study by johnson et al . in canada , similarly observed that 65% of the patients received metformin , alone or in combination .
another study in nepal also noted metformin to be the most frequently prescribed antidiabetic agent .
however , in some studies conducted in india and abroad , the sulfonylureas group of antidiabetics were observed to be the most commonly prescribed drug class .
the fact that metformin was the most frequently prescribed drug in this study is in accordance with its endorsement as the preferred anti - diabetic agent by current clinical guidelines .
it has even been recommended as the first choice oral medication in the large subset of elderly diabetics ( > 65 years ) .
advantages of metformin that make it the preferred antidiabetic agent include its efficacy in blood sugar reduction without risk of hypoglycemia , greater general tolerability , and relatively lower cost . in obese diabetic patients , it has also been found to significantly reduce glycosylated hemoglobin and all - cause mortality as compared to sulfonylureas and insulin . among the sulfonylureas ,
glibenclamide was used sparingly ( 2.6% patients ) despite being included in the nlem , whereas glipizide and glimepiride together were prescribed in 34.8% of the patients .
this could be due to the fact that glibenclamide is more likely to cause hypoglycemia , particularly in the elderly , consequent to its longer duration of action .
on the contrary , other second generation sulfonylureas such as gliclazide , glipizide , and glimepiride are safer than glibenclamide and are preferred .
the use of combination antidiabetic therapy ( 65.1% ) was more frequent than that of monotherapy ( 34.8% ) , a finding also observed in a study by rajeshwari et al . ,
several other studies have also reported the combination of metformin and a sulfonylurea to be used most widely . a combination of metformin and glimepiride , in particular , was the most commonly used drug combination in a study conducted in gujarat where it was prescribed in 76.2% of the patients .
clinical studies have shown that a combination of sulfonylureas with metformin can achieve optimal glycemic control even in advanced niddm . broadly speaking , antidiabetics with different mechanisms of action show the greatest synergy , which in turn forms the basis of the guideline recommendation of adding either insulin or sulfonylurea to metformin when the target glycosylated hemoglobin is not achieved .
insulin has been used in 23% of the patients , which is similar to the frequency of insulin use in a study by rajeshwari et al .
the use of insulin has been observed to be more frequent in inpatients than in outpatients and monotherapy as compared to combination therapy ( p < 0.0001 for both parameters ) .
a similar pattern of insulin use was also observed in a study done in mysore .
this may suggest that in patients with advanced diabetes and concomitant complications are more likely to require an insulin - based treatment regimen .
insulin is mostly indicated when optimal doses of oral hypoglycemic agents do not achieve target glycemic control , and deterioration of glycemic status is associated with substantial weight loss . because of the progressive nature of type 2 diabetes , a substantial proportion of patients are eventually going to require insulin therapy .
many studies suggest that t2 dm patients who are intensively being treated with insulin , the combination of insulin and metformin results in superior glycemic control as compared to insulin therapy alone while insulin requirement and weight gain are less .
use of metformin in combination with an insulin - based treatment regimen has however been minimal .
the use of thiazolidinedione , pioglitazone , and the dpp-4 inhibitor , sitagliptin , has been used mostly in an outpatient hospital setting and in combination with other hypoglycemic agents .
the newer oral hypoglycemic agents are likely to be used in combination with the first - line hypoglycemic agents to achieve optimal glycemic control .
a significant number of patients with long - term diabetes are at a higher risk of developing complications .
the prevalence of hypertension is 1.52 times greater in patients with diabetes mellitus compared with matched non diabetic individuals .
conversely , hypertensives are more predisposed to the development of diabetes than their normotensive counterparts .
hypertension comorbid with other conditions / complications such as nephropathy , cva , and ihd was seen in 74% of the patients .
a high incidence of hypertension comorbid with diabetes was also seen in other studies by rajeshwari et al . and upadhyay et al .
since concomitant hypertension increases the risk of development of diabetes - related complications , and vice versa , it is imperative to ensure widespread screening and early detection of both these disorders to impede involvement and progression of end organ damage .
rational prescribing practices and the safe use of drugs are very important in the management of diabetic patients since they are likely to be on lifelong therapy .
the nlems is aimed at promoting rational use of medicines by considering their cost , safety , and efficacy , thus prioritizing the availability of affordable quality medicine at all levels of healthcare . in our study , the use of antidiabetic agents from the nlem was 51.2% .
a slightly higher use of drugs from the nlem was observed in a study by agarwal et al . ,
prescribing drugs by generic name allows flexibility of stocking and dispensing various brands of a particular drug that are cheaper than and as effective as proprietary brands , and should thus be encouraged .
there is a clear emphasis on the overall use of metformin and sulfonylureas as combination therapy , and insulin as monotherapy , particularly in an inpatient hospital setting .
evidence - based medicine should be an essential component of continuing medical education to enable advances in clinical research to be translated into best possible patient care practices .
| objective : diabetes has gradually emerged as one of the most serious public health problems in our country .
this underlines the need for timely disease detection and decisive therapeutic intervention .
this prospective cross - sectional observational study aims at analyzing the utilization pattern of antidiabetic agents in a remote north - east indian tertiary care teaching hospital in the perspective of current standard treatment guidelines.materials and methods : diabetic patients receiving antidiabetic medication , both as outpatients and inpatients in our hospital over a period of 12 months ( may 2013may 2014 ) , were included in this study .
the data obtained were sorted and analyzed on the basis of gender , type of therapy , and hospital setting.results:a total of 310 patients were included in the study .
metformin was the single most frequently prescribed antidiabetic agent ( 66.8% ) followed by the sulfonylureas group ( 37.4% ) .
insulin was prescribed in 23.2% of the patients .
combination antidiabetic drug therapy ( 65.1% ) was used more frequently than monotherapy ( 34.8% ) . the use of biguanides ( p < 0.0001 ) and sulfonylureas ( p = 0.02 ) in combination was significant as compared to their use as monotherapy .
a total of 48% of all antidiabetic combinations used , comprised metformin and sulfonylureas ( n = 96 ) .
insulin use was significantly higher as monotherapy and in inpatients ( p < 0.0001 ) .
the utilization of drugs from the national list of essential medicines was 51.2% , while 11% of antidiabetics were prescribed by generic name.conclusion:the pattern of utilization largely conforms to the current standard treatment guidelines .
increased use of generic drugs is an area with scope for improvement . |
histologically , aggregates of calcium can be shown with von kossa stain.scn is a special type belonging to the idiopathic group , usually presenting as a solitary firm nodule on the head and neck.the pathogenesis of scn is not understood , yet .
scn is a special type belonging to the idiopathic group , usually presenting as a solitary firm nodule on the head and neck .
calcinosis cutis is a term used to describe a group of disorders in which calcium deposits form in the skin .
, it has a profound effect on keratinocyte proliferation , differentiation , and cell - to - cell adhesion .
cutaneous calcium deposits were describe first in 1877 , but it was in 1952 that winer described congenital nodular calcifications , currently known as scn . synonyms include winer 's nodular calcinosis , solitary genital nodular calcification , cutaneous calculi , and solitary congenital calcified nodule .
the etiology of calcinosis cutis may be idiopathic or due to abnormal calcium or phosphorus metabolism of dermal collagen .
scn is a rare form of idiopathic calcinosis ( ic ) that occurs more commonly in children , particularly in the head - and - neck region .
scn can be present at birth without any previous history of cutaneous and systemic pathology or disturbances in the metabolism of calcium and phosphorus , with a male - to - female ratio of 2/1 .
most lesions appeared as solitary , raised , tan , or white nodules on the upper eyelid or medial canthal skin of healthy , young patients .
all reported patients with scn had normal serum levels of calcium and phosphates , with no other systemic abnormality or disseminated integumentary deposits .
by contrast , additional calcium deposits beyond the eyelid warrant attention to the patient 's health status , as hyper - calcemic states have been reported to associate with eyelid margin , corneal , limbal , and inter - palpebral calcific deposit .
the scn cases , which have been reported in the literature , are usually in the form of case reports in children with placement of the eyelid [ table 1 ] . to date published the cases we report a case of a 22-year - old man with multiple nodules of the bilateral dorsum of hands mimicking eruptive xanthoma with the review of the literature .
a 22-year - old healthy white man presented with asymptomatic , multiple nodules on the bilateral dorsum of hands since he was 10 years old .
clinical examination was remarkable for 13 lesions ( range in diameter 0.2 - 1 cm ) , white to yellowish , hard , non - sensitive nodules on the bilateral dorsum of hands [ figure 1 ] .
the case was misdiagnosed as verruca vulgaris and was treated with cryotherapy at different centers .
histopathology showed homogeneous basophilic masses and granules in the upper dermis , which were surrounded by foreign body reaction and epidermal hyperplasia , an appearance consistent with cutaneous calcinosis [ figure 2 ] .
the lesions on the dorsum of righthand the histopathological image routine laboratory tests and metabolic evaluations ( calcium , phosphate , and parathyroid hormone ) , hematological parameters , and blood sedimentation rate were within normal limits .
x - ray of the affected hands showed small radio - opaque focuses , but the bony structure did not show any pathology .
the cause and histogenesis of these deposits have not been fully established , but several theories have been proposed .
the most favored theory has been proposed by steigleder who believed that the calcium was deposited on a pre - existing lesion such as a hamartoma or nevus .
cutaneous calcification may be divided into four major categories such as metastatic , dystrophic , idiopathic , and iatrogenic .
metastatic calcinosis ( mc ) occurs in the presence of primary disorders of calcium / phosphate metabolism as well as from secondary causes such as hyper - parathyroidism , hyper - vitaminosis d , sarcoidosis , neoplastic involvement of bone , renal insufficiency , and milky alkali syndrome .
metastatic calcification can occur in the media layer of the blood vessels and this may result in vascular occlusion .
dystrophic calcification ( dc ) is the most common type of calcinosis cutis and occurs in the presence of normal serum levels of calcium and phosphates but in previously diseased skin .
the dc that occurs in conjunction with the above entities does not likely involve a bacterial etiology .
dc is common in childhood in the presence of such diseases as dermatomyositis , systemic scleroderma , crest ( calcinosis , raynaud phenomenon , esophageal dysmotility , sclerodactyly , and telangiectasia ) syndrome , morphea , subcutaneous fat necrosis of the newborn , and cutaneous neoplasms .
iatrogenic calcinosis is a result of extravasation of some intravenous liquids such as calcium gluconate , calcium chloride solutions , during intravenous application , forming nodules in the skin .
ic appears without an underlying cutaneous disease ; the clinical picture resembles the one seen in dc .
lesions are usually seen in young and middle - aged men , presenting as asymptomatic round yellow multiple papules , ranging from a few millimeters to centimeters .
ic occurs in the absence of evident tissue or metabolic abnormalities , and is further subdivided into three distinctive disorders of childhood : calcinosis circumscripta , ic of the scrotum , and scn .
there is also a milia - like form that occurs on the hands , and face , of some patients with down syndrome .
the milia - like calcinosis cutis lesions are mostly multiple especially seen on hands , feet , knees , and elbows to be more widely distributed .
reported 21 cases of scn showing a male predominance with a male - to - female ratio of 2:1 .
alper et al . presented a case where the lesion was localized on the knees of a 23-year - old female patient .
the oral cavity is very rarely affected by calcinosis cutis of any type [ table 1 ] .
histopathologically , scn is characterized by an intensely basophilic sub - epithelial calcium deposit beneath the acanthotic and papillomatous epidermis on hematoxylin and eosin - stained preparations .
the deposits stain with von kossa 's stain for calcium and are surrounded by foreign body reactions , and trans - epidermal eliminations of calcium granules can be observed . the clinical diagnosis of scn is not easy and it is most often mistaken for verruca , molluscum contagiosum , pilomatricoma , epidermal cyst , milium , syringoma , congenital inclusion cyst , sebaceous cyst , or xanthoma . in our case , the diagnosis was made by histopathology , rather than the clinic .
intra - lesional steroid injection and co2 laser have also have been used as alternative treatment modalities .
eruptive xanthoma is in clusters throughout the body in the yellow - orange - colored papular lesions that are often surrounded by an erythematous halo .
they appear in crops on the buttocks , extensor surfaces of the extremities , and flexural creases . in our case ,
yellow - white colored papules on the bilateral dorsum of the hands composed of a large number of settlers is similar to eruptive xanthoma .
we considered cutaneous eruptive xanthomas in the differential diagnosis , which are characteristic lesions of hyper - lipidemia and chylomicronemia .
rarely , eruptive xanthomas have been reported with hypo - thyroidism , nephrotic syndrome , and von gierke 's glycogen storage disease .
rarely , these lesions may present with prominent leukocytoclasis as seen in papular neutrophilic xanthomas , which have been described in hiv - positive and immunocompromised patients .
aldabagh and bergfeld described a patient with eruptive neutrophilic xanthomas with neither hyper - lipidemia nor immunocompromise .
histologically , foamy macrophages are present in the dermis with an inflammatory infiltrate of lymphocytes and neutrophils .
tendon xanthomatosis often accompanies familial hyper - cholesterolemia , but it can also occur in other pathological states .
lesions of our case were not his tendons and our patient 's lipid profile was normal .
our patient 's serum calcium and phosphorus levels were normal and there was no history of parenteral treatment .
patient 's current physical examination , laboratory , and histopathological findings led us to the diagnosis of ic of the subcutaneous calcified nodule .
for treatment of multiple lesions , the patient is advised to have follow - up examinations .
scn , settled in the form of yellow - white - colored lesions , may be multiple and at atypical localization .
clinicians should be aware that calcinosis cutis may involve the bilateral dorsum of hands and elicits appropriate history to exclude metastatic cutaneous calcification .
dermatologists should include this entity in the differential diagnosis of multiple papular lesions on bilateral hand dorsums .
sub - epidermal calcified nodules ( scns ) can rarely present with multiple nodules resembling xanthoma.although the head - and - neck region is the common location , unusual presentations on the dorsum of hands can occur .
sub - epidermal calcified nodules ( scns ) can rarely present with multiple nodules resembling xanthoma .
although the head - and - neck region is the common location , unusual presentations on the dorsum of hands can occur . | sub - epidermal calcified nodule ( scn ) is an uncommon form of idiopathic calcinosis .
it usually occurs in children , particularly in the head and neck region , presenting as a solitary , painless , yellow - white nodule with papillomatous features .
these lesions occur twice as common in males compared with females .
the pathogenesis is uncertain , but the clinical and histological features of this lesion are distinctive .
we report a case of 22-year - old man with multiple nodules bilaterally located on the dorsum of hands simulating eruptive xanthoma . histopathological examination of one of the excised lesion confirmed the diagnosis showing epidermal and sub - epidermal deposition of calcium .
this paper presents a review of the literature and adds a new case of scn . |
it could have been a good idea to replace diseased liver tissue by healthy hepatocytes in order to provide the metabolic power , which gets lost during liver damage from any kind of challenge viral , genetic , chemical intoxication , etc . , ( muraca , 2011 ; puppi et al . , 2011 ; hughes et al . , 2012 ) .
this concept is based on the assumption that the hepatocyte represents the smallest functional unit of the liver executing all the single metabolic services as the liver does as a whole .
indeed , hepatocyte transplantation has been proven feasible in animal trials and turned out to promise an alternative to liver transplantation in clinical settings .
usually , in rodents cells are administered to the liver either via the splenic vein after injection into the spleen or via the portal vein .
cells then spread with the blood stream over the entire organ and enter the parenchyma after endothelial penetration . they integrate and proliferate and
there is huge experience in hepatocyte transplantation available from animal trials comprising acute and chronic liver disease models .
provided that a mitotic challenge and a regenerative advantage is presented to the donor hepatocytes then significant or even nearly complete repopulation of the host liver might be achieved .
yet , without this the rate of repopulation is rather low ranging at about 1% ( santoni - rugiu et al . , 2005 ;
christ , 2006 ; weber et al . , 2009 ; shafritz and oertel , 2011 ) .
there is doubt whether this is sufficient to supply the metabolic capacity needed to overcome the malfunction of the damaged host liver in clinical applications .
an estimate of 15% of repopulating hepatocytes has been considered to suffice for the correction of a genetic metabolic defect of the liver ( fox and roy - chowdhury , 2004a ; lee et al . , 2004b ) .
patients suffering from the defect of udp - glucoronosyltransferase ( crigler najjar - syndrome ; fox et al . , 1998 ) or of glucose-6-phosphatase ( glycogen storage disease type ia ; muraca et al . , 2002
) improved after receiving human hepatocyte transplants at least for a transient period of time .
thus , hepatocyte transplantation has also gained proof - of - concept in clinical trials , which is documented by more than 30 ongoing or published studies ( muraca , 2011 ; christ and brckner , 2012 ; hughes et al . , 2012 ) .
there are 30% more patients on the waiting list for liver transplantation than actually receive the life - saving organ both in the united states and in europe indicating the scarcity of donor livers .
it is self - evident that in this situation also livers to isolate primary hepatocytes for purposes of cell transplantation are scarce and , they are often marginal yielding hepatocytes of minor quality and insufficient quantity . hence , even if hepatocyte transplantation turned out a versatile alternative to liver transplantation the shortage of donor livers prompted the search for novel cell resources to generate hepatocytes or hepatocyte - like cells .
it might be assumed that the principles of hepatocyte transplantation are also valid for these artificial hepatocytes in terms of cell transplant quantity , site of application , mode of action , principles of tissue integration , and finally therapeutic support in the short- and long - term range .
this approach sounds rather straightforward and therefore it is worthy to talk about alternatives , which would aid to provide surgical potential in order to manage the bottleneck of donor liver availability both for organ and hepatocyte transplantation .
tissue turnover is not the liver s most prominent quality under resting , i.e. , healthy conditions . with only 0.01% hepatocytes undergoing mitosis
, 1966 ; koniaris et al . , 2003 ) . yet , in case of liver damage accompanied by massive hepatocyte loss the organ displays a remarkable regenerative potential .
after two third partial hepatectomy the liver mass is restored after only about 12 weeks in rodents . the regenerative process is tightly regulated by a plethora of cytokines , hormones , factors , and their interactions .
the initial response is triggered by the liver - resident macrophages , the kupffer cells , which engages the activation by tumor necrosis factor ( tnf- ) , components of the complement system ( c3a/5a ) , lymphotoxin , just to mention some of those best known until today .
the kupffer cells then secrete the pro - inflammatory cytokine il-6 , which targets the hepatocytes and activates the canonical il-6-signaling pathway involving gp130-mediated dimerization of stat3 and the downstream activation of il-6 target genes .
this so - called priming phase initiates hepatocyte proliferation involving a second set of factors comprising hepatocyte growth factor ( hgf ) and epidermal growth factor ( egf ) receptor ligand family such as transforming growth factor ( tgf- ) , heparin - binding egf - like growth factor and amphiregulin .
hepatocyte proliferation continues until the original mass of the liver is restored ( fausto and campbell , 2003 ; michalopoulos , 2007 , 2010 ; riehle et al . , 2011 ) .
yet , there is evidence that hepatocytes may not only generate hepatocytes but may also differentiate into other liver cell types such as biliary epithelial cells ( michalopoulos et al . , 2005 ) or pancreatic cells ( horb et al .
hence , hepatocytes themselves fulfill the basic criteria of stem cells , the self - renewal and multiple differentiation potential giving rise to progeny of at least two different lineages .
the liver contains a parenchymal back - up compartment , which is activated under injury conditions preventing mature hepatocyte proliferation and/or causing hepatocyte replicative senescence .
experimentally , such situations may be provoked in rodents by feeding a choline - deficient diet in combination with the administration of acetylaminofluorene ( aaf ) or ethionine , by galactosamine or dipin combined with partial hepatectomy to mention a few ( koniaris et al . ,
2003 ; santoni - rugiu et al . , 2005 ; shafritz and oertel , 2011 ) .
liver progenitor cells called oval cells in rodents emerge in the periportal areas of the liver lobule comprising the canals of hering , structural links between the terminal biliary branches and the periportal hepatocytes surrounding the proximal parts of the sinusoids . under healthy conditions oval cells are rare and hardly detectable .
it is widely agreed upon that the oval cells are the bipotent progeny of hepatic stem cells , of which their real nature and existence in the adult liver has still to be substantiated ( sell , 2001 ; fausto , 2004 ; kofman et al . , 2005 ; santoni - rugiu et al . , 2005 ;
but , due to similar marker gene expression patterns it has been proposed that there might exist a precursor / product relationship between the embryonic hepatoblasts and the oval cells ( fausto and campbell , 2003 ) . in humans
hepatic progenitor cells , perhaps equivalent to the oval cells in rodents , appear in the pathophysiological situations of viral hepatitis , liver cancer and massive drug intoxication ( roskams et al . , 2004 , 2010 ) .
injuries occurring under these conditions provoke so - called ductular reactions , of which the hallmark is the appearance of transit amplifying cells , the progeny of hepatic progenitor cells residing in the liver stem cell niche , the canals of hering ( roskams et al .
hepatic progenitor cells may be identified based on the expression of cytokeratin 7 ( ck7 ) , epithelial cell adhesion molecule ( epcam ) , neural adhesion molecule , and cd133 ( alison et al . , 2009 ;
the cells of the ductular reactions display an intermediate immunophenotype featuring both biliary and hepatocyte marker expression .
there is emerging evidence that the etiology of the liver disease may imprint the phenotype of the cells of the ductular reaction indicating their bipotent differentiation capacity , but which may also be the result of stimulation of different hepatic stem cell niches or the differential activation of one and the same niche under different hepatic injury conditions ( van den heuvel et al .
indeed , active notch signaling seems to specify cholangiocyte differentiation whereas this pathway must be shut off for hepatocyte differentiation , which , however , requires in addition active wnt signaling ( spee et al .
in recent times it became obvious that hepatic stem cells might also derive from extrahepatic sources such as the bone marrow .
in the animal model of fumarylacetoacetate hydrolase ( fah ) deficiency featuring human tyrosinemia type i transplantation of hematopoietic stem cells ( hsc ) resulted in the rescue of the disease phenotype in the mouse liver due to the generation of hsc - derived functional hepatocytes ( lagasse et al .
oval cells were also attributed to be of bone marrow origin ( petersen et al . , 1999 ; alison et al . , 2000 ; theise et al . , 2000 ) . yet , not differentiation of the hsc into hepatocytes but rather fusion with host hepatocytes was the product of donor cell - derived hepatocytes ( petersen et al . , 1999 ; alison et al .
, 2000 ; theise et al . , 2000 ; alvarez - dolado et al . , 2003 ; vassilopoulos et al . , 2003
the bone marrow harbors mesenchymal stem cells ( msc ) , which are cd34- and cd45-negative indicating their non - hematopoietic nature .
they feature multiple differentiation potential including lineage commitment into cells of all three germ layers ( pereira et al . , 1995 ;
their hepatocyte differentiation capacity in vitro and in vivo has been demonstrated and because of their easy availability and low ethical risks msc have become an attractive cell source for clinical cell therapy approaches including cell therapy of liver diseases ( see below ) .
there is great hope in induced pluripotent stem cells ( ips ) , which were generated first in mice from somatic cells complemented with the so - called pluripotency factors , oct4 , sox2 , klf4 , and c - myc re - programming the cells into an embryonic stem cell - like genotype ( takahashi and yamanaka , 2006 ) .
one prominent feature of these cells is their pluripotent differentiation capability , which comprises differentiation into cells from the three germ layers such as cardiomyocytes , adipocytes , neurons , hematopoietic precursors , osteoclasts , pancreatic cells ( for recent reviews cf . ;
hanna et al . , 2010 ; okita and yamanaka , 2011 ; bilic and belmonte , 2012 ) .
endodermal differentiation includes also hepatocyte differentiation ( yagi et al . , 2009 ; ghodsizadeh et al .
introduction of the factors is achieved by viral , chemical , and dna - mediated delivery .
all of these methods raise safety concerns , which in addition to the tendency of the ips to form teratoma , restrict the clinical use of these cells so far .
however , first liver repopulation experiments in mice demonstrated the high regenerative potential of ips ( espejel et al . , 2010 ) , which certainly opens a clinical perspective .
this is highly relevant since application of cells of autologous origin back to the patient avoids the long - term risks associated with immunosuppression .
thus , in summary liver regeneration might be accomplished by liver stem cells either of intrinsic origin or from extrahepatic sources like bone marrow ( msc ) or any somatic cell .
artificial hepatocytes from stem cells for clinical hepatocyte transplantation ( fox and roy - chowdhury , 2004b ) .
one feasible alternative to human adult hepatocytes is the use of hepatocytes derived from human msc .
experiments in rats ( wang et al . , 2004 ; lange et al . , 2005 ) , mice ( jiang et al . , 2002 ) , and humans ( schwartz et al . , 2002 ; lee et al . , 2004a ; hong et al . , 2005 ; seo et al . , 2005 ; talns - visconti et al . , 2006 ;
. , 2007 ) confirmed the in vitro differentiation potential of msc from prominent sources like bone marrow or adipose tissue . in the following
we will reference some of the studies using msc in order to indicate their versatile application in animal models of different liver diseases .
cultured bone marrow - derived msc from male albino rats were infused into the tail vein of female rats treated with carbontetrachloride ( ccl4 ) to induce liver fibrosis .
y chromosome - positive donor cells were found in the female host liver exhibiting reduced collagen depositions and improved liver functions ( abdel aziz et al . , 2007 ) .
attenuation of ccl4-induced liver fibrosis was also demonstrated using hepatocyte - like cells differentiated from bone marrow - derived msc in the rat ( oyagi et al . , 2006 ) .
undifferentiated human bone marrow - derived msc attenuated acute liver injury induced by allyl alcohol in sprague dawley rats ( sato et al . , 2005 ) .
hepatic integration and function of human adipose tissue - derived msc pre - differentiated into hepatocyte - like cells prior to transplantation was shown both in ccl4-treated mice ( seo et al . , 2005 ; banas et al . , 2007 ) and rats after partial hepatectomy ( sgodda et al . , 2007 ) .
not surprisingly , hepatocyte pre - differentiated msc were more effective as compared to their undifferentiated precursors . in the hepatectomized scid mouse model bone marrow - derived msc pre - differentiated into hepatocyte - like cells in vitro xenografted to the mouse livers and expressed hepatocyte markers such as albumin and ck18 ( lysy et al . , 2008 ; aurich et al . ,
mscs engrafted predominantly in the periportal portion of the liver lobule displaying hepatocyte - specific features like glycogen storage and expression of phosphoenolpyruvate carboxykinase , connexin32 , albumin , and the human hepatocyte - specific antigen heppar1 ( aurich et al . , 2007 ) . in summary ,
irrespective of the site of application , i.e. , systemic infusion , intrahepatic injection , intrasplenic delivery , or portal vein infusion msc were found in the liver of the host animal forming clusters of donor cells .
these cells were functional in terms of expression of specific markers and secretion of albumin . in the case of acute and chronic liver architecture deterioration msc improved the disease .
both undifferentiated and hepatocyte - differentiated msc integrate functionally into the host liver but at significant higher rates using differentiated cells .
facing the fact that functional characterization of msc - derived hepatocyte - like cells after transplantation is fragmentary at best , is it then reasonable to use msc in clinical applications ?
in the following section animal studies will be exemplified to delineate critical aspects of potential safety concerns before translation of msc - based hepatocyte transplantation into the clinics .
these include site of administration , distribution , bioavailability , elimination , and tumorigenicity . msc display migratory competence .
after systemic application they migrate to inflammatory sites attracted by chemokines liberated from the regions of tissue injury .
intrasplenic and hepatic injection have been chosen as the sites primarily used for transplantation of adult hepatocytes .
it may be anticipated that a portion of injected cells resides in the spleen , which provides an acceptable tissue environment for adult hepatocytes to survive , proliferate , and execute hepatocyte - specific functions without systemic side effects ( kusano and mito , 1982 ) .
very likely the mechansims of hepatic integration of stem cell - derived hepatocytes is similar or even equal to that of adult hepatocytes as discussed above .
transplanted hepatocytes mainly engraft in the periportal regions of the liver lobule and acquire the gene expression pattern of periportal hepatocytes ( aurich et al . , 2005 ) . however , shifting transplanted hepatocytes into the perivenous areas by treatment with carbontetrachloride resulted in the change from a periportal to a perivenous hepatocyte expression pattern in these cells .
this indicates that the hepatic microenvironment governs the differentiation state of transplanted cells directing position - specific gene expression ( gupta et al . , 1999 ;
intraportal infusion of hepatocytes resulted also in entrapment of cells passaged through the liver into the lung parenchyma of new zealand rabbits ( schneider et al .
, virtually all hepatocytes were cleared from the pulmonary capillaries within 24 h ( rajvanshi et al . , 1999 ; schneider et al . , 2003 ) .
hepatic engraftment after transplantation of human bone marrow - derived msc into the spleen or the liver was similar in scid mice ( lysy et al . , 2008 ) .
as mentioned above msc - derived hepatocyte - like cells both after intrasplenic and portal administration were found in the periportal areas of the liver lobule where they featured typical characteristics of periportal hepatocytes 10 weeks post - transplant ( aurich et al .
principally , undifferentiated msc may contribute to the formation of most if not all somatic cell types .
donor cells were found in hematopoietic organs and in the epithelia of the lung , liver , and gut ( jiang et al . , 2002 ) .
injection of undifferentiated murine bone marrow - derived msc into the tail vein of nod / scid mice resulted in engraftment of donor cells into gastrointestinal organs but also in the lung and skin ( anjos - afonso et al . ,
2004 ) , a result , which was also demonstrated after intravenous application of undifferentiated bone marrow msc into baboons ( devine et al . , 2003 ) .
taking advantage of the permissive milieu of tissues and organs during organogenesis , fetal sheep were transplanted i.p . with human bone marrow - derived msc , which integrated and differentiated into blood , liver , and skin cells ( almeida - porada and zanjani , 2004 ) .
intrahepatic versus intraperitoneal injection of human msc improved the percentage amount of human hepatocytes in sheep livers by fivefold ( chamberlain et al . , 2007 ) .
it may be concluded that under minimal injury conditions as in the models described here msc may give rise to cell types of different tissues and organs but that hepatic injury leads primarily to engraftment in the liver .
hence , it is very likely that msc , both native and hepatocyte - differentiated home to the liver without significant extrahepatic tissue colonization .
there is evidence that msc might contribute to extrahepatic manifestation of cancer or even liver cancer .
it is a generally accepted concept that mature differentiated cells in a tissue originate from multipotent stem cells via tissue - specific stem and/or progenitor cell differentiation .
tumorigenic transformation at each step of this one - way lineage leads to loss of the differentiated phenotype and may give rise to a putative cancer ( stem ) cell developing into tumors of the respective tissues ( cf . ; martnez - climent et al . , 2006 ;
polyak and hahn , 2006 ; ailles and weissman , 2007 ; wu , 2008 ; for recent reviews ) .
common properties of both tissue - specific stem cells and tumor ( stem ) cells are their potential of self - renewal , differentiation , and gene expression signatures supporting the abovementioned concept .
thus , any mutational event given will cause expansion of stem / progenitor cells normally quiescent in the healthy tissue thereby increasing their propensity to tumor development .
the tumor stroma contains mesenchymal cells ( mtc ) with an invasive phenotype contributing to neoangiogenesis , which they share with msc .
thus , similar morphological and immunological features , as well as the expression of a common set of stemness signature genes might indicate the risk of the therapeutic use of mscs under tumor - promoting conditions ( studeny et al .
there is controversy whether or not somatic stem cells are involved in hepatocarcinogenesis ( wu and yu , 2007 ) .
however , in a transgenic mouse model of hepatocellular cancer ( hcc ) induced by diethylnitrosamine and phenobarbital bone marrow cells did not progress to hcc ( ishikawa et al . , 2004 ) .
similar results were found in non - transgenic balb / c mice after chemical induction of hcc by diethylnitrosamine ( zheng and liang , 2008 ) . in the lewis rat ,
bone marrow - derived stem cells were recruited to the liver after feeding a choline - deficient diet , fused with hepatic oval cells but did not contribute to pre - neoplastic nodule formation ( kubota et al . , 2008 ) .
numerous studies have since shown hepatogenic differentiation from both hematopoietic and msc without cellular fusion in a variety of different animal disease models ( ishikawa et al . , 2003 ; newsome et al .
, 2003 ; jang et al . , 2004 ; sato et al . , 2005 ) .
thus , even under conditions favoring tumorigenesis in the liver , no contribution of msc to tumor formation in the liver has been reported so far whatever site of application or carcinogen was being used .
most of the studies described above applied msc not pre - differentiated into hepatocyte - like cells prior to hepatic transplantation . in a murine melanoma model
ectopic administration of allogeneic msc showed that msc after chondrogenic differentiation did not display migratory activity and reduced the promotion of tumor growth while undifferentiated msc migrated to the site of the tumor and favored tumor growth and metastasis ( akay et al . , 2010 ) .
it seems to be a general feature of undifferentiated msc to be recruited to the tumor stroma as shown previously in a culture model of human glioblastoma ( birnbaum et al . , 2007 ) .
nevertheless it can not be excluded that msc promote tumor growth indirectly due to their propensity to form progenitor cells of tumor vessels exemplifying the pro - angiogenic properties of msc ( kinnaird et al . , 2004 ) and/or stromal - fibroblast like cells thus impacting the tumor stroma and supporting tumor growth ( huss et al . , 2004 ;
there is also evidence that msc by producing anti - inflammatory molecules reduce pancreatic tumor growth ( zischek et al . , 2009 ) .
on the other hand the immunosuppressive features of undifferentiated msc might favor tumor growth and metastasis as shown in rodent animal models ( djouad et al .
thus , the current knowledge does not allow for the safe use of msc in clinical settings at least in terms of tumorigenicity .
therefore , investigations in large animal models of liver diseases like in the pig are appreciated to study the behavior of msc under the given environment produced by the specific disease . in recent times
pig models for isolation and transplantation of msc became available ( casado et al . , 2012 ) , which now allow for the evaluation of both the therapeutic and the potential side effects of msc as close as possible to the human situation ( shi et al .
, 2010 ; groth et al . , 2012 ; li et al . , 2012 ) .
due to their specific properties like low immunogenicity and promotion of anti - inflammatory responses msc act immunomodulatory ( djouad et al . , 2003 ; krampera et al . , 2007 ; newman et al . , 2009 ) .
the application of allogeneic msc does not provoke an immune response in vitro or in vivo
. this might be partially due to the expression of intermediate levels of hla class i antigens and lack of expression of hla class ii antigens on the cell surface ( di nicola et al .
, 2002 ; le blanc et al . , 2003 ; klyushnenkova et al . , 2005 ; sotiropoulou et al . ,
the msc - mediated immune modulation mechanistically varies depending on the immune cell type affected ( meisel et al . , 2004 ;
aggarwal and pittenger , 2005 ; nasef et al . , 2007 ; feng and chen , 2009 ; siegel et al . , 2009 ) .
msc interact with dendritic cells ( dc ) as well as with t - cells , b - lymphocytes , and with nk cells ( aggarwal and pittenger , 2005 ; nauta and fibbe , 2007 ; noel et al . , 2007 ; stagg and galipeau , 2007 ) .
they modulate generation , activation as well as function of dc at different levels of differentiation ( jiang et al . , 2005 ; nauta et al . ,
they inhibit the maturation and migration of dc to the lymph nodes and the secretion of tnf- by dc ( krampera et al . , 2006 ; spaggiari et al .
, 2006 ; nasef et al . , 2007 ; ramasamy et al . , 2007
recent studies identified two different functional types of msc . depending on the prevailing conditions immunosuppressive msc or immunogenic msc may be distinguished . in the presence of pro - inflammatory cytokines like tnf- and interferon - gamma ( ifn- ) the immunosuppressive phenotype of msc is favored .
if anti - inflammatory cytokines like il-10 are predominant the suppressive effect of msc is abrogated ( renner et al . , 2009 ) .
depending on the level of ifn- msc furthermore exhibit antigen - presenting properties ( chan et al . , 2006 ) .
differentiated msc promoted human dc maturation by stimulation of cd38 expression on the dc and upregulation of b7 expression on msc . yet ,
osteogenic , chondrogenic and adipogenic differentiation did not alter the immunosuppressive properties of msc ( chen et al . , 2007 ) , which supported the conclusion that msc , undifferentiated , or differentiated , may be accepted even by hla - incompatible patients .
msc attenuate secretion of major pro - inflammatory cytokines like tnf- and ifn- and thus reverse tissue inflammation , which is supported by an increased expression of the immunosuppressive cytokines il-10 and tgf- secreted by the msc ( krampera et al .
this would explain the anti - inflammatory features of msc ( di nicola et al .
, 2009 ; newman et al . , 2009 ; mao et al . , 2010 ) .
immunosuppressive and anti - inflammatory effects of msc may be mediated on the molecular level by heme oxygenase ( ho-1 ) and inos ( munn et al . , 1998 ) ,
indoleamine 2,3-dioxygenase ( ido ) preventing the t - cell response through tryptophan depletion ( aggarwal and pittenger , 2005 ) or prostaglandin e2 ( pge2 ; bartholomew et al . , 2002 ; aggarwal and pittenger , 2005 ; beyth et al . , 2005 ; le blanc and ringden , 2005 ; yanez et al . ,
so far major attempts are under way to apply msc for the prevention of graft versus host disease ( gvhd ) , rejection of organ transplants and for modulation of inflammation in general
. it may be concluded that msc may play a pleiotropic role impacting a given disease by a specified mode of action , which is triggered by the diseased tissue environment .
this includes tissue regeneration through substitution of the tissue lesion by functional cells differentiated from the msc but also modulation of an inflammatory tissue environment thus improving or stimulating self - regeneration of the affected tissue .
these pleiotropic mode of action is highly appreciated to treat liver diseases of different etiology .
acute or chronic liver injuries require the down - regulation of inflammatory processes in order to prevent progressing tissue damage whereas ample liver resection due to liver cancer might require substitution of functional loss .
hence , in the one case undifferentiated msc might represent the cell source of choice while in the latter hepatocyte - differentiated msc might be appreciated .
it must be anticipated that nearly all tissues harbor msc , which upon tissue injury proliferate and differentiate into the cells of the tissue of origin to replace and functionally regenerate the injured tissue regions .
recently , msc - like cells have even been isolated from adult human liver ( najimi et al . , 2007 ; covas et al . ,
2008 ) and liver grafts ( pan et al . , 2011 ) suggesting that these cells might contribute to tissue repair after hepatic injury .
so why not use msc for allogeneic stem cell transplantation in liver diseases ? as outlined above this concept has widely been proven in animal models of a great variety of different liver diseases , and indeed , finds increasing interest to progress into clinical translation .
liver cirrhosis is characterized by the irreversible deterioration of the liver s architecture resulting in the formation of regenerative nodules , which are separated by fibrotic septae .
it may progress to liver cancer and/or liver failure with a very high incidence of mortality .
msc have been shown to ameliorate liver fibrosis in mice and rats , which was likely due to the reduction of collagen synthesis and the induction of expression of metalloproteinases , the major players in matrix degradation and remodeling ( parekkadan et al . , 2007 ; banas et al . , 2008 ;
acute liver failure is a highly inflammatory response of the liver to exogenous toxic insults , which is characterized by parenchymal dysfunction leading to systemic organ failures due to the lack of metabolic homeostasis normally provided by the healthy liver .
the disease requires intensive care and like liver failure due to chronic dysfunction bears a high risk of mortality ( ostapowicz and lee , 2000 ; gill and sterling , 2001 ; rahman and hodgson , 2001 ; ogrady , 2005 ) .
taking advantage of the anti - inflammatory , anti - apoptotic , and pro - proliferative features of msc it has been shown in animal models that the cells attenuated acute liver failure by inhibition of inflammatory infiltration , reducing the rate of cell death , by increasing tissue recovery through stimulation of hepatocyte proliferation , and finally by augmenting survival rate ( parekkadan et al .
, 2007 ; van poll et al . , 2008 ; zagoura et al . , 2012 ) .
these encouraging results from animal studies prompted clinical application of msc in chronic and acute liver failure .
however , so far there is only limited information available on the clinical outcome . in patients suffering from decompensated liver cirrhosis treatment with umbilical
cord - derived msc reduced ascites volume and improved liver function in the short - term range ( kharaziha et al . , 2009 ;
zhang et al . , 2012 ) and patients with end - stage liver failure improved in terms of ascites volume reduction and improvement in child score after autologous bone marrow - derived msc transplantation ( amer et al . , 2011 ) .
these phase i / ii clinical trials demonstrated safety of hepatic msc transplantation at least under these indications but efficacy still awaits confirmation .
even if some clinical parameters might improve , the fate and long - term survival of the transplanted cells in the host liver , their mode of action , and finally safety in the long - term range have to be demonstrated .
it is likely that depending on the etiology and pathophysiology of the liver disease to be treated msc act differently according to their pleiotropic spectrum of action .
thus , the anti - inflammatory , anti - apoptotic , and pro - proliferative features of msc might be favorable in cases of chronic inflammatory liver diseases but in addition a functional tissue replacement is warranted in cases where massive tissue loss has to be substituted to provide sufficient metabolic capacity like in acute liver failure and huge liver resections .
therefore , it is necessary to understand the impact of msc both on the molecular and cellular level and their interactions with the host liver tissue under a given microenvironment as created by the diseased liver . it might also be thought to use msc in combination with primary human hepatocytes to either support hepatocyte function and moreover to minimize immunological rejection of the transplant in the short - term range taking advantage of the immunosuppressive features of msc ( stutchfield et al . , 2010 ) .
this could help to bridge the patient to liver transplantation and even through the critical phase of acute liver failure until the host liver recovers from the acute insult .
this is of high interest because this setting would enable allogeneic hepatocyte transplantation avoiding long - term immunosuppression with all the known undesired adverse effects .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | mesenchymal stem cells represent an alternate cell source to substitute for primary hepatocytes in hepatocyte transplantation because of their multiple differentiation potential and nearly unlimited availability
. they may differentiate into hepatocyte - like cells in vitro and maintain specific hepatocyte functions also after transplantation into the regenerating livers of mice or rats both under injury and non - injury conditions . depending on the underlying liver
disease their mode of action is either to replace the diseased liver tissue or to support liver regeneration through their anti - inflammatory and anti - apoptotic as well as their pro - proliferative action . |
childhood overweight and obesity is a growing problem worldwide which , according to the who , represents one of the most serious challenges to human health in this century . globally as many as 42 million children under the age of five were overweight in 2010 .
for example , manios has described how a team of 15 partners across the eu are working to develop such a program for children aged 46 years . in the usa , fitzgibbon et al .
conducted a pilot intervention study to prevent obesity in 35-year - old latino children , and taveras et al .
tested an intervention in primary care pediatrics including children aged 26 years in an attempt to reduce their overweight and obesity .
identification of overweight and obesity in young children is generally based on the bmi ( body mass index ) of boys and girls from several countries with age- and sex - specific cut - off values for these conditions .
however , obesity is characterized by excessive body fat accumulation , and in adults the body fat content for any particular bmi - value is quite variable .
published data suggest that bmi is an inaccurate estimate of body fatness of individuals also in pediatric populations .
however , the relationship between bmi and body fatness has been little studied in children below the age of five and no data are available to demonstrate how well the commonly used definition of overweight identifies children with a high body fat content in this age group .
this lack of data is likely due to a lack of appropriate body composition methodology .
it is therefore of interest to note that the air displacement plethysmography ( adp ) technique , a method known to be able to assess body composition accurately in adults , has recently been modified for young children .
a validation study demonstrated that this method can be accurate also in such subjects provided that measurements are appropriately conducted , which requires that the child accepts to sit alone in a closed chamber during three measurements each with a duration of about 50 seconds .
unfortunately , this requirement makes it difficult to study children below two years of age .
better compliance can be expected among older children , but it is likely that a certain number of children below the age of five will refuse participation .
the aims of this paper were ( a ) to report the compliance of 4-year - old children when performing the adp measurement according to established requirements ; ( b ) to describe body fatness , assessed by means of adp , in a group of healthy 4-year - old boys and girls in relation to commonly used bmi cut - off values for overweight ; ( c ) to assess the relationship between bmi and body fat ( % ) in 4-year - old boys and girls .
parents who had participated with their children ( n = 110 ) in a previous study were asked to let their children participate in the present study and 84 parent couples accepted .
body volume and density along with body fat were evaluated by means of adp using the pediatric option with software 5.2.0 ( bod pod body composition system , cosmed usa ) . in this procedure body mass
is measured using an electronic scale and body volume is assessed in a closed chamber utilizing the relationship between pressure and volume .
however , volume measurements were always performed in triplicate and strictly according the manufacturer 's instructions .
corrections for surface area artifact and thoracic gas volume and calculations of body composition were conducted as described by fields and allison .
overweight was assessed according to the international obesity task force using age- and - sex specific cut - off values .
our sample size ( n = 76 ) was sufficient to identify a correlation between bmi and body fat ( % ) of 0.28 as significant ( p < 0.05 ) with a power of 0.8 .
body composition was successfully measured in 76 children , equivalent to 90% of the children brought to the examination .
it should be noted that their weight and height are comparable to swedish reference data as demonstrated by the z - scores given in this table .
figure 1 shows bmi versus body fat ( % ) for boys ( a ) and girls ( b ) in the study together with the appropriate age- and sex - specific cut - offs for overweight . obviously , children with a high body fat content may well have a bmi below the cut - off for overweight and children with a bmi above this cut - off may well have a comparatively low body fat content .
for example , children with a bmi between 15 and 16 had a body fat content ranging from 14.3 to 32.5% .
bmi ( x ) and body fat ( % ) ( y ) were significantly but weakly correlated in boys ( r = 0.38 , p < 0.01 , y = 1.22x + 5.74 ) , in girls ( r = 0.46 , p < 0.01 , y = 1.66x + 0.63 ) , and in the sexes combined ( r = 0.39 , p < 0.001 , y = 1.32x + 4.94 ) .
in this study of 4-year - old boys and girls we found that most children accepted the requirements of the adp measurement and that bmi - based cut - offs for overweight did not effectively identify children with a high body fat content . we also found weak but significant correlations between bmi and body fatness in boys and girls . in our study
a large proportion of the children brought to the investigation by their parents could be measured with adp .
it is relevant to point out that these parents represented quite a special group since they had previously agreed to participate in a study when their children were newborns .
therefore they represented a selected group that tended to be quite positive towards participation in research . on the other hand , most of them , fathers as well as mothers , were professionally active with busy schedules which may have diminished their possibility to participate with their children in the study .
therefore , our parent population is not necessarily comparable to other parent populations regarding the proportion willing to accept participation in studies . in spite of these considerations , it is important to note that our sample of children is similar to that of healthy swedish children in general regarding weight and height . in conclusion
, our study demonstrated that a large proportion of healthy 4-year - olds who are brought to a measurement session by their parents will accept the requirements of the adp technique .
our study clearly demonstrates that bmi - based cut - offs for overweight do not effectively identify 4-year - old children with a high body fat content .
however , a significant correlation between bmi and body fat ( % ) was found in these children .
this relationship appeared to be slightly stronger in girls than in boys but our study may have been too small to identify such a significant difference between the sexes .
however , the correlation coefficient for the sexes combined , 0.39 , indicates that bmi explained only about 15% of the variation in body fat ( % ) .
the corresponding figure for adults is 5070% and 3470% for 318 year old children . these studies [ 8 , 14 ] clearly demonstrated that bmi is a poor predictor of the body fat content of individual subjects .
the poor correlation between bmi and body fat ( % ) found in the present study show that this is also the case for 4-year - old children .
this finding is likely to have important implications for studies of overweight and obesity in children .
for example , our results motivate attempts to include body composition assessment by means of adp in obesity prevention programs for young children .
it is important to realize that such assessments must be properly carried out and that behavioral issues are likely to be a limiting factor in infants and in some young children .
nevertheless , most 4-year - olds accepted the requirements of adp and therefore this technique can certainly be applied in a large number of young children .
thus it has the potential to be a useful complement to bmi and thereby improve our understanding regarding the biology of childhood obesity development . in conclusion ,
requirements associated with successful assessments of body composition by means of adp , a valid body composition method , were accepted by most 4-year - old children .
therefore this method has the potential to be a useful complement to bmi in studies related to overweight and obesity in this age group .
furthermore , our study showed that bmi - based cut - offs for overweight do not effectively identify 4-year - old children with a high body fat content and that bmi explains only a small proportion of the variation in body fat ( % ) in this age group . | childhood overweight and obesity , a worldwide problem , is generally identified using bmi ( body mass index ) . however , this application of bmi has been little investigated in children below 5 years of age due to a lack of appropriate methods to assess body composition . therefore , we used air displacement plethysmography ( adp ) to study 4.4-year old boys and girls since this method is accurate in young children if they accept the requirements of the measurement .
the purpose was to analyze the relationship between bmi and body fat in these children .
body composition was assessed in 76 ( 43 boys , 33 girls ) of the 84 children brought to the measurement session .
boys and girls contained 25.2 4.7 and 26.8 4.0% body fat , respectively .
bmi - based cut - offs for overweight could not effectively identify children with a high body fat content .
there was a significant ( p < 0.001 ) but weak ( r = 0.39 ) correlation between bmi and body fat ( % ) . in conclusion ,
requirements associated with a successful assessment of body composition by means of adp were accepted by most 4-year - olds . furthermore , bmi - based cut - offs for overweight did not effectively identify children with a high body fatness and bmi explained only a small proportion of the variation in body fat ( % ) in this age group . |
human glp-1 fragment 736 amide , exendin-4 , nicotinamide , and resveratrol were obtained from sigma ( st . louis , mo ) .
rpmi-1640 medium , fcs , and other culture media were purchased from invitrogen ( burlington , on , canada ) .
antiacetyl - lysine and anti - sirt1 antibodies were obtained from millipore ( bedford , ma ) .
ins832/13 cells ( 24 ) were grown in rpmi-1640 medium supplemented with 10 mmol / l hepes , 10% heat - inactivated fcs , 2
mmol / l l - glutamine , 1 mmol / l sodium pyruvate , 50 mol / l -mercaptoethanol , 100 iu / ml penicillin , and 100 g / ml streptomycin at 37c in a humidified 5% co2 atmosphere .
cells at 70% confluence were washed with phosphate - buffered saline and preincubated in serum - free rpmi-1640 medium supplemented with 3 mmol / l glucose and 0.1% bsa ( sigma ) for at least 4 h before treatment .
rat islets were isolated from male wistar rats ( 250 g ) by collagenase digestion .
human islets were isolated from organ donors at the department of surgery , montreal general hospital , mcgill university health center , montreal , quebec , canada ( three separate donors were received ) .
donors were between ages 42 and 65 , and none had a history of diabetes or metabolic disorder .
islets were isolated by digestion with liberase ci ( boehringer mannheim , indianapolis , in ) followed by purification over a ficoll gradient using a core 2991 cell processor ( cobe bct , denver , co ) .
proteins were extracted and quantified by bca assay ( roche , indianapolis , in ) .
foxo1 protein complexes were immunoprecipitated from 1 mg of total protein extracts and subjected to electrophoresis on 8 or 10% polyacrylamide gels .
cells were fixed to isolate intact chromatin and sheered in 200-base pair fragments , and sirt1 dna / protein complexes were immunoprecipitated using an anti - sirt1 antibody ( millipore ) . bound dna was amplified by pcr using sequence - specific primers designed for amplification of the forkhead binding site region of the foxa2 promoter ( 16 ) .
cells were treated for 15 min , and sirt1 activation was measured using a commercially available fluorometric assay ( biomol , plymouth meeting , pa ) . in brief , the kit uses a sirt1 substrate consisting of amino acids 379382 of human p53 ( arg - his - lys - lys[ac ] ) .
the assay 's fluorescence signal is generated in proportion to the amount of deacetylation of lys-382 , a known in vivo target of sirt1 .
cell extracts were incubated for 10 min at 37c with a 25 mol / l concentration of the fluorogenic sirt1 substrate .
reactions were stopped by the addition of 1 mmol / l nicotinamide , and the fluorescence resonance energy transfer signal was determined .
nad , nadh , and atp levels were measured in cell extracts using commercial kits ( nad / nadh quantification kit and atp fluorometric kit from biovision , mountain view , ca ) .
nicotinamide phosphoribosyltransferase ( nampt ) activity was measured by the conversion of c - labeled nicotinamide to [ c]nicotinamide mononucleotide as described previously ( 25 ) . in brief , cell lysates
( 10 g total protein ) were incubated with atp , 5-phosphoribosyl-1-pyrophosphate , and [ c]nicotinamide for 30 min ; filtered through glass fiber filters ; and washed with acetone .
cells were transfected with either control green fluorescent protein ( gfp ) , wild - type sirt1 , or a catalytically inactive sirt1 mutant ( 26 ) using lipofectamine 2000 ( invitrogen ) as described previously ( 16 ) .
the following day , proliferation of transfected cells was evaluated using brdu incorporation assay ( roche ) . in brief , cells were treated for 24 h in the absence or presence of 1 nmol / l glp-1 , and brdu was added to the culture medium for the last 60 min of the incubation period .
wild - type and sirbaco transgenic mice ( 27 ) aged 612 months were treated with daily intraperitoneal injections of exendin-4 ( 10 nmol / kg ) or saline for 7 days ( n = 5 each ) .
mice were killed , and pancreas sections were processed for insulin and ki67 immunohistochemistry to assess -cell proliferation .
cross - sectional islet area was measured using image pro plus software ( media cybernetics , silver spring , md ) .
results are presented as relative -cell areas ( i.e. , percent of insulin + areas relative to total pancreas areas ) . for each animal , at least four sections spaced 80 m apart were studied .
human glp-1 fragment 736 amide , exendin-4 , nicotinamide , and resveratrol were obtained from sigma ( st . louis , mo ) .
rpmi-1640 medium , fcs , and other culture media were purchased from invitrogen ( burlington , on , canada ) .
antiacetyl - lysine and anti - sirt1 antibodies were obtained from millipore ( bedford , ma ) .
ins832/13 cells ( 24 ) were grown in rpmi-1640 medium supplemented with 10 mmol / l hepes , 10% heat - inactivated fcs , 2 mmol / l l - glutamine , 1 mmol / l sodium pyruvate , 50 mol / l -mercaptoethanol , 100 iu / ml penicillin , and 100 g / ml streptomycin at 37c in a humidified 5% co2 atmosphere .
cells at 70% confluence were washed with phosphate - buffered saline and preincubated in serum - free rpmi-1640 medium supplemented with 3 mmol / l glucose and 0.1% bsa ( sigma ) for at least 4 h before treatment .
rat islets were isolated from male wistar rats ( 250 g ) by collagenase digestion .
human islets were isolated from organ donors at the department of surgery , montreal general hospital , mcgill university health center , montreal , quebec , canada ( three separate donors were received ) .
donors were between ages 42 and 65 , and none had a history of diabetes or metabolic disorder .
islets were isolated by digestion with liberase ci ( boehringer mannheim , indianapolis , in ) followed by purification over a ficoll gradient using a core 2991 cell processor ( cobe bct , denver , co ) .
proteins were extracted and quantified by bca assay ( roche , indianapolis , in ) .
foxo1 protein complexes were immunoprecipitated from 1 mg of total protein extracts and subjected to electrophoresis on 8 or 10% polyacrylamide gels .
cells were fixed to isolate intact chromatin and sheered in 200-base pair fragments , and sirt1 dna / protein complexes were immunoprecipitated using an anti - sirt1 antibody ( millipore ) . bound dna was amplified by pcr using sequence - specific primers designed for amplification of the forkhead binding site region of the foxa2 promoter ( 16 ) .
cells were treated for 15 min , and sirt1 activation was measured using a commercially available fluorometric assay ( biomol , plymouth meeting , pa ) . in brief , the kit uses a sirt1 substrate consisting of amino acids 379382 of human p53 ( arg - his - lys - lys[ac ] ) .
the assay 's fluorescence signal is generated in proportion to the amount of deacetylation of lys-382 , a known in vivo target of sirt1 .
cell extracts were incubated for 10 min at 37c with a 25 mol / l concentration of the fluorogenic sirt1 substrate .
reactions were stopped by the addition of 1 mmol / l nicotinamide , and the fluorescence resonance energy transfer signal was determined .
nad , nadh , and atp levels were measured in cell extracts using commercial kits ( nad / nadh quantification kit and atp fluorometric kit from biovision , mountain view , ca ) .
nicotinamide phosphoribosyltransferase ( nampt ) activity was measured by the conversion of c - labeled nicotinamide to [ c]nicotinamide mononucleotide as described previously ( 25 ) . in brief , cell lysates
( 10 g total protein ) were incubated with atp , 5-phosphoribosyl-1-pyrophosphate , and [ c]nicotinamide for 30 min ; filtered through glass fiber filters ; and washed with acetone .
cells were transfected with either control green fluorescent protein ( gfp ) , wild - type sirt1 , or a catalytically inactive sirt1 mutant ( 26 ) using lipofectamine 2000 ( invitrogen ) as described previously ( 16 ) .
the following day , proliferation of transfected cells was evaluated using brdu incorporation assay ( roche ) . in brief , cells were treated for 24 h in the absence or presence of 1 nmol / l glp-1 , and brdu was added to the culture medium for the last 60 min of the incubation period .
wild - type and sirbaco transgenic mice ( 27 ) aged 612 months were treated with daily intraperitoneal injections of exendin-4 ( 10 nmol / kg ) or saline for 7 days ( n = 5 each ) .
mice were killed , and pancreas sections were processed for insulin and ki67 immunohistochemistry to assess -cell proliferation .
cross - sectional islet area was measured using image pro plus software ( media cybernetics , silver spring , md ) .
results are presented as relative -cell areas ( i.e. , percent of insulin + areas relative to total pancreas areas ) . for each animal ,
statistical analyses were performed with spss ( spss inc . , chicago , il ) using anova .
we have previously shown that inhibition of the forkhead transcription factor foxo1 mediates the pleiotropic action of the glucoincretin hormone glp-1 ( 10 ) .
foxo1 is subject to various posttranslational modifications , including akt - dependent phosphorylation and sirt1-mediated deacetylation . here
, we sought to test the hypothesis that glp-1 inhibits sirt1 to enhance foxo1 acetylation and to stimulate -cell mass expansion .
we first evaluated foxo1 acetylation and binding to sirt1 by western blot in ins832/13 cells .
we resorted to the use of a pancreatic -cell line because of the high amount of biological material required to perform the assays .
ins cells were incubated in serum - free medium , a condition known to activate sirt1 , in the presence or absence of glp-1 and the sirt1 activators h2o2 or resveratrol .
figure 1a and b shows that glp-1 induced foxo1 acetylation , an action prevented by resveratrol but not by h2o2 .
coimmunoprecipitation experiments revealed that glp-1 inhibited the physical association between foxo1 and sirt1 ( fig .
the action of glp-1 on foxo1 acetylation was transient , with a maximal effect observed between 15 and 45 min .
1c ) . taken together , these results suggest that glp-1 inhibits sirt1-mediated foxo1 deacetylation .
a : foxo1 acetylation and binding to sirt1 were evaluated by western blot after immunoprecipitation of foxo1 protein complexes .
ins832/13 cells were incubated in serum - free medium in the presence or absence of glp-1 ( 10
nmol / l ) , with or without the sirt1 activators resveratrol ( 10 mol / l ) and h2o2 ( 25 mol / l ) for 45 min .
b : densitometry analysis of five different experiments as shown in a. * p < 0.05 .
c : foxo1 acetylation was evaluated as described in a after the indicated periods of time .
sirt1 was immunoprecipitated from cross - linked chromatin extracted from ins832/13 cells treated with or without glp-1 for 45 min .
eluted dna was pcr - amplified using oligonucleotides flanking the forkhead binding site in the rat foxa2 promoter .
e : western blots showing the subcellular localization of sirt1 and foxo1 after 45-min incubation with either 10 nmol / l glp-1 ( glp ) or 10 mol / l resveratrol .
chromatin immunoprecipitation assay was performed to assess whether sirt1 is recruited to the promoter region of foxo1 target genes .
figure 1d shows that sirt1 was physically associated to a region of the foxa2 promoter encompassing the forkhead binding site ( 10 ) .
this result indicates that sirt1 binding to the foxa2 promoter mirrors that of foxo1 , as we have previously demonstrated ( 10 ) .
altogether , these findings indicate that sirt1 interacts with foxo1 and is recruited to the promoter of foxo1 target genes in a glp-1inhibitable manner .
these data suggest a role for sirt1 in the transcriptional response to the glucoincretin hormone in -cells .
we next performed subcellular fractionation to address whether glp-1 provokes sirt1 nuclear exclusion , as it does for foxo1 ( fig .
our results show that sirt1 is predominantly nuclear in ins cells and that its subcellular localization was not altered by glp-1 treatment .
conversely , glp-1 induced cytoplasmic translocation of foxo1 , as we have published previously ( 10 ) .
we next sought to directly test whether glp-1 affects sirt1 activity using an in vitro deacetylase assay .
figure 2a shows that glp-1 blunted sirt1 activity to the same extent as the sirt1 inhibitor nicotinamide .
conversely , sirt1 activity was increased in resveratrol - treated cells . because sirt1 activity is dependent on nad , we measured changes in the nad - to - nadh ratio in response to glp-1 treatment in ins cells and isolated human islets
. figure 2b shows that glp-1 decreased the nad - to - nadh ratio by 30% in ins cells , an action mimicked by the addition of 10% serum .
conversely , resveratrol increased the nad - to - nadh ratio by 60% . both glp-1 and serum also elicited a reduction in the nad - to - nadh ratio in human islets ( fig .
2c ) , whereas the effect of resveratrol ( 25% ) did not reach statistical significance .
the reduction in nad availability provides a possible mechanism by which glp-1 could acutely regulate sirt1 activity . to directly test this possibility , we supplemented the assay buffer with 450 mol / l nad ( fig .
supplementation of nad suppressed glp-1 as well as serum inhibition of sirt1 activity . in an effort to unravel the mechanism by which glp-1 could alter the nad - to - nadh ratio
, we investigated its action on the activity of nampt , the rate - limiting enzyme for the biosynthesis of nad , and on the cellular atp content .
2e ) , thereby revealing a novel mechanism by which glp-1 could decrease the nad - to - nadh ratio .
fk-866 ( 10 nmol / l ) , a specific nampt pharmacological inhibitor , was used as a positive control .
2f ) , consistent with a recent publication by peyot et al . ( 28 ) .
it is interesting that the addition of serum did not alter nampt activity but significantly increased the cellular atp concentration .
a : cells were incubated in the presence or absence of 10 nmol / l glp-1 , 10 mmol / l nicotinamide ( nam ) , or 10 mol / l resveratrol ( res ) .
proteins were extracted after 15 min to perform the in vitro sirt1 deacetylase assay using a fluorogenic sirt1 substrate .
b and c : nad and nadh levels were determined in extracts from cells ( b ) or human islets ( c ) incubated in the presence or absence of 10 nmol / l glp-1 , 10% serum , or 10 mol / l resveratrol for 15 min .
d : sirt1 activity was measured as described in a with the modification that the assay buffer was supplemented with 25 mol / l nad .
e : nampt activity was measured by the conversion of c - labeled nicotinamide to [ c]nicotinamide mononucleotide . the specific nampt pharmacological inhibitor fk-866 ( 10
we next measured sirt1 expression by quantitative pcr after overnight incubation in serum - free medium in the absence or presence of glp-1 ( fig .
our data show that glucose and serum deprivation , a condition mimicking calorie restriction , increased sirt1 expression by fivefold compared with complete growth medium in ins cells .
3b ) . both glp-1 and serum decreased sirt1 expression in rat islets as well , although the detected changes were more modest .
thus , sirt1 expression was repressed by 30% in the presence of glp-1 and by 40% in response to serum .
we assessed sirt1 protein levels by western blot to test whether alterations in sirt1 expression were translated into changes in protein levels .
figure 3c and d shows that glp-1 decreased sirt1 protein levels by 70% in ins cells , an effect mimicked by serum .
a and b : cells ( a ) and isolated rat islets ( b ) were incubated in serum - free medium in the absence or presence of glp-1 or left untreated in complete growth medium for 24 h. sirt1 expression levels were measured by quantitative pcr and normalized to actin .
c : sirt1 protein levels were evaluated by western blot in ins cells treated as described in a and b. d : densitometry analysis of three different experiments as shown in a and b. * p < 0.05 . to test whether sirt1 inactivation mediates glp-1 action on -cell proliferation
, we sought to perform sirt1 gain of function both in vitro and in vivo .
ins832/13 cells were either transfected with wild - type sirt1 , a catalytically inactive sirt1 mutant , or with control gfp , and -cell replication was evaluated by brdu incorporation .
transfection of the cells with sirt1 led to a fivefold increase in protein levels as compared with gfp ( fig .
overexpression of wild - type sirt1 inhibited glp-1induced -cell proliferation but failed to significantly affect the effect of serum ( fig .
overexpression of a catalytically inactive sirt1 mutant did not significantly alter -cell proliferation , indicating that the effects of sirt1 on -cell proliferation are dependent on its deacetylase activity .
a : sirt1 protein levels were evaluated by western blot after transfection with wild - type ( wt ) or dominant - negative ( dn)-sirt1 .
b : the effect of sirt1 overexpression on -cell proliferation was evaluated by brdu incorporation .
ins832/13 cells were transfected with wt - sirt1 , dn - sirt1 , or control gfp for 24 h and then incubated in the presence or absence of glp-1 ( 10 nmol / l ) or 10% serum for an additional 24-h period .
results represent mean sem of three separate experiments carried out in triplicate . * p < 0.05 compared with the respective control . to demonstrate the implication of sirt1 in glp-1 action in vivo , we determined whether the effects of glp-1 on -cell mass were curtailed in transgenic mice with increased dosage of sirt1 ( sirbaco mice ) as previously described ( 27 ) .
thus , mice were administered with either saline or the long - acting glp-1 analog exendin-4 ( 10 nmol / kg ) daily for 7 days .
cross - sectional -cell areas were estimated by morphometry of pancreatic sections stained for insulin ( fig .
exendin-4 administration increased the relative -cell area by 2.5-fold and stimulated -cell replication by 50% in wild - type animals .
however , glp-1 effects on both -cell area and -cell replication were abolished in sirbaco mice . taken together , our results indicate that sirt1 gain of function prevents the mitogenic action of glp-1 and identify sirt1 as a negative regulator of -cell mass expansion .
wild - type ( wt ) or sirbaco transgenic mice received daily injections of exendin-4 ( 10 nmol / kg body wt ) or saline for 7 days .
pancreatic -cell mass and -cell replication were evaluated by morphometry and immunohistochemistry with anti - insulin and anti - ki67 antisera .
a and b : the relative cross - sectional islet area ( a ) and the percentage of ki67-positive -cells ( b ) are shown .
we have previously shown that inhibition of the forkhead transcription factor foxo1 mediates the pleiotropic action of the glucoincretin hormone glp-1 ( 10 ) .
foxo1 is subject to various posttranslational modifications , including akt - dependent phosphorylation and sirt1-mediated deacetylation . here
, we sought to test the hypothesis that glp-1 inhibits sirt1 to enhance foxo1 acetylation and to stimulate -cell mass expansion .
we first evaluated foxo1 acetylation and binding to sirt1 by western blot in ins832/13 cells .
we resorted to the use of a pancreatic -cell line because of the high amount of biological material required to perform the assays .
ins cells were incubated in serum - free medium , a condition known to activate sirt1 , in the presence or absence of glp-1 and the sirt1 activators h2o2 or resveratrol .
figure 1a and b shows that glp-1 induced foxo1 acetylation , an action prevented by resveratrol but not by h2o2 .
coimmunoprecipitation experiments revealed that glp-1 inhibited the physical association between foxo1 and sirt1 ( fig .
the action of glp-1 on foxo1 acetylation was transient , with a maximal effect observed between 15 and 45 min .
1c ) . taken together , these results suggest that glp-1 inhibits sirt1-mediated foxo1 deacetylation .
a : foxo1 acetylation and binding to sirt1 were evaluated by western blot after immunoprecipitation of foxo1 protein complexes .
ins832/13 cells were incubated in serum - free medium in the presence or absence of glp-1 ( 10
nmol / l ) , with or without the sirt1 activators resveratrol ( 10 mol / l ) and h2o2 ( 25 mol / l ) for 45 min .
b : densitometry analysis of five different experiments as shown in a. * p < 0.05 .
c : foxo1 acetylation was evaluated as described in a after the indicated periods of time .
sirt1 was immunoprecipitated from cross - linked chromatin extracted from ins832/13 cells treated with or without glp-1 for 45 min .
eluted dna was pcr - amplified using oligonucleotides flanking the forkhead binding site in the rat foxa2 promoter .
e : western blots showing the subcellular localization of sirt1 and foxo1 after 45-min incubation with either 10 nmol / l glp-1 ( glp ) or 10 mol / l resveratrol .
chromatin immunoprecipitation assay was performed to assess whether sirt1 is recruited to the promoter region of foxo1 target genes .
figure 1d shows that sirt1 was physically associated to a region of the foxa2 promoter encompassing the forkhead binding site ( 10 ) .
this result indicates that sirt1 binding to the foxa2 promoter mirrors that of foxo1 , as we have previously demonstrated ( 10 ) .
altogether , these findings indicate that sirt1 interacts with foxo1 and is recruited to the promoter of foxo1 target genes in a glp-1inhibitable manner .
these data suggest a role for sirt1 in the transcriptional response to the glucoincretin hormone in -cells .
we next performed subcellular fractionation to address whether glp-1 provokes sirt1 nuclear exclusion , as it does for foxo1 ( fig .
our results show that sirt1 is predominantly nuclear in ins cells and that its subcellular localization was not altered by glp-1 treatment .
conversely , glp-1 induced cytoplasmic translocation of foxo1 , as we have published previously ( 10 ) .
we next sought to directly test whether glp-1 affects sirt1 activity using an in vitro deacetylase assay .
figure 2a shows that glp-1 blunted sirt1 activity to the same extent as the sirt1 inhibitor nicotinamide .
conversely , sirt1 activity was increased in resveratrol - treated cells . because sirt1 activity is dependent on nad , we measured changes in the nad - to - nadh ratio in response to glp-1 treatment in ins cells and isolated human islets
. figure 2b shows that glp-1 decreased the nad - to - nadh ratio by 30% in ins cells , an action mimicked by the addition of 10% serum .
conversely , resveratrol increased the nad - to - nadh ratio by 60% . both glp-1 and serum also elicited a reduction in the nad - to - nadh ratio in human islets ( fig .
2c ) , whereas the effect of resveratrol ( 25% ) did not reach statistical significance .
the reduction in nad availability provides a possible mechanism by which glp-1 could acutely regulate sirt1 activity . to directly test this possibility , we supplemented the assay buffer with 450 mol / l nad ( fig .
supplementation of nad suppressed glp-1 as well as serum inhibition of sirt1 activity . in an effort to unravel the mechanism by which glp-1 could alter the nad - to - nadh ratio
, we investigated its action on the activity of nampt , the rate - limiting enzyme for the biosynthesis of nad , and on the cellular atp content .
2e ) , thereby revealing a novel mechanism by which glp-1 could decrease the nad - to - nadh ratio .
fk-866 ( 10 nmol / l ) , a specific nampt pharmacological inhibitor , was used as a positive control .
2f ) , consistent with a recent publication by peyot et al . ( 28 ) .
it is interesting that the addition of serum did not alter nampt activity but significantly increased the cellular atp concentration .
a : cells were incubated in the presence or absence of 10 nmol / l glp-1 , 10 mmol / l nicotinamide ( nam ) , or 10 mol / l resveratrol ( res ) .
proteins were extracted after 15 min to perform the in vitro sirt1 deacetylase assay using a fluorogenic sirt1 substrate .
b and c : nad and nadh levels were determined in extracts from cells ( b ) or human islets ( c ) incubated in the presence or absence of 10 nmol / l glp-1 , 10% serum , or 10 mol / l resveratrol for 15 min .
d : sirt1 activity was measured as described in a with the modification that the assay buffer was supplemented with 25 mol / l nad .
e : nampt activity was measured by the conversion of c - labeled nicotinamide to [ c]nicotinamide mononucleotide . the specific nampt pharmacological inhibitor fk-866 ( 10
we next measured sirt1 expression by quantitative pcr after overnight incubation in serum - free medium in the absence or presence of glp-1 ( fig .
our data show that glucose and serum deprivation , a condition mimicking calorie restriction , increased sirt1 expression by fivefold compared with complete growth medium in ins cells .
3b ) . both glp-1 and serum decreased sirt1 expression in rat islets as well , although the detected changes were more modest .
thus , sirt1 expression was repressed by 30% in the presence of glp-1 and by 40% in response to serum .
we assessed sirt1 protein levels by western blot to test whether alterations in sirt1 expression were translated into changes in protein levels .
figure 3c and d shows that glp-1 decreased sirt1 protein levels by 70% in ins cells , an effect mimicked by serum .
a and b : cells ( a ) and isolated rat islets ( b ) were incubated in serum - free medium in the absence or presence of glp-1 or left untreated in complete growth medium for 24 h. sirt1 expression levels were measured by quantitative pcr and normalized to actin .
c : sirt1 protein levels were evaluated by western blot in ins cells treated as described in a and b. d : densitometry analysis of three different experiments as shown in a and b. * p < 0.05 .
to test whether sirt1 inactivation mediates glp-1 action on -cell proliferation , we sought to perform sirt1 gain of function both in vitro and in vivo .
ins832/13 cells were either transfected with wild - type sirt1 , a catalytically inactive sirt1 mutant , or with control gfp , and -cell replication was evaluated by brdu incorporation .
transfection of the cells with sirt1 led to a fivefold increase in protein levels as compared with gfp ( fig .
overexpression of wild - type sirt1 inhibited glp-1induced -cell proliferation but failed to significantly affect the effect of serum ( fig .
overexpression of a catalytically inactive sirt1 mutant did not significantly alter -cell proliferation , indicating that the effects of sirt1 on -cell proliferation are dependent on its deacetylase activity .
a : sirt1 protein levels were evaluated by western blot after transfection with wild - type ( wt ) or dominant - negative ( dn)-sirt1 .
b : the effect of sirt1 overexpression on -cell proliferation was evaluated by brdu incorporation .
ins832/13 cells were transfected with wt - sirt1 , dn - sirt1 , or control gfp for 24 h and then incubated in the presence or absence of glp-1 ( 10 nmol / l ) or 10% serum for an additional 24-h period .
results represent mean sem of three separate experiments carried out in triplicate . * p < 0.05 compared with the respective control . to demonstrate the implication of sirt1 in glp-1 action in vivo , we determined whether the effects of glp-1 on -cell mass were curtailed in transgenic mice with increased dosage of sirt1 ( sirbaco mice ) as previously described ( 27 ) .
thus , mice were administered with either saline or the long - acting glp-1 analog exendin-4 ( 10 nmol / kg ) daily for 7 days .
cross - sectional -cell areas were estimated by morphometry of pancreatic sections stained for insulin ( fig .
exendin-4 administration increased the relative -cell area by 2.5-fold and stimulated -cell replication by 50% in wild - type animals .
however , glp-1 effects on both -cell area and -cell replication were abolished in sirbaco mice . taken together , our results indicate that sirt1 gain of function prevents the mitogenic action of glp-1 and identify sirt1 as a negative regulator of -cell mass expansion .
wild - type ( wt ) or sirbaco transgenic mice received daily injections of exendin-4 ( 10 nmol / kg body wt ) or saline for 7 days .
pancreatic -cell mass and -cell replication were evaluated by morphometry and immunohistochemistry with anti - insulin and anti - ki67 antisera . a and b : the relative cross - sectional islet area ( a ) and the percentage of ki67-positive -cells ( b ) are shown .
restoration and maintenance of -cell mass is a major goal of diabetes treatment ( 2931 ) .
glp-1 , a potent antidiabetes medication ( 4 ) , enhances glucose - stimulated insulin secretion and promotes -cell mass expansion , at least in rodents .
however , the molecular mechanism by which glp-1 exerts its action on -cell mass is not fully elucidated .
we have previously demonstrated that the transcription factor foxo1 , an important regulator of -cell mass ( 1618 ) , is a prominent transcriptional effector of glp-1 action ( 10 ) .
thus , glp-1 provoked nuclear exclusion of foxo1 to relieve a molecular brake on pdx1 and foxa2 expression . also , the effect of exendin-4 on -cell mass expansion was abolished in transgenic mice with -cell specific foxo1 gain of function ( 10 ) .
acetylation / deacetylation of foxo1 regulates its transcriptional activity ( 19 ) . on one hand , acetylation of foxo1 by cbp
/ p300 reduces its dna binding activity and increases its susceptibility to phosphorylation by akt ( 20 ) . on the other hand ,
acetylated foxo1 binds to the promyelocytic leukemia associated protein pml and is targeted to specific nuclear subdomains ( pml nuclear bodies ) ( 32 ) . upon calorie restriction or oxidative stress
, foxo1 is deacetylated by the nad - dependent sirtuin deacetylase sirt1 , which renders foxo1 immobile within the nuclear compartment and results in foxo1 transcriptional activity ( 26 ) .
our findings show that glp-1 increases foxo1 acetylation via inhibition of the nad+-dependent sirt1 deacetylase .
first , we show that glp-1 acutely decreases the cellular nad - to - nadh ratio , possibly via its hitherto uncharacterized action on nampt .
second , glp-1 downregulates sirt1 expression , thereby providing a long - term mechanism by which chronic or prolonged exposure to glp-1 receptor agonists could also inhibit sirt1 .
the fact that glp-1 failed to increase the intracellular atp content seemingly refutes the hypothesis that glp-1 could inhibit sirt1 via the stimulation of -cell glucose metabolism .
however , because our assay did not take into account compartmentalization of atp production or breakdown , this possibility can not be completely ruled out .
we also demonstrate that the effects of glp-1 and its long - acting analog exendin-4 on -cell mass were blunted in a pancreatic -cell line with increased dosage or sirt1 as well as in transgenic mice with sirt1 gain of function .
our results are consistent with a model in which glp-1 inhibits sirt1-mediated foxo1 deacetylation to relieve the constraint on -cell proliferation and -cell mass expansion ( fig .
thus far , the action of glp-1 agonists on -cell mass has not been demonstrated in humans in vivo .
moreover , the reported increase in -cell mass in mice has been shown to be restricted after the initial burst of proliferation in the postnatal period ( 33,34 ) .
however , a recent publication suggests that exendin-4 can stimulate -cell replication in human islet grafts ( 35 ) . proposed model .
mmp , matrix metalloproteinase ; egf , epidermal growth factor ; egfr , epidermal growth factor receptor ; pi-3k , phosphatidylinositol-3 kinase .
( a high - quality color representation of this figure is available in the online issue . )
previous studies using genetically engineered mice with sirt1 gain ( 36 ) or loss of function ( 37 ) indicate that sirt1 could enhance insulin secretion , an effect mediated via reduction of ucp2 expression .
these findings garnered much attention by identifying sirt1 , a molecule already scrutinized for its role in longevity , as a potential target for diabetes treatment .
however , the action of sirt1 on insulin secretion is difficult to conciliate with its role in calorie restriction ( 38,39 ) .
this discrepancy may be attributed to differences in the level and pattern of sirt1 expression between the various animal models . at first glance
, our findings that the glucoincretin hormone glp-1 inhibits sirt1 may seem conflicting with the action of sirt1 on insulin secretion .
however , the short - term effects of glp-1 on insulin secretion are not transcriptional in nature ( 40 ) . in conclusion
our study describes a novel mechanism of action for the glucoincretin hormone and identifies for the first time sirt1 as a negative regulator of pancreatic -cell mass .
thus , sirt1 could link -cell replication to the hormonal / nutritional status of the cells . | objectivethe glucoincretin hormone glucagon - like peptide 1 ( glp-1 ) enhances glucose - stimulated insulin secretion and stimulates pancreatic -cell mass expansion .
we have previously shown that the forkhead transcription factor foxo1 is a prominent transcriptional effector of glp-1 signaling in the -cell .
foxo1 activity is subject to a complex regulation by akt - dependent phosphorylation and sirt1-mediated deacetylation . in this study , we aimed at investigating the potential role of sirt1 in glp-1 action.research design and methodsfoxo1 acetylation levels and binding to sirt1 were studied by western immunoblot analysis in ins832/13 cells .
sirt1 activity was evaluated using an in vitro deacetylation assay and correlated with the nad+-to - nadh ratio .
the implication of sirt1 in glp-1induced proliferation was investigated by brdu incorporation assay .
furthermore , we determined -cell replication and mass in wild - type and transgenic mice with sirt1 gain of function after daily administration of exendin-4 for 1 week.resultsour data show that glp-1 increases foxo1 acetylation , decreases the binding of sirt1 to foxo1 , and stunts sirt1 activity in -ins832/13 cells .
glp-1 decreases both the nad+-to - nadh ratio and sirt1 expression in ins cells and isolated islets , thereby providing possible mechanisms by which glp-1 could modulate sirt1 activity .
finally , the action of glp-1 on -cell mass expansion is abolished in both transgenic mice and cultured -cells with increased dosage of sirt1.conclusionsour study shows for the first time that the glucoincretin hormone glp-1 modulates sirt1 activity and foxo1 acetylation in -cells .
we also identify sirt1 as a negative regulator of -cell proliferation . |
the pathologic causes of hyperparathyroidism can be divided into single adenoma of the parathyroid ( 89% ) , multiple hyperplasia of the parathyroid ( 6% ) , and parathyroid carcinoma ( 0.1 to 4% ) .
the diagnosis of parathyroid carcinoma is made by first referring to serum calcium or intact parathyroid hormone ( ipth ) levels , then locating the enlarged parathyroid with ultrasonography , scintigraphy , or computed tomography and confirming the parathyroid tumor with fine needle aspiration biopsy . however ,
if asymptomatic , most parathyroid tumors are adhered to the thyroid gland , and therefore , making the distinction between parathyroid and thyroid tumor is difficult under ultrasonography , and the differential diagnosis is also difficult with cytologic findings alone without clinical signs
. stated that vesicle formation and presence of colloid or macrophages suggests thyroid lesions .
however , studies on numerous parathyroid lesions have reported that the amount of colloid , vesicular structures , and presence or absence of macrophages , do not greatly help in distinguishing thyroid tumors from parathyroid tumors . for this reason ,
the criteria for diagnosis of parathyroid carcinoma include 1 ) direct invasion into neighboring organs , such as thyroid gland , neck muscles , nerve , and esophagus , 2 ) distant metastasis to lung or liver , 3 ) cervical lymph node metastasis , and 4 ) histological findings including fibrosis , trabecular growth , necrosis , and nuclear atypia ( pleomorphism , large nuclei , macronucleoli , mitosis ) .
the recurrence of parathyroid carcinoma occurs within 2 to 3 years after removal , but the disease - free survival period is known to vary greatly from case to case . therefore , various studies have attempted subgrouping to classify high - risk and low - risk categories , histologically to reflect variable prognosis of the carcinoma . among such studies ,
the study by bondeson et al . argues that macronucleoli , necrosis , and mitotic activity in excess of 5 per 50 high - power fields reflect bad prognosis .
in addition , a report by kameyama and takami argues that the criteria suggested by bondeson et al . did not reflect the patients ' prognosisappropriately and classified parathyroid carcinoma into either minimally invasive or widely invasive carcinoma , similar to the classification of follicular carcinoma .
serum calcium levels typically returns to normal within 24 to 48 hours after excision of the parathyroid gland due to primary hyperparathyroidism , but hypocalcemia occurs in 10 to 30% of the cases .
this is known to be due to the time required for normal parathyroid glands to recover their sensitivity to calcium after surgery , which takes several days .
however , persistent hypocalcemia requires differential diagnosis of hypoparathyroidism due to surgery , concomitant hypomagnesemia , and hungry bone syndrome . in other words , after the excision of the parathyroid gland due to primary hyperparathyrodism of any cause , serum ipth levels normalize and serum calcium and phosphate rapidly migrate to the bone , leading to hypocalcemia .
this syndrome is known as hungry bone syndrome , known to occur in about 12.6% of operations on the parathyroid gland .
we experienced 1 case of minimally invasive parathyroid cancer accompanied by postoperative hungry bone syndrome , and attempt to report this case along with a review of related literatures .
a 29-year - old female without any notable past history visited for further evaluation of elevated alkaline phosphatase ( alp ) and a mass was found at the lower right thyroid gland during a regular checkup . a relatively firm mass of about 3 2 cm was found at the right anterior portion of the neck upon examination .
the mass was movable , and there was no palpable lymph node . a clinical laboratory study performed before the operation resulted in the following : blood urea nitrogen 6.3 mg / dl , creatinine 0.8 mg / dl , serum calcium 11.1 mg / dl , phosphorous 2.1 mg / dl , alp 1,072 u / l , and ipth 1,476 pg / dl .
a round , hypoechogenic mass sized about 2 1.7 3 cm with well - defined margin separate from the right lower thyroid gland was observed under ultrasonography , and accompanied by signs of increased blood flow ( fig .
some lymph nodes appearing to be positive reactive changes were observed inferior to the mass at level vi of right neck .
fine needle aspiration revealed hurthle cell change of cell clusters , implying the possibility of hurthle cell neoplasm of the thyroid gland or a parathyroid neoplasm .
the immunohistochemistry resultsshowed ipth and the clinical pattern confirmed the suspicion of parathyroid tumor , and therefore , a diagnosis of parathyroid tumor was made ( fig .
sincecytologic study alone was unable to determine the benign or malignant nature of the tumor , a need for a frozen section of the specimen upon surgical excision was suggested .
imaging studies showed enhancement upon contrast injection , making the determination of the exact nature of the tumor more difficult ( fig .
the right lower parathyroid gland did not show any direct invasion to neighboring organs on surgical examination , and a round shaped mass of about 3 2 cm with a smooth capsule easily separable from the thyroid gland and the surrounding muscles was found .
a right lower parathyroidectomy was performed , and an excisional biopsy of the surrounding lymph nodes was also performed simultaneously for frozen - sectionevaluation .
the pathologic result of the frozen section reported high possibility of benign parathyroidoma , and examination of the excised lymph nodes revealed reactive hyperplasia .
therefore , no further operation was performed . the serum ipth level immediately after the excision was 199.7 pg / dl , which became 18.54 pg / dl 1 hour later and 43.84 pg / dl 3 hours later .
positive chevostek sign was observed , but the patient did not show any spasmodic muscle contraction .
serum calcium , phosphorous , and ipth at this period was measured to be 7.2 mg / dl , 1.9 mg / dl , and 102.5 pg / ml , respectively .
intravenous calcium chloride solution and 4 tablets of oral calcium agent ( dicamax 1000 tab , dalim biotech , seoul , korea ) divided into 2 doses twice a day , were concomitantly administered thereafter .
the serum calcium level was maintained at below normal value despite a continuous supply of calcium , and serum calcium and ipth 8 days after operation was 7.1 mg / dl and 226.1 pg / dl , respectively .
dicamax1000 tab was replaced by healthcal tab ( dong wha pharm co. , seoul , korea ) , with a daily dosage of 6 tablets divided into 3 doses three times a day .
the patient was discharged 18 days after operation since she did not show any particular symptoms , and laboratory study performed 174 days after surgery reported ipth at 65.73 pg / dl , alp at 172 u / l , serum calcium level at 9.1 mg / dl , and phosphorous at 4.3 mg / dl ( fig .
healthcal tab was replaced by dicamax 1000 tab with daily dose of 2 tablets divided into 2 doses twice a day .
the final pathologic diagnosis of the patient was minimally invasive parathyroid carcinoma , and no metastasis to surrounding lymph nodes was found ( fig .
various studies describe cytologic findings that distinguish parathyroid lesions from thyroid lesions , but the distinguishing points vary from paper to paper , and are sometimes even contradictory [ 4 - 6,12 ] . in short , there is no single cytologic finding that can definitively diagnose a parathyroid lesion as of yet .
there have been reports of mixing fine needle - aspirated samples of parathyroid with liquid and measuring the concentration of parathyroid hormone of the solution being helpful in making the diagnosis in such cases . in the case of this patient ,
the clinical signs clearly pointed toward parathyroid tumor , and the measurement of parathyroid hormone levels in fine - needle aspirated samples is thought to help in making the diagnosis in cases of asymptomatic parathyroid tumors .
it is especially of major importance to distinguish hungry bone syndrome from surgical hypoparathyroidism in order to start early the appropriate treatment given for a long period .
therefore , we could establishthe cause of hypocalcemia in this patient as hungry bone syndrome .
hungry bone syndrome was first reported in 1948 after studying patients who showed hypocalcemia , muscle spasm , and hypophosphatemia after receiving parathyroidectomy .
extensive remineralization of the bone , reflecting deposition of calcium and phosphate within the bone parenchyme , was discovered upon bone tissue biopsy , and this finding was named ' hungry bone syndrome ' .
the treatment of hungry bone syndrome usually involves supplementation of inadequate minerals . intravenous or oral calcium agents are administered in cases of hypocalcemia , and intravenous or oral magnesium agents are supplied in cases of hypomagnesemia as well .
this patient similarly showed hypocalcemia and hypomagnesemia , and therefore , she received supplementary minerals , and a normalized serum calcium level was achieved14 days after operation .
braiser and nussbaum suggested relatively large tumor size , blood urea nitrogen , alp , osteitisfibrosacystica , and old age as risk factors that may cause hungry bone syndrome in patients with primary hyperparathyroidism who receiveparathyroidectomy .
when taking into consideration the tumor size and preoperative alp level , it is thought that the possibility of occurrence of hungry bone syndrome after operation in this patient could have been predicted beforehand .
in addition , it is thought that radiographic studies , such as osteitisfibrosacystica , that observe the changes in bone related to hungry bone syndrome may have needed to be performed in more detail .
mizrachi et al . stated that of all patients with primary hyperparathyroidism due to parathyroid adenoma , 25% experience a postoperative rise of ipth and that patients with preoperative ipth greater than 225 pg / ml can be predicted to maintain high levels of ipth after operation .
mittendorf and mchenry recorded that this postoperative increase of pth is due to remineralization of the bone , and stated that most postoperative increases of ipth dropped to normal levels after an average of 16 months . since this patient recorded preoperative ipth greater than 225 pg / ml , a persistent elevation in postoperative ipth could be predicted , and a nearly normal level was recorded after about 6 months of follow - up study .
the cause of primary hyperparathyroidism in this case was parathyroid carcinoma , which prompted the possibility of metastatic lesions in distant areas and caused much concern ; however , both preoperative and postoperative imaging studies revealed no abnormal findings , so close follow - up monitoring is thought to be needed . in this patient , a focal , very limited capsular invasion and invasion into one small vessel
was histologically observed , which prompted the diagnosis of minimally invasive parathyroid carcinoma according to the aforementioned report by kameyama and takami .
their report also stated that all of 12 patients who had no recurrence had minimally invasive parathyroid carcinoma .
examination of preoperative laboratory results related to postoperative hungry bone syndrome can help in predicting the possibility of hungry bone syndrome .
there is a high possibility that a postoperative increase of ipth may be caused by remineralization of the bone associated with hungry bone syndrome ; also , close follow - up monitoring , including blood tests and imaging studies , is thought to be warranted even in minimally invasive parathyroid carcinomas that are reported to show good prognosis . a case of hungry bone syndrome , accompanied by persisting hypocalcemia and elevated ipth after operation on postoperatively diagnosed minimally invasive parathyroid carcinoma has been reported as such . | the prognosis of parathyroid carcinoma varies significantly between numerous studies . therefore
, many attempts have been made to grade the degree of parathyroid carcinoma , and recently , classifying parathyroid carcinomas into either minimally invasive or widely invasive carcinoma- similar to follicular carcinoma of the thyroid- has led to a more reliable prediction of the prognosis .
hungry bone syndrome can occur if parathyroidectomy is performed due to primary hyperparathyroidism regardless of the cause of the disease .
hungry bone syndrome is characterized by postoperative a hypocalcemic state due to remineralization of various minerals , including calcium , of the bone ; this syndrome requires a long - term supplementation of calcium .
the authors aim to report , along with a review of related literatures , 1 case of a 29-year - old female patient diagnosed with minimally invasive parathyroid carcinoma who fell into hungry bone syndrome after parathyroidectomy . |
the clearance of cell components , in particular those that are damaged , is essential for cell welfare and survival .
this is mainly , but not exclusively , performed by two different degradation pathways involving proteasomes or lysosomes .
the delivery of intracellular material to lysosomes for breakdown is principally mediated by double membrane vesicles called autophagosomes . in the last years , the origin of the autophagosomal membrane and the molecular mechanisms of autophagosome formation have been extensively analyzed and discussed .
however , much less attention has been paid to later steps in the autophagic process , when autophagosomes deliver their content to acidic compartments for degradation , which are nonetheless the final destiny of the sequestered material . at this stage ,
autophagosomes mature by fusing with different endocytic and lysosomal vesicles , which add complexity to these fusion events .
although the available information on this machinery is still fragmentary , several cell components have been described to be involved in the fusion of autophagosomes with endo - lysosomal compartments .
for example , microtubules are thought to direct the traffic of autophagosomes toward lysosomes and endosomes . also snares ( soluble n - ethylmaleimide - sensitive factor attachment protein receptors ) , proteins with a well known role in tethering / docking of vesicles in the presence of ca , induce , in association with the rab7 gtpase and the hops ( homotypic fusion and protein sorting ) complex , the fusion of autophagosomes with lysosomes .
in addition , it has been reported that the three escrt ( endosomal sorting complex required for transport ) complexes , i iii , which were originally associated with the sorting of ubiquitinated membrane proteins into multivesicular bodies , participate in the fusion of autophagosomes with lysosomes by mechanisms that are still unknown .
annexins are a family of ubiquitous and ca - dependent membrane - binding proteins whose functions depend on their ability to attach to specific lipid microdomains . using a proteomic approach , we recently identified annexin a5 as a regulator of autophagosome maturation , especially in the starvation response , where it localizes on lysosomal membranes in a ca - dependent way . under starvation conditions , annexin a5 translocates from the golgi complex to lysosomes and , to a lesser extent , to late endosomes .
interestingly , this protein was found to inhibit fluid phase and cholera toxin endocytosis . since annexin a5 localizes in late endosomes
considerably more than in early endosomes , it is likely that the observed inhibition of endocytosis occurs at the late steps of this process .
moreover , annexin a5 induces autophagosome fusion with lysosomes , but inhibits the formation of amphisomes , hybrid organelles produced by the fusion of autophagosomes with late endosomes .
although the molecular basis of these two opposite roles of annexin a5 , activation of autophagy and inhibition of endocytosis , remains to be elucidated , it is possible that lysosomal and late endosomal membranes have different molecular characteristics in terms of their respective mechanisms of fusion with autophagosomes . in accordance with this concept ,
at least one protein , rab7 , is required in autophagosome - lysosome fusions , but is dispensable in fusions of autophagosomes with late endosomes .
experimental findings also support the involvement in autophagy of another protein of the same family , annexin a1 .
in fact , in the same proteomic analysis we found that , like annexin a5 , the levels of annexin a1 increased on lysosomal membranes upon starvation . also , a different group showed that annexin a1 promotes autophagy and suggested that this protein plays a role in the formation of amphisomes .
somewhat complementary to these results , a small dimeric ca - binding protein that can form a complex with annexin a1 , s100a11 , was identified as another component of the lysosomal membrane .
mounting evidences support that , in spite of their lack of transmembrane domains , various members of the annexin family can induce membrane fusions .
23 ) described a ca - dependent role of some of these proteins in the formation and traffic of specific endo - lysosomal compartments including annexin a1 ( early endosomes , multivesicular bodies and lysosomes ) and annexin a5 ( late endosomes and lysosomes ) .
since ca promotes the fusion of autophagosomes with lysosomes under in vitro conditions , these two annexins may be involved in ca - regulated interactions of the autophagosomal and lysosomal membranes that finally lead to their fusion and to the delivery of the autophagosomal content to the lysosome .
another interesting association of annexin a1 with autophagy was revealed in preliminary maps of interaction networks in autophagy , which are based on a shotgun proteomic analysis .
this protease has a crucial role in the formation and maturation of autophagosomes , because it participates in the conjugation / deconjugation of phosphoethanolamine to lc3 , the mammalian ortholog of yeast atg8 .
in fact , the balance between lipidation and delipidation of lc3 controls the tethering and hemifusion during closure of the autophagosomal membranes , and this is an important requirement for the fusion of autophagosomes with endosomes and lysosomes that occurs later .
therefore , it is tempting to speculate that annexin a1 stimulates the fusogenic potential of autophagosomes by regulating the activity of atg4b .
copine 1 is another protein whose levels increased on lysosomal membranes under high proteolysis conditions .
it shares with the annexin family of proteins the property of binding to phospholipid membranes in a ca - dependent manner .
in addition , its presence in autophagosomal , phagosomal and lysosomal delimiting membranes has been previously reported .
interestingly , an in vitro study showed that annexin a1 creates membrane domains enriched in phosphatidyl serine ( ps ) that assemble copine 1 aggregates .
also , annexin a5 is known to bind with high specificity to ps , using ca as a bridge between the negatively charged convex side of the c - terminal domain of the protein and the anionic phospholipid .
ps is known to be distributed in all cellular membranes , but it only confers a negative charge ( ideal for ca binding ) at the cytosolic face of endosomes and lysosomes .
this is probably because in other organelles , such as mitochondria , golgi and endoplasmic reticulum , ps is localized in the luminal leaflets of their membranes .
although annexins a1 and annexin a5 lack a coiled - coil domain , which according to a yeast two - hybrid screening study facilitates copine 1 binding , it is possible that annexin a5 , like annexin a1 , also forms suitable domains for copine 1 recruitment , after its translocation under high proteolysis conditions from cytosol to lysosomal membranes , to facilitate the fusion of lysosomes with autophagosomes ,
annexin a1 , annexin a5 , and probably also copine 1 , emerge as possible regulators of autophagosome maturation by mechanisms that require ca .
both annexins could interact on the lysosomal surface with copine 1 , by mechanisms regulated by phospholipid rearrangements and ca ( see fig . 1 )
possible mechanisms for the involvement of annexin a5 , annexin a1 and copine 1 in autophagosome maturation : the sequence of the different steps in autophagy is shown below .
this protein inhibits ( indicated by the blunted red lines ) endocytosis and amphisome formation and induces ( red arrow ) autophagosome fusion with lysosomes .
likewise , two other ca - dependent phospholipid binding proteins , annexin a1 and copine 1 , are localized on lysosomal membranes under starvation .
it is likely that annexin a5 and annexin a1 aggregate on lysosomal membranes in a ca - dependent way in order to form domains for the subsequent binding of copine 1 , and that interactions between these and perhaps other proteins promote the fusion of autophagosomes with lysosomes .
an additional possibility , at least for annexin a1 , is that its interaction with atg4b regulates the activity of this protease in the lipidation / delipidation of lc3 and thus contributes to increase the ability of autophagosomal membranes to fuse with lysosomes . to determine which of the proposed molecular mechanism are involved in this process , it will be necessary to identify other proteins and , perhaps more important , the specific lipids that interact with annexins a1 and annexin a5 and also with copine 1 at the cytosolic surface of the endo - lysosomal membranes
. in particular , it would be interesting to find differences in the interacting proteins and lipid domains between lysosomes and late endosomes and also to verify whether these interactions produce phospholipid rearrangements at specific lipid domains . | autophagy is a membrane trafficking pathway responsible for the breakdown of unwanted intracellular materials and crucial for the cell healthiness and survival . in the autophagic flux ,
various dynamic membrane rearrangements occurs starting with the elongation of the phagophore and its closure to build an autophagosome and ending with its fusion with late endosomes and lysosomes to form an autolysosome .
although ca2 + is a well established regulator of membrane fusion events , little is known about its role in these processes during autophagy .
recent studies , based on proteomic analyses of lysosomal membranes , have provided new insights into this field of study .
thus , the levels on lysosomal membranes of annexin a1 , annexin a5 and copine 1 , three proteins that bind to phospholipid membranes in a ca2 + -dependent manner , increased under nutrient deprivation , a condition that promotes autophagic degradation .
in addition , two different studies showed that annexin a5 and annexin a1 are involved in autophagosome maturation . here , we discuss the molecular mechanisms by which the fusion of autophagosomes with endosomes and lysosomes could be regulated by these three proteins and ca2 + . |
epidural analgesia has been used for decades as one of the modalities to relieve labour pain .
it has been accepted as an effective means of analgesia for women undergoing labour and its usefulness is well - recognised .
there is a wide variation in the use of labour epidural analgesia in different parts of the world .
approximately 60% patients in united states prefer epidural analgesia or combined spinal epidural analgesia during child birth .
in contrast , its use is only 9.5 - 15% in hong kong which is significantly lower than that quoted for other developed countries which is 20 - 50% .
there are multiple factors responsible for variable rate of utilisation of epidural analgesia by pregnant women all over the world . in our part of world
, the factors include inadequate patient knowledge , cultural influences , inadequate anaesthesia services and fear of complications . during counselling most common questions asked by patients and their relatives
is related to post - partum back pain or a perceived life - long damage to spinal cord . over the last 20 years the use of neuraxial technique has
literature does not support any association between epidural analgesia and post - partum back pain .
the reported incidence of post - partum low back pain in women not receiving epidural analgesia is 43% .
however , post - partum back pain secondary to epidural analgesia is still a concern in our patients mind , despite many useful advances in neuraxial analgesia such as refinement in techniques and availability of newer drugs .
the current survey was designed to prospectively assess the prevalence of post - partum backache in patients undergoing labour with or without epidural analgesia and to find out any correlation between low back pain and some identified / perceived factors .
the study was designed as non - randomized prospective cohort with follow - up at first postnatal day , 1 week , 1 month and 3 month after delivery through direct and telephonic contact .
epidural analgesia services in labour suite are available round the clock in our institution by trained anaesthesiologists , for many years .
all primigravida as well as multiparous women presenting to labour room for labour and delivery were included in the study .
consent was taken for the study once the epidural analgesia or other modalities of pain relief were decided and the visual analogue scale ( vas ) of pain was explained to the patients .
the women were categorized into two groups , those who received epidural analgesia were enrolled in group a and those who did not receive epidural analgesia in group b. patients with a history of chronic backache unrelated to pregnancy and those undergoing caesarean section within these groups were excluded from the study and patients living long distance away from the city were also excluded due to logistical problems .
incomplete information in data collection form and loss of follow - up were not included in statistical analysis .
first form was filled by one of the investigators and second form was filled by a different investigator to prevent bias .
form i and ii are attached in [ appendix i ] and [ appendix ii ] respectively . as data collection in form
i included demographic , contact number , parity , education , occupation and past history regarding epidural analgesia and epidural analgesia related backache .
a log number was allotted to the patient in both forms so it could be merge for data entry and statistical analysis .
form ii was handed over to research assistant and follow up for backache was started from first post natal day by direct contact and through telephonic communication at 1 week , 1 month and 3 months .
it was already decided that those patients who experienced mild backache will be advised to take simple measures of back care at home and for moderate to severe backache they will be referred to our pain clinic .
the results were analysed for the rate of occurrence of low back pain and pain lasting longer than 1 month .
pain lasting longer than 1 month was selected because it is indicative of persistent and possibly disabling pain .
therefore , on the basis of an error of 5% and 80% power to detect a 15% difference with increased risk of post - partum back pain in women who had received epidural analgesia , about 230 women in each group were required .
data were analysed using the statistical package for the social sciences ( spss for windows , 17.0 , spss , chicago , il ) .
frequency and percentages were estimated for categorical variables and analysed by chi - square test .
mean and standard deviation were computed for quantitative variables and analysed by independent sample t - test or mann - whitney u - test .
the frequency of postpartum low back pain in epidural analgesia and non - epidural analgesia groups on day 1 , day 7 , end of 1 and 3 month was estimated .
unadjusted odd ratio was calculated for the risk of postpartum low back pain and multivariate logistic regression analysis was used to provide adjusted odd ratio estimates for the association between epidural analgesia and low back pain .
a total of 482 women met inclusion criteria and consented to participate in this study .
out of the total , 240 females were enrolled in epidural analgesia group and 242 females were in non - epidural analgesia group .
follow - up was obtained from 460 women with the response rate of 95.4% and these cases were included in our statistical analysis . those who could not be followed had either moved to newer addresses or their contact number was incorrect ( 10 cases from epidural analgesia and 12 from non - epidural analgesia group ) .
the demographic data and obstetric characteristic of both groups are shown in table 1 and table 2 .
demographic characteristics of women obstetric characteristics of women there were no significant difference between groups with respect to age , weight , height and body mass index . literacy rates and the number of working women were significantly high in epidural analgesia group as compare to non - epidural analgesia group ( p < 0.01 ) .
mean duration of labour was significantly high in epidural analgesia than non - epidural analgesia groups ( p < 0.01 ) .
frequency of backache in previous pregnancy was significantly high in non - epidural analgesia than epidural analgesia group ( 13% vs. 5.7% ; p = 0.006 ) .
nearly 14.3% of patients of epidural analgesia group received epidural analgesia in previous pregnancy as well while it was only 6% in non - epidural analgesia group .
in epidural analgesia group , 96.1% of patients received epidural analgesia while rest of 3.9% patients received combined spinal epidural analgesia .
sixteen gauge needle was commonly used and there were 29 epidurals ( 12.4% ) that required more than one attempt at placement .
satisfaction with epidural analgesia was excellent in 46.5% cases , good in 45.2% and fair in 8.3% cases .
the prevalence of post - partum back pain was similar ( 40% ) in both groups on day 1 after delivery .
post - partum backache was non - significant on day 1 and after 1 week .
however , at 1 and 3 month follow - up , backache was observed less frequently in epidural analgesia group than non - epidural analgesia group ( cured odds ratio [ or ] : 0.63 ; 95% confidence interval [ ci ] : 0.39 - 0.99 ) and ( cured or : 0.32 ; 95% ci : 0.15 - 0.69 ) respectively and the odd ratio of low back pain adjusted for age , weight , occupation , parity , antenatal medicine , history of backache in previous and current pregnancy delivery and concern of back pain was 0.59 ( or : 0.59 ; 95% ci : 0.36 - 0.99 ) at 1 month and 0.25 ( or : 0.25 ; 95% ci : 0.11 - 0.58 ) at 3 months .
postpartum backache in epidural and non - epidural groups over time figure 1 shows the comparison of mean pain scores ( vas ) for the two groups .
there was no significant statistical difference in pain score between groups at 1 post natal day , 1 week , end of 1 and 3 months .
comparison of mean pain score between groups during the follow - up , we asked mothers about different treatment modalities in their use .
oral analgesics were found to be the highest ( 50% vs. 54% ) among patients with the complaint of low back pain on 1 postnatal day , among epidural analgesia and non - epidural analgesia group .
intravenous analgesia was only given to 20% patients in epidural analgesia group with the complaint of low back pain on 1 postnatal day .
there was a reducing trend of oral analgesics use from 38% to 8% and then 6.5% on consecutive follow - up in non - epidural analgesia group .
massage with local anaesthetic creams was the option used by 0.4 - 1.7% in non - epidural analgesia group and 0.4 - 7.0% in epidural group .
the current survey showed that there is no difference in the prevalence of low back pain on day 1 and day 7 after delivery among epidural analgesia and non - epidural analgesia group .
we did nt find any difference between the two groups with respect to back pain scores and use of analgesics .
working women chose epidural analgesia more as compared to non - epidural analgesia group which shows more awareness of labour epidural analgesia among working and literate women .
mean duration of labour was significantly higher in epidural analgesia than non - epidural analgesia group ( p < 0.01 ) which is already reported to be increased by 1 h by eltzschig et al .
the choice of epidural analgesia depends on multiple factors and a very important factor that came out of this survey was frequency of backache in previous pregnancy . although , it is significantly high in non - epidural analgesia than epidural analgesia group ( 13% vs. 5.7% ; p = 0.006 ) , back pain in the last pregnancy was the main reason for refusing epidural in current labour .
wong and to reported that patients with back pain in antenatal period were less likely to request epidural analgesia for labour pain relief while patients having back pain in postnatal period were less likely to regard epidural analgesia as most effective method of pain relief .
it shows that concern of low back pain in our population is same as in other parts of the world .
interestingly the response to concerns of epidural related low back pain was nearly similar in epidural analgesia and non - epidural group .
there was no association between number of attempts for epidural catheter insertion and low back pain .
the most surprising finding was the similar rates of prevalence of post - partum low back pain ( 40% ) in both groups on day 1 after delivery .
butler and fuller also found equal prevalence of back pain ( 30.5% ) in both groups initially but new , long - term back pain occurred in 7.5% and 6.9% of patients at 3 months in epidural analgesia and non - epidural analgesia group . at 3 months follow - up , we found an incidence of 3.9% versus 11.3% backache in epidural and non - epidural analgesia group .
found a 19% versus 11% incidence of low back pain in patients receiving epidural analgesia versus non epidural in which the prevalence in epidural was nearly 5 times higher than that shown in our results but exactly same prevalence in non - epidural group .
as this study was reported two decades back we can not comment on expertise and equipment used at that time .
have reported nearly same incidence of back pain three years later ( 18% vs. 12% ) at a follow - up of 1 year .
butler and fuller reported 7.5% back pain lasting for more than 2 weeks following epidural analgesia for labour which is 2 times higher than back pain reported in our study .
moschini et al . compared complications among three groups and found no significant difference in localized and diffuse back pain after epidural analgesia , spinal epidural analgesia and no analgesia .
response of treatment modalities by patients in the present study showed that most of the patients used oral analgesics and only one patient needed pain physician consultation and underwent physiotherapy for her pain relief .
on the basis of our results , we conclude that there is no association found between epidural analgesia and low back pain .
an increased prevalence of persistent low back pain was seen in patients delivered without using epidural analgesia , those with history of backache in previous pregnancy and primiparous mothers . on the basis of our survey
, we can counsel our patients that there is no increased risk for post - partum low back pain with the use of epidural analgesia for labour pain .
we feel that there is an intense need to identify the actual causes of backache and their remedies in young females and hence queries could be better answered at the time of counselling . | background and aims : the most frequent concern of patients receiving epidural analgesia for labour pain relief is post - partum back pain .
this survey was designed to assess the prevalence of post - partum backache with and without epidural analgesia among post - partum women.methods:the study was conducted at a university teaching hospital and women presenting to labour room for labour and delivery formed the target population .
a total of 482 women were recruited during the study period .
response rate was 95.4% and these cases were included in our statistical analysis .
two forms were designed for data collection before and after delivery ; form i was filled by one of the investigators while form ii was filled by a research assistant to prevent bias which included follow - up of back pain .
the primary outcome variable was backache quantified with visual analogue scale score .
out of 460 women , 230 women received epidural analgesia for labour and 230 women had not.results:the prevalence of post - partum back pain in epidural analgesia versus non epidural analgesia groups was 40.9% versus 40% on day one and 32.2% versus 35.2% after 1 week .
however , after one and 3rd months follow - up , backache prevalence was less in epidural analgesia group ( unadjusted odds ratio [ or ] : 0.63 ; 95% confidence interval [ ci ] : 0.39 - 0.99 ) and ( unadjustedd or : 0.32 ; 95% ci : 0.15 - 0.69 ) respectively .
the adjusted odd ratio was 0.59 at 1st month and 0.25 at 3rd month .
there was no significant difference between the two groups in pain scores.conclusion:there was no association between the epidural analgesia and post - partum back pain |
noncystic fibrosis bronchiectasis ( ncfb ) is a disease characterized by permanently dilated airways due to bronchial wall structural components destruction , as a result of bronchial inflammation caused by recurrent or chronic infections .
clinical and functional features of ncfb are chronic cough , at times with haemoptysis , increased sputum production due to impaired mucus clearance , dyspnoea , and frequent bacterial colonization .
bronchial biopsies in patients with bronchiectasis have demonstrated tissue neutrophilia , a mononuclear cell infiltrate composed mainly of cd4 + t cells and cd68 + macrophages , and increased expression of il-8 and other chemokines .
neutrophil massive recruitment into the airways in response to infective or inflammatory triggers results in proteolytic enzymes such as neutrophil elastase ( ne ) and matrix metalloproteinases ( mmp ) release , leading to airway matrix destruction .
the damage of the epithelial layer is responsible for reduced mucociliary clearance efficiency , leading to bacterial colonization and perpetuating the vicious circle bacterial load - inflammation - airway damage .
systemic inflammation as demonstrated by increased blood neutrophils and plasma cytokines ( like tnf - alfa ) has been measured in patients with ncfb , with some relationship with disease severity and bacterial colonization . despite the relevant role the neutrophilic inflammation
is believed to have in the progression of the disease , few studies have evaluated the relationship between sputum inflammatory biomarkers and clinical or functional findings in patients with bronchiectasis [ 57 ] .
in addition , very few data are reported on the measurement of oxidative stress biomarkers in exhaled air in this kind of patients .
the aim of this study was to evaluate the level of bronchial inflammation in subjects with stable ncfb and to compare it with clinical and functional findings in the attempt to understand its role in ncfb severity and progression .
we used sputum inflammatory cell counts for confirming and extending previous data from the literature and ebc - mda as a new tool in the correlation between biomarkers and clinical and functional findings .
we performed a cross - sectional study on 152 patients with noncystic fibrosis bronchiectasis ( ncfb ) presenting to our pulmonary unit .
criteria for entering in the study were the following : ( a ) nfcb diagnosis according to high resolution computed tomography ( hrct ) , ( b ) absence of clinical , radiological , and laboratory tests suggestive of cystic fibrosis , and ( c ) stable phase of the disease ( no acute exacerbations or antibiotic use in the previous 4 weeks ) . diagnosis and assessment of ncfb have been done according to bts guidelines .
patients with long - lasting clinical history of copd ( confirmed by spirometry ) associated with smoking habit and bronchiectasis associated with interstitial lung diseases were not included . in the same day , patients underwent complete spirometric evaluations ( including measurement of diffusing capacity and bronchodilator reversibility ) , arterial blood gas analysis , leicester cough questionnaire ( lcq , in 62 out of 152 patients ) , assessment of the number and severity of comorbidities , assessment of the number of acute exacerbations in the last year ( defined as increase in cough and/or sputum requiring a short course of antibiotics , in few cases also as fever and/or chest pain ) , sputum collection for bacterial colonization and inflammatory cell analysis , exhaled breath condensate ( ebc ) collection for malondialdehyde ( mda ) assay , and exhaled nitric oxide ( no ) measurement .
information about the number and the severity of exacerbations in the last year was collected .
the aetiology of bronchiectasis was derived from the clinical history , ct features and from a set of blood analyses ( including serum immunoglobulin , standard rheumatologic blood tests , and blood cell counts ) , while more detailed blood tests ( like extensive rheumatologic evaluation , serum ige or igg for aspergillus , and nasal biopsy ) were limited to patients with some clinical suspect of specific diseases ( like mucociliary dyskinesia , bronchopulmonary aspergillosis , and rheumatologic disorders ) .
localization , extent , and type of bronchiectasis and presence of any inflammatory impairment / alteration due to other / different diseases were evaluated by hrct performed in the last year before the study assessment [ 1 , 12 ] .
ncfb severity was assessed by both faced score and bronchiectasis severity index ( bsi ) [ 13 , 14 ] .
pulmonary function testswere performed using medical graphics equipment ( elite series plethysmography , medical graphics , saint paul , usa ) , according to the ats recommendations .
arterial blood sample for the measurement of paco2 and pao2 was taken in sitting position .
pharmacologic treatment with bronchodilators and/or inhaled corticosteroids ( ics ) was stopped 2 days before spirometry , while long - term azithromycin treatment was withdrawn 4 weeks before the study day .
informed signed consent was obtained from each patient . as an observational study , the study protocol had been notified to the local ethic committee of our university hospital .
sputum collection and analysis were carried out according to a standardised protocol . in patients with spontaneous sputum production ( n = 35 ) ,
samples were collected for bacteriology and inflammatory cell count , after mouth rinsing with normal saline . in patients who did not expectorate spontaneously ( n = 74 ) , sputum production was induced with hypertonic saline solution ( hs : nacl 4.0% w / v ) ( 2.8 ml / min output ; sirius , technomed , firenze , italy ) , after inhaled salbutamol pretreatment .
nebulization was stopped after 15 min or earlier if fev1 fell by 20% or more from baseline values .
bacterial assessment of the spontaneous or induced sputum was performed according to the current standard laboratory methods .
gram - positive and gram - negative bacteria , tb and non - tb mycobacteria , and fungi were searched .
for inflammatory cell counts , sputum samples were processed within two hours from collection ; more dense portions were selected and processed as previously described .
at least 350 inflammatory cells were counted and macrophage , lymphocyte , neutrophil , and eosinophil values were expressed as percent of total inflammatory cells .
slides with cell viability < 50% or an amount of squamous cells such that 350 inflammatory cells could not be counted were considered inadequate and discarded .
our reproducibility for sputum inflammatory cell count was previously assessed : excluding lymphocytes ( ri : 0.15 ) , it was considered as satisfactory : ri was 0.80 for macrophages , 0.85 for neutrophils , and 0.82 for eosinophils .
ebc was collected by cooling exhaled air with a specially designed condenser ( ecoscreen , jaeger , wurzburg , germany ) .
subjects breathed tidally for 15 min through a two - way nonrebreathing valve by which inspiratory air and expiratory air are separated , and saliva is trapped .
mda in ebc was quantified , according to the method described by lrstad et al . , using high - performance liquid chromatography ( hplc ) ( waters 1525 ) with fluorescence detector ( multi fluorescence detector , waters 2475 ) , after derivatization with thiobarbituric acid ( tba ) .
the mda - tba adduct was detected using excitation and emission wavelength of 532 nm 553 nm , respectively .
nm / l , the intra- and interassay reproducibility were 0.9 and 10.4% , respectively , and the recovery was 96% .
no was measured in exhaled air , using a nitric oxide analyzer ( noa 280 , sievers instruments , inc .
patients performed a single slow exhalation ( 3045 sec ) through a mild resistance , while maintaining expiratory flow of about 50 l / min , and no concentration at mouth level was registered all along the expiration phase . at least three acceptable maneuvers with no variability lower than 10% were obtained , and the highest value was considered . pulmonary function parameters
differences between two groups were tested by means of t - test for normally and mann - whitney test for nonnormally distributed variables . for analysis of larger groups , anova test , for normally distributed variables , and kruskal - wallis test , for nonnormally distributed variables , were used .
correlations were evaluated by means of spearman 's rank correlation test . a p value lower than 0.05 was considered as significant .
we studied 65 males and 87 females with ncfb , with a mean age of 62.6 years .
bronchiectasis was diffuse in 84% and localized in 10% of patients ; 77% showed cylindric , 12% cystic , and 5.3% varicose bronchiectasis ( in the remaining patients , a recent ct assessment was not available ) .
nfcb aetiology was idiopathic in 56% , postinfectious in 27% , tb - related in 8% , and of other causes in 9% of patients ( postsurgical be : 2.7% , dcp : 1.4% , hypogammaglobulinemia : 2.0% , churg - strauss syndrome : 0.7% , kartagener syndrome : 0.7% , medium lobe syndrome : 0.7% , and occupational exposure : 0.7% ) .
patient showed mild airway obstruction , no hyperinflation , and normal diffusing capacity ; 24 patients had a bronchodilator reversibility greater than 12% .
frequent exacerbations ( mean value , 2.5 exacerbations / year ) were reported by 56% of patients , while persistent cough ( 20,4% ) , dyspnoea on exercise ( 11% ) , and sputum production and/or hemoptysis ( 6% ) were reported in a limited number of patients .
lcq questionnaire showed a mild impairment due to cough , as only 21 out of 62 patients reported a score > 0 .
presence of airway pathogens was observed in 70.5% of patients , and of these 52% were represented by pseudomonas aeruginosa .
patients with pseudomonas aeruginosa infection showed lower levels of fev1 in comparison with patients with other or no colonization ( p = 0.007 ) .
regular pharmacologic treatment was performed by 82 patients ( 54.3% ) with inhaled corticosteroids at different doses ( always associated with long - acting beta2-agonist and/or antimuscarinic drugs ) and by 71 patients ( 47% ) with long - term oral azithromycin ( 7501000 mg weekly ) .
relevant comorbidities were reported by 49 out of 152 patients ( 32% ) , in particular cardiovascular diseases ( 29% ) , upper airway diseases ( 26% ) , and gi diseases ( 13% ) .
inflammatory cell analysis showed a prevalent neutrophilic profile , with 69% of them having a sputum neutrophil percentage > 64% .
eosinophils percentages were equal to or more than 3% in only 20% of patients ( table 2 ) .
patients with airway bacterial pathogens showed higher levels of sputum neutrophils than patients with no pathogens ( p = 0.009 ) , and those with pseudomonas aeruginosa had even more sputum neutrophilia in comparison with those with other bacteria ( p = 0.006 ) .
mda levels were slightly higher than those previously reported in bronchiectasis ( 19.2 ( 654 ) nm ) and similar to those found in moderate copd patients ( 29.1 ( 981 ) nm ) .
fev1% predicted correlated with bmi ( p = 0.03 ; rho = 0.178 ) and number of pulmonary lobes involved in the disease ( p = 0.039 ; rho = 0.21 ) .
neutrophil percentages in induced sputum were inversely correlated with fev1% predicted ( p < 0.0001 ; rho = 0.428 ) and fev1/vc ( p <
0.0001 ; rho : 0.4 ) , while sputum neutrophil percentages positively correlated with months between diagnosis and study evaluation ( p = 0.004 ; rho = 0.3 ) , residual volume ( p = 0.001 ; rho = 0.03 ) , and bsi severity score ( p = 0.005 ; rho = 0.37 ) , but not with faced ( figure 1 ) .
sputum neutrophil percentages were inversely correlated with feno ( p = 0.01 ; rho = 0.28 ) .
mda levels in ebc significantly increased with the increasing number of exacerbations in the previous year ( p < 0.05 by kruskal - wallis test ) ( figure 2 ) .
in particular , patients with 3 or more exacerbations in the last year showed a significantly greater mda concentration in ebc than patients with 1 or 2 exacerbations or patients without any exacerbations .
in this study , the analysis of bronchial inflammatory biomarkers in induced sputum and exhaled air was aimed at a better characterization of adult patients with ncfb .
we found that neutrophilia in induced sputum is a good marker of severity as confirmed by its correlation with several functional findings ( fev1 , fev1/vc , and rv ) , severity index ( bsi ) , and symptoms ( lcq ) assessment questionnaire and also with the time elapsed after diagnosis , suggesting that inflammation grows over time and might contribute to the progression of the disease .
moreover , neutrophilia was associated with the presence of airway pathogens , in particular with the presence of pseudomonas aeruginosa .
the large majority of our patients ( almost 70% ) showed a percentage of sputum neutrophils greater than that observed in normal subjects , despite the fact that they were examined in a stable phase of the disease .
this confirms that neutrophilic inflammation is a strong component of the disease . as reported by other authors [ 7 , 24 ] ,
sputum neutrophilia was associated with the type and severity of bacterial colonization , and also in our large group of patients , those with pseudomonas aeruginosa had greater sputum neutrophilia and lower fev1 in comparison with patients without airway pathogens or patients with other bacteria or fungi .
in addition , we observed in 20% of our patients a sputum eosinophil percentage 3% , which is considered the upper limit of the normal distribution . to the best of our knowledge ,
this data has not been reported previously , and it can be due to the well - known association between bronchiectasis and asthma symptoms .
we did not find any relationship between the presence of sputum eosinophilia and acute fev1 reversibility after salbutamol , clinical history of asthma , or treatment with inhaled corticosteroids ( data not shown ) ; other information regarding family history of allergic diseases , allergic sensitization , or bronchial hyperresponsiveness was not available in our patients . in any case , it is possible that this asthmatic
component may play a role in the clinical manifestation of the disease and in the response to treatment .
our study confirms and extends on a larger group of patients previous observations which have demonstrated the prominent neutrophilic systemic and airway inflammation in ncfb in comparison with control subjects and also some relationship between the level of inflammation and indices of severity of the disease , like pulmonary function , extension of bronchiectasis at hrct , and bacterial colonization [ 48 ] .
in addition to that , we found in our study new correlations not previously reported : in particular , sputum neutrophils directly correlated with residual volume , the duration of the disease , and its severity as assessed by the bsi score .
the inverse correlation between residual volume and sputum neutrophilia may suggest some involvement of small airways , leading to air trapping due to mucus plugging in the lower airways and then to a redistribution of lung volumes .
this may be due to some potential extension of inflammation from airways of large or medium calibre to small airways , with potential consequences on the gas exchange .
we found a good correlation between sputum neutrophilia and duration of the disease , and also with bsi but not with faced . in effect , bsi includes a larger number of variables than faced and allows therefore a better stratification of the patients .
in addition , faced has not been validated and therefore it is uncertain whether it can be confidently used . to our knowledge , this is the first time that sputum neutrophilia has been related to this composite score assessing the severity of bronchiectasis , confirming that also this biomarker correlates with the comprehensive evaluation of disease severity as assessed by bsi .
oxidative stress is a major component of the mechanisms leading to the damage of the airway wall in bronchiectasis and also in other diseases , like copd . in our study ,
ebc - mda concentrations in our patients were higher in comparison with a group of normal subjects studies in a previous methodologic paper .
mda is a well - known biomarker of the oxidative stress , and we as well as other authors have demonstrated elevated mda concentrations in ebc of patients with different inflammatory airway diseases [ 21 , 2729 ] .
this means that mda could have a role as indicator of future risk of exacerbation , potentially suggesting a different treatment strategy .
firstly , we did not include a control group of normal subjects ; however , the difference between patients with ncfb and normal subjects as regards both systemic and airway inflammations is well known [ 48 ] .
secondly , we took into consideration only a single bacterial evaluation in the sputum for defining patients with bacterial colonization when repeated confirmations of the presence of sputum pathogens are required . in effect , in many of our patients , the presence of sputum pathogens has been confirmed in previous sputum specimens , and furthermore each patient was examined in a stable phase of the disease .
thirdly , some additional evaluations for explaining the presence of sputum eosinophilia in a subgroup of our patients were not included .
finally , we included both spontaneous and induced sputum in the inflammatory and microbiologic assessment ; although these measurements are not interchangeable , previous studies have demonstrated similar inflammatory cell percentages in both samples . on the contrary , this is one of the largest series of ncfb patients , examined in a very extensive way . in conclusion , sputum neutrophilic inflammation in ncfb patients can be considered a good biomarker of disease severity , as confirmed by pulmonary function , disease duration , bacterial colonization , and bsi score . | background .
neutrophilic bronchial inflammation is a main feature of bronchiectasis , but not much is known about its relationship with other disease features . aim . to compare airway inflammatory markers with clinical and functional findings in subjects with stable noncystic fibrosis bronchiectasis ( ncfb )
. methods .
152 nfcb patients ( 62.6 years ; females : 57.2% ) underwent clinical and functional cross - sectional evaluation , including microbiologic and inflammatory cell profile in sputum , and exhaled breath condensate malondialdehyde ( ebc - mda ) .
nfcb severity was assessed using bsi and faced criteria .
results .
sputum neutrophil percentages inversely correlated with fev1 ( p < 0.0001 ; rho = 0.428 ) , weakly with leicester cough questionnaire score ( p = 0.068 ; rho = 0.58 ) , and directly with duration of the disease ( p = 0.004 ; rho = 0.3 ) and bsi severity score ( p = 0.005 ; rho = 0.37 ) , but not with faced .
sputum neutrophilia was higher in colonized subjects , p. aeruginosa colonized subjects showing greater sputum neutrophilia and lower fev1 .
patients with 3 exacerbations in the last year showed a significantly greater ebc - mda than the remaining patients .
conclusions .
sputum neutrophilic inflammation and biomarkers of oxidative stress in ebc can be considered good biomarkers of disease severity in ncfb patients , as confirmed by pulmonary function , disease duration , bacterial colonization , bsi score , and exacerbation rate . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.