article
stringlengths
0
826k
abstract
stringlengths
174
4.34k
a central goal of genome wide association studies ( gwas ) is to identify genetic risk factors for complex disorders . in order to find the disease genetic risk factors in a population , gwas measures dna sequence variations across human genome ( bush and moore , 2012 ) . practitioners in medical sciences and bioinformatics use gwas to investigate the relations in different disorders ; gwas of different cancers ( easton and eeles , 2008 ) , gwas of pancreatic cancer ( amundadottir et al . , 2009 ) . the idea of genetic variations with alleles that are common in the population may explain much of the heritability of common diseases , see ( reich and lander , 2001 ) and ( schork et al . , 2009 ) . review of gwas can be found in several texts and papers , see ( moore et al . , 2010 ) among others . in the simplest form of association mapping , a set of markers are genotyped in both sample of cases and sample of unrelated controls and then using different association tests , allele frequency differences or genotype frequency differences at each marker will be studied ( pritchard and donnelly , 2001 ) . the main idea behind gwas studies relies on the fact that if a mutation has positive correlation with susceptibility of a disease , then that mutation is expected to be more frequent among affected individuals than those unaffected individuals ( pritchard and donnelly , 2001 ) . hence , considering the existence of linkage disequilibrium ( ld ) between the marker locus and the susceptibility mutation , the marker close to the disease mutation may also present a frequency difference between case and control group of study ( pritchard and donnelly , 2001 ) . case - control traits can be analysed using either logistic regression or contingency table techniques ( bush and moore , 2012 ) . contingency table methods examine the deviation from independence that is expected under the null hypothesis of observing no association between the disease under study and the measured allelic / genotyping frequency differences ( bush and moore , 2012 ) . pearson chi - squared test and the related fisher 's exact test are the most widely used tests for independence of the rows and columns of the contingency table ( bush and moore , 2012 ) . it should be noted that the association tests are performed separately for each individual marker and depending on the aim of study , the data for each marker with minor allele a and major allele a can be represented either as genotype count ( e.g. , a / a , a / a and a / a ) or allele count ( e.g. , a and a ) ( clarke et al . , 2011 ) . it is widely believed that the allelic association test with 1 degrees of freedom ( df ) is more reliable than the genotypic test with 2 df . however , it is imperative to note that this superior performance can only be considered for the case of having the penetrance of the heterozygote genotype between the penetrance of the two homozygote genotypes ( clarke et al . , 2011 ) . when the distribution of genotypes in the population deviates from hardy - weinberg proportions ( hwe ) , of which additive , dominant and recessive models are all examples ( clarke et al . , 2011 ) , the frequency of genotypes rather than alleles should be compared by the cochran - armitage test for trend ( sasieni , 1997 ) . for more information on different models thus , the advantage of the cochran - armitage trend test in comparison to pearson 's chi - square test is that it possesses the superior conservation and is not dependent on the hwe assumption ( sasieni , 1997 ) . therefore a number of authors have recommended to use the cochran - armitage trend test as the genotype - based test for association ( sasieni , 1997 , corcoran et al . , 2000 , li , 2008 , risch and merikangas , 1996 , risch , 2000 ) . it should also be noted that the allelic and trend statistic are equivalent when the combined sample is in hwe ( sasieni , 1997 ) . however , a major drawback of model based methods is that the statistical properties depend on the choice of weights . thus , the model miss - specifications minimize the power of the test ( sasieni , 1997 , corcoran et al . , 2000 , li , 2008 , risch and merikangas , 1996 , risch , 2000 ) . furthermore , escott - price et al . ( 2013 ) showed that , although in most scenarios the cochran - armitage trend test is more powerful than the chi - squared test of genotype counts , the advantage is not substantial . even , when the disease locus is extremely biased from the additive model , the chi - squared test of genotype counts can be more powerful than the cochran - armitage trend test due to the choice of scores for each genotype in the trend test ( escott - price et al . although , there are considerable studies about the advantages and disadvantages of cochran - armitage trend test , to the best of our knowledge , there is a small number of researches which evaluated the distribution of p - values for this association test . in this paper the distribution of the p - values derived by the cochran - armitage trend test has been studied and it has been shown that unlike the considered presumption those p - values obtained by this test are not uniformly distributed . to overcome this issue , we introduce a new method , based on the bootstrap technique , for computing the p - value of the cochran - armitage trend test . the bootstrap method has become a standard tool in statistical analysis and is an indispensable tool for testing statistical hypotheses . using resampling , bootstrap approximates the sampling distribution of a statistic under the null ( or the alternative ) hypothesis . bootstrap provides a practical complement to asymptotic parametric inference , hence have attracted many attentions in the applied . the efficiency of the nonparametric bootstrap method has also been shown by amiri and von rosen ( 2011 ) in which for example in the case of the pearson chi - squared statistic with a yates ' correction and fisher 's exact test , remarkable improvement has been achieved . the pearson chi - squared statistic with a yates ' correction and fisher 's exact test , are quite conservative and fail to reject the null hypothesis and can not be recommended to test independence with small sample sizes . section 3 studies the alternative approach to draw the inference including the bootstrap version of cochran - armitage trend test . section 4 investigates the proposed method using the monte carlo simulation , which show they are the accurate tests in terms of the significant level and statistical power . section 4 also demonstrates the improvements in goodness - of - fitness achieved by the introduced bootstrap approach . the cochran - armitage 's trend test is a widely used test for trend among binomial proportions which uses the genotype contingency table ( table 1 ) in a different manner than pearson 's test . power is very often improved as long as the probability of having disease increases with the number of disease - associated alleles . in genetic association studies in which the underlying genetic model is unknown , the additive version of this test is most commonly used . in order to measure the effect of genotype i and to detect particular types of association , we introduce a weight wi the special choice ( w0 , w1 , w2 ) = ( 0,1,2 ) , represents the additive effect of allele a. ( see table 2 . ) let us consider a single - marker locus with two possible alleles which are commonly denoted by a and a. thus , each individual has three possible genotypes aa , aa , and aa . in the following we denote the two alleles by 0 and 1 instead of a and a and the genotypes by 0 , 1 , 2 , the sum of the two allele indices involved . the case - control data can then be summarized according to genotypes as shown in table 1 . here , ( n0 , n1 , n2 ) are counts of the genotypes in cases and ( m0 , m1 , m2 ) are counts of the genotypes in controls , and ( n0 , n1 , n2 ) are counts of the genotypes in case - control samples . let n and m be the total number of cases and controls , respectively , and the total sample size , n = n + m. as cases and controls are independently sampled the genotype counts for cases and controls follow independent multinomial distributions with parameters ( p0 , p1 , p2 ) , and ( p0 , p1 , p2 ) , respectively , where pi and pi , i = 0,1,2 , are the genotype probabilities in cases and controls.n0n1n2:multinp0p1p2,m0m1m2:multimp0p1p2. under the null hypothesis of no association , h0 : pi = pi for i = 0,1,2 . the cochran - armitage 's trend test statistic for the data in table 1 is given by(1)t = nnn1 + 2n2nn1 + 2n22nnnnn1 + 4n2n1 + 2n22 . the statistic in eq . ( 1 ) follows the chi - square distribution with one degree of freedom ( df ) , see ( armitage , 1955 ) . let us denote the cochran - armitage trend test as ca in the rest of work . agresti ( 2007 ) states ca in terms of the pearson chi - squared statistic . consider a contingency table 2 j with ordered column , see table 1 . let nj ~ bin(nj , pj ) , j = 0 , , j 1 , it is of interest to test the following null hypothesis(2)h0:p0=p1= =pj1,h1:pipj,ij . one can use the ordinary least square approach for testing . let w=njwj / n , pj = nj / nj and p^=n / n . the prediction equation isp^j = p^+^wiw,where^=njpjp^wjwnjwjw2 . using the pearson chi - squared statistics(4)x2=jnjpjp^2p^1p^=z2+x2l~j12 , wherez2=2^p^1p^jnjwjw2,x2l=1p^1p^jnjp~jp^j2,under linear probability model x(l ) ~ j 2 that using the application of cochran 's theorem , z ~ 1 . it can be used to test h0 : = 0 for the linear trend , the test of independence using z is called the cochran - armitage ( ca ) trend test . the bootstrap method has brought a vast new body of statistics in the form of nonparametric approaches to model uncertainty , in which not only the individual parameters of the probability distribution , but also the entire distribution are sought ( amiri , 2013 ) . this has led to a versatile tool for data analysis , in particular in the field of statistical hypothesis tests . two monographs on the bootstrap method written by efron and tibshirani ( 1994 ) and davison and hinkley ( 1997 ) are very useful in this regard in that they focus more on applications than on the theoretical approach . the idea of the bootstrap method is to approximate the sampling distribution of the proposed statistic , and this technique is based on resampling , which provides a practical complement to asymptotic parametric methods . the flexibility and robustness of this technique , especially in situations where the violation of assumptions is being dealt with , can be counted as two advantages of the technique ( good , 2013 ) . amiri and von rosen ( 2011 ) use the bootstrap to carry out the test of the contingency table . in order to test the association using the bootstrap method , the resampling should be performed on eij , where it is held for the expected value in the ( i , j)th cell . the principle of the bootstrap test is the performance of bootstrap resampling under the null hypothesis , which is explained in ( efron and tibshirani , 1994 ) and ( davison and hinkley , 1997 ) . the null hypothesis of the lack of the association in the contingency table is h0 : pij = pi.p.j , it leads to h0 : eij = oi.o.j / o .. , and therefore resampling under the null hypothesis is resampling on eij rather than oij , where oij is held for the observed value . let x be the resampled that is done under null hypothesis and has j 1 , since x = z + x(l ) , z has 1 and can be used to test h0 : p0 = p1 = = pj 1 . the test can be done using the following steps,1.calculate t or z.2.resample data under eij , and obtain the contingency table n = { n0 , , nj 1 , m0 , , mj 1 } , where n*~multine00n e2j1n.3.repeat the second step b times , and calculate tb or zb , b = 1 , , b.4.estimate p - value usingpvalue=#tb*>tb . resample data under eij , and obtain the contingency table n = { n0 , , nj 1 , m0 , repeat the second step b times , and calculate tb or zb , b = 1 , , b. estimate p - value usingpvalue=#tb*>tb . another approach is to consider a parametric bootstrap . to this end , consider each allele or column are produced from the independent pdf . under the null hypothesis(5)fpn=j=0j1njnjpnj1pnjnj , that is actually a product of four binomial pdf . in order to estimate p , the maximum likelihood estimation ( mle ) of it can be used i.e. , p^=nn . the procedure of the test is the same as below , just in the step 3 , the resampled contingency tables are generated using fp^n=j=0j1njnjp^nj1p^njnj . the test can be done using the following steps,1.calculate t or z.2.resample data under eij , and obtain the contingency table n = { n0 , , nj 1 , m0 , , mj 1 } , where n*~multine00n e2j1n.3.repeat the second step b times , and calculate tb or zb , b = 1 , , b.4.estimate p - value usingpvalue=#tb*>tb . resample data under eij , and obtain the contingency table n = { n0 , , nj 1 , m0 , repeat the second step b times , and calculate tb or zb , b = 1 , , b. estimate p - value usingpvalue=#tb*>tb . another approach is to consider a parametric bootstrap . to this end , consider each allele or column are produced from the independent pdf . under the null hypothesis(5)fpn=j=0j1njnjpnj1pnjnj , that is actually a product of four binomial pdf . in order to estimate p , the maximum likelihood estimation ( mle ) of it can be used i.e. , p^=nn . the procedure of the test is the same as below , just in the step 3 , the resampled contingency tables are generated using fp^n=j=0j1njnjp^nj1p^njnj . this section demonstrates the validity of the proposed methods for the inference of cochran - armitage trend test . in order to study the finite sample properties of the proposed approaches , the proposed methods are simultaneously based on the same simulated data in order to provide a meaningful comparison of various algorithms . in total 5000 simulations were performed . in order to make a comparative evaluation of the procedures , we seek the certain desirable features such as the actual significance level . in order to produce the simulation , the data is generated using ( n0 , n1 , n2 ) : multi(n , ( 0.2,0.4,0.2 ) ) and ( m0 , m1 , m2 ) : multi(m , ( 0.2,0.4,0.2 ) ) . the q - q plot of the p - value of the proposed tests are given in fig . 1 , which shows that the p - value using the bootstrap tests fit better to the uniform distribution , that admits the bootstrap can be nominated to draw the inference . racine and mackinnon ( 2007 ) suggest(6)pvalue=#tb*>tb+1+ub+1 , where u : unif(0 , 1 ) . under null hypothesis , p(p value < ) = for any finite b , specially if the number of bootstrap is not large . the simulated data are generated using ( n0 , n1 , n2 ) : multi(n , ( 0.2,0.4,0.2 ) ) and ( m0 , m1 , m2 ) : multi(m , ( 0.4,0.2,0.2 ) ) . 2 . the violin plot is a combination of a box plot and a kernel density plot ; it starts with a box plot , and then adds a rotated kernel density plot to each side of box plot that provides a better indication of the shape of distribution and summary of data . 3 illustrates the q - q plot of generated random number of size 100,000 from 1 . the results confirm that the statistic with distribution 1 suffer from the lack of goodness - of - fitness in the right tail . this fact is also quite evident for cochran - armiatage trend test . in order to study the efficiency the proposed approaches , we generate 2000 tables with ( n0 , n1 , n2 ) : multi(n , ( 0.2,0.4,0.2 ) ) and ( m0 , m1 , m2 ) : multi(m , ( 0.2,0.4,0.2 ) ) , where n = m = 20 . the q - q plot from 1 and the bootstrap approach is given in fig . this article explores the genetic association study for the case - control design that draw the inference of the equality of the genotype frequencies . gwas represent important challenges and opportunities in bioinformatics as they enable modeling of complex genotype - phenotype relationships using the mathematical and statistical approaches . such models aids us to understand and interpret genetic association studies and promotes the development of powerful algorithms to examine genotype - phenotype relationships . in this paper it was shown that the proposed bootstrap can be used to test the genetic association . the results confirm that the p - value of the proposed approaches fits better to the uniform distribution , specially on the right side . another advantage of the proposed tests require less assumption in comparison with the conventional method . the results also support that the proposed approaches can be successfully employed to test the genetic association . extending the proposed idea in this paper to obtain a better test that is more robust under choosing weights for the cochran - armitage trend test is our future research plan .
genome - wide association studies the evaluation of association between candidate gene and disease status is widely carried out using cochran - armitage trend test . however , only a small number of research papers have evaluated the distribution of p - values for the cochran - armitage trend test . in this paper , an enhanced version of cochran - armitage trend test based on bootstrap approach is introduced . the achieved results confirm that the distribution of p - values of the proposed approach fits better to the uniform distribution , and it is thus concluded that the proposed method , which needs less assumptions in comparison with the conventional method , can be successfully used to test the genetic association .
current recommendations for multidrug therapy ( mdt ) of leprosy follow a fixed duration of treatment regardless of clearance of skin lesions or presence or absence of acid - fast bacilli in the skin . a fairly high percentage of patients with leprosy who complete recommended duration of multi - drug therapy are left with residual skin lesions which are a great source of anxiety to the patient and the family . a small percentage of patients go on to develop new lesions after completion of treatment which may be either late reactions or relapse . hardly any literature exists on the histological findings in biopsies taken from patients who have completed mdt . this article describes histomorphological findings in patients with treated leprosy who underwent skin biopsies after completion of mdt because they either had persistent lesions or developed new lesions on follow - up . histology of treated leprosy may show findings that are diagnostic for leprosy ( histology active ) or findings that by themselves are not diagnostic for leprosy ( histology inactive ) but may be used as clues in confirming that the persistent skin lesions are histologically inactive and need no further treatment . awareness of histomorphological changes that occur in skin lesions of leprosy after completion of treatment can aid the pathologist to determine whether the lesions are active or inactive histologically and assist the clinician to convince the patient that his disease is inactive and does not need further treatment . current recommendations for multidrug therapy ( mdt ) of leprosy follow a fixed duration of treatment ( 6 months for pauci and 12 months for multibacillary leprosy ) regardless of clearance of skin lesions or presence or absence of acid - fast bacilli in the skin . a fairly high percentage of patients with leprosy who complete recommended fixed duration of mdt are left with residual skin lesions , which are a great source of anxiety to the patient and the family . a small number of patients go on to develop new lesions after completion of the course of treatment which are regarded as either late reactions or relapse . many of such patients who are under treatment from dermatologists in private , undergo skin biopsy to assess hardly any literature exists on the histologic findings in biopsies taken from patients who have completed chemotherapy . this article describes the histomorphological findings in skin lesions of leprosy patients who had completed course of treatment but had either persistence of lesions or developed new lesions on follow - up and underwent biopsies for assessing the biopsy of persistent lesions in treated leprosy may show : findings still diagnostic of leprosy , i.e. persistence of granulomas or in the absence of granulomas , selective lymphocytic infiltration of nerves , arrectores pilorum muscles , eccrine structures , etc . such findings are reported as persistence of activity of the disease.findings that by themselves are not diagnostic for leprosy , but when considered in conjunction with the history of anti - leprosy treatment taken by the patient can be used as clues for diagnosis of treated leprosy . findings still diagnostic of leprosy , i.e. persistence of granulomas or in the absence of granulomas , selective lymphocytic infiltration of nerves , arrectores pilorum muscles , eccrine structures , etc . such findings are reported as persistence of activity of the disease . findings that by themselves are not diagnostic for leprosy , but when considered in conjunction with the history of anti - leprosy treatment taken by the patient can be used as clues for diagnosis of treated leprosy . this article will focus on the second group of findings that show subtle but characteristic changes that may be used for diagnosis of treated leprosy and confirm these can be subdivided into : epidermal changes.alterations in dermal stroma.morphological changes in the inflammatory infiltrate . epidermal changes : flat epidermis with prominent melanin in a lesion that is clinically hypopigmented [ figures 1 and 2]:lesions of treated leprosy that clinically are hypopigmented and show a dry surface often show prominent melanin in the basal layer without any increase in the number of melanocytes at the dermoepidermal junction . at first glance the histology is suggestive of a pigmented lesion , however , the lesion biopsied is always hypopigmented clinically . prominent melanin in the basal layer in a clinically hypopigmented patch is a clue to treated , histologically inactive hansen 's disease.spike of lymphocytes in the epidermis or eccrine ductal epithelium [ figure 3]:a single small collection of epitheliotropic lymphocytes in the epidermis or eccrine ductal epithelium ( acrosyringium ) may be seen in a lesion of treated leprosy . the dermis is devoid of any inflammation or granulomas and the sections may be passed of as normal skin . there is no atypia of the lymphocytes or psoriasiform epidermal hyperplasia as seen in mycosis fungoides . such cases usually have had borderline leprosy and have received full course of mdt.a single focus of epidermotropic lymphocytes in a flat epidermis in the absence of dermal inflammation is a clue to treated , borderline hansen 's disease . alterations in dermal stroma : edema of perivascular and periadnexal adventitial dermis with scatter of noncohesive lymphoplasmacytic cells and increased numbers of mast cells [ figure 4 ] : the adventitial dermis surrounding the vessels and adnexal structures in the dermis shows a pale edematous appearance that reflects resolving inflammation with alteration in the characteristics of the inflammatory cells , lymphocytes are replaced by plasmacytoid cells with abundant amphophilic cytoplasm . also seen are increased numbers of mast cells scattered amidst the regenerating stroma.fibromyxoid changes of dermis [ figure 5]:this may take the form of extensive myxoid appearance of the upper and mid - dermis with pale fibrillary collagen separated by myxoid material , fibroplasia with scattered fibroblasts , upper dermal telangiectasia and perivascular and periadnexal lymphoplasmacytic infiltrate . a second pattern is blue - gray mucin deposition between the collagen bundles in the upper and mid - dermis that may resemble mucin deposits in collagen vascular diseases like lupus erythematosus [ figure 6].morphea - like dermal changes [ figure 7]:histopathological findings that mimic morphea may be seen in lesions of treated leprosy , with a flat epidermis which has prominent melanin in the basal layer , a thickened sclerotic dermis with paucity of adnexal structures and no granulomas or significant inflammatory infiltrate . important to note that patients with morphea - like dermal changes post - treatment show granulomas in the pretreatment biopsies without sclerosis of dermal collagen . morphological changes in inflammatory infiltrate : lymphoplasmacytoid appearance of infiltrate [ figure 8]:the lymphocytes that in pretreatment biopsies are seen as tight cohesive collections around vascular and adnexal structures are replaced by plasmacytoid cells with abundant amphophilic cytoplasm scattered in the pale edematous stroma of the adventitial dermis . similar changes may be seen surrounding residual granulomas of treated leprosy.uniformly foamy histiocytes with fragmented and granular acid - fast material [ figure 9]:in multibacillary leprosy macrophages may be present in large numbers even after completion of mdt . these develop uniformly foamy cytoplasm that on staining with fite - faraco stain show no solid viable bacilli but abundant fragmented and granular acid - fast debris . such macrophages laden with lipids derived from the mycobacteria can be easily differentiated from an active nontreated case of bl / ll leprosy in which the histiocytes have solid staining amphophilic cytoplasm and occasional variably sized foamy cells . the uniformly foamy histiocytes of treated multibacillary leprosy are seen surrounding vascular and adnexal structures and may even be seen interstitially and be mistaken for a xanthoma . flat epidermis with prominent melanin in a lesion that is clinically hypopigmented [ figures 1 and 2]:lesions of treated leprosy that clinically are hypopigmented and show a dry surface often show prominent melanin in the basal layer without any increase in the number of melanocytes at the dermoepidermal junction . at first glance the histology is suggestive of a pigmented lesion , however , the lesion biopsied is always hypopigmented clinically . prominent melanin in the basal layer in a clinically hypopigmented patch is a clue to treated , histologically inactive hansen 's disease.spike of lymphocytes in the epidermis or eccrine ductal epithelium [ figure 3]:a single small collection of epitheliotropic lymphocytes in the epidermis or eccrine ductal epithelium ( acrosyringium ) may be seen in a lesion of treated leprosy . the dermis is devoid of any inflammation or granulomas and the sections may be passed of as normal skin . there is no atypia of the lymphocytes or psoriasiform epidermal hyperplasia as seen in mycosis fungoides . such cases usually have had borderline leprosy and have received full course of mdt.a single focus of epidermotropic lymphocytes in a flat epidermis in the absence of dermal inflammation is a clue to treated , borderline hansen 's disease . flat epidermis with prominent melanin in a lesion that is clinically hypopigmented [ figures 1 and 2 ] : lesions of treated leprosy that clinically are hypopigmented and show a dry surface often show prominent melanin in the basal layer without any increase in the number of melanocytes at the dermoepidermal junction . at first glance the histology is suggestive of a pigmented lesion , however , the lesion biopsied is always hypopigmented clinically . prominent melanin in the basal layer in a clinically hypopigmented patch is a clue to treated , histologically spike of lymphocytes in the epidermis or eccrine ductal epithelium [ figure 3 ] : a single small collection of epitheliotropic lymphocytes in the epidermis or eccrine ductal epithelium ( acrosyringium ) may be seen in a lesion of treated leprosy . the dermis is devoid of any inflammation or granulomas and the sections may be passed of as normal skin . there is no atypia of the lymphocytes or psoriasiform epidermal hyperplasia as seen in mycosis fungoides . a single focus of epidermotropic lymphocytes in a flat epidermis in the absence of dermal inflammation is a clue to treated , borderline hansen 's disease . alterations in dermal stroma : edema of perivascular and periadnexal adventitial dermis with scatter of noncohesive lymphoplasmacytic cells and increased numbers of mast cells [ figure 4 ] : the adventitial dermis surrounding the vessels and adnexal structures in the dermis shows a pale edematous appearance that reflects resolving inflammation with alteration in the characteristics of the inflammatory cells , lymphocytes are replaced by plasmacytoid cells with abundant amphophilic cytoplasm . also seen are increased numbers of mast cells scattered amidst the regenerating stroma.fibromyxoid changes of dermis [ figure 5]:this may take the form of extensive myxoid appearance of the upper and mid - dermis with pale fibrillary collagen separated by myxoid material , fibroplasia with scattered fibroblasts , upper dermal telangiectasia and perivascular and periadnexal lymphoplasmacytic infiltrate . a second pattern is blue - gray mucin deposition between the collagen bundles in the upper and mid - dermis that may resemble mucin deposits in collagen vascular diseases like lupus erythematosus [ figure 6].morphea - like dermal changes [ figure 7]:histopathological findings that mimic morphea may be seen in lesions of treated leprosy , with a flat epidermis which has prominent melanin in the basal layer , a thickened sclerotic dermis with paucity of adnexal structures and no granulomas or significant inflammatory infiltrate . important to note that patients with morphea - like dermal changes post - treatment show granulomas in the pretreatment biopsies without sclerosis of dermal collagen . edema of perivascular and periadnexal adventitial dermis with scatter of noncohesive lymphoplasmacytic cells and increased numbers of mast cells [ figure 4 ] : the adventitial dermis surrounding the vessels and adnexal structures in the dermis shows a pale edematous appearance that reflects resolving inflammation with alteration in the characteristics of the inflammatory cells , lymphocytes are replaced by plasmacytoid cells with abundant amphophilic cytoplasm . also seen are increased numbers of mast cells scattered amidst the regenerating stroma . fibromyxoid changes of dermis [ figure 5 ] : this may take the form of extensive myxoid appearance of the upper and mid - dermis with pale fibrillary collagen separated by myxoid material , fibroplasia with scattered fibroblasts , upper dermal telangiectasia and perivascular and periadnexal lymphoplasmacytic infiltrate . a second pattern is blue - gray mucin deposition between the collagen bundles in the upper and mid - dermis that may resemble mucin deposits in collagen vascular diseases like lupus erythematosus [ figure 6 ] . morphea - like dermal changes [ figure 7 ] : histopathological findings that mimic morphea may be seen in lesions of treated leprosy , with a flat epidermis which has prominent melanin in the basal layer , a thickened sclerotic dermis with paucity of adnexal structures and no granulomas or significant inflammatory infiltrate . important to note that patients with morphea - like dermal changes post - treatment show granulomas in the pretreatment biopsies without sclerosis of dermal collagen . morphological changes in inflammatory infiltrate : lymphoplasmacytoid appearance of infiltrate [ figure 8]:the lymphocytes that in pretreatment biopsies are seen as tight cohesive collections around vascular and adnexal structures are replaced by plasmacytoid cells with abundant amphophilic cytoplasm scattered in the pale edematous stroma of the adventitial dermis . similar changes may be seen surrounding residual granulomas of treated leprosy.uniformly foamy histiocytes with fragmented and granular acid - fast material [ figure 9]:in multibacillary leprosy macrophages may be present in large numbers even after completion of mdt . these develop uniformly foamy cytoplasm that on staining with fite - faraco stain show no solid viable bacilli but abundant fragmented and granular acid - fast debris . such macrophages laden with lipids derived from the mycobacteria can be easily differentiated from an active nontreated case of bl / ll leprosy in which the histiocytes have solid staining amphophilic cytoplasm and occasional variably sized foamy cells . the uniformly foamy histiocytes of treated multibacillary leprosy are seen surrounding vascular and adnexal structures and may even be seen interstitially and be mistaken for a xanthoma . lymphoplasmacytoid appearance of infiltrate [ figure 8 ] : the lymphocytes that in pretreatment biopsies are seen as tight cohesive collections around vascular and adnexal structures are replaced by plasmacytoid cells with abundant amphophilic cytoplasm scattered in the pale edematous stroma of the adventitial dermis . uniformly foamy histiocytes with fragmented and granular acid - fast material [ figure 9 ] : in multibacillary leprosy macrophages may be present in large numbers even after completion of mdt . these develop uniformly foamy cytoplasm that on staining with fite - faraco stain show no solid viable bacilli but abundant fragmented and granular acid - fast debris . such macrophages laden with lipids derived from the mycobacteria can be easily differentiated from an active nontreated case of bl / ll leprosy in which the histiocytes have solid staining amphophilic cytoplasm and occasional variably sized foamy cells . the uniformly foamy histiocytes of treated multibacillary leprosy are seen surrounding vascular and adnexal structures and may even be seen interstitially and be mistaken for a xanthoma . scanning view with flat pigmented epidermis and thickened nerve with surrounding lymphocytic infiltrate in subcutis . ( h and e , 40 ) flat epidermis with uniformly increased melanin in the basal layer without increased melanocytes at dermoepidermal junction . ( hande , 400 ) single focus of epidermotropic lymphocytes in the basal and spinous layers of the flat epidermis . ( h and e , 400 ) perivascular edema with many mast cells , fibroplasia and lymphoplasmacytic cells . ( h and e , 400 ) myxoid pale appearance of reticular dermis with scattered fibrocytes and lympho - plasmacytoid infiltrate . ( h and e , 100 ) interstitial mucin deposits that appear as blue - gray stringy material between the collagen bundles . ( h and e , 400 ) morphea - like appearance with flattened pigmented epidermis and thick sclerotic dermis that is paucicellular and pauciadnexal . ( h and e , 100 ) numerous plasmacytoid cells with abundant amphophilic cytoplasm scattered in a pale edematous stroma . ( h and e , 400 ) uniformly foamy ( xanthomatous ) histiocytes in treated bl / ll hansen 's . many patients of leprosy who complete prescribed courses of mdt are left with residual lesions that may clinically be active or inactive at the time of release from treatment ( rft ) . governmental agencies and ngos engaged in the treatment and follow - up of leprosy patients do not recommend skin biopsies post - treatment , however , patients undergoing treatment with private dermatologists often undergo skin biopsies to assess activity of the disease for visible skin lesions and/or persistent neural symptoms like loss of sensations or tingling / numbness which are a source of great anxiety to the patient and the families given the great social stigma associated with this disease . biopsies from such patients are received because of the following reasons : skin lesions are still clinically active.lesions although clinically inactive still persist and are a source of anxiety to the patient.new lesions develop.there are no skin lesions but neural symptoms persist.delayed reactions / relapse.persistent reactions . lesions although clinically inactive still persist and are a source of anxiety to the patient . how does a histopathologist deal with such biopsies ? hardly any literature exists on the histological findings in treated leprosy and on criteria for active versus inactive disease . biopsies from persistent skin lesions of treated leprosy may show findings that are still diagnostic of leprosy , i.e. , presence of epithelioid cell granulomas that selectively involve adnexal and neural structures in tuberculoid / bt leprosy or collections of histiocytes that harbor acid - fast bacilli or fragmented acid fast debris . in multibacillary leprosy finding of viable solid staining afb is suggestive of a relapse , however , in paucibacillary leprosy it is very difficult to differentiate histologically between a reaction and a relapse . some authorities advocate use of quantitative evaluation of granulomas ( granuloma fraction and bacillary index of granuloma ) and comparison of before and after biopsies . in most cases , however , pretreatment biopsies are not available for comparison . also sampling errors can occur as different areas in the same biopsy do show differences in granuloma fraction and the pre and post - treatment biopsies can not be from the same site . further more , patients tend to change doctors and conceal history of previous treatments , especially in a disease like leprosy . therefore , assessment of post - treatment histology of skin lesions is best done using qualitative and morphological findings . morphological changes seen in treated leprosy include : ill - formed , noncohesive , opened out granulomas with intercellular edema separating the epithelioid cells [ figure 10].scatter of lymphoid cells in an edematous fibroblastic stroma . ( in active untreated leprosy the stroma is normal and uninvolved and the granulomas and lymphocytes are selectively restricted to adnexal and neural structures ) [ figure 11].histiocytic granulomas made up of uniformly foamy histiocytes and containing fragmented and granular acid - fast bacillary debris . ill - formed , noncohesive , opened out granulomas with intercellular edema separating the epithelioid cells [ figure 10 ] . ( in active untreated leprosy the stroma is normal and uninvolved and the granulomas and lymphocytes are selectively restricted to adnexal and neural structures ) [ figure 11 ] . histiocytic granulomas made up of uniformly foamy histiocytes and containing fragmented and granular acid - fast bacillary debris . ill formed , noncohesive , opened out granuloma with intercellular edema separating the epithelioid cells . ( h and e , 400 ) interstitial scatter of lymphocytes in fibroblastic stroma with resolving granulomas . ( h and e , 100 ) such findings suggest that the patient has received treatment , however , the granulomas persist and histologically the lesion is still active. on the other hand , many biopsies from persistent lesions , post - mdt , do not show granulomas or histiocytes and can not be diagnosed as leprosy based on the current histological findings . these cases , however , do show subtle morphological findings that are seen only in lesions of treated leprosy and such findings can be used in conjunction with history of previous diagnosis and treatment of leprosy to confirm that the disease is inactive , has been adequately treated , and does not need further continuation of mdt . the morphological findings described in this article have not been described before and they possibly reflect postinflammatory changes and regenerative responses of the dermis . changes in immune status that occur with mdt may also play a role especially in the finding of epitheliotropic lymphocytes in the epidermis . upgrading of adhesion molecules like icam 1 on keratinocytes is associated with epidermotropism of lymphocytes in inflammatory conditions with improved cmi and a th1 response that releases interferon-. healing and resolution of inflammation in treated leprosy does not normally lead to promiment fibrosis as is seen in other granulomatous diseases of the skin , like tuberculosis , leishmaniasis , etc . this is because inflammation in leprosy favors selectively the papillary and adventitial dermis that abuts the epidermis and epithelial adnexal structures respectively . postinflammatory changes in the adventitial dermis do not lead to prominent fibrosis unlike the dense fibrosis that is seen in resolving and treated lesions of lupus vulgaris or tuberculosis verrucosa cutis where the reticular dermis is the seat of granulomatous inflammation . the finding of morphea - like dermal sclerosis and mucin deposits in the dermis are unusual findings for treated leprosy which may lead to diagnostic confusion . interestingly such patients never show dermal sclerosis in the pretreatment biopsies but show granulomas , histologically typical of leprosy , and are never diagnosed as morphea clinically . therefore , it is unlikely that such patients may have had morphea to begin with and the changes of dermal sclerosis seen in post - mdt biopsies represent postinflammatory changes of the reticular dermis . the alteration of morphology of the cellular infiltrate , i.e. , plasmacytoid lymphocytes may represent persistent innate immune responses , as plasmacytoid lymphocyte transformation is known to occur in viral infections with heightened innate immune responses . uniformly foamy histiocytes reflect complete killing of mycobacteria and correlates with granular acid - fast material without solid staining organisms . no explanation can be offered for the hyperpigmentation of basal layer of the epidermis , but this finding serves to differentiate between other hypopigmented lesions that clinically may be considered in the differential diagnoses . the findings described in this article are based on the personal experience of the author and may reflect personal bias . this is a retrospective and descriptive study of findings that the author finds useful for making diagnoses of histologically inactive disease in cases of leprosy . not all biopsies show these findings and amongst the described clues some like basal cell hyperpigmentation in hypopigmented patches and plasmacytoid appearance of cells are common while dermal changes like morphea - like appearance and mucin in the dermis are rare . the common factor , however , is that all these patients have had leprosy diagnosed on clinicopathological grounds and have completed recommended courses of mdt before the post - treatment biopsies were taken . it is important to understand that these findings by themselves , are not diagnostic for leprosy and are of value only in patients with leprosy who have completed mdt . to conclude , many patients with leprosy who complete fixed duration of mdt continue to have persistence of skin lesions , or develop new lesions . activity of disease and the morphological findings described in this article are helpful to confirm the diagnosis of treated , histologically
background : current recommendations for multidrug therapy ( mdt ) of leprosy follow a fixed duration of treatment regardless of clearance of skin lesions or presence or absence of acid - fast bacilli in the skin . a fairly high percentage of patients with leprosy who complete recommended duration of multi - drug therapy are left with residual skin lesions which are a great source of anxiety to the patient and the family . a small percentage of patients go on to develop new lesions after completion of treatment which may be either late reactions or relapse . many such patients undergo skin biopsy to assess activity of the disease . hardly any literature exists on the histological findings in biopsies taken from patients who have completed mdt.materials and methods : this article describes histomorphological findings in patients with treated leprosy who underwent skin biopsies after completion of mdt because they either had persistent lesions or developed new lesions on follow-up.results:histology of treated leprosy may show findings that are diagnostic for leprosy ( histology active ) or findings that by themselves are not diagnostic for leprosy ( histology inactive ) but may be used as clues in confirming that the persistent skin lesions are histologically inactive and need no further treatment . these findings may be divided into 1 . epidermal findings , 2 . alterations in dermal stroma , and 3 . morphological characteristics of the dermal inflammatory infiltrate.conclusion:awareness of histomorphological changes that occur in skin lesions of leprosy after completion of treatment can aid the pathologist to determine whether the lesions are active or inactive histologically and assist the clinician to convince the patient that his disease is inactive and does not need further treatment .
although anterior cruciate ligament ( acl ) damage occurs most frequently in populations aged 1525 years participating in pivoting sports , it can occur in people of any age1 . at least 80,000250,000 cases of acl damage occur annually in the usa , and acl ruptures occur annually at a ratio of approximately one per every 3,000 people2 . since acl damage frequently occurs , incurs large treatment expenses , and can cause various complications even after surgical treatment , many studies have been conducted on acl damage - related surgery and rehabilitation exercises . although recent methods of rehabilitation after acl reconstruction are faster and more diverse , the purpose of rehabilitation exercises is invariably to reduce knee joint instability to enable activities without damage . an important objective of rehabilitation exercise after acl reconstruction is the recovery of the normal muscle strength of the femoral muscles3 . since the recovery of the original muscle strength after atrophy of the femoral muscles takes a long time , disuse atrophy of the femoral muscles is considered very important in knee joint surgery . although experts in exercise prescriptions have recently been examining the effects of accelerated rehabilitation exercises after acl reconstruction , no study has been conducted on differences in the effects of accelerated rehabilitation exercises between males and females . therefore , research is needed into muscle functions with changes in muscle strength and muscle power , which are the core of rehabilitation exercises , after the performance of accelerated rehabilitation exercises after acl reconstruction . the purpose of the present study was to examine changes in the knee joint s isokinetic muscle functions after systematic and gradual rehabilitation exercises lasting for 12 weeks for male and female patients who underwent acl reconstruction . differences in muscle functions between the uninvolved side ( us ) and the involved side ( is ) before surgery , differences in muscle functions between us and is after rehabilitation exercises for 12 weeks , and changes in muscle functions on us and is between before and after surgery were analyzed to examine the effects of accelerated rehabilitation exercises after acl reconstruction . the study subjects were 10 patients , five females and five males , who underwent acl reconstruction performed by the same surgeon . the male group was ( meansd ) 25.801.92 years old , 173.005.83 cm tall , and 67.007.28 kg in weight . the female group was 26.603.44 years old , 167.404.77 cm tall , and 63.207.73 kg in weight . to ensure the safety and validity of rehabilitation exercises , a rehabilitation exercise program was prepared as follows . based on a review of the literature related to rehabilitation exercises after acl reconstruction , wilk s accelerated rehabilitation exercise program after acl reconstruction was modified for the content of the rehabilitation exercise program ( table 1table 1 . objectives of rehabilitation exercise programs after acl reconstruction by stage and rehabilitation exercises ) . as a measuring tool , a biodex multi - joint system 3pro ( usa ) , which is an isokinetic measuring device , was used to examine the flexion and extension forces of the knee joint . for accurate measurement during tests , test motions were practiced three times with maximum muscle strength before measurements were taken , and the measurements were conducted after a rest had been taken . to prevent the force of the other parts of the body from acting during repeated knee joint extension and flexion exercises , the subject was instructed to sit on the chair , and the subject s shoulder , chest , and pelvis were fixed using a belt connected to the chair . then , the thigh of the subject was fixed using the thigh stabilization belt . the length of the belt of the dynamometer was adjusted so that the shin pad was placed approximately 1 cm above the lateral malleolus of the ankle joint , the force point , and the shin pad was fixed using a velcro strap . the axis of the dynamometer was aligned with the axis of exercise , and the subjects were verbally encouraged to exert maximum muscle strength during the test . the entire work done is a variable that can provide information useful for determining the degree of injury rehabilitation , because this value is affected by the rom . therefore , in the present study , during isokinetic muscle strength evaluation , the rom of us was the same as that of is for consistency of measurement . the study data were statistically processed using the spss 15.0 statistics program for windows . preoperative differences in isokinetic muscle functions between us and is , postoperative differences in isokinetic muscle functions between us and is , and differences in isokinetic muscle functions between before and after surgery on each of us and is were analyzed using the paired t - test with a significance level of =0.05 . all the subjects understood the purpose of this study and provided their written informed consent prior to their participation in the study in accordance with the ethical standards of the declaration of helsinki . at 60/s , the isokinetic muscle functions of the females did not show any significant change between before and after surgery in any of variables on both us and is ( table 2table 2 . changes in females isokinetic muscle functions between before and after surgery at an angular velocity of 60/s ) . at 60/s , the isokinetic muscle functions of the males did not show any significant change between before and after surgery in peak torque , average power , and entire work done on us ( table 3table 3 . changes in males isokinetic muscle functions between before and after surgery at an angular velocity of 60/s ) . in extension , however , in extension , the average power and entire work done on is significantly increased ( p<0.05 ) . in flexion , whereas the peak torque and average power on us significantly increased ( p<0.05 ) , the entire work done on the same side did not show any significant change . in flexion , the peak torque , average power , and entire work done on is significantly increased ( p<0.01 ) . rehabilitation exercises after acl reconstruction are receiving attention from many experts in sports medicine . traditional rehabilitation exercise methods restrict the range of motion , do not apply weight bearing at the beginning , and are composed of only low intensity exercises . therefore , however , accelerated rehabilitation programs are composed of immediate and active rehabilitation exercises after surgery , and have been reported to enable a return to sport activities in approximately six months after acl reconstruction4 . studies related to the evaluation of acl reconstruction patients muscle strength report that an analysis of the deficit ratio of is to us is more valuable than the evaluation of individual muscle strengths5 , 6 . clinical specialists , referring to empirical evidence , point out that applying the same accelerated rehabilitation exercises is somewhat impractical . therefore , in the present study , the discussion focuses on the results of the application of a modified wilk s accelerated rehabilitation exercise program lasting for 12 weeks after acl reconstruction surgery7 . at 60/s , the isokinetic muscle functions of the females did not show any significant change between before and after surgery in any variable on both us and is . at 60/s , the isokinetic muscle functions of the males did not show any significant change between before and after surgery , except that in extension , the average power and entire work done on is significantly increased ( p<0.05 ) . therefore , we consider 12-week duration rehabilitation exercises are incapable of improving knee joint extension muscle functions in females , but are capable of partially recovering extensor muscle functions on is in males . evidence in support of this conclusion includes a study on gender differences regarding the effects of rehabilitation exercises after acl reconstruction conducted by an8 , who found that when the same rehabilitation exercises were performed by both males and females , subjective knee evaluation scores ( 2000 international knee document committee subjective knee evaluation : 2000 ikdc ) of males had improved at 12 weeks after surgery , whereas ikdc scores of females had decreased . this result is consistent with the present study results that show different responses of males and females after 12 weeks of rehabilitation exercises after acl reconstruction . male and female patients exhibited different effects after a 12-week course of rehabilitation exercises for the recovery of knee joint muscle functions after acl reconstruction . for full recovery of knee joint muscle functions after surgery , rehabilitation exercises of longer duration are necessary .
[ purpose ] to examine changes in the knee joint s isokinetic muscle functions following systematic and gradual rehabilitation exercises lasting for 12 weeks for male and female patients who underwent anterior cruciate ligament ( acl ) reconstruction . differences in muscle functions between the uninvolved side ( us ) and the involved side ( is ) before surgery , differences in muscle functions between us and is after rehabilitation exercises lasting for 12 weeks , and changes in muscle functions on us and is between before and after surgery were analyzed to examine the effects of accelerated rehabilitation exercises after acl reconstruction . [ subjects ] the study subjects were 10 patients , five females and five males , who underwent acl reconstruction performed by the same surgeon . [ methods ] as a measuring tool , a biodex multi - joint system 3pro ( usa ) , which is an isokinetic measuring device , was used to examine the flexion and extension forces of the knee joint . during isokinetic muscle strength evaluation , the rom of us was set to be the same as that of is for consistency of measurement . [ results ] at 60/s , the isokinetic muscle functions of the females did not show any significant change between before and after surgery in any of the variables on both us and is . at 60/s , the isokinetic muscle functions of the males did not show any significant change between before and after surgery in the peak torque , average power , and entire work done on us . in extension , peak torque on is did not show any significant change .
nasopharyngeal carcinoma ( npc ) is a major malignant disease of the head and neck region and is endemic to southeast asia and mediterranean basin , especially in southern china [ 1 , 2 ] . since npc originates from a hidden anatomical site and is more closely associated with advanced clinical stage , the results of conventional radiotherapy technique are unsatisfactory although it is a radiosensitive tumor . therefore , chemotherapy treatment is a necessary ancillary method for these npc patients [ 3 , 4 ] . cis - diamminedichloroplatinum ( cddp ) , also known as cisplatin , which is the most active and most frequently employed drugs , is often used to treat distant metastasis or advanced locoregional recurrence of npc patients , and the chemotherapeutic regimen of cddp plus 5-fluorouracil ( 5-fu ) is the main drug combination used in clinical trials [ 5 , 6 ] . however , inherent and acquired resistance to the drug limits its applications in npc chemotherapy . of all these mechanisms , the one that is most commonly encountered in the laboratory is the increased efflux of abroad class of hydrophobic cytotoxic drugs that is mediated by one of a family of energy - dependent transporters , known as adenosine triphosphate binding cassette ( abc ) transporters . the abc transporters have the capability to use energy to drive the transporters of various molecules across the cellular membrane and are confirmed to be associated with anticancer drug transporter . so far , tissue culture studies have consistently shown that the major mechanism of mdr in most cultured cancer cells involves abcb1(also known as p - glycoprotein , p - gp , or mdr1 ) , abcc1 ( also known as multidrug resistance associated - protein 1 , mrp1 ) , or abcg2 . abcc2 , also known as mrp2 or cmoat , had been identified to confer cellular resistance of tumor cells to various anticancer drugs including cddp . our previous study had confirmed that lentivirus - mediated rnai silencing targeting abcc2 might reverse the abcc2-related drug resistance of npc cell line cne2 against cddp . to further illustrate the mechanism of cddp - resistance , given that the chemotherapeutic regimen of cddp plus 5-fu was widely used in clinic , cddp-5fu - resistant cell line derived from parental cne2 was also established . psc 833 , a second - generation powerful mdr modulator , was utilized to reverse the cddp - resistance in these cells . the modulation of abcc2 expression was detected , and high performance liquid chromatograph ( hplc ) was used to detect the intracellular accumulation of cddp in these cells with or without psc 833 . the human npc cell line cne2 was grown in rpmi-1640 medium(hyclone , logan , ut ) supplemented with 10% fetal calf serum ( excell , cranford , nj ) and 1% l - glutamine . the cddp - resistant and cddp-5fu - resistant sublines were generated by continuously culturing the drug - sensitive parental cell line cne2 in medium containing large dose of cddp ( 1 g / ml ) and cddp ( 1 g / ml ) plus 5-fu ( 1 g / ml ) for over 1 year . to avoid an influence of cddp or 5-fu , all resistant sublines were cultured in drug free medium for over 1 month before subsequent analysis . cells were seeded into 96-well plates at a density of 5 10 cells per well . to investigate the effect of psc 833 , cells were incubated with or without 2 g / ml psc 833 ( sandoz , basel , switzerland ) . various gradient concentrations of cddp ( qi lu pharmaceutical factory , jinan , china ) ranging from 0.5 to 32 g / ml were added to each well 24 hours after seeding . wells containing no drugs or psc 833 were used to control cell viability , and wells containing no cells were used as a blank control . after 48 hours of incubation under normal culture condition , mtt was added at a final concentration of 5 mg / ml . four h later , dmso ( sigma , louis , mo , usa . ) was added to each well to dissolve the crystal with shaking horizontally for ten minutes . the optical density ( od ) value of 570 nm wavelength was measured by microplate reader ( bio rad , hercules , ca ) . the ic50 value , defined as the drug concentration required to reduce cell survival to 50% determined by the relative absorbance of mtt , was assessed by probit regression analysis in spss11.5 statistical software . the resistance index ( ri ) was calculated by dividing the ic50 of the cddp - resistant sublines by that of parental cell line cne2 . cells were seeded into seven 96-well plates at a density of 1 10 cells per well . a mtt assay was done daily from the second to the eighth day of incubation . total rna from all cells were extracted using trizol reagent ( invitrogen , carlsbad , ca ) and reverse transcribed to cdna using primescript kit ( takara bio , otsu , japan ) following the manufacturer 's instructions . real - time pcr was performed with mx3000p instrument ( stratagene , cedar creek , tx ) using a commercially available master mix sybr premix ex taq kit ( takara bio , otsu , japan ) containing taq dna polymerase and sybr - green i fluorescence dye . agatagg-3 , abcb1 reverse , 5-aagaacaggactgatggc-3 ; abcc1 forward , 5-gaggaagggagttcagtctt-3 , abcc1 reverse , 5-acaagacg agctgaatgagt-3 ; and abcc2 forward , 5-ctcacttcagcgagaccg-3 , abcc2 reverse , 5-ccagccagttcagggttt-3 ; abcg2 forward , 5-acctg aaggcatttactgaa-3 , abcg2 reverse , 5-tctttccttgcagctaagac-3 ; the primer sequences for reference gene actb ( also known as -actin ) were as follows : actb forward : 5-cacccagcacaatgaagat-3 ; actb reverse : 5-caaataaagc catgccaat-3. cycling conditions were used as described previously : 95c for 10 minutes to activate dna polymerase , followed by 45 cycles of 95c for 15 seconds , 55c for 20 seconds , and 72c for 10 seconds . the cycle threshold ( ct ) , which represents a positive pcr result , is defined as the cycle number at which a sample 's fluorescence crossed the threshold automatically determined by the mx3000p system . the relative changes in gene expression were calculated with the 2 method , where ct = ct(target gene)ct(actb ) , and ct = ct ( sample)ct ( calibrator ) [ 17 , 18 ] . here sample refers to cddp - resistant and cddp-5fu - resistant cne2 sublines , while calibrator refers to parental cell line cne2 . cells were seeded on slides , incubated under normal culture conditions for overnight , fixed in acetone for 30 minutes at 4c , washed with pbs , and air - dried . after treated by endogenous biotin block system ( maixin biotechnology , fuzhou , china ) , the slides were incubated in 3% h2o2 for 10 minutes to block endogenous peroxidase , and then in 10% normal rabbit serum for 10 minutes to block nonspecific antibody binding sites . when blocking was complete , the slides were then incubated with specific antibody against human abcc2 ( ( boster , wuhan , china ) in a 1 : 100 dilution in pbs at 4c overnight . subsequently , the slides were detected with the biotin - streptavidin- peroxidase system ( ultra sensitive - sp kit ; maixin biotechnology , fuzhou , china ) at room temperature , using diaminobenzidine ( maixin biotechnology , fuzhou , china ) as color presentation ( 13 min ) . negative controls were performed by substituting the specific antibody with pbs [ 19 , 20 ] . one day after cells were seeded in 25 cm flasks , cddp ( 10 g / ml ) was added to the flasks with or without psc 833 ( 10 g / ml ) . subsequently , they were counted by a haemocytometer , with total 10 cells to be used . after washing by rpmi-1640 for three times , cell pellets were collected and resuspended in 0.3 ml distilled water , followed by freeze / thaw for 5 times to breakdown the cells . finally , 10 l of the supernatant containing cddp content were analyzed by hplc ( series 1200 , agilent , santa . cddp standard solutions ranging from 5 to 80 g / ml were used for preparation of calibration curve . the data of quantitative rt - pcr , ic50 , and intracellular accumulation of cddp were expressed as mean sd value . statistical analysis for these data was carried out by one - way anova in statistical package spss 11.5 . the cddp - resistant sublines , cne2-cddp , and cne2-cddp-5fu , were generated after more than 1 year of culture . cellular growth was determined by a continuous 7-day mtt assay , and growth curve was made according to the od value alterations of mtt assay . no significant difference was found between the cellular growth of these cells ( figure 1 ) . table 1 summarized all the ic50 obtained testing cddp . at the ic50 level , the resistance of cne2-cddp and cne2-cddp-5fu against cddp was 2.63-fold and 5.35-fold stronger than that of cne2 , respectively . in the parental cell line cne2 , psc 833 was inactive , whereas in cne2-cddp and cne2-cddp-5fu , the resistance against cddp was reversed by psc 833 from 2.63-fold to 1.62-fold and 5.35-fold to 4.62-fold , respectively . these data indicated that two cddp - resistant sublines are established successfully , with more acquired cddp - resistance in cne2-cddp-5fu , and the cddp - resistance can be partially reversed by psc 833 . several members of the abc transporter family including abcb1 , abcc1 , abcc2 , and abcg2 can induce mdr [ 7 , 9 ] . of the four abc transporters , abcc2 was found to be upregulated both in cne2-cddp and cne2-cddp-5fu ( table 2 ) . compared to untreated cne2 , the expression level of abcc2 mrna in cne2-cddp and cne2-cddp-5fu was 2.46-fold and 4.29-fold increased , respectively . these data showed that in cddp - resistant sublines , abcc2 mrna was overexpressed , with more expression level in cne2-cddp-5fu . since abcc2 was found to be overexpressed both in cne - cddp and cne2-cddp-5fu , and previous studies have shown that abcc2 can be localized in the nuclear membrane of cddp - resistant cells , immunocytochemistry staining method was used to detect the abcc2 protein expression . as shown in figure 2 , abcc2 protein was found to be localized in cytoplasm . the expression level of abcc2 protein in cddp - resistant sublines was stronger than that in parental cne2 . interestingly , abcc2 protein was also found to be localized in nucleus of cne2-cddp-5fu cells . abc transporters have the capability to use energy to drive the transporters of various molecules across the cellular membrane . as a measure of the functional activity of abcc2 which was overexpressed in cddp - resistant sublines , the detection of intracellular accumulation of cddp was carried out by hplc . as shown in figure 3(a ) , a symmetrical peak for typical chromatograms of cddp was found , and retention time for cddp was 1.55 minutes . figure 3(b ) showed a typical linear relationship ( r = 0.9965 ) between peak height value and gradient concentration of cddp . the equation obtained from this calibration curve is y = 1.59x + 17.92 , where y stands for the peak height value of cddp and x stands for the concentration of cddp . thereby the intracellular concentration of cddp for each sample was analyzed ( shown in figure 3(c ) ) . compared to untreated cne2 , the intracellular level of cddp was decreased by 2.03-fold in cne2-cddp and 2.78-fold in cne2-cddp-5fu . in contrast , after treatment with psc 833 , the intracellular level of cddp was decreased from 2.03-fold to 1.33-fold in cne2-cddp and from 2.78-fold to 1.35-fold in cne2-cddp-5fu , which indicate that the intracellular accumulation of cddp in cne2-cddp and cne2-cddp-5fu was increased after psc 833 treatment . these data suggest that the capacity to drive cddp out of cells in cddp - resistant sublines is enhanced and can be partially reversed by psc 833 . chemotherapy with cddp is widely used to treat npc patients . primary and secondary resistance to cddp are major limitations to their use in cancer chemotherapy . improved understanding of the biologic mechanisms leading to cddp resistance will provide molecular targets for therapeutic intervention and may facilitate prediction of response and therewith the basis for individually tailored therapy . to further understand the mechanisms of cddp - resistance , two cddp - resistant sublines , cne2-cddp and cne2-cddp-5fu , derived from parental npc cell line cne2 , were established . the resistance was found to be stable for over 1 month in drug - free medium . the resistance against cddp , compared to untreated cne2 , was 2.63-fold for cne2-cddp and 5.35-fold for cne2-cddp-5fu , respectively . these data suggest that the cddp - resistant sublines were established successfully , with more acquired resistance against cddp in cne2-cddp-5fu than that in cne2-cddp . after the cddp - resistant sublines were generated , the mrna levels of the four members of abc transporter family , abcb1 , abcc1 , abcc2 , and abcg2 , which were found to be associated with mdr , were detected by real - time pcr . only abcc2 was found to be up - regulated both in cne2-cddp and cne2-cddp-5fu and was confirmed by immunocytochemichal staining . abcc2 had been shown to be a unidirectional atp - driven export pump localized mainly in the canalicular membrane of hepatocytes . in vitro data suggest that abcc2 might act as an organic anion pump [ 24 , 25 ] . on the other hand , the expression of abcc2 was found to be elevated in a number of cell lines selected for cddp resistance [ 9 , 26 ] . in addition , our previous study had demonstrated that the specific rnai targeting abcc2 led to greater cytotoxicity of cddp to cne2 . these data indicated that abcc2 is related to cddp - resistance . in this study , compared to cne2-cddp , increased expression of abcc2 was observed in cne2-cddp-5fu , which was found to be shown more acquired cddp - resistance than cne2-cddp . our results imply that abcc2 may play an important role in the cddp - resistance of npc cell line cne2 . previous studies confirmed that abcc2 was localized in the nuclear membrane of cddp - resistant cells , and nuclear membranous localization of abcc2 correlated with resistance against cddp in ovarian carcinoma cells [ 22 , 27 ] . furthermore , it had been reported that after treatment with rnai targeting abcc2 , decreased nuclear membranous abcc2 protein expression in the cddp - resistant cancer cell lines was observed . in this study , abcc2 protein was also found to be localized in the nucleus of the more cddp - resistant subline cne2-cddp-5fu , but not in cne2-cddp and parental cne2 . the cellular target of cddp has long been believed to be dna , for it has been shown to bind dna and cause dna duplex to bend and unwind . thus , abcc2 may protect the nucleus from formation of platinum - dna adducts by driving cddp out of the cytoplasm and nucleus . to further confirm that cddp can be driven out of cells by abcc2 , hplc , which is an effective method to detect the intracellular accumulation of cddp , was applied . hplc was a rapid , economic , and validated way to determine the accumulation of cddp in plasma , cancer cell , and tumor samples . our results showed that the intracellular accumulation of cddp in cne2-cddp and cne2-cddp-5fu was decreased compared to cne2 . since in the four abc transporters ( abcb1 , abcc1 , abcc2 , and abcg2 ) related to drug resistance , only abcc2 was found to be up - regulated both in cne2-cddp and cne2-cddp-5fu , and previous study had demonstrated that after treatment with rnai targeting abcc2 , the cellular accumulation of cddp in cne2 was increased , it was inferred that probably abcc2 has the capacity to drive cddp out of the cytoplasm of cddp - resistant sublines . furthermore , compared to cne2-cddp , less intracellular accumulation of cddp these data indicated that may be nuclear localized abcc2 has the capacity to drive cddp out of the nucleus of cne2-cddp-5fu , which results in more acquired resistance to cddp . the mdr - associated transporters inspired a wide search for compounds that would not be cytotoxic themselves but would inhibit mdr transporters . the first of these drugs to be studied was psc 833 , a nonimmunosuppressive cyclosporine d derivative and less toxic compared to cyclosporine a , and also known to inhibit abcc1 and abcc2 [ 11 , 30 , 31 ] . in our research , after treatment with psc 833 , the intracellular accumulation of cddp in subline cne2-cddp and cne2-cddp-5fu was increased , with increased cytotoxicity of cddp . given that of the four abc transporters , only abcc2 was found to be up - regulated both in cne2-cddp and cne2-cddp-5fu , and psc 833 was a modulator of mdr - associated transporters including abcc2 , the role of abcc2 in driving cddp out of cytoplasm may be interfered by psc 833 , which further imply that abcc2 may play an important role in cddp - resistance . in our research , abcc2 moreover , less intracellular accumulation of cddp and more acquired resistance against cddp were found in cne2-cddp-5fu compared to cne2-cddp . these results suggest that the combination of cddp and 5-fu may result in the nuclear localization of abcc2 , thus cddp may be driven out of nucleus and more resistance against cddp was acquired . our results imply that perhaps such a regimen will result in greater cytotoxicity to tumor cells , yet it will make the remaining tumor cells more resistant to cddp , probably mediated by abcc2 , and finally lead to poor prognosis . the relationship between the expression of abcc2 in npc patients and cddp - resistance in clinic should be further studied . taken together , derived from parental npc cell line cne2 , two cddp - resistant sublines ( cne2-cddp and cne2-cddp-5fu ) were developed , hence a good cell model to study the mechanisms of cddp - resistance was established . we demonstrated that the expression of abcc2 was both elevated in cne2-cddp-5fu and cne2-cddp , and abcc2 protein was found to be localized in nucleus of cne2-cddp-5fu , but not in cne2-cddp and parental cne2 . furthermore , less intracellular accumulation of cddp in cddp - resistant sublines compared to parental cne2 was found . therewith , more acquired cddp - resistance was found in cddp - resistant sublines compared to cne2 . of these cell lines , the most resistance against cddp was found in cne2-cddp-5fu , with abcc2 localized in nucleus and the least intracellular accumulation of cddp . the intracellular accumulation of cddp and cddp - resistance can be partially reversed by psc 833 , a modulator of mdr - associated transporters including abcc2 . these data suggest that abcc2 may play an important role in npc resistant to cddp , indicating that abcc2 may be taken as one of the targets to overcome cddp - resistance in npc .
cisplatin ( cddp ) is one of the most active drugs to treat nasopharyngeal carcinoma ( npc ) patients . to further understand the mechanisms of cddp - resistance in npc , two cddp - resistant sublines ( cne2-cddp and cne2-cddp-5fu ) derived from parental npc cell line cne2 were established . it was found that at the ic50 level , the resistance of cne2-cddp and cne2-cddp-5fu against cddp was 2.63-fold and 5.35-fold stronger than that of parental cne2 , respectively . of the four abc transporters ( abcb1 , abcc1 , abcc2 and abcg2 ) related to mdr , only abcc2 was found to be elevated both in cddp - resistant sublines , with abcc2 located in nucleus of cne2-cddp-5fu but not in cne2-cddp and parental cne2 . further research showed that compared to untreated cne2 , the intracellular levels of cddp were decreased by 2.03-fold in cne2-cddp and 2.78-fold in cne2-cddp-5fu . after treatment with psc833 , a modulator of mdr associated transporters including abcc2 , the intracellular level of cddp was increased in cddp - resistant sublines , and the resistance to cddp was partially reversed from 2.63-fold to 1.62-fold in cne2-cddp and from 5.35-fold to 4.62-fold in cne2-cddp-5fu . these data indicate that abcc2 may play an important role in npc resistant to cddp .
reactive airways dysfunction syndrome ( rads ) is defined as the sudden onset of asthma - like symptoms following high - level exposure to a corrosive gas , vapor , or fumes . the term rads was originally described by brooks and lockers in 19811 as nonimmunological asthma resulting from exposure to an irritant gas . given that most cases are recognized retrospectively , often with considerable delay , they usually lack accurate assessment of the exposure intensity and objective evidence of prior normal bronchial hyper - responsiveness required for the diagnosis of rads.2 the symptoms usually manifest within 24 hours of exposure as bronchitis , with ocular or mucus membrane irritation of the upper airway ( depending on the agent ) and often require emergency treatment . the presentation of rads is different from that of true occupational asthma , because it is an acute single event without a significant latency period . many cases occurred after the 9/11 collapse of the new york world trade center , resulting from the inhalation of fumes and particulate matter.3 the american college of chest physicians consensus criteria for the diagnosis of rads were agreed in 1995,4 and were : documented absence of preceding respiratory complaintonset after single exposure incident / accidentexposure to very high concentration of gas , smoke , fumes , or vapors with irritant propertiesonset of symptoms within 24 hours after exposure with persistence for at least 3 monthssymptoms that simulate asthma with cough , wheeze , and dyspneapresence of airflow obstruction on pulmonary function nonspecific bronchial hyper - responsivenessall other pulmonary disease excluded . documented absence of preceding respiratory complaint onset after single exposure incident / accident exposure to very high concentration of gas , smoke , fumes , or vapors with irritant properties onset of symptoms within 24 hours after exposure with persistence for at least 3 months symptoms that simulate asthma with cough , wheeze , and dyspnea presence of airflow obstruction on pulmonary function nonspecific bronchial hyper - responsiveness all other pulmonary disease excluded . these criteria have been criticized for being overly restrictive by alberts and do pico.5 the pathology of rads shows nonspecific inflammation , with a cellular infiltrate which is primarily lymphocytic with epithelial desquamation.6 alberts and brooks describe the big bang mechanism of epithelial injury , with activation of nonadrenergic and noncholinergic fibers via axon reflexes giving rise to neurogenic inflammation , macrophage activation , and mast cell degranulation.7 the resulting proinflammatory state , with toxic mediators , gives rise to epithelial injury . although most people recover , extensive inflammation and epithelial sloughing could reduce receptor thresholds for severe ongoing bronchial hyper - reactivity . to date the literature suggests that rads should be recognized as a unique form of asthma with significant upper airway symptoms that are often ignored but appear to be part of the condition.8 there is a growing list of recognized causal agents,9 which include : household exposure : floor sealants , spray paint , bleaching agents , household cleaners containing morpholine.chemical : chlorine , sulphuric acid , ammonia , hydrochloric acid , acetic acid , phosgene , hydrogen sulphide , sodium azide , sodium hypochlorite , toluene di - isocyanates , organic solvents.industry : paint spraying , metal - coat removers , welding , heated plastics or acids , epoxy resins , perfumes , pesticides , enzymes , industrial cleaning products , dust or molds in silos.other : fire and smoke inhalation , burning paint fumes , tear gas , locomotive exhaust , world trade center collapse in new york . household exposure : floor sealants , spray paint , bleaching agents , household cleaners containing morpholine . chemical : chlorine , sulphuric acid , ammonia , hydrochloric acid , acetic acid , phosgene , hydrogen sulphide , sodium azide , sodium hypochlorite , toluene di - isocyanates , organic solvents . industry : paint spraying , metal - coat removers , welding , heated plastics or acids , epoxy resins , perfumes , pesticides , enzymes , industrial cleaning products , dust or molds in silos . other : fire and smoke inhalation , burning paint fumes , tear gas , locomotive exhaust , world trade center collapse in new york . traditional treatment is the same as that of conventional asthma , despite evidence that patients with rads are less responsive to 2 agonists.10 long - term outcome is not well documented , but if symptoms do not remit within 624 months they are more likely to become persistent.11 oral corticosteroids and bronchodilators commenced within the first 3 months have had the most favorable outcomes.12,13 however , some reported case series suggest symptoms may be more persistent than originally thought . demeter et al14 reported a nine - year follow - up , where nine of 19 patients with rads still had ongoing symptoms , one of whom was progressive . malo assessed mill workers following exposure to chlorine , and found that 29 of 51 still had bronchial hyper - responsiveness over a period of 24 months.15 there is a paucity of data regarding therapeutic interventions for those with persistent symptoms . nebulized sodium bicarbonate following chlorine gas exposure has been shown to improve quality of life and forced expiratory volume in 1 second ( fev1),16 but not lead to a resolution of symptoms . lung transplantation has been used for severe ongoing symptoms of rads following the new york world trade center collapse.17 this report describes a patient with severe unremitting symptoms of rads five years following ammonia exposure , and discusses the response to vitamin d. a 36-year - old nursing sister was referred to our center with a history of incessant cough , shortness of breath , and extreme bronchial hyper - reactivity of five years duration . symptoms had started following exposure to an ammonia spillage by workmen on the floor below the renal unit where she worked as a dialysis sister . the unit had to be evacuated and she received high level exposure for up to two hours . later that day she developed acute onset of cough , wheeze , and mucosal irritation symptoms , and needed to attend accident and emergency . initially this produced an improvement in symptoms ; however , over the subsequent year she required multiple courses of prednisolone , and commenced inhaled corticosteroids and a short - acting 2 agonist . she was seen at a specialist chest hospital , but no solution or effective treatment was found , and pessimism developed about a likely response to any treatment . her original assessment showed normal routine blood tests , a clear chest radiograph , normal echocardiogram , and normal high - resolution computed tomography of her chest . pulmonary function tests had revealed evidence of airways obstruction with airway resistance ( raw ) at 168% of predicted and reduced small airway indices . histamine challenge was positive , with a methacholine - provoking concentration for a 20% fall ( pc20 ) of 7.3 mg / ml . the patient was unable to return to work , and had become virtually housebound due to the severity of her symptoms and the speed and intensity of her bronchospasm to outside odors . she had no prior respiratory illness , no atopy , and was a lifelong nonsmoker . five years later , at the time of her referral to our center , her life quality was extremely poor . she was experiencing intractable paroxysms of coughing lasting continuously for 45 hours , with an incessant background cough leading to significant chest wall pain . she recognized multiple triggers , including air temperature changes , cigarette smoke , perfumes , cleaning products , exertion , and laughing . she suffered from dyspnea secondary to the coughing both at rest and on exertion due to her level of bronchial hyper - reactivity . in terms of medication , she was taking high - dose inhaled pulmicort , formoterol , ipratropium , and regular nonsteroidal anti - inflammatory analgesia and tramadol for chest wall pain , along with omeprazole . she fulfilled all clinical criteria for the diagnosis of rads.1 a repeat of her tests was impossible due to her intractable coughing . however , she did undergo a bronchoscopy at our center , which showed the entire bronchial tree mucosa to be deeply erythematous with widespread petechial hemorrhage . due to the irritant effects of the disinfectants in the endoscopy suite , severe aggravation of her coughing occurred on her arrival , making the procedure very difficult , and precluding the chance of a biopsy . g / l ) without any other immune defect , and intravenous immunoglobulin ( vigam ) was given without benefit . antiviral drugs were tried followed by cotrimoxazole without benefit , with trials lasting several weeks . this appeared to increase her symptoms by 3 months , and at 4 months it was discontinued . this completed at least 12 months of trials with different treatments , without any hint of improvement . at this stage , the immunological properties of vitamin d were being reported , and we began a trial of high - dose oral vitamin d 2000 iu / day . vitamin d levels were requested , but her local hospital did not routinely perform this test . as a result , scientific data from osteoporosis research shows a rise of 810 nmol each month on a vitamin d dose of 1000 iu / day . this would suggest that our patient s vitamin d level was < 25 nmol / l , initially consistent with severe deficiency . history - taking confirmed no ingestion of oily fish and no sunlight exposure or sunbathing for many years . at the start of vitamin d therapy , her symptoms were severe with incessant cough and bronchial hyper - reactivity as described before , which made measurement of formal lung function difficult . her chest remained clear on physical examination , and she had a c - reactive protein of 0.2 and an immunoglobulin e of 9 ku / l . despite no other adjustment to her regular medication regime , she noticed an improvement in her symptoms once her 25-hydroxyvitamin d blood levels were > 100 initially the paroxysms of cough abated , followed by resolution of dyspnea on exertion at vitamin d levels > 150 nmol / l . we were then able to measure formal lung function tests reliably for the first time . her vitamin d levels took 6 months to rise to 200 nmol / l . at that point symptoms resolved , and weaning of nebulizers , steroids , nonsteroidal anti - inflammatory drugs , and other painkillers could commence , because chest wall pains due to incessant cough eased . figure 1 demonstrates her serum vitamin d levels , and highlights the symptomatic improvement and spirometry . at two years her lung function tests one year later are normal ( forced vital capacity 117% , vital capacity 100% , tlco ( transfer factor of the lung for carbon monoxide ) 97% , forced expiratory flow 25%75% 110% ) , apart from a residual volume of 182% of predicted which has remained unchanged on several repeat measurements . a recent methacholine test gave a pc20 of 32 mg / ml . high - dose vitamin d has been continued and blood levels have remained at 150200 nmol / l with normal calcium levels . there are no reported adverse effects of regular vitamin d at doses of up to 5000 iu / day . there were no side effects of the vitamin d , but oral preparations are known to have a mild laxative effect and increase skin oils that may cause spots . we all live or work in an increasingly chemical environment , where uncontrolled inhalational exposures to toxic materials could affect our respiratory system acutely . the risk of toxic household cleaning products , paints , and resins may not be well recognized by the general public , unlike that in industry where risk assessments are paramount . rads is a condition which currently lacks clarity,2,18 with the main difficulties related to retrospective diagnosis of a condition following an unmeasured exposure to a respiratory irritant . animal models to establish the exact nature and natural history are still awaited , but should assist our understanding of whether this is an asthma variant or a different disease state . while the literature contains increasing numbers of reported cases from an expanding array of causal agents , it lacks any guidance on effective treatment , especially for those patients with ongoing symptoms who have a very poor quality of life . the effects of vitamin d as a hormone have gained attention in the literature over the last 23 years . vitamin d appears to have regulatory effects on every part of the immune system , with vitamin d deficiency being linked to an array of immunologically based diseases.19 because vitamin d promotes steroid sensitivity in the body and can downregulate an inflammatory state via gene expression and cytokine production , its action in this case could be directly on the airway . vitamin d receptors are present in the airways and are thought to inhibit proinflammatory cytokines , with effects on cd4 + t cells , interleukin-2 , interferon - gamma , and macrophages.20,21 a deficiency of vitamin d could be associated with an inability to switch off the inflammatory state , following an acute inhalational insult , with upregulation of prostaglandin , leukotrienes , macrophages , and t cell activity and recruitment . vitamin d receptor polymorphisms are gaining attention as a cause of vitamin d insensitivity in respiratory diseases , which can be overcome by high doses . in our case , vitamin d deficiency was present because optimal blood levels should be > 75 nmol / l . we had no histological biopsies from our case , but considered her to fulfill all criteria for rads . this case presented a difficult management problem , and was refractory to all conventional treatments , with devastating effects on employment . the responses to vitamin d were slow and progressive , and effects appeared optimal when blood levels were > 150 nmol / l . these observations would support a trial of high - dose oral vitamin d in similar cases of rads refractory to asthma treatment . if this experience is repeated , it may assist our understanding of the condition and possible disease mechanisms , via the anti - inflammatory effects of vitamin d , and offer a treatment .
reactive airways dysfunction syndrome is a controversial and poorly understood condition produced by inhalational injury from gas , vapors , or fumes . the symptoms mimic asthma , but appear unresponsive to asthma treatments . if symptoms persist for more than 6 months , there is a risk that they can become chronic . for these cases , effective treatments are lacking and quality of life is poor . we describe the first use of high - dose vitamin d in a patient with this condition , who fulfilled the 1995 american college of chest physicians criteria for this syndrome . the patient we describe presented an extremely difficult management problem and was refractory to conventional treatments , but responded to high - dose oral vitamin d supplements .
the dentigerous cyst is the most common type of noninflammatory odontogenic cyst and the most common cause of a pericoronal area of lucency associated with an impacted tooth . the dentigerous cyst develops around an unerupted tooth by accumulation of fluid between the reduced enamel epithelium and the enamel . it has been suggested that the pressure exerted by a potentially erupting tooth on an impacted follicle obstructs the venous outflow and there by induces rapid transudation of serum capillary walls . the increased hydrostatic pressure of this pooling fluid separates the follicle from the crown with or without reduced enamel epithelium . dentigerous cysts by far the most common lesion that often exhibits marked displacement of the unerupted tooth within the jaw . with the pressure of enlarging cyst , the unerupted tooth can be pushed away from its direction of eruption . here , we present a rare case report of a dentigerous cyst in an 80-year - old male in the anterior mandible crossing the midline . this rare case is reported because of its unusual presentation at such a location , its occurrence at this age and most importantly it is unique case because it is a single dentigerous cyst crossing midline , which is not reported in any of the literature available . an 80-year - old man , reported to the department of oral medicine and radiology with the chief complaint of pus discharge from the left lower front region of face since 2 years . extra - oral view showing fibrosed sinus opening in the parasymphyseal region in the lower border of the mandible on examination , extra - orally a fibrosed sinus opening was present on the left parasymphyseal region . on palpation , sinus opening was non - tender and fixed to the underlying bone with no frank discharge but a single , non - tender , movable left submandibular lymph node was palpable . root stump in relation to 17 , 21 , 22 , 27 , 46 were present and 26 , 34 , 35 , 43 were missing . iopa in relation to 35 , 36 , 37 revealed radiolucency in the periapical region of 36 not contacting the teeth . mandibular cross - sectional occlusal radiograph showed diffuse radiolucency extending from 34 to 44 region , latero - medially and from periapex to lower border of mandible superior - inferiorly . mandibular cross - sectional radiograph revealing radiolucent area from 34 to 44 region latero - medially and from periapex to lower border of mandible superior - inferiorly opg showed a unilocular well - defined radiolucency extending lateromedially from the distal root of 36 to the mesial root of 47 and superior - inferiorly from the furcation area of the teeth to the lower border of the mandible . a well - defined radio - opacity is seen at the lower border of the mandible on the right side in the periapex of 44 , which was identified as impacted canine ( 43 ) [ figure 3 ] . opg showing a unilocular well defined radiolucency with scalloped margins associated with impacted canine on the basis of history , clinical and radiological examination , a provisional diagnosis of odontogenic keratocyst was given . enucleation of the cyst with chemical cauterization was done conserving the impacted canine to avoid fracture of lower border of the mandible . histopathological examination revealed cystic epithelium comprising of 2 - 3 layers of non - keratinized stratified squamous epithelium . photomicrograph revealed-3 layers of non - keratinized stratified squamous epithelium with fibrous connective tissue and inflammatory cell infiltrate healing was uneventful and 1 week after the surgery , the surgical site showed good healing and the sutures were removed . the patient was recalled for follow - up every week and iodoform dressing was given . the post - operative opg taken after 2 weeks revealed healing by secondary intention [ figure 5 ] . iopa in relation to 35 , 36 , 37 revealed radiolucency in the periapical region of 36 not contacting the teeth . mandibular cross - sectional occlusal radiograph showed diffuse radiolucency extending from 34 to 44 region , latero - medially and from periapex to lower border of mandible superior - inferiorly . mandibular cross - sectional radiograph revealing radiolucent area from 34 to 44 region latero - medially and from periapex to lower border of mandible superior - inferiorly opg showed a unilocular well - defined radiolucency extending lateromedially from the distal root of 36 to the mesial root of 47 and superior - inferiorly from the furcation area of the teeth to the lower border of the mandible . a well - defined radio - opacity is seen at the lower border of the mandible on the right side in the periapex of 44 , which was identified as impacted canine ( 43 ) [ figure 3 ] . opg showing a unilocular well defined radiolucency with scalloped margins associated with impacted canine on the basis of history , clinical and radiological examination , a provisional diagnosis of odontogenic keratocyst was given . enucleation of the cyst with chemical cauterization was done conserving the impacted canine to avoid fracture of lower border of the mandible . histopathological examination revealed cystic epithelium comprising of 2 - 3 layers of non - keratinized stratified squamous epithelium . photomicrograph revealed-3 layers of non - keratinized stratified squamous epithelium with fibrous connective tissue and inflammatory cell infiltrate healing was uneventful and 1 week after the surgery , the surgical site showed good healing and the sutures were removed . the patient was recalled for follow - up every week and iodoform dressing was given . the post - operative opg taken after 2 weeks revealed healing by secondary intention [ figure 5 ] . dentigerous cyst accounts for more than 24% of jaw cysts and it is the most common developmental cyst of oral region . the dentigerous cyst occurs most commonly in second and third decade . koseoglu et al . in their study , stated that dentigerous cysts occur over a wide age range age from 15 years to 65 years . as evident from literature dentigerous cyst is twice as often in males than females and is 10 times more likely to occur in the lower - jaw than in the upper - jaw . the present case seems to support the age and sex pre - dilection given by other authors . a study reported by mourshed state that 1.44 per cent of impacted teeth may undergo dentigerous cyst transformation . as was found in our case report . stated that dentigerous cysts are frequently associated with impacted teeth and its occurrence in association with canines is frequent as the canines are the commonly impacted anterior teeth as was found in our case report . there is no evidence of dentigerous cyst crossing the midline in the literature in various search engines like medline , cochrane and pubmed apart from a case report by gonzalez et al . ( 2011 ) who reported a dentigerous cyst encompassing the right and left impacted mandibular canines and crossing the midline . hence , we are reporting this case , which is unique in its own kind as dentigerous cyst has never been found to cross midline . this will be a great break - through in the classification of midline crossing cysts . the authors also stated that as dentigerous cyst enlarges , it displaces the affected tooth or teeth apically , which was found in accordance to our case report . this new case presentation shows that a dentigerous cyst might also cross the midline . as dentigerous cysts are asymptomatic , they can attain considerable size without the notice of the patient and this warrants an early clinical and radiographic detection of the cyst so that early treatment strategies will prevent or decrease the morbidity associated with the same .
dentigerous cyst is a developmental odontogenic cyst , which develops by accumulation of fluid between reduced enamel epithelium and the tooth crown of an unerupted tooth . dentigerous cysts are usually solitary , slow growing , asymptomatic lesions that are incidentally found during routine radiographs they most frequently involve the mandibular third molar followed in order of frequency by the maxillary canine , mandibular second pre - molar and maxillary third molar . occasionally , these cysts become painful when infected causing swelling and erythema . the cyst is usually small , however , when large , results in the expansion and thinning of the cortex leading to pathological fracture . radiographic features are specific to the lesion characterized by a well - defined radiolucency circumscribed by a sclerotic border , associated with the crown of an impacted or unerupted tooth . dentigerous cysts are treated most commonly by enucleation , marsupialization and decompression of cyst by fenestration . the criteria for selecting the treatment modality is based on the age , size , location , stage of root development , position of the involved tooth and relation of the lesion to the adjacent tooth and vital structure . the prognosis is an excellent when the cyst is enucleated and recurrence is rare . in this article , we present a case of a dentigerous cyst in an 80-year - old man in the anterior aspect of the mandible enveloping an impacted canine and crossing the midline but with no clinical expansion or discomfort .
mucosal infections by candida albicans and related non - albicans candida species are some of the most frequently encountered infections in modern medicine . oral thrush and vulvovaginal candidiasis ( vvc ) amass the largest numbers of incidences among mucocutaneous candida infections . while most forms of candidiasis affect immunocompromised individuals , vvc is commonly encountered by millions of otherwise healthy women . estimates on the occurrence of vvc point to at least one episode of vvc in 75% of all women [ 13 ] . clinical signs of vaginitis appear when the balance between the host and fungal colonization is disrupted , for example , by antibiotic suppression of beneficial components of the bacterial vaginal microbiota . of note , unlike bacterial vaginosis ( bv ) recurrent vvc , defined as at least four episodes in one year , affects a subpopulation , the treatment of whom requires long - term antifungal therapy . after bv , vvc is the second most common cause of vaginitis , affecting about 40% of women with vaginal complaints . in the usa , diagnosis and treatment of vvc and the concomitant loss of productivity was last estimated in 1995 to cost us$ 1.8 billion . while the treatment of vvc is relatively effective , it has been suggested that patients could benefit from restoration of the vaginal microbiota and/or modulation of the local mucosal immune response via supplementation with probiotics . furthermore , some non - albicans candida species are inherently more resistant to antifungal agents and therefore can pose a greater challenge to treatment . establishment of a healthy vaginal microbiota using beneficial lactobacillus strains might be a supportive and preventive measure against vvc . a recent randomized , double - blind and placebo - controlled trial by martinez and coworkers has shown that lactobacillus rhamnosus gr-1 and l. reuteri rc-14 increased the efficacy of antifungal agents in women diagnosed with vvc . in a related in vitro study it was also noted that these probiotics had the potential to inhibit c. albicans , the most common cause of vvc . in the present study , the objective was to learn more about the molecular mechanisms of c. albicans growth inhibition by the probiotic strains using microbiological and genome - wide expression analyses . the candida albicans and bacterial strains used in this study are listed in table 1 . stock cultures of all strains were stored at 80c with 15% v / v glycerol as cryopreservative . c. albicans was routinely grown in ypd media ( 10 g / l yeast extract , 20 g / l tryptone , and 20 g / l dextrose ) . for coculture assays , c. albicans was grown in the same media as lactobacilli and staphylococci , that is , difco lactobacilli mrs broth ( bd diagnostics , franklin lakes , nj , usa ) . regular agar plates contained 15 g / l agar ( fisher bioreagents , pittsburgh , pa , usa ) while 7 g / l of agar were used in soft agar overlays . bacteria - candida cocultures were incubated as indicated in a co2 incubator or in ambient air at 37c growth temperature . the effects of the presence of lactobacillus strains on the growth of c. albicans were determined in vitro on agar plates and in liquid cultures . the intestinal lactobacillus johnsonii strain pv016 and the non - lactic acid bacterium staphylococcus aureus atcc 25923 were used as controls . plate assays with deferred inoculation of c. albicans were performed on mrs or mrs - mops ( mrs medium buffered with 0.165 m 3-morpholinopropane-1-sulfonic acid to ph 7.0 ) media . for the plate overlay assays , overnight cultures of the bacteria were diluted to an od600 nm of 1 and 4 l of the dilution were spotted on mrs or mrs - mops agar plates . after incubation for 2 days at 37c in a co2 incubator , plates were overlayed with a c. albicans suspension ( od600 nm = 0.01 ) in mrs soft agar ( 0.7% agar ) that was prepared after cooling the autoclaved agar medium to 45c . following solidification of the soft agar overlay , plates were incubated for one day at 37c in normal aerobic atmosphere . overlay plates were inspected for clear zones with no c. albicans growth surrounding bacterial colonies capable of inhibiting growth of the fungi . disk diffusion assays were used to detect inhibition of c. albicans growth by lactic acid . briefly , 20 l of lactic acid dilutions were pipetted onto antibiotic assay disks ( diameter 6 mm , whatman , ge health care , piscataway , nj , usa ) and the disks were placed on mrs or mrs - mops agar plates inoculated for dense growth of c. albicans . clear zones around the disks after 24 hr incubation at 37c indicated fungal growth inhibition by lactic acid . viability of c. albicans cells during coculture with lactobacilli was qualitatively assessed using the fun 1 viability indicator ( live / dead yeast viability kit ; invitrogen , carlsbad , ca , usa ) and fluorescence microscopy . after a 24 hr incubation of c. albicans cells in mrs at 37c in presence or absence ( control ) of lactobacilli , cells were washed with gh buffer ( 10 mm na - hepes buffer ph 7.2 containing 2% glucose ) . fun 1 cell stain was diluted in the same buffer to a concentration of 5 m and the solution was added to the cells . following incubation for 30 min in the dark , a biorad mrc-1024 confocal laser scanning microscope was used to determine the metabolic activity of the yeast cells . excitation and emission filter sets for green and red fluorescence of fun 1 were used according to the manufacturer 's directions . intact metabolically active c. albicans cells converted the green - fluorescent intracellular fun 1 dye to red fluorescent intravacuolar structures . cells with little or no metabolic activity but still intact membranes just show diffuse cytoplasmic green fluorescence and no red intravacuolar bodies . in contrast , diffuse and extremely bright green - yellow fluorescence indicates dead cells . for semiquantitative assessment of fungal viability , the fun 1 viability assay was adapted for fluorometric measurement of metabolic activity according to the manufacturer 's recommendations . following overnight incubation of c. albicans cells ( starting od600 nm 0.1 ) in mrs with bacteria ( starting od600 nm 0.05 ) or in the presence of lactic acid , the viability of c. albicans cells was determined by kinetic readings of red ( excitation filter 485/20 , emission filter 590/35 ) and green ( excitation filter 485/20 , emission filter 528/20 ) fluorescence in a biotek synergy 2 multimode microplate reader ( biotek , winooski , vt , usa ) . for this purpose , aliquots from cultured cells were washed in gh buffer , adjusted to od600 nm 0.5 in 200 l gh + 5 m fun 1 and subsequently incubated for 1 hr in the microplate reader at 30c . red and green fluorescence readings were taken every 5 minutes and red / green ratios were determined to monitor the viability of fungal cells . an increase in the red / green ratio over time indicated the presence of the metabolic activity required for formation of the red fluorescent intravacuolar structures . bacteria did not convert the dye ( data not shown ) . for genome - wide transcriptional analysis of c. albicans challenged by the presence of lactobacilli , cocultures of both microorganisms were established in 6-well plates with thincert ( greiner bio - one , monroe , nc , usa ) inserts that kept both cell populations separated by a pet membrane with a pore - size of 0.45 m . fungal cells were inoculated in the lower compartment and pregrown for 6 hrs at 37c in 5% co2 atmosphere without shaking . lactobacilli were then inoculated in the thincert compartment and the cocultures were incubated up to 24 hrs total incubation time ( i.e. , 18 hrs in coculture ) . parallel c. albicans cultures without addition of lactobacilli served as controls . at various time points , the ph of the medium was measured and the cell density of both bacterial and fungal cells was determined by spectrophotometry at 600 nm . c. albicans cells were harvested and total rna was isolated using a fastprep fp120a instrument in conjunction with the fastrna pro red kit ( mp biomedicals , solon , oh , usa ) . isolated total rnas underwent further purification with the qiagen rneasy mini kit ( qiagen , valencia , ca , usa ) . integrity and concentration of the total rnas were determined by agarose gel electrophoresis and spectrophotometry , respectively . for preparation of affymetrix genechip ( affymetrix , santa clara , ca , usa ) hybridization targets , 50 ng of the highly - purified total rnas were used for cdna generation , ribo - spia amplification , and biotin - labeling using the nugen ovation biotin system ( nugen technologies inc . the resulting biotin - labeled single - stranded cdnas were used in c. albicans genechip hybridizations according to the manufacturers ' directions . the custom - made c. following hybridization in a genechip hybridization oven 640 and a genechip fluidics station 400 ( affymetrix ) , the microarrays were scanned using a genearray scanner ( hewlett - packard ) . the resulting image files were processed for absolute and comparative expression analysis using microarray suite 5.0 ( mas 5.0 ; affymetrix ) . global scaling to a target intensity of 500 was used to correct for variations between arrays . experimental data were stored in microdb 3.0 and analyzed in data mining tool 3.0 ( affymetrix ) as well as microsoft access . default parameters were used for the statistical algorithms implemented in mas 5.0 to calculate probe set signals , signal log ratios ( slr ) as well as detection and change p values . for determination of differential gene expression between lactobacillus - candida coculture experiments and candida - only controls , we also employed the snomad software for standardization and normalization of microarray data ( http://pevsnerlab.kennedykrieger.org/snomadinput.html ) . here , signals ( intensities ) of experiment - control sets are log - transformed and the log ratios are normalized by calculation of a local mean across the element signal intensities ( loess fit ) . furthermore , a local variance correction is applied and a z score is calculated for each probe set as a measure for differential expression . transcripts with z scores 3 were considered significantly increased and transcripts with z scores 3 were considered significantly decreased in comparative analyses . in order to group genes with similar regulation , cluster analyses were performed using the programs cluster and treeview . the rich mrs medium was chosen for these experiments because it supported vigorous growth by the lactobacillus , staphylococcus aureus , and c. albicans strains . agar overlays of c. albicans on mrs plates inoculated with the probiotic lactobacilli and control bacteria represented a relatively simple screening method for growth inhibitory activities of the bacteria towards this yeast . the deferred assay regimen with a 2-day preincubation of the bacteria was the method of choice because simultaneous inoculation often led to no or very small bacterial colonies due to rapid overgrowth by the fungal cells . albicans overlays revealed clearly visible zones of fungal growth inhibition around the lactobacillus gr-1 and rc-14 colonies ( see figure 1(a ) ) on mrs plates . very weak or no inhibition zones were found around the colonies of the control strains l. johnsonii pv016 and s. aureus atcc 25923 , respectively . pv016 was isolated by us from the prairie vole intestine and classified by molecular methods as l. johnsonii ( data not shown ) . this strain appears to have only limited anti - candida activity . despite the vigorous growth of the s. aureus strain on mrs , s. aureus is not considered a lactic acid bacterium and appears to produce only limited amounts of lactic acid under aerobic conditions . on buffered mrs - mops agar plates the clear areas around the probiotic lactobacilli were much smaller or absent . thus , the inhibitory activities of lactobacilli towards c. albicans appear to be decreased when the media is buffered with mops to an initial ph of 7.0 before inoculation . the formation of lactic acid and other organic acids by the growing probiotic lactobacilli is likely to cause a substantial decrease in the ph of unbuffered mrs . in comparison to the probiotics , the l. johnsonii and s. aureus control strains apparently were not able to produce sufficient acid or other metabolic products to inhibit the fungi . on the other hand , the control results suggest that potential glucose or other nutrient exhaustion around the bacterial colonies is not a likely cause for fungal growth inhibition in the overlay assay . c. albicans also produces acids during aerobic growth and can drastically reduce the ph of batch cultures in some media [ 16 , 17 ] . however , in an overnight culture of c. albicans grown in mrs at 37c , we observed a ph reduction to only ph 6.0 . in a disk diffusion assay with lactic acid , the potential inhibition of c. albicans growth by the acid clear zones around the disks were visible if the concentration of the acid was sufficiently high . however , performing the disk diffusion assay on mrs - mops revealed that buffering diminished the antifungal activity , similar to the overlay assays with bacteria . for a more detailed assessment of the acid tolerance of c. albicans in mrs broth , we conducted growth assays with mrs containing lactic acid at different ph levels ( not ph adjusted or adjusted to ph 7.0 and 4.5 ) , and mrs adjusted to ph 4.5 using hydrochloric acid ( figure 2 ) . the strongest growth inhibition was detected in mrs that contained lactic acid ( 120 mm ) with no ph adjustment . addition of 120 mm lactic acid to mrs resulted in an actual ph of 4.2 . the growth inhibitory effect of this high concentration of lactic acid was reduced by ph adjustment to 4.5 and completely abrogated by neutralization to ph 7.0 with sodium hydroxide . adjustment of the ph of mrs to 4.5 using hydrochloric acid led to intermediate growth reduction which was significantly lower than the reduction achieved by 120 mm lactic acid at ph 4.5 . these results indicate that c. albicans appears to be sensitive to low ph and lactic acid . in conjunction with acid stress , the increased concentration of membrane - permeable , undissociated lactic acid ( pka = 3.86 ) at low ph could have an inhibitory effect on the growth of the pathogenic yeast . undissociated lactic acid permeates the plasma membrane by diffusion and subsequently dissociates into protons ( h ) and lactic acid counterions . the charged ions are unable to cross the membrane bilayer , accumulate , and interfere with cell metabolism by acidification of the cytosol . inhibition of fungal growth through lactic acid production by lactobacilli might therefore be most efficient at low ph . growth inhibition assays using culture filtrates from l. rhamnosus gr-1 and l. reuteri rc-14 indeed revealed that c. albicans growth was suppressed at low ph by the bacterial culture supernatants . neutralization of the culture filtrates , however , completely abrogated the inhibitory effects of these supernatants ( figure 3 ) . while the contribution of additional antifungal compounds produced by the lactobacilli in inhibiting c. albicans is unknown at present , our results indicate that lactic acid at low ph plays a major role in keeping fungal growth in check . hydrogen peroxide production by l. reuteri rc-14 could be an additional anti - candida factor . in contrast to l. rhamnosus gr-1 , l. reuteri rc-14 produces h2o2 constitutively on mrs ( data not shown ) . however , the relatively high resistance of c. albicans to this potential growth inhibitor likely diminishes its efficacy . the growth assays conducted in this study did not show that l. reuteri rc-14 was more potent in inhibiting c. albicans , despite the strain 's ability to generate h2o2 . a microscopic approach was taken to visualize whether the probiotic lactobacilli are in fact able to kill the fungal cells . fun-1 live / dead staining following cocultures of the bacteria with c. albicans revealed that fungal cells lost metabolic activity in the presence of the lactobacilli and eventually were killed ( figure 4(a ) ) . semiquantitative analyses of c. albicans cell viability following exposure to low ph , lactic acid , and the bacterial strains used in this study revealed again that lactic acid at low ph and the probiotic strains gr-1 and rc-14 exert the most potent antifungal properties . the microplate - based assay system was used to determine cell viability by kinetic measurement of the intracellular conversion of the green fluorescent fun-1 dye to red fluorescent intravacuolar structures . only viable and metabolically active cells are able to carry out this conversion which can be monitored by determination of red / green fluorescence ratios in a fluorometer . figure 4(b ) shows the effect of mrs with lactic acid at ph 4.5 compared to mrs with hcl - adjusted ph 4.5 on c. albicans cell viability after overnight incubation . presence of lactic acid under these conditions appears to affect fungal cell viability substantially more than just the low ph . the efficacy of the probiotic strains gr-1 and rc-14 to compete with c. albicans growth is also confirmed by the fluorometric viability assay results shown in figure 4(c ) . both strains generated the flattest red / green ratio curves indicating the strongest antagonistic effects on the fungi in this assay system . l. johnsonii pv016 appeared to have an intermediate effect on fungal cell viability while s. aureus only produced a minor reduction in the conversion rate from green to red fluorescence when compared to the c. albicans control ( see figure 4(c ) ) . overall , these viability assay results provide strong evidence that the probiotics are not only competing for nutrients and have fungistatic properties under suitable conditions they can indeed exert fungicidal effects . the 0.45 m porous membrane was effective at separating the fungi from the lactobacilli cells ( see figure 5(a ) ) . using this approach , it was possible to isolate total fungal rna without contaminating bacterial rna . similar to previous experiments , presence of lactobacilli in the culture reduced c. albicans growth as determined by od600 nm measurements ( figure 5(b ) ) . despite physical separation of the microorganisms , the competition for nutrients and the presence of diffusible inhibiting substances ( e.g. , lactic acid ) produced by the lactobacilli led to fungal growth retardation . transcriptome analysis of c. albicans using custom - made candida affymetrix genechip expression arrays revealed that genes involved in lactic acid utilization were induced early in cocultures with lactobacilli in contrast to control cultures without the bacteria . table 2 lists genes that were differentially expressed in at least three of the seven coculture experiments . surprisingly , the lactate importer gene jen1 in c. albicans was not induced and remained at relatively low expression levels in all conditions tested . jen1 is reportedly induced on lactate as the sole carbon source , but subject to glucose repression . thus , presence of glucose ( mrs contains 2% glucose ) might have affected the lactate transporter expression at least in the early stage cocultures . interestingly , the related jen2 gene encoding a dicarboxylic acid transport protein was transiently induced in two experiments ( data not shown ) . whether increased acidification of the cytosol at later growth stages also suppressed the expression of the lactate / proton symporter gene jen1 is unknown . the upregulation of the l - lactate cytochrome - c oxidoreductase gene cyb2 ( orf19.5000 ) in two experiments in conjunction with the continued induction of the putative d - lactate dehydrogenase gene dld1 ( orf19.5805 , see table 2(a ) ) indicated that the fungal cells indeed metabolized lactate despite the lack of strong induction of lactate transporter genes . it remains to be determined whether additional transport systems facilitate the transport of lactic acid or whether undissociated lactic acid enters the fungal cell by simple diffusion . transcriptional profiling of the c. albicans cells during coculture with the probiotic lactobacilli also indicated that the fungal cells came under increased stress . the increased expression of stress - related genes ( e.g. , sis1 , tps3 , hsp78 , tpo3 , seo1 ) in progressed cocultures might signify that the fungal cells were challenged by acid production of the lactobacilli and the concomitant lowering of the ph . the mixed expression profile of the stress - related genes yhb1 and npr1 ( table 2(b ) ) might indicate transient induction of components of the stress response , however further studies are necessary for detailed analysis of stress responses induced by the lactobacilli . interesting aspects of the interaction of the microorganisms can also be gleaned from the list of downregulated genes ( see table 2(c ) ) : for example , ergosterol biosynthetic genes ( erg6 , erg11 , orf19.2016 ) were repressed . it remains to be elucidated , whether this repression was caused simply by growth retardation or specific interactions with products of the lactobacilli . the erg11 gene product lanosterol 14-alpha - demethylase is the target enzyme for fluconazole and other azoles [ 2123 ] . the cdr1 gene encoding an important drug efflux pump involved in fluconazole resistance [ 21 , 24 , 25 ] appears also on the list of genes with significantly lower expression ( table 2(c ) ) . in contrast , a related abc transporter gene , cdr4 , showed increased expression in the present study . cdr4 is not involved in fluconazole resistance , but appears to be induced in the core stress response of c. albicans [ 26 , 27 ] . thus , downregulation of the target enzyme erg11p and the drug efflux pump cdr1p could render the fungal cells more susceptible to the antifungal drug . these findings are especially interesting in light of recent results in a randomized , double - blind and placebo - controlled trial on the effect of l. rhamnosus gr-1 and l. reuteri rc-14 application in fluconazole - treated women with vulvovaginal candidiasis . production of lactic acid and other short - chain fatty acids by the lactobacilli leads to acidification of the surrounding microenvironment such as the vaginal ecosystem or an in vitro culture vessel . low ph favors the yeast form of c. albicans and inhibits the invasive hyphal form of these fungi [ 28 , 29 ] . the transcriptome analysis in this study confirmed at the gene expression level that the fungi were in an increasingly acidic environment . for example , acidic culture conditions were indicated in all cocultures by the observed repression of the cell wall beta-(1,3)-glucanosyltransferase encoded by the phr1 gene . this ph - responsive gene is only induced under high ph ( in vitro ph > 5.5 ) or conditions supporting hyphal growth of c. albicans [ 30 , 31 ] . interestingly , phr1/phr1 null mutants of c. albicans show defects in adhesion to abiotic and epithelial surfaces indicating that repression of this gene could affect biofilm formation of c. albicans . probiotic lactobacilli such as l. rhamnosus gr-1 are able to suppress biofilm formation of c. albicans on abiotic surfaces . this is presumably achieved by combining growth inhibition and repression of genes involved in biofilm formation ( e.g. , phr1 , als12 ; see table 2(c ) ) . the list of downregulated genes in the cocultures experiments also reflects the growth inhibitory effects of the lactobacilli . key genes involved in dna replication ( pol3 , pri2 ) , translation ( cef3 , rps23a , asc1 ) , glycolysis ( cdc19 ) , and gluconeogenesis ( pck1 ) are expressed at lower levels . overall , the exploratory c. albicans transcriptome analysis presented in this study has revealed first indications on the molecular mechanisms of probiotic interference instigated by l. rhamnosus gr-1 and l. reuteri rc-14 towards the opportunistic fungal pathogen c. albicans . elucidation of the specific inhibitory mechanisms employed by the probiotic strains will require further analysis . to this end , the development of continuous coculture systems mimicking the vaginal environment as close as possible in conjunction with genomic and proteomic analyses will further improve our understanding of the molecular basis of probiotic effects . the results of the present study confirm that the probiotic strains l. rhamnosus gr-1 and l. reuteri rc-14 are able to suppress the growth of vvc - causing c. albicans and can even kill the fungus . the probiotics were effective at low ph levels , similar to those found in a healthy vaginal environment .
candida albicans is the most important candida species causing vulvovaginal candidiasis ( vvc ) . vvc has significant medical and economical impact on women 's health and wellbeing . while current antifungal treatment is reasonably effective , supportive and preventive measures such as application of probiotics are required to reduce the incidence of vvc . we investigated the potential of the probiotics lactobacillus rhamnosus gr-1 and lactobacillus reuteri rc-14 towards control of c. albicans . in vitro experiments demonstrated that lactic acid at low ph plays a major role in suppressing fungal growth . viability staining following cocultures with lactobacilli revealed that c. albicans cells lost metabolic activity and eventually were killed . transcriptome analyses showed increased expression of stress - related genes and lower expression of genes involved in fluconazole resistance , which might explain the increased eradication of candida in a previous clinical study on conjoint probiotic therapy . our results provide insights on the impact of probiotics on c. albicans survival .
seizures lie among prevalent diseases of childhood and occur in 10% of children . in the emergency setting , the intravenous route is considered as the most suitable method , delivering adequate quantities of benzodiazepines in a short time . however , when intravenous administration is not available , other forms of benzodiazepine administration such as rectal diazepam or buccal midazolam may offer an alternative way of drug administration . benzodiazepines contain an imidazole ring which is highly water soluble and is rapidly absorbed from rectal , nasal , and buccal mucosa . the ring is also highly lipophilic at physiologic ph , a characteristic that facilitates its rapid effect on the central nervous system . a few studies have confirmed both efficacy and safety of buccal midazolam as well as rectal diazepam[610 ] . meanwhile , few studies have reported severe respiratory depression following buccal midazolam administration ; a fact that might have resulted from using high doses of the medication[6 , 8 ] . in the study conducted by thomas marshal , buccal midazolam was found effective in seizure attacks but it was mentioned that the medication was unlicensed for such a purpose . these findings shed light on the necessity to perform further studies to evaluate the efficacy and potential side effects of buccal midazolam . the purpose of this study was to determine whether buccal midazolam is efficient in control of convulsive episodes in children irrespective of the etiology of the seizure in comparison with intravenous diazepam , namely , the best accepted way of acute seizure episodes therapy[1 , 2 , 9 ] . this study was approved by the clinical ethics committee of shahid beheshti university of medical sciences . 271 children , aged 6 months to 14 years , admitted to the pediatric emergency ward of mofid children 's hospital due to seizure diagnosis between october 2007 and september 2008 . mofid children 's hospital has full - time medical and nursing staff on site . the inclusion criteria dictated that the patients needed to fulfill the following criteria : ( 1 ) documented seizure persisting at the time of administration of anticonvulsant ; ( 2 ) types of atonic , tonic and tonic - clonic seizures ; ( 3 ) seizure lasting for more than 5 min . the exclusion criteria were : ( 1 ) patients who received intravenous diazepam or other benzodiazepines within 24 hours prior to presentation of the seizure ; ( 2 ) previous history of narrow angle acute glaucoma ; ( 3 ) doubt about the historical information given by patient 's family . after history taking and physical examination , 46 patients had conditions that mimicked seizure like drugs side effects ( e.g. extrapyramidal movement due to metoclopramide ) , movement disorders ( like myoclonic jerks ) , etc . so , 92 children ( 51 boys , 41 girls ) were enrolled in the study ( fig 1 ) . flow diagram of patients consecutive patients were enrolled and were randomized to receive either buccal midazolam or intravenous diazepam . if the seizure was not controlled within five minutes of administration of buccal midazolam or intravenous diazepam , the second dose of the same drug was given to patient . in the event that the seizure remained uncontrolled within ten minutes after the first buccal midazolam or intravenous diazepam administration , either phenobarbital or phenytoin buccal midazolam ( epistatus , midazolam buccal liquid , and midazolam maleate ) was used with following doses : 2.5 mg for children aged 6 - 12 months , 5 mg for 1 - 4 years , 7.5 mg for 5 - 9 years , and 10 mg for 10 years or older . children received buccal midazolam by placing the syringe between their teeth and cheek , and after drug administration the cheek was gently massaged . intravenous diazepam was administered in a dosage of 0.3 mg / kg / dose and through an intravenous line as usual . all the nurses and doctors of the emergency ward were aware of the study and helped our team for administration of drugs as well as follow up of the patients and completing the information sheet . in case the patient fulfilled the inclusion criteria , an informed consent was provided after a parent or legal guardian was briefed about the study purpose and procedures . in the next step , the patient was randomly assigned into one of the two treatment groups , either buccal midazolam ( first group ) or intravenous diazepam ( second group ) . in order to record the underlying causes of convulsions , patient 's history , physical examination , and laboratory evaluations including determination of electrolytes and glucose were considered for all patients . heart rate , respiratory rate , blood pressure , and hemoglobin oxygen saturation were monitored continuously all through the procedure . during the seizure patients were followed up for 24 hours after drug administration . any side effects including apnea , hypotension , bradycardia , due to drug administration were also recorded . the duration of seizures before buccal midazolam or intravenous diazepam therapy was approximate , based on the history obtained from the patient 's attendants and other family members . for each patient , the time of noticing the first convulsion at the arrival in emergency , the time of administrating the drugs and the time of cessation of all motor seizure activity were recorded . the drug administration was considered as failed in case the convulsive motor activities did not stop within 10 minutes of administration . nobody was lost to follow up in both groups , because the results of intervention were recorded on site and all patients were admitted for at least 24 hours . every patient included in the study , was assigned by a number in series and the numbering was based upon differences between proportions were statically tested by chi - square or fisher 's exact test . all other numerical or quantitative comparisons were performed using student 's unpaired t - test . this study was approved by the clinical ethics committee of shahid beheshti university of medical sciences . 271 children , aged 6 months to 14 years , admitted to the pediatric emergency ward of mofid children 's hospital due to seizure diagnosis between october 2007 and september 2008 . mofid children 's hospital has full - time medical and nursing staff on site . the inclusion criteria dictated that the patients needed to fulfill the following criteria : ( 1 ) documented seizure persisting at the time of administration of anticonvulsant ; ( 2 ) types of atonic , tonic and tonic - clonic seizures ; ( 3 ) seizure lasting for more than 5 min . the exclusion criteria were : ( 1 ) patients who received intravenous diazepam or other benzodiazepines within 24 hours prior to presentation of the seizure ; ( 2 ) previous history of narrow angle acute glaucoma ; ( 3 ) doubt about the historical information given by patient 's family . after history taking and physical examination , 46 patients had conditions that mimicked seizure like drugs side effects ( e.g. extrapyramidal movement due to metoclopramide ) , movement disorders ( like myoclonic jerks ) , etc . so , 92 children ( 51 boys , 41 girls ) were enrolled in the study ( fig 1 ) . flow diagram of patients consecutive patients were enrolled and were randomized to receive either buccal midazolam or intravenous diazepam . if the seizure was not controlled within five minutes of administration of buccal midazolam or intravenous diazepam , the second dose of the same drug was given to patient . in the event that the seizure remained uncontrolled within ten minutes after the first buccal midazolam or intravenous diazepam administration , either phenobarbital or phenytoin was used as the second line antiepileptic . buccal midazolam ( epistatus , midazolam buccal liquid , and midazolam maleate ) was used with following doses : 2.5 mg for children aged 6 - 12 months , 5 mg for 1 - 4 years , 7.5 mg for 5 - 9 years , and 10 mg for 10 years or older . children received buccal midazolam by placing the syringe between their teeth and cheek , and after drug administration the cheek was gently massaged . intravenous diazepam was administered in a dosage of 0.3 mg / kg / dose and through an intravenous line as usual . all the nurses and doctors of the emergency ward were aware of the study and helped our team for administration of drugs as well as follow up of the patients and completing the information sheet . in case the patient fulfilled the inclusion criteria , an informed consent was provided after a parent or legal guardian was briefed about the study purpose and procedures . in the next step , the patient was randomly assigned into one of the two treatment groups , either buccal midazolam ( first group ) or intravenous diazepam ( second group ) . in order to record the underlying causes of convulsions , patient 's history , physical examination , and laboratory evaluations including determination of electrolytes and glucose were considered for all patients . heart rate , respiratory rate , blood pressure , and hemoglobin oxygen saturation were monitored continuously all through the procedure . during the seizure , oxygen was administered by nasal prongs . patients were followed up for 24 hours after drug administration . any side effects including apnea , hypotension , bradycardia , due to drug administration were also recorded . the duration of seizures before buccal midazolam or intravenous diazepam therapy was approximate , based on the history obtained from the patient 's attendants and other family members . for each patient , the time of noticing the first convulsion at the arrival in emergency , the time of administrating the drugs and the time of cessation of all motor seizure activity were recorded . the drug administration was considered as failed in case the convulsive motor activities did not stop within 10 minutes of administration . nobody was lost to follow up in both groups , because the results of intervention were recorded on site and all patients were admitted for at least 24 hours . every patient included in the study , was assigned by a number in series and the numbering was based upon table of random sampling for grouping them in case and control groups . differences between proportions were statically tested by chi - square or fisher 's exact test . all other numerical or quantitative comparisons were performed using student 's unpaired t - test . fifty - one ( 55.4% ) out of 92 participants were male and 41 ( 44.6% ) female . in the buccal midazolam group , 14 patients were male and 18 were female while in the intravenous diazepam group , 37 were male and 23 were female ( p=0.1 ) . the median age in buccal midazolam group was 18.410.3 and in the other group was 17.110.1 . 82% of patients age was equal or less than 24 months with mean weight of 10.62.73 kg ( 6 to 18 kg ) . twenty ( 21.8% ) patients had tonic seizure , 58 ( 63% ) had tonic - clonic seizures and others ( 15.2% ) had atonic seizure . in the buccal midazolam group , 9 patients had tonic seizures , 18 had tonic - clonic and 5 had atonic seizures . in intravenous diazepam group , 11 had tonc seizures , 40 had tonic - clonic and 9 had atonic seizures . there was no statistically significant difference in the seizure types between the two groups ( p=0.5 ) . the etiologies included idiopathic epilepsy 64 ( 70% ) , febrile seizure 9 ( 10% ) , and cryptogenic or symptomatic epilepsy 19 ( 20% ) . underlying disorders associated with the symptomatic or cryptogenic seizure episodes has been shown in table 1 . in our study , 32 ( 34.8% ) of patients received buccal midazolam and 60 ( 65.2% ) intravenous diazepam . comparison of the two treatment responses is illustrated in table 2 and fig 2 . in the first group , the first administration was effective in controlling the seizures in 13 ( 40% ) whereas in the second , seizures were completely controlled after the first dosage in 24 ( 40% ) ( p=0.9 ) . overall , 22 ( 68.7% ) of the patients in the first group were relieved from seizures after the first or the second dosage whereas the applied medication controlled seizures in 42 ( 70% ) patients of the second group ( p=0.9 ) . box and whisker plots of time from drug administration up to the end of seizure underlying disorders associated with the symptomatic or cryptogenic seizure episodes control of seizures and seizure control time in two groups significant adverse effects included agitation observed in 11 and 25 patients , and mild hypotension in 7 and 9 patients in the first and second group , respectively . in the second group , 4 patients experienced apnea ; there was no statistically significant difference in the side effects between the two groups ( agitation p=0.5 , hypotention p=0.4 , apnea p=0.2 ) . the mean time for medication effect was not significantly shorter with intravenous diazepam as compared to buccal midazolam ( p=0.09 ) , but the mean time for control of patients in the first or the second administration drug dose was significantly shorter with intravenous diazepam than with buccal midazolam ( fig . 2 and table 2 ) . according to our results , administration of intravenous diazepam or buccal midazolam resulted in cessation of convulsions similarly . the overall rate of response in both groups was similar and this suggests that buccal midazolam is effective in controlling acute convulsions of generalized tonic , tonic - clonic , or atonic type . so far there has been a few study comparing intravenous diazepam and buccal midazolam[4 , 13 ] . in that study the rate of controlled seizures was similar in both groups , but the overall frequency of control of convulsive episodes by buccal midazolam was 85% . in ashrafi 's et al study , midazolam ceased all of the seizures with 5 min and diazepam ceased 82% of patient 's seizures with 5 min of drug administration . in another study from iran javadzadeh et al showed the time needed to control seizure by intranasal midazolam was shorter than intravenous diazepam . in other researches such as our study , efficacy of buccal midazolam was confirmed[3 , 5 , 810 ] . our results showed the time of seizure control in both groups of patients in the first five minutes or the second five minutes after administration of drugs was not significantly different . in the previous study , the results of the mean time for controlled seizure in the two groups was similar to our study , and the time for seizure cessation with intravenous diazepam was less than buccal midazolam . in another study , mean time for seizure cessation with buccal midazolam was reported to be 3.892.22 minutes . these differences of overall control and the time required to complete the control should be subject to further investigation . there is increasing evidence that the longer seizures persist , the more difficult they will be to stop . a previous study showed that first line therapy stopped seizures in 80% of patients when administered within 2 hours after the onset of the seizures , but less than 40% of patients were controlled if the treatment started after 2 hours . the results of the present study manifest that buccal midazolam efficacy is similar to intravenous diazepam for seizure cessation and because buccal midazolam administration is very easy and fast , it can prevent status epilepticus . so far , no serious adverse effects have been reported in most cases of buccal midazolam administration[4 , 7 , 15 , 16 ] , but in some of the studies respiratory depression has been observed[6 , 8 ] . probably , this complication is a result of high dosage of buccal midazolam ( 0.5 mg / kg / dose ) . administration of buccal midazolam with a dose of 0.3 mg / kg / dose does not seem to cause side effects . in our study , respiratory depression with buccal midazolam was not seen ; some patients experienced mild hypotension and agitation whereas patients who took intravenous diazepam showed respiratory depression , mild hypotension , and agitation . this study was not blinded and placebo was not administered , although placebo administration in these situations may not be ethical . another limitation of our study was small numbers of patients , so we suggest this study must be repeated with more patients . our results suggest that buccal midazolam at a dose of 0.3 mg / kg may be as effective as intravenous diazepam for the treatment of acute convulsive seizures in children and it is safer than intravenous diazepam , so buccal midazolam can be used at home very easy , safe and effective .
objectivethe purpose of the present study is to compare efficacy and safety of buccal midazolam with intravenous diazepam in control of seizures in iranian children.methodsthis is a randomized clinical trial . 92 patients with acute seizures , ranging from 6 months to 14 years were randomly assigned to receive either buccal midazolam ( 32 cases ) or intravenous diazepam ( 60 cases ) at the emergency department of a children 's hospital . the primary outcome of this study was cessation of visible seizure activity within 5 minutes from administration of the first dosage . the second dosage was used in case the seizure remained uncontrolled 5 minutes after the first one.findingsin the midazolam group , 22 ( 68.8% ) patients were relieved from seizures in 10 minutes . meanwhile , diazepam controlled the episodes of 42 ( 70% ) patients within 10 minutes . the difference was , however , not statistically significant ( p=0.9 ) . the mean time required to control the convulsive episodes after administration of medications was not statistically significant ( p=0.09 ) . no significant side effects were observed in either group . nevertheless , the risk of respiratory failure in intravenous diazepam is greater than in buccal midazolam.conclusionbuccal midazolam is as effective as and safer than intravenous diazepam in control of seizures .
a 49-year - old , nonsmoking female had been treated for aml with one course of induction chemotherapy with the use of daunorubicin and cytosine arabinoside ( ara - c ) . after relapse of aml , the patient was treated with 10 mg / m iv mitoxantrone daily for six days and 3 g / m iv ara - c , daily for six days . on day six , flu - like symptoms including fever and cough developed after completion of the chemotherapy . on examination , the patient had an elevated temperature ( 38.5 ) and tachypnea . the results of arterial blood gas analysis in room air were as follows : pao2 92 mmhg , paco2 30 mmhg and ph , 7.37 . the results of a laboratory evaluation were as follows : hemoglobin level , 104 g / l ; platelet count , 140,000/l ; white blood cell count , 11,100/l . the level of c - reactive protein and the erythrocyte sedimentation rate did not increase . fiberoptic bronchoscopy showed patent airways and the bronchoalveolar lavage ( bal ) fluid was non - diagnostic . culture and microscopy of sputum and bal materials were negative for fungi , bacteria , acid - fast bacilli , pneumocystis carinii and cytomegalovirus . empirical antibiotic therapy was initiated for a case of presumed pneumonia . over the next few days , fever and cough persisted in spite of the antibiotic treatment . on day 11 , twenty hours later , a chest computed tomography ( ct ) scan confirmed the presence of numerous discrete 1-mm to 5-mm nodules throughout the lungs ( fig . 1b , c ) . due to the poor response to the antibiotic treatment and the questionable diagnosis of pulmonary metastases , a video - assisted thoracoscopic lung biopsy with wedge resection of the posterior segment of the right upper lobe was performed on day 13 . histopathological analysis revealed that polypoid granulation tissue was filling the air spaces and foamy macrophages and inflammatory cells with interstitial pneumonia and air - space fibrosis were present , consistent with cop ( fig . 1d , e ) . dramatic improvement of the clinical symptoms and radiographic abnormalities was noted after two weeks of appropriate steroid treatment ( fig . 1f ) , and the lesions were almost completely resolved after three weeks ( fig . 1 g ) . at a follow - up visit one month after discharge , the patient remained asymptomatic and chest radiograph showed a stable appearance . cryptogenic organizing pneumonia is a distinct clinicopathological entity characterized by a subacute illness with shortness of breath , fever , cough , malaise and patchy peripheral air - space infiltrates as depicted on chest radiographs ( 1 ) . the disease is defined histopathologically as granulation tissue plugs within the lumina of small airways , alveolar ducts and alveoli ( 2 ) . most cases are idiopathic and may be secondary to infections , a hematological malignancy , connective tissue disorders , drug administration , exposure to radiation or bone marrow or lung transplantation ( 2 , 3 ) . cryptogenic organizing pneumonia has a variable radiologic appearance and is usually characterized by unilateral or bilateral areas of patchy air - space consolidation with a subpleural and peribronchial distribution ( 1 , 2 ) . in a review of 14 patients with cop , mller and colleagues ( 4 ) found no single finding or combination of findings that could be considered diagnostic of this disease . the presentation of a patient with diffuse discrete 1-mm to 5-mm pulmonary nodules associated with cop is uncommon . correlation of the high - resolution ct abnormalities with the findings on video - assisted thoracoscopic biopsy suggest that the nodules seen on ct corresponded to localized areas of organizing pneumonia around the bronchiolitis obliterans . this pattern of lesions is separated from other involved bronchioles by a zone of relatively normal parenchyma , explaining the nodular appearance . the findings differ from the patchy or confluent nodular infiltrations usually associated with cop ( 5 , 6 ) . the clinical presentation in this case differs from that of neoplastic diseases , however , due to the rapid progression to diffuse nodules over a few days . furthermore , multiple nodules are not always a sign of malignant disease , and benign lesions such as tuberculosis and fungal and parasitic infections should be considered in the differential diagnosis . definitive differentiation of cop from infectious diseases by imaging studies , however , is usually not possible . the absence of microorganisms in cultures of blood , sputum , and bal fluid and the failure of empirical antibiotic treatment ruled out active infection at the onset of pulmonary symptoms in our patient . the factors responsible for cop in this case remain unclear but may include a direct immunologic reaction resulting from a possible subclinical viral infection , a toxic reaction to the chemotherapeutic agents and underlying hematological disease . however , whatever the etiology of cop in this case , the clinical symptoms and pulmonary lesions dramatically improved as the patient was responsive to steroid therapy . further , early diagnosis prevented the patient from having rapidly progressive cop that is a deadly form of the disease and can occur in a small percentage of patients ( 7 ) . as pointed out in previous studies , benign pulmonary nodules in patients with an underlying malignancy have occasionally been seen in the setting of allogeneic bone marrow transplantation ( 8) or in chemotherapeutic drug toxicity ( 9 ) . in our patient , the question of drug - induced cop arises as bone marrow transplantation was not performed and the clinical and radiological manifestations of pulmonary lesions developed after chemotherapy . our patient , however , was not given bleomycin , which has been associated with nodular cop mimicking pulmonary metastases ( 10 ) . the association between the administration of high - dose intravenous ara - c and lung toxicity is well recognized , and battistini et al . ( 11 ) reported the development of cop in three children with acute leukemia who received a combination of high - dose ara - c and anthracyclines , which is similar to the regimen that was followed by our patient . therefore , although undetectable infectious agents may be etiologic factors , chemotherapeutic toxicity can be presumed . in conclusion , our patient had an unusual radiological pattern of diffuse discrete pulmonary nodules associated with cop that mimicked pulmonary metastases . the development of new pulmonary symptoms accompanied by a radiological manifestation of diffuse pulmonary nodules in cancer patients during chemotherapy should prompt consideration of this diagnosis so that appropriate steroid treatment can be initiated .
the radiological appearance of diffuse discrete pulmonary nodules associated with cryptogenic organizing pneumonia ( cop ) has been rarely described . we describe a case of cop in 49-year - old woman with acute myeloid leukemia who developed diffuse pulmonary nodules during the second course of induction chemotherapy . the clinical status of the patient and imaging findings suggested the presence of a pulmonary metastasis or infectious disease . a video - assisted thoracoscopic lung biopsy resulted in the unexpected diagnosis of cop as an isolated entity . steroid therapy led to dramatic improvement of the clinical symptoms and the pulmonary lesions .
although a richly vascularized organ with important circulatory communications , the penis is seldom the site of metastases . since eberth first reported it in 1870 there have been approximately 300 cases in the english language literature . the primary tumour sites are principally the genitourinary organs , mainly the bladder and prostate gland . only in 15.7% metastatic disease isolated to the penis and amenable to potentially curative treatment is very uncommon [ 13 ] . this is the first case of isolated penile metastasis following abdominoperineal resection ( aper ) with perineal vertical rectus abdominis myocutaneous ( vram ) flap reconstruction . a 58-year - old gentleman presented with diarrhoea . digital rectal examination revealed a low anterior rectal tumour , 3 cm from the anal verge . due to his frequency he underwent laparoscopic defunctioning colostomy prior to neoadjuvant long course chemoradiation in the aristotle trial . restaging showed a modest response to treatment with the crm still predicted positive ( figs 1 and 2 ) . at 9 weeks post radiotherapy he underwent an open difficult aper t2 waited axial image through lower pelvis through the large polypoid rectal tumour with t3 extension involving the crm . t2 axial image through pelvis demonstrating limited response to chemoradiotherapy with tumoral margins still predicted positive . mri pelvis . t2 waited axial image through lower pelvis through the large polypoid rectal tumour with t3 extension involving the crm . t2 axial image through pelvis demonstrating limited response to chemoradiotherapy with tumoral margins still predicted positive . at 18 months post - surgery he presented with an otherwise asymptomatic mass on the lateral aspect of his penile shaft . restaging with ct and mri confirmed an isolated 2.7 cm 6.2 cm lesion in the midshaft involving the corpora cavernosum with extension into the corpus spongiosum . histopathology confirmed metastatic rectal adenocarcinoma with clear resection margins though extensive lympho - vascular and perineural involvement . currently , the patient is clinically doing well , with a reasonable quality of life with his urethrostomy and under close clinical follow up . figure 3:mri pelvis large field t2 sagittal image through penile shaft showing the lesion involving the corpora cavernosum with extension in the spongiosum . mri pelvis large field t2 sagittal image through penile shaft showing the lesion involving the corpora cavernosum with extension in the spongiosum . it is still a controversial subject the reason why the penis , despite its vascularization is a rare site for metastasis . it has been postulated that the route of metastasis include retrograde venous or lymphatic spread , local direct extension , arterial embolism or instrumental spread [ 1 , 2 , 4 ] . currently the most accepted theory is the mechanism that involves retrograde venous spread from pudendal to the dorsal venous system of the penis [ 2 , 4 ] . the most common type of presentation is malignant priapism followed by urinary retention , penile nodules , ulceration , perineal pain , oedema , infiltrative enlargement , dysuria and haematuria , with the corpora cavernosa being the most common site of metastasis and the glans and corpus spongiosum infrequently involved . our case respected the above mentioned cavernosal involvement but also had mild extension into the corpus spongiosum , more to the fact that this isolated metastatic penile neoplasm is extremely rare . management of penile metastasis is mainly palliative as this is a sign of poor prognosis and tends to be part of widely disseminated disease . treatment plan is influenced by the size of the primary , extent of the metastatic spread , performance status of patient and also prognostic characteristics of the primary tumour [ 2 , 5 ] . treatment modalities include the combination of radiotherapy with chemotherapy , local excision and penectomy [ 2 , 4 ] . in isolated disease , as described in this case , penectomy may offer the possibility of cure although such cases are very rare . in conclusion , this is a case report of penile metastasis following rectal adenocarcinoma , being the first one described in a patient that had aper with vram flap reconstruction . this report highlights the rarity of the penis as site of metastasis and marker of disseminated disease , however this is not the case in our report and albeit rare , cure can be achieved in isolated cases .
penile metastases are rare in colorectal cancer . we report the first case of such a recurrence in a patient who had undergone an extralevator abdominoperineal resection with vertical rectus abdominis myocutaneous flap perineal reconstruction . the patient was treated with curative intent by total penectomy .
as the demand for adult orthodontic treatment increases and the popularity of esthetic dentistry expands , orthodontists are more likely faced with the problem of placing orthodontic appliances on teeth restored with resin and porcelain fixed prostheses or veneer laminates . when esthetics is a concern , orthodontists will have to depend on the direct bonding technique . numerous methods and materials have been suggested for bonding to ceramic restorations [ 17 ] . the conventional method for optimal bonding of brackets and retainer wires to ceramic surfaces is application of hydrofluoric ( hf ) acid for etching the ceramic surface , because phosphoric acid etching , which is used for the enamel , is ineffective in the preparation of ceramic surfaces for mechanical retention of orthodontic attachments [ 810 ] . however , the in vivo use of hf acid is too hazardous . mucosal or skin contact with hf acid can cause erythema and burning associated with loss of tissue along with intense pain for several days . the purpose of this study was to evaluate tensile bond strength between metal brackets and non - glazed ceramic surfaces with three different surface treatments to evaluate application of phosphoric acid instead of hf acid . we evaluated the non - glazed ceramic surfaces because clinicians sometimes remove the glaze layer of porcelain restorations by a low speed bur in the oral cavity and then apply phosphoric acid instead of hf . forty - two non - glazed , feldspathic porcelain disks , 2.0 mm thick and 8.0 mm in diameter , were used . the disks were fabricated from super porcelain ex-3 body ( noritake , japan ) using a handmade mold . the specimens were washed with water , dried with air , and then divided into three equal groups randomly . in groups i , and ii ; 9.5% hf acid gel ( ultradent , usa ) was applied for 2 minutes , then rinsed with water and dried with oil - free air . subsequently , in group i , a layer of silane ( scotchbond ceramic primer , 3 m unitek , usa ) was applied and dried with light oil - free air spray . then a layer of scotchbond multi purpose plus adhesive ( 3 m unitek , monrovia , calif . , usa ) was applied , thinned with air spray and cured with light ( 500 ) for 10 seconds . in group ii , after etching with 9.5% hf acid , only a layer of bonding agent ( unfilled resin , 3 m unitek , usa ) was used . in group iii , ceramic surfaces were treated with 35% phosphoric acid ( 3 m unitek , usa ) and then silane and adhesive were applied similar to group i. metal brackets for maxillary central incisors ( dyna lock , std . edgewise 018 , 3m - unitek , usa ) were bonded to each conditioned ceramic surface with light - curing composite resin ( transbond xt , 3m - unitek , usa ) . excess composite was removed and then light cured for 40 seconds ( coltolux 75 , swiss ) with an intensity of 500 . the surface areas for the bases of brackets was 16.52 mm which were obtained bfrom the manufacturer . after bonding , all specimens were stored in a water bath in room temperature for 24 hours , then thermocycled 500 times between 5c and 55c with a dwelling time of 60 seconds . all specimens were partially embedded in acrylic resin using a hand - made jig , especially designed for this purpose ( fig 1 and 2 ) . zwick universal testing machine ( z/100 , germany ) was used to measure the tensile bond strength . the machine had an upper jaw that was mounted to a movable crosshead and a lower jaw mounted on the base . the tensile force at a crosshead speed of 0.5 mm / minute was transmitted to the bracket by a steel wire that was placed under the bracket wings . the force required for debonding was recorded and the tensile bond strength in megapascal ( mpa ) was determined from the load at failure and the area of bracket base . after debonding , the specimen surface was examined under magnification 2 to determine how much residual adhesive remained on the ceramic according to the following scale : 1=all the composite remained on the ceramic , 2=more than 90% of the composite remained on the ceramic , 3=more than 10% but less than 90% remained on the ceramic , 4=less than 10% remained on the ceramic , and 5=no composite remained on the ceramic . descriptive statistics including the mean , standard deviation , and minimum and maximum values were calculated for the three groups . then tensile bond strength data were subjected to one - way anova and tukey s hsd post hoc tests . the nonparametric kruskal - wallis test was used to compare the adhesive remnant index ( ari ) score for the three groups . four specimens in group i , three specimens in group ii , and two specimens in group iii did not have a measurement of tensile bond strength because of the operator s mistake . the difference of tensile bond strength between groups i , and iii was not significant ( p=0.999 ) . however , the tensile bond strength of group ii was significantly lower than groups i , and iii ( p<0.001 ) . the ari scores show that in group i specimens , all the composite remained on the ceramic . in group ii , 63.7% of the specimens had an ari higher than 4 , meaning that less than 10% of the composite remained on the ceramic . in group iii , more than half of the specimens had an ari lower than 2 ( i.e. more than 90% of the composite remained on the ceramic ) . the direct bonding of orthodontic attachments has revolutionized and improved the clinical practice of orthodontics . more recently bonding materials have been introduced for bonding to ceramic . however , before clinical experiments , these materials should be evaluated in vitro to find which products and materials seem most valuable to include in supplementary clinical evaluation . although both shear and tensile loading modes are valid tests for studying bond strengths of orthodontic materials , choosing the tensile bond strength test as the more frequently used shear bond strength test needs some explanation . in order to allow the calculation of the true interfacial failure stress , the experiment should be designed so that a uniform stress distribution is created across the interface . production of complex stress distribution in the shear bond strength test may start fracture at sites with high concentration of local stress ; therefore , the adhesive characteristics of the bonded interface are not expressed . the tensile bond strength test used in this study provides a specimen design with a stress distribution across the interface as near to uniform as possible . we used long thin wires under the bracket wings , as suggested by katone and chan . the relatively slow crosshead speed used for bond strength in this study moreover , viscoelastic behavior that is absent in vivo may occur at low strain rates for the adhesive which may be an important area for future investigation . newman stated that 14 kg / cm2 ( 1.5 mpa ) was the maximum force that could be applied to a tooth by an orthodontic appliance . the tensile bond strength in our study exceeded this value greatly , but were still less than reynold s value ( 50 kg / cm5 mpa ) recommended for in vivo success . group i and iii had the closest results to this value with a mean of 3.91 mpa and 3.90 mpa , respectively . olsen et al evaluated shear bond strength between metal brackets and enamel using scotch bond multipurpose adhesive , 37% phosphoric acid and 10% maleic acid . their results were 13.1 mpa ( sd=4.8 ) for phosphoric acid and 10.3 mpa ( sd=3.1 ) for maleic acid . moreover , it is proved in orthodontics that shear bond strength is higher than tensile bond strength [ 2022 ] . thurmond et al found significantly lower shear bond strength with application of phosphoric acid plus silane on ceramic than with hf acid plus silane ( p<0.001 ) , but saygili and sahmali reported that acid etching of the surfaces with hf acid had a weak tendency to improve bond strength . aida et al showed that acid etching of porcelain with hf acid could be eliminated . our finding showed no statistical difference between application of hf acid with scotch bond multipurpose plus adhesive and phosphoric acid with scotch bond multipurpose plus adhesive on non - glazed ceramic ( p=0.999 ) . major et al showed that the site of failure at low bond strength tended to be at the porcelain - adhesive interface . when the bond strengths became greater , the chemical retention was equal or exceeded the mechanical retention provided by the bracket base . therefore , increased bond strengths resulted in failure at the bracket - adhesive interface or a cohesive failure within the composite resin in a way that some composite was left on both the bracket and the porcelain surfaces . in our study , in group i , 100% of the specimens and in group iii , 60% of the specimens had more than 90% composite remaining on the ceramic . however , in group ii , which had a lower bond strength ( 2.70 mpa ) , about 60% of the specimens had less than 10% composite remaining on the ceramic . the tensile bond strength to ceramic surface reported by cochran et al , kocadereli et al and harari et al using the same method were higher than our results . but it should be noted that they did not thermocycle their specimens and they also used different material . eustaquio et al reported a tensile bond strength of bonding brackets to deglazed ceramic using conocise / scotch prime ( 3 m ) comparable with groups i and iii of our study . overall , these differences may be due to variables such as the type of bond strength test , ceramic , adhesive , brackets , storage environment and presence or absence of thermocycling . in some researches , the specimens were stored in 37 degrees and in others ; they were kept in room temperature . we used the second method . regarding the effect of phosphoric acid on porcelain , the results of studies are mixed and confusing . while some researches show that this acid does not have a considerable effect on the porcelain surface [ 810 ] , others show that this effect is clinically acceptable [ 3335 ] . our results showed that by using scotch bond multipurpose plus adhesive on non - glazed ceramic we can use phosphoric acid for treating the ceramic surface instead of hf acid gaining a statistically not different tensile bond strength and also preventing hazard for the oral tissue , skin and the respiratory system .
objective : the aim of this study was to evaluate the bond strength between metal brackets and non - glazed ceramic with three different surface treatment methods.materials and methods : forty - two non - glazed ceramic disks were assigned into three groups . group i and ii specimens were etched with 9.5% hydrofluoric acid . subsequently in group i , silane and adhesive were applied and in group ii , bonding agent was used only . in group iii , specimens were treated with 35% phosphoric acid and then silane and adhesive were applied . brackets were bonded with light - cured composites . the specimens were stored in water in room temperature for 24 hours and then thermocycled 500 times between 5c and 55c.results:the difference of tensile bond strength between groups i and iii was not significant ( p=0.999 ) . however , the tensile bond strength of group ii was significantly lower than groups i , and iii ( p<0.001 ) . the adhesive remnant index scores between the three groups had statistically significant differences ( p<0.001).conclusion : with the application of scotch bond multi - purpose plus adhesive , we can use phosphoric acid instead of hydrofluoric acid for bonding brackets to non - glazed ceramic restorations .
tissue specimens were sent to the national reference center ( marseilles , france ) either frozen or in transport media . csd was definitively diagnosed when a specimen was positive for 2 genes of bartonella spp ( 1 ) . total genomic dna was extracted from samples by using a qiaamp tissue kit ( qiagen , hilden , germany ) . before 2005 , pcr amplification and sequencing of the internal transcribed spacer ( its ) region and pap31 gene were used for detecting b. henselae and thus confirming csd ( 1 ) . beginning in 2005 , real - time pcr to amplify the its region and pap31 gene was used ( 8) . for all assays , dna from b. elizabethae and b. henselae houston - i was used as the positive control for the its region and the pap31 gene , respectively ( 1 ) . to exclude false - positive results , we performed a second independent extraction when false - positive or unexpected results were obtained . results were confirmed by using pcr amplification and sequencing aimed at 16s rrna gene ( 8) . epi info version 6.0 software ( centers for disease control and prevention , atlanta , ga , usa ) was used for significance variations in the number of positive specimens between 2 consecutive months , nonconsecutive months , and seasons ( p<0.05 ) . the mantel - haenszel test or the fisher exact test positive csd cases were plotted for each month ( figure 1 ) to identify seasonal distributions of csd from 1999 through 2009 . monthly mean numbers of csd were lowest from may through august , followed by significant increases during august september ( p = 0.002 ) and during november december ( p = 0.01 ) . during december january , the mean number of csd cases decreased significantly ( p = 0.005 ) , then plateaued from january through march ( table ) . cases decreased slightly in april , then decreased significantly during april may ( p = 0.002 ) . mean numbers of patients tested for cat - scratch disease and for whom the disease was diagnosed , france , 19992009 . the odds of a csd diagnosis based on lymph node biopsy was 9.2 higher in december , the month with the highest number of cases ( 92/493 ) , than in july , the month with the lowest number of cases ( 12/493 ) . the number of csd cases was significantly higher in autumn ( october december ) than in summer ( july september ) ( p<0.0001 ) . fewer cases were identified in winter ( january march ) than autumn ( p = 0.02 ) , and cases decreased significantly from winter to spring ( april june ) ( p = 0.0001 ) . the number of cases did not differ significantly from spring to summer ( p = 0.06 ) . our findings that the number csd cases in france varies by season are similar to findings in japan and the united states . in japan , 64% of csd occurred during september december and peaked in november ( 7 ) . in the united states , most csd have occurred during the last 6 months of the year , with a peak in september ( 9 ) . moreover , the analysis of 3 us national databases indicated that most csd cases have occurred during september january , with peaks in november and december ( 5 ) . on the other hand , 60% of admissions for csd in children in the united states have occurred during july october ( 6 ) . the fact that the united states is a large country with diverse climates , whereas continental france has a more homogeneous climate , may explain the differences in seasonality . the presence of ct . felis fleas is essential for maintaining b. henselae infection within the cat population ( 2 ) . flea infestation is more frequent in bacteremic than in nonbacteremic cats , particularly in pet cats ( 10 ) . after adult cat fleas parasitize a host cat , they feed on its blood and transmit b. henselae . fleas go through 4 life cycle stages : egg , larva , pupa , and imago ( adult ) ( figure 2 ) . temperature and relative humidity are the 2 most essential factors for the successful reproduction , development , and survival of fleas ( 11 ) . cats reported to have been infested with fleas during the preceding 6 months were more likely than cats without fleas to be seropositive ( 12 ) , and the seroprevalence of b. henselae is higher in the pet cat population in warm , humid climates than in cold , dry climates because ct . felis fleas are more common in warmer climates ( 10 ) . as a result , cats have more fleas during the summer and autumn months than in the other 2 seasons ( 13 ) . explanation of cat scratch disease seasonality by seasonality of the birth of cats and the activity of their fleas , france , 19992009 . 53% of 94 stray cats were infected with either b. henselae or b. clarridgeiae ( 14 ) . in paris , chomel et al . reported a b. henselae seroprevalence of 36% in 64 pet cats , of which 11% were b. henselae infected ( 12 ) . determined that 16.5% of cats tested were bartonella infected , and 41% were seropositive for b. henselae or b. clarridgeiae ( 15 ) . risk for bartonella infection or seropositivity was higher in cats from multicat households and in cats adopted from the pound or from the street ( 15 ) . feline sexual activity also may influence the seasonality of csd . in the northern hemisphere , cat reproduction increases during spring and summer , and kittens stay with their mothers until they are 1216 weeks of age . b. henselae infection appears to be more common in young cats ( 10 ) , and infection decreases with the length of cat ownership ( 15 ) . in addition , cats encounter more fleas during summer and autumn , and transmission of b. henselae from cat to cat is facilitated during this period ( 13 ) . in conclusion , csd is a seasonal disease in france with increased incidence in autumn , with peaks in december , and a decrease in spring . this pattern may be explained by seasonality in cat reproductive behavior , their fleas activities , and the fact that during summer cats spend most time outside the house , whereas during autumn they stay indoors .
cat - scratch disease is seasonal in the united states and japan ; but no data are available from europe . to assess the seasonality of the disease in france , we analyzed lymph node biopsy specimens collected during 19992009 . most ( 87.5% ) cases occurred during september april and peaked in december .
these benign cysts are located at the right cardiophrenic angle in 70% of cases , left cardiophrenic angle in 22% of cases and rarely in the posterior or anterior superior part of the mediastinum in 8% of cases ( 2 ) . most of pericardial cysts ( > 50% ) are asymptomatic ( 1 , 3 ) and have a benign natural course . some cysts have symptoms such as dyspnea , chest pain , or persistent cough . although it occasionally presents with symptoms related to compression of adjacent structures , pericardial cysts usually have no symptoms and are almost always diagnosed incidentally . in this case report , we describe a patient with a pericardial cyst . presentation and the course of illness were unusual and the cyst was one of the largest cysts that has been reported to date . pericardial cysts are not common and giant pericardial cysts are rare and only data of 12 cases were available from 2000 to 2014 in pubmed , and we will review available published articles in the literature . with improvement of technology and a 24-year - old man presented to the emergency department with dyspnea and persistent cough . in physical exam , no abnormality was found . there was no recent weight loss , cough , sputum production , exposure to tuberculosis , joint pain , or rash . chest x - ray showed a large opacity obscuring the right heart border ( figure 1 ) . his trans - thoracic echocardiogram showed an echo - lucent space next to the right atrium at the right cardiophrenic angle . the apical four - chamber view of the transthoracic echocardiogram showed an echolucent space next to the right atrium at the right cardiophrenic angle , consistent with a pericardial cyst . the right and left ventricular chamber size and function were normal , and there was no valvular heart disease then computed tomography ( ct ) was recommended . ct revealed no pleural effusions , and a large fluid collection at the right pericardial border ( figure 2 ) . extensive work - up for infectious and inflammatory causes , including blood cultures , viral antibodies , sputum acid fast bacilli s ( afb ) , ppd testing , and collagen vascular disease markers was negative . no fluid or pathologic finding was seen in the pericardium . on the right side and outside the pericardium , a huge pericardial cyst measuring approximately 13 8 5 cm in diameter was found and totally excised ( figures 3 and 4 ) . pericardial cysts are uncommon benign congenital lesions in the middle mediastinum ( 1 , 4 ) . most of the masses in the middle mediastinum ( 61% ) are cysts ( 1 , 5 ) . pericardial cysts and also bronchogenic cysts are the second most common masses after lymphomas ( 1 ) . other cysts in the mediastinum are bronchogenic ( 34% ) , enteric ( 12% ) , thymic and others ( 21% ) ( 1 , 4 ) . pericardial cysts ( or benign mesothelial cysts ) , are uncommon lesions that are often found incidentally . their formation may result from failure of fusion of one of the mesenchymal lacunae that form the pericardial sac ( 6 ) . on histologic examination , the cyst wall is composed of fibrous tissue lined by mesothelium , like normal pericardium , with mild chronic inflammation ( 6 ) . most of them are asymptomatic ( 50% - 75% ) and found incidentally during routine chest x - ray or echocardiography ( 2 ) . additional diagnostic methods include trans - thoracic echocardiography , ct scan and magnetic resonance imaging ( mri ) . contrast - enhanced ct scan has been the modality of choice for diagnosis and follow - up ( 3 ) . on ct scan , the pericardial cyst is thin - walled , sharply defined , and an oval homogeneous mass . the diagnosis usually is suspected following abnormal findings on chest radiography , showing bulging of the right heart border . additional diagnostic modalities that may find pericardial cysts include transthoracic echocardiography , ct , and mri of the chest ( 3 , 5 , 8) . twenty reported cases of pericardial cysts in literatures presented before the age of eighteen ( 1 ) , but most of the articles reported older patients . pericardial cysts are usually unilocular , smooth , and smaller than 3 cm in diameter ( 5 ) . cyst size varies from 2 to 28 cm ( 1 ) . in our patient , the cyst size was 13 8 5 cm in diameter that is one of the largest cysts we have found in the literature ( 9 ) ( table 1 ) . ct scan with contrast has been the diagnostic modality of choice to follow asymptomatic patients with pericardial cysts ( 1 ) . however , no studies have shown the superiority of contrast ct over mri and echocardiography for diagnosis or follow - up . on ct scan , pericardial cysts are thin - walled , sharp , oval homogeneous masses . their attenuation is slightly higher than water density ( 30 to 40 hu ) ( 2 ) . their enhancement with intravenous contrast is poor ( 2).the frequency of follow - up imaging has not been defined . if the patient is asymptomatic , serial echocardiography is enough , but if the patient is symptomatic or reveals an increase in the size of the cyst or has solid component in the cyst cavity in the serial follow - up , a cyst resection has been the most favored approach [ with thoracotomy or sternotomy or video - assisted thoracic surgery ( vats ) ] ( 3 , 5 ) . aspiration is another method , but one - third of the patients have shown recurrence . one literature review reported that about 30% of the patients had recurrence after percutaneous drainage at three years .
pericardial cysts are rare lesions . these benign anomalies are located in the middle mediastinum . in this article , we present a 24-year - old man who was referred to the emergency department with dyspnea and persistent cough . in physical exam , no abnormality was found . his past medical history was normal . his trans - thoracic echocardiogram showed an echo - lucent space next to the right atrium at the right cardiophrenic angle . no pericardial effusion was found . the patient underwent surgery . after midsternotomy , a huge cyst measuring approximately 13 8 5 cm in diameters was found on the right side and outside the pericardium that was totally excised . after 5 days , the patient was discharged and pathologic report confirmed preoperative diagnosis of pericardial cyst . giant pericardial cysts are not common and in this report , we will review published case reports .
between 1996 and 2011 , all patients who underwent endovascular treatment via facial venous embolization for davf were identified from the neurointerventional database of three hospitals . clinical outcomes and radiologic findings of all patients with davf treated with transvenous embolization via fv the dosage of heparin was intravenously 2,000 or 3,000 iu bolus at the beginning of the procedure and if the procedure prolonged more than one hour , additional heparin 1,000 iu or more dose was administrated intravenously after checking activated clotting time . the 5 or 6 fr envoy guiding catheters ( codman & shurtleff , rayham , ma , usa ) were placed at to the level of mandibular angle of the fv in all cases . twelve patients with cs ( n = 11 ) or lesser wing of sphenoid sinus ( lwss , n = 1 ) davf were attempted to treat by transvenous embolization via ipsilateral ( n = 10 ) or contralateral ( n = 2 ) fv . the patient group consisted of six male and six female patients with an age range from 20 to 83 years ( mean age , 55 years ) . clinical findings included exophthalmos and chemosis ( n = 10 ) , limitation of lateral gaze in ipsilateral eye ( n = 3 ) , headache ( n = 1 ) , tinnitus ( n = 1 ) and intracranial hemorrhage ( n = 1 ) . trans - ips access to the target lesion was impossible due to chronic occlusion ( n = 11 ) of the ips or acute angulated route adjacent the target lesion ( n = 1 ) . in all twelve cases , it was possible to catheterize the fv with guiding catheter , and to navigate the microcatheter through the angular vein and sov , and then to reach the cs . eleven of all cases had thrombosed ips , so it was not accessible to approach the shunt through the route of ips . in one case , the ips was patent , but the attempt to reach the shunt via this ips was failed due to acute angle between cs and lwss . postembolization control angiography revealed complete occlusion of the shunt in eleven patients and partial occlusion in one patient . the exophthalmos and chemosis in all ten patients improved after the procedure , but sixth nerve palsy in three patients was not improved immediately but improved slightly at two months during clinical follow - up . a 55-year - old man was admitted with dysarthria , left exophthalmos , chemosis and left - side motor weakness . brain computed tomographic angiography ( cta ) revealed acute intracranial hemorrhage in right capsular region and tangled vessels of right temporal area with early venous drainage . digital subtraction angiography ( dsa ) showed davf involving cs with arterial feeders from right external carotid artery ( eca ) and internal carotid artery ( ica ) , venous drainage to left sov , right sphenoparietal sinus and superficial middle cerebral vein , thought as dangerous retrograde cortical drainage , through intercavernous sinus ( fig . 1 ) . we decided to occlude the fistula by coil embolization via venous route . under general anesthesia , initially a guiding catheter was placed in the left ijv to fv and a microcatheter - exchanged prowler select plus to excelsior sl-10 straight because of tortuous angular vein - could be introduced in left cs through sov by a microwire ( transend 0.014 , boston scientific , natick , ma , usa ) . however , the microwire and microcatheter could not be passed through intercavernous sinus , so the microwire was changed to agility 14 soft microwire ( codman & shurtleff , rayham , ma , usa ) . the microcatheter was then exchanged with prowler select plus ( codman , usa ) , and it was advanced to the transition site between the right cs and sphenoparietal sinus ( fig . the fistula site in the cs was completely occluded by embolization using detachable and pushable fibered coils through from right to left cs involving intercavernous portion . enhanced orbit mri revealed a lobulated mass - like lesion at the left sphenoid bone with extension to the orbit and middle cranial fossa , and it showed strong enhancement . dsa showed an arterio - venous fistula involving the left frontal region , with shunt flow from the middle meningeal artery , draining into the dilated venous , and then into lwss and sov through cs ( fig . 2 ) . we decided to occlude the fistula portion involving middle meningeal artery and performed embolization for the lesion via arterial approach using detachable and pushable fibered coils . the post - procedural angiography showed occlusion of internal maxillary artery but other fistula from ophthalmic artery was seen . the exophthalmos and chemosis improved in some degree after the procedure and the patient discharged , pledging to treat the remnant lesion again . after the initial treatment , follow - up angiography showed remained arterio - venous shunt at left lwss , with arterial feeders including left middle meningeal artery and branch of inferolateral trunk from the left ica , and venous drainage mainly into the sov via left cs with small amount of venous drainage also into the left ips . under general anesthesia , initially a pre - shaped 45-degree microcatheter ( excelsior sl-10 , boston scientific , natick , ma , usa ) was placed in the left middle meningeal artery . liquid embolic agent ( onyx , micro therapeutics , irvine , ca , usa ) was prepared and injected through the microcatheter . the arteriovenous shunt from the left middle meningeal artery was completely occluded but the left lwss region remained . a microcatheter was placed in the left ips , and the left cs was selected . however , it could not be further advanced due to acute angle at the connection site between the left cs and lwss . the microcatheter was placed in the left fv and sov , and then it was placed at the venous side near the arteriovenous shunt site at left lwss . a 55-year - old man was admitted with dysarthria , left exophthalmos , chemosis and left - side motor weakness . brain computed tomographic angiography ( cta ) revealed acute intracranial hemorrhage in right capsular region and tangled vessels of right temporal area with early venous drainage . digital subtraction angiography ( dsa ) showed davf involving cs with arterial feeders from right external carotid artery ( eca ) and internal carotid artery ( ica ) , venous drainage to left sov , right sphenoparietal sinus and superficial middle cerebral vein , thought as dangerous retrograde cortical drainage , through intercavernous sinus ( fig . 1 ) . we decided to occlude the fistula by coil embolization via venous route . under general anesthesia , initially a guiding catheter was placed in the left ijv to fv and a microcatheter - exchanged prowler select plus to excelsior sl-10 straight because of tortuous angular vein - could be introduced in left cs through sov by a microwire ( transend 0.014 , boston scientific , natick , ma , usa ) . however , the microwire and microcatheter could not be passed through intercavernous sinus , so the microwire was changed to agility 14 soft microwire ( codman & shurtleff , rayham , ma , usa ) . the microcatheter was then exchanged with prowler select plus ( codman , usa ) , and it was advanced to the transition site between the right cs and sphenoparietal sinus ( fig . the fistula site in the cs was completely occluded by embolization using detachable and pushable fibered coils through from right to left cs involving intercavernous portion . enhanced orbit mri revealed a lobulated mass - like lesion at the left sphenoid bone with extension to the orbit and middle cranial fossa , and it showed strong enhancement . dsa showed an arterio - venous fistula involving the left frontal region , with shunt flow from the middle meningeal artery , draining into the dilated venous , and then into lwss and sov through cs ( fig . 2 ) . we decided to occlude the fistula portion involving middle meningeal artery and performed embolization for the lesion via arterial approach using detachable and pushable fibered coils . the post - procedural angiography showed occlusion of internal maxillary artery but other fistula from ophthalmic artery was seen . the exophthalmos and chemosis improved in some degree after the procedure and the patient discharged , pledging to treat the remnant lesion again . after the initial treatment , follow - up angiography showed remained arterio - venous shunt at left lwss , with arterial feeders including left middle meningeal artery and branch of inferolateral trunk from the left ica , and venous drainage mainly into the sov via left cs with small amount of venous drainage also into the left ips . under general anesthesia , initially a pre - shaped 45-degree microcatheter ( excelsior sl-10 , boston scientific , natick , ma , usa ) liquid embolic agent ( onyx , micro therapeutics , irvine , ca , usa ) was prepared and injected through the microcatheter . the arteriovenous shunt from the left middle meningeal artery was completely occluded but the left lwss region remained . a microcatheter was placed in the left ips , and the left cs was selected . however , it could not be further advanced due to acute angle at the connection site between the left cs and lwss . the microcatheter was placed in the left fv and sov , and then it was placed at the venous side near the arteriovenous shunt site at left lwss . a 55-year - old man was admitted with dysarthria , left exophthalmos , chemosis and left - side motor weakness . brain computed tomographic angiography ( cta ) revealed acute intracranial hemorrhage in right capsular region and tangled vessels of right temporal area with early venous drainage . digital subtraction angiography ( dsa ) showed davf involving cs with arterial feeders from right external carotid artery ( eca ) and internal carotid artery ( ica ) , venous drainage to left sov , right sphenoparietal sinus and superficial middle cerebral vein , thought as dangerous retrograde cortical drainage , through intercavernous sinus ( fig . 1 ) . we decided to occlude the fistula by coil embolization via venous route . under general anesthesia , initially a guiding catheter was placed in the left ijv to fv and a microcatheter - exchanged prowler select plus to excelsior sl-10 straight because of tortuous angular vein - could be introduced in left cs through sov by a microwire ( transend 0.014 , boston scientific , natick , ma , usa ) . however , the microwire and microcatheter could not be passed through intercavernous sinus , so the microwire was changed to agility 14 soft microwire ( codman & shurtleff , rayham , ma , usa ) . the microcatheter was then exchanged with prowler select plus ( codman , usa ) , and it was advanced to the transition site between the right cs and sphenoparietal sinus ( fig . the fistula site in the cs was completely occluded by embolization using detachable and pushable fibered coils through from right to left cs involving intercavernous portion . enhanced orbit mri revealed a lobulated mass - like lesion at the left sphenoid bone with extension to the orbit and middle cranial fossa , and it showed strong enhancement . dsa showed an arterio - venous fistula involving the left frontal region , with shunt flow from the middle meningeal artery , draining into the dilated venous , and then into lwss and sov through cs ( fig . 2 ) . we decided to occlude the fistula portion involving middle meningeal artery and performed embolization for the lesion via arterial approach using detachable and pushable fibered coils . the post - procedural angiography showed occlusion of internal maxillary artery but other fistula from ophthalmic artery was seen . the exophthalmos and chemosis improved in some degree after the procedure and the patient discharged , pledging to treat the remnant lesion again . after the initial treatment , follow - up angiography showed remained arterio - venous shunt at left lwss , with arterial feeders including left middle meningeal artery and branch of inferolateral trunk from the left ica , and venous drainage mainly into the sov via left cs with small amount of venous drainage also into the left ips . under general anesthesia , initially a pre - shaped 45-degree microcatheter ( excelsior sl-10 , boston scientific , natick , ma , usa ) was placed in the left middle meningeal artery . liquid embolic agent ( onyx , micro therapeutics , irvine , ca , usa ) was prepared and injected through the microcatheter . the arteriovenous shunt from the left middle meningeal artery was completely occluded but the left lwss region remained . a microcatheter was placed in the left ips , and the left cs was selected . however , it could not be further advanced due to acute angle at the connection site between the left cs and lwss . the microcatheter was placed in the left fv and sov , and then it was placed at the venous side near the arteriovenous shunt site at left lwss . in this study , we reported favorable results and outcomes of trans - facial venous embolization for cavernous and paracavernous type davfs . the transvenous endovascular embolization is safe and effective option for davf requiring treatment , especially in davf with multiple feeders [ 3 , 10 , 11 ] . the transvenous route is usually through the ijv and the ips up to the pathologic shunts of the cs . even though the ips is partially or completely thrombosed , trans - ips embolization of cavernous davf was often possible because of further developed materials and experience in the catheterization through the venous route . nevertheless , if the ips route is not feasible or has failed in several efforts , an anterior transvenous approach to the cs through the sov can be considerable and accessible as alternative route [ 12 , 13 ] . in our cases , all except one case showed occluded ips . however we challenged the other route and almost the procedures were successful . therefore , even if the ips as a shortest route to target lesion was inaccessible , the fv and sov should be considerable route for the transvenous approach . the anterior approach to the cs through the sov can be performed through surgical exposure of sov or the endovascular route ( e.g. , transfemoral transvenous ) via the fv . the surgical approach for the sov is usually performed after surgical exposure of the sov or of the angular vein [ 3 , 13 , 14 ] . the sov surgical route was described and reported by several authors [ 3 , 15 , 16 ] . in surgical approach for the fv or sov routes , it require cut - down or puncture of the sov and may remain cutaneous scars , which are not always cosmetically acceptable [ 6 , 17 ] . in addition , disadvantages and complications of the sov exposure include bleeding from the sov , difficulty in identifying the vein , injury of the supraorbital nerve and levator muscle , damage to the trochlea , infection , and granuloma [ 6 , 8 , 17 ] . therefore , we supposed that transfemoral transvenous approach through the fv was more accessible and had more advantages than the surgical exposure of sov for the treatment of cavernous davf in which trans - ips approach is not accessible . it would be beneficial to the patient as well as to the operator , especially in terms of radiation dose reduction , if the process of the transvenous catheterization procedure could be more easily performed . the efficacy of such procedures could very likely be improved if an appropriate venous route is identified and selected for catheterization at an early stage of the procedure . yu et al . reported a venographic - based operational classification of cavernous type davf for early selection of the optimal venous route for embolization of the cs . they concluded that the knowledge of the status of compartmentalization of the cs as well as opacification of fv or ips on angiogram were very important for the procedural success . in their study , anterior compartment of the cs was more accessible through the sov , especially , with occluded ips . also in our study , all of cases showed opacification of fv and sov on angiogram and all approaches through the fv and sov were successful . we experienced one case with davf in the region of the lwss ( case 2 ) . in general , asymptomatic davf of the lwss probably do not require any correction . however , bithoh et al . reported a case of davf of the lwss in a patient with exophthalmos and chemosis due to venous hypertension in the sov , which needed correction . also in our case involving the lwss , ophthalmic symptom presented as proptosis and chemosis . the lwss may be identified angiographically and distinguished from an ophthalmic vein , especially on lateral projections . in the anteroposterior view , distinction between diploic vein of the lwss and the sov is made by identifying the characteristic inverted - s course of the sov and its dorsal connection with the cs . in these anatomical concepts of the lwss and the cs , in addition , the bridge between the lwss and the cs may have unusual angle if the approach is performed through the ips . as expected , our case involving the lwss was not accessible through the ips due to bizarre course from the cs to the lwss . finally , we challenged the approach to the lwss through the fv and sov and the attempt was successful . in conclusion , in the endovascular treatment of cavernous or paracavernous davf in which trans - ips approach is not feasible , the fv provides safe and effective treatment route for transvenous embolization . especially , in anterior or superior compartmental lesion , the transfacial - ophthalmic venous approach may be feasible and effective modality . in addition , the compartmental venous anatomy should be considered and identified for proper targeting the lesions .
purposethe aim of this study was to evaluate the feasibility and safety of the transfacial venous embolization of cavernous or paracavernous dural arteriovenous fistula ( davf ) in which approach via inferior petrosal sinus ( ips ) was not feasible.materials and methodswe identified the cases of transfacial venous embolization of cavernous sinus ( cs ) or adjacent dural sinuses from the neurointerventional database of three hospitals . the causes and clinical and angiographic outcomes of transfacial venous embolization were retrospectively evaluated.resultstwelve patients with cs ( n = 11 ) or lesser wing of sphenoid sinus ( lwss , n = 1 ) davf were attempted to treat by transvenous embolization via ipsilateral ( n = 10 ) or contralateral ( n = 2 ) facial vein . trans - ips access to the target lesion was impossible due to chronic occlusion ( n = 11 ) or acute angulation adjacent the target lesion ( n = 1 ) . in all twelve cases , it was possible to navigate through facial vein , angular vein , superior ophthalmic vein , and then cs . it was also possible to further navigation to contralateral cs through intercavernous sinus in two cases , and laterally into lwss in one case . post - treatment control angiography revealed complete occlusion of the davf in eleven cases and partial occlusion in one patient , resulting in complete resolution of presenting symptom in eight and gradually clinical improvement in four patients . there was no treatment - related complication during or after the procedure.conclusionin the cavernous or paracavernous davf in which trans - ips approach is not feasible , the facial vein seems to be safe and effective alternative route for transvenous embolization .
the personal and professional development ( ppd ) module was introduced as a part of the medical curriculum , in september 2006 , along with other curricular changes , to ensure that students not only grow professionally into good doctors , but also grow personally . in order to offer our students a humane and holistic experience in the medical curriculum , the personal and development module was introduced at the melaka manipal medical college ( mmmc ) , manipal , india . the module was designed with an objective to inculcate and impart in the students , a variety of fundamental skills to provide an environment that will extend their strengths , challenge their competencies , and work with their weaknesses . the module includes courses involving communication skills , ethics , working in groups and early patient contact through community visits . the course has a significant focus on the activities designed to foster collaborative practices , commitment to life - long learning , and aid understanding of ethical , scientific and philosophical principles underlying the practice of medicine . this study aimed at evaluating the ppd module that was introduced in the undergraduate medical curriculum . the mmmc is a private medical college that was flagged off in 1997 with classes commencing at manipal , india . the bachelor of medicine bachelor of surgery ( mbbs ) curriculum of the melaka manipal medical college is a 5-year academic program with the first two and half years in india and the next part of the program in malaysia . the first batch of students was admitted into the twin campus program at manipal , india , in september 1997 and the program grew in strength both in numbers as well as in academic quality and curricular innovations . feedback and suggestions from accrediting bodies led to mmmc adopting a new curriculum in september 2006 , 9 years after inception of the program . this curriculum called the six - strand integrated curriculum ( table 1 ) had horizontal strands including normal human body and its function , body s reaction to injury , and practice - based medicine and vertical strands including scientific basis of medicine , doctor , patient , health , community , and environmental module , and ppd module . this module was introduced to foster collaborative practices , inculcate life - long learning and enable students to understand the ethical and philosophical principles underlying the scientific practice of medicine . in the first year of the mbbs program , ppd classes are conducted in topics related to doctor patient relationship , professional ethics and humanities related topics . in the second year , students of the institution are required to pursue a project involving in - depth study of an area of interest and prepare a written , referenced report of scholarly substance . this helps the student to gain insight into research methodology and to encourage the development of critical thinking skills . in the first half of the third year , students are introduced to a few topics in palliative care . as a first step , 2 hours per week of ppd was incorporated in the time - table for the first year medical students . a group of faculty and a coordinator identified relevant topics such as medical humanities , leadership skills , communication skills , ethics , professional behavior and patient narratives ( table 2 ) that would be introduced to students . all faculty were requested to identify topics of their choice so that they could conduct the sessions in an engaging manner . there were also hours set aside for creative essay writing , role plays and theater by the students . in terms of students , the quality of the module such as content , presentations and engagement were evaluated by using a prevalidated module specific questionnaire with 10 items . a total of 528 students from three different batches from march 2011 to march 2013 were enrolled to give module feedback . the effectiveness of the module was studied by using a longitudinal survey using a modified course evaluation form . it was a 16-item questionnaire , with 16 closed and an option to write open comments , where students could explain about any personal / professional improvements they would attribute to the ppd experience . the same students responded to this questionnaire when they reached the clinical phase . in terms of faculty , personal interviews and focus group discussions were conducted by the coordinator , with eleven faculty members who conducted the ppd classes . continuous feedback is an important tool that helps to improve quality on an ongoing basis . the analysis of student responses showed that majority of them agreed that the module was useful and the results are as follows : a good percentage ( 67% ) of the students found the course to be relevant . they also found the teaching effective ( good , 27% ; and very good , 63% ) and well - paced ( 92% ) . the ppd workload was not a major issue and 97% of the students found that it was reasonable . the students strongly agreed that the course was well coordinated ( 65% ) , course materials were well prepared ( 55% ) , group discussions were effective ( 65% ) , and role plays helped in understanding the topics ( 85% ) . however , a few students wanted discussion on tourism in india , indian culture , art , and food . other useful tips from students included interactions with senior doctors from the hospital to share experiences and local community visits . students communicated that they were able to carry the content forward from what was taught and applied it in their day to day contexts . modules provided a range of opportunities to apply theoretical knowledge in different ways ( case studies , labs , interactive activities , and so forth ) . individual comments suggested that the courses challenged them to think about humane aspects of medicine , provided opportunities to develop self - directed learning skills , to develop skills and abilities to work as a team member , advanced skills of inquiry to pursue projects in second year and to develop professional attributes and behaviors in the clinical setting . however , they have made many positive comments about the perceptions of modules and its effectiveness . often , students have been able to share their learning with colleagues , either informally or through groups developed in ppd for collaborative / team work . students identified many benefits especially when they worked on their projects . in discussions on impact , students make comments such as enhancing study skills , empathy , team spirit , helping to change classroom practice , and participating proactively in clinical discussions . faculty found the topics new and interdisciplinary , handling such topics , and creating interest and engaging the students were a challenge . in the first year of the mbbs program , ppd classes are conducted in topics related to doctor patient relationship , professional ethics and humanities related topics . in the second year , students of the institution are required to pursue a project involving in - depth study of an area of interest and prepare a written , referenced report of scholarly substance . this helps the student to gain insight into research methodology and to encourage the development of critical thinking skills . in the first half of the third year , students are introduced to a few topics in palliative care . as a first step , 2 hours per week of ppd was incorporated in the time - table for the first year medical students . a group of faculty and a coordinator identified relevant topics such as medical humanities , leadership skills , communication skills , ethics , professional behavior and patient narratives ( table 2 ) that would be introduced to students . all faculty were requested to identify topics of their choice so that they could conduct the sessions in an engaging manner . there were also hours set aside for creative essay writing , role plays and theater by the students . in terms of students , the quality of the module such as content , presentations and engagement were evaluated by using a prevalidated module specific questionnaire with 10 items . a total of 528 students from three different batches from march 2011 to march 2013 were enrolled to give module feedback . the effectiveness of the module was studied by using a longitudinal survey using a modified course evaluation form . it was a 16-item questionnaire , with 16 closed and an option to write open comments , where students could explain about any personal / professional improvements they would attribute to the ppd experience . the same students responded to this questionnaire when they reached the clinical phase . in terms of faculty , personal interviews and focus group discussions were conducted by the coordinator , with eleven faculty members who conducted the ppd classes . in the first year of the mbbs program , ppd classes are conducted in topics related to doctor patient relationship , professional ethics and humanities related topics . in the second year , students of the institution are required to pursue a project involving in - depth study of an area of interest and prepare a written , referenced report of scholarly substance . this helps the student to gain insight into research methodology and to encourage the development of critical thinking skills . in the first half of the third year , students are introduced to a few topics in palliative care . as a first step , 2 hours per week of ppd was incorporated in the time - table for the first year medical students . a group of faculty and a coordinator identified relevant topics such as medical humanities , leadership skills , communication skills , ethics , professional behavior and patient narratives ( table 2 ) that would be introduced to students . all faculty were requested to identify topics of their choice so that they could conduct the sessions in an engaging manner . there were also hours set aside for creative essay writing , role plays and theater by the students . in terms of students , the quality of the module such as content , presentations and engagement were evaluated by using a prevalidated module specific questionnaire with 10 items . a total of 528 students from three different batches from march 2011 to march 2013 were enrolled to give module feedback . the effectiveness of the module was studied by using a longitudinal survey using a modified course evaluation form . it was a 16-item questionnaire , with 16 closed and an option to write open comments , where students could explain about any personal / professional improvements they would attribute to the ppd experience . the same students responded to this questionnaire when they reached the clinical phase . in terms of faculty , personal interviews and focus group discussions were conducted by the coordinator , with eleven faculty members who conducted the ppd classes . continuous feedback is an important tool that helps to improve quality on an ongoing basis . the analysis of student responses showed that majority of them agreed that the module was useful and the results are as follows : a good percentage ( 67% ) of the students found the course to be relevant . they also found the teaching effective ( good , 27% ; and very good , 63% ) and well - paced ( 92% ) . the ppd workload was not a major issue and 97% of the students found that it was reasonable . the students strongly agreed that the course was well coordinated ( 65% ) , course materials were well prepared ( 55% ) , group discussions were effective ( 65% ) , and role plays helped in understanding the topics ( 85% ) . however , a few students wanted discussion on tourism in india , indian culture , art , and food . other useful tips from students included interactions with senior doctors from the hospital to share experiences and local community visits . students communicated that they were able to carry the content forward from what was taught and applied it in their day to day contexts . modules provided a range of opportunities to apply theoretical knowledge in different ways ( case studies , labs , interactive activities , and so forth ) . individual comments suggested that the courses challenged them to think about humane aspects of medicine , provided opportunities to develop self - directed learning skills , to develop skills and abilities to work as a team member , advanced skills of inquiry to pursue projects in second year and to develop professional attributes and behaviors in the clinical setting . however , they have made many positive comments about the perceptions of modules and its effectiveness . often , students have been able to share their learning with colleagues , either informally or through groups developed in ppd for collaborative / team work . students identified many benefits especially when they worked on their projects . in discussions on impact , students make comments such as enhancing study skills , empathy , team spirit , helping to change classroom practice , and participating proactively in clinical discussions . faculty found the topics new and interdisciplinary , handling such topics , and creating interest and engaging the students were a challenge . with an objective to introspect and reflect upon the challenges and experiences of faculty and students with the ppd module that was introduced at the melaka manipal medical college , and identify key strategies to sustain and improve the module in the curriculum . students expression on the ppd sessions was similar to results obtained with the ppd module introduced in another indian university . systematic , future directed , continuous cycle of goal setting , planning , managing , and reviewing is essential for quality improvement of any program . analyzing student and faculty feedback is a simple , but rich and valuable source of information for quality enhancement . for any program to grow , stabilize , improve , be effective and sustainable the drawback of this module was that there was no formal assessment for each of the sessions . however , reflective summaries are now introduced and used to assess skills acquired through this module . in conclusion , implementation of ppd modules in the undergraduate medical curriculum in melaka manipal medical college , india was successful case since students could improve their affective skills .
the study aimed at evaluating the personal and professional development ( ppd ) module in the undergraduate medical curriculum in melaka manipal medical college , india . ppd hours were incorporated in the curriculum . a team of faculty members and a faculty coordinator identified relevant topics and students were introduced to topics such as medical humanities , leadership skills , communication skills , ethics , professional behavior , and patient narratives . the module was evaluated using a prevalidated course feedback questionnaire which was administered to three consecutive batches of students from march 2011 to march 2013 . to analyze faculty perspectives , one to one in - depth interviews and focus group discussions were conducted by the coordinators with faculty members who conducted the ppd classes . analysis of the course feedback form revealed that majority ( 80% ) of students agreed that the module was well prepared and was " highly relevant " to the profession . faculty found the topics new and interdisciplinary and there was a sense of sharing responsibility and workload by the faculty . ppd modules are necessary components of the curriculum and help to mould students while they are still acquiescent as they assume their roles as doctors of the future .
about ten years ago , we hypothesised that grasping is controlled as the independent movements of digits towards positions on an object s surface ( smeets and brenner 1999 ) . in this view , the curved paths ( i.e. the opening and closing of the grip ) emerge because the digits tend to approach the surface perpendicularly . we showed that a minimum - jerk model ( flash and hogan 1985 ) based on this view is quantitatively consistent with many aspects of grasping without any further assumptions or parameter - fitting ( smeets and brenner 1999 ) . such a model can deal with responses to perturbation in object position and size ( smeets et al . 2002a ) , and also explain the time - dependency of the effects of illusions on grip formation ( smeets et al . 2002b ; smeets et al . 2003 ) . for instance , grasping with the finger and thumb of a single hand is very similar to grasping with the index fingers of both hands , and in terms of the variability in the movements , the digits are to a large extent independent ( smeets and brenner 2001 ) . furthermore , obstacles influence the speed of grasping as predicted if one regards the limitations on the individual digits paths ( biegstraaten et al . the fact that the digits paths during the closing of the grip are influenced by the orientation of the surface ( kleinholdermann et al . 2007 ) provided direct evidence that the approach of the digits to the object s surface is not a simple closing of the grip , but consists of movements that tend to approach the surface perpendicularly . nevertheless , many authors question this view on grasping ( mon - williams and mcintosh 2000 ; bennis and roby - brami 2002 ; kamper et al . 2003 ; van de kamp and zaal 2007 ) and continue to use peak grip aperture as a measure for visual size processing ( ganel et al . 2008 ; franz et al . the aim of the present study is to provide a further test of the hypothesis of independent digit control for grasping . to do so , we compare movements of the digits in grasping with those in two single - digit tasks . we try to make the task constraints ( e.g. start and end position , required precision and contact force ) similar for the three tasks . in the present study , we therefore compare the movements of the active digits in grasping with those in two other tasks : lightly tapping ( touching ) the object from the side and pushing the object sideways . the three tasks were set up so that the active digits had same start and goal positions and more or less the same precision requirements . the main difference is that both digits are active in grasping , whereas only one is active in pointing and touching ( we refer to the digit that is not used to perform the task as the passive digit ) . however , as the constraints are not exactly the same ( e.g. , the movement of the thumb is also constraining the movement of the index finger in grasping , but not in the single - digit tasks ) , we can not expect the movements of the digits to be exactly the same . therefore , we formulate three predictions that do not rely on an exact match of the task constraints . an experimental fact that seems to be in conflict with our view is that the movements of the thumb and finger are not the same ( or more precisely : they are not each other s mirror image ) when grasping . for instance , it has been reported that the path of the thumb is less curved than that of the finger ( wing and fraser 1983 ; paulignan et al . such differences between the digits paths are largely due to non - equivalent contacts points . in natural grasping , contacts positions are generally chosen so that the thumb has to move a shorter distance . but even with equivalent contact positions , there remain differences between the digits ( smeets and brenner 2001 ) . it might be that differences in shape between the digits , or other anatomical properties , lead due to different precision requirements . these differences between finger and thumb are present in any task , independent of the precise constraints . if the hypothesis of independent digit control were correct , one would expect the same deviation from a mirror image in grasping as for the active digits in touching and pushing . the second prediction is about the most commonly used parameter to describe grasping : peak grip aperture . if the hypothesis of independent digit control is correct , one may expect that the peak grip aperture in grasping and the imaginary peak grip aperture that can be constructed by combining movements of finger and thumb from corresponding single - digit trials should be the same . this will very likely not be exactly true , as the constraints will slightly differ . despite such differences , we can expect peak grip aperture and its timing to be systematically related : larger peak grip apertures ( in more accurate tasks ) occur earlier in the movement ( smeets and brenner 1999 ) . so if we find differences in peak grip aperture , we will test whether this depends on timing in the same way for all tasks . if such a relationship is found , we can test whether this relationship follows the quantitative predictions of the minimum - jerk model . the third prediction is about the effects of the independence of the digits on the variability . the first part of this prediction is that the digits that are active in touching , pushing or grasping are controlled in the same way in all tasks . therefore , the precision of the movements of the active digits will be the same . according to our view , the characteristics of the movements follow from the constraints to movements of the individual digits . as the movement of the passive digit in the single - digit task is much less constrained than that of the active digit , we predict that a digit will be more variable when passive than when active . eight subjects took part in the experiment : one author ( eb : s5 ) , one visiting scientist experienced in grasping research ( s6 ) , and six colleagues of the vu university who were not involved in grasping research . five of the subjects were women , and the other three were men ; their mean age was 34.4 ( sd = 9.5 ) . all subjects were right - handed and had normal or corrected - to - normal vision ; none of them reported any physical injuries or anomalies affecting their performance . except for the co - author , all subjects were nave with respect to the specific hypothesis being tested . the main aim of the setup was to create equal levels of comfort and difficulty for all subjects , while motor demands were equal for thumb and index finger both within and between tasks . a graphic representation of the setup is shown in fig . the two thin lines indicate the position to which the subject had to push the cube . the thick curves are hypothetical paths of index finger and thumb top view of the experiment . the two thin lines indicate the position to which the subject had to push the cube . the thick curves are hypothetical paths of index finger and thumb subjects were asked to sit on a stool that was adjusted in height so that subjects belly buttons coincided with the edge of the experimental table . subsequently , subjects were asked to stretch their dominant arm and place their hand flat on the table in the median plane . , mass 364 g. ) and asked to place it on the marked spot , and orient it in a manner that maximised their comfort . the individual preferred position and orientation of the cube the starting position was 30 cm from the cube , perpendicular to the centre of the face of the cube that was closest to the right shoulder . subjects were asked to hold the tips of their index finger and thumb in contact at this starting position at the beginning of each trial . the instructions were to grasp the object with a precision grip ( i.e. with the object between thumb and index finger ) and lift it ; to touch the object on the side without making it move using the thumb ; to touch the object on the side without making it move using the index finger ; to push the object away using the thumb ; or to push the object away using the index finger . in the latter two conditions , subjects were instructed to move the cube until it passed across a line that was 10 cm from the far side of the cube . having to push the cube in a specified direction with one digit made it important to make contact near the centre of the cube s surface . the instruction was incorporated in the verbal go - signal ( for instance : push with thumb , movements were recorded at 200 hz with an optotrak 3020 camera unit ( northern digital , waterloo , canada ) . each cluster was connected to the optotrak system by a single , flexible wire that was taped to the subject s arm . the data of the three markers of a cluster were used to calculate the thumb and index finger s position off line . we wanted to evaluate the location of the point at which the digit contacted the object instead of the position of the cluster attached to the nail . in order to do so , a one - second recording was taken of an additional marker held in a precision grip . the position of this additional marker was regarded as the thumb or finger s position , and its position relative to the two clusters during this additional recording was used to calculate the relevant position in the subsequent analysis . we determined the tangential velocity of each digit by numerical differentiation . for each digit , movement onset was defined as the moment in time at which the digit had moved 5 mm from its starting position . we determined the endpoints of the digits movements using the multiple sources of information method ( schot et al . this method determines the most likely endpoint by combining various parameters . in our case , the end was when the digits moved slowly , and were close to the cube , but the cube had not moved . the precise measure we used was:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \mathop { \max } \limits_{{v_{\text{cube } } ( t ) = 0 } } \left ( { 1 - { \frac{v(t)}{{v_{\max } } } } } \right)\left ( { 1 - { \frac{d(t)}{10 } } } \right ) $ $ \end{document}in which d(t ) is the distance between the digit and the centre of the cube s surface in cm , v(t ) is the velocity of the digit , and vmax is the maximum velocity of that digit . movement time ( mt ) was calculated as the difference in time between movement onset and endpoint . in addition to parameters that describe the digits movements , we want to compare parameters of grasping ( such as peak grip aperture ) with equivalent measures during single - digit tasks . in the latter case , the parameters in a single trial are not equivalent to the ones in grasping ( e.g. the grip aperture is meaningless in a finger push trial ) , but we can combine movements of the active digits across trials . thus , we can define a measure for the push task that is equivalent to the grip aperture by taking the distance between the finger in a finger push trial and the thumb in a thumb push trial . we used the average trajectories of the active digits to do so . in order to make a fair comparison , we also calculated the parameters in the grasping trials based on the digits average trajectories . the segment ends were determined using linear spatial interpolation . the relative time ( time relative to movement onset divided by the movement time ) and we compared movement parameters ( movement time , maximum velocity ) between conditions using t - tests , using an alpha - level of 0.05 . these tests were paired t - tests if they compared the two digits in grasping , and unpaired t - tests for all other comparisons . we furthermore used an anova to test whether the condition affected the within - subject variability in the above - mentioned parameters . in order to evaluate how much the digits deviated from each other s mirror image , we defined a measure for this finger thumb difference by averaging the two paths of the active digits for each of the 101 ends of the segments . for grasping , the resulting trajectory corresponds to the transport component . for digits paths that are each other s mirror image we will refer to the deviation from a straight line as the finger thumb difference . in our initial paper on the control of digits during grasping , we made quantitative predictions using a minimum - jerk model ( for details , see smeets and brenner 1999 ) . in this model , we implemented independent control of the digits by letting each digit move as smoothly as possible from the start to the final position , with constraints on the velocity and acceleration at both movement onset and contact . contact also occurred simultaneously , with zero velocity and a final deceleration that was perpendicular to the surface . eight subjects took part in the experiment : one author ( eb : s5 ) , one visiting scientist experienced in grasping research ( s6 ) , and six colleagues of the vu university who were not involved in grasping research . five of the subjects were women , and the other three were men ; their mean age was 34.4 ( sd = 9.5 ) . all subjects were right - handed and had normal or corrected - to - normal vision ; none of them reported any physical injuries or anomalies affecting their performance . except for the co - author , all subjects were nave with respect to the specific hypothesis being tested . the main aim of the setup was to create equal levels of comfort and difficulty for all subjects , while motor demands were equal for thumb and index finger both within and between tasks . a graphic representation of the setup is shown in fig . the two thin lines indicate the position to which the subject had to push the cube . the thick curves are hypothetical paths of index finger and thumb top view of the experiment . the two thin lines indicate the position to which the subject had to push the cube . the thick curves are hypothetical paths of index finger and thumb subjects were asked to sit on a stool that was adjusted in height so that subjects belly buttons coincided with the edge of the experimental table . subsequently , subjects were asked to stretch their dominant arm and place their hand flat on the table in the median plane . , mass 364 g. ) and asked to place it on the marked spot , and orient it in a manner that maximised their comfort . the individual preferred position and orientation of the cube were marked and used during the rest of the experiment . the starting position was 30 cm from the cube , perpendicular to the centre of the face of the cube that was closest to the right shoulder . subjects were asked to hold the tips of their index finger and thumb in contact at this starting position at the beginning of each trial . the instructions were to grasp the object with a precision grip ( i.e. with the object between thumb and index finger ) and lift it ; to touch the object on the side without making it move using the thumb ; to touch the object on the side without making it move using the index finger ; to push the object away using the thumb ; or to push the object away using the index finger . in the latter two conditions , subjects were instructed to move the cube until it passed across a line that was 10 cm from the far side of the cube . having to push the cube in a specified direction with one digit made it important to make contact near the centre of the cube s surface . the instruction was incorporated in the verbal go - signal ( for instance : push with thumb , movements were recorded at 200 hz with an optotrak 3020 camera unit ( northern digital , waterloo , canada ) . each cluster was connected to the optotrak system by a single , flexible wire that was taped to the subject s arm . the data of the three markers of a cluster were used to calculate the thumb and index finger s position off line . we wanted to evaluate the location of the point at which the digit contacted the object instead of the position of the cluster attached to the nail . in order to do so , a one - second recording was taken of an additional marker held in a precision grip . the position of this additional marker was regarded as the thumb or finger s position , and its position relative to the two clusters during this additional recording was used to calculate the relevant position in the subsequent analysis . we determined the tangential velocity of each digit by numerical differentiation . for each digit , movement onset was defined as the moment in time at which the digit had moved 5 mm from its starting position . we determined the endpoints of the digits movements using the multiple sources of information method ( schot et al . this method determines the most likely endpoint by combining various parameters . in our case , the end was when the digits moved slowly , and were close to the cube , but the cube had not moved . the precise measure we used was:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \mathop { \max } \limits_{{v_{\text{cube } } ( t ) = 0 } } \left ( { 1 - { \frac{v(t)}{{v_{\max } } } } } \right)\left ( { 1 - { \frac{d(t)}{10 } } } \right ) $ $ \end{document}in which d(t ) is the distance between the digit and the centre of the cube s surface in cm , v(t ) is the velocity of the digit , and vmax is the maximum velocity of that digit . movement time ( mt ) was calculated as the difference in time between movement onset and endpoint . in addition to parameters that describe the digits movements , we want to compare parameters of grasping ( such as peak grip aperture ) with equivalent measures during single - digit tasks . in the latter case , the parameters in a single trial are not equivalent to the ones in grasping ( e.g. the grip aperture is meaningless in a finger push trial ) , but we can combine movements of the active digits across trials . thus , we can define a measure for the push task that is equivalent to the grip aperture by taking the distance between the finger in a finger push trial and the thumb in a thumb push trial . we used the average trajectories of the active digits to do so . in order to make a fair comparison , we also calculated the parameters in the grasping trials based on the digits average trajectories . the segment ends were determined using linear spatial interpolation . the relative time ( time relative to movement onset divided by the movement time ) and we compared movement parameters ( movement time , maximum velocity ) between conditions using t - tests , using an alpha - level of 0.05 . these tests were paired t - tests if they compared the two digits in grasping , and unpaired t - tests for all other comparisons . we furthermore used an anova to test whether the condition affected the within - subject variability in the above - mentioned parameters . in order to evaluate how much the digits deviated from each other s mirror image , we defined a measure for this finger thumb difference by averaging the two paths of the active digits for each of the 101 ends of the segments . for grasping , the resulting trajectory corresponds to the transport component . for digits paths that are each other s mirror image we will refer to the deviation from a straight line as the finger thumb difference . in our initial paper on the control of digits during grasping , we made quantitative predictions using a minimum - jerk model ( for details , see smeets and brenner 1999 ) . in this model , we implemented independent control of the digits by letting each digit move as smoothly as possible from the start to the final position , with constraints on the velocity and acceleration at both movement onset and contact . contact also occurred simultaneously , with zero velocity and a final deceleration that was perpendicular to the surface . on average , subjects took 710 134 ms ( mean sd ) to complete the movements . pushing was faster than touching ( 652 121 ms and 771 122 ms , respectively ; p < 0.001 ) . the movement times for grasping ( 702 138 ms ) did not differ from either of these values . with respect to temporal constraints , grasping is therefore intermediate between our two one - digit tasks . movements in which the thumb was the active digit were slightly ( 42 ms , not significant ) faster than ones in which the index finger was the active digit . also in grasping , the movement time did not differ between the two digits . the maximum velocity of the digits was about 0.45 m / s . in all tasks , the maximum velocity of the index finger was higher than that of the thumb ( difference 0.04 m / s , p < 0.001 ) . figure 2 shows a top view of all movement paths of subject s6 for three of the five conditions . the movements of the digits are quite reproducible , except for the passive thumb when pushing with the finger ( the continuous magenta lines ) . the movements of the digits are different when passive than when active : the paths of the passive digit do not curve towards the object s surface . for this subject , the paths of the active digits are more or less the same when pushing , touching and grasping . we will concentrate on the question whether the movements of the active digits differ systematically between the tasks , and if so , on the nature of the difference.fig . the movements of thumb ( continuous lines ) , index finger ( dotted lines ) and cube ( dashed lines ) are indicated for grasping the object ( left panel , grey curves ) , and for pushing the object with the thumb ( green curves , central panel ) and index finger ( magenta curves , right panel ) example trajectories . the movements of thumb ( continuous lines ) , index finger ( dotted lines ) and cube ( dashed lines ) are indicated for grasping the object ( left panel , grey curves ) , and for pushing the object with the thumb ( green curves , central panel ) and index finger ( magenta curves , right panel ) figure 3 shows the average paths of the active digits in all tasks for all subjects . 2 is a subject for whom the three tasks yield almost identical paths . for most other subjects , the digits stay closer to each other when grasping than one would predict from the paths in the other two tasks . it is clear from this graph that subjects have their own characteristic movement pattern . some subjects curve leftward ( towards the thumb , e.g. s1 ) , others rightward ( e.g. s2 ) in all tasks . according to the minimum - jerk model , the vertical component should be a straight line , which it definitely is not ( right panels of fig . a top view ( left column ) and a side view ( right column ) is given for each subject ( s1s8 ) . the colours and styles of the curves indicate the task : continuous black : grasping ; dotted red : touch with thumb ; dotted blue : touch with finger ; dashed green : push with thumb ; dashed magenta : push with finger overview of the active digits paths when performing the three tasks . a top view ( left column ) and a side view ( right column ) the colours and styles of the curves indicate the task : continuous black : grasping ; dotted red : touch with thumb ; dotted blue : touch with finger ; dashed green : push with thumb ; dashed magenta : push with finger as anticipated on the basis of the literature , the paths of the finger and the thumb were clearly not each other s mirror image when grasping . the difference is not simply that the paths of the index fingers are less straight than those of the thumbs : subjects seem to have their own preferred curvatures for both finger and thumb . to quantify the differences between the digits in grasping , and to test whether the same differences between the two digits also exist when performing the single - digit tasks , we determined the path of the average of the two digits ( see fig . 4 ) . if the digits movements were each other s mirror image , as predicted by the minimum - jerk model , this analysis would always give a straight line ( dashed line ) . the differences between the digits differ between subjects ( different colours in left column graphs ) , but are rather consistent across tasks ( different line styles in central and right column graphs ) . this means that the difference between the paths of the two digits is due to specific properties of the individual digits movements and not due to specific properties of the control for grasping.fig . thumb difference ( the lateral deviation in the average of the active finger and thumb ) is plotted as a function of the percentage of the movement to the cube . for grasping , the finger if the thumb curves farther out than the finger , this measure will be positive finger thumb difference ( the lateral deviation in the average of the active finger and thumb ) is plotted as a function of the percentage of the movement to the cube . for grasping , the finger if the thumb curves farther out than the finger , this measure will be positive as discussed earlier , it is clear from the trajectories in fig . 3 that subjects individual digits moved further from a straight path in the single - digit tasks than in grasping . the peak distance between the active digits in the single - digit tasks is clearly larger than in grasping and occurs earlier ( paired t - test ; p < 0.005 ) . such a negative correlation between the peak grip aperture and its timing is predicted by the minimum - jerk model for grasping . it occurs when the single free parameter of that model is varied ( smeets and brenner 1999 ) . for each subject in each task , we therefore determined how much the hand opened wider than the final grip ( when touching the object ) and where ( in terms of percentage of distance ; fig . 5b ) and when ( in terms of a percentage of time ; fig . , we find a very good correlation ( r = 0.84 for position and r = 0.74 for time ) with a slope of 4.9%/cm for position and 4.6%/cm for time . this linear relationship between the timing of peak grip aperture and the aperture itself is inconsistent with the non - linear prediction of the minimum - jerk model.fig . grip aperture is defined as the distance between the average path of the active index finger and active thumb at corresponding positions on their paths . for touching and pushing , such apertures obviously never occurred in a single trial . a the distance between the digits as a function of time . b , c the relation between peak grip aperture and the position ( b ) or time ( c ) of its occurrence . different tasks are indicated by different symbols ; different subjects by different colours ( colour coding as in fig . continuous line : straight line fit to the data of all tasks ; dashed curve : minimum - jerk prediction ( no fit parameters ) grip aperture in the three tasks . in all tasks , grip aperture is defined as the distance between the average path of the active index finger and active thumb at corresponding positions on their paths . for touching and pushing , such apertures obviously never occurred in a single trial . a the distance between the digits as a function of time . b , c the relation between peak grip aperture and the position ( b ) or time ( c ) of its occurrence . different tasks are indicated by different symbols ; different subjects by different colours ( colour coding as in fig . continuous line : straight line fit to the data of all tasks ; dashed curve : minimum - jerk prediction ( no fit parameters ) the standard deviation in the horizontal placing of the active digits on the cube s surface is about 7 mm , irrespective of the task ( fig . 6 ) . the standard deviation for the passive digits ( in the same direction and at the same time ) is twice as large ( 14 mm ) , again independent of the task.fig . the standard deviation parallel to the cube s surface ( the square root of the sum of the variances in the forward and vertical direction ) . the variability in the active digit s position is the same for the two digits in the three tasks and is much smaller than that of the passive digit in touching and pointing . error bars indicate the standard error of the mean ( across subjects ) variability in the digits end positions in the five tasks . the standard deviation parallel to the cube s surface ( the square root of the sum of the variances in the forward and vertical direction ) . the variability in the active digit s position is the same for the two digits in the three tasks and is much smaller than that of the passive digit in touching and pointing . our main overall result is that several aspects of the movements of the digits in grasping were very similar to those in pushing and touching . this was so for the path of the average of finger and thumb ( first prediction , fig . 4 ) , for the relationship between peak grip aperture and its timing ( second prediction , fig . these results can be regarded as clear support for our hypothesis that the movements of the digits themselves are controlled in grasping , not the opening of the grip ( smeets and brenner 1999 ) . the fact that the grip aperture was smaller than could be expected from the movements in the single - digit tasks ( fig . 5a ) shows that the movements of the digits in grasping are not completely independent . this difference might be caused by the elastic tissue of the hand pulling the digits towards each other . such elastic tissue would exert equal forces in opposite directions , and thus leave the average path unaffected . it has been argued before that the thumb and finger have different roles in grasping : that the grip is made by moving the index finger relative to the thumb , which is regarded as the stable transport component ( wing and fraser 1983 ; haggard and wing 1997 ) . in the present study , the difference in path curvature between the digits is not systematic across subjects : for some subjects the finger deviates more than the thumb , but for others it is the other way around ( fig . 3 ) , leading to subject - specific finger thumb differences ( fig . 4 ) . the precision is also the same for both digits , independent of whether they were active or not ( fig . more importantly , the same differences between the digits were visible in the single - joint tasks . apparently , subjects deal with the specific properties ( thickness , segment length , etc . ) of their finger and thumb in a certain way , independent of whether they are used in grasping or in single - digit pushing or touching . a recent attempt to falsify the independent digit hypothesis subjects grasped an object that could change in such a way that only the target position of one of the digits was perturbed . in some cases , they found that the movement of the other digit changed to some extent ; and in other cases , they found no significant effect . why the digit for which the target did not change was affected in some cases is not clear , as simple kinematic parameters were not affected . the authors correctly claimed that any cross - talk is in conflict with purely independent control . we already showed in earlier experiments that the independence of the digits was not complete : there is a small but clear correlation between the digits ( smeets and brenner 2001 ) . this correlation was absent in bimanual grasping ( a task that is similarly organised as unimanual grasping ; tresilian and stelmach 1997 ) , suggesting that the correlation is caused by anatomical factors rather than a control strategy . elastic tissue connecting the finger and thumb , combined with independent control of the digits , does not only explain the correlation between the digits ( as reported by smeets and brenner 2001 ) , but also the smaller grip aperture in grasping than one would expect on the basis of the single - digit tasks ( as we found in the present study ) . in our original proposal , the present study shows that although this might yield a good description of average behaviour , it clearly misses some details . examples in the present study are the linear relationship between peak grip aperture and its timing ( the model predicts a non - linear relation : fig . 5 ) and the subject - specific finger thumb differences ( fig . 4 ) . note that our original model inspired us to look for the correlation between peak grip aperture and its position in the movement . the very systematic relationship we find differs from the one we predicted ( fig . the data deviate more substantially from the minimum - jerk model in the vertical component of the movement . according to the model , the digits should move in a straight line ( glide across the table ) , which they clearly did not ( right column of fig . 3 ) . this deviation is not specific to grasping , but a general aspect in all our tasks . the large deviation from a straight movement in the vertical direction could be regarded as an argument against the minimum - jerk model , or more generally , against planning movements in extrinsic space ( and in favour of joint - based planning , desmurget et al . an alternative view is to regard the vertical component as the consequence of an additional constraint ( the table as an obstacle to avoid ) that might be incorporated in the spatial planning . this latter view would also give a possible explanation for the differences between conditions in the vertical component . most subjects held their digits that were not used ( little , ring and middle finger ) in a different posture during grasping than during the other two tasks . in order to avoid contact with the table , an important aspect of our model is that it is derived from task constraints , rather than anatomical constraints . the idea behind this is that our movements are organised in such a way that we can move without the anatomical constraints interfering with the execution . how this is done is not made explicit , but movements of distal joints will have to compensate for limitations of more proximal joints and vice versa . it is therefore not surprising that when expressed in a coordinate system that is attached to the hand ( neglecting the contributions of proximal joints ) , the movements of the digits deviate clearly from a minimum - jerk trajectory ( kamper et al . 2003 ) . it is promising for our view on grasping that the same laboratory has reported a similar pattern of digit movements in pointing as in grasping ( cruz and kamper 2006 ) . the minimum - jerk model can describe independent control of the digits in grasping , pointing and touching . although this model can not describe all details , it has the advantage of being very simple ( smeets and brenner 2002 ; smeets et al . 2009 ) . it is clear that a simple model based on independent control of the digits ( such as presented in smeets and brenner 1999 ) would not have predicted all the current results . we have argued above that some interaction between the digits needs to be incorporated in such a model to explain the differences between the individual digits paths when grasping and when performing the other tasks . does this imply that models based on the classical distinction between transport and grip yield a better description of the data ? we do not think so , as no implementation of the classical model would have predicted our main finding : a striking correspondence in the difference between the digits paths when grasping and when performing the two single - digit tasks ( fig . moreover , incorporating an interaction between the individual digits does not make the model more complex than the classical description using the variables transport and grip , because that description also requires an interaction between its two independent variables ( paulignan et al . we therefore conclude that our experimental results support the idea that grasping should be regarded as consisting of controlling the digits , rather than transporting the hand and shaping the grip .
in order to find out whether the movements of single digits are controlled in a special way when grasping , we compared the movements of the digits when grasping an object with their movements in comparable single - digit tasks : pushing or lightly tapping the same object at the same place . the movements of the digits in grasping were very similar to the movements in the single - digit tasks . to determine to what extent the hand transport and grip formation in grasping emerges from a synchronised motion of individual digits , we combined movements of finger and thumb in the single - digit tasks to obtain hypothetical transport and grip components . we found a larger peak grip aperture earlier in the movement for the single - digit tasks . the timing of peak grip aperture depended in the same way on its size for all tasks . furthermore , the deviations from a straight line of the transport component differed considerably between subjects , but were remarkably similar across tasks . these results support the idea that grasping should be regarded as consisting of moving the digits , rather than transporting the hand and shaping the grip .
voltage - gated cation ( e.g. , na , k ) channels are central to neurological signal transmission . x - ray crystal structures of the open state of several voltage - gated potassium ( kv ) channels and a sodium ( nav ) channel have recently been determined . kv channels are composed of four identical subunits , each containing a voltage - sensor domain ( vsd ) and one - fourth of the pore domain ( pd ) , the latter forming the complete pore in the homotetrameric channel . despite numerous experimental and computational studies , the mechanism of voltage gating , namely the coupling of specific conformational changes within the vsd in response to depolarizing potentials with respect to the resting transmembrane electric potential , to opening the pd resulting in transmembrane ionic current , has not been fully resolved for two reasons . one arises because the direct methods utilized for the investigation of the 3-d structure of either the detergent solubilized vsd ( e.g. , x - ray crystallography and solution nmr ) or the complete kv / nav channel ( e.g. , x - ray crystallography ) can not provide the structure as a function of the membrane potential in the absence of the membrane , the closed form of the complete channel occurring only at the resting potential . another arises because the physical chemical techniques utilized to investigate the structures of the complete kv / nav channel in the membrane as a function of the potential have been more indirect . because they generally utilize site - directed mutation of one or two residues at a time within the vsd to cysteine , followed by either their labeling with large chromophores for the purpose of fluorescence or light - energy transfer measurements [ e.g. , refs ( 8 and 9 ) ] or alternatively for measuring their accessibility to lipid soluble or insoluble reagents [ e.g. , refs ( 10 and 11 ) ] , as a function of the transmembrane electric potential , they are likely to involve some perturbation of the structure and dynamics of the protein and/or its membrane environment . the vsd itself can be considered as a distinct module that , when linked to an otherwise voltage - insensitive , ion - selective membrane pore , imparts voltage sensitivity to the channel . furthermore , voltage - sensor proteins homologous with the vsd have recently been found to function themselves as voltage - gated proton channels involved in ph regulation during phagocytosis or to impart voltage sensitivity to enzymes involved in signaling . as for the complete kv / nav channels , emerging x - ray crystal structures for these proteins can not directly address their membrane potential - dependent conformational states . thus , elucidating the conformational states associated with voltage gating within the vsd itself , and these homologous voltage - sensor proteins , gains broad biological significance , especially utilizing approaches that minimize any perturbation of the structure and dynamics of either the protein itself or its membrane environment . we have developed a single membrane system containing the vectorially oriented vsd , or the complete kv / nav channel , at high in - plane density tethered to the surface of a solid inorganic substrate , as illustrated in figure 1 . two different methods were utilized to fabricate the single membrane on the surface of the substrate : one referred to as self - assembly and the other as directed assembly . although published previously , the methods are briefly summarized in the experimental methods section and illustrated with figures in the supporting information . when placed in a suitable electrochemical cell , the so - called profile structure of the membrane can be investigated using the direct methods of high energy x - ray reflectivity and neutron reflectivity , each enhanced by utilizing an interferometric technique enabled by the fabrication of an inorganic multilayer structure on the surface of the substrate to which the membrane is tethered . refers to the projection of the membrane s 3-d structure dominated by the vsd protein , parallel to the plane onto the axis normal to the plane of the membrane , as also illustrated in figure 1 . for x - rays , this projected structure is the x - ray scattering length ( or electron ) density profile ( denoted herein as the xsld profile ) and for neutrons the neutron scattering length density profile ( similarly denoted as the nsld profile ) . the significance of the x - ray ( or neutron ) interferometric technique was clearly demonstrated in an earlier publication via a direct comparison of the x - ray reflectivity from a langmuir monolayer of an amphiphilic 4-helix bundle protein at the water air interface in the absence and presence of the interferometric effect . the technique is briefly summarized in the experimental methods and illustrated with figures in the supporting information using this example . molecular graphics representation of a small 3 3 ensemble of the vectorially oriented vsd molecules ( -helices represented as solid cylinders ) solvated by a popc bilayer ( turquoise ) tethered to the surface of a solid inorganic substrate ( not shown ) below the monolayer of tethering chain molecules ( yellow ) in the side view . the profile structure arises from the projection of the 3-d structure of the membrane along rxy vectors parallel to the plane onto the z - axis normal to the plane of the membrane . the vsd molecules have been rotated randomly with respect to one another about the z - axis in the top view . however , unlike in the top view shown , experimentally , the vsd s exhibit only glass - like order in the x y plane , even at this low average area / vsd of 1400 approximating that of the experimental situation . the profile structure of this single membrane system has been extensively characterized by neutron interferometry . this characterization is in full agreement with the independent , but more limited results from x - ray interferometry . importantly , it demonstrated several key elements essential for the success of the approach utilized in this work . with reference to figure s1 in the supporting information ( from ref ( 19 ) ) , the vsd protein exhibits a unidirectional vectorial orientation in the membrane , the in - plane density of the protein is sufficiently high so that the protein dominates the profile structure with the protein occupying 50% of the membrane area , the space between adjacent protein molecules in the membrane plane is filled by an asymmetric phospholipid bilayer occupying the remaining 50% of the membrane area , the layer containing the chain molecules tethering the membrane to the inorganic surface positions the membrane 20 away from the inorganic surface , and the surface of the membrane proximal to the inorganic surface is highly hydrated to the level of 50% that of bulk water , the distal surface being fully hydrated . in this work , we report the characterization of the electrical properties of this single membrane system via electrical impedance spectroscopy . these properties ( resistance and capacitance ) were found sufficient to permit the direct measurement of changes in the sld profiles of the vsd protein , vectorially oriented within the single phospholipid bilayer membrane , as a function of the steady - state transmembrane electric potential . a time - resolved version of the direct methods of x - ray and neutron interferometry was utilized , analogous to the classic pump - probe approach widely applied using spectroscopic techniques . the transmembrane potential was varied in a stepwise , cyclic fashion with data collection at each of three values of the potential . for the x - ray case , only one cycle was sufficient to achieve satisfactory standard errors at each value of the potential due to the high photon flux density available with the synchrotron x - ray source , although four cycles of data were collected and analyzed separately . with the much lower flux density of neutrons from the spallation neutron source , the data were necessarily averaged over many cycles for each value of the potential to reduce the standard errors prior to further data reduction and analysis . this approach for each case was employed to ensure that the changes in the sld profiles detected were fully reversible and to avoid the possibility of trapping the vsd in an inactive state by exposing the protein to a particular potential for an extended time . the changes in the experimental sld profiles so observed were found to be qualitatively consistent with the results from molecular dynamics simulations of a related membrane system , thus suggesting an initial interpretation of these changes in terms of the vsd s atomic - level 3-d structure . two different methods , designated as self - assembly and directed assembly and described previously , were used for the preparation of single membranes tethered to the surface of an inorganic sigesi or sinisi multilayer substrate , the membrane composed of a phospholipid bilayer ( popc ; 1-palmitoyl-2-oleoyl - sn - glycero-3-phosphocholine ) containing the voltage sensing domain ( vsd ) of the voltage - gated potassium channel from arepyrum pernix kvap , vectorially oriented with respect to the normal to the membrane plane at high in - plane surface density . importantly , vsd : popc membranes formed by both the sa and da methods were investigated in this work . the hybrid bilayer was formed via the chemisorption of ots ( octadecyltrichlorosilane ) onto the silicon oxide surface of a sigesi multilayer substrate . a monolayer of popc ( 1-palmitoyl-2-oleoyl - sn - glycero-3-phosphocholine ) was physisorbed onto the hydrophobic surface of the substrate alkylated with the ots via the rapid solvent - exchange technique . the electrochemical cells employed in the x - ray and neutron interferometry experiments are substantially different for each of the two scattering techniques employed . as a result electrical impedance spectroscopy ( eis ) measurements , using a chi660d electrochemical workstation from ch instruments , were performed in situ on the membrane specimens utilized in the x - ray and neutron interferometry experiments , as well as on many additional , entirely analogous specimens performed ex situ . these data were usually successfully modeled with simple equivalent circuits , composed of a resistance , representing that of the silicon oxide surface of the si ge si or si ni si multilayer substrates , in series with an rc component , representing the bio - organic overlayer on its surface , e.g. , the reconstituted vsd : popc membrane or the hybrid ots : popc bilayer . interferometry is a form of the specular x - ray or neutron reflectivity technique that enhances the sensitivity to a bio - organic layer adjacent the surface of a solid inorganic multilayer substrate and allows the direct determination of the sld profile for the bioinorganic layer . the method for the collection of specular x - ray reflectivity data , enhanced by interferometry and corrected for the beam footprint on the specimen and off - specular reflectivity , from single membranes tethered to the surface of an inorganic multilayer substrate fully hydrated with an aqueous medium , utilizing synchrotron radiation from an undulator source at sufficiently high x - ray energy to penetrate the aqueous medium , has been described previously . with x - rays , the inorganic substrate was a sigesi multilayer fabricated by magnetron sputtering onto heavily doped silicon . the electrochemical cell was formed by pressing the end of 1 cm diameter kapton tubing against the surface of the substrate possessing the membrane ; the area of the membrane exposed to the x - ray beam in front - side reflection geometry was less than 0.1 1.0 cm at grazing angles of incidence . the electrolyte was 100 mm kcl in 1 mm tris buffer at ph 7.8 . the substrate served as the working electrode held at ground potential and a platinum electrode in the electrolyte served as the counter electrode to which the potential was applied via a commercially available potentiostat , also allowing for in situ measurement of the electrical properties of the membrane via impedance spectroscopy . specular x - ray reflectivity from the substrate : bio - organic overlayer system was collected in front - side geometry , utilizing a flat substrate and monochromatic radiation , performing a 2 scan to collect data over a range of momentum transfer perpendicular to the substrate surface , qz , where is the angle of x - ray incidence with respect to the plane of the substrate s surface possessing the overlayer and 2 the angle of reflection with respect to the incident beam . unlike highly penetrating neutrons , high - energy x - rays ( e.g. , > 20 kev ) are required to penetrate the aqueous medium hydrating the membrane within an electrochemical cell . herein , time resolution is utilized only to denote the investigation of the profile structure of the vsd protein at selected values of the steady - state transmembrane potential as the potential is varied cyclically in a stepwise manner over multiple cycles during reflectivity data collection . an ensemble of vsds is capable of responding to such a step in the potential on the time scale of a few milliseconds . the cyclic variation provides a key check on reversibility while avoiding trapping the protein in an inactive conformational state . with the vastly greater x - ray flux from an undulator - based synchrotron x - ray source , only very short collection times of 520 s were required for the majority of the large number of angles of incidence employed with monochromatic radiation , the incident beam appropriately attenuated to satisfy the count - rate limitations of the scintillation detector and achieve the desired standard error in the reflectivity data with increasing angle . the potential was then cycled over the sequence of 0 mv , 100 mv , + 100 mv , 0 mv for each angle of incidence , utilizing 520 s / potential with increasing angle . the entire 2 scan for one cycle over all four values of the potential required a total of 82 min . although as many as four cycles were collected for a particular specimen , the data were recorded separately for each cycle without any averaging over multiple cycles because the standard errors achieved for each value of the potential within a cycle were sufficient . the values of the potentials indicated here and subsequently refer to the potentials applied to the electrodes . impedance spectroscopy suggests that the actual transmembrane potentials are at least 5070% of these values , the reduction due to the silicon oxide surface of the substrates as described in the results section . the method for the collection of specular neutron reflectivity data , enhanced by interferometry and corrected for the beam footprint on the specimen and off - specular reflectivity , from single membranes tethered to the surface of an inorganic multilayer substrate fully hydrated with an aqueous medium , utilizing a polychromatic , pulsed spallation neutron source , has been described previously . for neutrons , the inorganic substrate was a sinisi multilayer fabricated by magnetron sputtering onto undoped silicon . the electrochemical cell was formed between the surface of the substrate possessing the membrane and a silicon wafer separated by a nitrile gasket ; the area of the membrane exposed to the incident neutron beam in backside geometry was 1.0 4.0 cm at grazing angles of incidence . the electrolyte was also 100 mm kcl in 1 mm tris buffer at ph 7.8 . again , the substrate served as the working electrode held at ground potential , and a platinum electrode in the electrolyte served as the counter electrode to which the potential was applied . with the much lesser neutron flux from the spallation source , much longer collection times of 3150 min were required for each of the few angles of incidence employing polychromatic radiation to achieve the desired standard error in the reflectivity data with increasing angle . hence , the potential was cycled over the sequence of 0 mv , + 100 mv , 100 mv , 0 mv for many cycles at each angle of incidence , utilizing 20 s / potential , and the data for each potential were summed prior to any further data reduction and analysis . the values of the potentials indicated here and subsequently again refer to the potentials applied to the electrodes . impedance spectroscopy suggests that the actual transmembrane potentials are also at least 5070% of these values , the reduction due to the silicon oxide surface of the substrates , as described in the results section . we analyzed the x - ray and neutron interferometry data in the first born approximation , which employs the fresnel - normalized specular x - ray / neutron reflectivity , r(qz)/rf(qz ) , where r(qz ) is the experimental specular reflectivity and rf(qz ) is the fresnel function . the fresnel - normalized reflectivity is proportional to the modulus square of the fourier transform f(qz ) of the gradient of the scattering - length density ( sld ) profile d(z)/dz , where the profile z - axis is normal to the plane of the interfaces(s ) comprising the system of interest . the standard errors in these data are expressed in terms of the counting statistics . these errors were propagated through the data reduction procedure , including the footprint correction , the correction for off - specular reflectivity , and division by the fresnel function for an ideal interface . it is essential to note that this procedure was precisely the same employing the same parameters , irrespective of the specimen or the applied potential for each reflectivity technique . the gradient xsld or nsld profile , [ d(z)/dz]0 mv or [ db(z)/dz]0 mv , respectively , for a particular specimen was calculated from its respective modulus data , |f(qz)| , at 0 mv potential utilizing a constrained refinement method to solve the phase problem , the integral of the gradient profile providing the xsld or nsld profile itself , (z , e / ) or b(z , 10/ ) , as fully described in prior publications . two key constraints are utilized , namely the sld profile of the inorganic multilayer substrate determined independently and the extent of the sld profile of the multilayer with the adsorbed bio - organic overlayer determined independently from the autocorrelation of its gradient profile { d(z)/dz d(z)/dz}. we then determined the difference between the xsld or nsld profile for a particular potential of 100 mv versus that at 0 mv , [ (z , e / )]100 mv or [ b(z , 10/]100 mv , by analyzing the difference modulus data , |f(qz)| = { |f100 mv ( qz)| |f0 mv(qz)| } , as fully described in the supporting information . the analysis constrained any potential differences within the region of the difference sld profiles occupied by the inorganic multilayer substrate to be negligible , compared to those within the membrane tethered to its surface . the dependence of the experimental xsld and nsld profiles on the transmembrane potential was compared with those calculated from molecular dynamics simulations of a system of one vsd embedded in an extended symmetric bilayer composed of 232 popc molecules in a symmetric water environment . in order to make this comparison with the experimental system , only the vsd s nearest - neighbor lipids were utilized in order to reduce the lipid / protein mole ratio to that comparable to the experiments , and the profiles for this truncated membrane were then calculated from the trajectories at the same potentials of 0 and 100 mv averaged over several microseconds , prior to calculating the difference time - averaged xsld and nsld profiles used in the comparison , as fully described in the supporting information . as described in the experimental methods , the electrochemical cells were somewhat different for the x - ray interferometry and neutron interferometry experiments , particularly with regard to the manner by which the electrolyte was contained . for the cell used in the x - ray experiments , the resistance of the silicon oxide surface was typically 200 k/cm for the si si multilayer reference structures fabricated on silicon . for the reconstituted vsd : popc membranes , the resistance typically varied from 200 to 400 k/cm with a capacitance of typically 23 f / cm . for the hybrid ots : popc bilayer membranes , the resistance typically varied from 250 to 350 k/cm with a capacitance of typically 12 f / cm . for the more tightly sealed cell used in the neutron experiments , the resistance of the silicon oxide surface increased to 300400 k/cm for the si si multilayer reference structures fabricated on silicon . for the reconstituted vsd : popc membranes , the resistance increased to 600700 k/cm with the capacitance decreasing to 12 f / cm . for the hybrid bilayer membranes , the resistance increased to 12 m/cm and the capacitance decreased to 0.40.6 f / cm . examples of the fit of the equivalent circuit model to the eis data from the cell used in the neutron experiments for the vsd : popc membrane , the hybrid ots : popc bilayer , and the sam used to tether the vsd : popc membrane to the surface of the sinisi substrate are shown in figure s8 of the supporting information . in view of these eis results , we estimate that the potentials across the vsd : popc membrane are likely to be only 5070% of the potentials applied to the electrodes for either the x - ray or neutron interferometry experiments , and similarly for the hybrid ots : popc bilayer for the x - ray interferometry experiments , reported herein . typical modulus data |f(qz)| from a vsd : popc membrane tethered to the surface of a sigesi multilayer substrate , prepared via directed assembly ( da ) , for the first two cycles of variation of the transmembrane potential are shown in figure 2 . the potential dependence of the modulus data was used for subsequent analysis . since the difference in the modulus data between p100 mv or m100 mv ( p/m denote + / , respectively ) and 0 mv were similar using the data for either the first or last 0 mv potential in each cycle , the data for the two 0 mv values were averaged . the difference modulus data for { p100mv-0mvave } , { m100mv-0mvave } , and { p100mv - m100mv } are also shown in figure 3 . such difference modulus data were similar for the first two cycles of the transmembrane potential and are significant because the difference data exceed the standard errors and they depend on the particular pair of potentials utilized . comparable difference modulus data were also obtained from a vsd : popc membrane , prepared via self assembly ( sa ) , for the first two cycles of variation of the transmembrane potential , thereby providing additional support for the reproducibility of these data specimen - to - specimen . by the third and fourth cycles , some evolution of the modulus data became evident , possibly arising from radiation damage ; the analyses of these data will therefore not be presented here . a hybrid bilayer membrane , composed of a chemisorbed layer of ots with an overlayer of popc lacking the vsd protein , was employed in this work primarily only as a control . typical modulus data for f(qz ) from the ots : popc hybrid bilayer for the first two cycles of variation of the transmembrane potential are shown in figure 2 . the difference modulus data for { p100mv-0mvave } and { m100mv-0mvave } are also shown in figure 2 . these difference modulus data were also similar for the first two cycles of the transmembrane potential and are significant because the difference data exceed the standard errors and they depend on the particular pair of potentials utilized . the difference modulus data for the ots : popc hybrid bilayer differ dramatically from those for the vsd : popc membrane , thereby providing an important control in momentum transfer space . left side : typical modulus |f(qz)| data ( top ) , calculated from the specular x - ray reflectivity r(qz)/rf(qz ) , where |f(qz)| = r(qz)/rf(qz ) , for the vsd : popc membrane tethered to the surface of a sigesi multilayer substrate at a transmembrane potential of 0 mv for the first two cycles of the series of potentials applied . the difference modulus data |f(qz)| for the second cycle are shown in the panels below for the pairs of potentials indicated . right side : typical modulus |f(qz)| data ( top ) for the ots : popc hybrid bilayer tethered to the surface of a sigesi multilayer substrate at a transmembrane potential of 0 mv for the first two cycles of the series of potentials applied . the difference modulus data |f(qz)| for the first cycle are shown in the panels below for the pairs of potentials indicated . the standard errors in the data are indicated for each case . reduced x - ray scattering - length density ( xsld ) profiles , (z)/si , calculated for the vsd : popc membrane tethered to the surface of a sigesi multilayer substrate ( upper left ) and the ots : popc hybrid bilayer tethered to the surface of a sigesi multilayer substrate ( upper right ) , each at a transmembrane potential of 0 mv . the profile of the multilayer substrate occurs for z < 0 ( see figure s2 of the supporting information , for example ) . the respective difference reduced xsld profiles , (z)/si for each case are shown in the panels below for the pairs of potentials indicated . the xsld profiles and their dependence on the applied potentials , as expressed in difference xsld profiles , were calculated from the modulus and difference modulus data , respectively , as described in the experimental methods . a typical xsld profile for the vsd : popc membrane at 0 mv is shown in figure 3 , along with the difference xsld profiles for { p100mv-0mvave } and { m100mv-0mvave}. by comparison with figure s1 in the supporting information , the vsd : popc membrane for these specimens is about 70 in total thickness and occurs within 25 < z < 95 of the xsld profile . the difference profiles exhibit substantial changes throughout the extent of the membrane profile and are distinctly different depending on the particular potentials utilized . in particular , for the potential pair { m100mv-0mvave } , the major changes involve a larger increase in electron density ( xsld ) over the region 55 < z < 70 and corresponding lesser decreases in electron density over the two adjacent regions 30 < z < 55 and 70 < z < 85 of the membrane profile . for the potential pair { p100mv-0mvave } , the major changes involve an increase in electron density ( xsld ) over the region 15 < z < 50 and a corresponding decrease in electron density of comparable magnitude over the adjacent region 50 < z < 85 of the membrane profile . a typical xsld profile for the ots : popc hybrid bilayer lacking the vsd protein at 0 mv along with the difference xsld profiles for { p100mv-0mvave } and { m100mv-0mvave } are also shown in figure 3 . the ots : popc hybrid bilayer for these specimens occurs within 0 < z < 50 of the xsld profile . the hydrocarbon core of the bilayer occurs within 5 < z < 35 and the popc polar headgroups within 35 < z < 55 . we note that the layer of popc polar headgroups is somewhat thicker than expected by 5 , given the spatial resolution of these profiles ( 13 ) , which may arise from the surface roughness of the sigesi multilayer substrates . the difference profiles exhibit substantial changes throughout the extent of bilayer profile , and they are distinctly different depending on the particular potentials utilized . in particular , for the potential pair { m100mv-0mvave } , the major changes involve increases in electron density ( xsld ) over the regions 10 < z < 25 and 40 < z < 50 and a corresponding decrease in electron density of comparable magnitude over the intervening region 25 < z < 40 of the bilayer profile . for the potential pair { p100mv-0mvave } , the major changes involve a large increase in electron density ( xsld ) over the region 35 < z < 55 and a corresponding decrease in electron density of comparable magnitude over the adjacent region 25 < z < 35 of the bilayer profile . importantly , these changes are very different from those for the vsd : popc membrane described above , the comparison facilitated by their juxtaposition in figure 3 , thereby providing an essential control in real space . while the standard errors are readily apparent in the modulus data , they are not so evident in the fourier analysis of these data . however , the control experiments utilized herein provide an important measure of these errors propagated through the analysis . in the x - ray case , the low amplitude , short wavelength fluctuations arising from transform truncation in the reduced xsld profile for the ots : popc hybrid bilayer within the region 60 < z < 120 , occupied only by the aqueous electrolyte where the profile should be flat , indicate that the propagated errors remain below the 5% level ( with reference to figure 3 ; right side , top panel ) . the propagated errors are thereby seen to rise to the 10% level within the same region of the difference xsld profiles ( with reference to figure 3 ; right side , middle and lower panels ) . unlike the case with x - rays , the modulus data for f(qz ) from the fresnel - normalized neutron reflectivity data from a vsd : popc membrane , prepared via self assembly ( sa ) , the control was composed of only the chemisorbed organic chain molecules , or sam , used to tether the vsd protein to the inorganic substrate surface , thus lacking the vsd protein . the difference modulus data for { p100mv-0mvave } , { m100mv-0mvave } , and { p100mv - m100mv } are shown in figure 4 for both the membrane and the sam . the errors for both the membrane and sam are larger than those for the x - ray case . nevertheless , the difference data remain significant as they barely exceed the standard errors , they depend on the particular pair of potentials utilized , and they differ between the vsd : popc membrane and the control sam lacking vsd protein . modulus |f(qz)| data calculated from the specular neutron reflectivity r(qz)/rf(qz ) , where |f(qz)| = r(qz)/rf(qz ) , for the vsd : popc membrane tethered to the surface of a sinisi multilayer substrate ( upper left ) and for the sam chemisorbed onto the surface of a sinisi multilayer substrate ( upper right ) , each at a transmembrane potential of 0 mv . the respective difference modulus data |f(qz)| for each case are shown in the panels below for the pairs of potentials indicated . the nsld profiles and their dependence on the applied potentials , as expressed in difference nsld profiles , were calculated from the modulus and difference modulus data , respectively , as described in the experimental methods . in figure 5 , we compare the nsld profile at 0 mv and the difference nsld profiles for { p100mv-0mvave } and { m100mv-0mvave } for the vsd : popc membrane with those from the sam . by comparison with figure s1 in the supporting information , the vsd : popc membrane for these specimens occurs within 25 < z < 95 of the nsld profile . the difference profiles exhibit substantial changes throughout the extent of vsd : popc membrane profile and are distinctly different depending on the particular potentials utilized . in particular , for the potential pair { m100mv-0mvave } , the major changes involve an increase in nsld over the region 80 < z < 100 and corresponding decrease in nsld over the adjacent region 55 < z < 80 of the membrane profile . for the potential pair { p100mv-0mvave } , the major changes involve a comparable increase in nsld over the two regions 30 < z < 50 and 70 < z < 90 , with smaller decreases in nsld for the region z < 30 and the intervening region 50 < z < 70 of the membrane profile . the corresponding difference profiles for the sam are essentially featureless , again providing an essential control in real space . neutron scattering - length density ( nsld ) profiles , b(z ) , calculated for the vsd : popc membrane tethered to the surface of a sinisi multilayer substrate ( upper left ) and for the sam chemisorbed onto the surface of a sinisi multilayer substrate ( upper right ) , each at a transmembrane potential of 0 mv . the respective difference nsld profiles , b(z ) , for each case are shown in the panels below for the pairs of potentials indicated . again , while the standard errors are readily apparent in the modulus data , they are not so evident in the fourier analysis of these data . the control experiments utilized provide an important measure of these errors propagated through the analysis . in the neutron case , the low amplitude , short wavelength fluctuations arising from transform truncation in the reduced nsld profile for the sam within the region 40 < z < 120 , occupied only by the aqueous electrolyte where the profile should be flat , indicate that the propagated errors are larger but remain below the 10% level ( with reference to figure 5 ; right side , top panel ) . the propagated errors are thereby seen to rise to the 20% level within the same region of the difference nsld profiles ( with reference to figure 5 ; right side , middle and lower panels ) . as described in the introduction , the structure of the reconstituted vsd : popc membranes central to these studies has been extensively characterized by both x - ray and neutron interferometry in prior work . their electrical properties within the electrochemical cells utilized in this work have been found sufficient to support transmembrane electric potentials , although these are only 5070% of the potentials applied to the electrodes due to the presence of a silicon oxide layer on the surface of the inorganic substrates to which the membranes are tethered . the structure of the ots : popc bilayer , utilized only as a control in these studies , has also been characterized by x - ray interferometry . its electrical properties within the electrochemical cells utilized in this work have been found sufficient to support transbilayer electric potentials , although again these are only 5070% of the potentials applied to the electrodes . the results from both the time - resolved x - ray and neutron interferometry experiments described demonstrate directly that significant changes occur throughout the profile structure of the vsd : popc membrane upon application of a transmembrane electric potential , and the changes depend on the sign of the applied potential with respect to zero potential . with reference to the resting potential of the natural membrane , for the vectorial orientation of the vsd within the membrane in our electrochemical cells , { p100mv-0mv } would refer to a polarizing potential difference while { m100mv-0mv } would refer to a depolarizing potential difference . such potential - dependent changes are either completely different for the ots : popc hybrid bilayer membrane or essentially absent for the sam , both serving as important controls lacking the vsd protein . since the physical origin of the atomic scattering factors for x - rays and neutrons is entirely different , the latter being much more sensitive to the distribution of exchangeable hydrogen including water , we have therefore verified the existence of potential - dependent changes within the profile structure of the vsd : popc membrane by two independent scattering methods . in addition , the difference sld profiles for the depolarizing potential pair { m100mv-0mv } convincingly demonstrate that a potential of 0 mv does not produce the depolarized state of the vsd , as has been commonly assumed [ e.g. , refs ( 3) , etc . ] . it is important to note that these new experimental results stand on their own , in the sense that any modeling of their structural significance at the 3-d atomic - level must account for the changes in the profile structure described . prior to addressing the structural significance of the observed potential - dependent changes in the sld profiles , it is important to reiterate that the changes described were both reproducible and reversible . reproducibility for both the x - ray and neutron experiments is described in some detail in the supporting information . the inactivation associated with the complete kvap channel ( from which the vsd was derived ) in electrophysiological experiments , arising from multiple cycles of depolarization and repolarization of the membrane potential on a time scale of 100200 ms per potential , could have undermined these experiments . in the x - ray case , it was not necessary to average over multiple cycles , and the experimental modulus data for the two 0 mv potentials employed within each of the four cycles investigated superimposed to within the noise level , demonstrating reversibility despite the longer time scale of 520 s per potential . furthermore , the potential - dependent changes in the xsld profiles were similar for the first and second cycles , in terms of the positions and amplitudes of their major features as evident from a comparison of figures 3 and 6 , although they do differ in detail . neither would have occurred with any substantial level of inactivation comparable to that for the complete kvap channel , for which the entire ensemble becomes inactivated after only three cycles . for the neutron case , averaging over many cycles was required to achieve a satisfactory noise level in the modulus data for each value of the potential . again , if inactivation on a time scale of 20 s , comparable to that for the complete kvap channel , had been a major factor cycle - to - cycle , potential - dependent changes in the modulus data would have vanished with averaging over many cycles . thus , the inactivation associated with the complete channel does not appear to play any significant role in these studies of the isolated vsd protein . left side : comparison of the difference xsld profiles determined from the x - ray interferometry experiments for vsd : popc membrane tethered to the surface of an inorganic multilayer substrate ( dotted ) from the first cycle of the series of potentials applied , with those calculated from molecular dynamics simulations for an untethered vsd : popc membrane ( solid ) for the two pairs of potentials indicated , each membrane fully hydrated . right side : the same comparison , but with the abscissa scale for the difference profiles calculated from the simulation expanded by 25% . the time - averaged profiles calculated from the simulations have been smoothed via convolution with a gaussian whose 1/e width was 2. the difference in the physical origin of the atomic scattering factors for x - rays and neutrons noted above makes it difficult to compare xsld and nsld profiles , and their respective potential - dependent difference profiles employed in this work , in the absence of a detailed atomic - level model for the vsd : popc membrane . furthermore , given the complexity of the membrane , and the fact that the profile structure is a 1-d projection of the 3-d structure , the observed changes in the profile structure of the vsd : popc membrane , in terms of its xsld and nsld profiles , have no simple interpretation . however , both the vsd itself and in a full - length kv - channel within fully hydrated popc membranes have been extensively investigated recently via molecular dynamics simulations as a function of the applied transmembrane electric potential . such simulations of only a single vsd or full - length kv - channel protein within the hydrated bilayer membrane require very long trajectories ( 10 and 100 s time scale , respectively ) as made possible by anton , a special - purpose supercomputer for molecular dynamics simulations . since these simulations contain the full 3-d atomic - level structure of the complex membrane system , it is straightforward to calculate its projected profile structure , time - averaged over a selected segment near the end of the trajectory over which the structure exhibits stability . in figure 6 , we compare the difference xsld profile structures from the experiments reported here for the first cycle in the variation of the transmembrane potential with those calculated from the simulations of the vsd within a fully hydrated popc membrane for both the polarizing and depolarizing cases as defined above . it is essential to note here that although the simulations were for an isolated vsd , they were set up based on indirect experimental data on the complete kvap channel , thereby biasing the results toward those for the vsd within the complete channel . the agreement from this comparison is only qualitative because although the difference profiles exhibit very similar shapes ( using similar in the geometric sense ) , the membrane profile from the simulations appears 2025% thinner than those for the tethered membrane in the experiments . for the purpose of demonstrating this geometric similarity , a 25% expansion of the abscissa scale for the simulation can readily be seen to improve the agreement between the experiments and the simulation , as also shown in figure 6 . this agreement between the experiment and the simulation is slightly better for the first cycle in the variation of the potential , as shown , than for the second cycle ( not shown ) . in figure 7 , we compare the difference nsld profile structures from the experiments reported here , in which the interferometric data for each value of the potential was an average over many cycles in the variation of the transmembrane potential , with those calculated from the simulations for the vsd within a fully hydrated popc membrane for both the polarizing and depolarizing cases as defined above . here , we show only the case for the 25% expansion of the abscissa scale . like the x - ray case , the experimental difference nsld profiles have very similar geometric shapes compared to their counterparts from these simulations . comparison of the difference nsld profiles determined from the neutron interferometry experiments for vsd : popc membrane tethered to the surface of an inorganic multilayer substrate ( dotted ) with those calculated from molecular dynamics simulations for an untethered vsd : popc membrane ( solid ) for the two pairs of potentials indicated , each membrane fully hydrated . as with the comparison of the difference xsld profiles shown in figure 6 , we show here only the case where the abscissa scale for the difference profiles calculated from the simulation have been expanded by 25% . the time - averaged profiles calculated from the simulations have been smoothed via convolution with a gaussian whose 1/e width was 2 , the larger value used here to allow for the lower spatial resolution of the nsld profiles . . there may be an explanation for the larger extent of the vsd : popc membrane profile in our experiments arising from differences in the x - ray crystal and nmr solution structures of the isolated , detergent - solubilized vsd compared to that within the x - ray crystal structure of the complete kv channel utilized in the simulations . first , the vsd protein construct in the experiments includes 18 additional residues on the n - terminus that were not explicitly modeled in the simulations , since it only appears in the nmr solution structure of the isolated vsd . ten residues in this sequence form an -helix ( designated as the s0 helix ) that , while not expected to change configuration under an applied potential , would occur on the proximal side of the membrane ( with respect to the substrate surface ) . it could increase the overall membrane thickness by as much as 15 , were its orientation approximately parallel to the axis of the transmembrane 4-helix bundle structure formed by helices s1s4 of the vsd , as in the nmr structure , and thereby approximately perpendicular to the membrane surface . second , in the simulations , the 12-residue s4s5 linker helix was aligned nearly parallel to the membrane surface as within the x - ray structure of the complete kv channel , unlike that for the isolated vsd in these experiments where the linker helix is an linear extension of the s4 transmembrane helix , thereby extending the length of the s4 helix in the transmembrane direction by as much as 18 , again depending on its precise orientation approximately perpendicular to the membrane surface . thus , favorable orientations of the s0 helix and of the s4s5 linker helix on the proximal side of the membrane approximately perpendicular to the membrane surface , associated with the very low lipid content of the membrane of only 24 popc nearest - neighbor molecules per vsd in these experiments , would be sufficient to explain the increase in the profile extent of the membrane dominated by the vsd protein , namely from 55 in the simulations to 70 , or by 25% . furthermore , potential - dependent changes in the profile would also be expected to occur over this increased extent given the likely origin of the conformational changes expected in the vsd that involve translation of the s4 helix in the transmembrane direction , as described below , that would likely include the translation of its linear extension through the s4s5 linker helix for the isolated vsd . the qualitative level of agreement between experiments and simulations , as shown in figures 6 and 7 , suggests that the voltage - dependent changes observed in the sld profiles arise from conformational changes in the isolated vsd that include an effective displacement of the helical hairpin formed by the s4 helix and the c - terminal half of the s3 helix ( termed s3b ) , as depicted in figure 8 , similar to those measured indirectly within the complete kv channel . the basic side chains in s4 contribute most of the charge that give rise to the gating currents in electrophysiology experiments . the simulations used here predict a substantial translational motion of the s4 helix along the transmembrane direction of 1012 between the depolarized and the polarized states . the indirect experiments on the complete kv channel suggest that the magnitude of this displacement may be slightly larger of 1215 ( see figure 2 in ref ( 26 ) for a direct comparison ) . importantly , these particular conformational changes must result in the propagation of changes over the entire 60 extent of the profile structure of the isolated vsd , as evident from the qualitative level of agreement between the experiments and the simulations . a key structural feature of the membrane - embedded vsd predicted by simulations and confirmed by neutron interferometry is that the interior of the vsd is hydrated along the entire length of its profile . our simulations suggest that measured gating charge displacements are the result of water - catalyzed rearrangements of salt bridges between the s4 basic side chains and the set of conserved acidic side chains on the s1s3 helical segments in the hydrated interior of the vsd ( figure 8) , an observation that is consistent with more extensive simulations of the kv full - length channel performed in the absence of any experimental restraints . these specific structural and mechanistic models gain definitive support from the direct measurements of potential - dependent structural changes within the isolated vsd protein reported here . top row : the vsd backbone is shown in ribbon representation with the s1s3a segments colored orange , the s3b s4 helix - turn - helix in purple , and the s4s5 linker in green . conserved charged side chains ( shown as filled spheres ) are colored by atom type ( carbon , silver ; oxygen , red ; nitrogen , blue ) . upon a change in applied membrane potential , the motion of the highly conserved basic side chains on ( r1 through k7 ) on the s4 helix induces conformational changes in the s3b s4 helical hairpin . as the basic side chains move within the membrane electric field , they exchange salt - bridge interactions with acidic side chains in conserved positions ( e1 , d2a , d2b , and e3 ) as well as two additional acidic side chains in s3b and s1 ( unlabeled ) . bottom row : the solvation of the vsd by the membrane environment is represented as a h bond network between the vsd basic and acidic side chains ( blue and red , respectively ) , lipid phosphate groups ( yellow ) , and waters ( colored by atom type ) . nevertheless , in order to obtain a more quantitative level of agreement with the experiments , the simulations would need to be modified to better represent the application of transmembrane electric potentials to a tethered vsd : popc membrane more closely approximating that of the experiments , specifically with regard to the asymmetric profile structure of the popc bilayer and the elongated profile extension of the isolated vsd protein within the membrane , as well as the partial hydration on the proximal side of the membrane in contrast to the full hydration of its distal side . such simulations are a substantial investigation on their own beyond the scope of this work . in addition , we anticipate that the experimental structural results will be further refined in the future to define the potential - dependent positions of the key elements of helical secondary structure within the isolated vsd , employing site - directed labeling with methyl - hg for time - resolved resonance x - ray interferometry and site - specific deuterium labeling ( enabled by protein semisynthesis ) for time - resolved neutron interferometry . lastly , we note that the time - resolved x - ray interferometry approach can be also applied to the complete kvap channel , despite its inactivation associated with multiple cycles of depolarization and repolarization , because satisfactory standard errors can be achieved within a single cycle . this will allow a more definitive comparison of the conformational changes within the vsd s profile structure associated with voltage gating for the isolated vsd with those for the vsd within the complete kv channel , due to the distinct advantage of utilizing the same direct method on each of the two proteins under otherwise identical experimental conditions . in contrast with prior studies , this work describes the measurement of changes in the structure of the isolated vsd protein , vectorially oriented within a reconstituted phospholipid bilayer membrane , as a function of the transmembrane electric potential using two direct and independent scattering techniques . time - resolved x - ray interferometry and time - resolved neutron interferometry have been employed to provide the dependence of their respective scattering - length density ( xsld and nsld ) profiles at three values of the potential spanning the physiological range . the results convincingly demonstrate that a potential of 0 mv does not actually produce the depolarized state of the vsd , as has been commonly assumed . the changes in the experimental xsld and nsld profiles for both polarizing and depolarizing potentials with respect to zero potential extend over the entire 60 length of the profile structure of the isolated vsd . these changes are in qualitative agreement with molecular dynamics simulations of a related membrane system , thus suggesting a possible origin of these changes in terms of the isolated vsd s atomic - level 3-d structure .
the voltage sensor domain ( vsd ) of voltage - gated cation ( e.g. , na+ , k+ ) channels central to neurological signal transmission can function as a distinct module . when linked to an otherwise voltage - insensitive , ion - selective membrane pore , the vsd imparts voltage sensitivity to the channel . proteins homologous with the vsd have recently been found to function themselves as voltage - gated proton channels or to impart voltage sensitivity to enzymes . determining the conformational changes associated with voltage gating in the vsd itself in the absence of a pore domain thereby gains importance . we report the direct measurement of changes in the scattering - length density ( sld ) profile of the vsd protein , vectorially oriented within a reconstituted phospholipid bilayer membrane , as a function of the transmembrane electric potential by time - resolved x - ray and neutron interferometry . the changes in the experimental sld profiles for both polarizing and depolarizing potentials with respect to zero potential were found to extend over the entire length of the isolated vsd s profile structure . the characteristics of the changes observed were in qualitative agreement with molecular dynamics simulations of a related membrane system , suggesting an initial interpretation of these changes in terms of the vsd s atomic - level 3-d structure .
on september 23 , 2014 , a healthcare worker was admitted to mengo hospital in kampala , uganda , with a febrile illness suspected to be viral hemorrhagic fever ( vhf ) . the patient , a 30-year - old man , was a radiographer who worked at mengo hospital and part - time at mpigi health center iv in the mpigi district , 30 km south of kampala ( figure 1 ) . a rapid diagnostic test result was positive for malaria , and the patient was given intravenous ceftriaxone , 5% dextrose , and artesunate . however , his condition continued to deteriorate . locations where patient with confirmed marburg virus disease lived , worked , and was buried , kampala , uganda , 2014 . clinical findings included fever ( temperature 38.4c ) , nausea , vomiting , diarrhea , musculoskeletal pain , abdominal pain , headache , sore throat , difficulty swallowing , difficulty breathing , anorexia , bleeding from the nose , bloody stools , vomiting blood , and upper gastrointestinal tract bleeding . whole blood and serum samples collected on september 28 were sent to the uganda virus research institute ( uvri)/us centers for disease control and prevention ( cdc ) vhf laboratory in entebbe for testing on september 30 . we performed diagnostic testing by real - time reverse transcription pcr ( rt - pcr ) targeting the marv np gene , antigen detection , and marv igm elisa on the suspected sample as described ( 8) . we detected marv by rt - pcr , but antigen detection and igm serologic results were negative . we obtained independent confirmation from duplicate whole blood and serum samples by using rt - pcr primers and probes targeting marv vp40 gene and a commercial filovirus pcr screening assay ( altona diagnostics , hamburg , germany ) ( 9 ) ( table ) . on the basis of the positive rt - pcr results , we confirmed mvd in this patient . we shipped specimens to the cdc viral special pathogens branch , division of high - consequence pathogens and pathology , national center for emerging and zoonotic infectious diseases ( atlanta , ga , usa ) , for further testing , including virus isolation and sequencing . a virus isolate ( 812601 ) was generated from the clinical specimen after a single passage in cell culture ( vero e6 ) . after laboratory confirmation , a multidisciplinary team from uvri and cdc - uganda performed the initial outbreak investigations at mengo hospital and mpigi health center iv . the investigation team provided the outbreak case definition , and details of case contacts were obtained from both health facilities . an investigation was also performed in kasese district , where the health worker was taken for burial . in addition , an ecologic investigation was conducted to identify roosting sites nearby for the potential presence of r. aegyptiacus bats . we created an outbreak database by using the epi info viral hemorrhagic fever outbreak management application ( 10 ) . all case and contact data were managed by the uganda ministry of health public health emergency operations center . we identified 197 close contacts , who were followed for 21 days . during the course of follow - up , 33 ( 16.2% ) of the 197 contacts converted to suspected case - patients by exhibiting clinically compatible signs or symptoms matching the outbreak case definition . blood samples from suspected case - patients were tested at the uvri / cdc laboratory in entebbe ; all were negative for marv by rt - pcr and serologic analysis . we describe the second single - case filovirus outbreak detected in uganda ; a case of infection with sudan ebolavirus was reported in luwero district in 2011 ( 11 ) . the investigation was unable to identify a conclusive source of infection , including evidence of the natural reservoir host near where the infected patient was working or residing or potential cases in persons who visited health centers before this case was confirmed . the patient tested positive for malaria but later tested positive for marv by rt - pcr and serologic analysis . these findings indicate that co - infection of viral hemorrhagic fever ( vhf ) and other tropical infectious diseases can confound diagnosis and delay early detection , potentially resulting in large outbreaks that are much harder to control , as was seen during the 20142015 ebola virus outbreak in west africa ( 12 ) . this finding emphasizes the need for continued surveillance and awareness even when other , more common pathogens are initially suspected . the finding of no secondary cases in this investigation can be attributed , in part , to use of infection control practices and personal protective equipment when first encountering a suspected vhf case . because uganda has experienced 10 vhf outbreaks since 2011 , increased awareness and use of personal protective equipment and infection control practices have greatly limited secondary transmission , especially in the healthcare setting . routine use of gloves , protective gowns , and chlorine is now more common in lower - level healthcare facilities in uganda ; these protective products were used at both mengo hospital and mpigi health center iv . the full genomic sequence of this marv isolate ( 812601 ; genbank accession no . kp985768 ) falls into a cluster that consists mostly of marv sequences isolated from bats . the closest related sequence was obtained from marv isolated from a juvenile male r. aegyptiacus bat ( q843 ) captured in august 2009 in python cave , queen elizabeth national park ( figure 2 ) . other viral sequences from bat specimens in this clade were from bats collected from either python cave or the kitaka mine during 20072009 . the most closely related human sequence ( 01uga07 ) was from a miner who worked in the kitaka mine in july 2007 ( 3,7 ) . because of the wide genetic diversity of marvs , there is no definitive way to identify where this patient may have become infected . phylogenetic tree comparing complete or nearly complete marburg virus ( marv ) genomes sequenced from bat and human sources in uganda . a consensus whole - genome sequence was assembled by mapping reads to the reference marv sequence nc_001608 using clc genomics workbench ( waltham , ma , usa ) . viral sequences acquired from human sources are in standard type , and viral sequences acquired from bats are italicized ; the sequence from the human case - patient described in this study , mbg 812601 2014 , is in bold . evolutionary history was inferred using the maximum - likelihood method based on the tamura - nei model with mega6.06 . the tree is drawn to scale , with branch lengths measured in the number of substitutions per site . genbank accession numbers used in this tree are kp985768 , jx458855.1 , fj750957.1 , jx458852.1 , jx458854.1 , fj750958.1 , jx458856.1 , jx458828.1 , jx458826.1 , jx458834.1 , dq447651.1 , jx458846.1 , ay358025.2 , dq447657.1 , z12132.1 , nc_001608.3 , z29337.1 , ef446132.1 , jn408064.1 , kc545388.1 , kc545387.1 , dq447649.1 , ef446131.1 , dq447652.1 , fj750956.1 , fj750955.1 , and fj750953.1 . we do not know why the patient did not transmit marv to any of his close contacts . we can assume that none of the contacts had substantial exposure to the patient while he was infectious . the relatively small size of this and previous filovirus outbreaks in uganda can be attributed to enhanced vhf surveillance , rapid case identification , laboratory testing , and investments from the global health security agenda in rapid sample transportation to the national vhf reference laboratory for diagnostic testing ( 13 ) . vhf surveillance continues to be a top priority for uganda , and the vhf surveillance program continues to play a crucial role in detecting , responding to , and helping to control these outbreaks .
in september 2014 , a single fatal case of marburg virus was identified in a healthcare worker in kampala , uganda . the source of infection was not identified , and no secondary cases were identified . we describe the rapid identification , laboratory diagnosis , and case investigation of the third marburg virus outbreak in uganda .
we analyzed 12 neuronal datasets recorded from two human clinical trial participants with tetraplegia ( hs1 and hs3 ) and four monkeys ( mla , mcl , mco and mab ) . these included m1 recordings taken while human participants performed two sessions of a neural cursor center - out task ( that is , a task where the participant used , via a neural interface , his or her own recorded m1 spiking activity to move a computer cursor to targets radially positioned on the computer screen ) , m1 recordings from two monkeys ( mla and mcl ) , each performing two sessions of a task requiring planar point - to - point reaches toward targets randomly placed in the workspace , simultaneous m1 and pmv recordings from a monkey ( mco ) performing two sessions of a task that required reach and grasp toward moving objects in a three - dimensional workspace , and simultaneous m1 and 5d recordings from a monkey ( mab ) performing two sessions of a pursuit tracking task that required planar hand movements . minimum inter - electrode distance in the 10 10 microelectrode array was 400 m . maximum inter - electrode distance , including electrodes in two arrays , was ~2 cm ( supplementary fig . 1 ) . to assess the predictive power of spiking histories , we first computed the probability that any given i neuron xi , t was going to spike at time t , conditioned on spiking histories t from the past 100 ms up to ( but not including ) time t. without further constraints , direct estimation of conditional probability distributions for high - dimensional systems is typically an intractable problem , leading to combinatorial explosion and requiring amounts of data that grow exponentially with the number of neurons in the ensemble . instead , we took advantage of the fact that this conditional probability can be computed as16 equation ( 1)pr(xi , t=1|t)t(t|t) where i(t| t ) is the instantaneous spiking rate ( conditional intensity function ) of the neuron and = 1 ms in our discrete time representation , and used a simplified model to capture the relationship between the instantaneous rate and spiking histories equation ( 2)log(i(t|t))=i+k1,ixi+jik2,i , jxj the term i relates to a background level of spiking activity , xi is the spiking history in the specified time interval for the i neuron , i = 1 , 2 , , n recorded neurons , and k1,i and k2,i , j denote temporal filters related to intrinsic and ensemble history effects , respectively . once an instantaneous spiking rate model was fitted , the estimated probability of a spike at any given time bin , conditioned on intrinsic and ensemble spiking histories , was easily computed using equation ( 1 ) ( the spike prediction approach is shown using cell 34a ( hs3 ) as the example target neuron ; fig . 1 ) . on the basis of the estimated conditional spiking probabilities , we used a standard tool , the roc curve analysis19 , to assess the predictive power of spiking history models ( see online methods ) . spike prediction in 1-ms time bins based on spiking histories was substantial . intra - areal ensemble history based predictions in m1 resulted in high true - positive rates while maintaining low numbers of false positives . for example , it was possible to correctly predict 80% of spikes in neuron 34a ( participant hs3 ) with a false - positive rate of less than 5% ( fig . similarly , an 80% true - positive rate was obtained for neuron 16a ( monkey mla ) with a less than 10% false - positive rate ( fig . this predictability was substantial despite the weak pair - wise correlations that we observed among all neuronal pairs in the recorded datasets for hs3 and mla ( fig . 2c , we obtained a more comprehensive assessment of predictive performance by computing the area under the roc curve . the area under the curve ( auc ) is a global summary statistic ; that is , it depends on both the true- and false - positive rates and on all of the possible thresholds on the spiking probability . the auc gives the probability that , when two samples are randomly drawn from the data ( one containing a spike , the other not ) , the conditional intensity model will assign a higher probability ( i.e. a higher instantaneous spiking rate ) to the sample with a spike20 . it therefore provides an assessment of the discriminatory power for predictive variables under a given model . it approaches 0.5 for a chance level predictor , that is , a predictor having false- and true - positive rates along the diagonal , and it equals 1 for a perfect predictor . 2a ) . we further corrected the auc by subtracting chance - level predictions estimated from the actual data and scaled it to obtain a quantity that ranged from 0 ( no predictive power ) to 1 ( perfect prediction ) . we refer to this corrected and normalized auc measure as the predictive power ( see online methods ) . more than 50% of examined neurons in monkey mla showed a predictive power higher than 0.5 ( median = 0.55 , range = 0.10.89 ) ( fig . 3 ) . prediction in subjects mcl and hs3 showed similar performances , with medians of 0.45 and 0.49 and ranges of 0.180.91 and 0.230.97 , respectively . predictive power was lower for participant hs1 ( median = 0.30 , range = 0140.69 ) . we conjectured that this was probably a result of the smaller number of neurons ( n = 21 , n = 22 ) that were recorded and used for prediction in this participant . to test this conjecture , we computed the predictive power on the basis of several smaller ensemble subsets ( n = 22 neurons ) randomly chosen out of the 110 neurons from hs3 s dataset ( session 2 ) . data from hs3 provided a good reference , as neurons were recorded from m1 under the same task condition as for hs1 . the distribution of predictive power values , based on this collection of smaller ensemble subsets , was similar to the one obtained for hs1 , supporting our hypothesis ( supplementary fig . 2 and supplementary note ) . these predictive power levels were obtained using the full history models , that is , the instantaneous spiking rate of each neuron conditioned on both intrinsic and ensemble histories . we further compared the predictive power of each of these two components separately ( fig . the predictive power obtained exclusively from the ensemble histories was larger than the predictive power from intrinsic histories . in addition , it is possible that some of the intrinsic history effects , beyond refractory and recovery period effects , could also reflect network dynamics . thus , these results indicate that the collective ensemble activity , rather than refractory and recovery dynamics , was the main source of the observed predictive power of spiking histories . the predictive power of these m1 spiking history models in monkeys mla and mcl was also higher than the predictive power of relevant kinematic covariates , such as hand position and velocity ( supplementary fig . 3 and supplementary note ) . we used pathlet models21 to estimate spiking probabilities conditioned on kinematics ; that is , the instantaneous spiking rate was expressed as function of hand position and velocity trajectory in the time interval ( 200 ms , 300 ms ) with respect to spiking time . furthermore , the predictive power values of spiking history and pathlet models were not strictly additive ( supplementary fig . this result indicates that there was some level of redundancy between the information conveyed by these two models about single - neuron spiking : some of the spiking activity that was predicted by the spiking history models could also be predicted by the examined kinematics . beyond examining the predictive power of ensemble spiking histories , we were also interested in the predictive power of instantaneous collective states in the recorded ensemble , that is , simultaneous states at either 1- or 10-ms temporal resolution . instantaneously correlated states could result from common inputs and/or from synchronization patterns arising from the neuronal network s own dynamics . strong instantaneous collective states7 could still be consistent with the weak pair - wise instantaneous interactions that we observed in our datasets ( fig . we estimated the joint probability distribution of these instantaneous collective states by fitting maximum entropy22,23 point process models constrained by empirical mean spiking rates and zero time - lag pair - wise correlations . that is , these maximum entropy distribution models were consistent with the observed mean spiking rates and zero time - lag pair - wise correlations , but made no additional assumptions ( see online methods ) . this pair - wise maximum entropy probability model , also known as the ising model in statistical mechanics24,25 , has been shown to capture most of the instantaneous interdependency structure in ex vivo / in vitro neuronal ensemble preparations7,8,10 . besides satisfying the pair - wise correlation structure in the examined datasets , the estimated models also accounted well for the distribution of multiple - neuron spike coincidences , as seen in the comparison of the empirical distribution and the distribution generated from the model via gibbs sampling26 ( fig . , the predictive power of this pair - wise correlation structure was considerably poorer than the predictive power of intrinsic and ensemble spiking histories , as captured by the models ( fig . - wise maximum entropy models corresponded to 0.10 0.17 , while the spiking history models yielded values of 0.50 0.40 ( mean s.d . ) . the predictive power of spiking history models were still higher when we considered instantaneous states at a coarser 10-ms temporal resolution ( fig . 4 ) , which resulted in predictive power values of 0.26 0.27 ( mean s.d . ) . we performed the same predictive power analysis for areas pmv and 5d and compared predictions based on ensemble histories recorded from the same or a different cortical area in the connected pairs m1pmv and m15d ( fig . predictive power , based on both local and inter - areal spiking histories , corresponding to target neurons in pmv ( mco ; fig . 5c ) had medians of 0.27 and 0.32 and ranges of 0.110.86 and 0.130.62 , respectively . predictive power corresponding to target neurons in m1 , based on both local and inter - areal spiking histories , had medians of 0.50 and 0.40 and ranges of 0.150.93 and 0.110.83 for monkeys mco and mab , respectively ( fig . the inter - areal predictive power could also be substantial in both directions , m1pmv and m15d ( fig . medians were 0.15 , 0.13 , 0.13 and 0.09 and ranges were 0.050.73 , 0.060.75 , 0.060.37 and 0.050.37 for m1pmv , pmvm1 , m15d and 5dm1 , respectively . furthermore , the predictive power from one area to target neurons in the other , especially from m1pmv , could be larger than the predictive power of local ensembles ( fig . we speculated that the higher predictive power of m1pmv in some of these cases could simply reflect the larger number of recorded neurons in m1 , rather than the relative strength of feedforward and feedback connections between these two areas . a supplementary analysis using ensembles of equal size suggested that this was the case ( supplementary fig . 5 and supplementary note ) . this analysis also indicated that intra - areal predictive power was slightly higher than inter - areal predictive power when ensembles of equal size were considered . as shown before for subjects mla and mcl , the predictive power of spiking history models for areas m1 , 5d and pmv also tended to be higher than the predictive power of pathlet models ( supplementary fig . the medians and ranges of predictive power values for pathlet models corresponded to 0.25 and 0.21 , and 0.010.77 and 0.010.75 for mco and mab , respectively . the predictive power of spiking history models varied broadly across the 1,187 neurons in the 12 datasets . we examined whether this variation could be easily explained by simple features of the predicted spiking activity . the predictive power of history models did not appear to depend , at least in a simple manner , on the mean spiking rate or on the level of irregularity of the predicted spiking activity ( fig . assessments of spike train irregularity were based on the coefficient of variation3 of the interspike time intervals . we also assessed how much information was involved in the prediction of single neuron spiking . in principle , the same level of prediction accuracy could be achieved for two different target neurons while involving different amounts of information . we examined this possibility by asking how much information about a neuron spiking or not at any given time was gained by modeling the intrinsic and ensemble history effects compared with knowing only the mean spiking rate of the process . this information gain can be estimated as the normalized difference between the log - likelihood under the estimated history model and the log - likelihood under a homogenous poisson process with given mean spiking rate ( see online methods ) . our analysis confirmed that similar predictive power values ( in the prediction of different target neurons ) could involve a wide range of information rates ( fig . on the basis of the estimated conditional spiking probabilities , we used a standard tool , the roc curve analysis19 , to assess the predictive power of spiking history models ( see online methods ) . intra - areal ensemble history based predictions in m1 resulted in high true - positive rates while maintaining low numbers of false positives . for example , it was possible to correctly predict 80% of spikes in neuron 34a ( participant hs3 ) with a false - positive rate of less than 5% ( fig . similarly , an 80% true - positive rate was obtained for neuron 16a ( monkey mla ) with a less than 10% false - positive rate ( fig . this predictability was substantial despite the weak pair - wise correlations that we observed among all neuronal pairs in the recorded datasets for hs3 and mla ( fig . 2c , we obtained a more comprehensive assessment of predictive performance by computing the area under the roc curve . the area under the curve ( auc ) is a global summary statistic ; that is , it depends on both the true- and false - positive rates and on all of the possible thresholds on the spiking probability . the auc gives the probability that , when two samples are randomly drawn from the data ( one containing a spike , the other not ) , the conditional intensity model will assign a higher probability ( i.e. a higher instantaneous spiking rate ) to the sample with a spike20 . it therefore provides an assessment of the discriminatory power for predictive variables under a given model . it approaches 0.5 for a chance level predictor , that is , a predictor having false- and true - positive rates along the diagonal , and it equals 1 for a perfect predictor . for example , the auc for neuron 34a was 0.95 ( fig . we further corrected the auc by subtracting chance - level predictions estimated from the actual data and scaled it to obtain a quantity that ranged from 0 ( no predictive power ) to 1 ( perfect prediction ) . we refer to this corrected and normalized auc measure as the predictive power ( see online methods ) . more than 50% of examined neurons in monkey mla showed a predictive power higher than 0.5 ( median = 0.55 , range = 0.10.89 ) ( fig . 3 ) . prediction in subjects mcl and hs3 showed similar performances , with medians of 0.45 and 0.49 and ranges of 0.180.91 and 0.230.97 , respectively . predictive power was lower for participant hs1 ( median = 0.30 , range = 0140.69 ) . we conjectured that this was probably a result of the smaller number of neurons ( n = 21 , n = 22 ) that were recorded and used for prediction in this participant . to test this conjecture , we computed the predictive power on the basis of several smaller ensemble subsets ( n = 22 neurons ) randomly chosen out of the 110 neurons from hs3 s dataset ( session 2 ) . data from hs3 provided a good reference , as neurons were recorded from m1 under the same task condition as for hs1 . the distribution of predictive power values , based on this collection of smaller ensemble subsets , was similar to the one obtained for hs1 , supporting our hypothesis ( supplementary fig . 2 and supplementary note ) . these predictive power levels were obtained using the full history models , that is , the instantaneous spiking rate of each neuron conditioned on both intrinsic and ensemble histories . we further compared the predictive power of each of these two components separately ( fig . the predictive power obtained exclusively from the ensemble histories was larger than the predictive power from intrinsic histories . in addition , it is possible that some of the intrinsic history effects , beyond refractory and recovery period effects , could also reflect network dynamics . thus , these results indicate that the collective ensemble activity , rather than refractory and recovery dynamics , was the main source of the observed predictive power of spiking histories . the predictive power of these m1 spiking history models in monkeys mla and mcl was also higher than the predictive power of relevant kinematic covariates , such as hand position and velocity ( supplementary fig . 3 and supplementary note ) . we used pathlet models21 to estimate spiking probabilities conditioned on kinematics ; that is , the instantaneous spiking rate was expressed as function of hand position and velocity trajectory in the time interval ( 200 ms , 300 ms ) with respect to spiking time . furthermore , the predictive power values of spiking history and pathlet models were not strictly additive ( supplementary fig . this result indicates that there was some level of redundancy between the information conveyed by these two models about single - neuron spiking : some of the spiking activity that was predicted by the spiking history models could also be predicted by the examined kinematics . beyond examining the predictive power of ensemble spiking histories , we were also interested in the predictive power of instantaneous collective states in the recorded ensemble , that is , simultaneous states at either 1- or 10-ms temporal resolution . instantaneously correlated states could result from common inputs and/or from synchronization patterns arising from the neuronal network s own dynamics . strong instantaneous collective states7 could still be consistent with the weak pair - wise instantaneous interactions that we observed in our datasets ( fig . we estimated the joint probability distribution of these instantaneous collective states by fitting maximum entropy22,23 point process models constrained by empirical mean spiking rates and zero time - lag pair - wise correlations . that is , these maximum entropy distribution models were consistent with the observed mean spiking rates and zero time - lag pair - wise correlations , but made no additional assumptions ( see online methods ) . this pair - wise maximum entropy probability model , also known as the ising model in statistical mechanics24,25 , has been shown to capture most of the instantaneous interdependency structure in ex vivo / in vitro neuronal ensemble preparations7,8,10 . besides satisfying the pair - wise correlation structure in the examined datasets , the estimated models also accounted well for the distribution of multiple - neuron spike coincidences , as seen in the comparison of the empirical distribution and the distribution generated from the model via gibbs sampling26 ( fig . , the predictive power of this pair - wise correlation structure was considerably poorer than the predictive power of intrinsic and ensemble spiking histories , as captured by the models ( fig . 4 ) . across the four subjects , the predictive power values of pair - wise maximum entropy models corresponded to 0.10 0.17 , while the spiking history models yielded values of 0.50 0.40 ( mean s.d . ) . the predictive power of spiking history models were still higher when we considered instantaneous states at a coarser 10-ms temporal resolution ( fig . 4 ) , which resulted in predictive power values of 0.26 0.27 ( mean s.d . ) . we performed the same predictive power analysis for areas pmv and 5d and compared predictions based on ensemble histories recorded from the same or a different cortical area in the connected pairs m1pmv and m15d ( fig . predictive power , based on both local and inter - areal spiking histories , corresponding to target neurons in pmv ( mco ; fig . 5c ) had medians of 0.27 and 0.32 and ranges of 0.110.86 and 0.130.62 , respectively . predictive power corresponding to target neurons in m1 , based on both local and inter - areal spiking histories , had medians of 0.50 and 0.40 and ranges of 0.150.93 and 0.110.83 for monkeys mco and mab , respectively ( fig . the inter - areal predictive power could also be substantial in both directions , m1pmv and m15d ( fig . medians were 0.15 , 0.13 , 0.13 and 0.09 and ranges were 0.050.73 , 0.060.75 , 0.060.37 and 0.050.37 for m1pmv , pmvm1 , m15d and 5dm1 , respectively . furthermore , the predictive power from one area to target neurons in the other , especially from m1pmv , could be larger than the predictive power of local ensembles ( fig . we speculated that the higher predictive power of m1pmv in some of these cases could simply reflect the larger number of recorded neurons in m1 , rather than the relative strength of feedforward and feedback connections between these two areas . a supplementary analysis using ensembles of equal size suggested that this was the case ( supplementary fig . 5 and supplementary note ) . this analysis also indicated that intra - areal predictive power was slightly higher than inter - areal predictive power when ensembles of equal size were considered . as shown before for subjects mla and mcl , the predictive power of spiking history models for areas m1 , 5d and pmv also tended to be higher than the predictive power of pathlet models ( supplementary fig . the medians and ranges of predictive power values for pathlet models corresponded to 0.25 and 0.21 , and 0.010.77 and 0.010.75 for mco and mab , respectively . the predictive power of spiking history models varied broadly across the 1,187 neurons in the 12 datasets . we examined whether this variation could be easily explained by simple features of the predicted spiking activity . the predictive power of history models did not appear to depend , at least in a simple manner , on the mean spiking rate or on the level of irregularity of the predicted spiking activity ( fig . assessments of spike train irregularity were based on the coefficient of variation3 of the interspike time intervals . we also assessed how much information was involved in the prediction of single neuron spiking . in principle , the same level of prediction accuracy could be achieved for two different target neurons while involving different amounts of information . we examined this possibility by asking how much information about a neuron spiking or not at any given time was gained by modeling the intrinsic and ensemble history effects compared with knowing only the mean spiking rate of the process . this information gain can be estimated as the normalized difference between the log - likelihood under the estimated history model and the log - likelihood under a homogenous poisson process with given mean spiking rate ( see online methods ) . our analysis confirmed that similar predictive power values ( in the prediction of different target neurons ) could involve a wide range of information rates ( fig . our findings reveal that single - neuron spiking in the cortex of humans and monkeys performing sensorimotor tasks can be substantially predicted by the spiking history of small , randomly sampled neuronal ensembles . the fact that this predictability was based on small neuronal ensembles , randomly sampled out of millions of neurons in the cortex , suggests that strongly coordinated activity underlies the generation of single - neuron spikes . cortical neurons are embedded in large , sparsely connected recurrent networks in which the high number of synaptic inputs and high - conductance states typically induce weak coupling between randomly sampled neuron pairs . not surprisingly , revealing and understanding these large scale and dynamic interactions has been challenging . on the basis of only the weak pair - wise correlations observed amongst cortical neurons in our datasets , one would have underestimated the strength of the statistical interdependencies induced by the collective dynamics . furthermore , we believe our estimates of predictive power for these small neuronal ensembles should be taken as lower - bound values . for example , even though we were careful to include only trials or time segments in which the hand was moving or when the human participants were controlling a computer cursor , it is possible that the network s functional connectivity was nonstationary within and across trials . also , we avoided more complex , and thus potentially more predictive , point process history models for computational tractability . the fact that spiking was better predicted by the ensemble s history than by the ensemble s simultaneous collective state , estimated via pair - wise maximum entropy models , emphasizes the temporal dynamics leading to spiking . this finding , however , should not be taken as a limitation of pair - wise maximum entropy models . it is possible that multiple time - lag pair - wise correlation maximum entropy models11,27 might capture most of the history effects detected in our data and therefore provide a simpler , minimal model . our goal here was not , however , to provide such a minimal model for the temporal and instantaneous collective dynamics , but to determine the existence and strength of such dynamics in the cortex of humans and behaving monkeys . this is , nevertheless , an important issue that should be addressed . in previous studies , we and others have shown that the spiking activity of small , simultaneously and randomly sampled neuronal ensembles in motor cortex can be used to predict ( decode ) subsequent complex behavioral variables such as arm kinematics2832 . here , we found that the activity of these same neuronal ensembles can also be used to predict subsequent single - neuron spiking with substantial accuracy , implying the presence of strong collective dynamics in sensorimotor cortex . although a comprehensive analysis of this problem is beyond the scope of this study , our results indicate that these collective dynamics do not simply reflect background coherent states that are completely unrelated to behavior and , conversely , do not simply reflect trivial common inputs , such as those usually considered in studies involving stimulus - driven activities of early sensory neurons . regarding the background coherent states , our data indicate that the predictive power of models based only on ensemble history and of models based only on kinematics are not strictly additive ( supplementary fig . , there is some level of redundancy between the information ( about single - neuron spiking ) conveyed by ensemble spiking histories and information conveyed by kinematics variables . therefore , the detected collective dynamics can not simply reflect background coherent states that are entirely unrelated to behavior . nonetheless , it is still possible , if not likely , that part of the detected collective dynamics may reflect ongoing internal processes that are not related to behavioral variables . regarding common inputs , we note that kinematics and other features of voluntary movements are controlled in large part ( either directly , or indirectly via spinal and muscle activations ) by the coordinated activity of sensorimotor cortical neurons . it is , therefore , not surprising that these behavioral variables can also achieve substantial explanatory power for spiking activity . even so , the fact that kinematics ( pathlet ) models were less predictive than ensemble history models suggests that the latter carried extra information about single - neuron spiking ( supplementary fig . the detected collective dynamics are unlikely to be explained as the simple reflection of trivial common inputs . in sum , we believe that these strong collective dynamics reflect the intra and inter - areal coordinated activity of neuronal ensembles distributed in the many different cortical and subcortical areas that participate in voluntary control of movement . we hypothesize that the detected collective dynamics and ensemble influences on spiking activity reflect information transfer and computation in cortical networks . collective dynamics and functional connectivity , as captured by connectivity matrices derived from ensemble history models , as well as predictive power levels , should vary as information transfer and computation change during behaviors that engage cortical areas . on the basis of current computational theories of motor control14,15 , one could predict , for example , that m15d spiking predictability will manifest primarily during the initial phase of reaching movements , whereas m1pmv spiking predictability will peak during the hand - shaping phase of object grasping . a related and more general inquiry will be to examine the relationship of collective dynamics at this microscopic spatial scale to neural activities reflected in meso- and macroscopic scale signals , such as local field potentials and electrocorticograms . our results also have implications for neural decoding theory and intracortical neural interfaces for motor prostheses . collective dynamics add redundancy and , therefore , error - correcting properties to neural codes7 . in addition , these dynamics might also account for variability of neural responses5 , which is otherwise usually attributed to noise . therefore , it seems that ensemble history effects should be taken into consideration when decoding kinematics ( or other variables ) from the spiking activity of neuronal ensembles . one would predict that decoding algorithms that take into account ensemble spiking histories will outperform algorithms that treat spiking activity of different neurons as , conditioned on decoded variables , independent processes . our findings suggest the presence of strong collective dynamics that are fundamental to the experimental endeavor of determining coordinated spiking in cortical networks . networks responsible for specialized cortical function are likely to be contained in the spiking patterns of millions of neurons distributed across multiple cortical areas . current and developing recording technologies measure the spiking activity of hundreds to thousands of neurons , a very small fraction of these networks . without strong collective dynamics ( that is , if neurons in small randomly sampled ensembles behaved seemingly independently ) , there would be little hope of determining how the coordinated propagation of action potentials in large - scale recurrent networks leads to computation and information processing . we believe , therefore , that the existence of these collective dynamics offers a basis for understanding cognition and adaptive behavior at the level of coordinated spiking in cortical networks . methods and any associated references are available in the online version of the paper at http://www.nature.com / natureneuroscience/.
coordinated spiking activity in neuronal ensembles , in local networks and across multiple cortical areas , is thought to provide the neural basis for cognition and adaptive behavior . examining such collective dynamics at the level of single neuron spikes has remained , however , a considerable challenge . we found that the spiking history of small and randomly sampled ensembles ( ~20200 neurons ) could predict subsequent single neuron spiking with substantial accuracy in the sensorimotor cortex of humans and nonhuman behaving primates . furthermore , spiking was better predicted by the ensemble s history than by the ensemble s instantaneous state ( ising models ) , emphasizing the role of temporal dynamics leading to spiking . notably , spiking could be predicted not only by local ensemble spiking histories , but also by spiking histories in different cortical areas . these strong collective dynamics may provide a basis for understanding cognition and adaptive behavior at the level of coordinated spiking in cortical networks .
not all of these inductions result in vaginal delivery , and some result in emergency cesarean sections . compared with spontaneous onset of labor , induction of labor is complicated by a higher rate of cesarean section , occurring in one - fifth of women who undergo induction.1,2 an issue of interest for reproductive health researchers is finding better methods for predicting an unwanted type of delivery after induction of labor . the bishop score is an index known to predict outcome of labor , but it does not provide satisfactory results , due to a low predictive value , especially in predicting cesarean section . it is not too sophisticated a procedure to be done in obstetric units and clinics . attempts have been made in the past to use transvaginal ultrasonography for prediction of type of delivery , and efforts have been made to explore if its predictive value is higher than that of the bishop score or not . however , controversial results have been published , and not enough evidence is available to consider it as a strong alternative to the bishop score . the aim of this study was to compare the predictive value of transvaginal ultrasonographic findings and the bishop score for cesarean section as an outcome of induction of labor . two hundred pregnant women admitted for induction of delivery were enrolled in this prospective study . they were hospitalized at alzahra university hospital in tabriz , northwest iran , in 20072009 . women with pregnancies at 3742 weeks gestational age who agreed to participate were considered eligible for the study . the study protocol was approved by the ethics committee at tabriz university of medical sciences . inclusion criteria were a singleton pregnancy , cephalic presentation , gestational age more than 37 weeks , and a live pregnancy . to prevent iatrogenic premature rupture of membranes , those with cervical dilatation cervical length and posterior cervical angle were measured by transvaginal sonography , using an aloka-350 ultrasound machine and a 15 mhz convex probe . posterior cervical angle , defined as the angle between the cervical canal and the posterior uterine wall , was measured using the trace function of the ultrasound machine.3 bishop score was assessed by digital examination prior to induction . data were entered into the computer and analyzed using the stata 11 statistical software package ( stata corporation , college station , tx ) . descriptive sensitivity and specificity statistics were calculated . to compare the predictive value of the methods , receiver - operating characteristic ( roc ) curves were plotted and equality of the area under the curve ( auc ) was tested . data were entered into the computer and analyzed using the stata 11 statistical software package ( stata corporation , college station , tx ) . the predictive value of the methods , receiver - operating characteristic ( roc ) curves were plotted and equality of the area under the curve ( auc ) was tested . mean age ( standard deviation [ sd ] ) of the participants was 29.9 ( 5.6 ) years , mean gestational age was 39.6 ( 1.4 ) years , and mean gravid was 1.5 ( 0.8 ) . up to 10% of the participants declared a previous abortion history , up to 10% were illiterate , and two - thirds were nulliparous . of 200 deliveries , 143 ( 71.5% ) were vaginal and 57 ( 28.5% ) were by cesarean section . the first - minute apgar score in half of the neonates was 9 , 6 in one , and 8 in 18 cases . except for two babies with a 5-minute apgar score = 8 , the babies had higher scores at the fifth minute . table 1 presents sensitivity , specificity , and correct classification rates for the different methods of predicting cesarean section . the wide range of cut points was truncated to those producing more acceptable sensitivity and specificity . the roc curves for bishop score , cervical length , and posterior cervical angle for predicting cesarean section versus vaginal delivery are compared in figures 1 and 2 . the auc for cervical length measured by ultrasonography was 0.69 ( 95% ci 0.60.77 ) . the auc for posterior cervical angle measured by ultrasonography was 0.38 ( 95% ci 0.290.47 ) . the roc for cervical length was significantly different from both bishop score and posterior cervical angle ( p < 0.001 ) . however , the difference for auc compared for bishop score and posterior cervical angle was not statistically significant . bishop score was correlated with posterior cervical angle ( r = 0.24 , p < 0.001 ) . it was inversely correlated with cervical length ( r = 0.51 , p < 0.001 ) and interval until induction of delivery ( r = 0.21 , p < 0.01 ) . induction interval was not found to be correlated with posterior cervical angle , but was correlated with cervical length ( r = 0.22 , p < 0.01 ) . imaging versus clinical assessment has always been a challenge for choosing diagnostic or prognostic measures , sometimes showing simple clinical prediction scores to be as good as sophisticated imaging facilities.3,4 in the present study , cervical length measured by transvaginal ultrasonography was found to be a better predictor of an unsuccessful labor leading to cesarean section than the bishop score . however , the ability of the posterior cervical angle to predict cesarean section was not much different from that of the bishop score . several previous studies have compared ultrasonographic findings with the bishop score in assessing the success of induction . most of these studies have used smaller sample sizes than ours , and few have had larger samples . regardless of slight differences in methodology , all the larger - scale studies , like ours , have found cervical length to be a better predictor than bishop score.1,2,513 few have found cervical length to be the best predictor , few have prioritized the bishop score,1416 and two studies have not observed a difference in their predictive value.17,18 studies suggesting bishop score as the best predictor have not compared the auc or provided sensitivity and specificity measures for given cut points . none of the other studies mentioned have reported auc for cervical length to be < 0.66 and > 0.89 , and the aucs reported for bishop score vary widely , sometimes being as low as 0.46 . novakov - mikic et al reported findings somewhat similar to ours.13 however , they investigated the anterior cervical angle , the predictive value of which was even lower than ours . eggebo et al found the posterior cervical angle to be a predictor of success of induction , but in a regression model rather than an assessment of predictive value.19 based on our findings and the information available in the literature , it seems that cervical length measured by transvaginal ultrasonography has the potential to replace the traditional bishop score when such a facility can be made easily available . however , prior to general recommendation of this approach , cost - effectiveness studies will be necessary .
background : reproductive health researchers are interested in finding better methods for predicting an unwanted type of delivery after induction of labor . the aim of this study was to compare the value of transvaginal ultrasonography findings and the bishop score in predicting cesarean section after induction of labor.methods:two hundred women with singleton pregnancies undergoing induction of labor at 3742 weeks were enrolled in this prospective study . transvaginal investigation was done for all participants prior to induction . to compare the predictive value of the methods , receiver - operating characteristic ( roc ) curves were plotted and equality of the area under curve ( auc ) was tested.results:the mean age of the participants was 29.9 years , mean gestational age was 39.6 weeks , and mean gravid was 1.5 . the auc calculated for bishop score was 0.39 ( 95% confidence interval [ ci ] 0.30.48 ) . the auc for cervical length measured by ultrasonography was 0.69 ( 95% ci 0.60.77 ) . the auc for the posterior cervical angle measured by ultrasonography was 0.38 ( 95% ci 0.290.47 ) . testing equality of the roc curves for these three methods showed the roc for cervical length to be statistically different from both bishop score and posterior cervical angle ( p < 0.001 ) . however , the difference in roc area compared between bishop score and posterior cervical angle was not statistically significant.conclusion:based on our findings and available information in the literature , it seems that cervical length measured by transvaginal ultrasonography has the potential to replace the traditional bishop score , provided that such a facility is available when needed .
a 9-month - old boy ( weight : 9 kg , height : 70.5 cm ) was brought into our emergency department with a complaint of vomiting . his past medical history included a repair of a congenital diaphragmatic hernia 8 months prior . chest radiography showed left lung haziness with pleural effusion and gaseous distended bowel loops in the upper abdomen . computerized tomography of the chest revealed herniated bowel loops in the left lower lung field and consequent passive atelectasis , suggesting recurrent diaphragmatic hernia and bowel strangulation . he was given 1 l / min oxygen by nasal prong , and peripheral oxygen saturation was maintained at 100% . general anesthesia was induced with intravenous propofol 3 mg / kg , and rapid sequence intubation with a cuffed endotracheal tube ( inner diameter 4.0 mm ) was performed after intravenous infusion of atropine 0.02 mg / kg and succinylcholine 2 mg / kg . breath sounds were bilaterally audible on chest auscultation , but with decreased sound at the left middle and lower lung field . anesthesia was maintained with sevoflurane in 50% oxygen / air , and an arterial catheter was placed at the left radial artery . after successful ultrasound - guided central venous catheterization in the left internal jugular vein , chest radiography was performed to determine the positions of the central venous catheter and the endotracheal tube . a specific surgical plan had not yet been fully confirmed , and the need for isolating the operative - side lung was considered . to determine whether endobronchial intubation with a single - lumen tube was enough to provide one - lung ventilation , or whether other techniques such as bronchial blockers were required for lung isolation , we introduced the endotracheal tube into the right main bronchus as a trial . although the breath sound at the left upper lung field was likely to decrease after inserting the tube 2 cm deeper , we could not ensure right endobronchial intubation . to confirm the placement of the tube , portable chest radiography was considered . fiberoptic bronchoscopy was equipped in the operating room , but it was not favorable due to the lack of a skilled anesthesiologist and the risk of hypoxia . therefore , we decided to identify the endobronchial intubation using ultrasonography ( z.one ultra sp , zonare medical system , mountain view , ca , usa ) . the patient was positioned supine , and a 4 cm sized pediatric 5 - 14 mhz linear ultrasound probe was placed sagittally into both midclavicular lines . an initial exam revealed rhythmical movement of the pleural line synchronized with respiratory movement ( lung sliding sign ) at both upper lung fields . using motion mode ( m - mode ) imaging 1a ) , known as a ' seashore sign ' , below the echogenic pleural line . when we gently inserted the endotracheal tube , we observed pleural movement of the left upper lung field using real - time ultrasonography . after insertion of the endotracheal tube ( at a depth of 15 cm ) , the lung sliding sign disappeared and a ' lung pulse ' , the recording of vibrations synchronized with heart activity , was detected ( fig . in contrast to the left side , the lung sliding sign of the right upper lung field could still be detected , suggesting that the right endobronchial intubation was performed successfully . after confirming the disappearance of left lung sliding sign , the endotracheal tube was pulled back to a 13 cm depth and the left lung sliding sign reappeared . finally , thoracoscopic surgery began without lung isolation , and an acceptable surgical field was obtained . the operation was completed with no adverse events , and the patient was delivered to the pediatric intensive care unit without extubation . immediate postoperative chest radiography showed improved haziness in the left lung , and the patient was extubated 1 hour later . one - lung ventilation technique during thoracoscopic surgery requires advanced skills especially when performed in infants . because of the small tracheal and bronchial diameter of infants , lung isolation is usually achieved by endobronchial intubation with single - lumen endotracheal tube . it is imperative to confirm appropriate tube placement in order to provide an adequate surgical field . in our present case , traditionally , lung auscultation , chest wall observation , fiberoptic bronchoscopy , chest radiography , and fluoroscopy have been used to confirm proper lung isolation . auscultation and chest wall observation are simple techniques and require no special equipment , but are not reliable methods . although chest radiography and fluoroscopy are accurate enough to determine the appropriate tube position , they are time consuming and may not be suitable in emergency situations . however , in small infants , it is difficult to define the tracheobronchial anatomy and there is a potential risk of desaturation during bronchoscopy due to their low oxygen reserve . recently , the applicability of ultrasonography has been expanded to airway management , and several authors have described ultrasonographic identification of endobronchial intubation . two characteristic signs , the lung sliding sign and the lung pulse , can be used to verify endotracheal or endobronchial tube position . the lung sliding sign is the sliding movement of hyperechoic pleural layers against each other , synchronized with respiration . the application of m - mode facilitates to identify lung sliding by detecting superficial multiple horizontal lines and fuzzy imaging under the pleura , referred to as the see - shore sign . the presence of the lung sliding sign suggests normal lung movement with intact interpleural space during respiration . the lung pulse is the recording of vibrations synchronized with heart activity at the pleural line and can be explained by transmission of the heartbeat through a motionless lung . in a well - ventilated lung , the lung sliding sign is dominant , overriding the heart signal . on non - ventilated lung segments , the absence of the lung sliding sign and the presence of the lung pulse indicate the existence of non - ventilated lung segments produced by endobronchial intubation . lung ultrasonography is less time - consuming than chest radiography and lessens the risk of multiple radiation exposure . moreover , it is a relatively simple technique that even the beginners can perform with least training . ultrasonographic lung isolation has some limitations . in the presence of pneumothorax , pleural adhesion , or subcutaneous emphysema hence , careful evaluation of preoperative chest radiography and an initial ultrasonography exam before intubation are necessary . in addition , the reliability and accuracy of lung ultrasonography to confirm the endotracheal tube position in pediatric patients have not been fully evaluated compared to adult patients . moreover , when the patient 's position changes or desaturation develops during one - lung ventilation , appropriate endotracheal tube position must be reconfirmed . however , the usefulness of lung ultrasonography to detect dislodgement of the tube has not been clearly elucidated . hence , lung ultrasonography can not be utilized as a standard technique instead of fiberoptic bronchoscopy . despite these limitations , lung ultrasonography may be an attractive technique to confirm lung isolation in pediatric patients . it can be utilized as a good adjuvant method to fiberoptic bronchoscopy and as a fast and easy alternative method particularly in emergency situations .
video - assisted thoracoscopic surgery for pediatric patients has gained popularity due to better outcomes than open surgery . for this procedure , one - lung ventilation may be necessary to provide an adequate surgical field . confirming lung isolation is crucial when one - lung ventilation is required . recently , we experienced a case in which one - lung ventilation was confirmed by ultrasonography using the lung sliding sign and the lung pulse in an infant . since lung ultrasonography can be performed easily and quickly , it may be a useful method to confirm lung isolation , particularly in emergency surgeries with limited time , devices , and experienced anesthesiologists .
tumor lysis syndrome ( tls ) is an oncologic emergency that frequently occurs in patients with a rapidly proliferating malignancy , commonly hematologic , after the initiation of cytotoxic therapy . tls is characterized by a massive release of intracellular potassium , phosphate , and nucleic acid metabolites into the systemic circulation , which can result in cardiac arrhythmia , seizure , or acute renal failure , all of which could be life - threatening . . however , spontaneous lysis of solid tumors is considered rare . herein , we present a case of spontaneous tls in a 55-year - old woman that occurred shortly after she was diagnosed with metastatic small cell lung cancer . a 55-year - old female smoker with a history of chronic obstructive pulmonary disease and diabetes presented to the emergency department with worsening dyspnea and respiratory distress . a physical examination revealed wheezing and decreased breath sounds in the left upper lung field . she was admitted to the intensive care unit and started receiving intravenous antibiotics , fluid resuscitation , and noninvasive ventilatory support . owing to right upper quadrant pain and a high alkaline phosphate level , once the patient 's condition stabilized , chest and abdomen computed tomography examinations were performed , which showed a 7-cm mass in the left upper lung lobe associated with obstructive pneumonitis involving much of the left upper lobe ( fig . 1 ) as well as extensive bilateral mediastinal and left hilar , axillary , and supraclavicular lymphadenopathy and multiple liver metastases . histopathologic examination of a liver biopsy specimen indicated high - grade small cell neuroendocrine cancer . magnetic resonance imaging of the brain yielded normal findings . finally , the diagnosis was established as extensive stage small cell lung cancer . on hospital day 4 , however , oliguria was detected . serum biochemistry tests showed elevated creatinine and potassium levels , and therefore , sepsis - associated acute kidney injury was initially considered . subsequent laboratory examinations revealed increasing levels of potassium ( maximum 5.6 meq / l ) , phosphorus ( maximum 8.4 mg / dl ) , and uric acid ( maximum 11.3 mg / dl ) . accordingly , spontaneous tls was diagnosed on the basis of the characteristic symptom of multiple electrolyte - related abnormalities . aggressive treatment in the form of fluid resuscitation , phosphate binders , allopurinol , and rasburicase was initiated . nonetheless , her renal function continued to deteriorate , with the creatinine level increasing from 0.5 mg / dl upon admission to 7.9 mg / dl over 6 days . the departments of oncology and nephrology were consulted , and the consensus was to conduct daily hemolysis after the first cycle of palliative chemotherapy comprising cisplatin and etoposide . the patient in this case demonstrated spontaneous tls caused by small cell lung cancer , which is a highly proliferative solid tumor . the patient had oliguric renal failure and characteristic laboratory abnormalities including hyperkalemia , hyperuricemia , and hyperphosphatemia in the setting of widespread metastatic disease . to the best of our knowledge , only 4 case reports of spontaneous tls associated with small cell lung cancer have been reported in the literature [ 3 , 4 , 5 , 6 ] . typically , tls results from the massive release of intracellular electrolytes and metabolites when large numbers of tumor cells are lysed by cytotoxic chemotherapy or , rarely , spontaneously . most commonly , tls occurs in cases of rapidly growing malignancies with a high tumor burden , especially hematologic malignancies such as burkitt lymphoma or acute lymphoblastic leukemia . however , cases of tls involving solid tumors have been reported in the literature [ 7 , 8 ] . the classic findings of tls are hyperkalemia , hyperphosphatemia with secondary hypocalcemia , and hyperuricemia . these electrolyte abnormalities can lead to cardiac arrhythmia , seizure , or acute renal failure , all of which could be life - threatening without prompt recognition and treatment . the risk factors for tls include bulky tumors , extensive metastatic diseases including visceral or bone marrow involvement , elevated serum uric acid or lactate dehydrogenase levels , high white blood cell count ( > 50,000 cells/l ) , tumors with a high sensitivity to antineoplastic treatment , and underlying renal dysfunction . tls involving solid tumors is assumed to share similar risk factors [ 8 , 9 ] , although its spontaneous occurrence in tumor types with relatively low response rates to cytotoxic therapy or without the classic rapid growth kinetics , such as that observed in hepatocellular , pancreatic , ovarian cancer , and malignant melanoma , has been reported . in our patient , the risk factors included extensive metastatic disease and small cell lung cancer , a rapidly proliferative tumor cell type . although rare , tls involving solid tumors is associated with a higher mortality rate than that reported for hematologic malignancies . current guidelines emphasize both preventive measures and monitoring for high - risk patients undergoing chemotherapy [ 1 , 2 ] . allopurinol , a xanthine oxidase inhibitor , or rasburicase can be used to lower the serum uric acid level . hemodialysis is an option for patients who develop severe renal failure or refractory electrolyte abnormalities , as in our patient . in conclusion , spontaneous tls should be considered in the differential diagnosis for patients who demonstrate the classic electrolyte abnormalities or renal failure in the setting of malignancy even without cytotoxic treatment , as observed in our case . prophylactic treatment could be a suitable option for patients with multiple risk factors for spontaneous tls . the authors declare that there is no conflict of interest regarding the publication of this article .
tumor lysis syndrome is an oncologic emergency that usually occurs after chemotherapy in patients with hematologic malignancies . tumor lysis syndrome is rare in cases of solid tumors , especially when it occurs spontaneously . herein , we present a case of spontaneous tumor lysis syndrome in a 55-year - old woman who presented with dyspnea and was found to have extensive metastatic small cell lung cancer . she developed acute oliguric renal failure and multiple electrolyte abnormalities requiring hemodialysis . the findings of this case suggest that clinicians should maintain a high index of suspicion for patients with malignancies who demonstrate the classic symptom of laboratory abnormalities even in the absence of chemotherapy .
early risk stratification is essential in the management of patients with suspected or confirmed acute coronary syndrome . traditionally , risk stratification involves an evaluation of medical history , a physical examination , and electrocardiography ( ecg ) upon admission . in recent years , additional variables for early risk stratification in patients with st elevation myocardial infarction ( stemi ) have been identified , and include the elevation of cardiac biochemical markers . for example , the myocardial release of troponin i ( tni ) and n - terminal pro - b - type natriuretic peptide ( nt - probnp ) represent sensitive serum markers for minimal myocardial injury . when present , these markers are associated with an increased likelihood of a cardiac event.1 ) the elevation of another marker , high - sensitivity c - reactive protein ( hscrp ) , upon admission with stemi is associated with an increased risk of complications both during hospitalization and after discharge.2 ) these biochemical markers are noninvasive indicators of the risk of first or recurrent cardiovascular events and also predict the success of therapeutic and preventive interventions.1 ) thus , several studies have demonstrated the independent prognostic value of elevated tni , nt - probnp , or hscrp at admission in patients with stemi.3 - 9 ) additionally , in patients treated for stemi , early st - segment resolution has been associated with a better outcome based on improved early infarct - related artery patency , smaller infarct size , and less impairment of left ventricular function.10 - 12 ) however , the combination of these two early available tools for predicting risk soon after a patient 's presentation has not been evaluated . to address these issues , we retrospectively assessed the clinical characteristics and follow - up outcomes of consecutive patients who received primary percutaneous coronary intervention ( pci ) after stemi . the aim of this study was to evaluate the combined effect of using multiple biochemical markers and st - segment resolution assessments for early risk stratification in patients with stemi and treated by pci . between january 2006 and june 2008 , 178 consecutive patients who presented with their first stemi and were subsequently treated with primary pci were enrolled in the study , which took place at two coronary care units at the kyung hee university hospital , seoul , korea . all patients were treated according to the standard of care for stemi and underwent primary pci . the diagnostic work - up in all patients consisted of history , 12-lead ecg , blood chemistries , and a two - dimensional ( 2d ) echocardiography . the inclusion criteria were as follows : 1 ) presentation within 12 hours of symptom onset ; 2 ) chest pain lasting 30 minutes and resistant to nitrates ; and 3 ) 0.2 mv st - segment elevation in at least two contiguous leads on 12-lead ecg . the exclusion criteria were as follows : 1 ) prior myocardial infarction , defined by pre - existing pathologic q - wave ; 2 ) non - st elevation myocardial infarction ; and 3 ) thrombolytic therapy taken instead of pci . patents with infectious disease , collagen disease , malignant disease , or severe hepatic or renal failure were also excluded . initial clinical demographic data , including killip classification , symptom - to - balloon times , door - to - balloon times , and pre- and post - thrombolysis in myocardial infarction ( timi ) flow grades were evaluated . all patients included in the study sample provided written informed consent for all procedures and our institutional review board approved this research . for all 178 patients , a standard 12-lead ecg was obtained at initial presentation and at 60 minutes after pci , and was obtained by investigators blinded to the clinical characteristics and coronary angiography findings of the patients . using calipers , the sum of the st - segment elevation 20 ms after the j point was calculated and compared with the baseline ecg . the percent resolution of the st - segment on ecg was categorized as complete ( 70% ) , partial ( 30% to 70% ) , or incomplete ( 30% ) , as originally described by schroder et al.10 ) in all patients , standard echocardiography was performed within one hour after coronary intervention . blood samples used to obtain serum levels of tni , nt - probnp , and hscrp were taken on presentation at the emergency department of each center . creatine phosphokinase ( ck ) , ck - mb isoenzyme , and tni levels were measured quantitatively at admission , six hours later , and then twice daily over the first 48 hours . levels were detected routinely in the laboratory using commercially available assays ( abbott immunoassay , abbott laboratories , abbott park , il , usa ) . the normal value of tni in our institution is 0.5 ng / ml . tni levels 0.5 ng / ml on admission was used as a serum marker for myocardial ischemia . nt - probnp was quantified using a one - step enzyme immunoassay based on electrochemiluminescence technology ( elecsys 2010 , roche diagnostics ) . the choice of the specific type of des { i.e. , sirolimus - eluting ( cypher , cordis , johnson & johnson , miami lakes , fl , usa ) or paclitaxel - eluting ( taxus , boston scientific , natick , ma , usa ) stents } was left to the surgeon 's discretion . patients were prescribed aspirin and clopidogrel for at least six months , regardless of des type . the outcome events in this study were all cause mortality , repeated myocardial infarction , and readmission for worsening of heart failure up to six months after pci . continuous variables are presented as a meana standard deviation or median , as appropriate , and categorical variables as a percentage . continuous data were compared using one - way analysis of variance among st - segment resolution groups . a multivariate analysis using forward stepwise logistic regression was performed to check for independent variables related to major adverse cardiac events ( mace ) reported up to six months of follow - up . the overall mace - free survival rates were calculated using the kaplan - meier method , and the differences were determined using the log - rank test . the independent effects of variables on prognosis were calculated using a cox proportional hazards regression model . additionally , we performed a univariate and multivariate analysis using a cox proportional hazards regression model , in which we explored the effects of different combinations of biomarkers on patient prognosis . between january 2006 and june 2008 , 178 consecutive patients who presented with their first stemi and were subsequently treated with primary pci were enrolled in the study , which took place at two coronary care units at the kyung hee university hospital , seoul , korea . all patients were treated according to the standard of care for stemi and underwent primary pci . the diagnostic work - up in all patients consisted of history , 12-lead ecg , blood chemistries , and a two - dimensional ( 2d ) echocardiography . the inclusion criteria were as follows : 1 ) presentation within 12 hours of symptom onset ; 2 ) chest pain lasting 30 minutes and resistant to nitrates ; and 3 ) 0.2 mv st - segment elevation in at least two contiguous leads on 12-lead ecg . the exclusion criteria were as follows : 1 ) prior myocardial infarction , defined by pre - existing pathologic q - wave ; 2 ) non - st elevation myocardial infarction ; and 3 ) thrombolytic therapy taken instead of pci . patents with infectious disease , collagen disease , malignant disease , or severe hepatic or renal failure were also excluded . initial clinical demographic data , including killip classification , symptom - to - balloon times , door - to - balloon times , and pre- and post - thrombolysis in myocardial infarction ( timi ) flow grades were evaluated . all patients included in the study sample provided written informed consent for all procedures and our institutional review board approved this research . for all 178 patients , a standard 12-lead ecg was obtained at initial presentation and at 60 minutes after pci , and was obtained by investigators blinded to the clinical characteristics and coronary angiography findings of the patients . using calipers , the sum of the st - segment elevation 20 ms after the j point was calculated and compared with the baseline ecg . the percent resolution of the st - segment on ecg was categorized as complete ( 70% ) , partial ( 30% to 70% ) , or incomplete ( 30% ) , as originally described by schroder et al.10 ) in all patients , standard echocardiography was performed within one hour after coronary intervention . blood samples used to obtain serum levels of tni , nt - probnp , and hscrp were taken on presentation at the emergency department of each center . creatine phosphokinase ( ck ) , ck - mb isoenzyme , and tni levels were measured quantitatively at admission , six hours later , and then twice daily over the first 48 hours . levels were detected routinely in the laboratory using commercially available assays ( abbott immunoassay , abbott laboratories , abbott park , il , usa ) . the normal value of tni in our institution is 0.5 ng / ml . tni levels 0.5 ng / ml on admission was used as a serum marker for myocardial ischemia . nt - probnp was quantified using a one - step enzyme immunoassay based on electrochemiluminescence technology ( elecsys 2010 , roche diagnostics ) . the choice of the specific type of des { i.e. , sirolimus - eluting ( cypher , cordis , johnson & johnson , miami lakes , fl , usa ) or paclitaxel - eluting ( taxus , boston scientific , natick , ma , usa ) stents } was left to the surgeon 's discretion . patients were prescribed aspirin and clopidogrel for at least six months , regardless of des type . the outcome events in this study were all cause mortality , repeated myocardial infarction , and readmission for worsening of heart failure up to six months after pci . continuous variables are presented as a meana standard deviation or median , as appropriate , and categorical variables as a percentage . continuous data were compared using one - way analysis of variance among st - segment resolution groups . a multivariate analysis using forward stepwise logistic regression was performed to check for independent variables related to major adverse cardiac events ( mace ) reported up to six months of follow - up . the overall mace - free survival rates were calculated using the kaplan - meier method , and the differences were determined using the log - rank test . the independent effects of variables on prognosis were calculated using a cox proportional hazards regression model . additionally , we performed a univariate and multivariate analysis using a cox proportional hazards regression model , in which we explored the effects of different combinations of biomarkers on patient prognosis . the 178 patients treated with primary pci were divided into the following three groups according to st - segment resolution : complete ( n=63 , 59.912.3 years , male 81% ) , partial ( n=90 , 63.910.9 years , male 68% ) , and incomplete ( n=25 , 67.613.3 years , male 76% ) . baseline characteristics , risk factors , lv ef , and biochemical markers at admission are listed in table 1 . patients in the incomplete resolution group were older , had worse killip classifications , and had significantly prolonged symptom - to - door times and door - to - balloon times . risk factors such as diabetes , hypertension , dyslipidemia , smoking history , and ischemic heart disease history were not different among the three groups . there were no significant differences among the groups regarding use of medications , such as aspirin , clopidogrel , beta - blockers , angiotensin converting enzyme inhibitors , angiotensin receptor blockers , and statins either during admission or after discharge ( data not shown ) . the lv ef was significantly lower in patients with incomplete resolution ( table 1 ) . biochemical markers , such as tni , nt - probnp , and hscrp at admission were significantly higher among patients in the incomplete resolution group , and were well correlated with the percent of st - segment resolution ( r=-0.38 , p<0.01 ; r=-0.41 , p<0.01 ; r=-0.43 , p<0.01 , respectively ) . however , the maximal values of ck - mb and tni after pci were not significantly different among the three groups ( data not shown ) . as shown in table 2 , there were no differences among the 3 groups in the number of diseased vessels , location of the culprit artery , type of lesion , or target lesion . pre- and post - timi flow grade 0 or 1 was more commonly observed in the incomplete group , but this finding was not statistically significant . the duration of coronary care unit admission in days was significantly prolonged in the incomplete group ( 2.31.4 , 3.22.3 and 4.72.9 , respectively ; p<0.05 ) . three ( 1.7% ) patients died before discharge , and another four ( 2.2% ) patients died during the follow - up period . the all - cause mortality rate increased stepwise according to st - segment resolution status ( 0% , 1% , and 24% , respectively ; p<0.01 ) . three patients were retreated due to repeated infarction , as shown in table 2 . during follow - up , 17 patients were readmitted for worsening congestive heart failure . the readmission rate was 3% ( 2/63 ) , 10% ( 9/90 ) , and 24% ( 6/25 ) in complete , partial , and incomplete st resolution groups , respectively ( p<0.01 ) . using median values , the study sample was divided into two groups according to the initial tni ( median=0.38 ng / ml ) , hscrp ( median=2.45 mg / l ) , and nt - probnp ( median=456 pg / ml ) levels . kaplan - meier curves showing mace - free - survival based on the biochemical levels and st - segment resolutions are presented in fig . 1 . there was a significant increased risk of six - month mace with increasing baseline circulating levels of either tni ( 6% , and 23% for lower and higher levels , respectively ; p<0.01 ) , hscrp ( 6% , and 23% for lower and higher levels , respectively ; p<0.01 ) , or nt - probnp ( 10% , and 24% for lower and higher levels , respectively ; p<0.05 ) . there was also a significant , gradually increased risk of six - month mace according to the st resolution status ( 5% , 12% , and 48% for complete , partial and incomplete st resolution , respectively ; p<0.01 ) . to evaluate the independent contribution of st - segment resolution to the prediction of clinical outcomes after stemi , variables used for this analysis were age , killip classification , symptom - to - balloon time , door - to - balloon time , lv ef , tni , hs - crp , nt - probnp , and the degree of st - segment resolution . for multiple regression analysis , the most important predictors of clinical outcomes after stemi were the lv ef { hazards ratio ( hr ) : 0.83 ( 0.76 - 0.91 ) , p<0.01 } , hscrp { hr : 1.15 ( 1.05 - 1.26 ) , p<0.05 } , and the degree of st - segment resolution { hr : 0.96 ( 0.93 - 0.09 ) , p<0.05}. the additional benefit of using st - segment resolution to predict cardiac events is shown in fig . with regard to the incremental value , st - segment resolution is a good parameter to predict mace after stemi . however , the addition of biochemical markers markedly improved the prognostic utility of the model containing st - segment resolution . the 178 patients treated with primary pci were divided into the following three groups according to st - segment resolution : complete ( n=63 , 59.912.3 years , male 81% ) , partial ( n=90 , 63.910.9 years , male 68% ) , and incomplete ( n=25 , 67.613.3 years , male 76% ) . baseline characteristics , risk factors , lv ef , and biochemical markers at admission are listed in table 1 . patients in the incomplete resolution group were older , had worse killip classifications , and had significantly prolonged symptom - to - door times and door - to - balloon times . risk factors such as diabetes , hypertension , dyslipidemia , smoking history , and ischemic heart disease history were not different among the three groups . there were no significant differences among the groups regarding use of medications , such as aspirin , clopidogrel , beta - blockers , angiotensin converting enzyme inhibitors , angiotensin receptor blockers , and statins either during admission or after discharge ( data not shown ) . the lv ef was significantly lower in patients with incomplete resolution ( table 1 ) . biochemical markers , such as tni , nt - probnp , and hscrp at admission were significantly higher among patients in the incomplete resolution group , and were well correlated with the percent of st - segment resolution ( r=-0.38 , p<0.01 ; r=-0.41 , p<0.01 ; r=-0.43 , p<0.01 , respectively ) . however , the maximal values of ck - mb and tni after pci were not significantly different among the three groups ( data not shown ) . as shown in table 2 , there were no differences among the 3 groups in the number of diseased vessels , location of the culprit artery , type of lesion , or target lesion . pre- and post - timi flow grade 0 or 1 was more commonly observed in the incomplete group , but this finding was not statistically significant . the duration of coronary care unit admission in days was significantly prolonged in the incomplete group ( 2.31.4 , 3.22.3 and 4.72.9 , respectively ; p<0.05 ) . three ( 1.7% ) patients died before discharge , and another four ( 2.2% ) patients died during the follow - up period . the all - cause mortality rate increased stepwise according to st - segment resolution status ( 0% , 1% , and 24% , respectively ; p<0.01 ) . three patients were retreated due to repeated infarction , as shown in table 2 . during follow - up , 17 patients were readmitted for worsening congestive heart failure . the readmission rate was 3% ( 2/63 ) , 10% ( 9/90 ) , and 24% ( 6/25 ) in complete , partial , and incomplete st resolution groups , respectively ( p<0.01 ) . using median values , the study sample was divided into two groups according to the initial tni ( median=0.38 ng / ml ) , hscrp ( median=2.45 mg / l ) , and nt - probnp ( median=456 pg / ml ) levels . kaplan - meier curves showing mace - free - survival based on the biochemical levels and st - segment resolutions are presented in fig . 1 . there was a significant increased risk of six - month mace with increasing baseline circulating levels of either tni ( 6% , and 23% for lower and higher levels , respectively ; p<0.01 ) , hscrp ( 6% , and 23% for lower and higher levels , respectively ; p<0.01 ) , or nt - probnp ( 10% , and 24% for lower and higher levels , respectively ; p<0.05 ) . there was also a significant , gradually increased risk of six - month mace according to the st resolution status ( 5% , 12% , and 48% for complete , partial and incomplete st resolution , respectively ; p<0.01 ) . to evaluate the independent contribution of st - segment resolution to the prediction of clinical outcomes after stemi , variables used for this analysis were age , killip classification , symptom - to - balloon time , door - to - balloon time , lv ef , tni , hs - crp , nt - probnp , and the degree of st - segment resolution . the most important predictors of clinical outcomes after stemi were the lv ef { hazards ratio ( hr ) : 0.83 ( 0.76 - 0.91 ) , p<0.01 } , hscrp { hr : 1.15 ( 1.05 - 1.26 ) , p<0.05 } , and the degree of st - segment resolution { hr : 0.96 ( 0.93 - 0.09 ) , p<0.05}. the additional benefit of using st - segment resolution to predict cardiac events is shown in fig . however , the addition of biochemical markers markedly improved the prognostic utility of the model containing st - segment resolution . in this study , initial tni , nt - probnp , and hscrp plasma levels were higher in the incomplete st - segment resolution group than in the st - segment resolution groups , and these elevated biomarkers on admission predicted an adverse prognosis over the following six months , especially among patients who presented with two or three elevated biomarkers . furthermore , biochemical markers , such as tni , nt - probnp , and hscrp at admission were well correlated with the percent of st - segment resolution . the combination of these tools improved risk stratification in stemi . in agreement with previous studies,13 - 15 ) elevated levels of tni , nt - probnp , and hscrp were each associated with higher rates of mace . among them , only the hscrp at initial presentation was significantly and independently associated with an adverse prognosis over the next six months . this finding suggests that the inflammatory process associated with myocardial necrosis may be still ongoing when the degree of inflammation in the acute phase increases , as several lines of studies have suggested.16 - 18 ) by contrast , tni and nt - probnp were not independent predictors of clinical outcomes . this discrepancy with previous studies is probably explained by the relatively small sample size . however , despite the small sample size , the combination of several these markers allowed for a very good prediction of clinical outcomes in patients with stemi treated with pci as shown in fig . 2 . these incremental effects could be explained by the different pathophysiological mechanisms assessed by these three biomarkers in myocardial ischemia , i.e. , elevations in troponins indicate myocardial necrosis,3)13 ) nt - probnp is elevated in response to left ventricular overload,8)9 ) and hscrp is a marker of inflammation.1)2 ) multi - marker approaches to rapidly stratify patients and identify those at risk for adverse cardiac outcomes may help in the selection of more intense interventional or pharmacological treatment strategies . in the present study , st - segment resolution at 60 minutes was independently associated with six - month mace , which agrees with the findings of previous studies.3)10 ) another strong finding was a positive correlation between st - segment resolution and the three biochemical makers . we evaluated the association between the initial biochemical makers and partial or incomplete st - segment resolution . in a multivariate analysis , elevated hscrp { hr : 6.29 ( 2.43 - 16.30 ) , p<0.01 } and elevated nt - probnp { hr : 3.32 ( 1.29 - 8.52 ) , p<0.01 } were independently associated with partial or incomplete st - segment resolution , but not elevated tni { hr : 2.47 ( 0.99 - 6.20 ) , p=0.053}. this finding suggests that high burdens of inflammation and ventricular loads may be associated with a lower likelihood of successful epicardial reperfusion . for this reason , the combination of biomarkers and early st - segment resolution improved risk prediction . biomarkers at admission and st - segment resolution at 60 minutes are strong predictors of clinical outcomes , and the combination of them gives additive early information concerning patient prognosis , and further improves risk stratification in stemi . the possibility of selection bias and low statistical power must therefore be considered when interpreting our findings . however , we demonstrated that elevated levels of biochemical markers were each associated with higher rates of clinical outcomes , as has been demonstrated by previous studies.1)7)11)15 ) we also showed the powerful prognostic value of the combination of biomarkers at admission and st - segment resolution at 60 minutes . another weak point of this study is that it was a retrospective study and we therefore could not control medications use . in this study , medications were chosen by each physician according to each patient 's status . we also achieved the purpose of this study by demonstrating improved predictions of clinical outcomes using the two different systems for patients with first stemi . our study suggests an association among high plasma levels of tni , nt - probnp , and hscrp at admission , incomplete st segment resolution in patients with stemi after pci , and unfavorable clinical outcomes . multi - directional approaches to risk stratification and treatment of patients with st - emi may improve the outcomes of adverse cardiac events . our study suggests an association among high plasma levels of tni , nt - probnp , and hscrp at admission , incomplete st segment resolution in patients with stemi after pci , and unfavorable clinical outcomes . multi - directional approaches to risk stratification and treatment of patients with st - emi may improve the outcomes of adverse cardiac events .
background and objectivesthe prognostic value of biochemical markers and the resolution of st - segment elevation on electrocardiogram are well established . however , how a combination of these two tools affects the evaluation of risk stratification has not yet been evaluated.subjects and methodsbetween january 2006 and june 2008 , 178 consecutive patients treated with primary percutaneous coronary interventions after st - segment elevation myocardial infarctions ( stemi ) were analyzed at two coronary care units . patients were divided into the following three groups according to st - segment resolution : complete ( 70% depression of the elevated st - segment , n=63 ) , partial ( 30% to 70% , n=90 ) , and incomplete ( < 30% , n=25 ) . demographic data , including history , electrocardiography , biochemical markers , initial ejection fraction , and angiographic findings were also evaluated.resultsthere were 7 deaths , 3 repeated myocardial infarctions , and 17 readmissions for worsening heart failure during six months of follow - up . in a multivariate analysis to predict clinical outcomes , ejection fraction { hazard ratio ( hr ) : 0.83 ( 0.76 - 0.91 ) , p<0.01 } , high - sensitivity c - reactive protein { hr : 1.15 ( 1.05 - 1.26 ) , p<0.05 } , and the degree of st - segment resolution { hr : 0.96 ( 0.93 - 0.09 ) , p<0.05 } were independently associated with clinical outcomes . according to the cox - proportional hazards model , the addition of st - segment resolution markedly improved the prognostic utility of the model containing biochemical markers and ejection fraction.conclusionassessment of biomarkers upon admission and st - segment resolution are strong predictors of clinical outcomes . the combination of these data provides additive information about prognosis at an early point in the disease progression and further improves risk stratification for stemi .
isotope exchange depth profiling and electrochemical impedance spectroscopy are usually regarded as complementary tools for measuring the surface oxygen exchange activity of mixed conducting oxides , for example used in solid oxide fuel cell ( sofc ) electrodes . only very few studies compared electrical ( kq ) and tracer ( k * ) exchange coefficients of solid gas interfaces measured under identical conditions . the 1:1 correlation between kq and k * often made is thus more an assumption than experimentally verified . in this study it is shown that the measured rates of electrical and tracer exchange of oxygen may strongly differ . simultaneous acquisition of kq and k * on la0.6sr0.4feo3- and srti0.3fe0.7o3- thin film electrodes revealed that k * > 100 kq in humid oxidizing ( 16o2 + h218o ) and humid reducing ( h2 + h218o ) atmospheres . these results are explained by fast water adsorption and dissociation on surface oxygen vacancies , forming two surface hydroxyl groups . hence , interpreting experimentally determined k * values in terms of electrochemically relevant oxygen exchange is not straightforward .
a quicker return to function , earlier discharge from the hospital , less postoperative pain , and better cosmesis due to the smaller incisions have been reported by multiple authors . decreased intraoperative blood loss and transfusion requirements have also been described . laparoscopic splenectomy for splenic trauma has been described in only a few instances in the literature . the original report by basso et al from italy in 2003 describes laparoscopic splenectomy 10 days postinjury for a grade iv ruptured spleen . in the united states , nasr et al in 2004 reported on a series of 4 stable patients undergoing delayed laparoscopic splenectomy for blunt trauma . we describe the successful treatment using a total laparoscopic approach shortly after admission of a young man with a grade v splenic injury . a 21-year - old man was transferred to our level 1 trauma center after sustaining a blow to his left flank from a falling construction pipe while working on an oil rig . he did not have peritoneal signs , and his examination was unremarkable except for left flank tenderness . he underwent a computed tomography ( ct ) scan with intravenous contrast that demonstrated hemoperitoneum with an american association for the surgery of trauma grade v splenic laceration and a grade ii left peri - nephric hematoma ( figures 1 , 2 , and 3 ) . the various management options were discussed with the patient , including observation , angiographic embolization , and splenectomy . given the severity of his splenic injury and the presence of a renal injury that could complicate conservative management , we decided to proceed with splenectomy . the patient remained hemodynamically stable , and we elected to attempt laparoscopic splenectomy , with readiness to convert to an open operation if the patient became unstable or if we were unable to quickly obtain vascular control . the patient was placed in the right lateral decubitus position with the bed flexed at the waist . we were able to easily visualize the spleen , which was noted to have a large hematoma and venous blood oozing from the hilum ( figures 4 and 5 ) . the spleen was carefully retracted upward with a blunt grasper and the hilum was visualized . a 15-mm endoscopic stapler ( autosuture , us surgical , hartford , ct ) with a 60-mm gray vascular cartridge was used to transect the hilum . no bleeding occurred from the remaining splenic artery or vein , and the pancreas was visualized and protected during this process . the remaining hemoperitoneum was suctioned and a # 10 jackson pratt drain was placed in the splenic fossa . the patient was able to tolerate a regular diet the next day with pain controlled by oral analgesics only . he was monitored for his renal injury on the wards for the next 3 days by the trauma and urology service . a follow - up renal ultrasound before discharge revealed no progression of his injury , and his hematuria resolved . this fell to 10 on the next measurement immediately after surgery , and remained stable postoperatively . he received his vaccinations for pneumococcus , meningococcus , and h. influenzae on the day of discharge . mandatory laparotomy with splenorrhaphy or splenectomy has been replaced in most cases by nonoperative management . initially proposed in the pediatric trauma literature , close observation has become the accepted treatment of stable splenic injuries from blunt trauma . patients with severe ( grade iii and higher ) splenic injuries have a higher failure rate than with injuries of lesser severity . several recent trials have shown that blood transfusion causes a dose - dependent immunosuppression and significantly increased mortality in critically ill patients , including trauma victims . further risks of nonoperative treatment include delayed splenic rupture , persistent pain , and prolonged immobilization which is contraindicated in a group at high risk for venous thromboembolism . splenic artery angio - embolization has been described as an alternative to operative management of splenic injuries . this has improved the rate of splenic salvage to greater than 90% in several series . complications of angioembolization include the need for delayed splenectomy due to splenic infarction , infection , abscess , or persistent pain . the rate of these complications has been described as high as 33% in some series . splenectomy is not indicated for all of the injuries , and angiographic embolization is an acceptable option to further define the injury and prophylactically reduce the rate of observation . we believe that in those institutions where a vascular surgeon or radiology specialist for embolization is available 24 hours a day , this can be the best option . when a vascular surgeon or radiologist specialist is not available for patients who are questionable , splenectomy , in our opinion , is still the best option , particularly if the splenectomy can be performed laparoscopically . prevention of overwhelming postsplenectomy sepsis ( opsi ) has often been cited as a reason for advocating splenic preservation . however , the incidence of opsi in adults , in contrast with children , is very low ( < 1% ) and with modern vaccination and antibiotics is expected to decline further . in adult patients , the risks of transfusion and delayed splenic rupture , abscess , and pain should be weighed against the risk of opsi in determining the best approach to severe splenic injuries . the role of laparoscopy in blunt trauma has yet to be defined . in experienced hands , it has been shown to reduce the negative laparotomy rate and identify and treat diaphragmatic and visceral injuries . several authors have used laparoscopy to apply hemostatic agents to solid organ lacerations and perform spleen preserving procedures in lower grade injury . we believe that if there is a splenic injury and no other injury in the abdomen , as shown by ct and fast scans , the laparoscopic approach is feasible , even though the gold standard is still considered exploratory laparotomy . we believe any injury of the hilum , specifically in the vein in the splenic area , is an indication for laparoscopy while the injury of the artery could not be a good indication at this point . laparoscopic splenectomy has not been well described in patients with splenic trauma . to our knowledge , this is the first report of laparoscopic splenectomy as first - line treatment for a grade v injury in a trauma patient . one patient had previously undergone splenic artery embolization and re - presented with delayed splenic rupture . based on our experience , we would like to point out that laparoscopic splenectomy can be safely performed in a high - grade injury by an experienced surgeon and should be considered in stable patients . the reason why we reported this case is to raise the question of whether we are ready to move into laparoscopy . we do not believe that we are at this point , but it is good to raise controversy and maybe in the future , a single injury to the spleen with no other injuries reported by ct and fast in patients who are hemodynamically stable could be an indication for laparoscopic splenectomy . in our case , a grade v injury was reported with the ct scan , and there was a big hematoma at the level of the hilum . we believe retrospectively that the hematoma made the bleeding decrease , and no more bleeding was coming out from the hilum . no vascular surgeon or radiologist was available ; therefore , embolization was not an option . we agree that there is nothing in the literature that requires immediate splenectomy in a young , healthy , stable patient with a high - grade injury based on the ct scan , but laparoscopic exploration in trauma is an acceptable option . transfusion is being increasingly recognized as an independent factor in poor outcomes , and avoidance of transfusion is likely to become a priority in managing stable trauma patients . laparoscopic splenectomy should be considered as an option in these patients , either on admission or after failure of nonoperative management . the benefits of smaller incisions , less postoperative pain , and the potential for earlier discharge from the hospital should be weighed when deciding on an operative approach . the risk of injury to the tail of the pancreas during a laparoscopic dissection of the splenic hilum in the presence of a hematoma / hemoperitoneum is not different from an exploratory laparotomy in experienced hands . we believe that with the laparoscopic technique , the experience of the surgeon and the visualization of the hilum are of utmost importance , and the pancreatic tail can be visualized well and decrease the risk of the pancreatic tail injury . our patient remained in the hospital for 3 days solely for observation of his associated renal injury . he was able to resume a regular diet immediately and had minimal requirements for pain medication . a patient with an isolated splenic injury would likely be stable enough to be discharged the next day , following laparoscopic surgery . laparoscopic splenectomy can be successfully used as an immediate treatment option in hemodynamically stable patients with severe splenic injury .
we describe the first reported use of laparoscopic splenectomy as initial treatment in high - grade blunt splenic trauma . a 21-year - old man sustained a blow to the left flank from a large construction pipe and was transferred to our hospital with a grade v splenic laceration and a grade ii left peri - renal hematoma with hematuria . he was hemodynamically stable . he underwent a laparoscopic splenectomy shortly after arrival . the patient 's renal injury was managed nonoperatively , and he was discharged home with no complications and has remained well .
harmonization of biobanking operational procedures and best practices is an essential element that enables biobanks to exchange and pool data and samples . this so - called interoperability is the foundation of successful global biobanking . rather than demanding complete uniformity among biobanks , harmonization is a more flexible approach aimed at ensuring the effective interchange of valid information and samples . one critical task of the harmonization process is to articulate those situations in which true standardization is required . standardization implies that precisely the same protocols / standard operating procedures ( sops ) are used by all biobanks . for example , if data are to be passed between biobank databases then there needs to be agreement on standard ontologies and exchange formats . likewise , comparison of high - throughput - technology - derived data requires that platforms and operational details be identical . harmonization is context - specific and pertains to the compatibility of methodologies and approaches to facilitate synergistic work . it thereby relates to the critical areas of generating , sharing , pooling , and analyzing data and biological samples to allow combining resources and comparing results obtained from different biobanks . harmonization encompasses enabling technologies and procedures for phenotype characterization , sample handling , in vitro assays , computational biology analytical tools and algorithms , data - coding and electronic - communication protocols that enable biobanks to network together within compatible ethico - legal frameworks . in recognition of the necessity to synchronize efforts and build upon previous achievements , a host of consortia - based initiatives , project teams and agencies ( table 1 ) have been working to optimize the establishment , operation , and use of interoperative biobank resources globally as demonstrated by the public population project in genomics and society . toward this end , the fundamental principles guiding these efforts include transparency , complementarity , and the sharing of relevant knowledge and tools to enable cutting - edge and translational science for the benefit of all . harmonization initiatives have brought together individuals with diverse expertise . on the basis of consensus , they have developed standards,10 , 11 tools , technologies , and resources , which are widely available to the biobanking community today . indeed , the science of biobanking has emerged as a field in its own right , providing an ever - growing armamentarium of tools , information , compatible bioinformatics , and sops . however , progress in unraveling the complexities of disease etiology and developing successful treatments will require a far greater degree of knowledge and data integration than currently exists . thus , how we structure and harmonize our biobanks today will have important impact on the future of biomedicine . a typology of biobanks includes : ( 1 ) residual specimens collected during routine clinical care for therapeutic or diagnostic purposes , including collections of tumor samples with associated histopathologic , demographic , clinical , and outcome data ; ( 2 ) specimens collected during clinical trials ; ( 3 ) specimens collected as part of specific research projects ; and ( 4 ) specimens collected as part of population - based biobanks , which often contain longitudinal components . these diverse types of biobanks have different roles in the generation and translation of knowledge into public health and clinical medicine , and technological plus conceptual evolution may make it impossible or undesirable to harmonize completely their practices , policies , and operations . nonetheless , some baseline level of harmonization should be fostered for two main reasons . first , harmonization increases the quantity of usable data and numbers of biospecimens to achieve levels of statistical power necessary to detect effects underlying complex disease etiology.12 , 13 , 14 , 15 second , translational science will rely on fundamental biological data to ( re)classify human disease on the basis of causality and to identify relevant drug targets and biomarkers . effective planning of studies will use targeted investigations of specific groups classified on their individual , detailed biological as well as socio - cultural profiles . such designs will enrich our analytical repertoire and may help overcome some of the historical boundaries between clinical and nonclinical research . accordingly , our ability to correlate data and biospecimens from different biobanks will be pivotal to accelerating the pace of translational research . a meta - model to describe information about a biobank is already under construction as a first - step data sharing among biobanks that exhibit tremendous heterogeneities . this work is being conducted internationally to help harmonize the national biobanks participating in the biobanking and biomolecular resources research infrastructures initiative ( bbmri ) . information about the participating biobanks is captured by a common set of attributes ( minimum data set ) designed to adopt different kinds of collections . the latest interoperability and semantic web technologies can be used for building resource description frameworks for data and services providing flexible frameworks that can be used in different data - sharing scenarios . figure 1 depicts three major types of biobanks and their niches in health - care research relative to population disease development . modern research strategies should be able to draw on samples and data derived from these biobank categories to capture the full range of biological variance associated with phenotypes ranging from pre - disease states through response to treatment . to ensure scientific excellence while optimally leveraging the potential of biobanks , the scientific frameworks within which biobanks operate will need to keep advancing in several critical areas , including : ( 1 ) networking of multidisciplinary professionals ; ( 2 ) development of comprehensive inventories , including listing of extant biobanks , their holdings , and access procedures ; ( 3 ) establishment of standardized data - collection protocols governed by appropriate quality management systems ; ( 4 ) continued innovation that leads to improved technologies for preservation of biospecimens and pre - analytical processes , ( 5 ) progress in information infrastructure to facilitate data sharing and pooling , including new technical solutions for data management and analysis , as well as for the protection of participant privacy and data confidentiality ; and ( 6 ) harmonization of quality management systems to ensure consistency of materials . the science of biobanking itself is as important to develop and fund as the science that uses biobanks . because the science of biobanking is very closely linked to the development of an enabling infrastructure , it requires scientists to work more closely with each other and with funders than has historically been the norm in biomedical science . in this , biobanking resembles more the situation typical for large - scale physics , which is characterized by close collaborative , pre - competitive relationships among workers in the field to construct , develop , and maintain the necessary research infrastructures while embracing healthy competition in the undertaking of both hypothesis - based and free research using these infrastructures . developing this kind of culture and spirit will be essential for the success of large , cross - institutional biobanking efforts . meeting these needs will require stable funding and new mechanisms to support the coordination of infrastructure programs internationally . other elements essential to the successful nurturing of a vibrant research community include frequent interchanges that will seed and foster relationships among scientists in the field , non - risk - averse early funding for small exploratory research projects , and the maintenance of registries of relevant professionals . several of the major initiatives listed in table 1 are already helping to meet these needs . however , they currently lack the kind of stable funding required not only for the activities listed above , but importantly also for the development of networking among biobanking professionals that can lead to the development of multidisciplinary research projects . training of the next generation of biobanking professionals is a critical aspect that requires focused attention and investment , as is the establishment of communication and publishing conduits for sharing resources and results . specific attention will also need to be paid to career development and advancement aspects of biobanking scientists in an effort to correct the current perception of the profession as mere infrastructure providers . likewise , the field itself still needs to build reputation and recognition as a scientific discipline as opposed to an ancillary service ' . no less important than harmonization of specimens and data is the promotion and implementation of shared ethical principles and procedures as they relate to biobanking . although the last decade has seen the emergence of principles reflecting shared ethical principles that foster international scientific collaborations , the concepts of altruism , of solidarity , or of databases as global public goods ' to promote data sharing , are still evolving . building trust , so that individuals will continue to donate to biobanks for the benefit of all , is essential to ensure the advance of biomedical research . society must recognize its role in this process and take steps to protect research participants against the possible misuse of their information . this will require building governance mechanisms that operate at a meta - level to enable accountable and responsible research . furthermore , we must develop approaches to foster trust related to specific contexts with which biobanks will interface , including , for example , industry and health care . the authors strongly advocate that the necessary procedural mechanisms for privacy protection and the use of it software and biostatistical solutions to facilitate secure use and transfer of data across borders be adopted and implemented more broadly by the global biobanking community as a matter of high priority . in addition , it will be important to build the mutual trust that is required for the delegation of ethics review across jurisdictions , where such delegation is feasible and appropriate . the use of researcher authentication techniques may provide additional protections and can be expected to develop gradually . for example , the open researcher and contributor i d initiative enables institutionally verifiable and reliable disambiguation of one author from another . the mandatory deposition of certain data into the public domain and publication policies of journals enforcing transparency on these issues constitute important steps in these directions . in order to build a global infrastructure involving high - quality specimens and data collections to support a broad array of scientific projects , a highly supportive political environment is also critical . strengthening relationships with governments , ministries , industry , and the general public will be crucial to create and maintain such an environment . developing a global biobanking infrastructure is expensive and relies on the willingness of individual participants to act as global citizens ' or as citizen scientists ' by providing their specimens and data for the greater good of science and progress in individual and public health . consideration should be given to working closely with agencies that communicate effectively the importance of science to educate the media and the general public . it is the responsibility of stakeholders to react sensitively and responsively to public and political perceptions and to maintain transparent , accountable information on their activities . in particular , general information on projects of researchers who have used the biobanks should be publically available . an important element of infrastructural development involves substantial investment in ensuring ethical , effective , and equitable access to banked data and samples . this often involves overlapping , but sometimes competing interests of biobank scientists and managers , secondary users of the biobank , study participants , funders , ethico - legal experts , and the public at large . such a multiplicity of stakeholders means that some issues can only be resolved at the highest level , with agreement on policy at an international level after significant stakeholder input . solutions include recognizing that data / samples funded from public funds are a shared resource for the promotion of scientific research for the public good , with adequate funding / cooperation and recognition of the contributions , which make these resources available , and with the provision of sanctions for those that misuse biobanks and/or specimens and data . to this end , the biobanking community and funders must work together with policy makers on regional , national , and international levels to provide legal and ethical frameworks or , at minimum , reciprocal safe harbor ' recognition to encourage the use and sharing of data , samples , and knowledge . this will require international consensus guidance and collaboration to ensure equitable approaches to the governance of privacy and access and the development of training programmes for members of ethics review boards and other data regulatory bodies . current challenges are often related to the application of existing regulations and policies that were developed for patient safety and protection in interventional clinical trials involving new , potentially harmful drugs , devices , or psychological interventions ; we argue that these norms are ill - suited for application to observational studies such as longitudinal population studies , with minimal risks ( related primarily to data protection ) . obviously , there must be sufficient investment in the infrastructure , personnel , and processes that enable data management , archiving and release under a pragmatic , simplified , streamlined ethics review . a number of considerations are critical to keeping biobanks and the research they support active and dynamic . the need for long - term investments into biological resources is clearly evident when longitudinal data are needed . prospective collections of data and samples from asymptomatic individuals will allow future identification of premorbid and subclinical periods of disease development and will identify prognostic and diagnostic biomarkers and drug targets.13 , 33 , 34 treatment follow - up studies require sampling and data collection over many years before substantive analysis can be performed . as molecular approaches to health and translational medicine are still in nascent stages , the value of already collected data will continue to grow as new knowledge and methodologies are applied to biobanks . thus , preservation of today 's biobanks is critical for realising the science and medicine of tomorrow . most conventional grant mechanisms with limited periods of funding are not sufficient for such sustainability . alternative approaches to providing long - term support , such as the nih contract model that has supported the framingham study , a distinguished successful biobanking initiative ( nota bene , since long before the term biobanking ' was coined ) , must be developed and expanded . it may well be that the answer will lie in the use of a combination of approaches that includes long - term commitments from public and governmental sources ( eg , the estonian human genes act ( 27 ) ) for functions related to the collection , maintainance , and storage of samples and information , as well as support from private industry . embedding biobanks in health - care systems would help ensure reliable long - term funding and establish biobanks as a key component of the public health infrastructure . both the long - term scientific benefits to be accrued from biobanking , and the personal health - care - related benefits that individuals may gain from having objective health - related information stored in biobanks , suggest that at least some types of biobanks may become nested within the health - care system . indeed this trend is already evident in many nations as reflected by the ever - growing number of national hubs associated with the bbmri . if we want to ensure that the environment is right to support such nesting , it is critical that biobank operators , biobanking scientists , and science funders work hand in hand with policy makers and health - care strategists at all levels to ensure that the development of governance systems and regulatory frameworks , mechanisms for quality management , and systems for data storage , transfer , and integration are all harmonized and aligned to meet current and future needs . if done properly , such a systematic integration may be the essential foundation for future contributions that biobanks can make to human health . thus , the design of approaches for data sharing across the spectrum of biobanks should dovetail with national health information systems to ensure that these systems are capable of interfacing ( in an appropriately controlled manner ) with the it systems that hold the bulk of the detailed information in biobanks . obviously , funding is conditional on the level of ongoing benefit produced . thus it is critical that biobanks are evaluated on an ongoing basis using well - defined metrics . this implies the urgent need to develop more formalized systems to objectively assess the value of biobanks or biobank networks over time . no such monitoring system exists yet , though some ideas for measuring a bio - resource impact factor ' ( brif ) are being designed and piloted . it will be necessary to record simultaneously the impact of biobanks as infrastructures supporting research and the scientific and operational contributions made by the biobank researchers ' ( principal investigators , managers , bioinformaticians so on ) . this will be assisted by the development of systems that track the history of biobank collections and their applications using digital ids for biobanks and researchers , and by a growing emphasis on publishing infrastructure data , as well as discoveries made as a result of accessing them . this , in turn , requires continued improvements in the underlying controlled vocabularies , databases , search systems , and guidelines addressing the ethical , legal , and social issues related to biobanks . likewise , criteria should be established to terminate biobanks , which fail to meet the established requirements and metrics . in addition to quantitative metrics for assessing the utility of biobanks , it is essential to also consider the less tangible , qualitative impact biobanks may have in fostering scientific advances the development and use of such metrics also serve another purpose that may affect sustainability needs : such metrics help to incentivize and justify the field by providing objective criteria for unambiguously qualifying scientific contributions by engaged investigators . biobanking has the potential to be the most powerful single platform for health innovation and knowledge generation , provided that it is adequately resourced and networked . maximizing the use , productivity , and value of biobanks worldwide will depend on a transition of the way in which biobanking is perceived and conducted . harmonization across biobanks is crucial in order to make investigations more robust , more targeted , and more economical . building on fundamental principles that emphasize synergy of effort , openness , and resource sharing for the benefit of all , international biobanking efforts have already begun to lay the groundwork for such harmonization . to realize fully the major public health benefits from the current patchwork of biobanking efforts , a coordinated strategy is required that engages the diverse stakeholders and proceeds through consensus building . we have articulated a vision and outlined a number of strategies for building the scientific , social , and political framework for continued progress . the key considerations underpinning the successful implementation of a road map to develop biobanking globally for health are summarized in table 2 . drawing from the experience of an impressive number of harmonization initiatives in the field , we propose working to establish an international biobanking infrastructure and community . the collective output of these efforts includes guidance for the design and management of biobanks , for the development of sops for sample handling within a quality management system , cataloging and comparing data , and for coordinating development of compatible bioinformatics and ethico - legal frameworks . in addition to fostering biobank interoperability , with regard to the collection and exchange of data and samples , it is critical to form strategic alliances between governmental bodies , funding agencies , public and private science enterprises , and other stakeholders . the challenges we describe must be met , if we are to realize , mobilize , and sustain the promise of major individual and public health benefits through the application of biobanking to biomedical research .
biobanks can have a pivotal role in elucidating disease etiology , translation , and advancing public health . however , meeting these challenges hinges on a critical shift in the way science is conducted and requires biobank harmonization . there is growing recognition that a common strategy is imperative to develop biobanking globally and effectively . to help guide this strategy , we articulate key principles , goals , and priorities underpinning a roadmap for global biobanking to accelerate health science , patient care , and public health . the need to manage and share very large amounts of data has driven innovations on many fronts . although technological solutions are allowing biobanks to reach new levels of integration , increasingly powerful data - collection tools , analytical techniques , and the results they generate raise new ethical and legal issues and challenges , necessitating a reconsideration of previous policies , practices , and ethical norms . these manifold advances and the investments that support them are also fueling opportunities for biobanks to ultimately become integral parts of health - care systems in many countries . international harmonization to increase interoperability and sustainability are two strategic priorities for biobanking . tackling these issues requires an environment favorably inclined toward scientific funding and equipped to address socio - ethical challenges . cooperation and collaboration must extend beyond systems to enable the exchange of data and samples to strategic alliances between many organizations , including governmental bodies , funding agencies , public and private science enterprises , and other stakeholders , including patients . a common vision is required and we articulate the essential basis of such a vision herein .
alzheimer s disease ( ad ) is the most common type of dementia , but a cure for ad has yet to be discovered . however , it may be possible to prevent or delay the onset of ad by reducing modifiable risks . education has been proposed as a protective factor that can reduce the risk of developing dementia . the protective effect of education has been supported by numerous epidemiological , imaging , pathological , and neuropsychological studies [ 13 ] . however , results are not consistent and some conflicting studies have shown no protective effect of education against dementia [ 4 , 5 ] . imaging studies have shown that education has a morphological influence on the brain in both non - demented and ad subjects [ 69 ] . whole brain and ventricular volumes have mainly been used as measures for evaluating the morphological effects of education on brain [ 6 , 7 , 10 ] . recently studies have shown that cortical thickness can give complementary information for evaluating brain morphology and is a promising parameter for early diagnosis of ad [ 11 , 12 ] . with the development of magnetic resonance ( mr ) post - processing technique , it is now possible to quantitatively measure regional cortical thicknesses and volumes in an automated way which minimizes rater - dependent bias . the relationship between education and regional cortical thicknesses and regional volumes of brain structures has not been studied previously in the same population however . the effect of education on brain structures might help our understanding of the mechanism of how education modulates the risk of ad and is of relevance for policy decisions , especially in low and middle - income countries where education provision is limited by restricted resources . the purpose of this study was to explore if regional cortical thickness and volume measures can provide evidence to support the protective effect of education against ad in a large sample from the addneuromed study [ 13 , 14 ] . a total of 121 ad patients ( 50% female ; 74 6 years ) , 121 mild cognitive impairment ( mci ) subjects ( 65% female ; 75 6 years ) , and 113 age - matched healthy controls ( 55% female ; 73 6 years ) were selected from the addneuromed study [ 13 , 14 ] ; a prospective , longitudinal multicenter study to discover biomarkers for ad . data were collected from six medical centers across europe : university of kuopio , finland ; university of perugia , italy ; aristotle university of thessaloniki , greece ; king s college london , united kingdom ; medical university of lodz , poland ; and university of toulouse , france . the length of formal education was 8 4 , 9 4 , and 11 5 years for the ad patients , mci subjects , and controls , respectively . clinical dementia rating scale ( cdr ) and mini - mental state examination ( mmse ) were assessed for each subject . the apoe genotype was determined in 114 ad , 110 mci , and 108 controls . informed consent was obtained for all subjects and protocols and procedures were approved by the relevant institutional review board at each data acquisition site and the data coordination site . none of the mci and ad subjects had other neurological or psychiatric disease , significant unstable systemic illness or organ failure , and alcohol or substance misuse . the diagnosis of dementia was based on the criteria of the diagnostic and statistical manual of mental disorders , 4th edition ( dsm - iv ) and the diagnosis of ad on the national institute of neurologic and communicative disorders and stroke and alzheimer s disease and related disorders association ( nincds - adrda ) criteria . at baseline all mci subjects fulfilled the following criteria , in line with consensus criteria for amnestic mci [ 19 , 20 ] : i.e. , ( 1 ) memory complaint by patient , family , or physician ; ( 2 ) normal activities of daily living ; ( 3 ) normal global cognitive function as measured by the mmse ( score range between 2430 ) ; ( 4 ) geriatric depression scale score less than or equal to 5 ; ( 5 ) subject aged 65 years or above ; ( 6 ) cdr memory score of 0.5 or 1 ; and ( 7 ) absence of dementia according to the dsm - iv and nincds - adrda criteria for ad . the controls did not have any neurological or psychiatric disorders and were not taking any psychoactive medication . classification of the controls and mci subjects was based on cdr score and clinician s judgment , rather than on cognitive tests . data acquisition took place using six different 1.5-t mr systems ( four general electric , one siemens , and one picker ) . at each site a quadrature birdcage coil was used for rf transmission and reception . a high - resolution sagittal 3d t1-weighted mprage volume was acquired using a custom pulse sequence specifically designed for the alzheimer s disease neuroimaging initiative ( adni ) study to ensure compatibility across scanners . the parameters were : tr = 913 ms , te = 3.04.1 ms , ti = 1,000 ms , flip angle = 8 , voxel size detailed quality control was carried out on all mr images using previously published criteria [ 21 , 22 ] . first , mri scans were regularly acquired at each of the sites using a urethane test phantom developed by the us - based adni consortium . this allowed precise quantification of the geometric accuracy of a scan , together with other quality control measures , including signal - to - noise ratio and image uniformity using the imageowl web - based automated quality control system ( http://www.imageowl.com ) to ensure good performance of each of the scanners during the duration of the study . second , two volunteers were scanned at each site , and their images were processed using the same analysis tools as the cohort images to ensure compatibility of data . finally , the mri sites and data coordination center worked closely together with continuous feedback as data were acquired . all mri centers were trained to perform quality control at their site at the time the images were acquired with particular emphasis on full brain coverage , image wrap around , subject motion artifacts , contrast between gray and white matter , and image non uniformities . all scanners remained within specification for the adni phantom throughout the course of the study . the coefficient of variation for whole brain measures for the two volunteers scanned at each of the sites was 1.7% and the mean ( sd ) of the coefficients of variation for the smaller anatomical regions reported in this paper was 3.4 ( 1.9)% . all mr images received a clinical read by an on - site radiologist in order to exclude any subjects with non - ad - related pathologies . the freesurfer structural mri image processing pipeline ( version 4.5.0 ) which was developed by fischl and his colleagues was utilized for data analysis [ 23 , 24 ] . cortical reconstruction and volumetric segmentation included removal of non - brain tissue using a hybrid watershed / surface deformation procedure , automated talairach transformation , segmentation of the subcortical white matter and deep gray matter volumetric structures ( including the hippocampus , amygdala , caudate , putamen , and ventricles ) [ 24 , 26 ] , intensity normalization , tessellation of the gray matter white matter boundary , automated topology correction , and surface deformation following intensity gradients to optimally place the gray / white and gray / cerebrospinal fluid borders at the location where the greatest shift in intensity defines the transition to the other tissue class . surface inflation was followed by registration to a spherical atlas which utilized individual cortical folding patterns to match cortical geometry across subjects and parcellation of the cerebral cortex into units based on gyral and sulcal structure . this method uses both intensity and continuity information from the entire three - dimensional mr volume in segmentation and deformation procedures to produce representations of cortical thickness , calculated as the closest distance from the gray / white boundary to the gray / csf boundary at each vertex on the tessellated surface . the maps are created using spatial - intensity gradients across tissue classes and are therefore not simply reliant on absolute signal intensity . the maps produced are not restricted to the voxel resolution of the original data and are thus capable of detecting submillimeter differences between groups . procedures for the measurement of cortical thickness have been validated against histological analysis and manual measurements [ 33 , 34 ] . these procedures have been demonstrated to show good test retest reliability across scanner manufacturers and across field strengths . a sample of scatter plot from our data shows good comparable across the different centers ( fig . 1 ) . 1years of education was inversely correlated with regional cortical thickness of the inferior parietal gyrus . the data from different countries and scanners were comparable years of education was inversely correlated with regional cortical thickness of the inferior parietal gyrus . the data from different countries and scanners were comparable the cortical thicknesses and regional cortical / subcortical volumes from the automatic processing output were used in the present study , including 33 regional cortical thicknesses and 15 regional volumes . the averaged values of left and right hemispheres were used in the analysis , unless otherwise noted . the correlation between years of schooling and regional cortical thicknesses / volumes was tested with the partial correlation coefficient for each diagnostic group . to allow for the possibility that education may not correlate linearly with regional thickness / volume , we further dichotomized the subjects into more and less educated groups . since the years of compulsory education in the countries from which the subjects was recruited varied from 911 years , and the median of years of schooling in our study population was 9 years , we chose this as a threshold to separate subjects with more and less education . the difference in presence of apoe4 between subjects with more and less education was tested with the chi square test . the analysis of covariance ( ancova ) test was used to compare mri measures between subjects with more and less education . the intracranial volume ( for volume measures , but not for cortical thickness measures ) , country of origin , age , and gender were used as covariates in the partial correlation analysis and ancova . previous studies have shown that higher education is related with better cognitive performance , and that cognitive performance is sensitive to brain atrophy . to control for the possible influence of cognitive performance on regional cortical thickness / volume , mmse was also used as a covariate in the analysis . as the cortical thickness and volumes were measured from a large number of locations , it was necessary to correct for multiple testing . false discovery rate ( fdr ) < 0.05 [ 38 , 39 ] was used to control for type 1 error in the correlation analysis and ancova with the qvalue software package ( http://genomics.princeton.edu/storeylab/qvalue ) . a q value for fdr analysis less than 0.05 was considered as statistically significant . a total of 121 ad patients ( 50% female ; 74 6 years ) , 121 mild cognitive impairment ( mci ) subjects ( 65% female ; 75 6 years ) , and 113 age - matched healthy controls ( 55% female ; 73 6 years ) were selected from the addneuromed study [ 13 , 14 ] ; a prospective , longitudinal multicenter study to discover biomarkers for ad . data were collected from six medical centers across europe : university of kuopio , finland ; university of perugia , italy ; aristotle university of thessaloniki , greece ; king s college london , united kingdom ; medical university of lodz , poland ; and university of toulouse , france . the length of formal education was 8 4 , 9 4 , and 11 5 years for the ad patients , mci subjects , and controls , respectively . clinical dementia rating scale ( cdr ) and mini - mental state examination ( mmse ) were assessed for each subject . the apoe genotype was determined in 114 ad , 110 mci , and 108 controls . informed consent was obtained for all subjects and protocols and procedures were approved by the relevant institutional review board at each data acquisition site and the data coordination site . none of the mci and ad subjects had other neurological or psychiatric disease , significant unstable systemic illness or organ failure , and alcohol or substance misuse . the diagnosis of dementia was based on the criteria of the diagnostic and statistical manual of mental disorders , 4th edition ( dsm - iv ) and the diagnosis of ad on the national institute of neurologic and communicative disorders and stroke and alzheimer s disease and related disorders association ( nincds - adrda ) criteria . at baseline all mci subjects fulfilled the following criteria , in line with consensus criteria for amnestic mci [ 19 , 20 ] : i.e. , ( 1 ) memory complaint by patient , family , or physician ; ( 2 ) normal activities of daily living ; ( 3 ) normal global cognitive function as measured by the mmse ( score range between 2430 ) ; ( 4 ) geriatric depression scale score less than or equal to 5 ; ( 5 ) subject aged 65 years or above ; ( 6 ) cdr memory score of 0.5 or 1 ; and ( 7 ) absence of dementia according to the dsm - iv and nincds - adrda criteria for ad . the controls did not have any neurological or psychiatric disorders and were not taking any psychoactive medication . classification of the controls and mci subjects was based on cdr score and clinician s judgment , rather than on cognitive tests . data acquisition took place using six different 1.5-t mr systems ( four general electric , one siemens , and one picker ) . at each site a quadrature birdcage coil was used for rf transmission and reception . a high - resolution sagittal 3d t1-weighted mprage volume was acquired using a custom pulse sequence specifically designed for the alzheimer s disease neuroimaging initiative ( adni ) study to ensure compatibility across scanners . the parameters were : tr = 913 ms , te = 3.04.1 ms , ti = 1,000 ms , flip angle = 8 , voxel size detailed quality control was carried out on all mr images using previously published criteria [ 21 , 22 ] . first , mri scans were regularly acquired at each of the sites using a urethane test phantom developed by the us - based adni consortium . this allowed precise quantification of the geometric accuracy of a scan , together with other quality control measures , including signal - to - noise ratio and image uniformity using the imageowl web - based automated quality control system ( http://www.imageowl.com ) to ensure good performance of each of the scanners during the duration of the study . second , two volunteers were scanned at each site , and their images were processed using the same analysis tools as the cohort images to ensure compatibility of data . finally , the mri sites and data coordination center worked closely together with continuous feedback as data were acquired . all mri centers were trained to perform quality control at their site at the time the images were acquired with particular emphasis on full brain coverage , image wrap around , subject motion artifacts , contrast between gray and white matter , and image non uniformities . all scanners remained within specification for the adni phantom throughout the course of the study . the coefficient of variation for whole brain measures for the two volunteers scanned at each of the sites was 1.7% and the mean ( sd ) of the coefficients of variation for the smaller anatomical regions reported in this paper was 3.4 ( 1.9)% . all mr images received a clinical read by an on - site radiologist in order to exclude any subjects with non - ad - related pathologies . the freesurfer structural mri image processing pipeline ( version 4.5.0 ) which was developed by fischl and his colleagues was utilized for data analysis [ 23 , 24 ] . cortical reconstruction and volumetric segmentation included removal of non - brain tissue using a hybrid watershed / surface deformation procedure , automated talairach transformation , segmentation of the subcortical white matter and deep gray matter volumetric structures ( including the hippocampus , amygdala , caudate , putamen , and ventricles ) [ 24 , 26 ] , intensity normalization , tessellation of the gray matter white matter boundary , automated topology correction , and surface deformation following intensity gradients to optimally place the gray / white and gray / cerebrospinal fluid borders at the location where the greatest shift in intensity defines the transition to the other tissue class . surface inflation was followed by registration to a spherical atlas which utilized individual cortical folding patterns to match cortical geometry across subjects and parcellation of the cerebral cortex into units based on gyral and sulcal structure . this method uses both intensity and continuity information from the entire three - dimensional mr volume in segmentation and deformation procedures to produce representations of cortical thickness , calculated as the closest distance from the gray / white boundary to the gray / csf boundary at each vertex on the tessellated surface . the maps are created using spatial - intensity gradients across tissue classes and are therefore not simply reliant on absolute signal intensity . the maps produced are not restricted to the voxel resolution of the original data and are thus capable of detecting submillimeter differences between groups . procedures for the measurement of cortical thickness have been validated against histological analysis and manual measurements [ 33 , 34 ] . these procedures have been demonstrated to show good test retest reliability across scanner manufacturers and across field strengths . a sample of scatter plot from our data shows good comparable across the different centers ( fig . 1 ) . 1years of education was inversely correlated with regional cortical thickness of the inferior parietal gyrus . the data from different countries and scanners were comparable years of education was inversely correlated with regional cortical thickness of the inferior parietal gyrus . the data from different countries and scanners were comparable the cortical thicknesses and regional cortical / subcortical volumes from the automatic processing output were used in the present study , including 33 regional cortical thicknesses and 15 regional volumes . the averaged values of left and right hemispheres were used in the analysis , unless otherwise noted . the correlation between years of schooling and regional cortical thicknesses / volumes was tested with the partial correlation coefficient for each diagnostic group . to allow for the possibility that education may not correlate linearly with regional thickness / volume , we further dichotomized the subjects into more and less educated groups . since the years of compulsory education in the countries from which the subjects was recruited varied from 911 years , and the median of years of schooling in our study population was 9 years , we chose this as a threshold to separate subjects with more and less education . the difference in presence of apoe4 between subjects with more and less education was tested with the chi square test . the analysis of covariance ( ancova ) test was used to compare mri measures between subjects with more and less education . the intracranial volume ( for volume measures , but not for cortical thickness measures ) , country of origin , age , and gender were used as covariates in the partial correlation analysis and ancova . previous studies have shown that higher education is related with better cognitive performance , and that cognitive performance is sensitive to brain atrophy . to control for the possible influence of cognitive performance on regional cortical thickness / volume , mmse was also used as a covariate in the analysis . as the cortical thickness and volumes were measured from a large number of locations , it was necessary to correct for multiple testing . false discovery rate ( fdr ) < 0.05 [ 38 , 39 ] was used to control for type 1 error in the correlation analysis and ancova with the qvalue software package ( http://genomics.princeton.edu/storeylab/qvalue ) . a q value for fdr analysis less than 0.05 was considered as statistically significant . the partial correlation coefficients between years of schooling and regional cortical thicknesses and regional volumes are summarized in table 2 , and the regional cortical thicknesses and regional volumes of subjects with more and less education for each group are summarized in table 3 . there were no significant differences in the presence of apoe4 between subjects with more and less education ( p values 0.57 , 0.72 , and 0.12 in ad , mci , and control groups , respectively).table 1demographics and cognitive test results of the ad , mci , and control subjectscontrol ( n = 113)mci ( n = 121)ad ( n = 121)age73 674 675 6female / male ( % female)62/51 ( 55%)60/61 ( 50%)79/42 ( 65%)education years ; mean sd ( range)11 5 ( 225)9 4 ( 020)8 4 ( 022)apoe4 carrier / non - carrier32/7640/7064/50cdr00.51.2 0.5mmse29 127 221 5table 2correlation between years of schooling and regional cortical thicknesses and volumes after controlling for intracranial volume , age , gender , mmse , and country of origincontrolmciadrpqrpqrpqregional cortical thicknessentorhinal cortex0.1080.2660.4880.0850.3670.7320.1790.0540.089parahippocampal gyrus0.0670.4890.6000.0330.7230.8210.0960.3070.327middle temporal gyrus0.1650.0880.3480.1610.0840.6820.2830.0020.022superior temporal gyrus0.1080.2660.4880.1240.1840.6820.2620.0050.041inferior temporal gyrus0.0670.4890.6000.0780.4020.7320.2370.0100.046temporal pole0.1650.0880.3480.0460.6250.7930.1900.0410.087transverse temporal cortex0.0200.8390.9060.1690.0700.6820.1560.0940.124insula0.0670.4910.6000.0610.5170.7320.1490.1100.140fusiform gyrus0.1450.1330.3660.0001.0001.0000.2270.0140.046medial orbitofrontal cortex0.2210.0210.2060.0550.5610.7410.1650.0770.110lateral orbitofrontal cortex0.2690.0050.1650.0270.7710.8210.1440.1220.146orbital operculum0.2150.0250.2060.1240.1840.6820.1660.0760.110frontal operculum0.1330.1700.3830.1150.2200.7260.1830.0500.087superior frontal gyrus0.0500.6110.7200.0710.4500.7320.2080.0250.069pars triangularis0.1510.1190.3570.0700.4530.7320.1090.2430.267frontal pole0.1620.0950.3480.0290.7530.8210.0430.6440.664rostral middle frontal gyrus0.0070.9390.9520.1460.1170.6820.1970.0340.080caudal middle frontal gyrus0.2310.0160.2060.1000.2860.7260.2340.0120.046precentral gyrus0.0750.4430.6000.1240.1860.6820.1820.0500.087superior parietal gyrus0.1620.0930.3480.0360.7040.8210.2290.0130.046post central gyrus0.1540.1110.3570.1900.0410.6820.1440.1240.146paracentral gyrus0.0410.6710.7640.0300.7500.8210.1880.0440.087inferior parietal cortex0.0740.4440.6000.0750.4230.7320.2940.0010.017supramarginal gyrus0.0750.4380.6000.1010.2800.7260.1850.0470.087pericalcarine cortex0.0060.9520.9520.1780.0560.6820.2310.0130.046precuneus cortex0.1320.1740.3830.0790.3990.7320.2300.0130.046lingual gyrus0.1040.2860.49670.0120.8960.9240.1590.0870.120cuneus cortex0.0180.8510.9060.0810.3860.7320.2140.0210.063lateral occipital cortex0.0980.3130.5160.0630.5010.7320.2970.0010.017isthmus of cingulate cortex0.1370.1570.3830.1060.2580.7260.1730.0640.101caudal anterior cingulate cortex0.1080.2660.4880.0670.4770.7320.0210.8200.820rostral anterior cingulate0.0670.4890.6000.0590.5320.7320.1120.2300.262posterior cingulate cortex0.1650.0880.3480.1410.1300.6820.2030.0290.074regional volumehippocampus0.0820.4000.7500.0810.3870.8930.0950.3120.736amygdala0.0340.7270.8390.0520.5760.8930.0800.3960.736caudate0.1150.2370.7500.0630.5000.8930.0380.6860.736accumbens0.0900.3550.7500.0730.4330.8930.0650.4860.736putamen0.0390.6850.8390.0130.8930.8930.0320.7330.736pallidum0.0370.7050.8390.1430.1240.8930.0880.3500.736brain stem0.0990.3100.7500.1210.1960.8930.0320.7360.736cerebral cortex0.0510.6010.8390.0240.7970.8930.0810.3870.736cerebellum cortex0.0560.5680.8390.0850.3620.8930.1470.1160.736thalamus0.1770.0660.5180.0910.3290.8930.0340.7210.736corpus callosum anterior0.1150.2350.7500.0290.7600.8930.0430.6440.736corpus callosum central0.0160.8660.9080.0320.7330.8930.0410.6650.736corpus callosum mid - anterior0.1760.0690.5180.1380.1400.8930.0470.6180.736corpus callosum mid - posterior0.1010.2980.7500.0160.8660.8930.0520.5810.736corpus callosum posterior0.0110.9080.9080.0430.6430.8930.0620.5060.736indicates significant correlation ( false discovery rate < 0.05)table 3regional cortical thicknesses and absolute regional volumes of more and less educated subjects in ad , mci , and control groupscontrolmciadless educated ( n = 41)more educated ( n = 72)less educated ( n = 69)more educated ( n = 52)less educated ( n = 77)more educated ( n = 44)regional cortical thickness ( mm)entorhinal cortex3.3 0.53.4 0.33.0 0.53.1 0.52.7 0.52.7 0.5parahippocampal gyrus2.5 0.32.6 0.32.4 0.32.4 0.32.2 0.32.2 0.3middle temporal gyrus2.7 0.22.7 0.22.6 0.22.7 0.22.5 0.32.4 0.3superior temporal gyrus2.5 0.22.5 0.12.4 0.22.5 0.22.3 0.22.2 0.2inferior temporal gyrus2.7 0.22.7 0.12.6 0.22.7 0.22.5 0.32.4 0.3temporal pole3.5 0.33.6 0.23.3 0.43.4 0.43.1 0.53.1 0.5transverse temporal cortex2.0 0.22.1 0.21.9 0.22.0 0.31.9 0.31.8 0.3insula2.8 0.22.9 0.22.7 0.22.8 0.22.6 0.32.6 0.2fusiform gyrus2.5 0.22.5 0.22.4 0.22.5 0.22.3 0.32.3 0.2medial orbitofrontal cortex2.3 0.22.3 0.22.3 0.22.3 0.22.1 0.32.1 0.2lateral orbitofrontal cortex2.5 0.12.5 0.12.4 0.22.4 0.22.3 0.22.3 0.2orbital operculum2.5 0.22.6 0.22.5 0.22.5 0.22.4 0.22.4 0.2frontal operculum2.3 0.22.3 0.22.2 0.22.3 0.22.2 0.32.2 0.2superior frontal gyrus2.5 0.22.5 0.22.4 0.22.5 0.22.4 0.22.3 0.2pars triangularis2.2 0.12.2 0.22.2 0.22.2 0.22.1 0.22.1 0.2frontal pole2.6 0.22.7 0.32.6 0.22.6 0.32.5 0.32.5 0.3rostral middle frontal gyrus2.1 0.12.2 0.12.1 0.12.2 0.22.1 0.32.0 0.2caudal middle frontal gyrus2.3 0.22.3 0.22.2 gyrus2.2 0.22.2 0.22.1 0.22.2 0.22.1 0.42.0 0.2superior parietal gyrus2.0 0.12.0 0.21.9 0.22.0 0.21.9 0.41.8 0.2post central gyrus1.8 0.21.8 0.11.7 0.11.8 0.11.7 0.31.7 0.2paracentral gyrus2.1 0.22.1 0.22.0 0.22.0 0.31.9 0.2inferior parietal cortex2.2 0.22.3 0.22.2 0.22.2 0.22.1 0.22.0 0.2supramarginal gyrus2.3 0.22.3 0.22.2 0.22.2 0.22.1 0.32.1 0.2pericalcarine cortex1.4 0.11.4 0.11.4 0.11.4 0.11.4 0.11.3 0.1precuneus cortex2.0 0.22.1 0.22.0 0.12.0 0.21.9 0.31.9 0.2lingual gyrus1.7 0.11.8 0.11.7 0.11.8 0.11.7 0.21.7 0.1cuneus cortex1.6 0.11.7 0.11.6 0.11.7 0.11.7 0.21.6 0.1lateral occipital cortex2.0 0.12.0 0.12.0 0.12.0 0.12.0 0.21.9 0.2isthmus of cingulate cortex2.3 0.22.2 0.32.1 0.3caudal anterior cingulate cortex2.6 0.22.6 0.22.6 0.32.6 0.22.5 0.32.5 0.3rostral anterior cingulate2.8 0.22.9 0.22.8 0.32.8 0.22.7 0.32.7 0.3posterior cingulate cortex2.3 0.22.4 0.22.3 0.12.3 0.22.2 0.22.2 0.2regional volume ( ml)hippocampus3.5 0.53.6 0.43.2 0.63.3 0.52.6 0.52.6 0.4amygdala1.4 0.21.4 0.21.2 0.31.2 0.31.0 0.21.0 0.2caudate3.3 0.63.3 0.53.3 0.53.3 0.63.3 0.73.2 0.7accumbens0.5 0.10.5 0.10.4 0.10.5 0.10.4 0.10.4 0.1putamen4.6 0.54.7 0.54.7 0.64.5 1.14.5 0.64.5 0.9pallidum1.5 0.21.5 0.21.5 0.21.5 0.21.4 0.41.4 0.2brain stem19.4 2.319.8 1.919.4 2.219.6 2.618.9 3.118.8 2.1cerebral cortex198.1 22.4198.9 16.1192.5 18.7196.2 18.3179.5 21.7180.8 22.7cerebellum cortex45.6 5.446.2 4.545.6 5.346.1 5.344.2 6.445.6 5.8thalamus5.9 0.75.9 0.55.8 0.65.9 0.76.0 2.7.5.7 0.7corpus callosum anterior0.8 0.10.8 0.10.7 0.10.8 0.10.8 0.40.7 0.1corpus callosum central0.3 0.10.3 0.10.3 0.10.4 0.10.4 0.70.3 0.1corpus callosum mid - anterior0.3 0.10.4 0.10.3 0.10.4 0.10.5 0.90.3 0.1corpus callosum mid - posterior0.3 0.10.3 0.10.3 0.10.3 0.10.3 0.10.8 0.10.8 0.10.9 0.10.8 0.20.8 0.1indicates significant difference ( fdr < 0.05 ) between more and less educated subjects after adjusting for age , gender , country of origin , and mmse . the intracranial volume was also adjusted for volumes demographics and cognitive test results of the ad , mci , and control subjects correlation between years of schooling and regional cortical thicknesses and volumes after controlling for intracranial volume , age , gender , mmse , and country of origin indicates significant correlation ( false discovery rate < 0.05 ) regional cortical thicknesses and absolute regional volumes of more and less educated subjects in ad , mci , and control groups indicates significant difference ( fdr < 0.05 ) between more and less educated subjects after adjusting for age , gender , country of origin , and mmse . the intracranial volume was also adjusted for volumes after adjusting for confounders and multiple testing , no significant correlation between years of schooling and regional cortical thicknesses / volumes was found . however , when the controls were dichotomized into more and less educated groups ( years of schooling 14 3 vs. 6 2 years ) , the thicknesses of the temporal pole , transverse temporal gyrus , and isthmus of cingulate cortex were significantly larger in the subjects with more education than in those with less education ( fig . 2the healthy controls with more education had greater cortical thickness than those with less education at the transverse temporal cortex , isthmus cingulate , and insula the healthy controls with more education had greater cortical thickness than those with less education at the transverse temporal cortex , isthmus cingulate , and insula after adjusting for confounders and multiple testing , no significant correlation between years of schooling and regional cortical thicknesses / volumes was found . the regional cortical thicknesses / volumes did not differ significantly between the subjects with more education than those with less education ( years of schooling 13 3 vs. 6 2 years ) . after controlling for confounders and multiple testing , in the ad group , the years of schooling were inversely correlated with regional cortical thicknesses of the inferior , middle and superior temporal gyri , fusiform gyrus , caudal middle frontal gyrus , inferior and superior parietal gyri , pericalcarine cortex , precuneus cortex , and lateral occipital cortex . we further separately analyzed the correlation between years of schooling and regional cortical thickness for the left and right hemispheres . the regional cortex was significantly thinner in the inferior , superior , and middle temporal gyri , superior and inferior parietal gyri , and lateral occipital cortex in the patients with more education than those with less education ( years of schooling 12 3 vs. 5 2 years).fig . 3after controlling for confounders and multiple testing , in the ad group , the years of schooling were inversely correlated with regional cortical thicknesses of the bilateral lateral occipital cortex , middle and superior temporal gyri , left fusiform gyrus , and right caudal middle and superior frontal gyri , inferior and superior parietal gyri , inferior temporal gyrus , posterior cingulate cortex , and precuneus cortex after controlling for confounders and multiple testing , in the ad group , the years of schooling were inversely correlated with regional cortical thicknesses of the bilateral lateral occipital cortex , middle and superior temporal gyri , left fusiform gyrus , and right caudal middle and superior frontal gyri , inferior and superior parietal gyri , inferior temporal gyrus , posterior cingulate cortex , and precuneus cortex after adjusting for confounders and multiple testing , no significant correlation between years of schooling and regional cortical thicknesses / volumes was found . however , when the controls were dichotomized into more and less educated groups ( years of schooling 14 3 vs. 6 2 years ) , the thicknesses of the temporal pole , transverse temporal gyrus , and isthmus of cingulate cortex were significantly larger in the subjects with more education than in those with less education ( fig . 2).fig . 2the healthy controls with more education had greater cortical thickness than those with less education at the transverse temporal cortex , isthmus cingulate , and insula the healthy controls with more education had greater cortical thickness than those with less education at the transverse temporal cortex , isthmus cingulate , and insula after adjusting for confounders and multiple testing , no significant correlation between years of schooling and regional cortical thicknesses / volumes was found . the regional cortical thicknesses / volumes did not differ significantly between the subjects with more education than those with less education ( years of schooling 13 3 vs. 6 2 years ) . after controlling for confounders and multiple testing , in the ad group , the years of schooling were inversely correlated with regional cortical thicknesses of the inferior , middle and superior temporal gyri , fusiform gyrus , caudal middle frontal gyrus , inferior and superior parietal gyri , pericalcarine cortex , precuneus cortex , and lateral occipital cortex . we further separately analyzed the correlation between years of schooling and regional cortical thickness for the left and right hemispheres . the regional cortex was significantly thinner in the inferior , superior , and middle temporal gyri , superior and inferior parietal gyri , and lateral occipital cortex in the patients with more education than those with less education ( years of schooling 12 3 vs. 5 2 years).fig . 3after controlling for confounders and multiple testing , in the ad group , the years of schooling were inversely correlated with regional cortical thicknesses of the bilateral lateral occipital cortex , middle and superior temporal gyri , left fusiform gyrus , and right caudal middle and superior frontal gyri , inferior and superior parietal gyri , inferior temporal gyrus , posterior cingulate cortex , and precuneus cortex after controlling for confounders and multiple testing , in the ad group , the years of schooling were inversely correlated with regional cortical thicknesses of the bilateral lateral occipital cortex , middle and superior temporal gyri , left fusiform gyrus , and right caudal middle and superior frontal gyri , inferior and superior parietal gyri , inferior temporal gyrus , posterior cingulate cortex , and precuneus cortex two kinds of reserve against brain damage have been advocated : brain reserve and cognitive reserve . the concept of brain reserve was first introduced by roth , tomlinson , and blessed and was elaborated upon by satz . it refers to individuals with larger brain volumes who can sustain brain damage before reaching a threshold for clinical symptoms . cognitive reserve refers to the ability of the brain to compensate for brain damage by using preexisting cognitive processing approaches or recruiting compensatory approaches . to date the concept of brain reserve has received very limited support ( for review see ) . it is likely that both brain and cognitive reserves are involved in providing reserve against brain damage and cognitive decline . one of the most interesting finding in the present study is that after adjusting for cognitive performance ( mmse ) , i.e. , at similar cognitive performance , some areas of regional cortex were significantly thinner in ad patients with high education than those with less education ( regional cortical thicknesses of middle and superior temporal gyri , inferior parietal cortex , and lateral occipital cortex ) . this implies that the ad patients with more education have better ability than the patients with less education to compensate for the effects of atrophy . this finding strongly supports the concept of an increased cognitive reserve in the subjects with more education . the thinner regional cortex in ad patients with more education might be one reason to explain why deterioration progresses more rapidly in ad patients with more education . this finding is supported by a diffusion tensor imaging study which showed that years of schooling are associated with reduced white matter integrity of media temporal lobe and is in line with the study of querbes et al . who found that people with more education have a thinner cortex than people with less education . the finding that ad patients had smaller regional cortical thicknesses is further supported by a recent study which showed that education is associated with cortical thinning in the frontal , temporal , and parietal association cortexes ; precuneus ; medial , frontal , and basal temporal regions ; orbitofrontal ; and cuneus . however , morphological influence of education on the brain in non - demented people is controversial in the literature . in previous volumetric studies , non - demented people with more education or better socioeconomic status have been shown to have more atrophy [ 6 , 7 ] . piras et al . reported that years of schooling are significantly positively correlated with regional brain volumes and inversely correlated with mean diffusivity of several deep gray matter structures , indicating larger regional volumes and higher level of neural reserve in non - demented people . a recent study showed that people with high early life iq had larger brains than people with low iq in the aged healthy group . in our study , after controlling for confounders and multiple testing , there was no significant correlation between years of schooling and regional cortical thicknesses / volumes in the healthy control group , which is supported by a recent study which showed no effect of education on regional cortical thickness in a linear regression analysis in healthy people . however , when dichotomizing the controls into more and less educated groups with a cutoff of 9 years of schooling , the thicknesses of the temporal pole , transverse temporal gyrus , and isthmus of cingulate cortex were significantly larger in the subjects with more education than those with less education . it is interesting that the healthy controls with more education had larger regional cortical thicknesses than those with less education after controlling for confounding factors , but that they did not show any significant correlation between regional cortical thicknesses and years of schooling . however , this potential nonlinear effect should be replicated in a population with the same education system to be truly robust . in the present study , the controls with more education had thicker regional cortices , but there was no significant difference in the mci subjects . in ad patients , a recent study showed that in non - demented people , higher socioeconomic status is associated with more rapid brain volume loss in those who developed dementia later . this might account for the different finding in our diagnostic groups . it is notable that there were positive findings for regional cortical thickness measures , but a lack of positive findings for regional volume measures . in previous studies , a significant correlation was found between education and whole brain volume or volume of peripheral cerebrospinal fluid [ 6 , 7 ] . however , in the study of coffey et al . , there was no significant correlation between regional volumes and education . in a recent study , seo et al . had similar findings to ours using regional cortical thicknesses as a morphological proxy . it thus seems that regional cortical thickness is a better parameter for studying brain and cognitive reserve than brain volume , especially when results are divided into subregions of the brain . the frequency of presence of apoe4 was different among the three groups and it is important to bear in mind that apoe4 genotype is a significant contribution to cortical thinning in ad and mci . the difference in the frequency of the presence of apoe4 might confound the results of the different groups . we do not have regional cortical thicknesses / volumes at the subject s schooling ages , so it is not possible to exclude the presence of selection bias due to individual difference in innate brain volume . therefore , the finding that healthy aged people with more education have larger regional cortices needs to be confirmed . using 9 years as a cutoff value to dichotomize less or more educated subjects might be one reason for the discrepancy between the results of the correlation analysis and group comparison . we did not control for cardiovascular disease and cardiovascular risk factors ( hypertension and diabetes ) , occupational attainment , and unhealthy life - styles . studies have demonstrated that each of these confounding factors independently contributes to reserve [ 3 , 45 , 47 , 48 ] . the mmse has very low variance and ceiling effects in control subjects might affect the correlation analysis in the control group . education appears to have a differential impact on cortical thickness in healthy controls and ad patients . it may increase regional cortical thickness in healthy controls , leading to increased brain reserve , as well as helping ad patients to cope better with the effects of brain atrophy by increasing cognitive reserve . this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited .
introductionthe aim of this study was to determine whether years of schooling influences regional cortical thicknesses and volumes in alzheimer s disease ( ad ) , mild cognitive impairment ( mci ) , and healthy age - matched controls.methodsusing an automated image analysis pipeline , 33 regional cortical thickness and 15 regional volumes measures from mri images were determined in 121 subjects with mci , 121 patients with ad , and 113 controls from addneuromed study . correlations with years of schooling were determined and more highly and less highly educated subjects compared , controlling for intracranial volume , age , gender , country of origin , cognitive status , and multiple testing.resultsafter controlling for confounding factors and multiple testing , in the control group , subjects with more education had larger regional cortical thickness in transverse temporal cortex , insula , and isthmus of cingulate cortex than subjects with less education . however , in the ad group , the subjects with more education had smaller regional cortical thickness in temporal gyrus , inferior and superior parietal gyri , and lateral occipital cortex than the subjects with less education . no significant difference was found in the mci group.conclusioneducation may increase regional cortical thickness in healthy controls , leading to increased brain reserve , as well as helping ad patients to cope better with the effects of brain atrophy by increasing cognitive reserve .
mutations and substitutions are fundamental changes in nucleotide sequence over evolutionary time ( 1 ) . among the well - established methods for studying the evolution of protein - coding genes , the ratio of non - synonymous substitution rate ( ka , amino acid replacing ) to synonymous substitution rate ( ks , silent ) is the most powerful measure of selective pressure on a protein ( 28 ) . since non - synonymous and synonymous substitution sites are interspersed within a gene segment , this approach literally compares the amino acid replacement rate against the silent substitution rate . traditionally , if ka / ks < 1 , the gene is inferred to be under negative ( purifying ) selection ; if ka / ks = 1 , the gene is probably neutrally evolving ; if ka / ks > 1 , the gene is probably under positive ( adaptive ) selection , since mutations in the gene have higher probabilities of being fixed in the population than expected from the predictions of neutrality . however , this approach , in effect , averages substitution rates over all amino acid sites in the sequence . because most amino acids are expected to be under purifying selection , with positive selection most likely affecting only a few sites , this approach often loses the power to detect positive selection . to increase its sensitivity , a sliding window analysis along the primary sequence was introduced ( 9,10 ) . recent studies further indicate that when a three - dimensional ( 3d ) protein structure is available , one can detect positive selection much more sensitively by using windows in 3d space instead ( 1113 ) . for example , hughes and nei ( 14 ) detected positive selection at the antigen recognition sites ( ars ) in major histocompatibility complex ( mhc ) alleles but not the whole gene . we developed a bioinformatic web server ( swakk ) whose primary purpose is to detect regions under positive selection using a sliding window ka / ks analysis ( figure 1 ) . with the input of two protein - coding dna sequences , one reference protein 3d structure and other user - defined parameters , the web server will automatically align the sequences , calculate ka / ks in each 3d window , and display the results on the 3d structure . the server also can perform the analysis on the primary sequence , either for comparison or when a structure is unavailable . in addition , if two inferred ancestral gene sequences are used as an input , the server can examine natural selection in an ancestral branch of a phylogenetic tree ( 15 ) . we note that two important features distinguish our swakk server from other available web servers ( 1618 ) that can identify functionally important sites in proteins . the first difference is that these other web servers focus on each single amino acid site or codon in the multiple sequence alignment , which essentially averages the overall time interval . instead , our server considers a group of codons within a small window for each pairwise comparison . second , unlike other web servers where protein 3d structures are only used to display the results , our swakk server takes full advantage of the information intrinsically stored in a 3d structure to define neighboring codon groups . without requiring an explicit evolutionary model or expensive computation , swakk thus provides a useful tool to complement the existing arsenal of methods for detecting positive selection . swakk accepts input as a pair of coding dna sequences and a reference protein structure ( pdb file ) . the dna sequences are translated into amino acids and aligned with the amino acid sequence parsed from the pdb file using clustalw ( 19 ) . swakk constructs 3d windows by placing each amino acid at the center and including all amino acids within a pre - specified distance ( in ngstrms ) from the center . all the corresponding codons within a window are extracted to form a sub - alignment , and the ka / ks score ( also the standard error ) is calculated using the paml package ( 20 ) . finally , according to the ka / ks scores and a user - defined cut - off , the sites ( regions ) can be classified as positive , negative or neutral , and these are displayed in different colors on the 3d structure using the chime plug - in component . if a reference structure is not available , the server can also perform the analysis on the primary sequence . in this situation , the window size is defined as the distance in 1d sequence rather than in 3d space , and the results are displayed in the graph drawn by the gnuplot software . with more and more protein structures available , we expect this web server to become a valuable bioinformatic tool for detecting functionally important sites . the server facilitates the identification of regions of a protein sequence or structure that may be under positive selection and is easily accessible to the broad biological community . the upper part is a snapshot of the 3d analyzer web page . on the bottom are sample output files : left , 3d provided by the 3d analyzer ( when the structure is available ) , with amino acids colored based on inferred level of selection . right , 2d graph ( [ ka ks ] versus window location ) provided by the 1d analyzer . the example shown is the mhc glycoprotein gene ( 14,21 ) and , consistent with the previous studies , most of the sites identified under positive selection are clustered in the ars domain .
we present a bioinformatic web server ( swakk ) for detecting amino acid sites or regions of a protein under positive selection . it estimates the ratio of non - synonymous to synonymous substitution rates ( ka / ks ) between a pair of protein - coding dna sequences , by sliding a 3d window , or sphere , across one reference structure . the program displays the results on the 3d protein structure . in addition , for comparison or when a reference structure is unavailable , the server can also perform a sliding window analysis on the primary sequence . the swakk web server is available at .
to assess local prevalence of b. microti in host - seeking nymphal i. ricinus ticks , we developed a tick - sampling procedure with high spatial resolution ( figure 1 ) . the roughly rectangular , 0.7-ha field site , ruetiwis ( 9 38 e , 46 59 n ) , is located on a steep southwesterly slope near seewis in the lower praettigau valley of eastern switzerland at an approximate mean altitude of 850 m above sea level . the site is characterized by abandoned pastures that are partly overgrown by young stands of deciduous and coniferous trees and bushes , as well as by mature mixed forest . distance between sampling points is 30 m. the letters and solid arrows denote the sections used for prevalence estimation . sampling lines that connect points not belonging to a section are not included in that section ( e.g. , line b4c2 is not part of section b ) . to ensure the quality of tick - derived dna , pools of 211 nymphal ticks were transferred to 0.5-ml microcentrifuge tubes containing 50 l guanidium thiocyanate solution and stored at room temperature until further processing . before homogenization with a glass pestle , the solution containing the ticks was incubated at 60c for 2 h. dna was extracted from the tick homogenate by the phenol - chloroform method . the resulting dna pellet was suspended in 30 l dnase - free h20 . to determine whether b. microti specific dna was present , the extracted dna was subjected to polymerase chain reaction ( pcr ) with the primer pair bab-1 ( 5-ttagtataagcttttatacagc-3 ) and bab-4 ( 5-ataggtcagaaacttgaatgataca-3 ) ( 10 ) , which targets a 250-bp fragment of the 18s rrna gene of b. microti . after denaturation for 2 min at 94c , 40 cycles were performed , with 45 sec at 94c , 45 sec at 55c , and 45 sec at 72c , followed by a 7-min final extension . amplification products were separated on 2% agarose gel in tris - borate - edta buffer , stained with ethidium bromide , and visualized under uv light . to differentiate the sequence of interest from a frequently observed , slightly smaller fragment , purified pcr products were digested with xhoi ( life technologies , invitrogen corp . , the resulting two fragments specific for b. microti migrate in one band on the 2% agarose gel . the corresponding sequence of b. divergens lacks the restriction site . to verify the taxonomic status of the babesia spp . detected in these ticks , we conducted a phylogenetic analysis on a representative sample from which dna had been amplified ( bab-1/bab-4 ) . for this purpose we used the primer pair piro a and piro b , which also targets 18s rdna but is less specific for b. microti ; the resulting sequence is longer ( 400 bp ) than the bab-1/bab-4 amplicon ( 11 ) . after pcr amplification , the respective band was excised from the agarose gel , purified with spin columns ( qiagen inc . , valencia , ca ) , and sent to the university of maine sequencing facility for sequence analysis . phylogenetic analysis was performed by both maximum parsimony ( swofford d. phylogenetic analysis using parsimony , paup*4b61 ; sinauer associates , inc . , sunderland , ma ) and neighbor - joining analyses ( 12 ) with toxoplasma gondii ( genbank accession no . robustness of the nodes was assessed by bootstrap analysis with 500 bootstrap replicates . to accurately estimate the local prevalence of b. microti infection in i. ricinus ticks , we developed a maximum likelihood method for point estimation as well as a method for calculating confidence intervals . briefly , the maximum likelihood estimate ( mle ) of the prevalence p is based on the likelihood to determine whether humans may be exposed to b. microti in the study area , we recruited 400 blood donors living within 10 km of the field site for a serologic survey of tick - borne zoonoses . volunteers were recruited for this cross - sectional seroprevalence study during blood drives from december 1997 to may 1998 in towns within a 10-km radius of the study site . this protocol was approved by the human subjects committee of the harvard school of public health ( protocol number 9712thee ) . the sera of participants who gave their written informed consent were tested by indirect immunofluorescence assay ( ifa ) as described ( 14 ) . antigen slides were prepared from erythrocytes of b. microti infected hamsters ( the gi strain , originally derived from a nantucket island patient ) . a panel of sera included all samples reactive in the screening test for which enough serum was available , including samples with borderline reactivity and representative controls . this panel was coded and blindly retested for b. microti ifa at the university of connecticut laboratories , which specialize in babesia serology . to assess local prevalence of b. microti in host - seeking nymphal i. ricinus ticks , we developed a tick - sampling procedure with high spatial resolution ( figure 1 ) . the roughly rectangular , 0.7-ha field site , ruetiwis ( 9 38 e , 46 59 n ) , is located on a steep southwesterly slope near seewis in the lower praettigau valley of eastern switzerland at an approximate mean altitude of 850 m above sea level . the site is characterized by abandoned pastures that are partly overgrown by young stands of deciduous and coniferous trees and bushes , as well as by mature mixed forest . distance between sampling points is 30 m. the letters and solid arrows denote the sections used for prevalence estimation . sampling lines that connect points not belonging to a section are not included in that section ( e.g. , line b4c2 is not part of section b ) . to ensure the quality of tick - derived dna , pools of 211 nymphal ticks were transferred to 0.5-ml microcentrifuge tubes containing 50 l guanidium thiocyanate solution and stored at room temperature until further processing . before homogenization with a glass pestle , the solution containing the ticks was incubated at 60c for 2 h. dna was extracted from the tick homogenate by the phenol - chloroform method . the resulting dna pellet was suspended in 30 l dnase - free h20 . to determine whether b. microti specific dna was present , the extracted dna was subjected to polymerase chain reaction ( pcr ) with the primer pair bab-1 ( 5-ttagtataagcttttatacagc-3 ) and bab-4 ( 5-ataggtcagaaacttgaatgataca-3 ) ( 10 ) , which targets a 250-bp fragment of the 18s rrna gene of b. microti . after denaturation for 2 min at 94c , 40 cycles were performed , with 45 sec at 94c , 45 sec at 55c , and 45 sec at 72c , followed by a 7-min final extension . amplification products were separated on 2% agarose gel in tris - borate - edta buffer , stained with ethidium bromide , and visualized under uv light . to differentiate the sequence of interest from a frequently observed , slightly smaller fragment , purified pcr products were digested with xhoi ( life technologies , invitrogen corp . , the resulting two fragments specific for b. microti migrate in one band on the 2% agarose gel . the corresponding sequence of b. divergens lacks the restriction site . to verify the taxonomic status of the babesia spp . detected in these ticks , we conducted a phylogenetic analysis on a representative sample from which dna had been amplified ( bab-1/bab-4 ) . for this purpose we used the primer pair piro a and piro b , which also targets 18s rdna but is less specific for b. microti ; the resulting sequence is longer ( 400 bp ) than the bab-1/bab-4 amplicon ( 11 ) . after pcr amplification , the respective band was excised from the agarose gel , purified with spin columns ( qiagen inc . , valencia , ca ) , and sent to the university of maine sequencing facility for sequence analysis . phylogenetic analysis was performed by both maximum parsimony ( swofford d. phylogenetic analysis using parsimony , paup*4b61 ; sinauer associates , inc . , sunderland , ma ) and neighbor - joining analyses ( 12 ) with toxoplasma gondii ( genbank accession no . to accurately estimate the local prevalence of b. microti infection in i. ricinus ticks , we developed a maximum likelihood method for point estimation as well as a method for calculating confidence intervals . briefly , the maximum likelihood estimate ( mle ) of the prevalence p is based on the likelihood to determine whether humans may be exposed to b. microti in the study area , we recruited 400 blood donors living within 10 km of the field site for a serologic survey of tick - borne zoonoses . volunteers were recruited for this cross - sectional seroprevalence study during blood drives from december 1997 to may 1998 in towns within a 10-km radius of the study site . this protocol was approved by the human subjects committee of the harvard school of public health ( protocol number 9712thee ) . the sera of participants who gave their written informed consent were tested by indirect immunofluorescence assay ( ifa ) as described ( 14 ) . antigen slides were prepared from erythrocytes of b. microti infected hamsters ( the gi strain , originally derived from a nantucket island patient ) . a panel of sera included all samples reactive in the screening test for which enough serum was available , including samples with borderline reactivity and representative controls . this panel was coded and blindly retested for b. microti ifa at the university of connecticut laboratories , which specialize in babesia serology . to verify the identity of the amplified dna , a phylogenetic analysis was performed . the sequence amplified from our i. ricinus ticks , which was deposited in genbank ( accession no . af494286 ) , differed by l bp from the north american b. microti sequence ( genbank accession no . af231348 ) and was identical with that of b. microti from slovenia ( genbank accession no . our sequence clearly clustered with the european and the american strain of b. microti ( figure 2 ) , with concordant results from both maximum parsimony and neighbor - joining analyses . therefore , the piroplasms detected in i. ricinus ticks from switzerland must be considered b. microti . : babesia microti - slovenia af373332 ; b. microti - switzerland af494286 ; b. microti- nantucket af231348 ; " toxoplasma annae " af188001 ; b. rodhaini ab049999 ; wa1 af158700 ; b. gibsoni 1 af158702 ; b. divergens 1 u07885 ; b. divergens 2 u16370 ; b. odocoilei u16369 ; b. gibsoni 2 af175300 ; b. gibsoni 3 af175301 ; and toxoplasma gondii x68523 . we then determined the prevalence of b. microti infection in nymphal i. ricinus ticks from the study site , on the basis of pcr amplification of b. microti in dna tick pools . thus , b. microti infection appears to be common in human - biting ticks at this central european study site . pools in bold are positive ; dashes represent the absence of further pools . to determine whether the prevalence of b. microti is distributed homogeneously within the study site , prevalence of infection in ticks the overall prevalence of b. microti infection in ticks , as estimated by mle , was close to 4% . more detailed spatial analysis , however , indicates that the distribution of babesial infection at the site is heterogeneous ( table 2 ) . in the lower portion of the site ( section d ) , > 10% of all ticks were infected , while in the upper portion ( b c ) , prevalence was < 1% . prevalence of infection in ticks was similar in sections b and c ( p=0.161 ) , but greater in section d than in sections b and c ( p=0.003 ) . mle ( maximum likelihood estimate ) of the point estimates are shown with 95% bootstrap confidence limits . to determine how frequently humans are exposed to b. microti infection in the region around the study site , sera of local residents were screened by ifa for the presence of antibodies to b. microti antigen . most sera ( 80% ) were collected from december through march , when i. ricinus is not active . five ( 1.5% ) of 396 human sera were immunoglobulin ( ig ) g - reactive against b. microti antigen at a titer 1:64 . all the samples positive on initial testing and one with a borderline result were confirmed on retesting to be reactive at a titer > 1:64 , while none of the samples with a negative screening result reacted ( table 3 ) . specific igm seroreactivity was not found in any of the sera , a finding compatible with the time of the year when most of the sera had been collected . these results indicate that residents of our central european study site are exposed to bites of ticks infected with b. microti . to verify the identity of the amplified dna , a phylogenetic analysis was performed . the sequence amplified from our i. ricinus ticks , which was deposited in genbank ( accession no . af494286 ) , differed by l bp from the north american b. microti sequence ( genbank accession no . af231348 ) and was identical with that of b. microti from slovenia ( genbank accession no . our sequence clearly clustered with the european and the american strain of b. microti ( figure 2 ) , with concordant results from both maximum parsimony and neighbor - joining analyses . therefore , the piroplasms detected in i. ricinus ticks from switzerland must be considered b. microti . : babesia microti - slovenia af373332 ; b. microti - switzerland af494286 ; b. microti- nantucket af231348 ; " toxoplasma annae " af188001 ; b. rodhaini ab049999 ; wa1 af158700 ; b. gibsoni 1 af158702 ; b. divergens 1 u07885 ; b. divergens 2 u16370 ; b. odocoilei u16369 ; b. gibsoni 2 af175300 ; b. gibsoni 3 af175301 ; and toxoplasma gondii x68523 . we then determined the prevalence of b. microti infection in nymphal i. ricinus ticks from the study site , on the basis of pcr amplification of b. microti in dna tick pools . thus , b. microti infection appears to be common in human - biting ticks at this central european study site . pools in bold are positive ; dashes represent the absence of further pools . to determine whether the prevalence of b. microti is distributed homogeneously within the study site , prevalence of infection in ticks the overall prevalence of b. microti infection in ticks , as estimated by mle , was close to 4% . more detailed spatial analysis , however , indicates that the distribution of babesial infection at the site is heterogeneous ( table 2 ) . in the lower portion of the site ( section d ) , > 10% of all ticks were infected , while in the upper portion ( b c ) , prevalence was < 1% . prevalence of infection in ticks was similar in sections b and c ( p=0.161 ) , but greater in section d than in sections b and c ( p=0.003 ) . mle ( maximum likelihood estimate ) of the point estimates are shown with 95% bootstrap confidence limits . to determine how frequently humans are exposed to b. microti infection in the region around the study site , sera of local residents were screened by ifa for the presence of antibodies to b. microti antigen . most sera ( 80% ) were collected from december through march , when i. ricinus is not active . five ( 1.5% ) of 396 human sera were immunoglobulin ( ig ) g - reactive against b. microti antigen at a titer 1:64 . all the samples positive on initial testing and one with a borderline result were confirmed on retesting to be reactive at a titer > 1:64 , while none of the samples with a negative screening result reacted ( table 3 ) . specific igm seroreactivity was not found in any of the sera , a finding compatible with the time of the year when most of the sera had been collected . these results indicate that residents of our central european study site are exposed to bites of ticks infected with b. microti . b. microti infected nymphal i. ricinus ticks are present at swiss study site , and human residents of the area appear to be exposed to this agent . however , the presence of b. microti in i. ricinus ticks has been reported only once before ( 5 ) . a phylogenetic analysis clearly demonstrated that the piroplasms found in our study site belong to b. microti , rather than to other babesia or theileria species ( figure 2 ) . the detection of b. microti dna in host - seeking nymphal i. ricinus ticks may , however , simply reflect spill - over from enzootic transmission by the accepted maintenance vector for b. microti in eurasia , the tick i. trianguliceps ( 15 ) . this tick , which does not bite humans , infests small rodents that also are abundantly parasitized by i. ricinus ( 3,16 ) . the prevalence of infection in ticks may be underestimated as only one genome copy is present per parasite in unfed ticks before sporogony . therefore , low parasite loads may escape detection , thus increasing the specificity of the assay . in our study , maximizing specificity was desirable because infection of i. ricinus with b. microti was a priori assumed to be rare , and underestimation of prevalence therefore is conservative . regardless , the proportion of ticks that appear to be infected by b. microti is similar to that in coastal new england ( s. telford , unpub . data ) . recently , duh et al . reported a similarly high prevalence of b. microti infection in nymphal i. ricinus ticks collected in slovenia ( 7 of 69 ticks tested by pcr ) ( 17 ) . in combination with our findings , this report suggests that b. microti infection in i. ricinus ticks is far more common than traditionally thought . in addition , vector competence of i. ricinus for b. microti has been demonstrated experimentally ( 7,18 ) . the frequent infection of i. ricinus with this piroplasm therefore implies zoonotic relevance of this vector - pathogen association in switzerland and possibly in other parts of europe . similar to tick - borne encephalitis virus , b. microti seems to be maintained in small focal areas . the risk of human infection therefore is spatially highly variable and may be conditional on tick density . preliminary analysis of tick infection data from the study site over a 3-year period ( foppa , unpub . data ) suggests that b. microti is locally maintained , especially in the lower portion of that site , while the exact location of the maximum risk changes over the years . residents of this site in eastern switzerland appear to be exposed to bites by ticks infected with b. microti . the serologic result is unlikely to reflect low specificity of the assay , as previous evaluation of this ifa has demonstrated high specificity ( 19,20 ) . as part of this evaluation , we tested 50 sera from residents of iceland , where ticks capable of transmitting b. microti are absent ; none of the sera reacted with b. microti antigen ( 19 ) . this finding suggests a satisfactory positive predictive value of the serologic test even in settings of low prevalence . in the northeastern united states , b. microti seroprevalence has varied in endemic regions , from 3.7% in red cross blood donors on cape cod , massachusetts ( 21 ) , to 2.5% and 9.5% in connecticut residents who were seronegative and seroreactive , respectively , to borrelia burgdorferi ( 22 ) . our findings of high local prevalence of b. microti infection in i. ricinus ticks may seem counterintuitive given the lower seroprevalence in residents of our study area . the findings may , however , reflect a high degree of spatial clustering of transmission with a low average risk ( 18 ) . alternatively , the low seroprevalence may be the result of low test sensitivity resulting from antigenic differences between north american b. microti strains , which were used for the serologic testing , and the european strains to which our study population had been exposed . at least locally , the potential for zoonotic transmission of b. microti by i. ricinus is considerable , which explains serologic evidence in human beings of exposure to this agent in parts of europe . the lack of recognized human pathology associated with european strains of b. microti , despite exposure to infectious tick bites , may be a consequence of a lower virulence of european strains than those of north american . disease episodes due to b. microti , on the other hand , may be overlooked because of the relative nonspecificity of signs and symptoms and the presumption that this agent rarely infects i. ricinus .
we evaluated human risk for infection with babesia microti at a site in eastern switzerland where several b. microti infected nymphal ixodes ricinus ticks had been found . dna from pooled nymphal ticks amplified by polymerase chain reaction was highly homologous to published b. microti sequences . more ticks carried babesial infection in the lower portion of the rectangular 0.7-ha grid than in the upper ( 11% vs. 0.8% ) . in addition , we measured seroprevalence of immunoglobulin ( ig ) g antibodies against b. microti antigen in nearby residents . serum from 1.5% of the 396 human residents of the region reacted to b. microti antigen ( > 1:64 ) , as determined by indirect immunofluorescence assay ( igg ) . these observations constitute the first report demonstrating b. microti in a human - biting vector , associated with evidence of human exposure to this agent in a european site .
cervical myelopathy with herniated discs is considered a degenerative process and many cases are diagnosed in older patients . however , patients presenting in late adolescence with cervical myelopathy without any underlying disease are rare . neurological deficit symptoms , including intractable radicular pain , limb weakness , and cervical myelopathy rarely occur , and conservative treatment is recommended in most cases . in the majority of adolescent patients , surgical treatment for cervical myelopathy due to herniated discs is rarely recommended because herniated discs could be spontaneously absorbed under the natural course of microvascular blood supply to the juvenile intervertebral disc . cervical spinal canal stenosis had been established as an important risk factor in patients with multilevel cervical myelopathy . laminoplasty could result in a wide spinal canal ; therefore , open - door laminoplasty might be a preferred method in treating multilevel cervical myelopathy with spinal canal stenosis in the absence of kyphosis . cervical laminoplasty prevents fusion and allows for preservation of an acceptable range of motions , so surgeons recommended laminoplasty for cervical myelopathy with spinal canal stenosis in younger patients . it was suggested that laminoplasty might be an effective surgical solution for cervical myelopathy due to both disc herniation and developmental cervical spinal canal stenosis in late adolescent patients . to our knowledge , very few cases are reported in the medical english literature about unilateral open - door laminoplasty in late adolescent patients with cervical myelopathy . therefore , we report 3 adolescent patients with cervical myelopathy due to both disc herniation and developmental cervical spinal canal stenosis , who underwent unilateral open - door laminoplasty . this study was approved by the ethical committee of peking university third hospital and all the participants signed informed consent on admission , before their data were archived in the hospital database and used for research purposes . from january 2006 to july 2012 all patients were boys , and the median age at the time of surgery was 17 years ( range 1617 years ) . all patients were high school students , spending 8 to10 hours a day in sitting position , with their neck flexed . progressive neurological deficit symptoms developed , which were associated with gait disturbance . all patients underwent imaging ( radiographic , computed tomography [ ct ] , and magnetic resonance imaging [ mri ] ) before surgery . characteristics and clinical outcomes of the patients the severity of myelopathy was evaluated according to the japanese orthopedic association 's ( joa ) scoring system . the recovery rate was calculated using the following formula : ( postoperative score preoperative score)/ ( 17 preoperative score ) 100% . all patients were asked to wear a cervical collar for 2 to 4 weeks after surgery . the patients were followed up at 3 , 6 , 12 , and 24 months postsurgery . the range of motion before and after surgery was measured using the dynamic lateral radiograms of the cervical spine . a 17-year - old boy had intermittent numbness in the left hand at the age of 15 . the patient presented with progressive neurological deficit , resulting in gait disturbance , and was transferred to our hospital . radiographic examination of the cervical spine showed a developmental cervical spinal canal stenosis ( figure 1a ) , and ct examination showed sclerosis of the vertebral body edge and facet joint ( figure 2a and b ) . the t2-weighted mri revealed posterior cord compression from c3 to c7 with a c34 herniated disc ( figure 3a and b ) . in addition , the t2-weighted mri showed focal high signal intensity of the cervical cord at the c34 ( figure 3a and b ) . the patient underwent unilateral open - door laminoplasty with the preservation of the unilateral paraspinal muscle ligament complex . at 5 years follow - up , the patient had no neurological deficit symptoms . a 17-year - old boy presented with numbness of the hand and gait disturbance . ( d e ) at 2 years follow - up after surgery , physiologic lordosis has improved and the range of motion in the cervical spine is preserved . computed tomography reveals sclerosis of vertebral body ( lower edge ) and joint facets without bony spurs . ( c ) open door laminoplasty with no broken shaft and no sinking of the lamina shaft . ( d ) image shows that the spinal canal has expanded at 3 months follow - up after surgery . the t2-weighted magnetic resonance imaging ( mri ) shows the posterior cervical cord compression from c3 to c7 and a c34 disc herniation ( a b ) . in addition , the t2-weighted images in axial mri show the focal high signal intensity at the c34 ( a ) . after surgery , the mri shows no further compression of the spinal cord and the high signal intensity of the spinal cord decreased gradually after 2 years ( c d ) . a 17-year - old boy had intermittent numbness in the left hand at the age of 15 . the patient presented with progressive neurological deficit , resulting in gait disturbance , and was transferred to our hospital . radiographic examination of the cervical spine showed a developmental cervical spinal canal stenosis ( figure 1a ) , and ct examination showed sclerosis of the vertebral body edge and facet joint ( figure 2a and b ) . the t2-weighted mri revealed posterior cord compression from c3 to c7 with a c34 herniated disc ( figure 3a and b ) . in addition , the t2-weighted mri showed focal high signal intensity of the cervical cord at the c34 ( figure 3a and b ) . the patient underwent unilateral open - door laminoplasty with the preservation of the unilateral paraspinal muscle ligament complex . at 5 years ( d e ) at 2 years follow - up after surgery , physiologic lordosis has improved and the range of motion in the cervical spine is preserved . computed tomography reveals sclerosis of vertebral body ( lower edge ) and joint facets without bony spurs . ( c ) open door laminoplasty with no broken shaft and no sinking of the lamina shaft . ( d ) image shows that the spinal canal has expanded at 3 months follow - up after surgery . the t2-weighted magnetic resonance imaging ( mri ) shows the posterior cervical cord compression from c3 to c7 and a c34 disc herniation ( a b ) . in addition , the t2-weighted images in axial mri show the focal high signal intensity at the c34 ( a ) . after surgery , the mri shows no further compression of the spinal cord and the high signal intensity of the spinal cord decreased gradually after 2 years ( c d ) . the dynamic lateral radiograms of the cervical spine before surgery showed physiologic lordosis with normal ranges of motion . all of these patients had developmental cervical spinal canal stenosis assessed with spinal canal - to - vertebral body ratio ( torg - pavlov ratio , table 1 ) . grip weakness and sensory disturbances improved after surgery . in addition , the radiographic examination revealed that the physiologic lordosis had improved . range of motion in the cervical spine was preserved after surgery , and none of the patients had adjacent segment disease ( asd ) or cervical kyphosis ( figure 1d f ) . ct scan revealed that the spinal canal had been expanded after the surgery , and no broken shaft or sinking lamina was noticed ( figure 2c and d ) . an mri showed no further spinal cord compressions and high signal intensity of the spinal cord decreased gradually ( figure 3c and d ) . long - term outcomes after surgery were satisfactory according to the evaluation criteria for the joa scores ( table 1 ) . however , the ranges of motion in the cervical spine decreased , and especially the ranges of motion on flexion after surgery showed a significant decrease ( table 1 ) . cervical disc herniation in adolescent patients is typically a benign process with minimal symptoms , which usually resolve spontaneously . surgical decompression should be performed only in cases presenting with persistent neurological deficits or progressive neurological deterioration , after an adequate course of conservative treatment . in the reported cases , because long - term conservative treatment was ineffective and did not prevent progression of neurologic deteriorations , it was necessary to perform surgical decompression for the cervical myelopathy . several reports indicate that anterior cervical discectomy and fusion ( acdf ) in children is a safe procedure with good clinical results . in adolescent patients , a shorter segment fusion is ideal to prevent kyphotic alignment in flexion and to decrease cervical movement . although acdf in young patients with cervical myelopathy could reduce segmental kyphosis and decompress the spinal cord at the responsible segments , surgeons should consider that the cervical spine in young patients would continue to grow . hyper - mobility of the segment above the fused vertebra was found more frequently in patients aged < 30 , and those patients had a higher incidence of developing asd . cervical arthroplasty for cervical myelopathy could preserve the motion of the cervical spine , potentially reducing the risk of asd . however , it was not a viable option in patients with cervical myelopathy due to both disc herniation and developmental cervical spinal canal stenosis . in late adolescent patients , asd should be avoided because it usually requires another surgical intervention . at the same time , it is important to preserve the motility in the cervical spine for a good quality of life . cervical expansive laminoplasty is usually performed in patients with multiple - level spinal cord compression or with canal stenosis , and the favorable surgical results have been usually obtained in adults . asd is not a common complication after expansive laminoplasty , if one paid attention to preserve the joint facets in the cervical spine , which would minimize the stress placed on adjacent motion segments . sato et al have reported that laminoplasty for calcified intervertebral disc herniation at the cervical thoracic junction had an excellent outcome in a 13-year - old girl at 5 years follow - up after surgery . the unilateral open - door technique could decrease the incidence of progressive spinal deformity and maintain stability . cervical laminoplasty has a more favorable outcome when compared with cervical laminectomy in preserving a physiologic range of motion . cervical laminoplasty allows for preservation of the posterior elements , and this might enhance the spinal stability and prevent kyphosis . in our opinion , unilateral open - door laminoplasty is more suitable for late adolescent patients due to both disc herniation and developmental cervical spinal stenosis . based on the increase in joa scores , we can conclude that neurologic function significantly improved in the patients after surgery . the long - term postoperative outcomes were satisfactory according to the evaluation criteria based on the joa scores . in addition , the high signal of the spinal cord gradually disappeared 2 years after the unilateral open - door laminoplasty . over the median 5 years follow - up , none of the patients presented with asd and cervical kyphosis , and all attained a favorable range of cervical motion , although the range of motion decreased slightly , especially on flexion . possible reasons for these differences are that the cases were few and the patients were younger , and very few cases of adolescents with cervical myelopathy that needed surgery have been reported . in conclusion , expansive laminoplasty is helpful for older adolescent patients with cervical myelopathy due to both disc herniation and developmental cervical spinal canal stenosis , if conservative treatments could not prevent deterioration of neurologic symptoms .
abstractreports on adolescent patients with cervical myelopathy who underwent anterior cervical discectomy and fusion are scarce . however , to our knowledge , no cases of expansive laminoplasty for cervical myelopathy associated with progressive neurological deficit after a series of conservative treatment , caused by both disc herniation and developmental cervical spinal canal stenosis , have been reported.from january 2006 to july 2012 , we retrospectively studied 3 patients in late adolescence presenting with cervical myelopathy who underwent expansive unilateral open - door laminoplasty at our hospital . the outcomes after the surgery were evaluated according to the japanese orthopedic association scores.symptoms presented by these patients were due to both disc herniation and developmental cervical spinal canal stenosis . no major complications occurred after the surgical procedures . the median follow - up time was 66 months ( range 36112 months ) . the japanese orthopedic association scores after surgery showed a significant increase . long - term outcomes after surgery were satisfactory according to the evaluation criteria for the japanese orthopedic association scores . however , the ranges of motion of the cervical spine decreased , especially the ranges of motion on flexion after surgery showed a significant decrease.expansive laminoplasty is helpful for older adolescent patients with cervical myelopathy due to both disc herniation and developmental cervical spinal canal stenosis , presenting with progressive neurological deficit after long conservative treatment .
nosocomial infections ( hospital - acquired infections ) are becoming a major problem in the hospitals due to increase in morbidity , mortality , and cost associated with them . ventilator - associated pneumonia ( vap ) is defined as hospital - acquired pneumonia which occurs within 48 - 72 h after endotracheal ( et ) intubation . this infection is the second most prevalent nosocomial infection in the intensive care units ( icu ) , which increases the hospital costs , morbidity , and mortality rate of intubated , critically ill patients . incidence rate of pneumonia depends on the type of patient population ( who are under examination ) , which is reported to be between 9 and 68% , and may have a mortality rate up to 27% . this nosocomial infection increases the hospital costs from about us$ 10,000 to 13,000 per case . the accumulated secretions around the endotracheal tube ( ett ) cuff ( subglottic space ) and aspiration of them is one of the main causes of vap . therefore , the plan of prevention must include ways for reducing accumulation , removing ( draining ) secretions , and averting leakage between the tube and tracheal wall . there are a few ways by which the secretions around the cuff can be cleared / removed . ett is not widely used . all over the world , many mechanically ventilated patients , before being admitted to the icu , are intubated with standard ett , which is not able to remove the accumulated secretions in the subglottic space . also , there are two obstacles in using the hi lo evac ett , including : the high price of the ett andidentifying patients at risk for vap ( patients who need long - term ventilation ) . the high price of the ett and identifying patients at risk for vap ( patients who need long - term ventilation ) . a new method was introduced in a report for controlling the subglottic secretions in patients who have standard ett and also to protect them from vap . gentile and soibal ( 2010 ) suggested this method , which is explained in the textbooks of respiratory care and anesthesia . in this technique , after suctioning the oropharynx , a positive pressure which causes lung hyperinflation is applied by an inspiratory pause ( use of inspiratory hold / pause key or with an ambu bag ) ; then the cuff is rapidly deflated , and the air flows upward past the deflated cuff and drives the secretions toward the oropharynx where they ( secretions ) can be cleaned with frequent oropharyngeal suctioning . as one of the preventive measures of vap , this operation could be used in order to remove or clear the subglottic secretions intermittently . ( inspiratory pause key causes the ventilator to seal patient 's breathing circuit at the conclusion of the gas delivery phase of designated volume- or pressure - based mandatory inspiration . this safe inspiratory pause maneuver , embedded in mechanical ventilators , maintains the inflated state of the lungs . thoracic compliance , static resistance , and plateau pressure . ) but the efficacy of this maneuver in removing the subglottic secretions and prevention of vap is still vague and needs further studies . for this reason , a clinical trial was conducted in order to study the effectiveness of subglottic secretions drainage ( ssd ) by an inspiratory pause method in patients undergoing mechanical ventilation . the main objective of this study was to determine the incidence of early - onset vap among patients who receive ssd and to compare this outcome with that of the patients who receive routine oropharyngeal suctioning without ssd . the study was conducted in four icus of the selected educational hospital in isfahan , iran . these icus are advanced care units with 56 active beds and more than 1600 admissions per year . they are general icus with medical , surgical , and trauma patients , which are under 24-h on - site intensivist coverage and a nurse - to - patient ratio of 1:2 is maintained at all times . the study protocol was reviewed and approved by the medical ethical committee of isfahan university of medical sciences . between november 2012 and february 2013 , all patients admitted to the icu were screened in order to detect those patients in the age range of 18 - 60 years who were intubated with single used cuffed polyvinyl chloride endotracheal tube ( pvc ett ) with high - volume and low - pressure cuff and likely required mechanical ventilation for at least 48 h. in this study , the following were the exclusion criteria : patients who were admitted to the icus with tracheostomypatients whose mechanical ventilation was normally shorter than 48 h ( psychotropic drug overdose , etc.)patients who were likely to die in the next 48 h ( those who were admitted after cardiac arrest , etc.)patients who were admitted to these units for treatment of pneumoniaothers with lung complications like fibrosis or cancer patients who were admitted to the icus with tracheostomy patients whose mechanical ventilation was normally shorter than 48 h ( psychotropic drug overdose , etc . ) patients who were likely to die in the next 48 h ( those who were admitted after cardiac arrest , etc . ) patients who were admitted to these units for treatment of pneumonia others with lung complications like fibrosis or cancer seventy - six patients satisfied the eligibility criteria . randomization was performed by minimization software based on age , sex , smoking , and simplified acute physiology score ( saps ) ii . patients were randomly allocated to undergo ssd ( ssd group , 38 patients ) or routine oropharyngeal suctioning ( control group , 38 patients ) . matching practices were used in both groups in order to prevent the nosocomial pneumonia , e.g. no routine change of ventilator circuit , a 30-45 head - of - bed elevation , oral care , and peptic ulcer prophylaxis with sucralfate , ranitidine , or omeprazole and hand hygiene . on admission to the icu , ssd group was connected to a ventilator with inspiratory pause or inspiratory hold key . after the patient was examined by the physician and in the absence of pulmonary complications , oropharyngeal suctioning was performed every 3 h under the supervision of an intensivist and close monitoring , and then by using the inspiratory pause or inspiratory hold keys in the ventilator , an inspiratory hold was applied . when the airway pressure was increased ( in 3 sec ) , the cuff was rapidly deflated by the researcher , and it was inflated immediately after 2 sec and inspiratory pause was released . air flow rising past the deflated cuff drove the subglottic secretions toward the oropharynx from where they ( secretions ) were removed with repeated oropharyngeal suctioning by a nurse specialist in critical care . this maneuver , based on the physician 's permission and after careful assessment by the intensivist in patients who had no lung complications , was performed periodically in order to clean up the subglottic secretions . this was a safe technique which must be done with the intensivist supervisor for caution . inspiration was held in the patient for 3 sec only until the cuff of the ett was depleted ; this method is not harmful for the patient . routine oropharyngeal suctioning was performed in the control group ( mouth and oropharyngeal suctioning before endotracheal suction with single - use catheter ) . because of the type of the intervention , physicians and nurses could not be blinded to the randomization arm . the following data were recorded : demographics ( age , sex , etc.)primary reason for icu admissionsmokingnonsmokerventilator modelevel of positive end - expiratory pressure ( peep)severity of illness that was measured by the new saps ii . primary reason for icu admission level of positive end - expiratory pressure ( peep ) severity of illness that was measured by the new saps ii . the incidence of early - onset vap in the case and control groups was the outcome measure and was compared between them . scores in this scale are between 0 and 12 ; scores equal to or greater than 6 are considered as the diagnostic cut - off . this is a validated scale with sensitivity and specificity more than 90% for vap diagnosis , and has been agreed upon by the doctors and nurses in the icus [ table 1 ] . incidence of pneumonia within the first 48 h of mechanical ventilation was not thought to be ventilator associated . a threshold of 5 days after initiation of mechanical ventilation was used to distinguish early - onset ( 5 days ) vap and assessed in all randomized patients with a blinded method by an intensivist physician who was not a member of the research team . means of continuous variables were compared using student 's t - test and categorical variables were compared using chi - square test and fisher 's exact test , as appropriate . the study was conducted in four icus of the selected educational hospital in isfahan , iran . these icus are advanced care units with 56 active beds and more than 1600 admissions per year . they are general icus with medical , surgical , and trauma patients , which are under 24-h on - site intensivist coverage and a nurse - to - patient ratio of 1:2 is maintained at all times . the study protocol was reviewed and approved by the medical ethical committee of isfahan university of medical sciences . between november 2012 and february 2013 , all patients admitted to the icu were screened in order to detect those patients in the age range of 18 - 60 years who were intubated with single used cuffed polyvinyl chloride endotracheal tube ( pvc ett ) with high - volume and low - pressure cuff and likely required mechanical ventilation for at least 48 h. in this study , the following were the exclusion criteria : patients who were admitted to the icus with tracheostomypatients whose mechanical ventilation was normally shorter than 48 h ( psychotropic drug overdose , etc.)patients who were likely to die in the next 48 h ( those who were admitted after cardiac arrest , etc.)patients who were admitted to these units for treatment of pneumoniaothers with lung complications like fibrosis or cancer patients who were admitted to the icus with tracheostomy patients whose mechanical ventilation was normally shorter than 48 h ( psychotropic drug overdose , etc . ) patients who were likely to die in the next 48 h ( those who were admitted after cardiac arrest , etc . ) patients who were admitted to these units for treatment of pneumonia others with lung complications like fibrosis or cancer seventy - six patients satisfied the eligibility criteria . randomization was performed by minimization software based on age , sex , smoking , and simplified acute physiology score ( saps ) ii . patients were randomly allocated to undergo ssd ( ssd group , 38 patients ) or routine oropharyngeal suctioning ( control group , 38 patients ) . matching practices were used in both groups in order to prevent the nosocomial pneumonia , e.g. no routine change of ventilator circuit , a 30-45 head - of - bed elevation , oral care , and peptic ulcer prophylaxis with sucralfate , ranitidine , or omeprazole and hand hygiene . on admission to the icu , ssd group was connected to a ventilator with inspiratory pause or inspiratory hold key . after the patient was examined by the physician and in the absence of pulmonary complications , oropharyngeal suctioning was performed every 3 h under the supervision of an intensivist and close monitoring , and then by using the inspiratory pause or inspiratory hold keys in the ventilator , an inspiratory hold was applied . when the airway pressure was increased ( in 3 sec ) , the cuff was rapidly deflated by the researcher , and it was inflated immediately after 2 sec and inspiratory pause was released . air flow rising past the deflated cuff drove the subglottic secretions toward the oropharynx from where they ( secretions ) were removed with repeated oropharyngeal suctioning by a nurse specialist in critical care . this maneuver , based on the physician 's permission and after careful assessment by the intensivist in patients who had no lung complications , was performed periodically in order to clean up the subglottic secretions . this was a safe technique which must be done with the intensivist supervisor for caution . inspiration was held in the patient for 3 sec only until the cuff of the ett was depleted ; this method is not harmful for the patient . routine oropharyngeal suctioning was performed in the control group ( mouth and oropharyngeal suctioning before endotracheal suction with single - use catheter ) . because of the type of the intervention , physicians and nurses could not be blinded to the randomization arm . the following data were recorded : demographics ( age , sex , etc.)primary reason for icu admissionsmokingnonsmokerventilator modelevel of positive end - expiratory pressure ( peep)severity of illness that was measured by the new saps ii . primary reason for icu admission level of positive end - expiratory pressure ( peep ) severity of illness that was measured by the new saps ii . the incidence of early - onset vap in the case and control groups was the outcome measure and was compared between them . scores in this scale are between 0 and 12 ; scores equal to or greater than 6 are considered as the diagnostic cut - off . this is a validated scale with sensitivity and specificity more than 90% for vap diagnosis , and has been agreed upon by the doctors and nurses in the icus [ table 1 ] . incidence of pneumonia within the first 48 h of mechanical ventilation was not thought to be ventilator associated . a threshold of 5 days after initiation of mechanical ventilation was used to distinguish early - onset ( 5 days ) vap and assessed in all randomized patients with a blinded method by an intensivist physician who was not a member of the research team . means of continuous variables were compared using student 's t - test and categorical variables were compared using chi - square test and fisher 's exact test , as appropriate . between november 2012 and february 2013 , 408 patients were admitted in the icus in the participating center . at icu admission , 162 patients were not intubated . among the 246 remaining patients , 150 met the exclusion criteria . finally , 96 patients were included : 50 in the control arm and 46 in the ssd arm . among the included patients , 11 patients died before the end of the study : 5 patients in the intervention group and 6 in the control group . nine patients required mechanical ventilation for less than 48 h , 6 in the control group and 3 in the ssd group , and they were excluded because of the unavailability of complete data . therefore , the analysis was limited to 76 patients : 38 in the control group and 38 in the intervention group . on the whole , the mean age of the patients was 42 14.66 years ( range 18 - 60 years ) . the peep level in the control and intervention groups was 9 4 and 10 4 cm h2o , respectively , and the mean saps ii score was 28.29 2.08 . in addition , there were no significant differences in the other features ( ventilator mode , peptic ulcer prophylaxis , etc . ) between the patients undergoing ssd and the control patients [ table 2 ] . baseline characteristics of the study patients within 5 days of mechanical ventilation , 28 patients developed pneumonia : 10 ( 26.3% ) in the intervention group and 18 ( 47.4% ) in the control group ( risk ratio ( rr ) 36.85 , 95% confidence interval , 0.26 - 0.47 , p = 0.04 ) . between november 2012 and february 2013 , 408 patients were admitted in the icus in the participating center . at icu admission , 162 patients were not intubated . among the 246 remaining patients , 150 met the exclusion criteria . finally , 96 patients were included : 50 in the control arm and 46 in the ssd arm . among the included patients , 11 patients died before the end of the study : 5 patients in the intervention group and 6 in the control group . nine patients required mechanical ventilation for less than 48 h , 6 in the control group and 3 in the ssd group , and they were excluded because of the unavailability of complete data . therefore , the analysis was limited to 76 patients : 38 in the control group and 38 in the intervention group . on the whole , the mean age of the patients was 42 14.66 years ( range 18 - 60 years ) . the peep level in the control and intervention groups was 9 4 and 10 4 cm h2o , respectively , and the mean saps ii score was 28.29 2.08 . in addition , there were no significant differences in the other features ( ventilator mode , peptic ulcer prophylaxis , etc . ) between the patients undergoing ssd and the control patients [ table 2 ] . within 5 days of mechanical ventilation , 28 patients developed pneumonia : 10 ( 26.3% ) in the intervention group and 18 ( 47.4% ) in the control group ( risk ratio ( rr ) 36.85 , 95% confidence interval , 0.26 - 0.47 , p = 0.04 ) . aspiration of subglottic secretions is an important pathophysiologic mechanism for both early- and late - onset vap . in our study , intermittent ssd with inspiratory pause maneuver resulted in a significant reduction in the incidence of early - onset vap ( 26.3% vs. 47.4% ) in an unselected population of icu patients . it is difficult to compare the results of the present study with those of other studies regarding the effect of ssd on vap incidence rate because ssd with inspiratory pause maneuver is a new method used to remove or clean up the subglottic secretions and there is no similar study to compare the results . however , our results are congruent with the studies about the effects of hi lo evac ett and the influence of oral suctioning on vap incidence . hi lo evac ett , reported vap reduction also , liu et al . and smulders et al . hi lo evac ett , showed vap reduction in the intervention group versus control group . in their systematic review and meta - analysis of 13 randomized clinical trials , have reported 50% reduction in vap incidence by using the hi lo evac ett . also , studies about oral suctioning in intubated patients show the reduction in vap incidence . chao et al . , in a study on removal of oral secretion prior to changing position , showed a significant reduction of vap incidence in the intervention group versus control group . , in their pilot randomized trial about the effect of continuous oral suctioning on the development of vap , found a significant reduction in vap incidence . these three methods ( ssd with inspiratory pause maneuver , hi lo evac ett , and oral suctioning ) operate by a similar mechanism in preventing vap by removing the accumulated secretions in the subglottic space and reducing their amount , but their methodologies are different . we suppose that the reduction of pneumonia rate in the present study is due to the removal of accumulated secretions from the subglottic space as done by hi lo evac ett and oral suctioning , but by a different method . an exceptional outcome in the present study is the 20% reduction of vap incidence , which was achieved with less cost . in addition , this technique is applicable in all intubated patients , as it was tolerated by all patients in the intervention group and no adverse effect was found . the results of this study support the protective effect of ssd with inspiratory pause maneuver on early - onset vap in intubated patients . the outcome that we evaluated was the early - onset vap , because this was a new technique and its impact on the occurrence of vap was unknown . one limitation of the study is its small sample size and inability to compare the effectiveness of two methods ( hi lo evac ett and ssd with inspiratory pause maneuver ) . currently , ssd by using inspiratory pause maneuver is an investigational intervention , and further research with a larger sample size is needed to prove its effects . in conclusion , a significant reduction in the incidence of early - onset vap by using ssd with inspiratory pause maneuver among intubated patients was demonstrated . future clinical trials with a larger sample size are needed to strengthen these results and to verify the general impact of ssd with inspiratory pause maneuver as part of the care plan for the prevention of vap . till such data are obtained , clinicians must learn to make the best use of innovative methods like inspiratory pause maneuver to prevent vap .
background : secretions contaminated with oral , nasal , and gastric bacteria accumulate in the subglottic space , above the endotracheal tube cuff . if these secretions are aspirated into lower airways , the intubated patient will be susceptible to ventilator - associated pneumonia ( vap ) . the aim of this study was to investigate the effect of inspiratory pause maneuver for intermittent subglottic secretions drainage ( ssd ) on the incidence of vap in patients receiving mechanical ventilation.materials and methods : this randomized clinical trial was conducted in four intensive care units of educational hospital in isfahan , iran . a total of 76 adult patients intubated with a conventional endotracheal tube and connected to ventilators for more than 48 h were selected through convenient sampling and were randomly assigned to undergo intermittent ssd ( n = 38 ) or not ( n = 38 ) . in this study , for ssd , we used inspiratory pause / hold key in the ventilators to hyperinflate the lungs . pressure that produces with this maneuver could remove the secretions from the subglottic space.results:vap was found in 10 ( 26.3% ) patients receiving ssd and in 18 ( 47.4% ) patients in the control group ( p = 0.04).conclusions : ssd using inspiratory pause during mechanical ventilation results in a significant reduction in vap .
although the regulatory mechanisms of autophagy are partially known , the exact function of autophagy in cancer is still controversial . when analyzing the intricate relationship between autophagy and cancer , a common challenge is to determine whether autophagy protects cell survival or contributes to cell death . to resolve the role of autophagy in cancer cell fate , several hypotheses have been put forward . one hypothesis proposes that the role of autophagy varies depending on the stage of tumor development . for instance , autophagy limits tumor formation in early stages but favors tumor cell survival , invasion , and metastasis after tumors have formed , . another hypothesis suggests that autophagy can affect tumorigenesis in a cell- or tissue - specific manner , . therefore , at the molecular level , autophagy plays either a pro - survival or a pro - death role by regulating tumor suppressor genes or oncogenes . these autophagic pro - survival or pro - death genes , and the corresponding proteins , can integrate into cancer cell signaling networks and ultimately regulate cell survival or death . autophagy is stimulated by nutrient deprivation , hypoxia , cytokines , hormones , and dna damage . the early stages of activation require atg1 and atg13 , which in turn can be inhibited by mtor . docking and fusion refer to the maturation of autolysosomes and are promoted by rab7 , lamp1 , lamp2 , skd1 , vtil 1b , and the escrt complex . in the last stage , atgs play a key role in the formation of autophagosomes and regulation of autophagic activity ; furthermore , they are closely linked to cancer initiation and progression . silencing some essential atgs , such as atg3 , atg4 , beclin-1/atg6 , atg10 , and atg12 , can sensitize cancer cells to a wide spectrum of stressful conditions . additionally , targeting selected protein kinases involved in autophagy regulation with small molecule kinase inhibitors may be another feasible approach in cancer treatment . a number of protein kinases regulate the induction of autophagy following nutrient deprivation or other cellular stresses . the following protein kinases have been reported to activate protective autophagy in cancer cells as a response to cytotoxic agents , including amp - activated protein kinase ( ampk ) , glycogen synthase kinase 3 ( gsk3 ) beta , extracellular signal - regulated kinases 1 and 2 ( erk1/2 ) , and eukaryotic elongation factor-2 kinase ( eef-2k). mtor , an evolutionarily conserved serine / threonine kinase , serves as the main negative regulator of autophagy in cancer cells . only mammalian target of rapamycin complex 1 ( mtorc1 ) is sensitive to inhibition by rapamycin ; therefore , we focus on the role of mtorc1 in autophagy . three major mtorc1-inducing pathways have been elucidated , including the pi3k - akt pathway and the mapk / erk pathway , consisting of ras - proto - oncogene serine / threonine - protein kinase ( raf-1 ) , mitogen - activated protein kinase 1/2 ( mek1/2 ) , and extracellular signal - regulated kinase 1/2 ( erk1/2 ) . the lkb1-ampk pathway , consisting of liver kinase b1 and ampk , can inhibit mtorc1 . the tsc2/tsc1 complex , which has a tumor suppressor function in various cancers , is a key point upstream of mtorc1 since tsc2/tsc1 can suppress mtorc1 by inactivating the mtorc1-interacting protein , rheb , . upon pi3k activation , akt phosphorylation of tsc2 destabilizes tsc2 and disrupts its interaction with tsc1 to abolish the negative regulatory effect of the tsc2/tsc1 complex on mtorc1 . phosphorylation of tsc2 by ampk can increase the gap activity of tsc2 , stabilize the tsc2/tsc1 complex , and inactivate rheb , resulting in the inactivation of mtorc1 and the initiation of autophagy . in mammals , two homologs of atg1 , namely uncoordinated 51-like kinase 1 ( ulk1 ) and ulk2 , mammalian autophagy - related protein 13 ( matg13 ) , and scaffold protein fip200 have been identified . under nutrient starvation conditions , mtorc1 disrupts the binding of atg13 with ulk and destabilizes ulk , thereby inhibiting the ulk - dependent phosphorylation of fip200 and autophagy induction by phosphorylation of ulk and atg13 . moreover , mtorc1 regulates autophagy by mediating protein translation and cell growth through phosphorylation of 4e - binding protein 1 ( 4e - bp1 ) and p70s6k . phosphorylation of 4e - bp1 leads to its dissociation from eukaryotic translation initiation factor 4e ( eif4e ) and up - regulates cap - dependent translation . phosphorylation of p70s6k by mtorc1 enhances p70s6k activity and allows it to phosphorylate downstream targets . once activated , p70s6k phosphorylates eukaryotic elongation factor 2 kinase ( eef2k ) to relieve elongation factor 2 ( eef2 ) from inhibition by eef2k in addition to promoting autophagy . deptor , an inhibitor of mtorc1 and mt0rc2 , inhibits mtorc1 and mt0rc2 by directly binding to them both . deptor is subjected to proteasome - dependent degradation upon serum stimulation to ensure mtor activation . p53 , a well characterized human tumor suppressor gene involved in genotoxic stress response and dna damage repair , also participates in autophagy regulation . intriguingly , the role of p53 in autophagy seems to be paradoxical depending on its subcellular localization , which may dictate whether p53 contributes to cancer cell survival or death . in the nucleus also , p53 can promote autophagy through targeting multiple genes that code for pro - autophagic modulators , including dapk-1 , damage - regulated autophagy modulator ( dram ) , pro - apoptotic bcl-2 proteins ( e.g. , bad , bax , bnip3 , and puma ) , sestrin1/2 , and tsc2 . notably , sestrin1 and sestrin2 , which are usually expressed under conditions of dna damage and oxidative stresses , are negative regulators of mtorc1 and execute their function through activation of ampk and tsc2 ; thus , sestrin1/2 establish a connection between p53 and autophagy through mtorc1 . the autophagy induced by loss of p53 promotes the survival of p53-deficient cells to sustain high atp levels under conditions of hypoxia and nutrient depletion . therefore , p53 signaling controls autophagy in an ambiguous fashion that depends on its subcellular localization and plays a two - sided role in cancer . beclin-1 , the mammalian homolog of atg6 and a bcl-2 interacting coiled - coil protein , is essential for the formation of double - membrane autophagosomes , which are required in the initial step of autophagy . beclin-1 can promote interaction of bcl-2 with other autophagy regulators , such as vps34 ( pi3k ) , p150 , uvrag , bif1 , atg14l , and rubicon , to form huge protein complexes . additionally , beclin-1 is a haploinsufficient tumor suppressor gene . uvrag , a major positive mediator of beclin-1 , can directly and markedly enhance pi3kiii lipid kinase activity , thus , facilitating autophagy . through mediating the beclin-1/pi3kiii complex , bif-1 , another positive mediator of beclin-1 , can interact with beclin-1 through uvrag to regulate autophagy and suppress tumorigenesis . following dissociation of beclin-1 from bcl-2 , autophagy may be activated depending on whether bcl-2 has been phosphorylated by the starvation - activated c - jun n - terminal kinase ( jnk ) . the tumor suppressor function of beclin-1 is supported by the identification of its mediators in tumorigenesis . bcl-2 inhibits autophagy through interacting with beclin-1 as beclin-1 contains a bh3 domain that facilitates the interaction of beclin-1 with bcl-2 . by interacting with beclin-1 , bcl-2 blocks the interaction of beclin-1 with pi3kiii , decreases pi3kiii activity , and down - regulates autophagy . overall , beclin-1 may enhance autophagy and inhibit tumorigenesis by forming signaling complexes mediated by positive and negative regulators , which suggests a crucial role for beclin-1 in cancer . mounting evidence has demonstrated that mitochondria , the main source of reactive oxygen species ( ros ) in cells , may orchestrate the autophagic process in cancer initiation and progression . for instance , ros play multifaceted roles as a molecular switch in the regulation of several core autophagic pathways ( e.g. , atg4-atg8/lc3 , beclin-1 , pten , p53 , pi3k - akt - mtor , and mapk signaling ) that may jointly seal the fate of cancer cells . mapks and p21-activated kinases ( pak ) , two classes of downstream signaling molecules regulated by ros , are thought to be the major signaling pathways for driving cancer cell metastasis , . in summary , all of the aforementioned survival / death signaling pathways involved in atgs , the mtor subnetwork , the beclin-1 interactome , p53 signaling , and ros may play crucial roles in autophagy - related cancer signaling networks . this suggests that autophagic pathways could be promising new targets in cancer drug development , which we will discuss in the following section . evidence suggests that induction of autophagy may help transform tumor phenotypes during cancer therapy . at this time , several novel strategies are being used to target autophagic signaling pathways for drug discovery in cancer treatment because a number of autophagy - inducing drugs have been identified as potential cancer therapeutic agents. several autophagy - inducing agents are already being used to treat different human cancers and should be further explored both at the bench and in the clinic . tumor cells can use autophagy to supply nutrients and energy , and promote tumor survival when nutrients are limited . therefore , some drugs have been developed to block autophagic processes so as to suppress tumor progression . autophagy process can be divided into several phases , including the initiation period , docking and fusion of autophagosomes with lysosomes , and catalytic degradation of cytoplasmic materials inside autolysosomes . pi3k inhibitors , including 3-methylade - nine ( 3-ma ) , wortmannin , and ly294002 , can interfere with or block autolysosome formation and result in the inhibition of autophagy . also , it has been observed that cancer cells undergo increased autophagy and are more sensitive to lysosomotrophic agents . bafilomycin a1 , vinblastine , and nuokaodazuo can inhibit the fusion process to interrupt autophagy . bafilomycin a1 , a type of macrolide antibiotic derived from streptomyces griseus , has been reported to block the fusion of autophagosomes with lysosomes in tumor cells . two anti - malarial drugs , hydroxychloroquine ( hcq ) and chloroquine ( cq ) , can inhibit lysosomal acidification and prevent the degradation of autophagosomes , thereby suppressing autophagy in myc - driven lymphoma and increasing the antitumor effects of cyclophosphamide. in imatinib - resistant bcr - abl - positive chronic myeloid leukemia ( cml ) cell lines , cq enhanced cell death by inhibiting autophagy and strengthened the activity of vorinostat , an histone deacetylase ( hdac ) inhibitor , . in combination with the anti - malarial drug quinacrine , cq remarkably sensitized gastrointestinal stromal tumor cells to imatinib , both in vitro and in vivo , and reinforced the efficiency of quinacrine . cq has recently been reported to be able to inhibit therapy - induced autophagy and to increase cell death in established tumors , leading to tumor regression . nevertheless , autophagy is not only a survival response that opposes growth factor and nutrient deprivation but also an important mechanism for tumor cell suicide . recently , an increasing amount of data have suggested that autophagy , as a mechanism of type ii pcd , may present new opportunities for developing alternative anti - cancer therapies . tamoxifen , an antagonist of estrogen receptor ( er ) , has a high binding affinity for the microsomal antiestrogen binding site ( aebs ) , a hetero - oligomeric complex involved in cholesterol metabolism . tamoxifen and other aebs ligands induce breast cancer cell autophagy through inducing sterol accumulation , . these data indicate a therapeutic implication for selective aebs ligands in breast cancer management and reveal a mechanism that may explain the induction of autophagy in mcf-7 cells by tamoxifen and other selective er modulators , . imatinib ( gleevec ) , an inhibitor of tyrosine kinases , can induce autophagy in multidrug - resistant kaposi 's sarcoma cells , . hdac inhibitors , such as suberoyla - nilide hydroxamic acid ( saha ) , have been reported to be able to induce autophagy and cell death in hela cells independent of caspase - dependent apoptosis ; thus , initiation of autophagic cell death by saha has clear therapeutic implications for apoptosis - defective tumors . it is well known that mtor is a major regulator of cell growth that has also been implicated in tumorigenesis , . the tumor suppressing action of rapamycin , an inhibitor of mtor , is linked to induction of autophagic cell death . in addition to these agents , there are also other interesting examples of autophagy - inducing agents from traditional chinese medicine . one such traditional chinese compound , arsenic trioxide ( as2o3 ) , has been reported to be able to induce apoptosis through cytochrome c release and caspase activatiori , . interestingly , recent studies showed that treatment of human t - lymphocytic leukemia cells with as2o3 led to cytotoxicity through inducing autophagy . a bcl-2 family member , bcl-2-adenovirus e1b 19-kda - interacting protein 3 ( bnip3 ) , was reported to play a pivotal role in as2o3-induced autophagic cell death in malignant glioma cells , . additionally , polygonatum cyrtonema lectin ( pcl ) was shown to be able to induce autophagic cell death via a mitochondria - mediated ros - p38-p53 pathway in human melanoma a375 cells , . based on the aforementioned examples , autophagy may play an important role in the cytotoxic effects of these compounds that could spark new autophagy - targeted cancer therapeutic strategies , . additionally , dna damage agents have been found to be able to induce autophagy in tumor cells . for example , temozolomide ( tmz ) , an alkylating agent , is widely used to treat primary and recurrent high - grade gliomas . the cytotoxicity of tmz is thought to result from the formation of o-6-methylguanine in dna , which mispairs with thymine during dna replication and triggers futile cycles of the mismatch repair system and subsequent dna damage . it was shown that tmz induces autophagy and that pharmacologic inhibition of autophagy could influence cellular outcome . much work is needed to determine how modulators of autophagy impact cancer initiation , progression , and therapeutic response , and to determine exactly why targeting autophagic signaling pathways may be a valuable strategy for cancer drug development . autophagy plays a dual role in the regulation of pro - survival and pro - death signaling pathways in a variety of diseases , including cancer . several key autophagic mediators , including atgs , pi3k , mtor , p53 , beclin-1 interacome , and ros , have been demonstrated to play pivotal roles in the complex autophagic network in cancer cells . however , much work is needed to determine the intricate molecular mechanisms of autophagy in cancer , to define how crucial modulators of autophagy in cancer impacts cancer initiation and progression , and to elucidate why targeting autophagic signaling pathways is promising for cancer therapeutics . furthermore , recent biological insights can provide a fertile foundation for launching this next round of small - molecule drug discovery . these discoveries are being driven by an abundance of structural information on the potential targets ; therefore , x - ray crystallography , nuclear magnetic resonance ( nmr ) , and structural bioinformatics - docking techniques will be invaluable in the efforts to target autophagic pathways for drug discovery . more importantly , there is an increasing emergence of sophisticated mathematical models , such as the naive bayesian framework and support vector machine ( svm ) , for the disruption of protein - protein interactions ( ppis ) . the best hope for targeting autophagy as a therapeutic intervention may lie in the discovery of agents that are able to target the altered autophagy - regulating signaling pathways , or even the autophagic network , rather than targeting the individual genes or proteins . a better understanding of the autophagic ppi network will provide useful insights into how these hub proteins and autophagy - related signaling pathways can be exploited as potential therapeutic targets for treatment of human diseases ( figure 2 ) . due to the complex , two - sided nature of autophagy , establishing the dual role of autophagy in tumor survival vs. death may assist in determining therapeutic potential . inhibiting autophagy may enhance the efficacy of currently used anti - cancer drugs and radiotherapy . in addition , promoting autophagy may induce cancer cell death with a high threshold to apoptosis . therefore , both strategies have significant potential to be translated into ongoing clinical trials that may provide more valuable information regarding whether targeting autophagic pathways in tumor cells would be a promising avenue for cancer therapeutics . in addition , with increasing accuracy , small molecules that inhibit or promote protein - protein interactions ( ppis ) can be screened as potential candidate drugs . thus , the autophagic ppi network can provide more novel insights into how these hub proteins and their autophagic pathways can play key roles as potential drug targets in cancer treatment .
autophagy , an evolutionarily conserved lysosomal degradation process , has drawn an increasing amount of attention in recent years for its role in a variety of human diseases , such as cancer . notably , autophagy plays an important role in regulating several survival and death signaling pathways that determine cell fate in cancer . to date , substantial evidence has demonstrated that some key autophagic mediators , such as autophagy - related genes ( atgs ) , pi3k , mtor , p53 , and beclin-1 , may play crucial roles in modulating autophagic activity in cancer initiation and progression . because autophagy - modulating agents such as rapamycin and chloroquine have already been used clinically to treat cancer , it is conceivable that targeting autophagic pathways may provide a new opportunity for discovery and development of more novel cancer therapeutics . with a deeper understanding of the regulatory mechanisms governing autophagy , we will have a better opportunity to facilitate the exploitation of autophagy as a target for therapeutic intervention in cancer . this review discusses the current status of targeting autophagic pathways as a potential cancer therapy .
wilms ' tumor is the second most common solid neoplasm and the most common malignant renal tumor in childhood affecting 1/1,000 of children12 ) . survival correlates with tumor histology , as children , with favorable tumor histology have good survival rates despite widespread disease ( 5-year survival rate is over 80%)3 ) . lung is the most common metastatic site thereafter liver , lymph nodes and bone2 ) . we present a rare case of wilms ' tumor with multiple brain metastases harboring anaplastic features . an 8-year - old girl , with a previous diagnosis of wilms ' tumor , admitted to our emergency department with new onset generalized tonic - clonic seizure . after we stabilized her status , emergency computed tomography scan showed posterior fossa intraparenchymal mass . contrast enhanced brain magnetic resonance imaging depicted homogenously enhanced multiple small metastases except a larger one in the right cerebellar parenchyma ( fig . she had had masses in both kidneys and had had distant metastases to lungs at the time of diagnosis ( stage v ) . she had been operated for bilateral kidney masses 3 months after her chemotherapy and had been put on chemotherapy once again after the surgery . she had been put on routine follow - ups since then . in her last clinic visit , distant metastases in the brain the tumor mass was sharply demarcated from the normal cerebellar tissue . the tumor had immature mesenchymal cells . in immunohistochemical staining , wt1 and gfap were positive ; ck was negative ( fig . , whole brain radiotherapy was given in another clinic , however her cranial masses progressed in time and she succumbed to her disease . the patient described in this case report , had been diagnosed of wilms ' tumor 5 years ago and had been treated accordingly . her brain metastases were diagnosed after a first - time tonic - clonic seizure attack . while recurrence of wilms ' tumor has been reported up to 25 years after primary diagnosis4 ) , brain metastases usually appear in 2 years . malogolowkin et al.5 ) made a meta - analysis of 10 consecutive trials conducted in wilms ' tumor patients . a total of 13,330 patients were enrolled into the analysis , which had a late recurrence rate of 0.5% . abdomen , lungs and contralateral kidney were found to be the most common sites of recurrences in these patients . three or more medications had been used in 32% and radiotherapy had been used in 37% of the patients with late recurrences5 ) . a huge difference in survival rates was present between the patients with recurrences in contralateral kidney and patients with distant organ recurrences ( 87% vs. 45% ) due to different cell lines they harbor . this means that recurrence in the contralateral kidney might not be a true metastasis , rather a de novo disease5 ) . abnormalities in wilms ' tumor suppressor genes wt-1 ( on 11p13 ) and wt-2 ( on 11p15 ) have been notified in the literature6 ) . immunohistochemical studies in the presented case were positive for wt-1 . beside these tumor suppressor genes , there are many defined molecular abnormalities on chromosomes 1p , 7p , 16q , 17p , and 19q78 ) . our patient had been treated in an outside clinic previously and we could not retrieve the past pathology slides to make a comparison between initial and late recurrent disease . in recent practice , solid tumor resection and adjuvant radiotherapy with chemotherapies are treatment of choices with good results . while some authors insist on aggressive therapy , some others recommend to treat these tumors same as recurrent disease in general59 ) . there is also no consensus over treatment modality for brain metastases of wilms ' tumor . however , median survival is 1 month for untreated patients , and sole treatment with only surgery or only radiotherapy is not enough for a long survival time210111213 ) . whole ( 30 gy in 10 fractions ) or local radiotherapy ( 3036 gy in 1.51.8 gy fractions ) to brain metastases are method of choices . a treatment regimen of vincristine , actinomycin d and cyclophosphamide were being used conveniently , however ifosfamide and etoposide have turned to be superior in terms of treatment success2 ) . the patient we presented had one solid mass in the cerebellum and multiple small metastases in the whole brain . we resected the solid tumor totally , and gave adjuvant radiotherapy to the whole brain , yet the patient died after the radiotherapy . one other point to consider in our patient was bilateral kidney masses at the initial presentation . after initial chemotherapy , the patient had had a nephron sparing surgery in both kidneys . bilateral nephron sparing surgery is a challenging situation against aggressive chemotherapy regimen in respect of toxicity14 ) . prognostic factors for patients with relapse are site of relapse , length of initial remission , initial treatment regimen ( 2 or 3 drugs ) , anaplasia and whether initially treated on national wilms ' tumor studies 2 or 315 ) . when there is clinical suspicion , cranial surveillance should be added to routine clinical work - up of wilms ' tumor follow - up to detect intracranial masses in a timely manner . combined aggressive therapy ( surgery+radiotherapy+chemotherapy ) should be applied whenever it is possible for both better survival and palliative aspects .
wilms ' tumor is the most common malignant renal tumor in childhood . the brain metastasis of a wilms ' tumor with anaplastic histopathology is rare . we present the case of an 8-year - old girl with wilms ' tumor , who presented with multiple brain metastases 5 years after her primary diagnosis . the brain masses were diagnosed after a generalized tonic - clonic seizure attack . the big solid mass in the cerebellum was resected , and whole - brain radiotherapy was performed , after which , she succumbed to her disease . in the case of clinical suspicion , cranial surveillance should be included in the routine clinical work - up for wilms ' tumor . combined aggressive therapy ( surgery+radiotherapy+chemotherapy ) should be applied whenever possible , for both better survival and palliative aspects .
injury of the anterior cruciate ligament ( acl ) is a common finding in orthopedic practice . accurate diagnosis of this entity may be difficult , however it is essential to implement adequate treatment in order to avoid secondary damages to the knee joint.12 anterior knee instability is one of the symptoms of complete acl rupture . a few clinical tests evaluating this parameter exist ; however , the outcome of these tests depend on the subjective opinion and the experience of the examiner . devices that allow for the measurement of translation between the femur and tibia during the examination , despite the recognized accuracy , are not widely used by clinicians . although magnetic resonance imaging ( mri ) is the gold standard modality for diagnosing knee pathologies,1 ultrasound ( us ) has the advantage of combining dynamic clinical tests with visualization in real time . together with its wide availability it is an ideal first line imaging technique when acl insufficiency is suspected . this study was to assess the diagnostic usefulness of this fast method for examination of complete acl insufficiency . the test uses us to directly visualize anterior instability of the knee and is designed for physicians involved in us diagnostics as well as for orthopedics and orthopedic surgeons . an ultrasonographically guided , dynamic test assessing anterior knee laxity and the mri examination were performed in 83 consecutive patients who experienced acute knee trauma between 2008 and 2012 . the inclusion criteria were suspected acl tear on clinical examination patient has recovered from acute phase of injury , age range between 16 and 50 years . exclusion criteria were acute injuries , no previous pathology , degenerative changes , previous surgical intervention where mri was not possible . the test was first performed in the uninjured knee and then in the contralateral joint in order to eliminate the influence of increased , individual specific knee laxity . in order to evaluate the intra and interobserver repeatability coefficient , 6 patients have had both their knees examined again by the same radiologist and by a second radiologist who was familiar with the examination technique . in 47 of 83 patients after knee injury arthroscopy was performed . examination protocol complied with the declaration of helsinki and was approved by the local research ethics committee . the ge vivid 7(general electric vingmed ultrasound , horten , norway ) us apparatus was used for the study , equipped with a 12 l linear transducer , with a frequency of 614 mhz . several push - pull movements of the lower leg were performed for proper muscle relaxation , which allowed further , more precise measurements to be obtained . following this , the patient was placed in a seated position and an elastic roll ( a diameter of about 20 cm ) was placed beneath the distal , posterior aspect of the thigh , so that the lower leg of the patient hung freely from the edge of the examination couch . in this start position , the knee joint was flexed to about 7080. the examiner sat in front of the patient with his lower leg close to the patient 's shin . the transducer was placed onto the anterior aspect of the knee , slightly above the level of the tibial tuberosity and parallel to the patellar tendon ( pt ) . after identification of the anatomical landmarks ( intercondylar eminence [ ie ] , tibial tuberosity and pt ) [ figure 1 ] , the lower leg of the patient was pushed backwards with the examiner 's foot flexing the tibia in the knee joint ( a leverage mechanism ) [ figure 2 ] . applied force was unlimited but a direct view of its effect allowed to recognise the end point , defined as no further displacement of the tibia relative to the femur . a line diagram showing pattern of movement of the proximal tibia in a patient with an intact anterior cruciate ligament ( acl ) ( a ) and with an acl deficiency ( b ) ( f : femur ; t : tibia ; p : patella ; pt : patellar tendon ; ie : intercondylar eminence ) ultrasonographic evaluation of anterior knee translation during the shift of the intercondylar eminence against the patellar tendon . arrows indicate the direction of the force applied in moving the shin from a start ( a ) to an end ( d ) position . corresponding ultrasound image in a patient with an intact anterior cruciate ligament ( acl ) ( b and c ) and an insufficient acl ( e and f ) procedure was repeated 3 times and stored as a cine loop . further analysis was performed immediately after acquisition on workstation ( echopack , general electric , horten , norway ) using quantitative image analysis software . the translation of the ie with respect to the pt was measured and given in millimetres as a mean of three repetitions . the examinations were performed with an avanto 1.5 t mri system ( siemens , germany ) , using the dedicated coil . the cruciate ligaments were evaluated on the basis of t1-weighted ( parameters applied : tr = 600 ms , te = 11 ms ) , and pd / t2-weighted ( parameters applied : tr = 3000 ms , te = 33 ms ) images ( fov = 160 mm , matrix = 320 mm 320 mm , thickness = 3 mm ) . all images were analyzed retrospectively on a work station ( exchibeon , pixel technology , poland ) using software that allowed for three - dimensional reconstructions and measurements . examinations were evaluated by an experienced musculosceletal radiologist who was unaware of the sonographic test results . complete acl insufficiency was diagnosed according to the criteria described elsewhere.1 the values of knee joint laxity are presented as the mean and range . the normality of data distribution was checked by the shapiro wilk test . because of non homogeneity of variance the mann whitney u - test was employed to evaluate the difference of the knee joint laxity between groups . to compare the side side difference of knee joint laxity in each patient , the wilcoxon signed rank test was applied . sensitivity , specificity , positive and negative predictive values with a 95% confidence interval ( ci ) were calculated and compared to the referential test ( arthroscopy or mri ) . altman plot and by calculating the r2 value by means of the linear regression analysis . altman plot depicts the percentile difference between two measurements ( y - axis ) against their mean ( x - axis ) and is used to assess for bias . statistical analysis was performed using statistica for windows ( version 10.0 , statsoft , tulsa , ok , usa ) . the ge vivid 7(general electric vingmed ultrasound , horten , norway ) us apparatus was used for the study , equipped with a 12 l linear transducer , with a frequency of 614 mhz . several push - pull movements of the lower leg were performed for proper muscle relaxation , which allowed further , more precise measurements to be obtained . following this , the patient was placed in a seated position and an elastic roll ( a diameter of about 20 cm ) was placed beneath the distal , posterior aspect of the thigh , so that the lower leg of the patient hung freely from the edge of the examination couch . in this start position , the knee joint was flexed to about 7080. the examiner sat in front of the patient with his lower leg close to the patient 's shin . the transducer was placed onto the anterior aspect of the knee , slightly above the level of the tibial tuberosity and parallel to the patellar tendon ( pt ) . after identification of the anatomical landmarks ( intercondylar eminence [ ie ] , tibial tuberosity and pt ) [ figure 1 ] , the lower leg of the patient was pushed backwards with the examiner 's foot flexing the tibia in the knee joint ( a leverage mechanism ) [ figure 2 ] . applied force was unlimited but a direct view of its effect allowed to recognise the end point , defined as no further displacement of the tibia relative to the femur . a line diagram showing pattern of movement of the proximal tibia in a patient with an intact anterior cruciate ligament ( acl ) ( a ) and with an acl deficiency ( b ) ( f : femur ; t : tibia ; p : patella ; pt : patellar tendon ; ie : intercondylar eminence ) ultrasonographic evaluation of anterior knee translation during the shift of the intercondylar eminence against the patellar tendon . arrows indicate the direction of the force applied in moving the shin from a start ( a ) to an end ( d ) position . corresponding ultrasound image in a patient with an intact anterior cruciate ligament ( acl ) ( b and c ) and an insufficient acl ( e and f ) procedure was repeated 3 times and stored as a cine loop . further analysis was performed immediately after acquisition on workstation ( echopack , general electric , horten , norway ) using quantitative image analysis software . the translation of the ie with respect to the pt was measured and given in millimetres as a mean of three repetitions . the examinations were performed with an avanto 1.5 t mri system ( siemens , germany ) , using the dedicated coil . the cruciate ligaments were evaluated on the basis of t1-weighted ( parameters applied : tr = 600 ms , te = 11 ms ) , and pd / t2-weighted ( parameters applied : tr = 3000 ms , te = 33 ms ) images ( fov = 160 mm , matrix = 320 mm 320 mm , thickness = 3 mm ) . all images were analyzed retrospectively on a work station ( exchibeon , pixel technology , poland ) using software that allowed for three - dimensional reconstructions and measurements . examinations were evaluated by an experienced musculosceletal radiologist who was unaware of the sonographic test results . the normality of data distribution was checked by the shapiro wilk test . because of non homogeneity of variance the mann whitney u - test was employed to evaluate the difference of the knee joint laxity between groups . to compare the side side difference of knee joint laxity in each patient , the wilcoxon signed rank test sensitivity , specificity , positive and negative predictive values with a 95% confidence interval ( ci ) were calculated and compared to the referential test ( arthroscopy or mri ) . altman plot and by calculating the r2 value by means of the linear regression analysis . altman plot depicts the percentile difference between two measurements ( y - axis ) against their mean ( x - axis ) and is used to assess for bias . statistical analysis was performed using statistica for windows ( version 10.0 , statsoft , tulsa , ok , usa ) . the examined group consisted of 52 caucasian men ( 62.7% ) and 31 caucasian women ( 37.3% ) with an average age of 30 years ( range 1650 years ) . ultrasonographic test was performed after acute signs of injury had subsided , no sooner than 10 days from a trauma ( 10365 days , average 42 days ) . arthroscopy confirmed the acl injury in 31 patients . in 1 patient arthroscopy revealed incomplete acl injury instead of complete insufficiency and remaining five patients did not give their consent to arthroscopy . in 10 patients with no signs of complete acl insufficiency in mri , a total of 36 patients were not verified arthroscopically due to lack of consent to surgical treatment , insufficient indications for surgery or treatment in other clinical centre . in 37 injured knees with confirmed acl insufficiency , the mean value of the total knee anterior translation was 8.67 mm ( standard deviation [ sd ] 2.65 mm ) . in 92 knees of 46 patients without diagnosed acl injury total translation was 2.88 mm ( sd 1.26 mm ) . the average side - to - side difference of the anterior knee translation was significantly increased in patients with complete acl insufficiency ( 5.1 mm sd 2.3 mm p < 0.001 ) , but not in patients without confirmed acl injury ( 0.1 mm sd 1.6 mm , p = 0.63 ) [ figure 4 . ] bar chart showing mean difference of the total knee anterior translation and the side - to - side difference in patients with positive and negative referential test results line chart showing side to side difference of the anterior knee translation in each patient from the group with negative and positive reverential test results there was no difference of total anterior knee translation of uninjured knee between groups ( 3.05 , sd 1.01 in uninjured knees of patients with acl insufficiency of the contralateral joint versus 2.88 , sd 1.26 in knees of patients without acl injury ; p = 0.5 ) . according to the diagnostic algorithm a side side difference greater than 2.0 mm and a total anterior translation of more than 5.0 mm should be both present to identify patients with a pathological instability suggesting complete acl insufficiency . tables 1 and 2 present the test ability to diagnose the acl insufficiency for each step of the diagnostic algorithm . sensitivity , specificity , positive and negative predictive values , with a 95% ci calculated for each step of the diagnostic procedure are presented in table 3 . information about the bias and agreement limits between measurements and between observers are presented in the bland the test ability to diagnose the acl insufficiency based on side to side difference ( s - t - s ) of 2 mm the test ability to diagnose the acl insufficiency based on side to side difference ( s - t - s ) of 2 mm and total translation of 5 mm sensitivity , specificity , positive and negative predictive values in each step of diagnostic algorithm intraclass correlation plot ( a ) and bland observer 1 : the first measurement of the observer ; observer 2 : the second measurement of the observer intraclass correlation plot ( a ) and bland observer 1 : the measurement of the first observer ; observer 2 : the measurement of the second observer . in 37 injured knees with confirmed acl insufficiency , the mean value of the total knee anterior translation was 8.67 mm ( standard deviation [ sd ] 2.65 mm ) . in 92 knees of 46 patients without diagnosed acl injury total translation was 2.88 mm ( sd 1.26 mm ) . the average side - to - side difference of the anterior knee translation was significantly increased in patients with complete acl insufficiency ( 5.1 mm sd 2.3 mm p < 0.001 ) , but not in patients without confirmed acl injury ( 0.1 mm sd 1.6 mm , p = 0.63 ) [ figure 4 . ] bar chart showing mean difference of the total knee anterior translation and the side - to - side difference in patients with positive and negative referential test results line chart showing side to side difference of the anterior knee translation in each patient from the group with negative and positive reverential test results there was no difference of total anterior knee translation of uninjured knee between groups ( 3.05 , sd 1.01 in uninjured knees of patients with acl insufficiency of the contralateral joint versus 2.88 , sd 1.26 in knees of patients without acl injury ; p = 0.5 ) . according to the diagnostic algorithm a side side difference greater than 2.0 mm and a total anterior translation of more than 5.0 mm should be both present to identify patients with a pathological instability suggesting complete acl insufficiency . tables 1 and 2 present the test ability to diagnose the acl insufficiency for each step of the diagnostic algorithm . sensitivity , specificity , positive and negative predictive values , with a 95% ci calculated for each step of the diagnostic procedure are presented in table 3 . information about the bias and agreement limits between measurements and between observers are presented in the bland the test ability to diagnose the acl insufficiency based on side to side difference ( s - t - s ) of 2 mm the test ability to diagnose the acl insufficiency based on side to side difference ( s - t - s ) of 2 mm and total translation of 5 mm sensitivity , specificity , positive and negative predictive values in each step of diagnostic algorithm intraclass correlation plot ( a ) and bland observer 1 : the first measurement of the observer ; observer 2 : the second measurement of the observer intraclass correlation plot ( a ) and bland observer 1 : the measurement of the first observer ; observer 2 : the measurement of the second observer . a number of clinical examinations have been proposed to evaluate anterior knee instability , which is the indicator of the acl injury.3 however , all clinical tests have some limitations because they are subjective , imprecise , rarely reproducible , and pain in the swollen joint or muscle spasm can interfere with proper examination.910 pivot shift test is considered to be the most specific ( 98% ) , but its poor sensitivity ( 2461% ) significantly limiting its use . the anterior drawer test shows good sensitivity ( 6892% ) and specificity ( 91% ) , especially in chronic conditions.4568 the lachman test is considered to be the most sensitive ( 8598% ) and specific ( 94% ) in the assessment of acl injury.4567 however , it might be difficult to perform it on a large person , especially by an examiner with small hands.8 the present test combines features of the lachman test and the anterior drawer test allowing for reliable knee assessment under sonographic control . moreover , a leverage mechanism that was used , diminish the influence of the examiner 's physical status on test accuracy . to quantitatively evaluate anterior knee displacement , arthrometers , fluoroscopic measurements and electromagnetic systems have been introduced.11 although they can facilitate a diagnosis to some extent,3101213 these methods are not free of disadvantages concerning their invasiveness , reliability , space requirements or cost,389121415 limiting their standard use in confirming an acl rupture . imaging techniques are widely used to assess the well characterised direct and indirect criteria of acl injury.1916171819 in recent decades , mri has gained the most acceptance in diagnosing different knee pathologies.18 a metaanalysis carried out by oei et al.20 defined the specificity and sensitivity of mri in detecting acl injuries as 94.4% ( 95% ci : 92.396.6 ) and 94.3% ( 95% ci : 92.795.9 ) , respectively . nevertheless , reduced accuracy was noted in cases of partial and chronic acl ruptures.1 moreover , mri evaluates only the structure of the ligament , which does not correlate fully with knee stability . thus , despite it being a commonly used diagnostic procedure , it will not provide a definite answer for the most important clinical question concerning mechanical and functional joint stability.2 in addition , it is also expensive and sometimes unavailable as a routine diagnostic tool . finally , a major limitation of mri are the artifacts due to metallic implant placement . the great advantage of us examination is its ability to assess the dynamic range of motion in a quantitative manner . for years , attempts have been made to introduce a reliable dynamic us test to assess the acl injury . those tests differ in probe placement ( dorsal or ventral approach ) , applied force ( gravity only or additional force ) and a number of required operators.28212223 all the above make standardization and parameterization of these tests difficult and result in varied sensitivity and specificity [ table 4 ] . results of studies concerning sonographic evaluation of the anterior cruciate ligament rupture examination the method presented in this paper differs from earlier studies in several regards . the ventral approach was chosen , which enables the examination of the patient staying in the supine position . this allows this technique to be applied in the operating room , as the supine position is the standard for acl reconstruction . in previous studies , only the side to side difference of anterior translation of the knee it was due to the fact that there is a great variance of absolute knee joint laxity in the population and the difference between two knees of the same patient gives more information than the absolute translation . the first step of the algorithm proposed in this study was based on the side - to - side difference of 2 mm and gave very similar sensitivity and specificity as presented by palm et al.2 ( palm et al . although the second step , assessing the total knee translation , decreased sensitivity from 97% to 91.9% it increased specificity from 87.5% to 95.6% . this indicates that , despite the population variability of total knee laxity , this parameter can increase the examination specificity . the influence of the examiners posture was eliminated . the use of leverage ( when the examiner pushes patients foot with ones foot , bending patients knee ) does not require much physical strength . furthermore it enables the test to be performed by only one physician , because both hands of the physician remain free , allowing for simultaneous manipulation of the transducer and adjustment of us apparatus parameters . moreover , the test became independent of the dynamic pull but rather on the application of constantly increased force . this reduces the displacement of the us probe during examination , enabling more precise diagnosis and improving test repeatability . on the other hand , it might be the reason for decreased absolute knee anterior translation values in comparison to the gebhard et al.8 results ( present study : 8.67 mm and 2.98 mm vs gebhard et al . contrary to this , the side - to - side differences reported in this paper were higher than in those by palm et al.2 ( 5.1 mm vs 3.8 mm in patients with acl instability and 1.3 mm vs 0.1 mm in subjects without the injury ) . it suggests that changes of position between proposed anatomical landmarks more accurately reflects the actual movement which occurs in the knee joint . according to the inter and intraclass agreement analysis , present test is characterised by a perfect repeatability . it indicates that the proposed examination technique is objective and very reliable . in the authors opinion , ultrasonography is the modality that provides the physician with the widest range of clinical information . it is available , safe , inexpensive , and unlike electromagnetic devices and arthrometers , it is not dedicated just to this one type of examination . the limitation of the present test is common for all forms of physical examinations and concerns its decreased diagnostic ability in the acute phase of trauma , when patient might not be able to move the knee joint freely . it is worth mentioning that even the mri sensitivity is reduced in the acute phase after trauma due to the presence of hematoma and/or edema in the injured joint.1 nevertheless because of the application of steady force , instead of powerful , quick manoeuvres , the test may be less unpleasant . it might be confirmed by the fact that it was capable of diagnosing complete acl insufficiency in 3 patients 10 days from the initial trauma . an ultrasonographically evaluated dynamic test of anterior instability of the knee is precise , harmless and a rapid method of quantitative tibio femoral translation assessment . because the current standard tests have not gained absolute acceptance among physicians we propose this test as an alternative that addresses their disadvantages . in our opinion
background : although ultrasound ( us ) has a wide range of applications in orthopedic diagnostics , sonographic evaluation of traumatic anterior cruciate ligament ( acl ) insufficiency is still inadequate . there is a growing need for diagnostic tests that allow for simple and reliable assessment of acl instability . this investigation aims to evaluate feasibility of sonographic technique for diagnosing complete acl insufficiency.materials and methods : eighty three consecutive patients suspected of acl injury were examined with sonographic , dynamic test of anterior instability . the translation of the intercondylar eminence against the patellar tendon was measured in the injured and opposite ( injured ) knee . subsequent magnetic resonance imaging was performed on all patients . forty - seven of them underwent a further arthroscopy . five patients have been examined for the 2nd time to evaluate interclass and intraclass agreement and bias.results:complete acl insufficiency has been confirmed in 37 patients . in those individuals , the total anterior knee translation and the difference between two joints ( side - to - side difference ) were significantly increased ( 8.67 mm standard deviation [ sd ] 2.65 mm in the affected knee versus 2.88 mm sd 1.26 mm in uninjured joint ; p < 0.001 ) . based on a threshold of 2.0 mm for the side - to - side difference and 5.0 mm for the absolute translation , the sonographic test was found to have a sensitivity and specificity of 91.9% and 95.6% , respectively.conclusions:the present technique supports the clinician with additional fast and noninvasive diagnostic procedure that can facilitate the evaluation of anterior knee instability .
behet 's disease ( bd ) is a chronic , relapsing , multisystem inflammatory disorder of unknown etiology , which is classified among the vasculitides.1 the cause of bd remains unknown ; however , an autoimmune reaction triggered by an infectious agent in a genetically predisposed individual has been suggested . recurrent oral ulcers in combination with genital ulcers , ocular disease , cutaneous lesions , arthritis , and less frequently , involvement of the gastrointestinal ( gi ) tract , central nervous system , and vascular beds have been typically observed.1 the disease can affect both sexes , and although it has a worldwide distribution , it is more prevalent in the mediterranean and far east . the incidence of bd involving the gi tract varies by country , ranging from 3 - 60% . the gi lesions are often refractory to conventional medical therapies ( e.g. , corticosteroids [ cs ] and immunosuppressants),2 and they sometimes cause life - threatening comorbidities such as intestinal perforation and massive bleeding . myelodysplastic syndrome ( mds ) is a heterogeneous group of clonal hematologic disorders characterized by ineffective hematopoiesis . several reports suggest that patients with mds and trisomy 8 are prone to having intestinal bd.3,4,5 in addition , intestinal bd patients with mds involving trisomy 8 fail to respond to the aforementioned conventional medical therapies . therefore , a new therapeutic strategy based on its pathogenesis is well expected for treating intestinal bd patients with mds . tumor necrosis factor ( tnf)- is strongly involved in the pathophysiology of several autoimmune diseases such as rheumatoid arthritis , ibd , and bd . in addition , tnf- plays an important role in the pathophysiology of mds by inhibiting normal hematopoiesis and inducing the programmed cell death of normal total bone marrow cells and normal cd34 + cells.6 recent clinical reports have demonstrated the favorable effect of tnf- antagonists in patients with refractory intestinal bd and those with mds.7 considering the common pathophysiology of intestinal bd and mds , the tnf- antagonist may be an ideal drug for treating intestinal bd patients with mds involving trisomy 8 . however , there are no reports on treating intestinal bd and mds successfully with tnf- antagonist alone . herein , we present the case of a patient with intestinal bd and mds involving trisomy 8 who was successfully treated with adalimumab ( ada ) , a completely humanized igg 1 monoclonal anti - tnf- antibody . a 79-year - old female underwent endoscopic submucosal dissection ( esd ) for an ileocecal , laterally spreading tumor . surgical resection of the ileocecal area was performed . however , the wound at the anastomotic site failed to heal , resulting in an enterocutaneous fistula . moreover , the patient had intractable oral and genital ulcerations during her disease course . despite no involvement of eye lesions or oral or genital ulcerations at this time , she had recurrent ulcers of the intestines with positive hla - b51 alleles ; thus , she was diagnosed with bd . three months of prednisolone ( 30 mg / day ) treatment without any other immune modulators relieved her upper abdominal pain . however , endoscopic findings revealed deterioration of the colonic ulcer ( fig . blood tests showed that the white blood cell ( wbc ) , hemoglobin ( hb ) , and crp levels were 6,500/l , 11.4 g / dl , and 0.6 mg / dl , respectively . firstly , surgical resection of the ileum and fistula closure was performed . however , her abdominal pain continued , and the laboratory data showed the following : leukocytopenia ( wbc , 1,800/l ) , anemia ( hb , 5.9 g / dl ) , and elevation of the crp ( 18.4 mg / dl ) . conventional cytogenetic testing ( g - banding ) of her bone marrow demonstrated the presence of trisomy 8 in all the cells . these findings led to the diagnosis of mds ( refractory anemia with excess blasts-1 ) involving trisomy 8 . the international prognostic scoring system of bd was 4.75.8 because of her diagnosis ( i.e. , cs - refractory bd associated with mds involving trisomy 8) , we administered ada . we decided to only use adalimumab to treat mds instead of using drugs such as azacitidine or decitabine , which may cause myelo - suppression , and she was an elderly patient with a high risk of infection . 1 ) , and there was a striking improvement in her crp level . of note , a gradual improvement in her leukocytopenia and anemia was observed at 4 months after starting ada . in this case , ada was effective for treating intestinal bd and also anemia related to mds with trisomy 8 . to our knowledge , this is the first case of an intestinal bd patient with mds involving trisomy 8 who was successfully treated with ada . in addition , our case emphasizes that tnf- plays a critical role in the pathogenesis of intestinal bd with mds . until recently , the trisomy 8 allele is one of the most frequent genetic abnormalities found in 6.5 - 16.3% of primary mds patients.9 furthermore , the prevalence rate of trisomy 8 is as high as 73.7% in mds patients with bd.10 the majority of cases have incomplete types of bd ( mainly the intestinal type ) and the refractory anemia subtype of mds . generally , it has been reported that patients with intestinal bd with mds involving trisomy 8 are refractory to conventional medical therapies . since extensive intramedullary cell death in mds patients is related to tnf-11,12 and the serum tnf- concentrations are increased in bd patients,13 a tnf- antagonist would theoretically be ideal for treating intestinal bd patients with mds . currently , there are several reports on the effectiveness of tnf- antagonists such as infliximab and ada in patients with intestinal bd . a previous case of intestinal bd with mds involving trisomy 8 was successfully treated with a combination of infliximab and methotrexate for an intestinal lesion ; however , infliximab monotherapy was not effective for improving intestinal bd comorbid with mds and trisomy 8.14,15 when treating patients with bd who have severe symptoms related to deep ulcers of the intestine , cs are the firstline of induction therapy . however , in bd patients refractory to cs , the use of anti - tnf- monoclonal antibodies would be considered , because there are many reports on the efficacy of anti - tnf- monoclonal antibodies in managing intestinal bd ; in addition , ada was approved for intestinal bd in japan in 2013.16 moreover , many physicians avoid using a high dose of cs in elderly patients as much as possible . therefore , in our case , we selected ada as an alternative to increasing the dose of cs . we recommend anti - tnf- therapy in patients with refractory bd , although more data regarding the efficacy and safety of anti - tnf- antibodies on refractory bd are needed . it remains unclear whether infliximab is effective for intestinal bd comorbid with mds involving trisomy 8 . however , there are no previous reports on intestinal bd patients with mds involving trisomy 8 who were treated with ada . in our case it is possible that the healing of the intestinal ulcers and good control of mds with ada may have contributed to the improvement of her anemia . in conclusion , our case strongly suggests that intestinal bd patients with mds involving trisomy 8 require optimal control of tnf- using tnf- antagonists . in the future , clinical trials with a larger number of patients will be required to elucidate whether ada monotherapy is optimal for intestinal bd patients with mds involving trisomy 8 .
behet 's disease ( bd ) is a systemic vasculitis , while myelodysplastic syndrome ( mds ) is a heterogeneous group of clonal hematologic disorders characterized by ineffective hematopoiesis . some studies suggest a relationship between mds and bd , especially intestinal bd , and trisomy 8 seems to play an important role in both diseases . there are several reports on patients with bd comorbid with mds involving trisomy 8 that frequently have intestinal lesions refractory to conventional medical therapies . tumor necrosis factor ( tnf)- is strongly involved in the pathophysiology of several autoimmune diseases such as rheumatoid arthritis , inflammatory bowel disease , and bd . in addition , tnf- plays an important role in the pathophysiology of mds by inhibiting normal hematopoiesis and inducing the programmed cell death of normal total bone marrow cells and normal cd34 + cells . recent clinical reports demonstrate the favorable effect of tnf- antagonists in patients with refractory intestinal bd and in those with mds . we present the case of a patient with intestinal bd and mds involving trisomy 8 who was successfully treated with adalimumab .
malakoplakia is an uncommon but distinctive type of chronic granulomatous inflammation that is characterized histologically by the presence of sheets of histiocytes with granular cytoplasm ( von hansemann cells ) admixed with intracellular and extracellular basophilic laminated inclusions ( michaelis - gutmann bodies ) . the present case , however , is the first case of epididymal malacoplakia without concurrent involvement of the testis . although the exact etiology of malakoplakia remains poorly understood , it is commonly associated with microbial infections and states of diminished immune response . here we report an unusual case of malakoplakia that involved the epididymis in a 61-year - old man with a scrotal mass . a 61-year - old man presented with a painful mass of his left epididymis for several months . ultrasonography of the left epididymis revealed a mass lesion of mixed echotexture in the epididymal tail ( fig . histopathology showed an epididymal mass comprising sheets of histiocytes with granular eosinophilic cytoplasm ( fig . many of the histiocytes contained small round to oval targetoid structures that were morphologically consistent with michaelis - gutmann bodies . the patient 's postoperative recovery was uneventful and the surgical outcome has been satisfactory for 8 months . malakoplakia , derived from the greek adjective malakos ( soft ) and plaka ( plaque ) , was first described in 1902 by michaelis and gutmann and was clearly explained by mcclue in his review . epididymal malakoplakia was first described in 1968 by green , and there have been five reports of this condition in korea . malakoplakia , which typically involves the urinary tract , is an uncommon form of chronic inflammation caused by chronic infections and characterized by accumulation of macrophages . it has also been found in various sites such as the gastrointestinal tract , pancreas , liver , lymph nodes , skin , respiratory tract , adrenal gland , vagina , and brain . malacoplakia is characterized histologically by the presence of michaelis - gutmann bodies contained within von hansemann macrophages . special stains such as periodic acid schiff and von kossa for calcium can be particularly helpful in highlighting the michaelis - gutmann bodies when these are obscured within dense lymphohistiocytic infiltrate . the etiology of malakoplakia has not been fully elucidated . coliform bacteria , particularly e. coli , have been isolated from the involved sites of genitourinary malakoplakia in more than two - thirds of patients . another potential contributing factor to the development of malakoplakia is an impaired immune response . in a review by long and althausen , approximately 40% of malakoplakia cases that did not involve the urinary tract were associated with immunosuppression . the ability of phagocytes to completely digest bacteria is impaired in malakoplakia , which is thought to be related to low levels of intracellular cyclic guanosine monophosphate ( cgmp ) and diminished release of b - glucuronidase . this would explain the successful treatment of a case with the cholinergic agonist bethanechol chloride , which acts by increasing the levels of cgmp . the treatment options for malakoplakia include two main approaches : the administration of antibiotics and surgical excision , depending on the site and extent of involvement . antibiotics that can penetrate the cell membrane and concentrate in macrophages are associated with a high cure rate . treatment with trimethoprim - sulfamethoxazole may be helpful because of the ability of trimethoprim to enhance the killing of viable undigested microorganisms inside malakoplakic macrophages . also , because ciprofloxacin penetrates well into macrophages , this drug has been found to be particularly useful in patients with advanced malakoplakia . in addition to these agents , bethanechol is believed to enhance phagocytic bactericidal activity by increasing cgmp levels . if conservative treatment fails to control and diminish the malakoplakia , which is the most likely situation according to most investigators , surgical resection is needed . close follow - up of these patients is needed because multiple locations can be affected . in our case , considering the involvement of the epididymis in our patient , who had no fever and negative results on urinalysis and urine culture , excision of the epididymal mass was the best option without antibiotic therapy , and this treatment led to a satisfactory outcome .
malacoplakia is a chronic inflammatory disease . the disease mainly affects the urinary bladder , although involvement of extravesical sites is increasingly being documented . most frequently involved is the urinary tract , particularly the urinary bladder , although the testis , epididymis , lungs , bone , colon , prostate , female genital organs , and retroperitoneum can also be involved . here we report the case of a 61-year - old man with a scrotal mass with histology that was specific for malacoplakia of the epididymis . the histologic workup demonstrated extensive involvement of the epididymis by diffuse infiltrates of large histiocytes with eosinophilic granular cytoplasm and numerous michaelis - gutmann bodies , which were diagnostic of malakoplakia . this is the first case of epididymal malacoplakia in our country and the first case of epididymal malacoplakia without concurrent involvement of the testis . there have been few reports of this condition worldwide .
impairments in affect recognition have been found in individuals with adhd across the lifespan ( corbett and glidden , 2000 ; kats - gold et al . , 2007 ; rapport et al . , 2002 ) and shown to impact cognitive control in children with adhd ( kochel et al . , 2014 ) . these basic emotion deficits have been linked to a pattern of limbic dysfunction in youth with adhd , including amygdala hyperreactivity ( brotman et al . , 2010 ; posner et al . , 2011b ) , enhanced amygdala - prefrontal connectivity ( posner et al . , 2011b ) , and valence - dependent activation in the prefrontal cortex that may reflect the impact of affect on cognitive control ( passarotti et al . , 2010 ; posner et al . , 2011a however , it is not known if this limbic dysfunction persists over development or biases cognitive control in adulthood , although anomalous intrinsic connectivity in fronto - limbic networks has been reported in adults with adhd ( cocchi et al . , 2012 ; mccarthy et al . , 2013 ) . establishing the developmental influence of basic emotion deficits on cognitive control in individuals with adhd and identifying the neural mechanisms that support this emotional bias have implications for addressing the impulsivity and affective instability that are the source of much of the impairment associated with the disorder in adults ( retz et al . , 2012 ) . facial expressions convey emotional cues that influence cognitive control processes , including response execution and inhibition in healthy adults ( hare et al . facial expressions of happiness promote approach tendencies ( otta et al . , 1994 ) , resulting in faster responses that are more difficult to inhibit ( hare et al . , 2005 ; schulz et al . , 2007 ) , while expressionless ( neutral ) faces are often mistakenly evaluated as positive or negative ( lee et al . , 2008 ) and the emotional biasing of these cognitive control processes depends on functional interactions between limbic regions specialized for the affective valuation of visual stimuli ( dolan , 2007 ; haber and knutson , 2010 ) , orbital aspects of the inferior frontal gyrus that integrate limbic input to assign behavioral significance to stimuli ( sakagami and pan , 2007 ) , and the dorsolateral prefrontal cortex ( dlpfc ) , which converts these behavioral codes into top - down control over sensorimotor effectors that directly support task performance ( dosenbach et al . , 2007 ; gazzaley and nobre , 2012 ) . the inferior frontal gyrus and dlpfc have been implicated in the cognitive control deficits in adhd ( hart et al . , 2013 ) and are some of the last brain regions to mature functionally , with development continuing into early adulthood ( gogtay et al . , 2004 ; shaw et al . , 2012 ) and reportedly delayed in individuals with adhd ( shaw et al . , 2012 ) . the late and protracted development of the dlpfc and inferior frontal gyrus suggests that the impact of aberrant limbic processing on cognitive control in individuals with adhd may not manifest fully until these regions reach functional maturation in early adulthood ( goldman , 1971 ) . the current study used functional magnetic resonance imaging ( fmri ) together with a face emotion go / no - go task to compare the emotional bias of cognitive control in young adults diagnosed with adhd in childhood and well - matched comparison subjects with no history of adhd . defining the probands based on a childhood diagnosis of adhd , rather than a current diagnosis , made it possible to test the relationship of the emotional bias of cognitive control to the persistence of adhd in adulthood . initial analyses disregarded face valence to focus on whole - brain activation and functional connectivity of dlpfc for cognitive control irrespective of emotion . the available literature suggested that probands would show cognitive control deficits relative to comparison subjects , as reflected in fewer correct responses and inhibitions overall on the task ( hervey et al . 2005 ) , diminished dlpfc and inferior frontal activation for response execution and inhibition ( hart et al . , 2013 ) , and reduced dlpfc limbic interactions that may reflect less cognitive control of emotion processing ( cocchi et al . , 2012 ; mccarthy et al . , 2013 ) . moreover , we predicted that dlpfc limbic connectivity would be related to the persistence of adhd in probands and differentially related to emotional lability in probands and comparison subjects . further analyses used the happy , sad , and neutral facial expressions that served as cues for go and no - go trials in the task to test the influence of face valence on activation for response execution and response inhibition . we predicted that emotional biases would exacerbate the response execution and inhibition deficits in probands ( e.g. , fewer correct inhibitions for happy faces than sad or neutral faces ) and result in greater valence - dependent variations in limbic and prefrontal activation for response execution and inhibition relative to comparison subjects . participants were 14 adult males who were diagnosed with adhd when they were 711 years old and 14 adult males with no history of adhd . the probands were recruited from a study of adhd conducted between 1990 and 1997 ( halperin et al . , 2003 ) . childhood diagnosis of adhd was based on parental responses to the diagnostic interview schedule for children parent version ( shaffer et al . , 1989 ) . diagnoses of major affective disorder , schizophrenia , pervasive developmental disorder , or tourette 's syndrome were exclusionary for the initial study , as was a full - scale iq below 70 . four probands had a comorbid diagnosis of conduct disorder in childhood , and two of these children also met diagnostic criteria for separation anxiety disorder . the comparison group was recruited from the same communities where the probands resided during an adolescent follow - up study ( miller et al . , 2008 ) . comparison subjects had no history of childhood adhd and no more than three inattentive or hyperactive impulsive symptoms reported by parents on the diagnostic interview schedule for children . other psychiatric disorders that were allowed in the childhood adhd sample were not exclusionary for the comparison group . the adult assessment was conducted a mean sd of 13.2 2.3 years following the probands ' childhood assessments , when probands were 1927 years old . all participants were interviewed with the structured clinical interview for dsm - iv axis i disorders ( scid ) ( first et al . , 2002 ) , supplemented by a semi - structured interview for adhd that was adapted from the schedule for affective disorders and schizophrenia for school - age children ( kaufman et al . , 1997 ) and the conners ' adult adhd diagnostic interview for dsm - iv ( epstein et al . , 2006 ) . the adapted interview was previously shown to demonstrate strong internal consistency ( a = 0.92 ) ( clerkin et al . , 2013 ) . the psychiatric status of the probands reflected the diverse adult outcomes characteristic of adhd ( faraone et al . , 2006 ) . seven ( 50% ) probands met full dsm-5 diagnostic criteria for adhd in adulthood , including six ( 43% ) with combined presentation and one ( 7% ) with predominantly hyperactive / impulsive presentation . seven ( 50% ) probands continued to report symptoms that resulted in impairment in at least one domain of functioning , but no longer met full criteria for dsm-5 adhd as adults , and were thus considered in partial remission . none of the comparison subjects met the diagnostic criteria for adhd in adulthood or reported more than three inattentive or hyperactive impulsive symptoms in the past 6 months . participants also completed the conners ' adult adhd rating scale ( caars ) ( conners et al . , 1999 ) ; probands had higher ratings than comparison subjects on the hyperactive impulsive symptoms ( t = 3.42 , p = 0.002 ) , inattentive symptoms ( t= 3.94 , p= 0.001 ) , and adhd symptoms total ( t = 4.16 , p < 0.001 ) subscales ( table 1 ) . probands and comparison subjects did not differ significantly in age , ratings on the beck depression inventory ii ( steer et al . , 1999 ) , or in their prevalence of mood , anxiety , and substance use disorders ( table 1 ) . however , probands had higher ratings on the caars impulsivity / emotional lability subscale than comparison subjects ( t = 2.76 , p= 0.01 ) . all participants were screened for substance use on the day of the scan and positive urine toxicology results for amphetamines , cocaine , and opiates were exclusionary . ten ( 71% ) probands had a previous history of stimulant treatment for adhd , but no patient received any psychotropic medication in the 6 months preceding this study . the study was approved by the institutional review boards of queens college of cuny and the icahn school of medicine at mount sinai . the face emotion go / no - go task has been previously described ( schulz et al . the task consisted of six 252-s runs that each began and ended with a 30-s central fixation - cross . each run contained 72 ( 75% ) go cues and 24 ( 25% ) no - go cues , yielding a total of 432 go cues and 144 no - go cues . participants had to respond rapidly with the right index finger to go cues and withhold responses to no - go cues . stimuli were presented in the center of the screen for 500 ms with an interstimulus interval that was pseudorandomized from 1250 to 1750 ms ( mean per block = 1500 ms ) . face stimuli consisted of gray - scaled happy , sad , and neutral facial expressions from 18 individuals ( 9 females , 9 males ) from the macbrain face stimulus set [ ( tottenham et al . , 2009 ) ; alternating the valence of the face stimuli used as trial cues resulted in six runs , as follows : 1 ) happy go / sad no - go ; 2 ) sad go / neutral no - go ; 3 ) neutral go / happy no - go ; 4 ) happy go / neutral no - go ; 5 ) sad go / happy no - go ; and 6 ) neutral go / sad no - go . trial order was counterbalanced across all conditions ( e.g. , trial type , facial expression , face ethnicity , face gender , face ) to ensure that each trial type followed every other trial type equally often . all participants were scanned on a 3.0 tesla siemens allegra ( siemens medical systems ) head - dedicated mri scanner . six series of 84 functional t2 * -weighted images were acquired with echo - planar imaging sensitive to the blood oxygenation level - dependent ( bold ) signal ( repetition time = 3000 ms ; echo time = 27 ms ; flip angle = 85 ; slice thickness = 2.5 mm ; skip = 0.825 mm ; 42 axial slices ) . the repetition time represented a trade - off for thinner slices that minimized distortions and increased sensitivity . a high - resolution t2-weighted anatomical volume was acquired at the same 42 slice locations with a turbo spin - echo pulse ( slice thickness = 3.325 mm ; no skip ; in - plane resolution = 0.41 mm ) . the percentage of correct responses on go trials served as the measure of response execution , while the percentage of correct inhibitions on no - go trials was the measure of response inhibition . behavioral performance was tested with repeated measures analyses of variance ( anova ) with face emotion ( happy vs. sad vs. neutral ) as the within - subjects factor and group ( probands vs. comparison subjects ) as the between - subjects factor . event - related analyses were performed with spm8 software ( http://www.fil.ion.ucl.ac.uk/spm/ ) . the six functional series for each participant were slice - time corrected , motion corrected , co - registered to the t2 anatomical volume , spatially normalized to the montreal neurological institute template , and smoothed with an 8-mm gaussian kernel . the proband and comparison groups did not differ in mean translational movement ( 0.97 0.64 mm vs. 0.99 0.40 mm ; t = 0.91 , p > 0.10 ) or rotational displacement ( 0.01 0.01 vs. 0.01 0.01 ; t= 0.74 , p > 0.10 ) during the scan . single - subject general linear models ( glm ) were conducted to fit beta weights to regressors for the four trial events ( correct no - go , correct go , incorrect no - go , incorrect go ) in each run , as well as six motion parameters of no interest ( johnstone et al . , 2006 ) , convolved with the default spm hemodynamic response function ( friston et al . , 1998 ) . the neural effect of cognitive control was tested by applying appropriate contrasts to the beta weights for correct no - go events minus correct go events collapsed over face valence . further analyses tested for variations in activation for response execution and inhibition as a function of face valence using linear and quadratic contrasts based on the behavioral results . the neural effects of happy , sad , and neutral faces were modeled with linear and quadratic contrasts applied separately to the beta weights for correct no - go and correct go events . psychophysiological interaction analyses were conducted to determine the whole - brain connectivity of the right dlpfc for cognitive control ( friston et al . , 1997 ) . the seed region was extracted from a 6-mm radius sphere at subject - specific maxima that were within 2 mm of the peak of the right dlpfc activation for the correct no - go minus correct go contrast common to all probands and comparison subjects ( x= 54 , y= 22 , z= 30 ) . the time series of the first eigenvariate of the bold signal in the seed region was calculated from the time - series of voxels within the sphere and was then deconvolved to estimate the time series of the neuronal signal ( gitelman et al . , 2003 ) . regressors representing the baseline dlpfc neuronal time series ( y ) , the correct no - go minus correct go contrast ( p ) , and the interaction between the physiological and psychological factors ( ppi ) were forward - convolved with the hemodynamic response function and then entered into single - subject glm , along with six motion parameters of no interest . the effect of cognitive control on right dlpfc connectivity was tested by applying appropriate contrasts to the beta weights for the ppi regressor . subject - specific contrast images for activation and connectivity were entered into second - level group analyses conducted with random - effects glm . one- and two - sample t - tests were conducted to analyze within - group and between - group effects in the contrasts of interest , respectively . the effect of emotional lability on right dlpfc connectivity was tested using a multiple linear regression analysis that included regressors centered on the mean for the group variable and the caars impulsivity / emotional lability subscale t - score , and an interaction predictor , calculated as the product of the centered regressors . a second analysis tested the effect of adhd persistence by regressing dlpfc connectivity on the caars adhd symptoms total subscale t - score in probands . the regression analyses were restricted to regions that differed in connectivity with the right dlpfc in probands and comparison subjects . the resultant voxel - wise statistical maps were thresholded for significance using a cluster - size algorithm that protects against false - positive results ( hayasaka et al . , 2004 ) . the height ( intensity ) threshold of each activated voxel was set at a p - value of 0.005 and the extent ( cluster ) threshold was fixed at ? > 100 contiguous voxels . a prior monte carlo simulation confirms the current voxel contiguity threshold ( schulz et al . , 2013 ) . separate anovas revealed that probands with childhood adhd made both significantly fewer correct inhibitions on no - go trials ( f(1 , 26 ) = 4.54 , p= 0.04 ) and fewer correct responses on go trials ( f(1 , 26 ) = 8.49 , p= 0.007 ) than comparison subjects ( fig . 1 ) . there were also significant main effects of emotion on the percentage of correct inhibitions ( f(2 , 26 ) = 6.03 , p= 0.004 ) and the percentage of correct responses ( f(2 , 26 ) = 7.99 , p < 0.001 ) . post - hoc bonferroni tests revealed : 1 ) a linear trend in the percentage of correct inhibitions that was due to fewer correct inhibitions for happy faces than sad faces , p < 0.05 , which in turn had fewer correct inhibitions than for neutral faces , p < 0.05 ; and 2 ) a quadratic trend in the percentage of correct responses that reflected fewer correct responses for sad faces than either happy or neutral faces , both p < 0.01 , which did not differ from each other , p > 0.05 . however , there were no significant group emotion interaction effects for either the percentage of correct inhibitions or the percentage of correct responses ( both p > 0.05 ) . there were no main effects or interactions for rt ( all p > 0.05 ) . probands with childhood adhd and comparison subjects demonstrated similar patterns of frontotemporal activation for cognitive control collapsed over face valence ( supplementary table 1 ) . as shown in fig . 2 , the two groups exhibited greater activation for correct no - go events than correct go events in overlapping areas of the right inferior frontal gyrus and right dlpfc , as well as in right middle temporal gyrus and right fusiform face area . comparison subjects showed additional frontal and left amygdala activation that was not evident in probands . however , direct comparison of the two groups found no significant differences in activation for cognitive control . psychophysiological interaction analyses revealed differences in the whole - brain connectivity of the right dlpfc for cognitive control in probands with childhood adhd and comparison subjects ( fig . 3 ; see also supplementary table 2 ) . comparison subjects showed significantly greater functional interactions for correct no - go events than correct go events between the right dlpfc and the left inferior frontal gyrus , bilateral subgenual cingulate cortex , and left putamen relative to probands . the regression analysis revealed that the caars impulsivity / emotional lability subscale scores were positively correlated with dlpfc subgenual cingulate cortex connectivity in probands but not comparison subjects ( fig . 4 ; f= 13.46 , extent = 126 voxels , [ 10 44 0 ] ) . in contrast , the caars adhd symptoms total score was not related to right dlpfc connectivity in probands . probands showed significant right dlpfc connectivity with bilateral fusiform face area , but this connectivity did not differ from comparison subjects ( supplementary table 2 ) . quadratic contrasts were used to model valence - dependent variations in activation for response execution ( correct go events ) that matched the quadratic trend in the percentage of correct responses reported above . direct comparison of the two groups revealed quadratic trends in activation for correct go events as a function of emotional valence in the right amygdala , left ventral striatum and orbitofrontal cortex , and right subgenual cingulate cortex in comparison subjects but not in probands with childhood adhd ( fig . 5 5b illustrates that the quadratic trends in activation reflected lower activation for response execution cued by sad faces than activation cued by either happy or neutral faces , which did not differ from each other . probands showed significant quadratic trends in left motor cortex activation for response execution as a function of emotional valence , but this valence - dependent activation did not differ from comparison subjects ( supplementary table 3 ) . the influence of face emotion valence on activation for response inhibition ( correct no - go events ) was modeled with linear contrasts based on the findings of fewer correct inhibitions for happy faces than sad faces and for sad faces than neutral faces . group analyses revealed no significant valence - dependent variations in activation for correct no - go events in either probands or comparison subjects and no difference in such activation between the groups . these results suggest that emotional cues conveyed by facial expressions bias cognitive control similarly , albeit through divergent neural mechanisms in young adults diagnosed with adhd in childhood and comparison subjects with no history of adhd . probands with childhood adhd made fewer correct responses and correct inhibitions overall than comparison subjects despite showing similar patterns of frontotemporal activation for cognitive control collapsed over face valence . the response execution and inhibition deficits may have instead been related to the anomalous functional connectivity of the right dlpfc in probands . comparison subjects showed enhanced right dlpfc connectivity with limbic structures , including the subgenual cingulate cortex , putamen , and orbital aspects of inferior frontal gyrus compared to probands , who showed connectivity with the fusiform face area . face emotion had comparable effects on performance in probands and comparison subjects ; the two groups showed similar linear trends in the percentage of correct inhibitions and quadratic trends in the percentage correct responses as a function of face valence . however , corresponding quadratic trends in activation for response execution as a function of emotional valence in the amygdala , ventral striatum , subgenual cingulate cortex , and orbitofrontal cortex were found in comparison subjects but not in probands . the findings point to functional anomalies in both the valence - dependent biasing of cognitive control and the valence - independent cognitive control of face emotion processing in probands . the impairments in response execution and response inhibition found in probands have long been considered core neuropsychological deficits in adhd ( hervey et al . , 2004 ; willcutt et al . , these cognitive control deficits have been linked to hypoactivation of the inferior frontal gyrus , dlpfc , and other frontoparietal regions that were engaged by both comparison subjects and probands in the current study ( hart et al . , 2013 ) . the lack of group differences in this valence - independent activation implies that the poor response execution and inhibition performance seen in probands was not directly related to motor or inhibitory processes . rather , differences in right dlpfc connectivity for cognitive control suggests that probands and comparison subjects engaged distinct neural mechanisms to process discrete features of the face stimuli . the dlpfc initiates and adjusts top - down control over task - essential sensorimotor effectors and thereby determines the focus of attention ( dosenbach et al . thus , the interaction of the right dlpfc with limbic circuits and orbital aspects of the inferior frontal gyrus suggests that comparison subjects focused on the affective valuation of the facial expressions for salience cues ( dolan , 2007 ; haber and knutson , 2010 ) and the behavioral encoding of these cues ( sakagami and pan , 2007 ) . probands showed right dlpfc connectivity with fusiform face areas specialized to process non - emotional features of face stimuli ( kanwisher and yovel , 2006 ) . the top - down focus on general face processing at the expense of higher - order affective processing could have impacted performance dependent on face emotion discrimination , and may have contributed to the response execution and inhibition deficits in probands , but was not related to the severity of adhd in adulthood . rather , the positive correlation of dlpfc subgenual cingulate connectivity with ratings of emotional lability in probands defined by a childhood diagnosis of adhd suggests that this pattern of connectivity may reflect trait - like dysfunction that develops from adhd in childhood , but is related to affective problems in adulthood . the behavioral results suggest that face emotion biased response execution and inhibition similarly in probands with childhood adhd and comparison subjects . both groups showed linear trends in the percentage of correct inhibitions that are consistent with prior studies in healthy adults that found that responses to happy faces were more difficult to inhibit ( hare et al . likewise , the quadratic trends in the percentage of correct responses found in the two groups corroborate previous reports of less accurate responses to sad faces than happy and neutral faces ( schulz et al . , 2009 , 2013 ) . however , differential localization of corresponding valence - dependent activation for response execution suggests that the affective cues conveyed by facial expressions biased different neural systems in probands and comparison subjects despite comparable effects on task performance . the finding of valence - dependent activation for response execution in the subgenual cingulate cortex , ventral striatum , amygdala , and orbitofrontal cortex in comparison subjects suggests that facial expressions influenced task performance by biasing the limbic network specialized for the evaluation of stimuli for salience cues ( dolan , 2007 ; haber and knutson , 2010 ) . conversely , the pattern of valence - dependent activation in probands hints that face emotion instead biased the primary motor cortex effectors for response execution ( lacourse et al . the top - down focusing of attention on general face processing exemplified by the connectivity results may have diminished the limbic response to the emotional features of the face stimuli in probands ( pessoa and ungerleider , 2004 ) . these differences in the stimulus - driven affective biasing of cognitive control processes may reflect abnormalities in the implicit and automatic limbic processing of affective cues in probands . the absence of limbic responses for the top - down cognitive control of face emotion processing and the stimulus - driven affective biasing of cognitive control in probands with childhood adhd differs from previous reports of amygdala hyperactivity in youth with adhd ( brotman et al . youth with adhd have been reported to show exaggerated stimulus - driven amygdala responses to fearful faces ( posner et al . , 2011b ) and enhanced amygdala activation during directed fear appraisal ( brotman et al . , 2010 ) . the discrepancies across the studies may be due to differences in task demands , face emotions , or more likely developmental differences between the samples . the samples in the previous studies all comprised children and adolescents who met the diagnostic criteria for adhd at the time of the study . in contrast , probands in the current study were defined by a childhood diagnosis of adhd ; their status at the time of the scan reflected the diverse adult outcomes characteristic of adhd ( faraone et al . , 2006 ) . the discrepant findings regarding limbic responsiveness may therefore reflect developmental differences across the samples , particularly in relation to the maturation of prefrontal control over limbic function ( blumberg et al . , 2004 ) . it should also be noted that reduced limbic responses to fearful faces have been reported in youth with disruptive behavior disorders , although this dysfunction was specifically linked to callous - unemotional traits , not the presence of adhd ( marsh et al . , 2008 ) . first , the analyses of group differences in activation for cognitive control and behavioral measures of face emotion would have benefitted from a larger sample size . the relatively small sample size may have limited the power to detect more subtle effects , but does not detract from our findings of significant group differences in activation , connectivity , and behavior . second , the uniqueness of the probands in our study might limit the generalization of the findings to all adults with adhd . as noted , probands were defined by a childhood diagnosis of adhd but presented with different degrees of symptoms as adults . conversely , this method enabled us to test the relationship of the emotional bias of cognitive control to the persistence of adhd symptoms in adulthood . finally , the inclusion of participants with mood and substance use disorders in the sample , while balanced between the proband and comparison groups , may have influenced the results . depressive disorders are characterized by mood - congruent biases that would be expected to enhance responding to sad faces on the go / no - go task ( blaney , 1986 ) . instead , probands and comparison subjects in the current study both made fewer correct responses ( i.e. , more errors ) to sad faces than happy and neutral faces . likewise , the two groups had similar rates of substance use disorders , but showed divergent patterns of activation in ventral striatal regions associated with substance use ( koob and volkow , 2010 ) . excluding participants with these disorders the present data suggest that emotional cues conveyed by facial expressions bias cognitive control through sensorimotor effectors rather than limbic networks in young adults diagnosed with adhd in childhood . this limbic dysfunction could impact cognitive control in emotional contexts and may contribute to the social and emotional problems associated with adhd . newcorn is a recipient of research grants from shire , and is or has been an advisor / consultant for alcobra , biobehavioral diagnostics , enzymotec , gencosciences , neos , shire , and sunovian .
affect recognition deficits found in individuals with attention - deficit / hyperactivity disorder ( adhd ) across the lifespan may bias the development of cognitive control processes implicated in the pathophysiology of the disorder . this study aimed to determine the mechanism through which facial expressions influence cognitive control in young adults diagnosed with adhd in childhood . fourteen probands with childhood adhd and 14 comparison subjects with no history of adhd were scanned with functional magnetic resonance imaging while performing a face emotion go / no - go task . event - related analyses contrasted activation and functional connectivity for cognitive control collapsed over face valence and tested for variations in activation for response execution and inhibition as a function of face valence . probands with childhood adhd made fewer correct responses and inhibitions overall than comparison subjects , but demonstrated comparable effects of face emotion on response execution and inhibition . the two groups showed similar frontotemporal activation for cognitive control collapsed across face valence , but differed in the functional connectivity of the right dorsolateral prefrontal cortex , with fewer interactions with the subgenual cingulate cortex , inferior frontal gyrus , and putamen in probands than in comparison subjects . further , valence - dependent activation for response execution was seen in the amygdala , ventral striatum , subgenual cingulate cortex , and orbitofrontal cortex in comparison subjects but not in probands . the findings point to functional anomalies in limbic networks for both the valence - dependent biasing of cognitive control and the valence - independent cognitive control of face emotion processing in probands with childhood adhd . this limbic dysfunction could impact cognitive control in emotional contexts and may contribute to the social and emotional problems associated with adhd .
mammary gland disorders were first described by an ancient surgeon , imhotep , in a papyrus dated to the 17 century bc . the author described 45 cases of this type , with a final conclusion of no cure presented along with the last case in the series . for more than 3000 years , breast cancer was a mysterious , abashing and incurable disease detected at a very advanced stage . it consisted in extensive procedures of dissecting the mammary gland along with pectoral muscles and axillary , supraclavicular , and often also mediastinal lymph nodes . currently , halsted 's radical mastectomy is performed only in cases of infiltration of pectoral muscles and the range of surgical treatment is decided on the basis of tnm disease staging . ultrasonography ( us ) is one of the basic methods used in detection of focal lesions , including breast cancer staging . first examinations employing ultrasonographic techniques were performed in a - mode using instrument probes immersed in water in the 1950s . in the 1960s , holmes , wright , and meyerdirk developed an ultrasound scanner facilitating two - dimensional b - mode imaging with the use of gel as a contact substance between the probe and the examined structures . recent years have witnessed a continuous , dynamic growth in breast and breast pathologies imaging methods [ ultrasonography , ultrasonography and sonoelastography , mammography ( mmg ) , magnetic resonance imaging ( mri ) , including contrast - enhanced imaging and positron emission tomography ( pet ) ] . thanks to the wide accessibility of mmg and us screening , breast cancer is increasingly often detected and successfully treated at earlier stages . a challenge related to the diagnostic imaging of breasts is the increase in the precision of the anatomical assessment of the gland for early detection of subclinical lesions , performance of ultrasound - guided biopsy procedures with subsequent preoperative location of lesions to optimize the surgical treatment . ultrasound imaging is a primary and baseline diagnostic procedure the patient with suspected pathological lesions within breast is referred to by the surgeon . the scan should be performed in compliance with the standards set forth by the polish ultrasound society . the results of ultrasound scans are subsequently correlated with the results of other imaging tests and , above all , with the clinical evaluation . following visualization of pathological lesions in a ultrasound scan , the lesions should be assigned a category according to the bi - rads us classification . according to the classification , category bi - rads us 2 includes focal lesions presenting with features of lesions that are unambiguously benign , requiring no further examinations or biopsy verification ; follow - up ultrasound scan is recommended in 12 months.in this category , surgical consultation may be required by clinically enlarging inflammatory lesions , including complex cysts , abscesses or damages to breast implants ( fig . 1).category bi - rads us 3 includes lesions of a probably benign , with probability of malignancy amounting to < 2% . category bi - rads us 2 includes focal lesions presenting with features of lesions that are unambiguously benign , requiring no further examinations or biopsy verification ; follow - up ultrasound scan is recommended in 12 months . category bi - rads us 3 includes lesions of a probably benign , with probability of malignancy amounting to < 2% . a , b. damaged saline chamber in a patient with a dual - chamber implant lesions classified into this category include fibroadenomas ( the most common solid lesions within the breasts ) , thickwalled cysts , dilated milk ducts with thick contents or small cyst aggregates . lesions classified into this category may be subject to fineneedle aspiration biopsy ( fnab ) , follow - up examination in 6 months , or sonoelastographic examination . results of surgical evaluation taking into account the patient 's age , family history and preferences are decisive for the choice of therapeutic management . they are characterized by high structural diversity as shown in ultrasound scans , reflecting their complex structure , including histopathological structure . according to stavros , only 4050% of fibroadenomas present with features typical of bi - rads us category 3 ; presentation of the remaining ones is considered suspicious , resulting in their being classified as bi - rads us category 4 ( fig . hypoechogenic , oval solid focal lesions with segmentally rough edges ; bi - rads us category 4 . histopathological verification : complex fibroadenomas asymptomatic fibroadenomas , do not become enlarged usually remain monitored and do not require surgical treatment . patients referred to surgical treatment are usually patients with rapidly - growing fibroadenomas or fibroadenomas larger than 45 cm in size , causing pain , presenting with features of atypia , or suspected of malignant growth . the incidence of malignancies in fibroadenomas is very low and accounts for 0.002% to 0.125% of cases . in situ carcinomas : ductal ( dcis ) and lobular ( lcis ) are diagnosed most commonly . usually , they consist in small foci of malignant growth within large adenofibromas and the prognosis is better compared to the overall prognosis in breast cancer . in these cases , ultrasound monitoring of lesion size , echogenicity , echostructure , shape and vascular pattern is particularly important . due to the large diversity and potentially benign character of lesions falling within this category , the therapeutic decisions , usually conservative in nature , are made mainly on the basis of ultrasound scans . precise determination of lesion morphology ensures appropriate therapeutic decision , increases emotional comfort of the patient as well as facilitates planning further follow - up without more invasive diagnostics.lesions classified as bi - rads us category 4 and bi - rads us category 5 are referred to as suspicious lesions characterized by the probability of malignancy being larger than 2% and requiring microscopic verification . thick needle biopsy is preferred in case of lesions falling within these categories ( fig . 3 a ) . in exceptional cases , following negative microscopic verification , vacuum- assisted biopsy ( vab ) or surgical biopsy may be considered . lesions classified as bi - rads us category 4 and bi - rads us category 5 are referred to as suspicious lesions characterized by the probability of malignancy being larger than 2% and requiring microscopic verification . thick needle biopsy is preferred in case of lesions falling within these categories ( fig . 3 a ) . in exceptional cases , following negative microscopic verification , vacuum- assisted biopsy ( vab ) or surgical biopsy may be considered . a 28-year - old female , using contraceptives , with clinically palpable tender tumor within the supramamillary region in the right breast . family history of breast or ovarian cancer negative . ultrasound scan reveals a hypoechogenic , solid lesion with not circumscribed margin , ap dimension > ll dimension . histopathological verification : hamartomas in case of benign lesions classified as bi - rads us category 4 , including complex fibroadenoma , hamartoma ( fig . determination of cancer cells implies therapeutic management appropriate for the cancer type and stage . in case of an invasive or an in situ carcinoma being diagnosed in these categories , there are two basic methods of surgical treatment : breast conserving therapy ( bct ) , consisting in resection of the breast tumor including a healthy margin , placement of radiopaque clips within the tumor bed followed by axillary lymphadenectomy ( al ) or sentinel lymph node biopsy ( slnb ) and subsequent radiation therapy;mastectomy involving resection of the mammary gland including the fascia of the major pectoral muscle and axillary lymph nodes ( lymphadenectomy of slnb , as in the case of cn0 ) . breast conserving therapy ( bct ) , consisting in resection of the breast tumor including a healthy margin , placement of radiopaque clips within the tumor bed followed by axillary lymphadenectomy ( al ) or sentinel lymph node biopsy ( slnb ) and subsequent radiation therapy ; mastectomy involving resection of the mammary gland including the fascia of the major pectoral muscle and axillary lymph nodes ( lymphadenectomy of slnb , as in the case of cn0 ) . radical mastectomy following halsted 's procedure performed only in case of infiltration of pectoral muscles . surgeons expectations regarding ultrasound scans performed in patients with lesions suspected of malignant growth and patients diagnosed with breast cancer and referred to ultrasound imaging examinations before planned surgery include the precise assessment of the focal lesion with : the size and location , echo pattern , shape , orientation , margin , vascularity , potential calcifications , evaluation of location relative to the surrounding structures such as skin , nipple , pectoral muscles of ribs , surrounding breast tissues and the axillary fossa . the size of the tumor is one of the factors taken into consideration in treatment planning . malignant lesions less than 3 cm in size and absence of secondary lesions in other organs or regions ( m0 ) are an indication for breast conserving therapy ( fig.s 4 and 5 ) . contraindications for breast conserving therapy include : multifocal carcinomahistory of radiation therapy delivered to the breastextensive microcalcifications reported in mmg summarycertain collagenoseslack of patient 's consent history of radiation therapy delivered to the breast extensive microcalcifications reported in mmg summary lack of patient 's consent types of the surgical treatment of breast cancer hypoechogenic lymph node without visible hilum , with indistinct capsular margin . patient diagnosed with breast cancer was qualified for axillary lymphadenectomy relative contraindications include retromamillar location of the tumor and pregnancy . breast conserving therapy is also possible in patients with tumors > 3 cm in size , particularly at specialist oncology centers . this pertains to patients with large breasts in whom the cosmetic effect will be maintained and in cases when the tumor size had regressed secondary to systemic treatment as evidenced by imaging studies . precise ultrasound assessment of the lymph nodes within the axillary fossa as well as in the supraclavicular and subclavicular lesions , often combined with fnab , is essential for the surgeon in order to properly plan the surgical procedure within the fossa . currently , patients with no palpable lymph node enlargement in the clinical evaluation of axillary fossa ( n0 ) are qualified for sentinel lymph node biopsy ( slnb ) . this allows to avoid axillary lymphadenectomy which is known to be associated with numerous adverse effects . however , it should be stressed that in case of a macrometastasis ( as detected in histopathological examination ) into the sentinel node , patients are usually qualified for another surgical procedure . as demonstrated by numerous publications , sensitivity of ultrasound assessment combined with fnab verification of lymph nodes presenting with suspicious image in the ultrasound scan allows for more accurate disqualification of patient from the slnb procedure as compared to clinical examination , thus allowing to avoid a double instead of a single surgical procedure . ultrasonographic examinations by choi et al . showed that the thickness of the lymph node cortical layer of more than 3 mm is a sensitive marker of metastases into the lymph nodes within the axillary fossa . determination of the number of visible lymph nodes , their size , shape , echogenicity or morphological abnormalities such as the image of the nodular hilum , capsule and outline , is also important . assessment of vascularity by color doppler scan and comparison with contralateral axillary fossa lymph nodes is also helpful . the potential importance of ultrasound scans is supported by the results of a recent study acosog z0011 , suggesting a possibility of abandoning lymphadenectomy in case metastatic involvement of 12 sentinel nodes in n0 patients subjected to a breast conserving procedure and adjuvant tangential fields radiotherapy covering the entire breast including the axillary fossa . in addition , ultrasound scan detection of abnormal lymph nodes within the supraclavicular region and cytology - confirmed presence of cancer cells within the fnab ( cn3 ) disqualifies patients from surgical treatment and is an indication for systemic induction treatment ( stage iiic ) . in case of finding benign neoplastic tumors ( including fibrocystic breast disease ) in this category of lesions , the recommended treatment involves tumorectomy without adjuvant treatment . besides preoperative assessment and monitoring of changes , ultrasound scans are also basic tools for the monitoring of postoperative lesions such as intraglandular hematomas or mastitis as well as for assessment of complications of subsequent radiotherapy . in addition , ultrasound scans are often primary examinations used in the assessment of palpable lesions , nearly half of which corresponds to variants of normal mammary gland structure . ultrasound scan of mammary glands is often the primary examination in the diagnostics of mammary disorders . it allows for precise estimation of malignancy of the detected focal lesions , monitoring of biopsy procedures and localization of lesions prior to surgical treatment . current worldwid e recommendations include the establishment of centers where surgery , oncology , radiotherapy and diagnostics specialists can make joint decisions regarding the treatment of breast cancer patients . this is obviously the optimum approach , similar as in the case of any other clinical and procedural discipline .
recent years have witnessed a dynamic development of mammary gland imaging techniques , particularly ultrasonography and magnetic resonance imaging . a challenge related to these studies is the increase in the precision of the anatomical assessment of breast , particularly for early detection of subclinical lesions , performance of ultrasound - guided biopsy procedures , and accurate preoperative location of pathological lesions so as to optimize the surgical treatment . ultrasound imaging is a primary and baseline diagnostic procedure the patient with suspected pathological lesions within breast is referred to by the surgeon . lesions visualized in ultrasound scans are classified according to the bi - rads us assessment categories . the successive categories ( 2 through 6 ) encompass individual pathological lesions , estimating the risk of malignancy and provide guidelines for further diagnostic and therapeutic management . this article described the important aspects of ultrasonographic imaging of focal lesions within the breasts as significant from the standpoint of surgical treatment of patients falling within bi - rads us categories 3 , 4 , 5 , and 6 . attention is drawn to the importance of ultrasound scans in the assessment of axillary fossa lymph nodes before the decision regarding the surgical treatment .
camp - protein kinase a a kinase anchoring protein a kinase binding domain cyclic adenosine monophosphate inositol triphosphate human chorionic gonadotropin mitogen - activated protein kinase proto - oncogene tyrosine - protein kinase the camp - dependent protein kinase ( pka ) signaling pathway is characterized in detail in a number of cell types and organ systems . specificity in the activation of pka in response to distinct extracellular stimuli is controlled by the intracellular compartmentalization and interaction of pka with a kinase anchoring proteins ( akaps ) . all akaps contain an a kinase binding domain ( akb ) and a unique targeting domain localizing the pka - akap complex to defined subcellular structures , membranes or organelles . distinct subcellular targeting of pka isozymes provides spatial regulation of different pka signaling events by controlling the phosphorylation of specific substrates . in addition , akaps form supramolecular signaling complexes by scaffolding other kinases than pka , protein phosphatases , phosphodiesterases and other proteins involved in signal transduction . through this essential role in the spatial and temporal integration of effectors and substrates , akaps provide a high level of specificity and temporal regulation to the camp - pka - signaling pathway . in vertebrates , communication between adjacent cells occurs through gap junctions , which are composed of connexin hexamers in the cellular membrane forming hemiconnexons that align with similar structures on neighboring cell to form gap junction channels . these intercellular channels allow passage of ions , second messengers ( e.g. camp , ca , ip3 ) and other small molecules between cells . connexin 43 ( cx43 ) is by far the most abundantly and widely expressed gap junction protein and its essential role is highlighted by the fact that cx43 knockout mice die hours after birth and present malformations of the conotruncal region of the right ventricle . gap junction intercellular communication through cx43 is critically important in many cell processes including control of cell proliferation ( e.g. , metastatic process ) , embryonic development , cell differentiation and the coordinated contraction of heart and smooth muscle . cx43 is expressed and form gap junction channels in cardiomyocytes , hepatocytes , placental trophoblasts and transiently between immune cells . in the heart , cx43 gap junctions allows spread of the electrical signals from the sinoatrial node across the heart muscle by transmitting the sodium - mediated membrane depolarization signal to neighboring cells allowing the synchronous contraction of many cardiomyocytes at the same time in each heartbeat . in the immune system naturally occurring regulatory t cells ( tregs ) , a sub - population of t lymphocytes with suppressive properties , protect from autoimmune responses to self - antigens by inhibition of effector t cells . one of the suppressive mechanisms involve transfer of camp from naturally occurring regulatory t cells to effector t cells via gap junctions , presumably formed by cx43 which is the connexin in t cells . in human placenta , cytotrophoblasts fuse to form the multinucleated syncytiotrophoblast involved in all the feto - maternal exchanges as well as in the placental hormonal functions . passage of fusogenic signals through cx43 gap junctions is required for trophoblastic cell fusion to proceed . the placental pregnancy hormone , human chorionic gonadotropin ( hcg ) , increased during early stages of pregnancy , signals via g - protein coupled lh receptors leading to intracellular bursts of camp . via pka , finally , changes in gap junction communication involving cx43 is characterized as the earliest alteration linked with malignant transformation in some cancer cells . whereas the n - terminal two - thirds of the cx43 sequence serve to form the pore , the c - terminal cytoplasmic part is more disordered and confers regulation of pore opening and conductivity . mutations in cx43 have been linked to several diseases , including oculodentodigital dysplasia ( oddd ) , atrioseptal defects , arrhythmias and ischemia / reperfusion injury . more than 70 mutations in the cx43 open reading frame have been characterized and linked to oddd . these mutations leading mostly to substitutions in the amino acid sequence localize in the n - terminal two - thirds of the cx43 peptide sequence and are mainly associated with a loss of intercellular communication function . to our knowledge only a single mutation in the c - terminal sequence of the cx43 has been described ( s364p ) , which suggests that mutations in this region , especially if leaving the pore constitutively open , could be lethal in the early stages of the development . taken together , this suggests some selection pressure to conserve the c - terminal part of the cx43 amino acid sequence intact in order to avoid impaired regulation of gap junction communication . as abnormal cx43 gap junction communication between neighboring cells contributes to the development of a set of diseases there is interest to develop therapeutic approaches ( i.e. , gene therapy , peptidomimetics and small molecules ) to modulate cx43 gap junction communication to counteract pathologies associated with an impaired cx43 function . interestingly , it has been described that a down regulation of cx43 or attenuation of gap junction communication in keratinocyte enhances wound closure . conversely , in cardiomyocytes a reduced cx43 gap junction communication ( both electrical and chemical ) triggers arrhythmias after myocardial ischemia . it has been shown that compounds that trigger cx43 intercellular communication prevent the risk of arrhythmias by increasing the conduction velocity . in certain cancers , loss of cx43 associates with progression and cx43 has been defined as a tumor suppressor . enhancement or restoration of cx43 intercellular communication restrains tumor cell growth and potentiates tumor sensitivity to therapy . abnormal cx43 junction communication has also been linked to immunological disorders , placental complications , hearing loss and gastrointestinal diseases . the c - terminal part of cx43 appears to be the region that becomes phosphorylated . several kinases are shown to phosphorylate cx43 on various specific sites with different effects on cx43 behavior . for instance , pka stimulates assembly of gap junction proteins at the cell membrane as well as intercellular communication , whereas pkc abrogates both assembly and communication through gap junctions . ck1 phosphorylation is shown to promote cell communication , while the effects of src and mapk appear to inhibit cx43 channel gating by affecting channel closure . interestingly , a serine to proline conversion at s364 , one of the known pka phosphorylation sites , was first identified as a mutation in a subset of patients with visceral atrial heterotaxia . transfected cells expressing the mutation display altered gap junction properties in response to increased pka activity . moreover , transgenic mice expressing a heart - specific , c - terminally truncated cx43 mutant display constitutively open channels with increased gap junction permeability , altered electrophysiological properties ( susceptibility to arrhythmias ) and larger damaged areas in the heart following myocardial infarction than wild type littermates . we examined whether the hcg- and camp - stimulated cell fusion in primary cultures of human placental cytotrophoblasts required subcellular anchoring of pka to akaps and how this could regulate cell fusion . we proceeded to examine where in the cell fusion process ezrin was working and found that it confers hcg and camp regulation on the opening of gap junctions formed by cx43 . upon local increases in the pool of camp , the phosphorylation of cx43 by pka at a specific site(s ) in the region between amino acid 362 and 379 promotes the opening of the gap junction and allows the passage of signal molecules ( fig . 1 ) . we proceeded to identify a contact site between cx43 and ezrin , map its molecular contacts and decipher the minimal amino acid sequence required for binding of ezrin to cx43 : rpssrassrassrprpdd . interestingly , this sequence overlaps with the pka phosphorylation sites in the c - terminal part of cx43 . the immediate vicinity between the akap docking site and the pka phosphorylation sites in cx43 highlights the importance of the spatial organization of available pka activity to regulate gap junction communication with the necessary kinetics . furthermore , we show that disruption of the cx43-ezrin interaction not only abolish cx43 phosphorylation but also inhibit gap junction flux of tracers . figure 1.cx43 gap junction communication is controlled by pka anchoring through ezrin . ( a ) schematic depiction of a resting state gap junction in trophoblast with cx43 and a compartmentalized pool of pka anchored to ezrin which again is bound to cx43 . ( b ) elevated intracellular camp levels lead to activation of pka and subsequent spatiotemporally controlled phosphorylation of cx43 which promotes the communication through the gap junction . c , catalytic subunit of pka ; p for phosphorylation ; pink dots , molecules of camp . ( a ) schematic depiction of a resting state gap junction in trophoblast with cx43 and a compartmentalized pool of pka anchored to ezrin which again is bound to cx43 . ( b ) elevated intracellular camp levels lead to activation of pka and subsequent spatiotemporally controlled phosphorylation of cx43 which promotes the communication through the gap junction . c , catalytic subunit of pka ; p for phosphorylation ; pink dots , molecules of camp . cx43 shares some of the same phosphorylation sites with other member of the connexins -group ( cx31.9 , cx37 , cx40 , cx43 , cx45 , cx46 , cx46.6 cx50 and cx59 ) but with the exception of cx46 , do not appear to share the essential residue correctly positioned to support the anchoring of ezrin ( r370 ) . based on its important physiological role it has been of interest to design pharmacological tools to module cx43 synthesis , assembly , stabilization or degradation . taking into account that cx43 is by far the most abundant and ubiquitously represented , additional drug design need to be performed to optimize selectivity , tissue specificity and off - target effects . we suggest that the pka - ezrin - cx43 macromolecular complex controlling the gap junction communication constitutes a general mechanism to regulate opening of cx43 gap junctions by phosphorylation and in response to camp . furthermore , targeting the cx43-ezrin interaction site may provide a new method to block opening of cx43 gap junctions . use of cx43-ezrin interaction inhibitors ( such as peptides , peptidomimetics and small molecules ) could inhibit opening of gap junctions for example in cardiomyocytes , regulatory t cells or human placental trophoblasts . we are grateful to pascale gerbaud and danile evain - brion for helpful comments and input on various parts of the work . our work is funded by inserm , the norwegian cancer society , research council of norway , and the k.g jebsen foundation .
anchored protein kinase a ( pka ) bound to a kinase anchoring protein ( akap ) mediates effects of localized increases in camp in defined subcellular microdomains and retains the specificity in camp - pka signaling to distinct extracellular stimuli . gap junctions are pores between adjacent cells constituted by connexin proteins that provide means of communication and transfer of small molecules . while the pka signaling is known to promote human trophoblast cell fusion , the gap junction communication through connexin 43 ( cx43 ) is a prerequisite for this process . we recently demonstrated that trophoblast fusion is regulated by ezrin , a known akap , which binds to cx43 and delivers pka in the vicinity gap junctions . we found that disruption of the ezrin - cx43 interaction abolished pka - dependent phosphorylation of cx43 as well as gap junction communication and subsequently cell fusion . we propose that the pka - ezrin - cx43 macromolecular complex regulating gap junction communication constitutes a general mechanism to control opening of cx43 gap junctions by phosphorylation in response to camp signaling in various cell types .
rapid development has been achieved in the construction of discrete and extended molecular architectures by selfassembly processes.1 such derivatives can be classified as inorganicorganic supramolecular complexes as they are usually obtained from twocomponent reactions involving the coordination of organic ligands bearing n , o , or s donor atoms to lewisacidic inorganic metal cations.[1h ] , 2 due to the lack of p donating connectors and the usual use of simple transitionmetal cations , our group established an alternative approach by utilising organometallic polyphosphorus ( pn ) ligand complexes with flexible coordination modes as connectors between metal ions . by using this novel method , it was possible to synthesize one and twodimensional coordination polymers,3 vast fullerenelike supramolecular spherical aggregates,4 and organometallic nanosized capsules.5 more recently , this concept was extended to threecomponent reactions by using additional bipyridinebased organic linkers in combination with pn ligand complexes and metal ions . organometallicorganic hybrid polymers [ where pnbased organometallic fragments ( nodes ) are linked by organic spacers ] , which could not be obtained from classical twocomponent reactions . for example , the tetrahedrane complex [ cp2mo2(co)4(p2 ) ] ( cp = c5h5 ) ( 1 ) was treated with ag or cu salts in the presence of dipyridylethene to yield unprecedented one , two , and threedimensional organometallicorganic coordination polymers.6 these results motivated us to expand our research field raising the question as to whether it is possible to utilize some other n donor ligands in our reactions . one of those ligands is 2,2bipyrimidine bpym,[7a ] which is a special molecule , because it can act both as a di or tetradentate ligand . the supramolecular chemistry of this molecule has been extensively studied , and its coordination to transition metals afforded a rich library of zero and multidimensional complexes.8 now , however , we have shown that the reaction of the p2 ligand complex 1 with ag[bf4 ] ( 2 ) in the presence of 2,2bipyrimidine bpym ( 3 ) allows access to the two polymeric networks 4 and 5 , with the latter representing a unique organometallicinorganicorganic hybrid network . a variety of heterometallic metallacycles were synthesized by jin et al . by linking a simple organometallic moiety and a metal cation with organic linkers.[7b ] , [ 7c ] however , to the best of our knowledge , no extended hybrid networks with mixed complexed organometallic and inorganic nodes linked by organic spacers have been reported yet ( scheme 1 ) . reaction of 1 with ag[bf4 ] ( 2 ) and bpym ( 3 ) , synthesis of twodimensional hybrid polymers 4 and 5 , and schematic illustration of nodes and connectors . in a first step , attention was focused on the reaction of the p2 ligand complex 1 with the silver salt 2 and the bpym linker 3 in a 1:1:1 stoichiometric ratio in a mixture of ch2cl2/ch3cn at room temperature . this reaction afforded , after crystallization , two compounds 4 and 5 as orange crystals suitable for xray diffraction studies . the structures obtained from xray diffraction analysis performed on single crystals of 4 and 5 revealed that compound 4 is a novel twodimensional organometallicorganic hybrid polymer with ag2(1)2 organometallic nodes connected to each other by bpym linker molecules ( scheme 1 , figure 1 ) . furthermore , derivative 5 outlines a new class of twodimensional coordination polymers composed of inorganic agcontaining and organometallic ag2(1)2comprising nodes that are connected to each other by organic bpym linkers ( scheme 1 , figure 2 ) . cp and co ligands , hydrogen atoms and counterions are omitted for clarity . within the organometallic nodes of 4 , the two p2 ligands are coordinated to the silver ions by a frequently observed bridging : coordination mode . in addition , four bpym molecules are also coordinated to those silver ions , each by two n atoms . as a consequence , each silver ion in 4 possesses a distorted octahedral coordination sphere consisting of two p atoms and four n atoms ( figure 1 ) . p bond in derivative 4 [ 2.0925(11 ) ] is slightly elongated compared to that of the noncoordinated ligand 1 [ 2.079(6 ) ] . the ag p bonds [ 2.5795(8)2.6040(8 ) ] are slightly elongated compared to those of similar hybrid polymers previously reported.[6a ] the agag distance is long ( 5.480 ) revealing no argentophilic interactions.9 the ag2p4 sixmembered motifs in 4 are nearly planar ( folding angle 0.04 ) . the organometallic nodes in 4 form the vertices of a 2d network with cavities having circular meshes of a maximum diameter of 1.36 nm ( figure 1b ) . in derivative 5 , each repeating unit is composed of one ag2(1)2 organometallic fragment ( organometallic node ) and two ag ions ( inorganic nodes ) connected to each other by bpym spacers ( figure 2a ) . each organometallic node in 5 consists of two silver atoms to which two p2 ligands are coordinated in a very rare bridging : coordination mode ( figure 2b).10 in addition , two bpym molecules are also coordinated to the silver atoms , each by two of its n atoms . as a consequence , each silver ion within those organometallic nodes p bond in 5 [ 2.151(2 ) ] is slightly elongated compared to that of the noncoordinated ligand 1 [ 2.079(6 ) ] and ligand 1 in compound 4 . the ag p bond lengths [ 2.555(2)2.630(2 ) ] vary within a wider range compared to those of complex 4 . the agag distance is short [ 2.939(1 ) ] suggesting argentophilic interaction.9 the ag2p4 sixmembered motifs in the organometallic nodes of 5 are less planar than in 4 ( folding angle 6.60 ) . each organometallic node is connected to two 1d ribbonlike inorganicorganic fragments ( figure 2b ) . those 1d fragments are composed each of silver ions ( nodes ) linked by organic bpym connectors . each of those silver ions possesses a distorted octahedral coordination sphere with six coordinated n atoms of three bpym molecules . two of those bpym molecules are a part of the 1d fragments , while the third one links the 1d fragment to one ag2(1)2 organometallic node . in complex 5 , the inorganic ag nodes within the 1d fragments form the vertices of a 2d network with cavities having a hexagonal shape of a maximum diameter of 2.22 nm . it is worth noting that in the solid state packing of both 4 and 5 no solvent molecules are observed . in addition , all bf4 counteranions are located outside the selfassembled structures . regardless of several attempts , the new products 4 and 5 could not be separated from each other because of similar colour and solubility . both compounds are well soluble in donor solvents like ch3cn , but insoluble in other common organic solvents like ch2cl2 , thf and npentane . their roomtemperature p nmr spectrum in cd3cn shows a broad signal centered at = 79.1 ppm , which is upfield shifted compared to that of the free p2 ligand complex 1 ( = 43.2 ppm).11 their roomtemperature h and c nmr spectra present simple sets of signals revealing all expected signals corresponding to the protons andcarbon atoms of ligand 1 and the bpym linker 3 . the f nmr spectrum features two signals centered at 150.5 and 150.6 ppm , corresponding to the bf4 counteranions ( see the supporting information ) . in the mass spectrum , only fragments of ag2(1)2 together with a bpym linker are found , revealing like the nmr data the depolymerisation of the aggregates in donor solvents . the presented results contribute to a new direction in the area of metallosupramolecular chemistry in which the synthesis of coordination polymers composed by organometallic and inorganic those polymers are obtained by simply mixing ag[bf4 ] , bpym linker and a p2 ligand complex under ambient reaction conditions . the described synthesis opens the door to a novel class of coordination compounds for which compound 5 has been found as a first example . here , the combination of organometallic and inorganic nodes ( both containing transition metal coordination centers ) linked by organic molecules was found for the first time resulting in a 2d organometallicinorganicorganic hybrid network . it further shows the advantage of our approach using threecomponent reactions over the classical twocomponent reactions approach with metal ions and organic linkers . taking into consideration that supramolecular aggregation reactions are usually sensitive to reaction conditions,12 current studies involve similar threecomponent reactions with careful optimization of the reaction conditions for the selective synthesis of hybrid general : all experiments were performed under dry argon using standard schlenk techniques . the compounds 2,2bipyrimidine ( 3 ) and silver tetraflouroborate ( 2 ) were purchased from alfa aesar and sigmaaldrich , respectively , and used as received without further purification . the ligand complex [ cpmo2(co)4(p2 ) ] ( 1 ) was synthesized according to a literature procedure.13 solvents were freshly distilled under argon from cah2 ( ch2cl2 , ch3cn ) and from na / k alloy ( npentane ) . h , c , p and f nmr spectra were recorded with a bruker avance 300 spectrometer . h and c nmr chemical shifts are reported in parts per million ( ppm ) relative to me4si as external standard . p nmr chemical shifts are expressed in ppm relative to external 85 % h3po4 and were decoupled from the proton . f nmr chemical shifts are reported relative to cfcl3 . for the esi mass spectra a finnigan thermoquest synthesis and nmr characterization of complexes 4 and 5 : a solution of equimolar amounts of ag[bf4 ] ( 2 ; 0.040 g , 0.20 mmol ) , [ cp2mo2(co)4(p2 ) ] ( 1 ; 0.100 g , 0.20 mmol ) and bpym ( 3 ; 0.032 g , 0.20 mmol ) in a 1:1 mixture of ch2cl2 ( 10 ml)/ch3cn ( 10 ml ) was stirred at room temperature for 3 h. the reaction mixture was filtered using a teflon capillary to remove any suspended particles , and the obtained solution was layered with the same amount of npentane and kept at room temperature . after 1 week , orange crystals of 4 and 5 had formed . the crystals were isolated together by decantation of the overlaying solution , washed two times with npentane ( 2 ml ) , and subsequently dried at reduced pressure . h nmr ( 300 mhz , cd3cn , 25 c ) : = 5.36 ( s , 5 h , c5h5 ) , 7.70 ( t , j hh = 4.9 hz , 2 h , hbpym ) , 9.04 ( d , j hh = 4.9 hz , 4 h , 4 h , hbpym ) ppm . c{h } nmr ( 75.47 mhz , cd3cn , 25 c ) : = 88.1 ( s , c5h5 ) , 124.1 ( s , chbpym ) , 159.7 ( s , chbpym ) , 160.7 ( s , cbpym ) , 224.6 ( cco ) ppm . p{h } nmr ( 121.49 mhz , cd3cn , 25 c ) : = 79.1 ( s , 1/2 = 13.9 hz ) ppm . f{h } nmr ( 282.40 mhz , cd3cn , 25 c ) : = 150.6 ( s , bf4 ) , 150.5 ( s , bf4 ) ppm . esims ( ch3cn ) : m / z ( % ) = 1452.7 ( 1 ) [ ag2{cp2mo2(co)4p2}2(c8h6n4)(bf4 ) ] , 1100.6 ( 4 ) [ ag{cp2mo2(co)4p2 } ] , 760.9 ( 45 ) [ ag{cp2mo2(co)4p2}(c8h6n4 ) ] , 732.8 ( 12 ) [ ag{cp2mo2(co)4p2}(c8h6n4)co ] , 704.8 ( 20 ) [ ag{cp2mo2(co)4p2}(c8h6n4 ) 2 co ] , 676.8 ( 6 ) [ ag{cp2mo2(co)4p2}(c8h6n4 ) 3 co ] , 643.7 ( 10 ) [ ag{cp2mo2(co)4p2}(ch3cn ) ] , 422.9 ( 5 ) [ ag(c8n6n4)2 ] , 305.9 ( 100 ) [ ag(c8n6n4)(ch3cn ) ] , 264.9 ( 21 ) [ ag(c8n6n ) ] . singlecrystal xray crystallography : all diffraction experiments were performed at 123 k. the data sets were collected with a rigaku ( formerly : agilent technologies or oxford diffraction ) supernova diffractometer using cuk radiation . the structure solution and refinement were done with shelx.14 the h atoms were calculated geometrically , and a riding model was used during the refinement process . graphical material was created with olex2.15 ccdc 1483826 ( for 4 ) , and 1483827 ( for 5 ) contain the supplementary crystallographic data for this paper . these data can be obtained free of charge from the cambridge crystallographic data centre . supporting information ( see footnote on the first page of this article ) : crystallographic data ( table s1 ) .
the threecomponent reaction of the tetrahedral diphosphorus complex [ cp2mo2(co)4(2p2 ) ] ( 1 ) , with ag[bf4 ] ( 2 ) in the presence of 2,2bipyrimidine ( 3 ) leads to the formation of the two novel twodimensional networks 4 and 5 . compound 4 is a new twodimensional organometallicorganic hybrid polymer , while derivative 5 represents a unique twodimensional organometallicinorganicorganic hybrid polymer . these results show the possibility of synthesizing a new class of coordination polymers , which could not be obtained from twocomponent reactions with organic molecules in addition of metal ions .
dementia causes a high burden of suffering for patients and their families ( boustani et al 2003a ) . for patients , in addition to cognitive and functional deterioration , dementia leads to behavioral and psychological complications , increased use of health and social services , complicated clinical management of other comorbid conditions , and increased risk for medical complications such as delirium , falls , motor vehicle crashes , incontinence , fractures , and infections . for family caregivers , dementia can lead to higher levels of anxiety , depression , use of psychotropic medications , sleep problems , and chronic fatigue ( boustani et al 2003a ) ( see table 1 ) . in 2003 , dementia constituted 11% of total years lived with disability in people aged 60 years and older . this is more than cancer , stroke or cardiovascular disease ( ferris et al 2005 ) . currently , medicare recipients with dementia account for 34% of medicare spending , even though they constitute only 13% of the total medicare beneficiaries . by 2050 , medicare will be spending over $ 1 trillion on beneficiaries with this syndrome ( the lewin group , 2004 ) . the majority of patients with dementia receive their care within a primary care system ( boustani et al 2005 ; callahan et al 2006 ) . in this health care setting , dementia prevalence is 2% among patients aged 65 to 69 years , 7% among those aged 70 to 79 years , and 17% among older adults aged 80 and older ( boustani et al 2005 ) . research studies found that less than a third of these patients are recognized by the primary care system as having dementia ( boustani et al 2003a , 2005 ) . patients with dementia suffer from numerous chronic medical conditions , receive multiple prescriptions including psychotropic drugs , display a wide range of behavioral and psychological symptoms , and extensively utilize the health care system ( boustani et al 2003a ; callahan et al 2006 ; schubert et al 2006 ) ( see table 2 ) . more than 20% of these patients with dementia are exposed to at least one definite anticholinergic medication and less than 10% are prescribed cholinesterase inhibitors ( schubert et al 2006 ) . unfortunately , the complicated medical and psychiatric needs of demented patients affect not only their own care but also the health of their informal caregivers ( guerriero austrom et al 2004 ; callahan et al 2006 ; schubert et al 2006 ) . thus , enhancing the primary care of patients with dementia will require additional financial , educational and social resources ( boustani et al 2005 ; callahan et al 2006 ) . dementia is characterized by a complex interaction of cognitive , functional , behavioral and psychological symptoms that decrease the quality of life for both the patient and the caregiver . the scope of such integrated management must include pharmacological therapies and psychosocial interventions that target the entire spectrum of dementia symptomatology . an efficacious management would most likely stabilize or slow the cognitive decline ; stabilize or prevent additional functional disability ; and decrease the severity or delay the emergence of behavioral and psychological symptoms of dementia ( bpsd ) ( see table 3 ) . to date , the united states federal drug agency ( fda ) and the european union drug evaluation agency have approved two classes of medications for the treatment of ad , cholinesterase inhibitors ( cheis ) ( donepezil , rivastigmine , galantamine ) and a nmda receptor antagonist ( memantine ) . recently , the two agencies approved the use of rivastigmine , a chei , for patients with parkinson disease dementia . cheis are generally considered the first line treatment , especially in mild dementia . in comparison to placebo , 6-month therapy with a chei has demonstrated statistically significant positive effects on cognition ( boustani , m et al 2003a ; 2003b ) . the level of improvement shown was approximately equivalent to a 5- to 10-month delay in the progression of the disease . memantine is approved for the treatment of patients with moderate to severe ad ( mini mental status examination < 18 ) . in comparison to placebo , memantine produces a similar effect to cheis on patients cognition with a mean difference of 4 points on the severe impairment battery ( sib ) ( sib range is 0 to 100 points ) ( areosa sastre a et al 2006 ) . moreover , memantine has also been evaluated as an add - on ( combined ) therapy to cheis among patients with moderate to severe dementia and has led to a significant cognitive difference of 3 points on the sib ( areosa sastre et al 2006 ) . treatment with cheis and memantine may , however , lead to adverse effects such as nausea , vomiting , and diarrhea for cheis and headache , confusion and constipation for memantine ( boustani m et al 2003a , 2003b ; areosa sastre a et al 2006 ) . since there is a lack of universally accepted measures to evaluate the impact of cheis and memantine on the functional performance of patients with ad and other dementias , it is difficult to appreciate the day to day impact of these medications on functional disability . in general , the effect of chei and memantine on daily function appears minimal ( boustani et al 2003a , 2003b ; livingston and katona 2004 ; areosa sastre et al 2006 ) . however , using time to functional decline as an outcome measure and in comparison to placebo , donepezil demonstrated a 5-month delay in such a decline ( boustani et al 2003a , 2003b ) . furthermore , 34% of patients with moderate to severe ad did not decline functionally after 6 months of treatment with memantine versus 20% of those receiving placebo ( livingston and katona 2004 ) . the non - cognitive behavioral and psychological symptoms in dementia ( bpsd ) can be defined as verbal , vocal , or motor behavior that is inappropriate for the setting , and reflects inadequate ability to cope with internal and/or environmental stressors . more than 90% of patients with dementia will experience bpsd at some point during the course of their illness ( finkel et al 2000 ) . aggression is the most serious symptom and seems to be present in 30% of patients with dementia attending primary care clinics ( haupt et al 2000 ) . the current management of aggression is , at best , moderately successful , even in controlled trials . one reason for the limited effectiveness of aggression management is the current focus on pharmacologic interventions used in the setting of an acute crisis . the traditional pharmacological management of bpsd in general and aggression in particular includes the use of typical and atypical neuroleptics , antidepressants , anticonvulsants , hypnotics , and cheis . however , these pharmacologic interventions have not been approved by the fda for such therapy , their efficacy is limited , and they produce numerous side effects ( schneider et al 2005 ; sink et al 2005 ; schneider et al 2006 ) . neuroleptics in particular can lead to the development of extra - pyramidal signs , gait abnormalities , sedation , increased incidence of cerebrovascular events , and higher mortality rates ( schneider et al 2005 , 2006 ; sink et al 2005 ) . to date , the united states federal drug agency ( fda ) and the european union drug evaluation agency have approved two classes of medications for the treatment of ad , cholinesterase inhibitors ( cheis ) ( donepezil , rivastigmine , galantamine ) and a nmda receptor antagonist ( memantine ) . recently , the two agencies approved the use of rivastigmine , a chei , for patients with parkinson disease dementia . cheis are generally considered the first line treatment , especially in mild dementia . in comparison to placebo , 6-month therapy with a chei has demonstrated statistically significant positive effects on cognition ( boustani , m et al 2003a ; 2003b ) . the level of improvement shown was approximately equivalent to a 5- to 10-month delay in the progression of the disease . memantine is approved for the treatment of patients with moderate to severe ad ( mini mental status examination < 18 ) . in comparison to placebo , memantine produces a similar effect to cheis on patients cognition with a mean difference of 4 points on the severe impairment battery ( sib ) ( sib range is 0 to 100 points ) ( areosa sastre a et al 2006 ) . moreover , memantine has also been evaluated as an add - on ( combined ) therapy to cheis among patients with moderate to severe dementia and has led to a significant cognitive difference of 3 points on the sib ( areosa sastre et al 2006 ) . treatment with cheis and memantine may , however , lead to adverse effects such as nausea , vomiting , and diarrhea for cheis and headache , confusion and constipation for memantine ( boustani m et al 2003a , 2003b ; areosa sastre a et al 2006 ) . since there is a lack of universally accepted measures to evaluate the impact of cheis and memantine on the functional performance of patients with ad and other dementias , it is difficult to appreciate the day to day impact of these medications on functional disability . in general , the effect of chei and memantine on daily function appears minimal ( boustani et al 2003a , 2003b ; livingston and katona 2004 ; areosa sastre et al 2006 ) . however , using time to functional decline as an outcome measure and in comparison to placebo , donepezil demonstrated a 5-month delay in such a decline ( boustani et al 2003a , 2003b ) . furthermore , 34% of patients with moderate to severe ad did not decline functionally after 6 months of treatment with memantine versus 20% of those receiving placebo ( livingston and katona 2004 ) . the non - cognitive behavioral and psychological symptoms in dementia ( bpsd ) can be defined as verbal , vocal , or motor behavior that is inappropriate for the setting , and reflects inadequate ability to cope with internal and/or environmental stressors . more than 90% of patients with dementia will experience bpsd at some point during the course of their illness ( finkel et al 2000 ) . aggression is the most serious symptom and seems to be present in 30% of patients with dementia attending primary care clinics ( haupt et al 2000 ) . the current management of aggression is , at best , moderately successful , even in controlled trials . one reason for the limited effectiveness of aggression management is the current focus on pharmacologic interventions used in the setting of an acute crisis . the traditional pharmacological management of bpsd in general and aggression in particular includes the use of typical and atypical neuroleptics , antidepressants , anticonvulsants , hypnotics , and cheis . however , these pharmacologic interventions have not been approved by the fda for such therapy , their efficacy is limited , and they produce numerous side effects ( schneider et al 2005 ; sink et al 2005 ; schneider et al 2006 ) . neuroleptics in particular can lead to the development of extra - pyramidal signs , gait abnormalities , sedation , increased incidence of cerebrovascular events , and higher mortality rates ( schneider et al 2005 , 2006 ; sink et al 2005 ) . complex adaptive system ( cas ) is an open , dynamic and flexible network that is considered complex due to its composition of numerous interconnected , semi - autonomous , competing and collaborating members ( mcdaniel et al 2003 ; stoebel et al 2005 ) . the members of cas can be individuals , teams , functional groups , social institutions , or organizational processes . the cas is considered adaptive due to its capability of learning from its previous experiences and its flexibility to accommodate change in the connecting pattern of its members ( mcdaniel et al 2003 ; stoebel et al 2005 ) . cas is characterized ( see table 4 ) by emergent behaviors as opposed to predetermined ones and self - organized control instead of hierarchical pyramid - based central control ( mcdaniel et al 2003 ; stoebel et al 2005 ) . health care delivery organizations such as primary care clinics are an example of cas ( stroebel et al 2005 ) . these clinics usually include administrative assistants , clinic managers , nursing staff , clinical providers , billing specialists and other individuals who each bring their own perspectives , skills , experiences , and goals to patient care . these clinic members interact constantly in a nonlinear way and are continually faced with external and internal changes , such as patient s medical status , insurance requirements , regulations , new research findings , member turnover and legal issues . primary care clinics have been described as complex adaptive systems with local critical nonlinear relationships that produce unpredictable behavioral patterns or dynamics ( mcdaniel et al 2003 ; stoebel et al 2005 ) . any attempt to rigidly control this cas may increase problems by paralyzing the members ability to learn and take action to affect outcomes ( mcdaniel et al 2003 ; stoebel et al 2005 ) . although the current system of primary care does not have the resources to provide the appropriate diagnosis , evaluation , education , and complex management required for patients with dementia ( gueerriero austrom et al 2004 ; boustani et al 2005 ; callahan et al 2006 ; schubert et al 2006 ) , understanding primary care clinics as a cas may enhance our capacity to develop a flexible process of minimally standardized approaches to assess and manage patients with dementia . such a process would have the best probability of surviving the unknowable future challenges that will face these primary care clinics . over the past decade , indiana university center for aging research used the lens of cas to develop such a collaborative and minimally standardized approach to assess and manage patients with dementia within a primary care system called prevent - memory loss ( boustani et al 2005 ; callahan et al 2006 ; guerriero austrom et al 2004 ) . the efficacy of prevent program was evaluated in a randomized controlled trial that enrolled 153 older adults with alzheimer disease and included their caregivers ( callahan et al 2006 ) . the prevent program included the following minimally specified components : ( 1 ) dementia care manager ( dcm ) ; ( 2 ) electronic tracking of patients status ; ( 3 ) interdisciplinary dementia management resources ; ( 4 ) collaborative work with the patients primary care provider ; and ( 5 ) caregiver support ( see figure 1 ) . the patients were enrolled in prevent via a screening and diagnosis program for all patients aged 65 and older presenting to their primary care physician with or without dementia related symptoms . the dcm provided each dyad of patient and caregiver with educational material related to the nature of alzheimer disease and community resources . this dcm trained the patient s caregiver in problem solving skills related to patients functional disability and behavioral and psychological symptoms ; the dcm was also available to the caregivers over the phone or for face - to - face visits at the primary care clinic or the patient s home for any dementia related crisis , such as aggressive behaviors and caregiver burden . moreover , the dcm coordinated a monthly care - giver support meeting that included an exercise program for the patients . in addition to consideration for enhancing the patient s cholinergic system via stopping any definite anticholinergic medication and initiating treatment with cholinesterase inhibitors , the prevent interdisciplinary resource team developed standard pharmacological and non - pharmacological protocols to identify , monitor , and treat behavioral and psychological symptoms of dementia ( guerriero austrom et al 2004 ) . in comparison to patients randomized to the usual care , prevent patients had significantly fewer bpsd ( 43% vs 71% with p < 0.05 ) ( callahan et al 2006 ) . such improvement in bpsd was not related to higher use of neuroleptics ( 13% vs 7% , p = 0.3 ) or sedatives ( 10% vs 9.5% , p = 1.0 ) . however , prevent patients were more likely to receive cheis ( 80% vs 55% , p < 0.01 ) and antidepressants ( 45% vs 28% , p < 0.05 ) . despite its impact on bpsd and caregiver stress , prevent program did not affect the patients cognition , activities of daily living , or rates of hospitalization , nursing home placement or death . the management of patients with dementia in primary care is a challenge to our current health care delivery . redesigning our health care system using the lens of cas to accommodate a program such as prevent would address this challenge . healthcare delivery programs such as prevent enhance the current primary care system by integrating a dementia recognition process within a dementia management system . to succeed , this program must be coordinated by a clinician liaison trained in dementia management and supported with access to community resources and interdisciplinary specialists in dementia care , such as geriatricians , geriatric psychiatrists , geriatric neurologists and geriatric psychologists .
most patients with dementia receive care within primary care systems and have challenging medical and psychiatric issues . their dementia related symptoms are often not recognized by the primary care system ; they suffer from multiple chronic medical conditions ; receive numerous psychotropic medications including anticholinergics ; and display clinically relevant behavioral and psychological symptoms . improving the care for such vulnerable patients demands supporting the primary care system with various resources , including dementia care managers , access to and coordination with interdisciplinary dementia specialists , and a feasible dementia screening and diagnosis process.understanding primary care clinics as a complex adaptive system may enhance our capacity to deliver a flexible supportive process using the above crucial resources to adequately assess and effectively manage patients with dementia . such a complex adaptive system process would have the best probability of surviving the unknowable future challenges that will face the primary care system .
traditional healers play an important role in health care delivery system , particularly for the primary health care , in rural parts of india . many of these traditional herbal health practices are popular among the community and claimed to be effective . however , most of these formulations are not scientifically studied for their safety and efficacy . hence , there is a need to evaluate the safety and therapeutic potentials of these formulations . this formulation is being used for the treatment of spasmodic abdominal pain in rural communities of northern karnataka , especially in gokak and hukkeri talukas in belgaum district of karnataka in india . local traditional practitioners claim that , the formulation is safe and effective in relieving abdominal pain . after detailed discussion with the practitioners , regarding the signs and symptoms of the pain , it was speculated that the formulation might be possessing anticholinergic / antihistaminic activity . several reports are available on chemical components and biological activities of the ingredients in the formulation . ( acanthaceae ) , locally known as nelabevu and is mentioned in various ayurvedic formulations for the treatments of fever , expectorant , diarrhea and inflammatory diseases . its various extracts have been studied for antipyretic , anti - ulcerogenic , analgesic , antioxidant and anti - inflammatory activities . the plant is also reported for hepatoprotective , anti - hyperglycemic and renal protective activities . cassia fistula l. ( caesalpiniaceae ) is the other plant in the formulation , which is known as kakke . in ayurveda , aragvadhadi kvatha churna is an important formulation mentioned in ayurveda , in which c. fistula is a major ingredient . the hepatoprotective , hypoglycemic , antitussive and anti - inflammatory activities are reported for the plant . the third plant , foeniculum vulgare mill . , ( apiaceae ) , commonly known as badesop , contains trans - anethole as its major component . indian pharmacopoeia of ayurveda suggest its uses for various ailments such as shoola , agnimandya , kasa , pravahika and raktadosha . the aqueous extract of f. vulgare has been reported for its anti - ulcerogenic activity . analgesic , anti - inflammatory and antioxidant activities are also reported for various extracts of the plant . the fourth ingredient of the formulation is cuminum cyminum l. ( apiaceae ) , known in local language as jeerige . c. cyminum l. mentioned in ayurveda for agnimandya , atisara , and krimiroga . hingvadi curna , jirakadyarista , jirakadimodaka , hinguvacadi curna are the popular formulations comprising this plant . the reported major chemical components from the plant were a - pinene , 1 , 8-cineole , cuminol , cuminic alcohol , -terpinene , safranal , p - cymene and -pinene . the oil from c. cyminum has been reported for analgesic effect , while aqueous extract of the plant is reported for relaxant activity in guinea pig tracheal chain model . however , no reports are available on antispasmodic activity of the formulation as a whole , which is being used in the community for several generations . the present study was , therefore , undertaken to evaluate the safety and efficacy of the formulation . the selected traditional practitioners were frequently visited and interviewed to get the details on disease , diagnosis , treatment , formulation and proportions of the ingredients , method of preparation , mode of administration etc . the plants incorporated in the formulation , that is , a. paniculata nees . c. fistula l. , f. vulgare mill . and c. cyminum l. were authenticated . their voucher specimens were deposited in the herbaria at regional medical research centre ( icmr ) , belgaum . these specimens are numbered as rmrc-0007 , 432 , 501 and rmrc 500 respectively . the parts of medicinal value from the plants were collected with the help of traditional practitioners . the method of preparation was standardized in consultation with the traditional practitioners . in the practice , 2 tsf of this mixture is given orally , early in the morning for 1-week . the coarse powders of a. paniculata stem ( 1.57 g ) , c. fistula stem bark ( 3.16 g ) , f. vulgare seeds ( 2.3 g ) were mixed with c. cyminum seeds ( 2.4 g ) . as there are no models available to evaluate the spasmolytic activity of the powdered material directly , the water extract of this formulation was prepared using cold maceration . the powder prepared is mixed thoroughly with 250 ml of distilled water for 7 days at room temperature with daily muddling up . the supernatant water was carefully decanted on 8 day and was used for the experiments . histamine and acetylcholine were procured from sigma - aldrich chemical co. calcium chloride ( cacl2 ) , magnesium sulfate , sodium chloride ( nacl ) , dextrose , sodium hydrogen carbonate ( nahco3 ) , potassium chloride ( kcl ) and sodium dihydrogen phosphate ( nah2po4 ) were procured from local supplier . guinea pigs of either sex weighing between 300 and 500 g were procured from shri venkteshwara traders , bengaluru , india . they were housed in galvanized cages under standard conditions ( temperature 25c 3c , relative humidity 5060% and natural light and dark cycle ) . the animals were fed with a balanced diet formulated in the department ( cauliflower , cabbage , gram and wheat flour ) and water was available ad libitum . the study was approved by institutional animal ethics committee , as per the guidelines of committee for the purpose of control and supervision of experiments on animals . a single dose ( 2000 mg / kg body weight ) of herbal formulation was administered next day , between 10:00 and 11:00 am and the animals were observed as per organization for economic co - operation and development ( oecd ) guideline 4232002 . overnight fasted ( with free access of tap water ) guinea - pigs of both sexes were sacrificed with halothane over anesthesia . the terminal portions , of about 1020 mm in length , were taken after discarding the portion nearest to the ileocecal - junction . the intestinal content was eliminated by washing with tyrode solution ( composition nacl 136.9 ; kcl 2.7 ; cacl2 1.3 ; nahco3 11.9 ; mgcl2 1.1 ; nah2po4 0.4 and glucose 5.6 ) as prescribed by jabeen et al . 1.5 cm ileum tissue was mounted in 15 ml organ bath containing tyrode solution at 37c , continuously bubbled with air . effect of acetylcholine and histamine , in a single dose ( 1 g ) , was recorded individually in the absence of herbal formulation . similarly , effect of herbal formulation ( 0.5 ml ) alone was tested in the absence of both acetylcholine and histamine . the test with a single dose of acetylcholine was repeated after wash period to confirm the tissue response . the tissue response for combination of herbal formulation ( 0.5 ml ) and acetylcholine ( 1 g ) was recorded , followed by the test with a single dose of acetylcholine . tissue response for a single dose of histamine was recorded , and test was conducted with a combination of herbal formulation ( 0.5 ml ) and histamine ( 1 g ) . finally histamine , in a single dose , was tested again to confirm the tissue response . all the tests were carried out twice , and the washing was repeated before each test . the percent of ileum relaxation induced by herbal formulation was calculated by assuming the contraction induced by spasmogens ( acetylcholine and histamine ) as 100% . the ileum relaxation or contraction was expressed as mean standard error of the mean ( sem ) results were analyzed using one - way anova and bonferroni post - hoc test by considering p 0.05 as significant . the selected traditional practitioners were frequently visited and interviewed to get the details on disease , diagnosis , treatment , formulation and proportions of the ingredients , method of preparation , mode of administration etc . the plants incorporated in the formulation , that is , a. paniculata nees . c. fistula l. , f. vulgare mill . and c. cyminum l. were authenticated . their voucher specimens were deposited in the herbaria at regional medical research centre ( icmr ) , belgaum . these specimens are numbered as rmrc-0007 , 432 , 501 and rmrc 500 respectively . the parts of medicinal value from the plants were collected with the help of traditional practitioners . the method of preparation was standardized in consultation with the traditional practitioners . in the practice , 2 tsf of this mixture is given orally , early in the morning for 1-week . the coarse powders of a. paniculata stem ( 1.57 g ) , c. fistula stem bark ( 3.16 g ) , f. vulgare seeds ( 2.3 g ) were mixed with c. cyminum seeds ( 2.4 g ) . as there are no models available to evaluate the spasmolytic activity of the powdered material directly , the water extract of this formulation was prepared using cold maceration . the powder prepared is mixed thoroughly with 250 ml of distilled water for 7 days at room temperature with daily muddling up . the supernatant water was carefully decanted on 8 day and was used for the experiments . histamine and acetylcholine were procured from sigma - aldrich chemical co. calcium chloride ( cacl2 ) , magnesium sulfate , sodium chloride ( nacl ) , dextrose , sodium hydrogen carbonate ( nahco3 ) , potassium chloride ( kcl ) and sodium dihydrogen phosphate ( nah2po4 ) were procured from local supplier . guinea pigs of either sex weighing between 300 and 500 g were procured from shri venkteshwara traders , bengaluru , india . they were housed in galvanized cages under standard conditions ( temperature 25c 3c , relative humidity 5060% and natural light and dark cycle ) . the animals were fed with a balanced diet formulated in the department ( cauliflower , cabbage , gram and wheat flour ) and water was available ad libitum . the study was approved by institutional animal ethics committee , as per the guidelines of committee for the purpose of control and supervision of experiments on animals . a single dose ( 2000 mg / kg body weight ) of herbal formulation was administered next day , between 10:00 and 11:00 am and the animals were observed as per organization for economic co - operation and development ( oecd ) guideline 4232002 . overnight fasted ( with free access of tap water ) guinea - pigs of both sexes were sacrificed with halothane over anesthesia . the terminal portions , of about 1020 mm in length , were taken after discarding the portion nearest to the ileocecal - junction . the intestinal content was eliminated by washing with tyrode solution ( composition nacl 136.9 ; kcl 2.7 ; cacl2 1.3 ; nahco3 11.9 ; mgcl2 1.1 ; nah2po4 0.4 and glucose 5.6 ) as prescribed by jabeen et al . 1.5 cm ileum tissue was mounted in 15 ml organ bath containing tyrode solution at 37c , continuously bubbled with air . effect of acetylcholine and histamine , in a single dose ( 1 g ) , was recorded individually in the absence of herbal formulation . similarly , effect of herbal formulation ( 0.5 ml ) alone was tested in the absence of both acetylcholine and histamine . the test with a single dose of acetylcholine was repeated after wash period to confirm the tissue response . the tissue response for combination of herbal formulation ( 0.5 ml ) and acetylcholine ( 1 g ) was recorded , followed by the test with a single dose of acetylcholine . tissue response for a single dose of histamine was recorded , and test was conducted with a combination of herbal formulation ( 0.5 ml ) and histamine ( 1 g ) . finally histamine , in a single dose , was tested again to confirm the tissue response . all the tests were carried out twice , and the washing was repeated before each test . the percent of ileum relaxation induced by herbal formulation was calculated by assuming the contraction induced by spasmogens ( acetylcholine and histamine ) as 100% . the ileum relaxation or contraction was expressed as mean standard error of the mean ( sem ) results were analyzed using one - way anova and bonferroni post - hoc test by considering p 0.05 as significant . there was no mortality over a period of observation for 14 days in animals treated with a single dose of 2000 mg / kg . there were no other signs of toxicity and adverse effects . the results of contraction and relaxation are expressed in mm ( millimeter ) and represented as mean sem [ table 1 ] . the herbal formulation reduced the ileum contraction induced by histamine and acetylcholine agonists [ figure 1 ] . the significant decrease ( p < 0.01 ) was observed in histamine with herbal formulation ( 26.01 3.53 ) , compared to histamine alone ( 53.38 8.29 ) . similar significant decrease ( p < 0.05 ) was observed also in acetylcholine with herbal formulation ( 20.83 4.24 ) , compared to acetylcholine alone ( 44.38 4.84 ) . the herbal formulation alone did not showed any changes ( contraction / relaxation ) in the tissue . changes in treated and nontreated ileum contraction / relaxation effect of herbal formulation on ileum contraction . * p < 0.05 , * * p < 0.01 . hista : histamin , hista + hf : histamin + herbal formulation , ach : acetylcholine , ach + hf : acetylcholine + herbal formulation there was no mortality over a period of observation for 14 days in animals treated with a single dose of 2000 mg / kg . there were no other signs of toxicity and adverse effects . the results of contraction and relaxation are expressed in mm ( millimeter ) and represented as mean sem [ table 1 ] . the herbal formulation reduced the ileum contraction induced by histamine and acetylcholine agonists [ figure 1 ] . the significant decrease ( p < 0.01 ) was observed in histamine with herbal formulation ( 26.01 3.53 ) , compared to histamine alone ( 53.38 8.29 ) . similar significant decrease ( p < 0.05 ) was observed also in acetylcholine with herbal formulation ( 20.83 4.24 ) , compared to acetylcholine alone ( 44.38 4.84 ) . the herbal formulation alone did not showed any changes ( contraction / relaxation ) in the tissue . changes in treated and nontreated ileum contraction / relaxation effect of herbal formulation on ileum contraction . * p < 0.05 , * * p < 0.01 . hista : histamin , hista + hf : histamin + herbal formulation , ach : acetylcholine , ach + hf : acetylcholine + herbal formulation the herbal formulation showed significant inhibition in the amplitude of spontaneous contraction of guinea pig ileum . results showed that the herbal formulation is capable of inhibiting acetylcholine and histamine - induced contractions . the current study also demonstrated that the herbal formulation has neither relaxing nor contracting effect on ileum ; it antagonizes the effect of spasmogens such as acetylcholine and histamine . among the ingredients of the present formulation , only c. cyminum has been reported to possess relaxant like activity in guinea pig tracheal chain tissue . however , no such reports were available for the other ingredients . the observed antagonism against the spasmogens suggests that the spasmodic action of the formulation was produced by all ingredients of the used herbal formulation . the plants of herbal formulation are not yet reported for such relaxant activity except c. cyminum . based on the data obtained , it can be concluded that , the traditional formulation is found to be safe and effective in the experimental model of the spasmodic pain . the study supports the claim of the traditional practitioners that this formulation can be used for the spasmodic pain treatment . further work is being carried out to determine the responsible fraction of the plant by employing the suitable model .
background : the herbal formulation consisting of andrographis paniculata nees . , cassia fistula l. , foeniculum vulgare mill . and cuminum cyminum l. is widely used by the local traditional practitioners in rural northern karnataka for spasmodic abdominal pain.objective:the present study was undertaken to evaluate safety and spasmolytic effect of poly - herbal formulation.materials and methods : acute toxicity studies were carried out in swiss mice , as per the organization for economic co - operation and development ( oecd ) guidelines . the spasmolytic activity of the formulation was studied in isolated guinea pig ileum model using histamine and acetylcholine as agonists . the data were analyzed by one - way anova , followed by dunnetts post - hoc test and p 0.05 was considered as significant.results:the formulation did not show any adverse toxic effects and found to be safe . it also showed significant ( p < 0.05 ) relaxation in different agonist like histamine and acetylcholine - induced contractions in guinea pig ileum.conclusion:antispasmodic activity of the herbal formulation can be attributed to its atropine - like activity . the present findings , therefore , support its utility in spasmodic abdominal pain .
bleeding gastric gastric varices ( gvs ) carry a higher morbidity and mortality than bleeding esophageal varices ( evs ) , which are easier to access and treat endoscopically using banding . balloon occluded retrograde transvenous obliteration ( brto ) of gvs is a minimally invasive treatment for such cases which relies on accessing the main efferent venous channel of these varices , i.e. the gastrorenal shunt ( grs ) via the left renal vein ( lrv ) . in cases lacking a grs , alternate efferent channels such as the left inferior phrenic vein ( ipv ) can be accessed and brto of varices is possible . to our knowledge , only one such previous case has been reported in which the communication between the left ipv and left hepatic vein ( lhv ) was utilized to perform a brto . a 70-year - old lady , a known case of hepatitis b virus ( hbv ) related cirrhosis presented to the emergency in gastroenterology department with complaint of malena for 1 day . she had been referred to our hospital from another centre where endoscopy had been performed on her earlier in the day and had revealed gastric varices . she reported 5 episodes of melena in the preceding 24 hours , with mild - to - moderate red discoloration of the stools . she was under medical management for chronic liver disease and cirrhosis for last many years . at presentation , her child pugh score was a6 with serum bilirubin of 1.4 mg% , serum albumin of 3.2 g% , international normalized ratio ( inr ) of 1.2 and absence of clinical ascites and encephalopathy . she had diabetes mellitus type 2 which was under medical control with oral hypoglycemic agents for many years . her serum hemoglobin was 8.3 g% with a hematocrit of 30.3% ( normal range : 3648% ) . the liver enzymes ( sgot , sgpt , and alkaline phosphatase ) and kidney function tests ( blood urea nitrogen and serum creatinine ) were within normal limits . gastric lavage performed with normal saline in the emergency room revealed presence of active bleeding in the aspirate . a preliminary diagnosis of liver cirrhosis with bleeding varices was made and esophago - gastric - duodenal endoscopy was performed for her 2 hours after admission . the same showed bleeding mid and distal esophageal varices ( grade ii ) along with bleeding varices in the gastric cardia [ figure 1 ] . upper gi endoscopy showing large varices in gastric cardia with raw red surface denoting recent bleeding ( arrow ) the patient underwent a triphasic computed tomography ( ct ) scan of the abdomen at the outside hospital on a 32 row scanner ( somatom perspective , siemens healthcare , erlangen , germany ) . varices were present along the lower esophagus and proximal lower curvature of stomach ( type 1 , sarin classification ) . because there was no large connection between the left renal vein and gv , the patient was referred to the department of radiology for transhepatic or transsplenic gv embolization . however , careful review of the images revealed the efferent channel of gastric varices to be the left ipv with one tributary leading into the left hepatic vein [ figure 2 ] . because this channel was of moderate size ( 34 mm ) and the patient was at high risk of re - bleeding from the gvs , it was decided to attempt a brto through this tributary . serial craniocaudal portal venous phase axial images ( a - c ) show the left ipv ( black arrows ) joining the lhv ( white arrow in c ) . axial image at a more caudal level ( d ) show the gvs in the region of cardia ( arrow ) . coronal reformatted image ( e ) shows the coursing left ipv ( arrow ) . the prominent fissures in segment 8 ( seen in a and b ) indicate cirrhotic morphology of the liver the procedure was performed under local anesthesia . under ultrasound guidance , the right femoral vein was accessed using a micropuncture introducer set ( flexor , ansel 1 modification , cook medical , bloomington , usa ) and a 7 fr , 70 cm sheath ( cook medical , bloomington , usa ) was placed with its tip in the ivc over a 0.035 diameter , 260 cm length hydrophilic glide wire ( radifocus , terumo medical corporation , tokyo , japan ) . a 90 cm , 5fr davis catheter ( ana md , sungnam , kyunggi province , korea ) was advanced over the wire . the catheter - wire combination was used to cannulate the lhv and was further advanced into the expected location of the ipv , as determined by ct . once the location of the catheter within the ipv was confirmed by a venogram , the sheath negotiation into the ipv was attempted , however , it was not possible . hence , the sheath was changed to a more flexible 7fr , 65 cm sheath ( super arrow - flex , arrow international inc , reading , usa ) and advanced further into the ipv [ figure 3a ] . fluoroscopic image ( a ) shows the tip of sheath within the left ipv ( arrow ) with the 5fr catheter and guidewire advanced further into the vein . ( b ) venogram after inflation of the balloon within ipv shows contrast run off into the distal ipv ( black arrow ) , pericardiophrenic vein ( black arrowhead ) and left lower intercostal veins ( white arrow ) . some filling of the gvs is seen ( white arrowhead ) the davis catheter was exchanged for a 80 cm length , 6 fr diameter occlusion balloon catheter ( terumo medical corporation , tokyo , japan ) and the balloon was inflated using 2 ml of contrast . the venogram of the shunt was done , which revealed run off into the left phrenic vein , pericardiophrenic vein , and lower left intercostal veins with poor filling of the gastric varices [ figure 3b ] . the phrenic vein branch which was not connected with gv was cannulated using a 110 cm , 2 fr diameter microcatheter ( progreat alphaterumo , tokyo , japan ) and 135 cm , 0.014 guidewire ( transcend , boston scientific corporation , marlborough , usa ) advanced co - axially through the occlusion balloon catheter . it was embolized using three 3 mm 4 cm nester pushable micro coils ( cook medical , bloomington , usa ) . following this , gelfoam slurry made using small gelfoam pieces ( cutanaplast , mascia brunelli spa , milan , italy ) and contrast ( 320 mg i / ml , visipaque , ge healthcare , ireland ) was injected to cause stasis within the intercostal vein and other small vein branches . the venogram was repeated which showed obliteration of the systemic run off and good filling of the gastric varices , as correlated with ct images [ figure 4a ] . repeat venogram ( a ) after coiling of ipv ( black arrow ) and gelfoam embolization showed absence of flow within ipv , stasis within intercostal veins and good visualization of gvs ( white arrowheads ) . the tortuous medially coursing channel ( white arrow ) is the left coronary vein and the faint vein ( black arrowhead ) is the posterior gastric vein ( afferent to the varices ) . ( b ) schematic diagram showing the anatomy relevant to the procedure thirty ml sclerosant mixture comprising 20 ml of 3% sodium tetradecyl sulphate ( tromboject , omega , montreal , canada),10 ml of contrast ( 320 mg i / ml , visipaque , ge healthcare , ireland ) and small gelfoam pieces were injected under fluoroscopic visualization till complete filling of the varices was achieved . the balloon was kept inflated and the patient was kept on the angiography table for an hour . fluoroscopy was used every 15 minutes to confirm that the balloon remained inflated and in place with stasis within the varices . the patient was then shifted to the ward with instructions to keep the right leg straight for 12 hours . a triphasic ct of the abdomen was done after twelve hours on a 320 row scanner ( aquilion one , toshiba medical systems , tokyo , japan ) , which showed non - enhancement within the region of gastric varices consistent with thrombosis [ figure 5 ] . the balloon was deflated , the sheath removed , and hemostasis ensured by manual compression . at the time of submitting , this article the patient has been on follow - up for 4 weeks and her ascites has decreased on serial ultrasounds and the lfts have shown no deterioration from pre - procedure levels . twelve - hour axial portal phase ct image shows complete thrombosis within the varices ( arrow ) . gvs can be caused by portal hypertension resulting from liver cirrhosis ( 90% of cases ) or due to splenic vein thrombosis ( 10% of cases ) . patients with liver cirrhosis having portal hypertension have a 30% risk of portosystemic collaterals or varices , with gvs comprising only 1020% of these . in other words , 36% of all cirrhotics have gvs . though risk of bleeding is lower with gvs compared to evs , upper gi endoscopy is usually the first line diagnostic and therapeutic tool for bleeding varices ( using injection sclerotherapy or banding for evs and injection sclerotherapy for gvs ) . in addition , there is a risk of complications resulting from embolization of sclerosant ( n - butyl-2-cyanoacrylate or isobutyl-2-cyanoacrylate ) to other organs . when endoscopy fails to control variceal bleeding , a transjugular intrahepatic portosytemic shunt ( tips ) is commonly performed to decompress the portal venous system . however , it is not very effective in controlling bleeding gvs as it is for bleeding evs . the concept of brto involves accessing the grs via the lrv through the femoral or jugular route and injecting a sclerosant agent such as ethanolamine oleate , absolute alcohol , gelfoam , or sodium tetradecyl sulphate into the varices after inflating a balloon in the grs to obstruct the shunt outflow , thereby obliterating the varices ( see the schematic diagram ) . olson et al . described the first attempt of balloon occluded sclerotherapy of grs for gvs . , its technique has evolved and it has become a well - established minimally invasive treatment for gastric varices both to control emergent bleeding or electively , especially in japan and south korea . the balloon is kept inflated for a period of 812 hours , during which time the varix undergoes thrombosis . at present , the two main clinical indications for this procedure are bleeding gastric varices in both emergent and elective situation and in some cases refractory hepatic encephalopathy . in the latter indication , discussion of detailed technique , patient selection and complications of this procedure is beyond the scope of this article and the reader is suggested to read the same from saad , et al . and watanabe , et al . the afferent channel for gastric varix is mostly from left gastric or posterior gastric veins . the efferent channel for most gvs ( 8085% ) is the grs , which opens into the lrv . however , gastric varices lacking a gr shunt have also been observed in 1015% of cases . the major outflow in such cases includes the ipv , cardiophrenic vein , pericardial vein , retroperitoneal veins , and intercostal veins . because these outflow veins open into the ivc or other systemic veins with an anatomy that is unfavorable for entry into them through femoral or jugular routes , the options for treatment in these cases include tips followed by obliteration of varices through the tips tract or antegrade obliteration of varices through the transhepatic or transspleenic puncture of hepatic vein / splenic vein respectively ( also known as bato : balloon occluded antegrade transvenous obliteration ) . described brto in 6 of their patients who lacked a grs but instead had a gastrocaval shunt through left ipv joining the ivc . in our case , there was no gr shunt and initially a brto was not considered . however , careful review of axial and coronal reformatted ct images showed the relative large communication between the lhv and the left ipv and a brto could be done successfully . extensive literature search revealed only one such previous case where ibukuro et al . in their article have described a similar approach for brto in which the authors have approached the varices through the hepatic vein . however , in their case the drainage of ipv into lhv could not be seen on ct but only on selective angiography of the splenic artery . other cases of brto that we came across during literature search for this article is by accessing the gastric varices through the intercostal vein and pericardiophrtenic vein . hemodynamically , our case is similar to the cases where the left ipv joins the ivc directly as described by kameda et al . increase in the amount of ascites indicates increase in portal venous pressure as a result of variceal obliteration , which is a known side effect of brto in 2030% of cases . our case highlights the importance of careful evaluation of ct images for alternate efferent pathways of a gastric varix lacking a grs . hence , the cross - sectional studies must be carefully analyzed for an alternate access to the varices in a case being evaluated for brto and lacking in a grs . also more importantly it underlines the fact that the varix can be treated using the cannulation of this small communication from the systemic vein .
approximately one in six patients with portal hypertension who develop varices at sites of portosystemic venous collaterals has gastric varices due to hepatofugal flow into the gastric veins . bleeding from gastric varices , though less common , has a higher mortality and morbidity compared to bleeding esophageal varices , which are easier to manage endoscopically . the efferent channel for gastric varices is mostly the gastrorenal shunt ( grs ) which opens into the left renal vein . balloon - occluded transvenous obliteration ( brto ) involves accessing the grs with an aim to temporarily occlude its outflow using a balloon catheter and at the same time injecting sclerosant mixture within the varix so as to cause its thrombosis and thereby obliteration . brto is one of the mainstays of minimally invasive treatment for bleeding gastric varices . in the minority of cases where the grs is absent , conventional brto is technically not possible . however , accessing the small alternate shunt from the inferior phrenic vein may be possible if one is aware of its existence .
mucosal surfaces are constantly exposed to the external environment , which includes commensal microbes and exogenous antigens . when pathogenic microbes breach the surface barrier , surveillance systems beneath sense the trespassers and send an alarm to defense headquarters . mucosal immune tissues comprise lymphoid organs associated with the gastro - intestinal tract ( e.g. , intestine , oral cavity and pharynx ) , respiratory tract , and urogenital tract , as well as the glands associated with these tissues , such as the salivary glands and lacrimal glands ( 1 ) . mucosal immunity can maintain peaceful body surface by generating secretory iga ( siga ) from b cells as well as priming specific t cell immunity . the intestine , especially , harbors an enormous community of commensal microorganisms that may contribute to host defense by enforcing the host 's barrier function ( 2 ) or by competing against other microorganisms metabolically ( 3,4 ) . dendritic cells ( dcs ) or other phagocytic cells continuously survey the mucosal environment by using innate pattern recognition receptors and sample antigens prior to integrate adaptive immune system . these cells also can adjust suppressive regulation to innocuous antigens by inducing tregs and keep distance to commensals by producing siga . moreover , these cells protect against pathogenic invasion by generating various kinds of helper t ( th ) and cd8 t cells as well as helping to produce siga antibodies . here , we provide an overview of the gut immune response , focusing on unique functional features of intestinal dcs and other phagocytic cells . lamina propria dcs in the small intestine ( si ) haves been well studied as one of the intestinal dc subsets . cd11c major histocompatibility ( mhc ) class ii cells in the gut comprise dcs as well as phagocytic macrophages . genuine dcs are a cd11c mhc class ii population , whereas macrophages are a cd11c mhc class ii population ( 5 ) . lamina propria phagocytic cells in the gut have different origins and functions ( 6 ) . dc subsets are differentiated by flt3 ligand - dependent manner whereas cx3cr1-expressing phagocytic cells are dependent on csf-1r ( 6 ) . peripheral cd103cd11b dcs are developmentally dependent on batf3 and are related to cd8 conventional dcs ( 7 ) . dc migration is tightly controlled by the expression of ccr7 , and it can be largely classified as non - migratory and migratory ( 8,9 ) . . migratory dcs travel into draining lymph nodes with sampled antigen and can be infiltrated under inflammation . dc and phagocytic cells in the gut and their functions therein are listed in table i. in the gut , cd103 cd11b dcs has been well reported by the function to induce lymphocytes . gut cd103 dcs comprise two major subsets , cd103cd11b and cd103cd11b dcs ( 10 ) . cd103 cd11b dcs are the dominant population of cd103 dc in the peyer 's patches and colon lamina propria ( 11 ) . in contrast , cd103cd11b dcs are the major dc subset in the si lamina propria ( 12 ) . in addition tnf-/inos - producing dcs ( tip dcs ) were initially reported in the spleen , where they released large amounts of nitric oxide ( no ) after recognizing commensal bacteria through toll - like receptors ( tlrs ) ( 13 ) . the presentation of innocuous food antigens by antigen - presenting cells induces oral tolerance by generation of inducible regulatory t ( treg ) cells ( 14 ) . cd103cd11b dcs can sample soluble antigens from the intestinal lumen through a process termed goblet cell - associated antigen passages ( gaps ) ( 15 ) ( fig . 1 ) . these dcs can also patrol among enterocytes while extending dendrites toward the lumen ( 16 ) . these intraepithelial cd103 dcs are recruited to sample bacterial antigens for presentation . in the si lamina propria as well as mesenteric lymph node ( mln ) , these dcs express retinaldehyde dehydrogenase type 2 ( raldh2 ) which can convert retinal to retinoic acid ( ra ) , a metabolic derivative of vitamin a found in food . this dc subset can induce regulatory foxp3cd4 t cells dependent on ra and tgf- ( 17,18,19 ) ; alternatively , cd11b f4/80cd11c macrophages in the lamina propria has been reported as more potent inducers of treg cells than dcs ( 20 ) . cx3cr1 phagocytic cells in the lamina propria support expansion of the foxp3cd4 treg cell population by producing il-10 to harness immune tolerance ( 21 ) . cx3cr1 phagocytic cells can capture salmonella by extending dendrites across epithelium in a cx3cr1-dependent manner ( 22 ) . antigens captured by cx3cr1 phagocytic cells can be transferred through gap junctions to cd103 dcs in the lamina propria to establish oral tolerance ( 23 ) . in addition to luminal antigen , lamina propria cx3cr1 cells facilitate the surveillance of circulatory antigens from blood vessels ( 24 ) . these cells fail to prime nave cd4 t cells ; however , cross - presentation by these cells can induce priming of and differentiation into cd8 t cells that express il-10 , il-13 , and il-9 . these cd8 t cells can suppress pathogen - specific cd4 t cell activation through il-10 ( 24 ) . finally , these cd8 t cells act as a regulatory cd8 tcr t cell population in the epithelium . cx3cr1 cells regulate colonic il-22 producing group 3 innate lymphoid cells ( ilc3 ) to promote mucosal healing and maintain barrier integrity ( 25 ) . therefore , cd103 dcs and cx3cr1 phagocytic cells can generate two distinct regulatory t cell subsets by different mechanisms to maintain gut immune homeostasis at steady state ( fig . 1 ) . pdcs may mediate anti - inflammatory responses following tlr2-polysaccharide a signaling ( 26 ) and type i interferon supports treg function and regulates colitis ( 27,28 ) . after dcs sample antigen in the lamina propria , they can present antigenic epitope to nave t cells in the isolated lymphoid follicles ( ilf ) or draining mln . cd103cd11b dcs , one of the major dc subset in the si lamina propria , are primarily a migratory population that responds to ccr7 expression and can be infiltrated under inflammatory conditions ( 29,30 ) . segmented filamentous bacteria ( sfb ) , murine commensal bacteria , are shown to be sufficient for th17 differentiation ( 31 ) . mhc ii - dependent presentation of sfb antigens by intestinal dcs is crucial for th17 cell induction ( 32 ) . cd103 cd11b dcs produce il-6 with tlr stimuli which enable to induce th17 cell differentiation ( 34 ) . several studies suggest the possibility that cd103cd11b dcs might interact with sfb and link signals to induce th17 . cd103 cd11b dcs can express high amounts of il-23 following tlr5 stimuli and then drove il-22-dependent regiii production from paneth cells ( 35 ) . tlr5 dcs promote the differentiation of antigen - specific th17 and th1 cells following stimulation by flagellin , a tlr5 ligand ( 36 ) . cd103cd11bcd8 dcs expressing tlr3 , tlr7 , and tlr9 can produce il-6 and il-12p40 following stimulation of the respective tlr ligands ( 37 ) . while their function under conditions of inflammation or infection remains unclear , their suppressive functions are well described at steady state . a unique feature of the mucosal immune system is local production of siga from plasma cells differentiated from b cells . iga class switching generally occurs in gut - associated lymphoid tissues including peyer 's patches , mlns , and ilfs within the lamina propria . sfb stimulates the postnatal development of ilfs and tertiary lymphoid tissue in the si lamina propria , which can substitute for peyer 's patches as inductive sites for intestinal iga ( 38 ) . intestinal iga coating identifies inflammatory commensals that drive intestinal disease like inflammatory bowel disease ( 33,39 ) . the siga within mucus establishes distance with commensals and forms a barrier between invading and commensal microorganisms . intestinal dcs support iga isotype class - switching and differentiation into iga - secreting plasma cells , either together with the assistance of th cells or in a t cell - independent manner by expressing b cell - activating factors ( baffs ) and a proliferation - inducing ligand ( april ) ( fig . 3 ) . intestinal pdcs , in particular , have been shown to induce iga production by expressing these factors ( 40 ) . when commensal bacteria are recognized through tlrs , tip dcs release large amounts of no which enhances iga class - switch dna recombination ( csr ) in b cells by inducing dc expression of baff and april ( 13 ) . further , ra can be converted by raldh2 from dietary vitamin a in dcs , and dcs expressing raldh2 can also induce iga csr ( 41 ) . lamina propria cd103cd11b dcs , tip dcs , and tlr5 dcs express raldh2 and produce ra , which in turn can be used for iga production together with tgf- ( 13,36,42 ) . langerin - expressing dcs in the mlns that emerge following trans - cutaneous vaccination can also induce ra - dependent antigen - specific iga production in the si ( 43 ) . moreover , ra confers gut homing signature such as 47 integrin and ccr9 on lymphocytes ( 42,44 ) . therefore , ra is essential to maintaining the intestinal immune environment ( 45,46 ) . in normal lamina propria , large numbers of eosinophils are present , accounting for approximately 5% of all lamina propria leukocytes ( 47 ) . recently , eosinophils have been found to promote the generation and maintenance of iga - producing plasma cells by inducing b cell activating factors ( 48 ) and supporting the function of cd103 dcs ( 49 ) . in this review , we focused on the integral role of intestinal dcs in shaping the unique intestinal immunity . the advent of advanced experimental techniques for surveying mucosal tissues and analyzing metagenomic data of commensals , along with the wide availability of germ - free mice has facilitated a growing understanding of this unique mucosal immune environment . for example , clostridium strains provide a rich environment of tgf- and induce foxp3 treg in the colon ( 50,51 ) , and sfb induce the generation of th17 cell by il-6 production from dcs ( 32 ) . some pathogens ( e.g. , listeria spp . ) thus , microbial signals may induce polarizing cytokine secretion from dcs , other innate cells or stromal cells . assembling combined information
innate immune cells survey antigenic materials beneath our body surfaces and provide a front - line response to internal and external danger signals . dendritic cells ( dcs ) , a subset of innate immune cells , are critical sentinels that perform multiple roles in immune responses , from acting as principal modulators to priming an adaptive immune response through antigen - specific signaling . in the gut , dcs meet exogenous , non - harmful food antigens as well as vast commensal microbes under steady - state conditions . in other instances , they must combat pathogenic microbes to prevent infections . in this review , we focus on the function of intestinal dcs in maintaining intestinal immune homeostasis . specifically , we describe how intestinal dcs affect iga production from b cells and influence the generation of unique subsets of t cell .
contrastinduced nephropathy ( cin ) is the third most common cause of hospitalacquired kidney injury , which contributes to decreased mobility and motility , prolonged hospitalization , and increased healthcare costs . identifying patients at risk of cin easily and accurately would allow the administration of prophylactic interventions to those at high risk . several riskscore models reflecting the cumulative risk of several periprocedural predictors , such as the mehran cin score and bmc2 cin score , have been established and have proven useful for both bedside clinical decisionmaking and risk assessment . however , although these score models include a multitude of qualitative risk factors , they lack quantitative biomarkers that are associated with multiple organ function and might serve as predictors in riskscore models . thus , there is a need for a more objective identification tool , readily available at hospital admission , before patients are subjected to contrast exposure during coronary angiography or percutaneous coronary intervention ( pci ) . nterminal probrain natriuretic peptide ( ntprobnp ) , an easily available biomarker , is associated with advanced age , kidney dysfunction , anemia , heart failure , and diabetes , which are risk factors for cin . recent data suggest that measurement of serum bnp at hospital admission may help identify patients with stsegment elevation myocardial infarction who are at risk for developing cin after primary pci . in the present study , our objective was to investigate the predictive value of objective preprocedural ntprobnp for cin in patients undergoing selective coronary angiography . we conducted a prospective observational study at the guangdong cardiovascular institute of guangdong general hospital , guangdong academy of medical sciences , between october 2008 and december 2012 . all consecutive patients aged > 18 years who underwent coronary angiography or pci were eligible for enrollment . the exclusion criteria included pregnancy , lactation , intravascular administration of a contrast medium within the previous 7 days or 3 days postoperation ( n=83 ) , cardiovascular surgery or endovascular repair ( n=382 ) , endstage renal disease or renal replacement ( n=7 ) , missing preoperative or postoperative creatinine ( n=61 ) , and malignancy ( n=3 ) . patients undergoing emergent coronary intervention ( n=406 ) and others who had no preprocedural evaluation of ntprobnp ( n=691 ) were also excluded . the study was approved by an institutional review committee and the subjects gave informed consent . once the patients had been admitted to the hospital , preprocedural ntprobnp was measured using electrochemiluminescence immunoassay ( roche diagnostics , germany ) . serum creatinine concentration was assessed in all patients , as a part of standard clinical care , at the time of hospital admission and daily for 3 days after contrast administration , as well as upon hospital discharge . estimated glomerular filtration rate ( egfr ) was evaluated using the levelmodified modification of diet in renal disease equation : 186.3serum creatinine(age in years)1.212 ( if patient was black)0.742 ( if patient was female ) . the contrast type and dose were left to the discretion of the interventional cardiologist , according to the patient 's need . the use of adrenergic blocking agents , angiotensinconverting enzyme inhibitors , diuretics , intraaortic balloon pump support , or inotropic drugs was left to the discretion of the interventional cardiologist and the physicians responsible for the patients . patients received intravenous normal ( 0.9% ) saline at a rate of 1 ml / kg per hour , 2 to 12 hours before and 6 to 24 hours after the administration of contrast medium . in patients with a left ventricular ejection fraction ( lvef ) < 40% or overt heart failure , the hydration rate was reduced to 0.5 ml / kg per hour . the primary end point of the study was the development of cin , defined as an increase in serum creatinine of > 0.5 mg / dl over the baseline value within 48 to 72 hours after the administration of contrast medium . additional end points recorded during the study included major adverse clinical events and cin requiring renal replacement therapy . major adverse clinical events included death , renal replacement therapy , target vessel revascularization , rehospitalization , and stroke . demographics and traditional risk factors were compared between patients who developed cin and those who did not , and the clinical outcomes and incidence of cin were compared among ntprobnp quartiles . comparisons between normally distributed continuous variables , expressed as meansd , were performed using 1way analysis of variance ; nonnormally distributed continuous variables , presented as median and interquartile range , were analyzed using kruskal the pearson or fisher exact tests were used , as appropriate , for categorical data , expressed as percentages . analyses of receiver operating characteristic curves were conducted and the youden index was used to determine the cutoff value of ntprobnp for predicting cin . the area under receiver operating characteristic curves of ntprobnp and mehran cin score for predicting cin were compared using the nonparametric approach of delong et al . higher ntprobnp group , congestive heart failure , age > 75 years , egfr < 60 ml / min per 1.73 m , diabetes mellitus , and contrast dose > 200 ml were included in the multivariable logistic regression analysis for cin . univariate analyses of mortality were performed using a logrank test for patients categorized by ntprobnp . all data analyses were performed using sas version 9.3 ( sas institute , cary , nc ) . we conducted a prospective observational study at the guangdong cardiovascular institute of guangdong general hospital , guangdong academy of medical sciences , between october 2008 and december 2012 . all consecutive patients aged > 18 years who underwent coronary angiography or pci were eligible for enrollment . the exclusion criteria included pregnancy , lactation , intravascular administration of a contrast medium within the previous 7 days or 3 days postoperation ( n=83 ) , cardiovascular surgery or endovascular repair ( n=382 ) , endstage renal disease or renal replacement ( n=7 ) , missing preoperative or postoperative creatinine ( n=61 ) , and malignancy ( n=3 ) . patients undergoing emergent coronary intervention ( n=406 ) and others who had no preprocedural evaluation of ntprobnp ( n=691 ) were also excluded . the study was approved by an institutional review committee and the subjects gave informed consent . once the patients had been admitted to the hospital , preprocedural ntprobnp was measured using electrochemiluminescence immunoassay ( roche diagnostics , germany ) . serum creatinine concentration was assessed in all patients , as a part of standard clinical care , at the time of hospital admission and daily for 3 days after contrast administration , as well as upon hospital discharge . estimated glomerular filtration rate ( egfr ) was evaluated using the levelmodified modification of diet in renal disease equation : 186.3serum creatinine(age in years)1.212 ( if patient was black)0.742 ( if patient was female ) . coronary angiography or pci the contrast type and dose were left to the discretion of the interventional cardiologist , according to the patient 's need . the use of adrenergic blocking agents , angiotensinconverting enzyme inhibitors , diuretics , intraaortic balloon pump support , or inotropic drugs was left to the discretion of the interventional cardiologist and the physicians responsible for the patients . patients received intravenous normal ( 0.9% ) saline at a rate of 1 ml / kg per hour , 2 to 12 hours before and 6 to 24 hours after the administration of contrast medium . in patients with a left ventricular ejection fraction ( lvef ) < 40% or overt heart failure , the hydration rate was reduced to 0.5 ml / kg per hour . the primary end point of the study was the development of cin , defined as an increase in serum creatinine of > 0.5 mg / dl over the baseline value within 48 to 72 hours after the administration of contrast medium . additional end points recorded during the study included major adverse clinical events and cin requiring renal replacement therapy . major adverse clinical events included death , renal replacement therapy , target vessel revascularization , rehospitalization , and stroke . demographics and traditional risk factors were compared between patients who developed cin and those who did not , and the clinical outcomes and incidence of cin were compared among ntprobnp quartiles . comparisons between normally distributed continuous variables , expressed as meansd , were performed using 1way analysis of variance ; nonnormally distributed continuous variables , presented as median and interquartile range , were analyzed using kruskal the pearson or fisher exact tests were used , as appropriate , for categorical data , expressed as percentages . analyses of receiver operating characteristic curves were conducted and the youden index was used to determine the cutoff value of ntprobnp for predicting cin . the area under receiver operating characteristic curves of ntprobnp and mehran cin score for predicting cin were compared using the nonparametric approach of delong et al . higher ntprobnp group , congestive heart failure , age > 75 years , egfr < 60 ml / min per 1.73 m , diabetes mellitus , and contrast dose > 200 ml were included in the multivariable logistic regression analysis for cin . univariate analyses of mortality were performed using a logrank test for patients categorized by ntprobnp . all data analyses were performed using sas version 9.3 ( sas institute , cary , nc ) . mol / l , and mean egfr was 82.225.2 ml / min per 1.73 m. of the total patient population , 565 ( 25.2% ) had diabetes , and 324 ( 14.6% ) had congestive heart failure . tables 1 and 2 show the univariate analysis of the baseline and procedural characteristics , including the traditional risk factors for cin between the patients with and without cin . patients who developed cin were more likely to be older , hypotensive , and smokers , as well as have anemia , congestive heart failure , lower lvef and hemoglobin values , and higher levels of serum creatinine , uric acid , lowdensity lipoprotein cholesterol , and highsensitivity creactive protein values . they presented with longer procedure durations or more multivessel disease , and they were more frequently treated with diuretics . furthermore , these patients were more likely to have a higher mehran risk score ( 9.535.14 versus 4.753.76 ) and higher ntprobnp levels ( 53207423 versus 10782548 pg / ml ) . quartiles of ntprobnp for the present study population were q1 ( < 65 pg / ml ) , q2 ( 65 to 247.5 pg / ml ) , q3 ( 247.5 to 976 pg / ml ) , and q4 ( 976 pg / ml ) . baseline characteristics for patients with and without cin values are meansd or n ( % ) . alb indicates albumin ; cabg , coronary artery bypass grafting ; cho , cholesterol ; cin , contrastinduced nephropathy ; crcl , creatinine clearance ; dbp , diastolic blood pressure ; egfr , estimated glomerular filtration rate ; hba1c , hemoglobin a1c ; hgb , hemoglobin ; ldlc , lowdensity lipoprotein cholesterol ; lvef , left ventricular ejection fraction ; mi , myocardial infarction ; ntprobnp , nterminal probrain natriuretic peptide ; sbp , systolic blood pressure ; tg , triglyceride ; uri , uric acid . procedural characteristics for patients with and without cin values are meansd or n ( % ) . acei indicates angiotensinconverting enzyme inhibitor ; arb , angiotensin receptor blocker ; ccb , calcium channel blocker ; cin , contrastinduced nephropathy ; hvwratio , hydration volumetoweight ; iabp , intraaortic balloon pump ; vcrclratio , volume of contrast agenttocreatinine clearance rate . individuals with high preprocedural ntprobnp concentrations were more likely to develop cin ( q1 , q2 , q3 , q4 : 0.5% , 1.2% , 1.2% , 5.9% ; p<0.001 ) . the differences were consistent with a different definition of cin , including an absolute increase of > 0.3 mg / dl and/or a relative increase of > 50% in serum creatinine from baseline within 72 hours after contrast administration ( table 3 ) . the patients with elevated ntprobnp levels were more likely to have major adverse clinical events , including overall death ( 0.2% , 0% , 0.2% , 1.8% ; p<0.001 ) and a need for renal replacement therapy ( q1 , q2 , q3 , q4 : 0.0% , 0.4% , 0.2% , 1.2% , p=0.023 ) . cin incidence and clinical outcomes according to ntprobnp quartiles cin indicates contrastinduced nephropathy ; ntprobnp , nterminal probrain natriuretic peptide ; rrt , renal replacement therapy ; scr , serum creatinine . receiver operating characteristic curve analysis indicated that a cutoff value of 682 pg / dl for ntprobnp could predict cin with a sensitivity of 78% and a specificity of 70% ( area under the curve=0.766 , p<0.001 ) ( figure 1 ) . ntprobnp was not significantly different from the mehran cin score with respect to predicting cin ( c=0.7657 versus c=0.7729 , p=0.8431 ) . receiver operating characteristic curve analysis for nterminal probrain natriuretic peptide ( ntprobnp ) and mehran scores in the prediction of contrastinduced nephropathy ( c=0.7657 vs c=0.7729 ; p=0.8431 ) . when analyzing all of the patients , we observed a significant positive correlation between ntprobnp and the patients ' age and mehran cin score . a significant negative correlation was demonstrated between ntprobnp and the values of lvef and hemoglobin ( figure 2 ) . correlation between nterminal probrain natriuretic peptide ( bnp ) and age ( a ) , creatinine clearance ( crcl ) ( b ) , left ventricular ejection fraction ( lvef ) ( c ) , and mehran contrastinduced nephropathy score ( d ) . pg / dl was significantly associated with cin ( odds ratio : 8.16 ; 95% ci : 4.15 to 16.02 , p<0.001 ) . pg / dl was an independent predictor of cin ( odds ratio : 4.007 ; 95% ci : 1.950 to 8.234 ; p<0.001 ) , even after adjustment for other established risk factors , including congestive heart failure , age > 75 years , egfr < 60 ml / min per 1.73 m , diabetes mellitus , and dose > 200 ml ( table 4 ) . univariate and multivariable logistic regression analysis egfr indicates estimated glomerular filtration rate ; ntprobnp , nterminal probrain natriuretic peptide ; or , odds ratio . we assessed the predictive value of different ntprobnp cutoffs ( 682 pg / dl ) . after adjusting for baseline clinical and other procedural variables , a higher ntprobnp group remained an independent predictor of longterm clinical outcomes ( figures 3 and 4 ) ; the adjusted mortality was higher for patients with ntprobnp > 682 pg / dl ( hazard ratio : 2.53 ; 95% ci : 1.49 to 4.30 ; p=0.0006 ) . cumulative mortality for patients according to the cutoff value for nterminal probrain natriuretic peptide ( bnp ) ( 682 ng / ml ) . hazard ratios for patients ' 2year death according to the cutoff value for bnp ( 682 ng / ml ) . bnp indicates nterminal probrain natriuretic peptide ; chf , congestive heart failure ; ckd , chronic kidney disease ; dm , diabetes mellitus ; hr , hazard ratio ; iabp , intraaortic balloon pump . mol / l , and mean egfr was 82.225.2 ml / min per 1.73 m. of the total patient population , 565 ( 25.2% ) had diabetes , and 324 ( 14.6% ) had congestive heart failure . tables 1 and 2 show the univariate analysis of the baseline and procedural characteristics , including the traditional risk factors for cin between the patients with and without cin . patients who developed cin were more likely to be older , hypotensive , and smokers , as well as have anemia , congestive heart failure , lower lvef and hemoglobin values , and higher levels of serum creatinine , uric acid , lowdensity lipoprotein cholesterol , and highsensitivity creactive protein values . they presented with longer procedure durations or more multivessel disease , and they were more frequently treated with diuretics . furthermore , these patients were more likely to have a higher mehran risk score ( 9.535.14 versus 4.753.76 ) and higher ntprobnp levels ( 53207423 versus 10782548 pg / ml ) . quartiles of ntprobnp for the present study population were q1 ( < 65 pg / ml ) , q2 ( 65 to 247.5 pg / ml ) , q3 ( 247.5 to 976 pg / ml ) , and q4 ( 976 pg / ml ) . baseline characteristics for patients with and without cin values are meansd or n ( % ) . alb indicates albumin ; cabg , coronary artery bypass grafting ; cho , cholesterol ; cin , contrastinduced nephropathy ; crcl , creatinine clearance ; dbp , diastolic blood pressure ; egfr , estimated glomerular filtration rate ; hba1c , hemoglobin a1c ; hgb , hemoglobin ; ldlc , lowdensity lipoprotein cholesterol ; lvef , left ventricular ejection fraction ; mi , myocardial infarction ; ntprobnp , nterminal probrain natriuretic peptide ; sbp , systolic blood pressure ; tg , triglyceride ; uri , uric acid . procedural characteristics for patients with and without cin values are meansd or n ( % ) . acei indicates angiotensinconverting enzyme inhibitor ; arb , angiotensin receptor blocker ; ccb , calcium channel blocker ; cin , contrastinduced nephropathy ; hvwratio , hydration volumetoweight ; iabp , intraaortic balloon pump ; vcrclratio , volume of contrast agenttocreatinine clearance rate . individuals with high preprocedural ntprobnp concentrations were more likely to develop cin ( q1 , q2 , q3 , q4 : 0.5% , 1.2% , 1.2% , 5.9% ; p<0.001 ) . the differences were consistent with a different definition of cin , including an absolute increase of > 0.3 mg / dl and/or a relative increase of > 50% in serum creatinine from baseline within 72 hours after contrast administration ( table 3 ) . the patients with elevated ntprobnp levels were more likely to have major adverse clinical events , including overall death ( 0.2% , 0% , 0.2% , 1.8% ; p<0.001 ) and a need for renal replacement therapy ( q1 , q2 , q3 , q4 : 0.0% , 0.4% , 0.2% , 1.2% , p=0.023 ) . cin incidence and clinical outcomes according to ntprobnp quartiles cin indicates contrastinduced nephropathy ; ntprobnp , nterminal probrain natriuretic peptide ; rrt , renal replacement therapy ; scr , serum creatinine . receiver operating characteristic curve analysis indicated that a cutoff value of 682 pg / dl for ntprobnp could predict cin with a sensitivity of 78% and a specificity of 70% ( area under the curve=0.766 , p<0.001 ) ( figure 1 ) . ntprobnp was not significantly different from the mehran cin score with respect to predicting cin ( c=0.7657 versus c=0.7729 , p=0.8431 ) . receiver operating characteristic curve analysis for nterminal probrain natriuretic peptide ( ntprobnp ) and mehran scores in the prediction of contrastinduced nephropathy ( c=0.7657 vs c=0.7729 ; p=0.8431 ) . when analyzing all of the patients , we observed a significant positive correlation between ntprobnp and the patients ' age and mehran cin score . a significant negative correlation was demonstrated between ntprobnp and the values of lvef and hemoglobin ( figure 2 ) . correlation between nterminal probrain natriuretic peptide ( bnp ) and age ( a ) , creatinine clearance ( crcl ) ( b ) , left ventricular ejection fraction ( lvef ) ( c ) , and mehran contrastinduced nephropathy score ( d ) . univariate logistic regression found that ntprobnp > 682 pg / dl was significantly associated with cin ( odds ratio : 8.16 ; 95% ci : 4.15 to 16.02 , p<0.001 ) . multivariable logistic regression analysis showed that bnp > 682 pg / dl was an independent predictor of cin ( odds ratio : 4.007 ; 95% ci : 1.950 to 8.234 ; p<0.001 ) , even after adjustment for other established risk factors , including congestive heart failure , age > 75 years , egfr < 60 ml / min per 1.73 m , diabetes mellitus , and dose > 200 ml ( table 4 ) . univariate and multivariable logistic regression analysis egfr indicates estimated glomerular filtration rate ; ntprobnp , nterminal probrain natriuretic peptide ; or , odds ratio . we assessed the predictive value of different ntprobnp cutoffs ( 682 pg / dl ) . after adjusting for baseline clinical and other procedural variables , a higher ntprobnp group remained an independent predictor of longterm clinical outcomes ( figures 3 and 4 ) ; the adjusted mortality was higher for patients with ntprobnp > 682 pg / dl ( hazard ratio : 2.53 ; 95% ci : 1.49 to 4.30 ; p=0.0006 ) . cumulative mortality for patients according to the cutoff value for nterminal probrain natriuretic peptide ( bnp ) ( 682 ng / ml ) . hazard ratios for patients ' 2year death according to the cutoff value for bnp ( 682 ng / ml ) . bnp indicates nterminal probrain natriuretic peptide ; chf , congestive heart failure ; ckd , chronic kidney disease ; dm , diabetes mellitus ; the present study showed that elevation of preprocedural ntprobnp , an easily available biomarker , was significantly associated with an increased risk of cin . after adjustment for other traditional confounders , including congestive heart failure , a level of preprocedural ntprobnp > 682 pg / ml , the best cutoff point , was a strong and independent predictor of cin and longterm death ; thus , besides the mehran cin score , preprocedural ntprobnp could become another objective and rapidly available tool for risk stratification and/or a modifiable target for prevention in patients undergoing coronary angiography . ntprobnp may be a promising and timely tool for predicting the risk of cin and adverse events in patients undergoing coronary angiography . the predictive value of the preprocedural ntprobnp level was not significantly different from that of the mehran cin score ( p=0.8431 ) , including 8 periprocedural risk factors , some of which were related to the patients ' medical histories and were often unavailable to the cardiologists before the procedure . ntprobnp , a qualitative and more objective risk stratification tool compared with the mehran score system , may potentially help cardiologists to identify highrisk patients ( with high ntprobnp ) , who may then receive timely preventive measures . at our institute , 80% patients who were undergoing elective coronary angiography and who were suspected to be at risk of heart failure also underwent ntprobnp testing ; this ntprobnp test is routinely performed at our facility . in addition , most of the risk factors included in the mehran score were associated with elevated ntprobnp levels in our study . therefore , this simple and readily available test may be a better tool for predicting cin than the existing mehran cin score system . cin is highly prevalent in patients with congestive heart failure and chronic kidney disease ( ckd ) undergoing coronary interventions . one study showed that lvef < 40% was significantly associated with cin ( odds ratio : 4.52 ; 95% ci : 1.30 to 15.71 ; p=0.02 ) in patients without congestive heart failure . another study conducted in denmark showed that using a heart failure diagnosis requiring elevated ntprobnp reduces the prevalence of heart failure with preserved ejection fraction and results in a survival rate similar to that of heart failure with reduced ejection fraction ; the finding supported the use of ntprobnp for the selection of highrisk patients having heart failure with preserved ejection fraction in future interventional clinical trials . in 1 recent study , ntprobnp also had strong associations with left ventricular systolic dysfunction , even in patients without clinical heart failure ; the study evaluated the crosssectional associations of ntprobnp with cardiac structural and functional abnormalities in patients with ckd ( n=3232 ) . ntprobnp significantly reclassified participants ' likelihood of having left ventricular systolic dysfunction ( net reclassification improvement 0.28 , 95% ci : 0.27 to 0.30 ; p<0.001 ) . in addition , pointofcare tests are available in which bnp concentrations are available within 20 minutes , making it a potentially useful candidate for early prognostication . therefore , preprocedural ntprobnp may be a more objective and rapidly available tool for the estimation of the risk of worsening renal function after coronary angiography . measurement of ntprobnp on admission has been a routine procedure for patients with suspected coronary heart disease who are to undergo coronary angiography . natriuretic peptides are a family of hormones synthesized in myocytes and secreted increasingly in response to the elevation of any chamber wall stress . consequently , as the inactive metabolite of bnp , ntprobnp has diagnostic and prognostic capabilities across a variety of conditions involving heart dysfunction . elevated ntprobnp levels have been shown to be a powerful predictor of shortterm and longterm outcomes . in the general population , elevated ntprobnp levels predict poor outcomes in both asymptomatic and dyspneic subjects , irrespective of renal function . ckd itself also amplifies the cardiovascular risk . even medical care supported by heart failure treatment that is guided by bnp therefore , recent clinical practice guidelines recommended ntprobnp for guiding heart failure management . in the present study , the data suggested that elevation of preprocedural ntprobnp was also an independent risk factor for cin in patients undergoing selected cardiac catheterization . one recent study , a substudy of the horizonsami trial , focused on the correlation between bnp and the risk of cin in patients with acute stsegment elevation myocardial infarction ( odds ratio : 1.29 , 95% ci : 1.10 to 1.51 ; p<0.001 ) ; however , bnp and serial creatinine levels suitable for complete measurement were only available in 979 of the 3602 patients enrolled ( 27.2% ) and were not sufficient to determine an optimal bnp cutoff concentration for the prediction of cin . another study indicated that preoperative bnp level is associated with postoperative acute kidney injury in highrisk patients undergoing cardiac surgery . bnp was linearly associated with the risk of at least mild acute kidney injury , whereas for evaluating severe acute kidney injury , a risk threshold was observed above the intermediate levels of bnp . our results are in accordance with the observations of a recent study , showing that patients with acute heart failure who develop acute kidney injury within 48 hours after admission have significantly higher initial bnp concentrations . according to our findings , an ntprobnp level > 682 pg / ml was a strong and independent predictor of ckd patients presenting with acute onset or worsening of symptoms ; in contrast , the optimal cutoff value of ntprobnp for diagnosing heart failure in unselected patients is 300 pg / ml . because all the subjects presented with renal dysfunction , the cutoff value of ntprobnp for predicting cin was strikingly higher than that for diagnosing heart failure . the reasons for the strong association between elevated preprocedural ntprobnp levels and a higher risk of cin were not clear ; however , the potential mechanisms by which high bnp concentrations are associated with cin may include the following . first , elevated bnp concentrations are also related to other risk factors , which are themselves directly associated with the development of cin , such as worse heart and renal dysfunction , advanced age , and diabetes mellitus . higher levels of ntprobnp were significantly associated with a higher risk of developing endstage renal disease in diabetic patients with ckd after adjustment for other risk factors . second , the elevated ntprobnp in patients with ckd may be due to decreased renal clearance , or decreased renal responsiveness to bnp . since previous studies found that plasma concentrations of ntprobnp increase as gfr declines in patients with or without apparent cardiac dysfunction , the decreased clearance ability of ntprobnp due to impaired renal function may play an important role . elevated ntprobnp concentrations may reflect cardiac involvement in patients with ckd , especially those undergoing catheterization . third , bnp , the source of ntprobnp , reduces the effects of catecholamines , and potentiates the generation of nitric oxide , which in turn is a known inhibitor of myocardial contractility , thereby possibly resulting in systemic vasodilation and renal hypoperfusion . cin is regarded as a specific subtype of cardiorenal syndrome type 1 , which is defined as worsening renal function attributed to acute heart dysfunction that may exacerbate the condition of both cardiac and renal impairment . it is associated with increased cardiovascular mortality and morbidity , increased stroke risk , longer hospitalization , and a higher readmission rate . although there is growing recognition of the frequency of cardiorenal syndrome , its underlying pathophysiology is not yet well understood . vascular factors such as nitric oxide , prostaglandin , natriuretic peptides , and endothelin may modulate renal perfusion independently of cardiac hemodynamics . recently , researchers have focused on the role of inflammatory markers as links between cardiovascular and kidney disease . the natriuretic peptides are established biomarkers in heart failure and , since elevated natriuretic peptide levels can be caused by renal dysfunction as well as congestive heart failure , they probably also reflect renal injury . thus , natriuretic peptides are emerging as pleiotropic biomarkers that are useful in the settings of both cardiac and renal dysfunction and have the potential to serve as a valuable diagnostic tool in the diagnosis of type 1 cardiorenal syndrome . moreover , bnp has been shown to cause natriuresis and diuresis in animals , healthy men , and patients with congestive heart failure . recombinant human bnp significantly reduced the incidence of cin , reduced serum creatinine , and improved egfr in a population of patients with congestive heart failure and stelevation myocardial infarction . the hormone may be especially beneficial in patients with acute myocardial infarction complicated by congestive heart failure , because of its inhibitory effect on the neuroendocrine system and its diuretic and natriuretic action . the cutoff value of ntprobnp , 682 pg / ml in the present study , may provide guidance for carrying out fluid management , as do the 35% or 40% limits for lvef . it may be reasonable to limit the hydration speed and volume , or even to consider the use of diuretics , in patients with ntprobnp > 682 pg / ml who are undergoing cardiac catheterization . patients with very high levels of ntprobnp may become optimal target subjects for receiving therapeutic measures to prevent cin in future randomized trials . it was a singlecenter , observational study without longterm followup for the systematic measurement of creatinine concentrations , such as at 3 months or 1 year . patients undergoing primary pci were excluded because they lacked preprocedural ntprobnp measurements ; this might have caused selection bias . variations in the measurement times may have led to missed peak levels of creatinine after the procedure . failure to perform systematic measurements at optimal times for determining peak creatinine concentrations may have led to an underestimation of the true incidence of cin . it was a singlecenter , observational study without longterm followup for the systematic measurement of creatinine concentrations , such as at 3 months or 1 year . patients undergoing primary pci were excluded because they lacked preprocedural ntprobnp measurements ; this might have caused selection bias . variations in the measurement times may have led to missed peak levels of creatinine after the procedure . failure to perform systematic measurements at optimal times for determining peak creatinine concentrations may have led to an underestimation of the true incidence of cin . besides the mehran cin score , measurement of serum ntprobnp at hospital admission may also help identify patients who are at high risk for developing cin after cardiac catheterization . the data may provide a modifiable target for therapeutic measures to prevent cin in future randomized trials , where patients with ntprobnp > 682 pg / ml may be the optimal target subjects .
backgroundnterminal probrain natriuretic peptide ( ntprobnp ) has been associated with important risk factors for contrastinduced nephropathy ( cin ) . however , few studies have investigated the predictive value of ntprobnp itself . this study investigated whether levels of preprocedural ntprobnp could predict cin after elective coronary angiography as effectively as the mehran cin score.methods and resultswe retrospectively observed 2248 patients who underwent elective coronary angiography . the predictive value of preprocedural ntprobnp for cin was assessed by receiver operating characteristic and multivariable logistic regression analysis . the 50 patients ( 2.2% ) who developed cin had higher mehran risk scores ( 9.55.1 versus 4.83.8 ) , and higher preprocedural levels of ntprobnp ( 53207423 versus 10782548 pg / ml , p<0.001 ) . receiver operating characteristic analysis revealed that ntprobnp was not significantly different from the mehran cin score in predicting cin ( c=0.7657 versus c=0.7729 , p=0.8431 ) . an ntprobnp cutoff value of 682 pg / ml predicted cin with 78% sensitivity and 70% specificity . multivariable analysis suggested that , after adjustment for other risk factors , ntprobnp > 682 pg / ml was significantly associated with cin ( odds ratio : 4.007 , 95% ci : 1.950 to 8.234 ; p<0.001 ) and risk of death ( hazard ratio : 2.53 ; 95% ci : 1.49 to 4.30 ; p=0.0006).conclusionspreprocedural ntprobnp > 682 pg / ml was significantly associated with the risk of cin and death . ntprobnp , like the mehran cin score , may be another useful and rapid screening tool for cin and death risk assessment , identifying subjects who need therapeutic measures to prevent cin .
a manifestation of severe insulin resistance , rabson - mendenhall syndrome presents with florid metabolic , cutaneous and systemic features thereby revealing the manifold effects of insulin on metabolism . first described by rabson and mendenhall in 1956 in three siblings presenting with dental and skin abnormalities , abdominal distension , coarse facies , early dentition , hirsutism , phallic enlargement and pineal hyperplasia , rabson - mendenhall syndrome ( rms ) is a rare insulin resistance syndrome of unknown prevalence . there is paradoxical fasting hypoglycemia and post - prandial hyperglycemia initially in life , followed by constant hyperglycemia ( by 4 years of age ) and constant ketoacidosis by 6 years of age . although insulin levels are extremely elevated initially and then decrease with age , they remain higher than normal . this case is being presented to highlight the wide spectrum of manifestations of this syndrome for its rarity and relative paucity of reports in dermatological literature . a 13-year - old girl presented with complaints of progressively increasing blackish discoloration of the folds of the body [ figure 1 ] , polydipsia and polyuria . the girl was first in birth order , born of a consanguinous marriage after a full - term uneventful pregnancy . the girl was found to have a coarse facies with a broad nose , prognathism and a fissured tongue . the abdomen was distended and loss of subcutaneous fat was visible [ figure 3 ] . acanthosis nigricans seen extending beyond the neck fissured tongue with overcrowding of teeth abdominal distension with loss of subcutaneous fat extensive acanthosis nigricans was conspicuous on the neck extending upto the sides of the face and the chest , the axillae , ante - cubital fossae , lower abdomen , groins , thighs , popliteal fossae and dorsum of feet proximally . the girl had a normal physical and mental development with tanner 's stage 2 breast axillary and pubic hair development . examination of the scalp revealed premature graying of hair which has not thus far been reported in any series [ figure 5 ] . routine blood counts , kidney and liver function tests were within normal limits . routine urine analysis revealed a glycosuria of 2% . fasting , postprandial and random blood sugars were 172 mg% , 708 mg% , and 387 mg% , respectively . the patients serum insulin levels were 530 u / ml ( normal range 2 - 20 u / ml ) and c - peptide levels were 46 ng / ml ( normal range 0.8 - 3.5 ng / ml ) . rms is a rare autosomal disorder characterized by severe insulin resistance , affecting males and females in equal number . severe insulin resistance is caused either by genetic defects of the insulin receptor gene ( type a ) or by the presence of circulating autoantibodies that disrupt the normal functions of the insulin receptor ( type b ) . the symptoms of rms may include intrauterine and postnatal growth retardation , dysmorphisms , nail , teeth , and skin abnormalities . the patients characteristically develop fasting hypoglycemia and postprandial hyperglycemia followed by , as the disease progresses , persistent hyperglycemia which eventually leads to persistent ketoacidosis . the paradoxical fasting hypoglycemia is caused by inappropriately elevated insulin levels at the time of fasting , due to excessive production of insulin by the pancreas , coupled with the prolonged half - life of the hormone . in individuals with rms , the body may attempt to compensate for insulin resistance by increasing insulin secretion , which may lead to excessive insulin levels in the blood ( hyperinsulinemia ) . hyperinsulinemia may result in certain features associated with rms such as acanthosis nigricans , hypertrichosis , and polycystic ovaries . as rms progresses , insulin levels decrease and are no longer capable of suppressing hepatic glucose production and release resulting in constant hyperglycemia . when insulin levels decrease further , their capacity to suppress fatty acid oxidation is compromised , and constant ketoacidosis ensues . the progressive decline in insulin levels mimics what is observed in patients with type 2 diabetes though at a faster rate . the changes observed in rms in a few years require decades in type 2 diabetes . even in rms the mutations in the insulin receptor gene cause a spectrum of inherited insulin - resistance syndromes ranging from severe leprechaunism to type a insulin resistance ( usually evident after puberty ) ; rms has an intermediate phenotype with survival beyond one year but death usually before puberty . leprechaunism ( donohue syndrome ) and rms both are autosomal recessive conditions with abnormal alleles for insulin receptors . affected infants may have distinctive abnormalities of the head and face ( craniofacial ) region , low birth weight , skin abnormalities and abnormal enlargement of the breast and clitoris in females and the penis in males . they present with more severe manifestations and do not develop ketoacidosis , their major problem being fasting hypoglycemia . rms differs from leprechaunism by being less severe , and by the presence of premature and dysplastic dentition , coarse facial features , gingival hyperplasia , pineal hyperplasia , and survival beyond 1 year of age . leprechaunism and rms should be considered as a continuous spectrum , in which the specific mutation and the degree of impairment of insulin action predict the survival , rather than the types of the syndrome . another disorder , acanthosis nigricans with insulin resistance type a , also caused by mutations in the insulin receptor gene , is a rare form of acanthosis nigricans characterized by skin abnormalities , insulin resistance , hyperinsulinemia , potential development of diabetes ; multiple cysts on the ovaries , increased androgens levels and/or hirsutism represents a milder phenotype . they are a group of rare metabolic disorders characterized by abnormalities in adipose tissue associated with total or partial loss of body fat , abnormalities of carbohydrate and lipid metabolism , severe insulin resistance and immune system dysfunction . apart from differences in physical appearance , high triglyceride levels and low hdl levels are observed in patients with lipodystrophy . patients with rms despite having high levels of insulin do not show raised triglyceride levels . the goal is to maintain blood glucose levels as constant as possible with the use of frequent or continuous feeds and complex carbohydrates . insulin is not effective at normal doses , minimal effects on glucose levels can be seen with extra large doses of insulin ( up to 9 u / kg per hour ) . affected individuals may receive high doses of insulin or insulin sensitizers , but in most cases this therapy ultimately proves unsuccessful . treatment may require the coordinated efforts of a team of specialists including pediatricians , surgeons , dental specialists and other health care professionals . high doses of recombinant insulin - like growth factor i ( rhigf - i ) have been used to treat individuals with ketoacidosis and it has demonstrated improvement in some affected individuals . the administration of recombinant methionyl human leptin ( r - methuleptin ) has also been shown to improve fasting hyperglycemia , hyperinsulinemia , glucose , and insulin tolerance in rms . biguanides , which may lead to an increased number of insulin receptors have also been tried with variable success . rabson - mendenhall syndrome is a genetic disorder , the treatment of which still remains far from satisfactory . newer research targeting gene therapy may help improve the clinical outcome in these patients . despite various treatment modalities , recombinant igf-1 and subcutaneous leptin therapy , which promise good results , have been tried only in a few cases .
rabson - mendenhall syndrome ( rms ) is a rare genetic disorder characterized by growth retardation , dysmorphisms , lack of subcutaneous fat , acanthosis nigricans , enlarged genitalia , hirsutism , dysplastic dentition , coarse facial features , abnormal glucose homeostasis , hyperinsulinemia and pineal hyperplasia . herein , we describe a 13-year - old girl with physical features of rms who presented to us on account of acanthosis nigricans .
the mouse epidermal jb6 cell system consists of clonal genetic variants that are sensitive ( p+ ) or resistant ( p- ) to the promotion of neoplastic transformation by phorbol esters and other tumor - promoting agents . p+ cells display ap-1-dependent phorbol - ester - inducible transactivation of gene expression , whereas p- cells have a defect in transactivation . transfection of promotion sensitivity gene pro-1 into p- cells reconstituted both p+ phenotype and ap-1-dependent phorbol - ester - inducible transactivation . p- and p+ cells exhibited induction of c - jun and c - fos messenger rna levels by phorbol ester , but p- cells had significantly lower basal and induced levels of jun mrna than p+ cells . basal and induced levels of c - jun protein were significantly lower in p- cells as well . differences in levels the 80-kda pi 4.5 protein p80 were also observed in jb6 cells as a function of preneoplastic progression ; high levels of p80 protein and mrna were observed in p- cells , intermediate levels in p+ cells , and negligible levels were observed in transformed derivatives of jb6 cells . phorbol ester treatment induced phosphorylation but not synthesis of p80 . these data are consistent with the hypotheses that ap-1 is required in the signal transduction pathway for promotion of neoplastic transformation by tumor promoter , that pro genes may control ap-1 activity , that threshold levels of jun mrna and protein may play a role in transactivation and promotion sensitivity , and that the p80 protein in jb6 cells may behave in vivo as a suppressor of cellular transformation.imagesfigure 4.figure 5 .
biologic agents specifically target cytokines or surface structures to counteract pathogenic immune activation . due to their high specificity , they usually neither exhibit organ toxicities nor inhibit other processes or interact with other drugs , even in high dosages . apart from the standard dose recommendations , as determined in phase ii and iii studies , our knowledge of alternate dosing for higher efficacy in special situations is still scarce . obesity is a common factor held responsible for compromised efficacy of fixed dosed biologics such as etanercept versus weight - based dosed medication such as infliximab , probably due to a higher distribution volume with decreased concentrations of the biologic agent . adalimumab in a dosage of 40 mg weekly versus biweekly has been shown to have an increased efficacy in patients with psoriasis previously treated with other biologics . alternatively , some experts have used doubled maintenance dosages of adalimumab 80 mg biweekly for obese patients [ pers . comm . ] . however , this strategy is very costly and , in our hands , has not proven particularly effective , although systematic studies are lacking . however , because these drugs target dynamic immunologic processes , modification of doses at critical time points , e.g. at the beginning of therapy , might yield higher efficacy than elevation of maintenance doses . hence , we increased the induction dose instead of the maintenance dose of adalimumab in an obese patient with severe psoriasis previously treated with other biologics . a 49-year - old caucasian male with obesity ( bmi 34.4 ) and arterial hypertension presented with a 32-year history of severe plaque - type psoriasis associated since 3 years with psoriatic arthritis . previously , the hla - cw6-positive patient had initially been successfully treated with the weight - based dosed efalizumab , but in 2007 , he was eventually switched to etanercept 2 25 mg weekly because of the development of psoriatic arthritis . although a decrease of the arthritis pain was noted , the pasi response was not satisfactory and the patient gained 12 kg in weight . instead of etanercept , methotrexate 15 mg s.c . once a week was started ; but pasi increased further to a score of 13.1 within 2 months . at this time point , was introduced and combined with methotrexate 7.5 mg ; however , pasi50 was not reached after 12 weeks , and infliximab was stopped again . based on the patient 's wish , we restarted efalizumab with subsequent reduction of pasi down to 2.1 until april 2009 . however , as efalizumab was drawn back from the market due to reports of progressive multifocal leukoencephalopathy , a change of treatment was required . therefore , in april 2009 ustekinumab was started at a dosage of 90 mg s.c . 1 ) within 14 weeks , and thus his impairment of quality of life reached a level of desperation , and he injected 15 mg methotrexate at week 14 on his own initiative . finally , we considered a switch to adalimumab . for this agent , the induction dose seems to be especially important , as patients started on 40 mg s.c . , such as for treatment of psoriatic arthritis , show inferior 12-week pasi75 responses [ 3 , 4 ] to induction doses of 80 mg s.c . . however , weight - adapted treatment protocols in regard to the induction dose do not exist yet . therefore , we started a therapy with adalimumab with a doubled loading dose of 160 mg in august 2009 ( fig . 2 ) , followed by a second dose of 80 mg s.c . two weeks later , and continued with the normal maintenance dose of 40 mg s.c . biweekly . this dosing protocol is effective for the treatment of crohn 's disease . within the following 12 weeks in clinical practice , fixed dosing of biologic agents as opposed to weight - based dosing seems to be relevant , especially in overweight patients . the suspicion that a drug dose optimized for the typical 70-kg patient might be insufficient for a 120-kg person , for example , is obvious , and has been shown for etanercept and alefacept , but is not yet clearly proven for adalimumab nor ustekinumab . although a consensus might be easily found that biologics must be adequately dosed in special situations , such as in obese patients or in patients previously treated with other biologics , it is not clear whether this is crucial during the induction phase or in the maintenance phase of therapy . because pathologic immune responses can be self - perpetuating processes [ 9 , 10 ] , it could be a sensible strategy to not only dampen the target cytokine with biologics , but also try to inhibit it as much as possible , especially at the beginning of therapy . accordingly , strategies with an early higher dose followed by lower maintenance doses have made their way in daily clinical protocols such as for adalimumab or infliximab . however , if early inhibition is more important than the maintenance dose , then we might be better advised to increase the starting dose in obese patients rather than the maintenance dose , such as in our indicator patient , in the hope that the pathologic immune response might be terminated early on . biologics are not easily overdosed , as complete inhibition of the target cytokine or surface antigen is the therapeutic goal already at recommended doses . their immunologic specificity is high , so that even at extreme doses , unwanted inhibition of , i.e. other cytokines , is not to be expected . in addition , in case overdose - induced side effects should occur , e.g. cardiac failure at 10 mg / kg infliximab , it might be better to overdose at the start and expect adverse reactions at the beginning of the therapy rather than run the risk of partly unknown insidious chronic changes that could result from long - term overdosing of biologics . on the contrary , underdosing of biologics might be much more problematic because of the induction of neutralizing antibodies that have also been shown to hamper the long - term efficacy of adalimumab [ 13 , 14 ] . a limitation to our observation is that we do not know whether the patient would have had a satisfactory response to the normal loading dose of adalimumab , but on the basis of the patient 's history and our experience with other patients with a similar profile of overweight and/or previous biologic therapies , we expected a further treatment failure with adalimumab in the normal dose . in addition , whether nonresponse to the normal induction scheme with subsequent increased induction dose as described here would lead to the same result remains unknown . taken together , our overweight patient with severe psoriasis and previous biologic therapy had a good clinical response to a doubled loading dose of adalimumab as used for crohn 's disease , while maintenance doses were not altered . this is a strategy that could be further evaluated for obese psoriasis patients refractory to previous treatments , including other biologics .
biologics are highly specific and exhibit few problems in regard to overdosages . in clinical practice , induction schemes with an initial loading dose and a subsequent lower maintenance dose have been established and are of higher efficacy for psoriasis than starting directly with the maintenance dose . as obese patients sometimes respond less well to standard dosages , increases of the maintenance dose , but not the loading doses , have been tried with variable success . in our study , we increased the loading ( 160 mg instead of 80 mg ) but not the maintenance dose of adalimumab in an obese patient with severe psoriasis resistant to previous biologics and methotrexate . within 12 weeks , both pasi ( 11 to 1.6 ) and dlqi ( 22/30 to 5/30 ) decreased . this strategy might be an effective and less costly alternative to doubling the maintenance doses , and could be further evaluated for psoriasis patients refractory to previous treatments .
the pediatric emergency care applied research network ( pecarn ) is a research collaboration of pediatric emergency departments ( eds ) across the united states focusing on the care of acutely ill and injured children . recognizing the need to generate definitive evidence to inform the treatment of acutely ill and injured children , pecarn was established in 2001 . led by experienced investigators with expertise in pediatric emergency care , and with the support and oversight of the emergency medical services for children ( emsc ) program of the health resources and services administration ( hrsa ) , pecarn is the first research network of pediatric eds funded by the federal government of the usa . the network is committed to conducting high - quality research in all phases of emergency care in children , including prevention , prehospital and ed treatment , and rehabilitation . pecarn leverages a combined population of more than one million children treated annually in 18 eds throughout the usa to overcome many of the barriers inherent to pediatric emergency care research . previously , the ability to generate scientific evidence regarding the optimal care of acutely ill and injured children in eds was limited by several barriers . the rarity of adverse outcomes in many pediatric conditions makes it difficult , if not impossible , to enroll a sufficiently large patient population at a single center to achieve the necessary statistical power to answer pressing clinical questions definitively . additionally , it can be difficult to obtain high quality data when enrolling patients into research studies in busy eds , as ed clinicians have multiple competing demands on their time . obtaining informed consent from the patient s family may be difficult under the stressful conditions of the ed , or even impossible if the patient s guardian is absent or also injured . the results of research findings performed in tertiary care ( research ) centers may be difficult to generalize to community hospitals , where most acutely ill and injured children are cared for . finally , translating research results into the daily practice of clinicians working in acute care settings can be challenging . the infrastruc - ture of pecarn supports collaboration on large multicenter studies and the sharing of experiences and best practices with communities of physicians , thus overcoming many of the barriers to performing pediatric emergency care research and then translating it into practice . pecarn is composed of seven research node centers ( rncs ) , located throughout the united states . funding from the united states federal government is directed to each rnc through the emsc program , established under hrsa , maternal child health bureau ( mchb ) . an independent data coordinating center ( dcc ) is also funded by emsc and works collaboratively with the rncs . the principal investigators of the rncs ( the nodal principal investigator [ pi ] ) , the pi of the dcc , and a representative from the federal funding agency form pecarn s executive committee . six of the rncs each coordinate and provide oversight of three academic children s eds , known as hospital emergency department affiliates ( hedas ) , for a total of 18 ed sites within the network . the seventh rnc was recently established and coordinates three emergency medical services agencies , instead of eds , in order to focus on pre - hospital research . each heda agrees formally to participate in any pecarn research study appropriate for its facility . members of the pecarn steering committee loosely include investigators and research coordinators from each heda , as well as dcc staff and research administrators from the rncs . only one representative from each heda and one representative from the dcc , however , comprise the pecarn steering committee voting membership , which acts as the primary governing body and arbitrator of the network . all nodal pis are voting members of the steering committee , as is the pi of the dcc . one nodal pi also serves as the chair of the pecarn steering committee , a position that rotates every three years in order to share opportunities for leadership and to ensure equity among the rncs . early in the development of the network , the pecarn steering committee established bylaws , which describe its structure and membership , its policies and procedures , and its code of ethics and conduct . pecarn s subcommittees were also established early in the network s development to advise the steering committee and perform specific tasks for the network . these subcommittees have evolved over time , to serve the ever - changing needs of the network . currently , the four subcommittees are the : protocol review and development subcommittee , which reviews specific research concepts and protocols and makes recommendations to the investigators , with the goal of improving the science of each proposal . feasibility and budget subcommittee , which reviews research concepts and protocols specifically to ensure that the studies can practicably be performed in pecarn , that budgets are sufficient to conduct the research and that funding is allocated appropriately . grant writing and publications subcommittee , which collaborates with investigators to help create study authorship plans , and reviews and critiques documents ( grants , abstracts , presentations , manuscripts ) prior to submission or presentation . quality assurance and safety subcommittee , which reviews research concepts and protocols to ensure compliance with standards for protection of human subjects , and monitors ongoing research to ensure rigorous adherence to patient safety and study protocols . the funding provided by hrsa / mchb / emsc supports pecarn s infrastructure as described above and also supports two in - person meetings of the steering committee and one in - person meeting of the pecarn executive committee per year . other ad hoc meetings and teleconferences are held throughout the year , typically to address short turn - around requests for grant proposals from federal funding agencies . investigators and research coordinators also participate in research study - specific meetings and teleconferences on a routine or as - needed basis . because funding for pecarn supports only its infrastructure costs , investigators who lead research studies that are approved / endorsed by the steering committee must compete for and be awarded extramural research grant funding in order to perform multicenter studies through the network . the typical funding sources for pecarn research include the national institutes of health , the centers for disease control and prevention , and the agency for healthcare research and quality , although the changing funding environment encourages the network to look creatively for diverse funding sources . extramural research grant funding augments the research infrastructure at participating pecarn sites and also funds study - related activities at the pecarn dcc . the pecarn dcc employs project managers and data managers , as well as both doctorate and masters - level statisticians in order to provide support and leadership of study design , coordination and statistical analysis for pecarn projects . the pecarn dcc acts as a central repository of network data and maintains highly sophisticated systems for secure transfer of electronic data . the dcc also performs a variety of quality assurance and training activities on behalf of the network and its research studies . pecarn s research priorities are guided by the network s published research agenda , which the steering committee developed in 2002 using the nominal group process and hanlon process of prioritization . using this well - established and validated qualitative process , steering committee members participated in facilitated discussions during which they identified high - priority research topics in pediatric emergency care and ranked the topics in order of perceived importance . the committee then refined the list of research priorities by taking into account each condition s prevalence , its seriousness ( i.e. , morbidity and/or mortality of the condition or the disruption it causes to society ) , and the practicality and feasibility of studying the condition in pecarn ( including the potential for external funding ) . the resulting research priorities list ( table 1 ) serves to maintain our focus on topics of great importance to emergency medical services for children . however , pecarn will diverge from the published agenda at times , for specific reasons . our success as a network is largely dependent on the desire and drive of individual investigators to have a research concept approved by the pecarn steering committee and ultimately his / her ability to secure funding to conduct the project , whether or not the topic of study is on the research priority list . one of the strengths of pecarn is the quality and scope of the research studies conducted . this strength may be credited in part to a robust and coordinated scientific review process where subcommittees work on behalf of investigators and the steering committee to refine and improve research studies during their development . this process begins with a brief preliminary research concept , which is developed in conjunction with one of the pecarn nodes . this concept may come from a member of pecarn or from an investigator outside of pecarn ; both are given equal consideration and priority . the sponsoring node conducts an initial and comprehensive concept review and discussion with member investigators and may also invite specific content experts to participate as appropriate . if the research concept is approved by the node and subsequently approved by representatives of emsc , the investigator then presents the concept to the entire steering committee at either an in - person meeting or teleconference . after the presentation , the investigator fields questions from the steering committee . the steering committee will hold a closed discussion ( without the investigator present ) , followed by a confidential vote to endorse or reject the research concept . if the concept is endorsed by the steering committee , the investigator will use the steering committee s formal feedback to improve and refine the research question and expand it into a full research protocol . this expanded protocol is the precursor to the grant application that the investigator will eventually submit for external funding . the investigator typically develops the concept into a protocol in collaboration with the pecarn dcc , often in - person during a pre - arranged working session . the pecarn dcc will engage its pi , biostatisticians and data managers to provide input into protocol development to the study pi , with consideration given to feasibility and statistical issues . after the initial protocol is developed , the pecarn subcommittees review the protocol and provide additional feedback to the investigator . after subcommittee feedback is incorporated by the study pi , the steering committee votes on the final protocol version . by reviewing and approving every research study conducted within the network , the pecarn steering committee ensures that each study meets established network research priorities and contains high - quality science , and is ultimately feasible for conduct in the network . this process also ensures that pecarn members are invested in a research study s successful completion . ultimately , this rigorous review process increases an investigator s likelihood of obtaining external funding and of performing successful studies in the network . the substantial track record of high - quality research in the network is in large part a testament to the comprehensive , collaborative and diligent process of network study development , as well as to the drive and determination of individual investigators . as pecarn evolves , the research studies we perform as a network also grow and evolve . pecarn s initial research studies were funded by core infrastructure funding only and descriptive in nature . subsequently , we received external funding for and performed several large observational cohort studies . as the network continues to mature , randomized clinical trials and studies of knowledge translation are becoming more common . one of the earliest unfunded , but nevertheless important and ongoing research studies is the pecarn core data project ( pcdp ) . in this observational , epidemiological study , specific data elements from all ed visits across all participating pecarn sites this pcdp database was used for some early research studies , including two studies comparing the availability and accuracy of administrative versus clinical data elements for pediatric emergency visits . pcdp data were also used to demonstrate differences in ancillary testing ( chest radiography and laboratory studies ) associated with patient , provider , and hospital characteristics among children with asthma . additionally , pcdp data were used to develop a consensus - based and clinically sensible diagnosis grouping system . the diagnosis grouping system includes 21 groups and 77 subgroups , which account for the vast majority of diagnoses among pediatric ed visits . study investigators also developed a diagnosis - based severity classification system associated with actual measures of ed resource use . as pecarn research studies are now more frequently interventional trials , pcdp data continue to be essential in providing background data , generating hypotheses , and determining feasibility of conducting prospective studies , including the likelihood of obtaining adequate sample sizes in children with specific medical and traumatic conditions . pecarn investigators also have performed large , observational cohort studies to develop clinical prediction rules for pediatric patients who have experienced blunt trauma . using both prospective cohort and retrospective case - control methodology , investigators attempted to identify pediatric patients who were at low risk for severe intracranial , intra - abdominal , and cervical spine injuries after blunt trauma and in whom evaluation may be safely limited , and radiation from radiography avoided [ 10 - 12 ] . the largest of these studies was a prospective cohort study of 42,412 children with minor blunt head trauma . based on data from these patients , two clinical prediction rules were derived and validated , one for patients < 2 years and another for those 2 years until their 18th birthday . the rules reliably identify patients at very low risk of clinically important traumatic brain injuries . sub - analyses of data from this study demonstrated the likelihood of clinically important traumatic brain injury associated with presence of several isolated individual risk factors [ 13 - 16 ] . all of these studies and sub - studies provide the evidence to help clinicians limit computed tomography ( ct ) use to only those children at non - negligible risk of clinically - important traumatic brain injuries after trauma . a similarly designed , cohort study of 12,044 children with blunt torso trauma resulted in a prediction rule using patient history and physical examination findings to identify those at very low risk for intra - abdominal injuries requiring acute intervention . additionally , pecarn performed a large retrospective case - control study of 540 children with cervical spine injuries from blunt trauma , comparing these patients to 2,774 controls . pecarn investigators are planning to pursue further study of cervical spine injuries in a prospective fashion with the goal of limiting the use of cervical immobilization and radiation in children with blunt trauma . another focus area of pecarn research is improving the safety of care delivered to children in the ed . in this area , pecarn investigators performed a research study describing ed characteristics related to and staff perceptions of safety , as well as a study describing the frequency and characteristics of medication errors in pediatric eds . additionally , pecarn investigators developed an infrastructure for reporting and analyzing safety events occurring in eds throughout the network . toward the goals of developing standards and methods for measuring the quality of care delivered in pediatric eds , one group of investigators identified and categorized performance measures relevant to pediatric emergency care . another group is completing analysis in a study to assess the consistency , reliability , and validity of a specific assessment tool to evaluate the quality of care provided at pediatric ed visits ( data analysis ongoing ) . that study is also attempting to identify hospital , ed , physician , and patient level factors that influence the quality of care delivered to ill and injured children in the ed . yet another ongoing study pertaining to the quality of care delivered in the pediatric ed uses the electronic health record , as well as natural language processing , to compare severity - adjusted quality measures of care across different institutions . in that study , investigators are using data from a registry of electronic medical records at six hospitals within the network . this novel pecarn registry is using state - of - the - art information technology with the goal of providing feedback to clinicians regarding their practice patterns and whether they are achieving accepted quality metrics in the care of acutely ill and injured children . as pecarn has matured , it has also demonstrated the ability to perform large , randomized clinical trials which seek to provide definitive evidence regarding treatment of acutely ill and injured children . pecarn s first randomized controlled trial was a double - blind comparison of oral dexamethasone versus placebo in infants with moderate - to - severe bronchiolitis . this study was conducted at 20 pecarn sites and demonstrated no difference between the groups in admission rates or respiratory status after four hours of observation . this high - profile study has been widely referenced and hopefully has decreased the inappropriate use of corticosteroids in this population . in another large , double - blind , randomized pecarn trial , investigators demonstrated no improvement in the safety or efficacy of intravenous lorazepam over diazepam in the treatment of pediatric status epilepticus . this study was particularly significant because it represented the first pediatric study in the usa that was granted federal exception from informed consent ( efic ) for emergency research . performing a trial under efic required extensive planning and preparation as each participating hospital engaged in a mandatory period of community consultation where the surrounding public was informed that children presenting to the hospital in status epilepticus may be enrolled and randomized before the guardians consented for their children to participate in the study . clinical trials performed under efic are likely to become more frequent in pecarn s future , as the network tries to address more complicated clinical issues under emergent situations . with its experience and large patient populations , pecarn is poised to perform trials to definitively answer even more complicated and challenging medical and traumatic controversies . a trial of therapeutic hypothermia after pediatric cardiac arrest seeks to determine if this practice , previously studied in adults , should be applied to children after cardiopulmonary arrest . this study includes children who have experienced cardiac arrest , either out - of - hospital or in the in - hospital setting . the in - hospital arrest arm of this trial is nearing completion ; the out - of - hospital arrest arm has already completed enrollment . another ongoing large , complex study of acutely ill children is a randomized trial of four different intravenous fluid regimens ( using a factorial study design ) in children with diabetic ketoacidosis . different rates of administration and sodium content of intravenous fluid are being compared to determine any differences in the development of cerebral injury between treatment groups . a placebo - controlled trial of probiotics to hasten recovery from acute gastroenteritis began patient enrollment in 2014 . with the large burden of diarrheal disease worldwide , this study has the potential for global impact , including in developing nations . additionally , a randomized , placebo - controlled study of intravenous magnesium for the treatment of acute pain crisis in children with sickle cell disease concluded patient enrollment very recently . knowledge translation is a logical next step for many pecarn studies , as the network has generated much evidence in the past decade , and now strives to improve the delivery of evidence - based care in eds throughout the usa and around the world one recent study investigated whether embedding the pecarn traumatic brain injury prediction rule into the electronic health record would decrease the frequency of unnecessary ct imaging in patients at very low risk for clinically important traumatic brain injuries . the results of this project are one step in helping pecarn achieve its goal of developing robust systems of studying the translation of evidence into practice . this is a particularly important goal as the network nears completion of several definitive trials for the care of acutely ill and injured children . one pecarn study is assessing new diagnostic techniques to evaluate febrile infants younger than 60 days of age . this study analyzes ribonucleic acid ( rna ) expression of blood leukocytes ( transcriptional biosignatures ) in these young infants host - responses to bacterial infections . initial analyses suggest that these new microarray techniques will allow discrimination between febrile infants with and without culture proven bacterial infections with excellent accuracy . with refinement , these techniques may eventually challenge the reference standard of bacterial culture for diagnosing serious bacterial infections in young febrile infants . current and future pecarn studies harness the screening potential of the ed in the study of pediatric and adolescent health issues . an ongoing study seeks to determine if a brief , two - question screen can accurately detect alcohol use and alcohol - related problems in adolescents . additionally , an upcoming study of adolescents in the ed will attempt to prospectively determine an optimal suicide risk screening strategy and an algorithm to triage these adolescents for immediate care or follow - up based on their risk stratification . in recent years , pecarn has also engaged in new international collaborations , contributing as a member of pediatric emergency research networks ( pern ) pern s initial research study was published in 2013 and identified clinical and patient history factors for severe outcomes in children with h1n1 influenza infections . ongoing studies with pern include a prospective , multicenter study to determine the epidemiology and management differences of acute poisonings in children in eight different regions of the world and a study of the association of pharmacotherapy and outcomes in infants presenting to the ed with acute bronchiolitis . although pecarn has overcome many of the barriers to performing ed network research and performed many successful research studies , some challenges to the network and its investigators persist . the substantial size of multicenter studies can make them unwieldy and difficult to fund and perform . in order to ensure uniform implementation of protocols and collection of high quality data , study investigators must invest in extensive initial and continuing training of study personnel . additionally , investigators must develop an explicit protocol and manual of operations describing standardized study procedures for all sites , and must monitor regularly for correct implementation . initiating a study at multiple sites is time consuming and requires an initial face - to - face meeting of many investigators , as well as ongoing meetings either electronically or in person . secure and timely transmission of data from study sites to the lead site and/or the data - coordinating center must be established . in pecarn , all studies must be reviewed and approved by the local institutional review board ( irb ) or ethics committee at each study site . irbs have varying standards , which often result in multiple modifications to a study protocol before its approval across all participating sites . for this and other reasons , development and implementation of a centralized irb once a study is underway , ongoing monitoring of study data , protocol implementation processes , and regulatory documentation are performed either remotely or by trained personnel who travel to individual sites . we are currently evaluating a process of virtual monitoring of study sites remotely via access to the electronic health record in order to enhance efficiencies , and decrease costs . a notable challenge which pecarn faces is obtaining adequate funding for studies . because network multicenter studies are frequently expensive compared to single institution studies , the amount of funding required to perform them frequently exceeds the standard limit of many funding agencies . in an era when only a small percentage of federal grant applications for clinical research in the usa are successfully funded , the necessity of exceeding established funding caps can further challenge the ability of investigators to obtain funding . moving forward , large networks like pecarn must be creative and diverse in seeking funding for research . even with these challenges , multicenter research within pecarn the network provides a clinical laboratory in which large - scale studies can be performed . often , small , pilot research studies suggest a benefit of a new practice or medication , and pecarn then provides the opportunity to test the study results by conducting large - scale , definitive , and potentially practice - changing research . performing a study within a network with an established reputation for performing and publishing high - quality studies may increase an investigator s chance of successfully obtaining grant funding , offsetting some of the funding challenges of research conducted outside of such a network . pecarn investigators also play a role in shaping the future of pediatric emergency medicine ( pem ) by providing crucial leadership and mentorship to the next generation of pem investigators . young investigators involved in pecarn studies directly benefit from senior mentorship and exposure to the network s research process . serving as a co - investigator or as a site pi for a pecarn study provides an introduction to the research process as well as insight into the challenges and benefits of multicenter research . involvement as a site pi on a multicenter study also offers authorship opportunities , including opportunities to be a supporting author on the study s main manuscript or the primary author on a planned secondary analysis . in recent years , pecarn has made concentrated efforts to focus on mentorship and development of future investigators . these efforts include inviting junior investigators to observe the process at network steering committee meetings . this allows them to view and participate in study proposal development and provides them access to the mentorship and guidance of experienced investigators . specific training sessions are held annually during which junior investigators present their research concepts for constructive review by senior pecarn investigators , many of whom are content experts as well as seasoned researchers who have conducted one or more large multicenter studies . if a junior investigator s research concept is accepted for review by the pecarn steering committee , he or she also benefits from the feedback of experienced statisticians and epidemiologists at our independent data coordinating center . participation in pecarn fosters development and growth of a solid research program at local institutions by helping to instill a culture of research ( particularly in multicenter / collaborative research ) and by providing specific infrastructure in the form of support for research and study coordinators . pecarn has evolved substantially since its inception in 2001 , with progression from retrospective epidemiologic studies to prospective observational studies and then to interventional trials and implementation research . as it moves into the future , pecarn will continue to pursue its mission of performing high - quality and definitive research in the prevention and treatment of acute illnesses and injuries in children . it is critical that evidence generated by pecarn research be disseminated , implemented , and incorporated into the care of children in various acute care settings . in partnership with emsc , pecarn strives to be a leader in pem in each step of this continuum . through leadership , mentorship , and development of new and junior investigators , pecarn hopes to ensure the continuation of high - quality pem research over time . finally , through increased and broadening collaboration both nationally and internationally , pecarn will continue to generate and widely disseminate new evidence in the care of acutely ill and injured children .
in this article , we review the history and progress of a large multicenter research network pertaining to emergency medical services for children . we describe the history , organization , infrastructure , and research agenda of the pediatric emergency care applied research network ( pecarn ) , and highlight some of the important accomplishments since its inception . we also describe the network s strategy to grow its research portfolio , train new investigators , and study how to translate new evidence into practice . this strategy ensures not only the sustainability of the network in the future , but the growth of research in emergency medical services for children in general .
adequate function of the extensor mechanism after total knee arthroplasty ( tka ) is essential for a successful clinical outcome as well as participation in daily living activities12 ) . quadriceps strength is the major determinant of extensor mechanism function , which is affected by a variety of factors in tka . single - radius ( sr ) and multi - radius ( mr ) femoral designs are believed to have different levels of influence on the recovery of quadriceps muscle strength345 ) . sr implants are designed to have a more posterior center of rotation , thus increasing the moment arm of the patellar tendon , requiring less quadriceps force , and lessening the load on the patella6 ) as demonstrated in cadaver studies3478 ) . furthermore , the sr design has a theoretical advantage of minimizing ligament instability during mid - flexion based on maintenance of ligament isometry through the entire range of motion ( rom)910 ) . few studies have extensively compared the sr and mr femoral components , and most of which focused on the clinical scores and rom11121314 ) . it is difficult to find studies that include preoperative or sequential follow - up data on quadriceps strength assessed in an objective manner12 ) . the purpose of the current study was to determine whether the theoretical advantage of the sr femoral design with regard to quadriceps recovery could be realized in a clinical setting . based on the theoretical advantage of the sr design documented in published research , we derived and tested the following hypotheses : 1 ) the quadriceps force and power values would be higher in the sr femoral design group ; 2 ) the proportion of patients with physiological levels of quadriceps force and power would be higher in the sr group ; and moreover we compared the clinical outcome based on the american knee society score ( akss ) between two groups . a total of 164 patients ( 164 knees ) who underwent elective primary tka were initially enrolled in the study . the indication for surgery was degenerative osteoarthritis in all patients . in order to rule out the influence of gender difference in muscle strength on the results , the study population was composed of female only . the exclusion criteria were the presence of following conditions : 1 ) 30 of flexion contracture ; 2 ) < 100 of rom arc ; 3 ) valgus deformity ; 4 ) diagnosis other than primary osteoarthritis such as inflammatory arthritis , haemophilic arthropathy , or posttraumatic arthritis ; and 5 ) a history of cerebrovascular accidents or presence of knee pain restricting ambulation or decreasing muscle strength of the lower limb . after excluding 44 knees based on the above - listed criteria ( fig . 1 ) , we evaluated the preoperative and postoperative clinical data of 120 consecutive tkas performed using a midvastus approach . the 120 patients were assigned using a computer - generated randomization table into the sr group and the mr group . sample size was calculated from a pilot study aimed at determining whether the quadriceps force ( primary outcome ) is significantly higher in the sr group at 1 year after surgery . the required sample size was calculated as 108 ( 54 per each group ) assuming a two - sided type i error rate of 0.05 and a power of 0.80 . ultimately , 120 patients were included in the study to allow for a 10% attrition rate at 12 months after surgery . this study was conducted with institutional review board approval and informed consent from all patients . the surgery was performed by the same surgeon ( kim ki ) via a minimally invasive approach in all patients . the sr group received the triathlon ( stryker orthopaedics , mahwah , nj , usa ) and the mr group received the pfc sigma ( depuy , warsaw , in , usa ) . pfc sigma is designed with several axes of rotation , the so called mr design : the axes make j - curve and have various radius sizes not defined as single range . triathlon is designed with single axis of rotation : the center of axis is about the transepicondylar axis and the single size of radius ranges from 10 to 110. in order to eliminate any influence of difference between the cruciate retention component and posterior stabilizing component , the implant was a posterior stabilized design in all patients . bone - cement ( simplex p , stryker orthopaedics ) was used for fixation in all knees . in both groups , patella resurfacing was performed if the patient was over 60 years of age and presented with grade iii arthritis , apparent anterior knee pain , and a patellar thickness of 20 mm . general anesthesia was used during surgery , and patient - controlled analgesia and intraoperative periarticular injection were administered for pain control . the postoperative rehabilitation regimen was identical for both groups . in order to obtain objective numeric data , we assessed the extent of quadriceps recovery using a dynamometer at the same time points until the first postoperative year and compared the values obtained from the sr group and mr group for analysis . for quantification of the extent of quadriceps recovery , quadriceps strength was assessed using the baltimore therapeutic equipment primus ( bte , hanover , md , usa ) preoperatively and 6 weeks , 3 months , 6 months , and 1 year postoperatively . the patient was seated on the chair of the dynamometer with the shoulder and hip tightly secured by a strap . the patient was informed about the testing procedures in advance so that the test could be conducted with the understanding and consent of the patient . the testing was performed by an independent physical therapist who did not participate in the surgery and was blinded to the group allocation . quadriceps force was measured in newtons and quadriceps power was measured in watts , and the measurements were recorded by an automated system . quadriceps force was defined as the maximum isometric effort exerted during full extension from 90 of knee flexion . quadriceps power , which refers to the amount of work per unit of time , was measured by asking the patient to maintain 60 of knee flexion and extension as long as possible during a period of 10 seconds under the application of a load equal to 50% of the quadriceps force . a value was accepted as valid if it was in the proximity of the other measured values ; if a value deviated considerably from the other values , measurement was repeated assuming an error had occurred . to evaluate the extent of quadriceps recovery , quadriceps force and power values and the percentage of improvement compared to the preoperative value preoperatively , weight - bearing anteroposterior , lateral , and 45 flexion radiographs of both knees , merchant views , and standing long leg radiographs were obtained in all patients . at 6 days , 6 weeks , 3 months , 6 months , and 12 months after surgery , anteroposterior and lateral radiographs and long leg standing radiographs were acquired . the rom and akss knee / function score were assessed preoperatively and at each follow - up session . all statistical analyses were performed using the spss ver . 16.0 ( spss inc . , the quadriceps force , akss ( knee score and function score ) , and rom were compared between the groups using independent sample t - tests . a chi - square test was used for comparison of the extent of recovery of the quadriceps force and power relative to the preoperative level at each follow - up session between the groups . for comparison of changes between the preoperative and follow - up quadriceps force values , ultimately , there were 55 patients in the sr group and 54 patients in the mr group . there was no significant intergroup difference with regard to patient demographics ( table 1 ) . the quadriceps force and power measured preoperatively and at every follow - up session until 1 year after the surgery were not significantly different between the groups ( table 2 ) . no notable intergroup difference was observed at each follow - up session with regard to the proportion of patients who achieved their preoperative levels of quadriceps force and power after tka . in both groups , the mean postoperative quadriceps force at 6 months could reach the preoperative level , and the mean postoperative quadriceps power at 3 months could reach the preoperative level ( figs . 2 and 3 ) . at 1 year after surgery , over 80% of the patients in both groups showed higher values than their preoperative quadriceps force and power ( table 3 ) . the rom and akss knee / function score at 1 year after surgery were significantly improved , but no intergroup difference was found ( table 4 ) . the principal finding of this study was there was no notable difference in quadriceps recovery related to the radius design of the femoral component . postoperative extensor mechanism function in tka has a considerable influence on a broad range of activities . therefore , restoration of extensor mechanism function is essential for a favorable clinical outcome and patient satisfaction15 ) . quadriceps strength that reflects extensor mechanism function is regarded as a major predictor of clinical outcome of tka , and the radius of curvature of the femoral component appears to affect quadriceps recovery . in particular , there are extremely few studies that provide quantitative data on the extent of quadriceps recovery that is considered as the primary benefit of the femoral component with a single sagittal radius12 ) . one study12 ) attempted to demonstrate the superiority of a sr femoral design in terms of postoperative quadriceps function with quantifiable data obtained using a dynamometer . however , the study had some limitations that could compromise the validity of the results , such as the difference in the follow - up period between the sr group and the mr group . therefore , we attempted to design a study based on more reliable and comprehensive data . in a retrospective study comparing 30 patients with a sr design and the equivalent number of patients with a mr design , the sr group exhibited higher extension peak torque and flexion / extension ratio12 ) . considering that the last parameter best reflects quadriceps function , the study suggests that the sr design is superior in terms of short - term functional outcome . however , their preoperative values and sequential follow - up data were not available in the study . the analysis of the study was based solely on the final follow - up data . thus , it was difficult to determine whether there was no inherent preoperative difference in muscle strength between the groups . in addition , the final follow - up assessment was performed later in the sr group . wang et al.16 ) however , there were differences in age and follow - up periods between the groups , and the number of cases was relatively small ( 8 in each group ) . on the other hand , hall et al.13 ) reported there was no statistically significant difference between the sing - radius group and the mr group with regard to quadriceps function that was evaluated , without using a dynamometer though , based on the ability to rise from a chair without assistance . in the current study , the objective quadriceps force and power assessed using a dynamometer were not significantly higher in the knees with a sr femoral component than those with a mr femoral component at each follow - up session until 1 year after tka . moreover , the proportions of patients with the postoperative quadriceps force and power the same or even beyond the preoperative level were not different between the groups . these findings may support the above study and femoral component design itself has no significant influence on the quadriceps recovery after tka . clinical outcomes of tka using sr femoral components have been published in previous studies . in a 3.9-year follow - up study comparing 426 knees with a sr design and 133 knees with a mr design , the former group obtained more satisfying results in terms of pain , stability knee flexion , stair climbing , clutching walking , and akks knee / function score11 ) . however , the number of subjects was not equivalent between the groups and there was a follow - up loss of 20% . jo et al.17 ) described there was no significant difference with regard to the hospital for special surgery scores and womac ( western ontario and mcmaster universities ) scores between the sr femoral design group and the mr femoral design group . these studies indicate there is still no consensus on the relationship between the radius of curvature of the femoral component and the clinical outcome of tka . in our cohorts , we could not observe intergroup difference with regard to the akss knee / function score and rom . it might be reasonable to surmise that clinical outcome of tka is not solely dependent on the difference of radius of the femoral component but on a variety of factors such as preoperative education , pre - emptive analgesia , local infiltration anesthesia , minimally invasive technique , and postoperative rehabilitation1819 ) . there are conflicting reports on the recovery of quadriceps after tka compared to the preoperative status . some studies showed that quadriceps strength after tka was less than or rarely recovered to the normal level2021 ) . they attributed this to persistent muscle weakness , surgical trauma during tka , and age - related muscle recovery dysfunction . on the contrary , other studies demonstrated substantial improvement compared to the preoperative condition2223 ) . in the current study , the mean quadriceps force and power assessed using a dynamometer at 1 year after surgery were improved compared to the preoperative status in both groups , and most of the patients achieved preoperative levels of quadriceps strength . in both groups , the mean quadriceps force at 6 months postoperative and the mean quadriceps power at 3 months postoperative were higher than the preoperative mean values . we believe it could be achieved by a complex interaction of minimally invasive technique using a mini mid - vastus approach and early rehabilitation protocol through multimodal pain control . one of the strengths of this study is that it is , to our knowledge , the first study that provides an analysis of preoperative and sequential follow - up data on quadriceps strength measured using a dynamometer . in contrast to previous studies that base their analyses only on final follow - up session data , we attempted to rule out the influence of physiological muscle strength difference between groups in order to enhance the credibility of the study results . in addition , this is a well - designed randomized , prospective study with a sufficient sample size . another significance of this study is that not only the isometric strength but also the amount of work per unit of time and the extent of recovery were assessed based on the quadriceps force and power measurements , which enabled more accurate evaluation of quadriceps strength after tka . furthermore , our study provided quantitative data on the improvement of quadriceps strength after tka that was achieved irrespective of the type of femoral components . first , additional potential advantages of the sr design with regard to mid - flexion range stability and patellofemoral joint were not addressed in the study . this was because the current study was focused on the assessment of quadriceps function recovery , not on the investigation of all benefits of the sr design . in our opinion , however , there is a low likelihood that the theoretical benefit of patellofemoral joint force reduction can be realized in clinical practice , considering that there was no case with anterior knee pain in both groups . we are unaware of studies that demonstrate the influence of patellar resurfacing in tka on quadriceps function recovery . patellar resurfacing vs. non - resurfacing in tka has been the subject of controversy . however , some meta - analysis studies suggest that patellar resurfacing has no significant clinical implication and reduces the incidence of reoperations related to patellofemoral joint conditions24252627 ) . therefore , assuming patellar resurfacing was not a factor associated with postoperative quadriceps recovery , we performed the procedure in both groups according to the same criteria adopted by our institution . the incidence of patellar resurfacing was not significantly different between the groups ( sr group , 19/55 ; mr group , 21/54 ) . we believe the influence of patellar resurfacing on quadriceps recovery should be examined further in future research . the sr femoral design was not superior to the mr femoral design in terms of quadriceps recovery during the 1-year follow - up after tka . in addition , the two femoral designs did not result in significant differences with regard to postoperative clinical scores and rom . thus , our findings suggest the femoral component design itself would not influence the quadriceps function after tka .
purposealthough single - radius ( sr ) designs have a theoretical advantage in quadriceps recovery following total knee arthroplasty ( tka ) , there has been a paucity of objective evaluation studies.materials and methodsone hundred and twenty minimally invasive tkas were prospectively randomized by a single surgeon into 2 groups : sr design tka group and multi - radius design tka group . quadriceps force and power were assessed using a dynamometer , and clinical data were investigated preoperatively and 6 weeks , 3 months , 6 months and 1 year postoperatively.resultsthere were no differences between two groups in quadriceps recovery and clinical results throughout the follow - up period . furthermore , the proportion of patients whose postoperative quadriceps force and power reached preoperative level was similar in both groups.conclusionsfemoral component design itself would not significantly influence quadriceps recovery after tka .
population aging is occurring in all the major areas of the world ; globally , the share of older people ( 60 years and older ) increased from 9% in 1994 to 12% in 2014 , and it is expected to reach 21% by 2050.1 there are critically important issues related to the aging society , such as future intergenerational relations and tensions , socioeconomic disparities and inequalities , changes in the structure and function of the family and its capacity to serve the traditional safety - net role , the impact of technology , and the critical importance of adaptation of core societal institutions , including education , work and retirement , housing , transportation , and even the design of the built environment.2 however , the main concern in an aging population is the fact that age is highly associated with illness and disability.3,4 the assumption that increasing numbers of older people , especially very old people , per se mean a parallel rise in social protection costs is erroneous ; nonetheless , there is an association between advanced old age and disability and , in turn , with health care costs . therefore , it is important to implement active aging strategies sensitive to this relationship and aim to recognize and prevent ill health and disability,5 not only at policy level but also at individual level , since aging is not only a population phenomenon but also an experience and an individual reality.6 the world health organization ( who ) proposed a policy framework that considers active aging as a positive process of optimizing opportunities for health , participation and security in order to enhance quality of life as people age.7 this concept was further refined with the addition of lifelong learning as a fourth component , which implies the opportunity to acquire and update knowledge and skills in order to stay relevant and better assure personal security . learning is understood as a renewable resource that enhances the capacity to remain healthy ; it can occur in formal contexts ( to obtain a grade or diploma ) , nonformal contexts ( through planned activities such as workshops , short courses , and seminars ) , or informal settings ( daily life experiences ) ; lifelong learning is important because the access to information is considered a vital key to active aging.8 thus , active aging is a global policy proposed by the who on the occasion of the ii international plan of action on aging approved by the united nations general assembly in 2002 that enables people to enhance their potential for physical , social , and mental well - being throughout the whole life course and to participate in society according to their needs , desires , and capacities and , at the same time , providing them with adequate protection , security , and care when required . this new and positive vision of gerontology emerged supported by several scientific research data : 1 ) the broad plasticity of human organisms across life span,9,10 2 ) the increase of variability of human characteristics across life span,11 3 ) the historical improvement of cognitive and physical characteristics across the last century,12,13 and finally , 4 ) the postponement of aging ( from a decline and impairment perspective ) at population level.14 this new paradigm is commonly expressed through the concept active aging with a wide global variation in the terms used to comprise the notion of aging well , including active , successful , healthy , optimal , productive , positive , competent aging.15,16 although all these terms can be considered synonymous , the concept of active aging and all the others lack a precise universally agreed definition and is commonly used to mean all things to all people.17,18 this lack of scientific consensus has resulted in a variety of different applied strategies . currently , there have been developed and implemented intervention programs devoted to promote active aging among older persons . although it is a complex and heterogeneous concept , active aging is reduced to one outcome variable in most intervention programs : physical activity . in this sense for example , active ageing australia promotes physical activity for a lifetime of health and well - being , considering that physical activity enriches persons lives by supporting their ability to maintain independent , healthy lifestyles and participate in and contribute to the community.19 other intervention programs encourage physical activity by offering a personal choice - based and telephone - assisted training program,20 enhancing pro - social behavior and volunteerism,21 or outdoor activities ( such as biking),22 as strategies for promoting active aging . on the other hand , some programs understand active aging only as emotional well - being , promoting life satisfaction . for example , through interventions centered in life review strategies on specific positive events23 or in education programs of care and exercises as strategies for enhancing emotional well - being , health , and therefore active aging.24 under a different approach , intervention programs aim to promote active aging by enhancing social and intergenerational relationships25,26 or fostering empowerment and participation.27 nevertheless , there are few documented intervention programs designed to promote active aging as a multidimensional concept as well as with empirical support . vital aging is an individual active aging promotion program that considers active aging as the lifelong adaptation process of maximizing four domains : 1 ) health and independence , 2 ) physical and cognitive functioning , 3 ) positive affect and control , and 4 ) positive engagement.28 this four - domain model of active aging has been tested through structural equation modeling with several samples and different methods29 and strongly supported by scientific literature through evaluation research.3037 moreover , developments from this program have had positive evaluation results such as the i am active program , involving a wider concept of active aging , including physical activity , healthy nutritional habits , cognitive functioning , and self - efficacy for aging , as core dimensions of active aging.38 vital aging ( vivir con vitalidad ) was initially developed in 1996 as a face - to - face course at the autonomous university of madrid . the objective of the program is to promote active aging through teaching basic knowledge about aging , promoting healthy behavioral lifestyles ( physical exercise , nutrition ) , training strategies for optimizing cognitive functioning and compensating potential cognitive declines , optimizing positive affect , emotion , and control , and promoting social relationships and social engagement throughout the life course using new technologies . currently , the program has different versions : vital aging face - to - face ( va - ff ) , participants attend 2/3-hour group sessions , held twice a week during 10 weeks . sessions are conducted by an expert trainer.vital aging - m ( va - m ) is the multimedia version of the program where participants attend group sessions to watch video lessons on tv taught by european experts from germany , italy , and spain ( voices were translated to spanish ) ; a trained tutor is in charge of the dvd s management.vital aging - elearning ( va - el ) is the online version and was adapted cross - culturally ; materials were designed to be used via internet and implemented through the learning management system moodle platform . students had a set of learning resources such as self - evaluation , reading , activities , forums , and tutorials . it was implemented between 2010 and 2012.vital aging - ocw ( open course ware ) , the course is supported by the autonomous university of madrid in the website http://ocw.uam.es/cursos/vivirconvitalidad/index.html ; it is an open course available to any people around the world . for this version , eight video lessons were selected from the multimedia version materials , based on their relevance to promote active aging ; each one includes practical and theoretical contents and a final assessment , as well as supporting materials . course duration is 36 hours.vital aging has also an internet webpage http://www.envejecimientoactivo.es , where materials are available for older adults ( only in spanish ) , and in this way , they can be self - administrated or can be used by professionals and implemented as a structured program . vital aging face - to - face ( va - ff ) , participants attend 2/3-hour group sessions , held twice a week during 10 weeks . vital aging - m ( va - m ) is the multimedia version of the program where participants attend group sessions to watch video lessons on tv taught by european experts from germany , italy , and spain ( voices were translated to spanish ) ; a trained tutor is in charge of the dvd s management . vital aging - elearning ( va - el ) is the online version and was adapted cross - culturally ; materials were designed to be used via internet and implemented through the learning management system moodle platform . students had a set of learning resources such as self - evaluation , reading , activities , forums , and tutorials . vital aging - ocw ( open course ware ) , the course is supported by the autonomous university of madrid in the website http://ocw.uam.es/cursos/vivirconvitalidad/index.html ; it is an open course available to any people around the world . for this version , eight video lessons were selected from the multimedia version materials , based on their relevance to promote active aging ; each one includes practical and theoretical contents and a final assessment , as well as supporting materials . vital aging has also an internet webpage http://www.envejecimientoactivo.es , where materials are available for older adults ( only in spanish ) , and in this way , they can be self - administrated or can be used by professionals and implemented as a structured program . for more details about vital aging program versions , basic principles , and theoretical model.36 the first implemented version was va - ff ; it was developed at the autonomous university of madrid as an open life course and delivered in several editions since then . the program was later transformed into a multimedia version based on the administration of video lessons with the same structure and content as in the va - ff . outcome measures of active aging for all the studies included active life , perceptions of aging , physical activity , nutrition , health , social relationships , and life satisfaction . supplementary material details information of previous outcomes of different editions of vital aging program , shown in table s1.3137 finally , although active aging is a world concept defined by the who and tested cross - sectionally across the world,39 it continues being a cross - cultural challenge ; thus , it is necessary to implement intervention strategies for helping older adults to reach this goal . in this sense , although the vital aging program is considered as an effective tool in european contexts , which has empirically demonstrated its efficacy to promote active aging through its different editions , versions , and target populations,36 the program has never been implemented in latin american population . the objective of this study is to determine the effectiveness of the vital aging program to promote active aging in mexican older adults . this is a quasi - experimental design with two experimental conditions ; the sample was recruited by convenience ( based on the institutional conditions and resources provided for the study ) . this is a semi - randomized study;40 participants were assigned to each experimental condition according to their choice , considering the schedule of the intervention . the study adopted an inter - group intra - group comparison and pretest posttest assessment . as the first experimental condition , the va - ff version was implemented , where a previously trained gerontologist conducted the sessions implemented as standard classes ; supporting materials were taken from the basic texts vivir con vitalidad ( vital aging).41 nineteen 2-hour sessions were held twice a week during 10 weeks . for the second experimental condition , the multimedia version was originally considered ; however , important observations from previous experiences were taken into account . due to technical issues when dubbing into spanish , the videos originally in english or italian were not applied directly as video lessons ; instead of it , they were taught in the face - to - face format . ( va - c ) because it combines multimedia and face - to - face sessions of the program . however , it is important to underline that the program was mainly multimedia ( 11 lessons ) and only one - third of it ( seven lessons ) was conducted in face - to - face format ( table 1 ) . lessons in multimedia format were implemented in a classroom equipped with tv , dvd , and a sound system ; participants attended video lessons taught by experts from spain . a trainer was in charge of the dvd s management ; supporting materials were available for the participants in a web site and they were encouraged to download them ; lessons were followed by simultaneously watching tv , listening to the expert , and reading the scripts . lessons in face - to - face format were according to this version and described earlier . multimedia sessions were carried out three times a week and face - to - face sessions twice a week . the total duration of the program was 30.5 hours ( 16.5 hours for multimedia and 14 hours for face - to - face sessions ) . contents and format of each session were implemented according to the four - domain model of active aging , and the detailed contents of each session were published elsewhere.36 in the control group , participants remained on a wait list , participating in the meantime in social activities organized by the senior center . after the study , they participated in the face - to - face version of the vital aging program if they were interested . for both experimental conditions , va - ff and va - c , each session has a similar structure ; it starts with a theoretical introduction of the lesson remarking its importance for a better aging based on scientific evidence . later on , practical strategies are described and reviewed , and practical exercises are implemented . participants were recruited from a senior center ( centro de atencin y desarrollo integral del pensionado cadip , direccin de pensiones del estado de jalisco [ center for comprehensive care and development of the pensioner from the direction of pensions of the state of jalisco ] ) for retired persons , former workers of the state government ( eg , teachers ) . participants lived in guadalajara city , the capitol of jalisco state located in the western region of mexico . recruitment was carried out through the notice board and dissemination in social events in the center . participants were included in the study only if they met the following criteria : 60 years and older , literate , and willing to participate . the project was reviewed and approved by the academic board of the doctoral program on behavioral sciences , at psychology faculty , university autonomous of madrid . the total sample was composed of 90 older persons , who were assigned to an experimental condition ( figure 1 ) . the sample size was determined by convenience , limited by the capacity , schedule , and resources provided by the senior center . due to institutional conditions , intervention was carried out in two trials ; in a first trial , va - ff , va - c , and a control group were included , and in a second trial , va - ff and a control group were included ; n=18 participants composed each group . for this study , participants in the two va - ff groups , as well as the two control groups , were joined for analyses purposes , and there was no difference between the groups . the total groups included va - ff = 36 , va - m = 18 , and control group = 36 participants . the final sample was composed of n=76 , all women with an age range of 6084 years ( mean age = 65.66 years , sd = 6.48 years ) , va - ff version involved n=35 participants ( mean age = 64.7 years , sd = 5.8 years ) , va - c version n=15 ( mean age = 63.9 years , sd = 4.5 years ) , and control group n=26 ( mean age = 67.8 years , sd = 6.4 years ) . attrition for each experimental condition was va - ff = 2.77% , va - c = 16.7% , and control = 27.8% . there were no differences in age and education between participants and those who did not complete the study ; their exclusion from both the study and the analysis did not alter the similarity between groups . a pretest was conducted for outcome measures , then intervention was developed during 10 weeks , and the posttest was conducted at the end of the program . a formative evaluation was also included , at the end of each lesson , for exploring participants opinions about materials , difficulty , format , and general appreciation of the lesson and their satisfaction . participants from va - ff , va - c , and control groups were evaluated at baseline and posttest . personal appointments were made , and participants were interviewed at the senior center . for comparison purposes , the assessment was based on a battery designed for the program and used in previous studies ; these variables were considered primary outcomes , which include the following : active life explores the frequency of performing 24 different activities : intellectual ( eg , reading , solving crossword puzzles or puzzles ) , art ( eg , studying singing , playing an instrument ) , social ( eg , caring someone else , visiting friends ) , and domestic ( eg , cleaning the house , watching tv ) . response options range from nothing = 1 , some = 2 , much =3 , and pretty much = 4.42perceptions of aging explores the degree of agreement with 16 positive statements of aging ; typically , they include topics related to aging such as autonomy ( eg , i will solve problems when they appear ) , memory ( eg , my memory is as good as before ) , attitude ( eg , life is always worth ) , and perception of one s action ( eg , i am able to learn something new ) . response options range from 1= strongly disagree to 4= strongly agree , the higher the score the better the opinion.physical exercise explores the level and frequency of physical activity done in the last month ; answers range from 1= sedentary to 5= intense exercise > 3 times a week.43frequency of social relationships ; this scale explores the frequency of social activities with family , friends , and neighbors . response options range from 1= less than once a month to 5= several times a week.44satisfaction with social relationships is a measure about the degree of satisfaction about social relationships with family , friends , and neighbors ( 1= not satisfied to 5= very satisfied).44life satisfaction refers to the current level of satisfaction about the own life expressed by the person after considering both the good and the bad things he or she had lived . the scale ranges from 1= none to 4= very much , where a higher score indicates greater life satisfaction.self-efficacy for aging assesses the people s beliefs about their own capability to solve or cope future problems related to the own health , family , abilities , and functionality . it includes 10 items such as i will maintain my intellectual functioning such as now and i could solve a health problem if emerged . answer options range from 1= strongly disagree to 4= strongly agree , where a higher score means better self - efficacy for aging.43 active life explores the frequency of performing 24 different activities : intellectual ( eg , reading , solving crossword puzzles or puzzles ) , art ( eg , studying singing , playing an instrument ) , social ( eg , caring someone else , visiting friends ) , and domestic ( eg , cleaning the house , watching tv ) . response options range from nothing = 1 , some = 2 , much =3 , and pretty much = 4.42 perceptions of aging explores the degree of agreement with 16 positive statements of aging ; typically , they include topics related to aging such as autonomy ( eg , i will solve problems when they appear ) , memory ( eg , my memory is as good as before ) , attitude ( eg , life is always worth ) , and perception of one s action ( eg , i am able to learn something new ) . response options range from 1= strongly disagree to 4= strongly agree , the higher the score the better the opinion . physical exercise explores the level and frequency of physical activity done in the last month ; answers range from 1= sedentary to 5= intense exercise > 3 times a week.43 frequency of social relationships ; this scale explores the frequency of social activities with family , friends , and neighbors . response options range from 1= less than once a month to 5= several times a week.44 satisfaction with social relationships is a measure about the degree of satisfaction about social relationships with family , friends , and neighbors ( 1= not satisfied to 5= very satisfied).44 life satisfaction refers to the current level of satisfaction about the own life expressed by the person after considering both the good and the bad things he or she had lived . the scale ranges from 1= none to 4= very much , where a higher score indicates greater life satisfaction . self - efficacy for aging assesses the people s beliefs about their own capability to solve or cope future problems related to the own health , family , abilities , and functionality . it includes 10 items such as i will maintain my intellectual functioning such as now and i could solve a health problem if emerged . answer options range from 1= strongly disagree to 4= strongly agree , where a higher score means better self - efficacy for aging.43 in addition , the following secondary outcomes were assessed for all participants in order to explore a broader impact of the program : subjective health explores the current self - perception of health , considered as 4= very good , 3= good , 2= regular , 1= poor.memory objective performance , measured by digit span backward subtest.45frequency of memory problems explores how often people report forgetfulness on a variety of daily activities , such as losing the house keys , doing activities , recognizing people , etc . subjective health explores the current self - perception of health , considered as 4= very good , 3= good , 2= regular , 1= poor . memory objective performance , measured by digit span backward subtest.45 frequency of memory problems explores how often people report forgetfulness on a variety of daily activities , such as losing the house keys , doing activities , recognizing people , etc . statistical analyses were performed with spss software version 18 ( chicago , il , usa ) . data were processed to obtain descriptive statistics ( proportions , mean value , and standard deviation ) from demographic and outcome variables . inter - group comparisons were tested by one - way analysis of variance ( anova ) . a repeated - measures anova with a greenhouse geisser correction was conducted to determine if means in outcome variables differed statistically significantly between time points ( pretest and posttest ) . cohen s d was estimated to determine the effect size classified as small ( d=0.2 ) , medium ( d=0.5 ) , and large ( d0.8).46 for formative evaluation , data from 19 sessions were averaged for each version of the program . this is a quasi - experimental design with two experimental conditions ; the sample was recruited by convenience ( based on the institutional conditions and resources provided for the study ) . this is a semi - randomized study;40 participants were assigned to each experimental condition according to their choice , considering the schedule of the intervention . the study adopted an inter - group intra - group comparison and pretest posttest assessment . as the first experimental condition , the va - ff version was implemented , where a previously trained gerontologist conducted the sessions implemented as standard classes ; supporting materials were taken from the basic texts vivir con vitalidad ( vital aging).41 nineteen 2-hour sessions were held twice a week during 10 weeks . for the second experimental condition , the multimedia version was originally considered ; however , important observations from previous experiences were taken into account . due to technical issues when dubbing into spanish , the videos originally in english or italian were not applied directly as video lessons ; instead of it , they were taught in the face - to - face format . ( va - c ) because it combines multimedia and face - to - face sessions of the program . however , it is important to underline that the program was mainly multimedia ( 11 lessons ) and only one - third of it ( seven lessons ) was conducted in face - to - face format ( table 1 ) . lessons in multimedia format were implemented in a classroom equipped with tv , dvd , and a sound system ; participants attended video lessons taught by experts from spain . a trainer was in charge of the dvd s management ; supporting materials were available for the participants in a web site and they were encouraged to download them ; lessons were followed by simultaneously watching tv , listening to the expert , and reading the scripts . lessons in face - to - face format were according to this version and described earlier . multimedia sessions were carried out three times a week and face - to - face sessions twice a week . the total duration of the program was 30.5 hours ( 16.5 hours for multimedia and 14 hours for face - to - face sessions ) . contents and format of each session were implemented according to the four - domain model of active aging , and the detailed contents of each session were published elsewhere.36 in the control group , participants remained on a wait list , participating in the meantime in social activities organized by the senior center . after the study , they participated in the face - to - face version of the vital aging program if they were interested . for both experimental conditions , va - ff and va - c , each session has a similar structure ; it starts with a theoretical introduction of the lesson remarking its importance for a better aging based on scientific evidence . later on , practical strategies are described and reviewed , and practical exercises are implemented . participants were recruited from a senior center ( centro de atencin y desarrollo integral del pensionado cadip , direccin de pensiones del estado de jalisco [ center for comprehensive care and development of the pensioner from the direction of pensions of the state of jalisco ] ) for retired persons , former workers of the state government ( eg , teachers ) . participants lived in guadalajara city , the capitol of jalisco state located in the western region of mexico . recruitment was carried out through the notice board and dissemination in social events in the center . participants were included in the study only if they met the following criteria : 60 years and older , literate , and willing to participate . the project was reviewed and approved by the academic board of the doctoral program on behavioral sciences , at psychology faculty , university autonomous of madrid . the total sample was composed of 90 older persons , who were assigned to an experimental condition ( figure 1 ) . the sample size was determined by convenience , limited by the capacity , schedule , and resources provided by the senior center . due to institutional conditions , intervention was carried out in two trials ; in a first trial , va - ff , va - c , and a control group were included , and in a second trial , va - ff and a control group were included ; n=18 participants composed each group . for this study , participants in the two va - ff groups , as well as the two control groups , were joined for analyses purposes , and there was no difference between the groups . the total groups included va - ff = 36 , va - m = 18 , and control group = 36 participants . the final sample was composed of n=76 , all women with an age range of 6084 years ( mean age = 65.66 years , sd = 6.48 years ) , va - ff version involved n=35 participants ( mean age = 64.7 years , sd = 5.8 years ) , va - c version n=15 ( mean age = 63.9 years , sd = 4.5 years ) , and control group n=26 ( mean age = 67.8 years , sd = 6.4 years ) . attrition for each experimental condition was va - ff = 2.77% , va - c = 16.7% , and control = 27.8% . there were no differences in age and education between participants and those who did not complete the study ; their exclusion from both the study and the analysis did not alter the similarity between groups . a pretest was conducted for outcome measures , then intervention was developed during 10 weeks , and the posttest was conducted at the end of the program . a formative evaluation was also included , at the end of each lesson , for exploring participants opinions about materials , difficulty , format , and general appreciation of the lesson and their satisfaction . participants from va - ff , va - c , and control groups were evaluated at baseline and posttest . personal appointments were made , and participants were interviewed at the senior center . for comparison purposes , the assessment was based on a battery designed for the program and used in previous studies ; these variables were considered primary outcomes , which include the following : active life explores the frequency of performing 24 different activities : intellectual ( eg , reading , solving crossword puzzles or puzzles ) , art ( eg , studying singing , playing an instrument ) , social ( eg , caring someone else , visiting friends ) , and domestic ( eg , cleaning the house , watching tv ) . response options range from nothing = 1 , some = 2 , much =3 , and pretty much = 4.42perceptions of aging explores the degree of agreement with 16 positive statements of aging ; typically , they include topics related to aging such as autonomy ( eg , i will solve problems when they appear ) , memory ( eg , my memory is as good as before ) , attitude ( eg , life is always worth ) , and perception of one s action ( eg , i am able to learn something new ) . response options range from 1= strongly disagree to 4= strongly agree , the higher the score the better the opinion.physical exercise explores the level and frequency of physical activity done in the last month ; answers range from 1= sedentary to 5= intense exercise > 3 times a week.43frequency of social relationships ; this scale explores the frequency of social activities with family , friends , and neighbors . response options range from 1= less than once a month to 5= several times a week.44satisfaction with social relationships is a measure about the degree of satisfaction about social relationships with family , friends , and neighbors ( 1= not satisfied to 5= very satisfied).44life satisfaction refers to the current level of satisfaction about the own life expressed by the person after considering both the good and the bad things he or she had lived . the scale ranges from 1= none to 4= very much , where a higher score indicates greater life satisfaction.self-efficacy for aging assesses the people s beliefs about their own capability to solve or cope future problems related to the own health , family , abilities , and functionality . it includes 10 items such as i will maintain my intellectual functioning such as now and i could solve a health problem if emerged . answer options range from 1= strongly disagree to 4= strongly agree , where a higher score means better self - efficacy for aging.43 active life explores the frequency of performing 24 different activities : intellectual ( eg , reading , solving crossword puzzles or puzzles ) , art ( eg , studying singing , playing an instrument ) , social ( eg , caring someone else , visiting friends ) , and domestic ( eg , cleaning the house , watching tv ) . response options range from nothing = 1 , some = 2 , much =3 , and pretty much = 4.42 perceptions of aging explores the degree of agreement with 16 positive statements of aging ; typically , they include topics related to aging such as autonomy ( eg , i will solve problems when they appear ) , memory ( eg , my memory is as good as before ) , attitude ( eg , life is always worth ) , and perception of one s action ( eg , response options range from 1= strongly disagree to 4= strongly agree , the higher the score the better the opinion . physical exercise explores the level and frequency of physical activity done in the last month ; answers range from 1= sedentary to 5= intense exercise > 3 times a week.43 frequency of social relationships ; this scale explores the frequency of social activities with family , friends , and neighbors . response options range from 1= less than once a month to 5= several times a week.44 satisfaction with social relationships is a measure about the degree of satisfaction about social relationships with family , friends , and neighbors ( 1= not satisfied to 5= very satisfied).44 life satisfaction refers to the current level of satisfaction about the own life expressed by the person after considering both the good and the bad things he or she had lived . the scale ranges from 1= none to 4= very much , where a higher score indicates greater life satisfaction . self - efficacy for aging assesses the people s beliefs about their own capability to solve or cope future problems related to the own health , family , abilities , and functionality . it includes 10 items such as i will maintain my intellectual functioning such as now and i could solve a health problem if emerged . answer options range from 1= strongly disagree to 4= strongly agree , where a higher score means better self - efficacy for aging.43 in addition , the following secondary outcomes were assessed for all participants in order to explore a broader impact of the program : subjective health explores the current self - perception of health , considered as 4= very good , 3= good , 2= regular , 1= poor.memory objective performance , measured by digit span backward subtest.45frequency of memory problems explores how often people report forgetfulness on a variety of daily activities , such as losing the house keys , doing activities , recognizing people , etc . subjective health explores the current self - perception of health , considered as 4= very good , 3= good , 2= regular , 1= poor . memory objective performance , measured by digit span backward subtest.45 frequency of memory problems explores how often people report forgetfulness on a variety of daily activities , such as losing the house keys , doing activities , recognizing people , etc . statistical analyses were performed with spss software version 18 ( chicago , il , usa ) . data were processed to obtain descriptive statistics ( proportions , mean value , and standard deviation ) from demographic and outcome variables . inter - group comparisons were tested by one - way analysis of variance ( anova ) . a repeated - measures anova with a greenhouse geisser correction was conducted to determine if means in outcome variables differed statistically significantly between time points ( pretest and posttest ) . cohen s d was estimated to determine the effect size classified as small ( d=0.2 ) , medium ( d=0.5 ) , and large ( d0.8).46 for formative evaluation , data from 19 sessions were averaged for each version of the program . the socio - demographic characteristics of participants in the two experimental and the control groups are shown in table 2 . both versions of the program were compared in order to know older adults perception about different conditions of each version ( lesson characteristics , proposed exercises , trainer abilities , graphics and images presented , understanding and doubts , duration , general satisfaction , and usefulness ) of the vital aging program as well as their satisfaction . results are shown in table 3 . a few but important differences between the two experimental conditions can be observed . participants in the combined version ( va - c ) considered that the lessons reviewed in each session during the program were more interesting and new , compared to those who participated in the face - to - face ( va - ff ) version ( p<0.05 ) . in the same sense , they evaluated both the exercises and the examples used during the program as more interesting ( p<0.05 ) . in general , older adults who participated in the version va - c ( which combined multimedia and face - to - face sessions ) reported being more satisfied with the program , compared to those participating only in the face - to - face sessions ( p<0.05 ) . the results of inter - group comparisons showed that there were no significant differences in pretest in almost all variables . differences between va - ff and control groups were found only in active life ( p<0.01 ) and perception of aging ( p<0.001 ) , where the control group had a better score . however , these differences were not maintained in the posttest comparison due to the significant improvement of va - ff after the intervention . inter - group comparisons in the posttest showed no significant differences between groups in any variable ; only in the memory performance , va - ff group reported better performance than the control group ( p<0.05 ) . on the results of intra - group comparisons , regarding the performance of activities or active life , participants in the va - c version reported a significant increase in frequency of activities ( f1,11=7.427 , p=0.02 , partial =0.403 ) , with a medium effect size of d=0.68 ; in the va - ff group , a trend of improvement in activities was observed ( f1,30=3.805 , p=0.06 , partial =0.113 ) with a small effect size ( d=0.25 ) , while the control group remained with no significant changes . perceptions on aging improved significantly in participants of both va - ff ( f1,30=121.41 , p=0.000 , partial =0.802 ) and va - c ( f1,11=55.298 , p=0.000 , partial =0.834 ) versions , with very large effect sizes of d=1.95 and d=2.10 , respectively . no effects in physical activity , subjective health , or life satisfaction were found in either versions of the vital aging program ( p>0.05 ) , although a medium effect size in life satisfaction was observed ( d=0.51 ) in the va - c group . regarding social relationships , although a significant increase on the frequency of relationships with family , friends , and neighbors was not observed ( p>0.05 ) , participants of the living version va - ff reported higher satisfaction in their social relationships after the program ( f1,30=7.142 , p=0.013 , partial =0.215 ) , with a medium effect size of d=0.49 , meanwhile participants in the combined version and the control group remained without significant changes . considering the effects of the program on the participant s memory , those in the va - ff version reported a significant improvement on their memory performance after the intervention ( f1,30=67.77 , p=0.019 , partial =0.708 ) , with a medium effect size of d=0.50 , and a trend to report less frequency of memory problems ( f1,30=3.429 , p=0.074 , partial =0.106 ) , with a small effect size of d=0.28 . in contrast , those who participated in the va - c version and the control group remained without significant changes in memory outcomes . on the other hand , both va - ff ( f1,30=29.265 , p=0.000 , partial =0.520 ) and va - c ( f1,11=34.385 , p=0.000 , partial =0.775 ) reported a significant improvement in self - efficacy for aging , with the effect sizes being large for both versions of the program ( d=0.75 and d=0.59 , respectively ) . the study s findings show that the vital aging program in the face - to - face and combined ( multimedia / face - to - face ) versions improves some active aging indicators or outcomes in mexican older persons . specifically , after both versions , participants reported significant higher frequency of cultural , intellectual , and social activities than the control group and had better views about aging , more satisfaction with social relationships , and better self - efficacy for aging . older adults in va - ff also reported better memory performance , a better perception of it , and a trend to have less memory problems , while older persons in va - c showed a trend to have better life satisfaction . these results are , in general , similar to those in spanish editions , which reveal the consistency of the program in different populations and place the program as an effective cross - cultural intervention to promote active aging . specifically , in this study , it was found as an outcome the increase of activities or active life in older adults participating in the program ; this finding is consistent with the reports of previous editions , whether in a face - to - face33,34 or multimedia version.3032,37 in addition to this evidence , a version combining both formats is also effective . the fact of being involved on a variety of activities ( cultural / artistic , intellectual , social ) is important in old age , due to its impact on different dimensions of life . for example , in a review that analyzed qualitative , quantitative , and mixed methods , including different artistic activities such as music and painting , it was found that artistic engagement could contribute to health and quality of life in older adults.47 in the same way , it has been reported that active participation in arts such as dance , expressive writing , music ( singing and instrumental ) , theater arts , and visual arts has been related to mental and physical improvements in memory , creativity , problem solving , everyday competence , reaction time , balance / gait , and quality of life.48 a remarkable finding in this study is the improvement in perceptions of aging , which is consistent in all previous editions of the vital aging program , whether face - to - face or multimedia versions , in community or nursing home settings.3035 besides , in this study , it was found that a combined ( va - c ) version is also effective in promoting positive views about aging . this is a significant outcome of the program because the evidence from other studies has shown that the ideas older adults hold about themselves , as aging people , have an influence on their own aging process . self - perception of aging is strongly influenced by the beliefs held both by the society about older adults and by themselves about the group of older adults.28 in this sense , research has shown that ideas about aging were good predictors of health and self - perception of aging predicts longevity.49 moreover , it has been found that individuals with positive self - perception of aging lived an average of 7.5 years longer than those with negative self - perceptions of aging.50 in this sense , results of this study had shown that vital aging program encourages positive beliefs about aging ( in general ) and the own aging process ( in particular ) , which finally promotes a healthy and active aging . in sum , there is strong evidence that the improved perception of aging is associated with health and longevity . regarding the impact of the vital aging program in social relationships , this study failed ( as well as previous editions ) in promoting more frequent social relationships , perhaps because the vital aging program participants had previously strong social ties . nevertheless , in this study , it was found that the group who participated in the face - to - face version reported greater satisfaction with social relationships . this result may be influenced due to the positive and good relationship among the participants in the group , but this is difficult to distinguish by the program effect itself . particularly , the unit social participation and engagement proposes very specific guidelines on how to improve social relationships ( including assertive communication with practical exercises , for example ) , underlines the importance of providing social support to others ( not only to receive it ) , and emphasizes the need of the active participation of older adults in the society and its impact for the other generations . the lessons of this unit were taught in face - to - face format for both intervention groups and seem to have had an effect on a greater social relationships satisfaction . the effects of the vital aging program related to the physical activity are controversial when compared to previous editions . in this study , no significant effects were found , while in previous studies , significant results were reported only in the multimedia format and when it is applied specifically in community settings.30,32 physical activity is a complex behavior to promote , which involves a complex and elaborate process of decision making.51 commonly , health promotion interventions seek to increase levels of physical activity by influencing personal and educational factors that contribute to physical activity behavior . however , the determinants and background of physical activity are diverse and include awareness of the physical activity message and its benefits , attitudes , and intentions toward being active , as well as supra - individual factors such as policies , environments , and cultural norms that facilitate physical activity.52 these factors should be considered in order to have a better impact in promoting physical activity , due to its importance to reach active aging . additionally , in this study , outcome variables that have not been studied previously were included , in order to explore the effects of the program in other important domains of active aging . variables were memory ( objective and subjective ) and self - efficacy for aging . both reported improvements only in the face - to - face format of the vital aging program . self - efficacy is defined as people s beliefs about their capabilities to produce designated levels of performance that exercise influence over events that affect their lives . perceived self - efficacy beliefs determine how people feel , think , motivate themselves , and behave . these include cognitive , motivational , affective , and selection processes.53 specifically , self - efficacy for aging has been studied in the vital aging program to examine to what extent it can be trained and improved . in this context , self - efficacy for aging involves the conviction for achieving a well aging by preventing and solving health problems , maintaining physical function ( independence ) , controlling emotions , solving social relationships problems ( if they appear ) , memory and cognitive issues , and the sense of being capable of accomplishing a well aging in the future . in sum , self - efficacy beliefs are strongly related to successful aging because they contribute to perceive age - related situations not as threats but as challenges , and they also support individuals to remain committed to selected goals , and self - efficacy perceptions seem to have strong associations with health and survival.28 in this study , positive outcomes with the largest effect sizes suggest that older persons strongly believe that they can achieve an active aging , and this is an important predictor of their ability to do so ; due to the sense of self - efficacy , it can even be considered precedent of behavior.54 therefore , the perception of self - efficacy for aging is related to the process of active aging.28 regarding the memory improvements , results of the vital aging program are relevant due to memory , and specifically working memory , that is considered a basic mechanism that explains age - related decline in cognitive function,55 and subjective memory is considered a predictor of the performance of memory itself.56 moreover , differences of the effectiveness between versions could be explained by the format itself . although face - to - face version implies a major interaction between trainers and classmates , a combined format ( multimedia and face - to - face ) introduces variability in techniques and strategies for education and training , which could be more stimulating and innovative for older adults , besides the idea of being involved in an international program with international trainers ( evident in lesson taught by spaniard or italian experts ) . this fact could explain that the version combining multimedia and living format was better evaluated , and participants reported more satisfaction than those participating only in face - to - face sessions . the limitations of this study include that the generalization of the results may be limited by the inclusion criteria and the characteristics of the participants ; in this case , they could be considered with exceptional conditions and do not necessarily represent the mexican older adults . participants were only women , had higher education , and received a pension ; these conditions could represent an advantage and facilitate better conditions to get benefits from the program . however , the original version of vital aging was designed for older adults with these characteristics ( spaniards ) , and then this represents a first approach , which allows a realistic idea about how the program should be adapted for being successfully implemented in a different population and being a cross - cultural effective program . sample size might also be a limitation ; in this sense , further interventions are required involving larger samples . due to this study not incorporating any blinding procedures , it must be acknowledged that the likelihood of differential treatment or assessment of outcomes , may represent bias . however , other methodologic precautions recommended to minimize potential bias have been incorporated , such as ensuring that groups involved were treated equally , and outcomes were measured as objectively as possible.57 these limitations may influence that the program still have a modest impact on some outcome variables ; however , this is a first approach to measuring the effectiveness of the vital aging program as a cross - cultural applied strategy to promote active aging , where the strengthens and challenges of the intervention begin to being identified . finally , active aging might be considered as a global strategy in the sense that it could be good for citizens of all ages because it promotes healthy life styles , but also , in terms of maximizing personal development and empowerment . therefore , it could increase the quality of life by getting the best from human capital , extending community participation and solidarity , avoiding intergenerational conflicts , and creating a fairer , more inclusive society . active older persons are a resource for their families , their communities , and the economy,5 although there is almost no acknowledgment of the substantial positive contributions and potential productivity of an aging society.2 aging as a human process is not a random phenomenon , the individual is an agent of his / her own aging process , in this sense , the capacity for aging well , healthy , and active comes , in a certain extent , from decisions taken by individuals themselves as well as their behavioral repertoires learnt across the life span.6 according to this statement , consistent results of the vital aging program ( both face - to - face or combined format ) place it as a useful cross - cultural tool for promoting active aging in older adults . regarding the multimedia version , it has been tested with consistent outcomes . in a first study , its efficacy was compared in different contexts , including community - dwelling older persons ( n=44 ) , living in residential context ( n=13 ) , and a control group ( n=31 ) ; results showed an increased frequency of cultural , intellectual , and social activities and a more positive view about aging in community and residential participants compared to those in the control group.1,2 besides , those in community setting improved their nutrition habits , physical activity , and had better life satisfaction . results remained in a 6-months follow - up with positive changes in health in the community group . a later study confirmed the impact of va - m ; it was implemented during 3 months . results showed that participants in va - m program improved in subjective health , general activities , frequency of physical exercise , and diet quality ; in addition to improvements found in the previous editions , better subjective memory , use of mnemonic strategies , hedonic balance , frequency of social relationships , and fewer negative emotions ( measures included only in this study ) were reported.3,4 a separate study compares va - ff ( n=28 ) and va - m ( n=25 ) and a control group ( n=37 ) in community - dwelling older persons . once again , improvements in the frequency of cultural , intellectual , and social activities and a more positive view about aging were reported . in addition , participants in the multimedia version reported more physical activity , better nutrition habits , and life satisfaction , compared to those in the face - to - face version . no effects were reported in social relationships and health.5,6 regarding va - el , it was implemented between 2010 and 2012 through the learning management system , learning management system moodle platform . after several changes with the purpose to have an adapted cross - cultural program , it was launched at four participating universities : autonomous university of madrid , catholic university of chile , la habana university , and the national autonomous university of mexico . preliminary results obtained in the spain subsample indicate that participants reported greater emotional balance and higher leisure and productive activities ; the report has not been completed yet.7 previous editions and outcomes of different versions of the vital aging program notes : + indicates improvements ; indicates no changes . abbreviations : va - m , vital aging multimedia ; va - ff , vital aging face - to - face ; c , control group .
introductionaging is not only a population phenomenon but also an experience and an individual reality . vital aging is a program that considers active aging as the lifelong adaptation process of maximizing health and independence , physical and cognitive functioning , positive affect regulation and control , and social engagement . through its different versions and editions , it has demonstrated being an effective program to promote active aging . the aim of this study is to determine the effectiveness of the face - to - face and combined versions of the program to promote active aging in mexican older adults trial.methodsseventy-six older adults aged 60 years and over participated in a quasi - experimental study and were recruited in a senior center to participate in the two experimental conditions : vital aging face - to - face ( va - ff ) ( n=35 ) and vital aging combined ( va - c ; multimedia / face - to - face ) ( n=15 ) , and the remaining 26 adults were assigned to a control group . pretest and posttest assessments were performed after the theoretical practical intervention . mean differences and size effects were calculated for estimating the effect of the program.resultsat the end of the study , participants showed improvements in the active aging outcome measures . positive effects were observed in the frequency of intellectual , cultural artistic , and social activities , perceptions of aging , satisfaction with social relationships , and self - efficacy for aging . additionally , those who participated in va - ff showed better memory performance , meta - memory , and a trend to report less memory problems , while older persons in va - c showed a trend to have better life satisfaction . no effects were observed in physical activity , frequency of social relationships , and subjective health.conclusionfindings show that the vital aging program in face - to - face and combined versions encourages active aging in mexican older persons . these results are in general similar to those found in editions performed in spain , revealing its consistency as a cross - cultural practical initiative for promoting active aging .
huntington s disease ( hd ) is a fatal , inherited neurodegenerative disorder characterized by progressive movement characterized by progressive motor , cognitive , and psychiatric symptoms . while clinical diagnosis typically depends on motor abnormalities , predictive genetic testing of patients with hd has shown that very early changes in cognitive function occur in gene carriers before any other clinical symptoms are apparent.1,2 cognitive dysfunction includes impairments in executive function , perception , visuospatial and psychomotor skills , memory loss , and problems learning new skills . these cognitive deficits ultimately lead to frontal and subcortical dementia.3,4 patients with hd also have a significant lifetime prevalence of psychiatric disorders.5 frequently reported psychiatric symptoms include depression , anxiety , irritability , apathy , obsessions and compulsions , and psychoses.6 for many patients and their families , neuropsychiatric symptoms constitute the most distressing aspect of hd . combined with the progressive decline in cognitive function , these behavioral symptoms have a significant impact on disease coping , interpersonal relationships , judgment , and the ability to live independently.7 the cognitive deficits associated with normal aging and age - related neurodegenerative diseases are proposed to be caused by impairments in cholinergic neurotransmission , in part due to a reduction in the number of nicotinic acetylcholine receptors ( nachrs).8,9 however , postmortem analysis of the hd brain shows no change in the number of nachrs , rather a significant loss of the neurotransmitter acetylcholine , its key synthetic enzyme ( choline acetyl transferase ) , and transporter ( vesicular acetylcholine transporter).1013 these neurochemical changes within the brain correlate with cognitive defects3 and support the hypothesis that dysfunctional cholinergic transmission , through a loss of agonist , rather than receptors , may be a significant contributing factor in the cognitive decline observed in hd . this presents an opportunity to investigate whether pharmacological replacement with an exogenous agonist can improve cognitive function in hd . indeed , small - scale clinical studies investigating the procholinergic effects of rivastigmine and donepezil in patients with hd indicated a trend for improved cognitive performance.1416 further , the nicotine analog varenicline ( champix ) used for smoking cessation17,18 has been shown to improve symptoms in rodent models and in patients with ataxic neurodegenerative disorders1921 and to display antidepressant activity.22 while recent evidence suggests no increased risk of neuropsychiatric events,23 we performed an open - label study to determine the tolerability of varenicline , a high - affinity agonist at 7 and partial agonist at 42 nachr subtypes,24,25 and its effects on cognitive function in three patients with early hd who smoked . varenicline ( champix ) was administered according to the standard regimen for smoking cessation ( initiated at 0.5 mg / d and escalated over a 2-week period to 2 mg / d ) . the frequency , intensity , and burden of side effects were recorded weekly , in addition to self - reported cigarette use . disease symptom severity was assessed at baseline and after 4-week treatment with varenicline using parts i ( motor ) and iii ( behavior ) of the unified huntington s disease rating scale ( uhdrs ) . categories within part i were analyzed separately:26 oculomotor function ( ocular pursuit , saccade initiation , saccade velocity ) , hyperkinesia ( chorea , dystonia , tongue protrusion , dysarthria ) , fine motor tasks ( finger taps , hand pronation / supination , luria ) , parkinsonism ( rigidity , bradykinesia ) , and gait ( gait , tandem walking , retropulsion ) . categories in part iii were analyzed in component parts ( depressed mood , apathy , low self - esteem / guilt , suicidal thoughts , anxiety , irritable behavior , aggressive behavior , obsessional thinking , compulsive behavior , delusion , and hallucinations ) . cognitive function was assessed using the fully validated integneuro computerized neurocognitive test battery ( brain resource company ltd ) . the computerized tests show a significant degree of overlap with traditional paper and pencil tests examining the same cognitive construct.27 domains assessed were manual dexterity ( motor tapping ) , impulsivity and attention ( go no go ) , switching attention , verbal interference , executive maze , and basic emotion recognition , in addition to a measure of premorbid intelligence ( spot the real word ) . integneuro uses different task versions for repeat testing sessions to minimize the effect of familiarization and practice effects , and test retest reliability measures have shown a high level of consistency ( on average 0.70).28 raw data from the neuropsychological tests were converted to z - scores normalized for age , sex , and years of education based on a database of > 5,000 control subjects provided by the brain resource company.29 all z - scores were computed so that positive scores indicated better performance . subjects were considered to show a significant deficit in a test if the z - score for any performance measure of that test was beyond two standard deviations below the mean of the age , sex , and education - matched controls in the brain resource company database . performance measure scores within each test were averaged to produce a domain - specific z - score for each participant.30 formal statistical analysis to determine group differences in domain - specific z - scores pre and post treatment was not performed due to the small number of cases . baseline assessment and follow - up ( after 4 weeks of treatment ) were carried out by the same clinicians ( gf and jd ) and are reported in tables 1 and 2 . the study design was reviewed and approved by the southern x regional ethics committee ( health and disability ethics committee , new zealand ) . written informed consent was obtained from all participants after the study had been fully explained . all patients were deemed by their treating physician as having capacity to give informed consent . a 45-year - old female patient ( smoked 15 cigarettes / d ) neurological examination showed subtle chorea and dystonic posturing of the arms but no other motor features . baseline cognitive testing demonstrated significant deficits in motor tapping ( number of taps , nondominant ) , maze navigation ( number of trials completed , overrun errors ) , and emotional identification ( accuracy of fear and disgust recognition ) compared to age , sex , and years of education - matched controls . no deficits were observed in any of the other cognitive domains tested . at the time of the study , she was on no medication but had taken venlafaxine to manage depression in the past . the patient reported a single aggressive outburst that was out of character during week 2 but experienced no other side effects . after 4 weeks of varenicline treatment , uhdrs total motor score decreased from 16 to 9 with notable improvement in oculomotor function and hyperkinesia scores ( table 1 ) . her uhdrs behavioral subscale score was increased from 2 to 8 and could be attributed to the episode of increased irritability / aggression ( table 2 ) . the patient self - reported an improvement in her thinking , being able to think more clearly and having a better memory . cognitive testing showed significant improvements in maze navigation ( domain - specific z - score : 3.25 vs 0.15 ) and facial emotion recognition ( domain - specific z - score : 3.10 vs 1.50 ) following varenicline treatment ( figure 1 ) . a 44-year - old male patient , diagnosed with hd in 2014 , showed slight slowing of rapid alternating movements in the upper limbs and mildly slowed finger tapping on the left side on neurological examination . chorea and behavioral symptoms were treated with haloperidol ( 0.5 mg / d ) , quetiapine ( 200 mg / d ) , and citalopram ( 30 mg / d ) at the time of the study . the patient displayed significant deficits in switching of attention ( completion time ) , verbal interference ( congruent accuracy , congruent and incongruent reaction time ) , maze navigation ( trials completed , overrun errors , total errors ) , and emotional identification ( accuracy of fear , disgust , and happiness identification ) tasks at the baseline clinic visit . he had no desire to stop smoking and continued to smoke ~23 cigarettes / d throughout the study . he self - reported that there had been an incident where he became extremely agitated and kicked the door in week 2 ; however , this passed quickly and he was unable to recall the cause . uhdrs total motor score decreased from 11 to 8 . while fine motor task and gait scores showed modest improvement , hyperkinesia and parkinsonism scores were moderately elevated ( table 1 ) . his uhdrs behavioral subscale increased from 4 to 8 , due to the aggressive outburst ( table 2 ) . cognitive testing at 4 weeks showed significantly improved performance in the switching attention ( domain z - score : 4.00 vs 1.7 ) and verbal interference ( domain z - score : 2.95 vs 1.90 ) tasks . performance in tests of executive function ( domain z - score : 2.82 vs 1.72 ) and emotional identification ( domain z - score : 2.13 vs 1.03 ) was also significantly improved ( figure 1 ) . the patient was a 40-year - old gene - positive male who had required support to manage behavioral symptoms since 2011 . baseline neurological examination showed no motor symptoms ( uhdrs total motor score 0 ) and a behavioral subscale score of 14 . he enjoyed smoking ( ~20 cigarettes / d ) and had no plan to give up . at the time of the study , he was on no medication and reported no effects or side effects of the medication at lower doses ( 0.5 mg / d and 1.0 mg / d ) . when the daily dosage of varenicline was increased ( 2 mg / d ) , he reported significant alterations in his sense of taste and was unable to drink coffee or take any dairy products . as a result , he discontinued the medication and did not attend follow - up appointments . he was reviewed in the community several months later , and both he and his mother reported that no other side effects were noted other than altered taste . varenicline ( champix ) was administered according to the standard regimen for smoking cessation ( initiated at 0.5 mg / d and escalated over a 2-week period to 2 mg / d ) . the frequency , intensity , and burden of side effects were recorded weekly , in addition to self - reported cigarette use . disease symptom severity was assessed at baseline and after 4-week treatment with varenicline using parts i ( motor ) and iii ( behavior ) of the unified huntington s disease rating scale ( uhdrs ) . categories within part i were analyzed separately:26 oculomotor function ( ocular pursuit , saccade initiation , saccade velocity ) , hyperkinesia ( chorea , dystonia , tongue protrusion , dysarthria ) , fine motor tasks ( finger taps , hand pronation / supination , luria ) , parkinsonism ( rigidity , bradykinesia ) , and gait ( gait , tandem walking , retropulsion ) . categories in part iii were analyzed in component parts ( depressed mood , apathy , low self - esteem / guilt , suicidal thoughts , anxiety , irritable behavior , aggressive behavior , obsessional thinking , compulsive behavior , delusion , and hallucinations ) . cognitive function was assessed using the fully validated integneuro computerized neurocognitive test battery ( brain resource company ltd ) . the computerized tests show a significant degree of overlap with traditional paper and pencil tests examining the same cognitive construct.27 domains assessed were manual dexterity ( motor tapping ) , impulsivity and attention ( go no go ) , switching attention , verbal interference , executive maze , and basic emotion recognition , in addition to a measure of premorbid intelligence ( spot the real word ) . integneuro uses different task versions for repeat testing sessions to minimize the effect of familiarization and practice effects , and test retest reliability measures have shown a high level of consistency ( on average 0.70).28 raw data from the neuropsychological tests were converted to z - scores normalized for age , sex , and years of education based on a database of > 5,000 control subjects provided by the brain resource company.29 all z - scores were computed so that positive scores indicated better performance . subjects were considered to show a significant deficit in a test if the z - score for any performance measure of that test was beyond two standard deviations below the mean of the age , sex , and education - matched controls in the brain resource company database . performance measure scores within each test were averaged to produce a domain - specific z - score for each participant.30 formal statistical analysis to determine group differences in domain - specific z - scores pre and post treatment was not performed due to the small number of cases . baseline assessment and follow - up ( after 4 weeks of treatment ) were carried out by the same clinicians ( gf and jd ) and are reported in tables 1 and 2 . the study design was reviewed and approved by the southern x regional ethics committee ( health and disability ethics committee , new zealand ) . written informed consent was obtained from all participants after the study had been fully explained . all patients were deemed by their treating physician as having capacity to give informed consent . a 45-year - old female patient ( smoked 15 cigarettes / d ) was diagnosed with hd in 2013 . neurological examination showed subtle chorea and dystonic posturing of the arms but no other motor features . baseline cognitive testing demonstrated significant deficits in motor tapping ( number of taps , nondominant ) , maze navigation ( number of trials completed , overrun errors ) , and emotional identification ( accuracy of fear and disgust recognition ) compared to age , sex , and years of education - matched controls . no deficits were observed in any of the other cognitive domains tested . at the time of the study , she was on no medication but had taken venlafaxine to manage depression in the past . the patient reported a single aggressive outburst that was out of character during week 2 but experienced no other side effects . after 4 weeks of varenicline treatment , uhdrs total motor score decreased from 16 to 9 with notable improvement in oculomotor function and hyperkinesia scores ( table 1 ) . her uhdrs behavioral subscale score was increased from 2 to 8 and could be attributed to the episode of increased irritability / aggression ( table 2 ) . the patient self - reported an improvement in her thinking , being able to think more clearly and having a better memory . cognitive testing showed significant improvements in maze navigation ( domain - specific z - score : 3.25 vs 0.15 ) and facial emotion recognition ( domain - specific z - score : 3.10 vs 1.50 ) following varenicline treatment ( figure 1 ) . a 44-year - old male patient , diagnosed with hd in 2014 , showed slight slowing of rapid alternating movements in the upper limbs and mildly slowed finger tapping on the left side on neurological examination . chorea and behavioral symptoms were treated with haloperidol ( 0.5 mg / d ) , quetiapine ( 200 mg / d ) , and citalopram ( 30 mg / d ) at the time of the study . the patient displayed significant deficits in switching of attention ( completion time ) , verbal interference ( congruent accuracy , congruent and incongruent reaction time ) , maze navigation ( trials completed , overrun errors , total errors ) , and emotional identification ( accuracy of fear , disgust , and happiness identification ) tasks at the baseline clinic visit . he had no desire to stop smoking and continued to smoke ~23 cigarettes / d throughout the study . he self - reported that there had been an incident where he became extremely agitated and kicked the door in week 2 ; however , this passed quickly and he was unable to recall the cause . following 4 weeks of varenicline treatment , uhdrs total motor score decreased from 11 to 8 . while fine motor task and gait scores showed modest improvement , his uhdrs behavioral subscale increased from 4 to 8 , due to the aggressive outburst ( table 2 ) . cognitive testing at 4 weeks showed significantly improved performance in the switching attention ( domain z - score : 4.00 vs 1.7 ) and verbal interference ( domain z - score : 2.95 vs 1.90 ) tasks . performance in tests of executive function ( domain z - score : 2.82 vs 1.72 ) and emotional identification ( domain z - score : 2.13 vs 1.03 ) was also significantly improved ( figure 1 ) . the patient was a 40-year - old gene - positive male who had required support to manage behavioral symptoms since 2011 . baseline neurological examination showed no motor symptoms ( uhdrs total motor score 0 ) and a behavioral subscale score of 14 . he enjoyed smoking ( ~20 cigarettes / d ) and had no plan to give up . at the time of the study , he was on no medication and reported no effects or side effects of the medication at lower doses ( 0.5 mg / d and 1.0 mg / d ) . when the daily dosage of varenicline was increased ( 2 mg / d ) , he reported significant alterations in his sense of taste and was unable to drink coffee or take any dairy products . as a result , he discontinued the medication and did not attend follow - up appointments . he was reviewed in the community several months later , and both he and his mother reported that no other side effects were noted other than altered taste . to our knowledge , this is the first report describing beneficial effects of the nicotinic agonist varenicline on motor and cognitive symptoms in patients with early hd . our preliminary investigation indicates that varenicline was generally well tolerated in these patents , and no clinically significant adverse effects were reported during the 4-week treatment period . two patients ( cases 1 and 2 ) reported single , brief episodes of increased irritability and aggression in the second week of varenicline treatment , which may be related to dose escalation from 1 mg / d to 2 mg / d . the third patient ( case 3 ) did not continue treatment beyond week 2 , due to changes in taste . no studies have directly investigated smoking in hd ; however , previous literature suggests that a significant proportion of patients with hd ( 40% ) are moderate or heavy smokers.31 in the first patient we treated , varenicline was an effective smoking cessation aid . the contribution of nicotine withdrawal to the observed increase in irritability in this patient remains unclear . approximately 40% of smokers achieve abstinence with varenicline,32,33 and end - of - treatment abstinence rates increase with increasing varenicline exposure.34 our result of abstinence in one of three patients after a 4-week treatment is in keeping with these observations . both patients who completed the study were fully adherent ; therefore , smoking cessation efficacy may be related to intention to quit or lower baseline smoking status.34 the patients who completed the course of treatment showed modest motor symptoms assessed by uhdrs but no clinically significant anxiety or depression ( assessed by the hospital anxiety and depression rating scale)35 at the time of the study . while both patients displayed different profiles with regard to which specific aspects of attention and verbal tasks were impaired at baseline , both showed impairments of comparable magnitude in maze navigation and emotional identification tasks . this is in agreement with previous literature describing early impairments in executive function , perception , and visuospatial and psychomotor skills.3,4 following 4 weeks of treatment with varenicline , both patients showed significantly improved performance in maze navigation and improved accuracy of fear and disgust recognition . deficits in emotion recognition , in particular negative emotions , are a key predictor of clinical diagnosis and progression of hd.3638 reversal of this disease biomarker after a relatively brief period of administration suggests that varenicline may have effects that justify further investigation . the cognitive assessment battery used in this study displays equivalent levels of test retest reliability over a 4-week period to the matrics cognitive consensus battery , and these improvements are unlikely to be due to practice effects.39 cholinergic neurotransmission is an important modulator of cognition within the central nervous system . indeed , disrupted cholinergic neurotransmission is associated with deficits in emotional processing40 and executive function.41,42 we hypothesized that impaired cholinergic neurotransmission through a loss of agonist , rather than nachrs , may contribute to the cognitive decline in patients with hd . stimulation of nachrs with nicotine has been shown to improve working memory , visual memory , information - processing speed , and emotion recognition in subjects with low baseline cognitive function.43 therefore , it is likely that the cognitive enhancing effects of varenicline are mediated through its effects as a full agonist at 7 and partial agonist at 42 nachrs , the subtypes thought to be most important in cognitive function.44,45 varenicline has been previously reported to improve balance and coordination and attenuate ataxias induced by l - dopa via 42 nachrs.46 partial agonist effects at this subtype may underlie the improvements in motor function observed in this study . it remains unclear whether a larger effect size would have been observed following a longer treatment period with varenicline or whether varenicline has the potential to improve motor deficits in late - stage patients . our case reports suggest that varenicline may provide multiple benefits by reducing the negative health impact of tobacco smoking , in addition to providing beneficial effects on motor and cognitive symptoms . a randomized control trial is now underway to further investigate the efficacy of varenicline in the symptomatic treatment of patients with hd .
the aim of this study was to describe the effects of varenicline , a smoking cessation aid that acts as a nicotinic agonist , on cognitive function in patients with early clinical huntington s disease ( hd ) who were current smokers . three gene - positive patients transitioning to symptomatic hd were evaluated using the unified huntington s disease rating scale part i and iii ( motor and behavioral subscales ) at baseline and after 4 weeks of treatment . cognitive function was assessed using a touch screen computer - based neurocognitive test battery ( integneuro ) . varenicline ( 1 mg twice daily ) significantly improved performance in executive function and emotional recognition tasks . our case reports describe no clinically significant adverse effects and suggest that varenicline improves aspects of cognitive function in patients with early hd . a randomized controlled study is now underway .
the healthy balance of normal processes in the lungs , termed pulmonary homeostasis , can be disturbed by external environmental insults or endogenous factors produced during other diseases . in response to insults , the lung responds with an ancient protective mechanism , inflammation . the subsequent course of events depends on the severity of the injury and on the effectiveness of the inflammatory response ( figure 1 ) . if the injury is mild , structural damage to the lung is limited and the lung tissue will rapidly return to homeostasis ( figure 1a ) . if the injury is more profound and the structural integrity of the tissue and/or vitality of cells are impaired , then the defect in the tissue will be patched with newly formed connective tissue scar . this repair process substitutes functional components of the tissue with extracellular matrix , which fills the defect and , in most cases , allows for the return to tissue homeostasis ( figure 1b ) . however , problems arise when the injury is severe or repetitive , and the inflammatory and repair processes fail to limit themselves . under these circumstances , chronic inflammation and exaggerated repair can ensue , in some cases leading to excessive accumulation of extracellular matrix , or so - called pulmonary fibrosis ( figure 1c ) . in this brief report , we present the regulation of these processes by key cytokines in three representative chronic diseases of the lung asthma , copd , and pulmonary fibrosis . ( a ) if the injury is mild and structural damage to the tissue is minimal , the process of regeneration allows for a rapid return to homeostasis . ( b ) a more profound injury affecting the structural integrity of the tissue and vitality of cells leads to repair with deposition of scar tissue , but in most cases there is a return to homeostasis . ( c ) repetitive injury , primary or secondary , combined with disturbed tissue responses may lead to continuous inflammation and exaggerated repair , resulting in fibrosis . note the central involvement of inflammation in all cases , as a bridge between the immediate response to injury and the subsequent repair processes . although there is a certain overall directionality of the sequence of events from injury to inflammation and to repair , these processes often occur simultaneously at a given time , as indicated by the overlapping corresponding curves . cytokines participate in cell - cell communication and regulate many functions including cell survival , cell growth , and induction of gene expression . cytokines can be produced by many cell types . during the adaptive immune response , cd4 + helper t - cells these helper cells can become th1 cells making high levels of interferon ( ifn) , th2 cells making high levels of interleukin ( il)-4 , il-5 , and il-13 , or th17 cells making high levels of il-17 . while each disease has unique attributes , several cytokines play roles in all three diseases and , thus , may provide interesting targets for therapeutic intervention . asthma is a chronic disease of the lung characterized by shortness of breath , wheeze , cough , reduced airflow on expiration , and airway hyperreactivity to non - specific bronchoconstrictors . recent evidence suggests that asthma is not a single disease , but consists of several subtypes , including allergic and steroid - resistant asthma . allergic asthma is mediated by the th2 cytokines il-4 , il-5 , and il-13 ( table 1 ) . il-4 participates in the differentiation of nave cd4 + t cells into the th2 type and is important for the production of allergen - specific ige . furthermore , il-4 drives the alternative activation of macrophages , which have been shown to increase lung inflammation in mouse models of allergic lung inflammation and to be correlated with asthma severity in asthma patients [ 6 - 12 ] . the role of il-4 in driving allergic asthma is well known , and recent data suggest that its alternatively spliced variant missing exon 2-encoded region , il-42 , is naturally produced by cells from patients with asthma but not from healthy controls . this splice variant is active independently of wild - type il-4 and promotes pulmonary inflammation without th2 skewing . the relative importance of these cytokines is difficult to assess quantitatively ; instead , the authors established this order based on their expertise and available literature in the field . abbreviations : ccl17 , thymus and activation - regulated chemokine ( also known as tarc ) ; copd , chronic , obstructive pulmonary disease ; ctgf , connective tissue growth factor ; gm - csf , granulocyte - macrophage colony - stimulating factor ; il , interleukin ; mcp-1 , monocyte chemotactic protein ( also known as ccl2 ) ; parc , pulmonary and activation - regulated chemokine ( also known as ccl18 ) ; pdgf , platelet - derived growth factor ; rantes , regulated and normal t cell expressed and secreted ; sdf-1/cxcl12 , stromal cell - derived factor-1 ; tgf- , transforming growth factor beta ; tnf- , tumor necrosis factor alpha ; tslp , thymic stromal lymphopoietin ; vegf , vascular endothelial growth factor . like il-4 , il-13 can also regulate ige production and the alternative activation of macrophages because it shares a receptor complex and downstream signaling pathways with il-4 . furthermore , il-13 has a distinct and prominent role in mediating the structural changes observed in the airways by modulating goblet cell differentiation and mucus production , airway smooth muscle cell proliferation , and subepithelial fibrosis . such changes lead to airway constriction and hyppereactivity to stimulants , and , after prolonged chronic allergen exposure , tissue remodeling and fibrosis . studies in both mouse models and human asthmatics have demonstrated that il-5 is critical for the differentiation of eosinophils from bone marrow precursors and for their trafficking from the bone - marrow to the lung [ 19 - 24 ] . thus , the th2 cytokines il-4 , il-13 , and il-5 orchestrate the set of physiological responses characteristic of allergic asthma including inflammation , airway hyperactivity , and airway remodeling . in addition to the classic th2-cell derived cytokines , cytokines produced by airway epithelial cells have recently been recognized as critical mediators of allergic asthma . airway epithelial cells are the first to encounter inhaled allergens or other agents and are stimulated to secrete il-25 , il-33 , and thymic stromal lymphopoietin ( tslp ) [ 30 - 33 ] . il-25 is produced by airway epithelial cells upon exposure to allergens , particles , and helminths . il-33 is present in cells in both full - length and mature forms , of which mature il-33 is a powerful activator of the th2 responses [ 29,36 - 41 ] , whereas full length il-33 activates inflammation without engaging the il-33 receptor component t1/st2 or engaging the th2 mechanisms . both il-25 and il-33 stimulate the rapid production of il-5 and il-13 by natural helper cells ( multipotent progenitor cells , nuocytes , c - kit+sca-1+il-7r+ il-33r+il-17rb+ cells ) in the airways , which promotes th2 generation and increases local th2 cytokine production [ 45 - 49 ] . tslp primes , polarizes , and maintains th2 cells , and its expression in the airways of patients with asthma has been shown to correlate with disease severity [ 51 - 53 ] . all these th2-associated cytokines are engaged in an intricate interplay with other cytokines including , but not limited to , tnf- [ 54 - 56 ] , il-1 , granulocyte - macrophage colony - stimulating factor ( gm - csf ) , vascular endothelial growth factor ( vegf ) [ 61 - 64 ] , il-18 [ 65 66 ] , and il-17 [ 67 - 73 ] . based on studies in mouse models , it is believed that th17 cells and , therefore , il-17 cytokines play a role in asthma severity by increasing neutrophil recruitment to the airways . furthermore , the th17-mediated pathway may contribute to steroid resistance in human asthma , but this has not yet been clearly established . thus , il-17-driven asthma may be distinct from allergic asthma and require different therapeutic strategies . the chemotactic family of cytokines called chemokines also centrally contributes to pathogenesis of asthma by recruiting specific inflammatory cells into the lung tissue [ 75 - 77 ] , including regulated and normal t cell expressed and secreted ( rantes)/ chemokine ( c - c motif ) ligand ( ccl)5 [ 78 - 81 ] , eotaxins ccl11 , ccl24 , and ccl26 [ 81 - 84 ] , cxcl8/il-8 . while the th1 cytokine ifn- is typically thought to suppress th2-mediated responses , several reports indicate that , in certain circumstances , ifn- is also involved in promoting disease pathogenesis [ 87 - 89 ] . copd is caused by smoking or other prolonged significant exposure to fumes , dust , or polluted air , which causes chronic inflammation of bronchi , destruction of lung tissue ( emphysema ) , and some degree of scarring . the inflammatory process involving t cells , neutrophils , and macrophages is driven by the classical proinflammatory cytokines tnf- , ifn- [ 92 - 94 ] , il-1 , il-6 , il-8 [ 90,91,97 - 102 ] , il-18 , and il-32 . recent evidence also implicates il-17 in the pathogenesis of copd [ 56,92,106 - 109 ] . increased sputum il-17 levels were identified in copd patients , and were even more pronounced than those detected in patients with asthma . these levels correlated with a decrease in lung function as measured by a decrease in forced expiratory volume , suggesting a potential role for il-17 in copd pathogenesis and defining it as a prognostic target for disease immunotherapy . although copd is not considered a th2 disease , activated th1 and th2 cells are found in copd patients , suggesting that both may contribute to the disease processes . for example , the pro - th2 cytokine tslp is expressed and functionally active not only in patients with asthma but also in patients with copd . similarly , il-13 may be contributing to mucus metaplasia , airway fibrosis , and vascular remodeling in copd . expression of the profibrotic cytokine transforming growth factor ( tgf)- is enhanced in the airways of patients with copd [ 110 - 113 ] . this appears somewhat counterintuitive because tgf- is a potent inducer of connective tissue deposition , whereas copd is characterized predominantly by lung tissue destruction . nevertheless , pulmonary fibroblasts from these patients respond to stimulation by tgf- with an enhanced activation of the wnt/-catenin pathway , whereas copd airway smooth muscles respond to similar stimulation with an enhanced deposition of the proteoglycan perlecan , suggesting that tgf- contributes to architectural changes in the lungs in copd . indeed , peribronchial fibrosis does develop in the lungs of patients with copd , which is in contrast to mostly subepithelial fibrosis in asthma ( see above ) and interstitial fibrosis in idiopathic pulmonary fibrosis and scleroderma lung disease ( see below ) . this process may be self - limiting , but in some cases , the fibrotic process becomes overt and irreversible , leading to a significant decline in lung function , the ability to exchange gas . pulmonary fibrosis is the main cause of death in the autoimmune disease scleroderma , whereas in patients with idiopathic pulmonary fibrosis , median survival is only two to three years . in cases of such profound pulmonary fibrosis , the available therapies have limited effectiveness . extracellular matrix , including collagen , accumulates in the lungs through several mechanisms . resident pulmonary fibroblasts become activated , increase their proliferation rate , while decreasing sensitivity to apoptotic signals , and deposit more extracellular matrix , while slowing down extracellular matrix turnover . bone marrow - derived cells called fibrocytes home to the lung and differentiate into activated fibroblasts [ 118 - 120 ] . epithelial - mesenchymal transition , a process by which lung epithelial cells transform into myofibroblasts , also contributes to lung fibrosis [ 121 - 123 ] . all these mechanisms are controlled by cytokines , either through direct recruitment and activation of extracellular matrix - producing cells , or indirectly , through regulation of pulmonary inflammation [ 124 - 130 ] , redox balance [ 131 - 133 ] , and activity of several enzymatic systems , including matrix metalloproteinases and their inhibitors [ 130,134 - 136 ] , and clotting enzymes [ 126,137 - 141 ] . it is produced in latent form and normally stored as such in tissues in association with extracellular matrix and needs to be activated to exert its functional effect . thus , tgf--driven fibrosis is controlled by the mechanisms of its activation rather than production . in the lungs , activation of tgf- by v - containing integrins plays a central role in the mechanism of fibrosis [ 127,143 - 146 ] . connective tissue growth factor ( ctgf ) acts in concert with tgf- , contributing to fibrosis . furthermore , the th2 cytokines il-4 and il-13 are direct activators of fibrosis [ 149 - 154 ] , whereas the th1 cytokine ifn- is a potent direct inhibitor of extracellular matrix deposition . interestingly , although the levels of th2 cytokines are substantially higher in asthma than in fibrotic diseases such as scleroderma or idiopathic pulmonary fibrosis , the severity of fibrosis is higher in the latter diseases . furthermore , scleroderma lung disease and idiopathic pulmonary fibrosis are characterized by diffuse parenchymal accumulation of extracellular matrix , whereas in asthma , fibrosis is mostly subepithelial . a possible explanation for this paradox is that , in asthma , th2 cytokines are the predominant drivers of fibrosis , whereas in scleroderma lung disease and idiopathic pulmonary fibrosis , the patients experience a profibrotic cytokine storm , with elevated levels of all of the cytokines listed in this section . furthermore , tgf- is a more potent profibrotic cytokine , exerting its effect at much lower concentrations than il-4 or il-13 . the chemokine monocyte chemotactic protein ( mcp)-1/ccl2 promotes fibrosis through direct and indirect mechanisms [ 157 - 160 ] , as do oncostatin m and platelet derived growth factor ( pdgf ) [ 162 - 164 ] . an important , predominantly indirect , modulator of fibrosis is the chemokine pulmonary and activation - regulated chemokine ( parc)/ccl18 , which is elevated in association with various fibrotic lung diseases , such as scleroderma , hypersensitivity pneumonitis and idiopathic pulmonary fibrosis , asthma , and sarcoidosis . although parc / ccl18 directly activates collagen production in fibroblasts in cell culture [ 170 - 173 ] , it exerts its profibrotic action in vivo mostly by recruiting profibrotic t cells . another chemokine , stromal cell - derived factor ( sdf)-1/ chemokine ( c - x - c motif ) ligand ( cxcl)12 , contributes to fibrosis by recruiting bone marrow - derived progenitors of fibroblasts to the lung [ 175 - 177 ] . numerous other cytokines may contribute to the mechanism of pulmonary fibrosis , but their exact roles remain either controversial or mechanistically unclear , including il-1 and il-17 [ 178 - 180 ] , il-10 , thymus and activation - regulated chemokine ( ccl17 ) , and gm - csf [ 184 - 186 ] . an extensive discussion of cytokines regulating pulmonary fibrosis can be found in [ 129,187 - 189 ] . the important contribution of cytokines to features of the chronic lung diseases presented above suggests potential targets for therapeutic intervention using blocking antibodies or therapeutic proteins . indeed , a number of clinical trials have been performed or are ongoing for many of the cytokine targets . the emerging anti - cytokine therapies for asthma are primarily directed toward il-4 , il-5 , or il-13 [ 190 - 195 ] . early studies targeting il-4 met with limited success , likely because they did not also block il-13 . more recent studies with blocking anti - il-13 antibodies or with an il-4 mutant that blocks the actions of both il-4 and il-13 showed greater promise in some , but not all , studies [ 191 - 193,195 - 197 ] . the varied effectiveness of il-13-directed therapies is not surprising considering that only 50% of asthmatics show elevated levels of sputum il-13 . similarly , there are controversial results on the effectiveness of il-5 directed therapies [ 196 , 197 ] . while anti - il-5 antibody was effective at reducing eosinophil numbers in blood and sputum , it was substantially less effective at reducing eosinophil numbers in the lung and had a modest impact on lung function . therefore , it is clear that currently existing therapies have to be extended to include downregulation of additional pathways that have been shown to play roles in asthma pathogenesis such as tslp , il-17 , il-25 , il-33 . other more non - traditional molecular pathways might also prove to be effective targets . as an example , we recently have shown that neuroimmune semaphorin 4a plays a downregulatory role in experimental asthma severity , in part , by regulation of il-13 . several drugs targeting the tumor necrosis factor ( tnf)- pathway have been developed and used in clinical settings . some of them ( i.e. mouse / human igg1 antibody against tnf- , ifliximab ) were found to be effective in asthma but not in copd [ 202 - 205 ] . a soluble human tnfr2 , etanercept , reduced lung pathophysiology in patients with severe forms of disease . clinical studies of a fully humanized il-1 blocking antibody ( canakinumab ) and anti - il-6r blocking antibody ( tocilizumab ) were reported to be in progress in patients with copd and rheumatoid arthritis , correspondingly , but no final results have been revealed yet . several drugs have been developed to target the vegf pathway , which has been implicated in asthma , such as bevacizumab , vegf - trap , and ptk737 with clinical trials being limited thus far to cancer , ischemia , and age - related macular degeneration . the identification and targeting of a cytokine active in more than one chronic lung disease would clearly be beneficial . there is growing awareness that there are key similarities in the contribution of cytokines and the manifestation of lung pathology among the chronic respiratory diseases . as noted in table 1 , several of the cytokines contribute to multiple chronic disease states ( e.g. tgf- , il-17 , tslp , il-4 , il-13 ) . while we have learned much about the general role of cytokines in these diseases , many questions remain unanswered . what is the relationship between the major chronic respiratory diseases ? are there common targets for intervention ? will it be possible in the future to attenuate or even abrogate the undesired excessive responses by therapeutically targeting cytokines ? experiments in animals have been very promising , but their translation into clinical trials lags behind . one difficulty is that cytokines are functionally pleiotropic and redundant , and , as a result , targeting an individual cytokine may have a less than expected effect ( due to functional substitution by other , functionally similar , cytokines ) or have undesired side effects ( due to pleiotropy ) . another difficulty is that mouse models do not completely mimic the disease in humans [ 210 - 212 ] . it will be important to further understand these issues to increase the likelihood that targeting cytokines will improve the clinical outcome for patients with chronic lung diseases .
cytokines are small , secreted proteins that control immune responses . within the lung , they can control host responses to injuries or infection , resulting in clearance of the insult , repair of lung tissue , and return to homeostasis . problems can arise when this response is over exuberant and/or cytokine production becomes dysregulated . in such cases , chronic and repeated inflammatory reactions and cytokine production can be established , leading to airway remodeling and fibrosis with unintended , maladaptive consequences . in this report , we describe the cytokines and molecular mechanisms behind the pathology observed in three major chronic diseases of the lung : asthma , chronic obstructive pulmonary disease ( copd ) , and pulmonary fibrosis . overlapping mechanisms are presented as potential sites for therapeutic intervention .
monoclonal gammopathy represents single plasma cell activation and is usually associated with several malignant diseases , including multiple myeloma , primary systemic amyloidosis , and other lymphoproliferative disorders1 ) . in contrast , polyclonal gammopathy represents the diffuse activation of b cells , and is associated with a heterogeneous group of nonmalignant conditions , including inflammation and immune - related diseases1 ) . we report a case of polyclonal gammopathy associated with massive gross hematuria in a pediatric patient who had bilateral dysplastic kidneys , and was undergoing peritoneal dialysis . a-15-year - old girl was admitted with left flank pain and gross hematuria for several days . four years ago , she was diagnosed as end - stage renal disease due to dysplastic kidneys which was multicystic dysplastic kidney in right side and was dysplastic kidney with severe hydronephrosis in left side . however , because chronic allograft dysfunction has occurred , she has been undergoing peritoneal dialysis for 3 months . she had received oral immunosuppressant therapy during kidney transplantation state , and it was stopped when the peritoneal dialysis was started . her blood pressure was 147/104 mmhg , heart rate was 112 beats / min and respiratory rate was 22 beats / min . she looked acutely ill and physical examination revealed severe tenderness on the left costovertebral angle , but no pitting edema . the laboratory findings on admission were hemoglobin 6.3 g / dl , hematocrit 18.7% , white blood cell count 5,640/l ( lymphocyte 78% neutrophil 17% ) and platelet 144,000/l . the blood chemistry showed total protein / albumin 6.8/2.6 g / dl , sodium / potassium 132/4.0 mmol / l , calcium / phosphorus 7.3/3.5 mg / dl , blood urea nitrogen / creatinine 43/13.1 mg / dl , erythrocyte sedimentation rate 53 mm / hr , and c - reactive protein 2.2 mg / dl . coagulation blood test was prothrombin time 105% , partial thromboplastin time 30.5 '' , international normalized ratio 1.0 . her urine showed gross hematuria with blood clots and protein ( 4 + ) occult blood ( 3 + ) on dipstick . computerized tomography of her abdomen revealed encapsulated intrapelvic hematoma in the left kidney ( fig . she was given red blood cell transfusion and with conservative therapy , flank pain and gross hematuria were improved . follow - up serial hemoglobin level was remained and her blood pressure was maintained within the normal range . follow - up abdominal computerized tomography showed as renal pelvic hematoma of the same size . she had neither fever nor pain , but complained of intermittent gross hematuria with blood clot and her anemia was not improved . ten days after discharge , follow - up laboratory findings showed a reversed albumino - globulin ratio ( total protein , 6.6 g / dl ; albumin , 1.9 g / dl ; globulin , 4.7 g / dl ; albumin / globulin ratio , 0.4 ) and this finding was sustained for two months in spite of no evidence of infection or inflammation . serum electrophoresis was compatible with polyclonal gammopathy , which showed an increased component with alpha-1 and gamma fraction ( fig . we performed the embolization of the left renal artery , two months after when the renal cystic hemorrhage began . the continuous bleeding was solved and also , albumino - globulin dissociation was normalized a month after renal artery embolization was done ( fig . in general , patients with renal diseases , such as nephrotic syndrome , represent hypoalbuminemia and hypogammaglobulinemia . serum globulin can be calculated by the total protein level minus the albumin level , and tends to increase in serious infectious diseases , inflammation , and malignancy . however , because globulin is composed of various protein components , simple change of globulin does not have meaningful diagnostic value . albumin / globulin ratio ( ag ratio ) is one of the methods to easily detect the relative change of albumin and globulin and has a normal range between 1.5 and 2.2 . for example , if there is an increase of albumin or decrease of globulin , ag ratio would be elevated above 2.2 . on the contrary , ag ratio would be down less than 1.5 , as in nephrotic syndrome . because our patient showed increased globulin compatible with polyclonal gammopathy , as well as hypoalbuminemia the net charge ( positive or negative ) and the size and shape of the protein commonly are used in differentiating various serum proteins2 ) . albumin is the major protein component of the serum and is produced by the liver , under normal physiologic condition . the alpha-1 fraction is comprised of alpha1-antitrypsin , thyroid - binding globulin , and transcortin , and it can be increased with specific condition , such as malignancy or inflammatio3 ) . the alpha-2 component is increased as an acute phase reactants , beta-1 is composed mostly of transferring and beta-2 as beta - lipoprotein , is composed immunoglobulin ( ig ) a , igm , and sometimes igg , along with complement proteins3 ) . but much of the clinical interest is focused on the gamma region of the serum protein spectrum because immunoglobulins migrate to this region and can be found throughout the electrophoretic spectrum3 ) . c - reactive protein is located in the area between the beta and gamma components2 ) . serum electrophoresis , in our patient , presented increased alpha-1 and predominantly , gamma fraction and it is consistent with acute or subacute inflammation . gammopathy is an abnormal proliferation of the b lymphocytes , resulting in abnormal levels of immunoglobulin production . it is important to differentiate between a monoclonal and a polyclonal increase in immunoglobulins because the former is associated with a clonal process that is malignant or potentially malignant , while a polyclonal increase is due to a reactive or inflammatory process . monoclonal gammopathy is an increased production of one type of immunoglobulin by a single clone of cells4 ) . the abnormal protein produced is called paraprotein or m component and may be composed of whole immunoglobulin molecules or subunits , light - chains or heavy - chains4 ) . it occurs usually in myelomas , lymphoproliferative neoplasms , and occasionally , chronic inflammatory or immune - mediated diseases5 ) . greatly elevated serum levels of protein may result in a hyperviscosity syndrome and it is more common in monoclonal gammopathy than the other one6 ) . in contrast , polyclonal gammopathy is known to be caused by any reactive or inflammatory process , and is associated with nonmalignant conditions . polyclonal gammopathy is a hypergammaglobulinemia , which results from an increased production of several different immunoglobulins . infectious , inflammatory or various reactive processes may be associated with a broad - based peak or band in the gamma region in serum protein electrophoresis . liver disease , autoimmune disease and chronic viral or bacterial infections may cause a polyclonal rise in the gamma fraction1,3 ) . pollock et al.7 ) surveyed 110 cases of renal transplant recipients and one half had abnormal serum immunoglobulins with 4 monoclonal gammopathy and 8 polyclonal gammopathy . gammopathy was more common in patients with chronic rejection , and therefore , with more intense immunosuppression8 ) . the mechanism leading to a post - transplant gammopathy in most cases appears to be related to diminution of t cell mediated immune surveillance , which leads to b cell proliferation9 ) . then , what was the main cause of polyclonal gammopathy in our case ? first , we assumed that immunosuppression itself could be the main cause . however , our patient did n't show this serologic problem during an aggressive immunosuppressive therapy after renal transplantation , and all immunosuppressive medicines were discontinued at the diagnosis on polyclonal gammopathy . second , it was the possibility of polyclonal gammopathy , developed by a subclinical infection due to hematoma located in renal pelvis that can be a potential culture media . however , we could not discover the evidence of infection from any inflammatory markers and cultures . actually , our patient used to show the erythropoietin resistant anemia , at the rebeginning of dialysis due to graft failure , and we did not find the evident cause of anemia . retrospectively , it was possible that intrarenal bleeding was started before gross hematuria . when gross hematuria and pelvic hematoma were diagnosed initially , we considered that renal hemorrhage was not active and decided to delay the embolization of the renal artery . although we can not explain the precise mechanism of polyclonal gammopathy originated from renal hemorrhage , it supports that polyclonal gammopathy has disappeared when renal bleeding was controlled by embolization of the renal artery . we have experienced and taken notice of a case of polyclonal gammopathy in a peritoneal dialysis patient with renal cystic hemorrhage .
polyclonal gammopathy represents the diffuse activation of b cells and is usually related to inflammation or immune - related diseases . however , the mechanisms leading to polyclonal gammopathy are essentially speculative . generally , infectious , inflammatory , or various other reactive processes may be indicated by the presence of a broad - based peak or band in the gamma region on serum protein electrophoresis results . a 15-year - old girl , who had been receiving peritoneal dialysis , presented with polyclonal gammopathy and massive gross hematuria . renal artery embolization was performed , after which the continuous bleeding subsided and albumin - globulin dissociation resolved . this is a rare case of polyclonal gammopathy related to renal bleeding .
acrylamide ( aa ) was first detected in heat - treated foods , especially potato chips , at high concentrations ( mg / kg ) by a group of swedish researches [ 1 - 3 ] . this finding aroused great interest in all the world because of the well - known toxicity of aa , classified as " probably carcinogenic to humans " ( group 2a ) by the international agency for research on cancer and as an a3 carcinogen ( confirmed animal carcinogen with unknown relevance to humans ) by the american conference of governmental industrial hygienists ( as cited in agency for toxic substances and disease registry ) . experimental studies in animals have shown that acrylamide causes chronic nephrotoxicity , adverse reproductive effects , and is characterized by genotoxic and carcinogenic activity mainly in glands : thyroid , mammary , adrenal , pituitary etc . the genotoxic activity of acrylamide seems to be partly mediated by its main metabolite , glycidamide [ 10 - 12 ] , which is mutagenic [ 13 - 15 ] . the risk of cancer due to aa intake is unclear ; the epidemiological studies on humans up to present have reported conflicting data and do not provide any substantial evidence that dietary exposure to aa is associated with cancer in humans , therefore more data are necessary to better assess the risk from dietary intake [ 7 , 16 ] , whereas the neurotoxicity activity of aa in humans is rather well known in accidental or occupational exposure through inhalation or dermal absorption . aa is produced during thermal processing , at temperatures of 120c or higher and low moisture , mainly via the maillard reaction , responsible for the flavour and colour of cooked foods , between amino acids ( mainly free asparagine ) and reducing sugars , such as glucose and fructose [ 1 , 7 , 18 , 19 ] . however , several other pathways and precursors have been proposed to contribute to aa formation as reviewed by keramat et al . . most of aa is formed rapidly during final phases of baking , grilling or frying processes of carbohydrate - rich foods such as fried potato and bakery products , biscuits , breakfast cereals , cocoa and coffee . after ingestion , aa is rapidly absorbed and distributed to different body tissues and organs such as muscle , liver , heart , thymus , brain , kidneys , placenta and breast milk , thus also representing a significant risk to the health of foetus and infants [ 22 , 23 ] . aa and glycidamide are then conjugated with glutathione , following the classical detoxification scheme , and eliminated in urine as mercapturic acid derivatives . since the urinary excretion is about 50% in the first 24 hours and 90% within 7 days , the aa metabolites could be used as an intake biomarker as recent exposure to aa [ 16 , 23 , 25 , 26 ] . as stated above , with concern for the potential risk on human public health , and in particular in babies and adolescents , since 2003 , at the request of the european commission , many studies have been carried out worldwide both on the development of analytical methods and on the determination of aa in food . according to this recommendation , furthermore , member states should carry out aa monitoring annually and provide the relative data to the european food safety agency ( efsa ) by june 1 of the following year . the recent efsa scientific report showed the results of the monitoring of aa in specific food categories from 2007 to 2010 and the estimation of the trend in aa levels by comparing results from 2007 , 2008 , 2009 and 2010 in main food categories and sub - categories . data collected showed only a few changes in the trend of aa values : a decrease in ' processed cereal based foods for infants and young children ' and an increase in ' coffee and coffee substitutes ' . the highest aa levels have been found in fried potato products , bread , bakery products and coffee . in 2010 the aa mean values ranged from 31 g / kg in ' other processed cereal based foods for infants and young children ' to 1350 g / kg in ' coffee substitutes ' , while breakfast cereals and biscuits had mean values of 138 g / kg and 289 g / kg respectively . the last scientific opinion on aa in food by efsa published in 2015 , confirms that the major contributing foods to aa exposure are potato products , coffee and bakery products ( biscuits and bread ) and relates that dietary aa intake is estimated in the range of 0.3 - 1.9 g/ kg b.w . per day for the general population , and for the 95 percentile exposure from 0.6 to 3.4 g / kg b.w . per day efsa concludes that " aa in food potentially increases the risk of developing cancer for consumers in all age groups " . within the european prospective investigation into cancer and nutrition ( epic ) study , . estimated the aa intake in 10 european countries : the study , involved a total of 39 994 participants , aged 35- 74 , showed that the mean intake ranged from 12 to 39 g per day for women and from 13 to 47 g for men . moreover , a substantial probability that the intake by children and adolescents is remarkably higher than that of adults must be considered , due to their more frequent consumption of certain foods such as fried potato products and biscuits . a large group of products contributing to aa intake is cereal - based food . in italy , to our knowledge , the data regarding dietary aa exposure principally concerned potato chips , which are estimated to contribute about 30% of the total diet [ 31 - 33 ] and coffee , whereas cerealbased foods have been investigated less in recent years . a maximum limit for aa in drinking water ( 0.5 g / l ) has been established by who , but no limit is established in food . in 2011 , the european commission established indicative values , as amended by recommendation ec of 2013 , for the food categories cited in recommendation ec of 2010 including ' french fries ' , ' potato crisps ' , ' soft bread ' , ' breakfast cereals ' , ' biscuits , crackers , wafers , crisp bread and similar ' , ' roast coffee ' , ' instant coffee ' , ' biscuits and rusks for infants and young children ' , ' processed cereal based foods for infants and young children ' and ' baby foods , other than processed cereal based foods ' , with the exception of the products for home cooking and ' other products ' . this recommendation stresses that ' these values are to be understood as indicative of the need for an investigation and not as safety thresholds ' . in italy , the second largest item of expenditure in the cereals derivatives segment is products for breakfast ( 30% of total ) . an increase in the volume of purchases of bakery products was observed ( + 3.2% ) compared to 2012 . furthermore , although in italy the breakfast cereals market is not yet as developed as in other countries , over the last few years we have witnessed a process of strong sales growth in volume . in particular , from 2004 to 2007 , the share of household spending on breakfast cereals has increased . in 2007 , fortified cereals and grains held the vast majority of sales quotas by volume , with 46% and about 44% respectively . the occurrence of aa in commercially available food is a matter of interest for public health due to continuous and prolonged exposure to a probable carcinogenic substance . as the ingestion of contaminated food is the primary route of potential human exposure to aa , the aim of this research was to determine aa levels in cereal- based food , in particular biscuits and breakfast cereals , considering the widespread use of these products for all ages . a total of 56 samples of biscuits and breakfast cereals of the most consumed brands in italy ( 17 and 5 respectively ) were randomly collected in the two major supermarkets in florence , as indicated by the european commission recommendation n 307 , and tested for aa . the samples collected included 12 breakfast cereals and 44 biscuits whose composition consisted of maize , rice , malt , oatmeal , wheat , spelt , barley , rye and cocoa in different combinations . aa determination was carried out following the method of wang et al . except for some modifications both in the extraction procedure and in the instrumental working conditions . the hplc method adopted is fast and cost - effective and it can be applied to screen the occurrence of aa in food samples ensuring a good degree of reliability . all organic solvents , methanol and acetonitrile , were from j.t . water was purified by a milli - q - ro4 water purification system ( millipore , bedford , ma , usa ) with a resistivity of 10 mcm . potassium hexacyanoferrate ( ii ) trihydrate and zinc sulfate heptahydrate were obtained from merck ( darmstad , germany ) . oasis hlb 200 mg/6 ml spe cartridges were obtained from waters ( milford , ma , usa ) . bond elut - accucat ( 200 mg/3 ml ) spe cartridges were purchased from varian ( chicago , il , usa ) and used with a spe vacuum manifold ( visiprep , supelco , bellefonte , pa , usa ) . amber glass auto - sampler vials with septum screw caps were obtained from agilent technologies ( wilmington , de , usa ) . the analytical column ( atlantis dc18 , 250 4.6 mm/5 ) with pre - column and syringe filters ( 0.45 m pvdf ) were from waters ( milford , ma , usa ) . a standard aa stock solution ( 1.0 mg / ml ) was prepared by dissolving 1.0 mg of aa in 1.0 ml of milli - q water . to weigh aa , an electronic analytical balance ( radwag , pce group , 0.01 mg radom , poland ) the aa stock solution was diluted in amber glass volumetric flasks to prepare calibration standards at 50 , 100 , 200 , 500 , 800 and 1000 ng / ml respectively and stored at 4c until use . 100 g of each sample was finely pulverized , homogenized and dehydrated at 103c for 4 hours , prior to sampling . a volume of 10 l of the internal standard solution , aa at 100 g / ml , was added to one centrifuge tube for recovery study . the samples were shaken for 3 min on a vortex and centrifuged ( 15 min at 3100 x g ) . the aqueous phase was collected and the extraction process was repeated twice , each time adding 2 ml of water , shaking for 2 min , and centrifuging for 15 min at 3100 x g. aliquots of 1 ml of a 0.355 mol / l potassium hexacyanoferrate ( ii ) trihydrate solution ( carrez i ) and 1 ml of a 1.04 mol / l zinc sulfate heptahydrate solution ( carrez ii ) were added to the supernatant for protein precipitation . the samples were shaken for 2 min , kept cool at 4c for 30 min , then centrifuged ( 15 min at 3100 x g ) . oasis hlb spe cartridges and bond elut - accucat spe cartridges , conditioned with methanol and washed by water , were used in sequence to remove the first eluted fraction containing interfering substances . the final eluted fractions were concentrated to 1 ml by evaporation under vacuum at 45c kept in amber glass vials at 4c before injection . hplc - uv analysis was performed with a hplc instrument equipped with a vacuum degasser , a binary pump , an autosampler , and a dad detector ( waters 1525 binary pump /waters 996 pda detector ) , at room temperature . the injection volume of calibration standards and sample extracts was 20 l ; aa was detected at two uv wavelengths of 200.5 and 210 nm . an isocratic elution was performed at a flow rate of 0.5 ml / min ; the mobile phase consisted of water / acetonitrile 96:4 ( v / v ) . the retention time of aa was approximately 10.1 min , and the total run time was 35 min . under these chromatographic conditions , aa and aa content is resulting from an average of three measurements and the relative standard deviation of each sample was below 10% . table i reports the analytical parameters calculated in the range of 0.05 - 2 g / g . the limit of detection ( lod ) ( calculated using the criterion signal to noise , s / n , of 3:1 ) and limit of quantification ( loq ) ( calculated using the criterion s / the intra - day and inter - day measurements show a good repeatability and reproducibility of the analytical methodology . analytical data of the acrylamide standard solution analysed by hplc - uv : linear regression equation ( peak area / conc . ) and correlation coefficient ( r ) calculated in the linearity range 0.05 - 2 g / g at wavelengths 210 and 200.5 nm ; limit of detection ( lod , s / n = 3/1 ) expressed as g / kg ; limit of quantification ( loq , s / n = 7/1 ) expressed as g / kg ; intra - day rsd and inter - day rsd ( n = 3 ) . values are referred to six independent samples analyzed in one day values are referred to six independent samples analyzed three times in three different days a total of 56 samples of biscuits and breakfast cereals of the most consumed brands in italy ( 17 and 5 respectively ) were randomly collected in the two major supermarkets in florence , as indicated by the european commission recommendation n 307 , and tested for aa . the samples collected included 12 breakfast cereals and 44 biscuits whose composition consisted of maize , rice , malt , oatmeal , wheat , spelt , barley , rye and cocoa in different combinations . aa determination was carried out following the method of wang et al . except for some modifications both in the extraction procedure and in the instrumental working conditions . the hplc method adopted is fast and cost - effective and it can be applied to screen the occurrence of aa in food samples ensuring a good degree of reliability . water was purified by a milli - q - ro4 water purification system ( millipore , bedford , ma , usa ) with a resistivity of 10 mcm . potassium hexacyanoferrate ( ii ) trihydrate and zinc sulfate heptahydrate were obtained from merck ( darmstad , germany ) . oasis hlb 200 mg/6 ml spe cartridges were obtained from waters ( milford , ma , usa ) . bond elut - accucat ( 200 mg/3 ml ) spe cartridges were purchased from varian ( chicago , il , usa ) and used with a spe vacuum manifold ( visiprep , supelco , bellefonte , pa , usa ) . amber glass auto - sampler vials with septum screw caps were obtained from agilent technologies ( wilmington , de , usa ) . the analytical column ( atlantis dc18 , 250 4.6 mm/5 ) with pre - column and syringe filters ( 0.45 m pvdf ) were from waters ( milford , ma , usa ) . a standard aa stock solution ( 1.0 mg / ml ) was prepared by dissolving 1.0 mg of aa in 1.0 ml of milli - q water . to weigh aa , an electronic analytical balance ( radwag , pce group , 0.01 mg radom , poland ) the aa stock solution was diluted in amber glass volumetric flasks to prepare calibration standards at 50 , 100 , 200 , 500 , 800 and 1000 ng / ml respectively and stored at 4c until use . 100 g of each sample was finely pulverized , homogenized and dehydrated at 103c for 4 hours , prior to sampling . a volume of 10 l of the internal standard solution , aa at 100 g / ml , was added to one centrifuge tube for recovery study . the samples were shaken for 3 min on a vortex and centrifuged ( 15 min at 3100 x g ) . the aqueous phase was collected and the extraction process was repeated twice , each time adding 2 ml of water , shaking for 2 min , and centrifuging for 15 min at 3100 x g. aliquots of 1 ml of a 0.355 mol / l potassium hexacyanoferrate ( ii ) trihydrate solution ( carrez i ) and 1 ml of a 1.04 mol / l zinc sulfate heptahydrate solution ( carrez ii ) were added to the supernatant for protein precipitation . the samples were shaken for 2 min , kept cool at 4c for 30 min , then centrifuged ( 15 min at 3100 x g ) . oasis hlb spe cartridges and bond elut - accucat spe cartridges , conditioned with methanol and washed by water , were used in sequence to remove the first eluted fraction containing interfering substances . the final eluted fractions were concentrated to 1 ml by evaporation under vacuum at 45c kept in amber glass vials at 4c before injection . hplc - uv analysis was performed with a hplc instrument equipped with a vacuum degasser , a binary pump , an autosampler , and a dad detector ( waters 1525 binary pump /waters 996 pda detector ) , at room temperature . the injection volume of calibration standards and sample extracts was 20 l ; aa was detected at two uv wavelengths of 200.5 and 210 nm . an isocratic elution was performed at a flow rate of 0.5 ml / min ; the mobile phase consisted of water / acetonitrile 96:4 ( v / v ) . the retention time of aa was approximately 10.1 min , and the total run time was 35 min . under these chromatographic conditions , aa and aa content is resulting from an average of three measurements and the relative standard deviation of each sample was below 10% . table i reports the analytical parameters calculated in the range of 0.05 - 2 g / g . the limit of detection ( lod ) ( calculated using the criterion signal to noise , s / n , of 3:1 ) and limit of quantification ( loq ) ( calculated using the criterion s / n of 7:1 ) . the intra - day and inter - day measurements show a good repeatability and reproducibility of the analytical methodology . analytical data of the acrylamide standard solution analysed by hplc - uv : linear regression equation ( peak area / conc . ) and correlation coefficient ( r ) calculated in the linearity range 0.05 - 2 g / g at wavelengths 210 and 200.5 nm ; limit of detection ( lod , s / n = 3/1 ) expressed as g / kg ; limit of quantification ( loq , s / n = 7/1 ) expressed as g / kg ; intra - day rsd and inter - day rsd ( n = 3 ) . values are referred to six independent samples analyzed in one day values are referred to six independent samples analyzed three times in three different days the results of the survey are shown in tables ii and iii . according to commission recommendation the first is the ingredient present in the largest quantity results lower than lod were assigned lod acrylamide ( aa ) content ( g / kg ) in breakfast cereals . the first is the ingredient present in the largest quantity results lower than lod were assigned lod of 56 samples tested , only five had aa concentrations below the detection limit ( 10 g / kg ) . the percentage of positive samples ( lod ) we detected in both kinds of food analysed was higher in biscuits ( 95.5% ) than in breakfast cereals ( 75% ) with a wide range of contamination and a considerable variability , as indicated from the high levels of standard deviation ( 294.1 and 287.75 respectively ) , also within each brand especially in biscuits ( tab . ii ) . in detail , the standard deviation of the samples of brand 6 was 297.85 ( aa levels ranging from < lod to 820 g / kg ) while that of brand 17 was 298.57 ( aa levels ranging from 30 g / kg to 700 g / kg ) . the biscuits of three brands ( number 1 , 9 and 16 ) showed the lower values , ranging from 30 to 50 g / kg , from < lod to 30 g / kg and from 30 to 40 g / kg respectively . in the biscuit category , compared to that of breakfast cereals , we noted also the highest value , in spite of the fact that the average value and the median are slightly lower . the range of contamination of biscuits was from 30 g/ kg to 940 g / kg . only ten samples ( 22.7% ) of biscuits showed a concentration above 500 g / kg , set as the indicative value recommended . the maximum level of 940 g / kg was found in the sample of brand 14 ( tab . ii ) , probably due to the industrial process conditions and to the presence of many different ingredients , such as wheat , oat , barley , rice , maize , rye . ingredients indeed play an important role in aa formation , as different cereals have different amounts of free asparagine and reducing sugars available for the maillard reaction . ec recommendation n 647 amended the previous indicative values for breakfast cereals according to the composition : for bran products and whole grain cereals the indicative value is 400 g / kg , for wheat and rye based products it is 300 g / kg , while for maize , oat , spelt , barley and rice based products the value is 200 g / kg . in the category of breakfast cereals tested , the aa occurrence , ranging from 60 to 810 g / kg , is less frequent ( 75% ) than in biscuits , although the percentage of samples with aa concentration above the indicative values recommended ( 33% ) was higher than that stated in the efsa report . the mean value obtained was 263.75 g / kg and the median value was 165 g / kg ; both these values were lower than those of the biscuits ( 297.18 and 200 g/ kg respectively ) and in agreement with data recorded in europe and other countries [ 7 , 21 , 28 ] . the highest values were found in two samples of brand 4 , one consisting of spelt ( 780 g / kg ) and the other consisting of wheat , rice and cocoa ( 810 g / kg ) : this also supports the hypothesis that the industrial process of preparation is the determinant key factor . of 56 samples tested , 18 ( 32.1% ) contained cocoa : 12 ( 27.3% ) biscuits and six ( 50% ) breakfast cereals . none of these had aa concentrations below the detection limit , and they showed a wide range of contamination , from 60 g / kg in a breakfast cereal to 840 g / kg in a biscuit sample . the average value of all samples containing cocoa was 375 g / kg and the median 275 g / kg . in comparison to the rates related to the aa contamination in the samples without cocoa ( mean = 242.6 g / kg , median = 95 g / kg ) , we suppose that the presence of cocoa probably contributes to the increase of aa concentration . some studies [ 46 , 47 ] reported that aa concentration in cocoa is variable and can reach concentrations of about 600 g / kg . in the scientific report of efsa on aa levels in food from monitoring years 2007 to 2010 , the average concentration of aa in breakfast cereals and biscuits ranged from 138 and 289 g / kg to a maximum of 1290 and 5849 g / kg respectively , and the median values are 99 and 91 g / kg ( data referring to 2010 ) . we noted that our results show mean and median values higher than those reported by efsa , while the maximum values are clearly lower . our results , compared to the aa indicative values recommended , showed that 22.7% of biscuits and 33% of breakfast cereals exceeded the indicative values set at 500 g / kg for biscuits and from 200 to 400 g / kg for breakfast cereals , depending on the composition . our findings are interesting to evaluate the impact of aa on dietary intake as the overall consumption of breakfast cereals by italian consumers is 14.8 g / d , while the overall consumption of biscuits is more relevant because it is rated at 27.3 g / d . for food consumption data authors referred to a survey carried out by the italian institute for nutrition ( inran ) that is highly representative of italian population for age , gender , geographical area and the wide number of subjects involved . in conclusion our data , not unlike that from the most recent research carried out in italy and other countries , showed widespread contamination by aa with high frequency of positive samples ( 91% of all samples tested lod ) and considerable variability in concentration values , most likely due to industrial processing and the presence of various ingredients . the good news is that 41.1% of samples tested , 40.9% biscuits and 41.7% breakfast cereals , showed an aa concentration below 100 g / kg , which can be considered a low value , even if low concentrations may not imply zero risk , especially in view of neoplastic effects based on animal evidence . since cereal based products are contributing substantially to human exposure , reducing aa levels in foods should be a high priority to decrease the risk for human health .
summaryintroduction.acrylamide , produced during thermal processing of carbohydrate - rich foods , is classified as " probably carcinogenic to humans " by the international agency for research on cancer.objective.the aim of this study was to determine acrylamide levels in biscuits and breakfast cereals considering the widespread use of these products for all ages.method.acrylamide determination was carried out in 56 samples by hplc - uv technique.results and discussion.the results showed a considerable variability in the contents of acrylamide in the samples analysed , most likely due to differences in industrial processing and ingredients . the percentages of contaminated samples tested were very high ( 95.5% of the biscuits and 75% of the breakfast cereals ) with a wide range of contamination : from 30 g / kg to 940 g / kg . our results showed that 22.7% of biscuits and 33% of breakfast cereals exceeded the indicative values recommended by ec 2013/647 set at 500 g / kg and 200 - 400 g / kg ( according to the composition ) respectively.conclusions.our findings suggest concern about the risk for human health .
pregnant women are at risk of infection during labor and delivery ; most infections of the female pelvic organs occur when normal flora of the female genital or gastrointestinal tract contaminate the normally sterile amniotic fluid and uterus . these bacteria can become pathogenic , particularly in devitalized tissue . bacterial infections in pregnant women may also originate from inoculation of bacteria during childbirth or surgery or from hematogenous spread . uterine infections are much more common after cesarean delivery ( c - section ) than following a vaginal delivery . fortunately , postpartum or puerperal infections have decreased over the last hundred years due to improved procedures and effective antibiotic use . however , infections still cause about 13% of pregnancy - related deaths and are the fifth leading cause of death among this population . group a streptococcus ( gas ) , or streptococcus pyogenes , is an uncommon , but serious and potentially preventable cause of postpartum and postsurgical infections . the incidence of confirmed gas infections among deliveries in a study in jerusalem over 6.5 years ranged from 0.33 to 3.16 per 1000 births ; suspected intra- or postpartum gas infections occurred in 13.2% of all deliveries . in a review of records of all mothers and babies with gas bacteremia in the united kingdom from 19801999 , peripartum gas infection occurred in 1 of every 11,000 live births . the source of a sporadic postpartum gas infection is typically unknown , but outbreaks of postpartum and postsurgical gas infections have been associated with colonized healthcare workers . healthcare workers who were asymptomatic carriers of gas have been identified in 15 of 21 outbreaks of postpartum and postsurgical infections reported from 1976 through 2005 [ 626 ] ; these infections represent a preventable manifestation of severe gas disease . in 2002 , centers for disease control ( cdc ) published guidelines for prevention of secondary invasive gas infections , including those among postpartum and postsurgical patients . recommended strategies for the investigation of both a single case and clusters of postpartum or postsurgical gas infection were developed . in brief , a single healthcare - associated infection should trigger notification of the hospital infection control practitioner , enhanced surveillance for additional cases and storage of gas patient isolates for potential strain characterization . when two or more postpartum or postsurgical cases occur in the same healthcare facility within six months , cdc recommends that epidemiologic links between the cases be investigated , including screening for gas colonization of healthcare personnel linked to known cases . although these guidelines were published in 2002 , the level of awareness and adherence to these recommendations is unknown . also , clinician knowledge and management of pregnancy - related and postsurgical infections has not been assessed . we conducted a survey of obstetric and gynecologic providers ( ob / gyns ) to estimate the frequency of intrapartum , postpartum , and postsurgical infections they encounter to determine bacterial culturing practices among providers , and to estimate the frequency of gas isolation among the respondents patient populations . we also sought to estimate awareness and adherence to the cdc guidelines , assess barriers to follow the guidelines , and query providers regarding more effective methods for distributing these recommendations . in july 2005 , an anonymous questionnaire focusing on current practices regarding intrapartum , postpartum , and postsurgical infections was mailed to 1300 american college of obstetricians and gynecologists ( acog ) fellows and junior fellows in practice ; 1000 subjects were members of the collaborative ambulatory research network ( carn ) . members of carn are practicing ob / gyns who have volunteered to participate regularly in surveys , facilitating assessment of clinical practice patterns , and aiding development of educational materials . the remaining 300 subjects consisted of a computer - generated random sample of acog fellows and junior fellows in practice who are practicing obstetrics and/or gynecology and had not received a survey from acog during the previous two years ( non - carn ) . a second mailing was sent approximately five weeks after the first to those individuals who did not initially respond . all survey respondents who reported performing deliveries or surgeries in 2004 were eligible for inclusion in our analysis . the survey included questions about the practitioner 's age and training , his / her practice , patient population demographics , and specific questions assessing experience with diagnosing and treating intrapartum , postpartum ( e.g. , wound infections , endometritis , bacteremia ) , and postsurgical infections ( e.g. , wound infections , endometritis , vaginal cuff cellulitis , bacteremia ) , particularly infections potentially due to gas . survey respondents were asked to estimate the racial and ethnic distributions of their patient population , number of deliveries and surgeries performed and related infections seen during 2004 . questions also assessed the practitioner 's use and understanding of the cdc guidelines for prevention of gas infections among postpartum and postsurgical patients . survey responses were double - entered into an american standard code for information interchange ( ascii ) file , corrected for data entry errors , and converted into an sas 9 database ( sas institute , cary , nc , usa ) . the racial and ethnic characteristics of the provider 's patient population were dichotomized into the following categories , based on the distribution of responses : less than 80% white versus 80% or more white ; less than 25% versus 25% or more black ; less than 20% versus 20% or more hispanic ; less than 7% versus 7% or more asian / pacific islander . the percentage of patients with medicaid was divided into low ( < 25% ) , medium ( 2549% ) , and high ( 50% ) categories . comparisons of responses by carn and non - carn members were completed for all survey questions . all statistically significant differences between carn and non - carn are presented ; otherwise the results for both carn and non - carn combined are shown . completed surveys were returned by 614 ( 61% ) carn and 75 ( 24% ) non - carn members ( 53% of all respondents ) . respondents who had not performed deliveries or surgeries in 2004 ( 54 carn and 6 non - carn respondents ) were excluded . demographic and practice characteristics of the remaining 629 survey respondents are detailed in table 1 . a majority of respondents practiced in a group setting , worked in an urban or suburban location , and considered themselves specialists . members of carn were older and more likely than nonmembers to be male and to have been in practice for 10 or more years . significant differences in sex of the respondents and number of years in practice among carn versus non - carn members did not persist when controlling for age : age and years of experience were highly correlated ( pearson correlation coefficient , r=0.91 ; p<.0001 ) . nearly all providers performed both deliveries ( vaginal or cesarean ) ( 91% ) and surgeries ( hysterectomies or cesarean deliveries ) ( 96% ) in the year preceding the survey . based on respondents estimates , the median number ( and range ) of vaginal deliveries performed per provider in 2004 were 120 ( 4512 ) ( n=568 survey respondents ) , and a median of 55 ( range : 1450 ) surgeries were performed per provider in 2004 ( n=596 respondents ) . based on respondents ' estimates , the median number of patients ( per provider ) who developed intraamniotic infection or chorioamnionitis in the year preceding the survey was five ( range : 0100 ) . nearly all respondents ( 91% of 568 ) stated that they would treat an intraamniotic infection empirically , without obtaining a complete blood count or blood culture or waiting for the results of either test if obtained . over half of respondents believe that the most common bacterial cause of intraamniotic infections is polymicrobial ( table 2 ) . with increasing years of experience , providers were more likely to consider gram - negative rods the most common bacterial cause of intraamniotic infections and less likely to consider the cause polymicrobial in origin ( chi - square test for linear trend : p < .001 for each ) . per survey respondents , an estimated 3% of patients who had vaginal deliveries developed a postpartum infection , and 7% of patients undergoing surgery ( cesarean delivery or hysterectomy ) developed postsurgical infections . over half of providers stated that they do not obtain diagnostic specimens from their patients with postpartum infections ; only 14% always obtain specimens . providers with increasing years of experience were more likely to routinely obtain specimens for microbiological diagnosis of postpartum infections ( chi - square test for linear trend : p=.002 ) . those who considered themselves both primary care physicians and specialists were more likely to routinely obtain cultures than respondents who considered themselves specialists only ( 21% versus 10% ; p<.001 ) . the suspected frequency of staphylococcus aureus and group b streptococcal infections differed for postpartum compared to postsurgical infections ( table 2 ) . in general , more providers either always ( 18% ) or sometimes ( 52% ) obtained cultures from patients with postsurgical infections compared to those with postpartum infections ; only 30% empirically treated without obtaining specimens . providers with increasing years of experience were more likely to always obtain specimens from patients with postsurgical infections ( chi - square test for linear trend : p=.004 ) . as with postpartum infections , those respondents who considered themselves both primary care providers and specialists were more likely to routinely obtain specimens than those who considered themselves specialists ( p=.001 ) . when asked to estimate how many of their patients developed a postpartum infection or a postsurgical infection that was caused by gas in the previous year , 384 and 472 providers responded , respectively . the numbers of estimated gas - specific infections for all providers combined were 81 postpartum and 81 postsurgical gas infections . when gas is isolated during routine rectovaginal culture for group b streptococcus ( gbs ) , 9% of respondents stated that they would treat the patient with antibiotics , 15% would give intrapartum antibiotic prophylaxis similar to management of gbs , most respondents ( 64% ) would do nothing , and 8% stated that they either do not see this organism or their laboratory does not routinely test rectovaginal cultures for gas . the majority of survey respondents correctly indicated that each of the five body sites listed ( oropharynx , nares , rectum , vagina , and skin ) may be colonized by gas ( table 3 ) although less than half ( 47% ) chose all five sites . respondents chose the following as possible causes of a cluster of postpartum or postsurgical gas infection in a facility : healthcare worker is a gas carrier ( 44% respondents ) ; patient being colonized prior to delivery or surgery ( 28% ) ; as well as poor infection control practices ( 23% ) . answers given to questions about potential sites of gas colonization and possible causes of clusters did not vary by provider characteristics such as years in practice or practice type . when questioned about action taken when a postpartum or postsurgical gas infection is identified , 25% would contact infection control personnel . few respondents chose the other two actions recommended in the cdc guidelines ( save gas isolates for further study ; enhance surveillance for such infections ) ( table 3 ) . the majority ( 73% ) of respondents stated that they had not diagnosed any gas infections . the proportion of respondents who would take actions recommended in the guidelines increased with increasing years in practice ; the proportion was also higher among providers with practices in rural areas . few survey respondents correctly identified the number of postpartum or postsurgical gas infections that should trigger infection control notification and investigation if the infections occurred in the same facility within six months : 23% stated correctly that two such infections should elicit this response ( table 3 ) . carn members ( 26% ) more frequently chose this response than non - carn members ( 4% ; p<.01 ) . no significant associations between choosing the correct response and other provider characteristics ( i.e. , years in practice , practice type or location ) were noted . only 5.6% of respondents ( n=611 ) stated that they were familiar with the 2002 cdc guidelines for management of gas infections ; in fact , over 70% were unaware of their existence . other barriers to learning about or following the guidelines included : perceived infrequency of gas infections in the respondent 's practice ( 18% ) , publication in a journal not routinely read ( 13% ) , the fact that the provider does not consider gas infection a priority disease ( 9% ) , and a lack of culture results for postpartum and postsurgical infections ( 4% ) . most ( 74% ) respondents stated that they do follow guidelines regarding diagnostic , management , or treatment of postpartum and postsurgical infections , principally those by acog ( 59% ) and those which are part of hospital infection control protocols ( 32% ) . our study is the first published survey of the knowledge , attitudes , and practices of ob / gyns regarding the perceived frequency , etiology , and management of intrapartum , postpartum , and postsurgical infections . among a large number of ob / gyns , we found that most empirically treat a variety of infections encountered in their routine practice . although this approach is within current standards of care , this presents a missed opportunity for the identification and potential prevention of illnesses such as severe gas infections . both our survey and the current literature suggest that intraamniotic , postpartum , and postsurgical infections are not uncommon . the providers in our survey identify approximately three postpartum infections per 100 vaginal deliveries and 7 postsurgical infections per 100 cesarean deliveries and hysterectomies . these estimates are conservative , as they do not include deliveries by other providers ( e.g. , family practitioners ) , but are consistent with previous estimates in the literature . intraamniotic infections have been reported to range from 0.5% to 10.5% of all pregnancies , occurring in 15% of term pregnancies and up to 10% in patients with premature labor [ 2832 ] . puerperal or postpartum endometritis has been reported to occur in 13% of women with vaginal deliveries and among 515% of women having scheduled repeat cesarean deliveries [ 1 , 28 ] . nearly all survey respondents treat intrapartum , postpartum , and postsurgical infections empirically although providers are more likely to obtain diagnostic specimens from patients with postsurgical infections . while no formalized guidelines on diagnostic management of intrapartum and postpartum infections exist , empiric therapy is not contrary to current practice recommendations . recently developed acog guidelines on the use of prophylactic antibiotics in labor and delivery recommend the use of prophylactic antibiotics in both high- and low - risk patients undergoing cesarean delivery although the data to support use among low - risk patients is inconclusive . blood cultures are typically taken only when the patient does not respond to empiric antibiotics or if complications arise . the rationale for not obtaining diagnostic cultures is multifold ; antibiotic therapy is typically empiric and based on clinical diagnosis , patients often respond to antibiotics before culture results are known , anaerobes are notoriously difficult to isolate , accurate postpartum endometrial specimens are difficult to obtain because of possible contamination by the lower genital tract , and cultures add cost and time . conversely , pretreatment cultures facilitate management of patients who fail initial empiric antibiotic . investigations of the specific pathogens causing intraamniotic , postpartum , and postsurgical infections have shown that the primary causative agents change over time . for example , the principal etiology of early onset neonatal sepsis has ranged from gas in the 1930s1940s , e. coli in the 1940s1970s , to group b streptococci in the current era . also , recent studies have documented an increase in the proportion of healthcare - associated bloodstream infections and the emergence of community - associated methicillin - resistant staphylococcus aureus infections among pregnant and postsurgical patients [ 3840 ] . comprehensive studies to evaluate the etiologies of pregnancy - related infections have not been performed for over 15 years [ 4145 ] . periodic evaluations of the etiologies of pregnancy - related infections and the prevalence of antibiotic - resistant isolates among this population would be useful . another benefit of obtaining pretreatment cultures is that identification of certain pathogens , such as gas , should trigger specific infection control measures to prevent spread of disease . gas infections can be devastating with an overall case fatality ratio ( cfr ) of 13% and cfrs of 2536% for the most severe manifestations necrotizing fasciitis and streptococcal toxic shock syndrome . because we only surveyed ~3% of the nation 's ob / gyns , we estimate that as many as 2700 postpartum and 2700 postsurgical gas infections may occur annually in the united states . healthcare - associated transmission of gas infections can sometimes be prevented , for example , in instances where an asymptomatic colonized healthcare worker is identified and treated as a result of a thorough epidemiologic investigation . provider responses to the gas - specific questions included in our survey underscore both the lack of awareness of the cdc gas guidelines among one of their targeted audiences very few providers were aware of the guidelines and the recommended public health action following identification of postpartum and postsurgical gas infections . the principal reason for not understanding or following these guidelines was a lack of awareness of their existence , most likely because they were published in a journal not read by this group of providers . potential solutions to this dilemma include publication in journals relevant to ob - gyns , incorporation into acog guidelines and hospital infection control protocols , presentation at relevant meetings , and inclusion in cme lecture series . a common thread in our survey results is the association of increasing years of experience and older age with a variety of practice patterns . older , more experienced providers were far more likely to attempt to determine the etiology of intra- and postpartum infections and also had different beliefs from younger providers as to the specific etiologies of such infections.the reasons for these trends are unknown but may include changes in medical education or in the epidemiology of these infections . limitations of our survey include our low response rate , particularly among non - carn providers although it is consistent with other acog surveys [ 47 , 48 ] . an important limitation is that we were unable to validate the estimated number of procedures performed and actual practices reported by the respondents . it is possible that the frequencies of infections reported are significantly underestimated . also , given the low number of providers who were aware of the cdc guidelines for postpartum and postsurgical gas infections , attempts to estimate the respondents ' understanding of specific aspects of these guidelines are of limited value . in summary , although the use of empiric antibiotics in intraamniotic , postpartum , and postsurgical infections may currently be effective in most cases , the paucity of diagnostic cultures obtained presents a missed opportunity to monitor the etiology of these infections and to identify a potentially preventable cause of serious healthcare - associated disease gas infections . current efforts to educate providers regarding the settings in which the identification of gas should trigger a public health response and augment infection control practices are inadequate . however , our survey identified more effective means of communicating with practicing ob / gyns and also emphasized that educational efforts should target the infection control practitioner ( icp ) as most hospitals currently rely on the icp to identify potential healthcare - associated infections and initiate necessary investigations . periodic , time - limited studies of the etiologies of pregnancy - related infections by public health and clinical researchers would help to monitor changes in the principal pathogens , track trends in antimicrobial resistance , and guide clinical management .
background . knowledge , attitudes , and practices of obstetricians and gynecologists regarding the centers for disease control and prevention ( cdc ) recommendations for prevention of healthcare - associated group a streptococcal ( gas ) infections as well as general management of pregnancy - related and postpartum infections are unknown . methods . questionnaires were sent to 1300 members of the american college of obstetricians and gynecologists . results . overall , 53% of providers responded . postpartum and postsurgical infections occurred in 3% and 7% of patients , respectively . only 14% of clinicians routinely obtain diagnostic specimens for postpartum infections ; providers collecting specimens determined the microbial etiology in 28% . microbiologic diagnoses were confirmed in 20% of postsurgical cases . approximately 13% and 15% of postpartum and postsurgical infections for which diagnoses were confirmed were attributed to gas , respectively . over 70% of clinicians were unaware of cdc recommendations . conclusions . postpartum and postsurgical infections are common . providing empiric treatment without attaining diagnostic cultures represents a missed opportunity for potential prevention of diseases such as severe gas infections .
when various talkers speak concurrently , listeners are required to identify target speech but also to identify location of the target talker for the segregation of competing speech signals . in this everyday listening situation , binaural hearing has been known to provide better speech perception and sound localization over monaural hearing . the advantage of binaural hearing for recognizing speech in noise has been explained in terms of binaural summation , binaural squelch , and head shadow effects.1 - 3 ) the use of binaural devices becomes increasingly common to hearing - impaired listeners since the binaural stimulation prevents neural degeneration associated with auditory deprivation.4,5 ) due to an expansion of cochlear implant ( ci ) candidacy , more individuals are eligible to receive ci.6 ) in general , people with unilateral ci can detect and recognize target sounds well in quiet listening conditions , yet their performances are greatly decreased in noisy listening situations.7 - 10 ) the unilateral ci users can achieve better speech perception in noise through binaural hearing , by either bilateral implantation or bimodal hearing ( the use of a ci in one ear and a hearing aid in the unimplanted ear ) . although the bilateral cis are becoming more common , it may not be recommended for all adult users with unilateral ci due to several reasons such as the substantial amount of residual hearing in unimplanted ear , and other health or financial issues.5,10,11 ) the advantage of wearing a hearing aid on the unimplanted ear , called the bimodal benefit , has been well documented from objective localization or recognition performance in adult and children ci users.12 - 18 ) although the group results revealed the significant bimodal benefits to speech recognition , some researchers emphasized analyses of the individual bimodal benefits . in addition , research on the subjective reports obtained with bimodal hearing has been limited compared to an extensive body of literature on objective measures . at present , only a few studies have examined both objective and subjective outcomes with bimodal devices.16,19 ) the studies above showed substantial individual differences in bimodal advantages between outcomes . given the issues , the current study concerned not only the group results but also the individual data on both objective and subjective outcomes . beyond the earlier studies which have mostly used a limited type of materials for objective measure , the present study measured localization and recognition abilities using both environmental sounds and target speech in quiet or with a competing speech . the research questions addressed in this study were as follows : 1 ) are there more benefits in bimodal individuals when localizing and recognizing sounds ? , and 2 ) are the objective performances associated with the subjective reports with bimodal hearing ? fourteen ci recipients ( mean age , 50.915.3 years ) participated for the experimental testing . the subjects were all postlingually deafened adults , and their mean duration of bimodal experience was approximately 0.9 years . the mean of puretone thresholds averaged ( pta ) across 0.5 , 1 , 2 khz with ci alone was 27.65.8 db hl , and the pta obtained by using hearing aid ( ha ) alone was 49.210.1 db hl . table 1 shows the ci participants ' demographic information on chronological age , sex , ci or ha aided threshold averaged across 0.5 , 1 , 2 khz , and details about cochlear implant and hearing aid usage . for pilot testing , ten normal - hearing adults ( mean age , 26.3 years ) participated in order to confirm the difficulty level of our testing , rather than for the purpose of group comparison . as a material of environmental sounds , forty environmental sounds developed by shafiro20 ) were used . as speech materials , sentences of the korean standard sentence lists for adults21 ) were used to make three types of speech materials for one - male talker , one - female talker , and two - talker ( male target talker with female background talker ) conditions . since the sentences had duration of approximately 4 - 7 seconds and the environmental sounds had different durations , some short environmental sounds were edited to repeat via adobe audition ( version 3.0 , adobe systems incorporated , san jose , ca , usa ) to make them last approxima - tely 5 seconds . all the target sounds were presented at 65 db sound pressure level and calibrated using sound level meter ( type 2150l , brel and kjr , skodsborgvej , denmark ) before testing . each participant was seated approximately 70 cm from the center of the 8-loudspeaker array that spaced 45 apart in a circle around the participant . participants were informed of the number of each speaker , and were instructed that one out of eight speakers would randomly present the target sound . on the measurement of localization ability , listeners were required to say the number of the loudspeakers that they thought the target sounds were coming . for the two - talker condition where the target male and competing talkers spoke at the same time , listeners needed to indicate the loudspeaker of male - target source . on the recognition measurement of environmental sounds or 1-talker sentence , the listeners were asked to say the environmental sounds or the sentences they heard . for the two - talker condition , the sentences spoken by target male talker were asked to repeat while ignoring the female 's speech . the abilities of localization were scaled depending on errors between the target speaker and the response speaker indicated by the subject . for example , when the listeners localized the target source correctly , a scale of 5 was given , which was calculated to imply 100% . when the listeners incorrectly responded as one of the two speakers next to the target speaker , a scale of 4 was given . when two , three , and four speakers were deviated from the target speaker source as responses , then the scales of 3 , 2 , and 1 were taken , respectively . those scales then were converted to percent correct ( % ) , where the score of 100% represents perfect localization . scoring sentence recognition , the user 's device settings and programs were verified to be preferred for everyday listening , and were maintained during the experimental testing . for the ci alone all the participants were familiarized to number the speaker source using speech - shaped noise until the correct numbering of speaker reached 70% . the order of two listening conditions ( ci alone , ci&ha ) and various target materials ( one - male , one - female , two - talker speech , and environmental sound ) was randomly selected for each listener . after the measurement of objective performances , each participant completed the korean - version of speech , spatial , and qualities of hearing scale ( k - ssq ) questionnaire.22 ) the ssq23 ) questionnaire was developed to measure a listener 's self - reported ability to hear in various listening situations within the three domains.24 ) first , the speech domain assesses various aspects of hearing speech in a range of realistic conversational situations involving such as reverberation and multiple talkers . second , the spatial domain covers the directional and distance aspects of listening and also the movement of the sound stimuli . third , the quality domain examines the degree of sound quality or clarity through various types of sounds . each domain of k - ssq includes 50 items , and each item is scored from 1 to 10.22 ) here , 1 always represents greater difficulties experienced , while the higher scores reflect greater abilities . since the purpose of this questionnaire was to determine the relative effectiveness of bimodal devices , participants were asked to report disabilities they experienced in the bimodal hearing . to present k - ssq results , listeners ' answers on each k - ssq item were converted to percent correct ( % ) . to confirm the difficulty level of the experimental testing , ten young normal - hearing adults were evaluated for both localization and recognition as a pilot testing . results showed that the localization performance of young normal - hearing adults ranged 99 - 100% , regardless of the test material . this verifies that this experimental testing was not too difficult , at least for normal - hearing adults . chicago , il , usa ) . a two - way analysis of variance with repeated measures was performed to determine the effects of test material ( environmental sounds , 1-talker speech , 2-talker speech ) and device condition ( ci , ci&ha ) on localization and speech recognition performances . to further estimate any relationships among objective and subjective measures or any relationships between demographic information and outcomes , pearson correlation analyses were conducted . fourteen ci recipients ( mean age , 50.915.3 years ) participated for the experimental testing . the subjects were all postlingually deafened adults , and their mean duration of bimodal experience was approximately 0.9 years . the mean of puretone thresholds averaged ( pta ) across 0.5 , 1 , 2 khz with ci alone was 27.65.8 db hl , and the pta obtained by using hearing aid ( ha ) alone was 49.210.1 db hl . table 1 shows the ci participants ' demographic information on chronological age , sex , ci or ha aided threshold averaged across 0.5 , 1 , 2 khz , and details about cochlear implant and hearing aid usage . for pilot testing , ten normal - hearing adults ( mean age , 26.3 years ) participated in order to confirm the difficulty level of our testing , rather than for the purpose of group comparison . the current study presented environmental sounds and sentences as test materials . as a material of environmental sounds , forty environmental sounds developed by shafiro20 ) were used . as speech materials , sentences of the korean standard sentence lists for adults21 ) were used to make three types of speech materials for one - male talker , one - female talker , and two - talker ( male target talker with female background talker ) conditions . since the sentences had duration of approximately 4 - 7 seconds and the environmental sounds had different durations , some short environmental sounds were edited to repeat via adobe audition ( version 3.0 , adobe systems incorporated , san jose , ca , usa ) to make them last approxima - tely 5 seconds . all the target sounds were presented at 65 db sound pressure level and calibrated using sound level meter ( type 2150l , brel and kjr , skodsborgvej , denmark ) before testing . each participant was seated approximately 70 cm from the center of the 8-loudspeaker array that spaced 45 apart in a circle around the participant . participants were informed of the number of each speaker , and were instructed that one out of eight speakers would randomly present the target sound . on the measurement of localization ability , listeners were required to say the number of the loudspeakers that they thought the target sounds were coming . for the two - talker condition where the target male and competing talkers spoke at the same time , listeners needed to indicate the loudspeaker of male - target source . on the recognition measurement of environmental sounds or 1-talker sentence , the listeners were asked to say the environmental sounds or the sentences they heard . for the two - talker condition , the sentences spoken by target male talker were asked to repeat while ignoring the female 's speech . the abilities of localization were scaled depending on errors between the target speaker and the response speaker indicated by the subject . for example , when the listeners localized the target source correctly , a scale of 5 was given , which was calculated to imply 100% . when the listeners incorrectly responded as one of the two speakers next to the target speaker , a scale of 4 was given . when two , three , and four speakers were deviated from the target speaker source as responses , then the scales of 3 , 2 , and 1 were taken , respectively . those scales then were converted to percent correct ( % ) , where the score of 100% represents perfect localization . scoring sentence recognition prior to the testing , the user 's device settings and programs were verified to be preferred for everyday listening , and were maintained during the experimental testing . for the ci alone all the participants were familiarized to number the speaker source using speech - shaped noise until the correct numbering of speaker reached 70% . the order of two listening conditions ( ci alone , ci&ha ) and various target materials ( one - male , one - female , two - talker speech , and environmental sound ) was randomly selected for each listener . after the measurement of objective performances , each participant completed the korean - version of speech , spatial , and qualities of hearing scale ( k - ssq ) questionnaire.22 ) the ssq23 ) questionnaire was developed to measure a listener 's self - reported ability to hear in various listening situations within the three domains.24 ) first , the speech domain assesses various aspects of hearing speech in a range of realistic conversational situations involving such as reverberation and multiple talkers . second , the spatial domain covers the directional and distance aspects of listening and also the movement of the sound stimuli . third , the quality domain examines the degree of sound quality or clarity through various types of sounds . each domain of k - ssq includes 50 items , and each item is scored from 1 to 10.22 ) here , 1 always represents greater difficulties experienced , while the higher scores reflect greater abilities . since the purpose of this questionnaire was to determine the relative effectiveness of bimodal devices , participants were asked to report disabilities they experienced in the bimodal hearing . to present k - ssq results , listeners ' answers on each k - ssq item were converted to percent correct ( % ) . to confirm the difficulty level of the experimental testing , ten young normal - hearing adults were evaluated for both localization and recognition as a pilot testing . results showed that the localization performance of young normal - hearing adults ranged 99 - 100% , regardless of the test material . the average scores of speech recognition ranged 94% to 100% across the target materials . this verifies that this experimental testing was not too difficult , at least for normal - hearing adults . statistical analyses were conducted using spss 18.0 ( spss inc . , chicago , il , usa ) . a two - way analysis of variance with repeated measures was performed to determine the effects of test material ( environmental sounds , 1-talker speech , 2-talker speech ) and device condition ( ci , ci&ha ) on localization and speech recognition performances . any necessary bonferroni - adjusted post - hoc multiple comparisons were also performed . to further estimate any relationships among objective and subjective measures or any relationships between demographic information and outcomes , pearson correlation analyses were conducted . mean performances of localization ( % ) are shown in fig . 1 when the environmental sounds , 1-talker , and 2-talker speech materials were presented . here , the scores with 1-talker speech show performance averaged across one - male and one - female conditions because of no significant effect of target - talker gender ( one male vs. one female ) or no related interactions . statistical results revealed that , on average , the localization scores with ci&ha were significantly greater than the scores with ci alone ( p<0.01 ) . the post - hoc pairwise multiple comparison results revealed that the localization performance of environmental sounds was significantly superior to the localization performance of 1-talker speech , which was significantly greater than the scores obtained with 2-talker speech ( p<0.01 ) . a two - way interaction between test material and device condition was also significant ( p<0.01 ) , indicating that the amount of bimodal benefits differed by the type of test materials . concerning the emphasis on individual results in binaural advantages , the present study explored whether all the ci recipients localized better with ci&ha than with ci alone and also whether the individual bimodal benefits in localization performance were consistent across test materials . 2 shows individual and mean bimodal benefits ( score with ci&ha - score with ci alone ) on the localization performance . as shown at the far right of fig . 2 , the mean performance improved by 9 - 12 percentage points with bimodal hearing , regardless of the test material . however , the amount of improvement varied across participants and test materials . when localizing environmental sounds , the bimodal benefits were greater than 20 percentage points to some participants ( s4 , s9 , and s11 ) while other participants ( s2 , s12 ) exhibited little bimodal benefits . when localizing 1-talker speech , three participants ( s10 , s12 , and s13 ) showed very minimal performance difference between their ci and ci&ha conditions . when localizing 2-talker speech , bimodal hearing provided relatively greater benefits ( 24 - 28 points ) to some ci recipients ( s5 , s6 , and s7 ) , whereas no improved ( s1 , s12 ) or even worsened localization performance ( s2 ) was observed with bimodal stimulation . summarizing , bimodal hearing appears to be beneficial to localizing target sounds based on the group - mean data . however , bimodal hearing does not lead to better localization performance to all ci participants . besides a substantial inter - subject variability in localization bimodal benefits , some participants ( s3 , s5 , and s13 ) showed a large intra - subject variability in bimodal benefits depending on the test material . average recognition scores ( % ) of the three test materials are plotted in fig . 3 . the recognition scores with 1-talker speech show performance averaged across one - male and one - female talker conditions . results showed significantly higher recognition scores with ci&ha compared to with ci alone ( p<0.01 ) . the pairwise multiple comparisons revealed that the overall performance of 1-talker speech recognition was significantly better than the recognition performance of environmental sounds , which was significantly superior to the 2-talker speech performance ( p<0.01 ) . 3 , the degree of bimodal benefits on recognition performance was substantially greater for the 2-talker speech than for other test materials . this tendency appeared to be significant from a two - way interaction between test material and device condition ( p<0.01 ) , due possibly to a greater room to be increased for 2-talker recognition performance with ci alone . 4 shows individual and mean bimodal benefits ( score with ci&ha - score with ci alone ) on the recognition scores . as shown at the far right of fig . 4 , the mean bimodal benefit was approximately 6 percentage points when recognizing both environmental sounds and 1-talker speech . the bimodal hearing facilitated the mean performance of 2-talker speech recognition by about 21 percentage points . considering the large individual variability in bimodal advantages for localization , a question of how the individual bimodal benefits varied across participants and test materials was also addressed for recognition performance first , when recognizing environmental sounds , bimodal hearing did not yield any advantage to five ( s3 , s7 , s8 , s10 , and s13 ) out of 14 participants . when recognizing 1-talker sentence , the benefits from bimodal device were substantially lower ( 4 percentage points ) for five subjects ( s2 , s7 , s8 , s9 , s11 , and s12 ) , and even two subjects ( s4 and s5 ) recognized slightly poorer with ci&ha than with ci alone , as shown in fig . 4 . for the 2-talker speech recognition , bimodal hearing was greatly beneficial ( improvement of 30 - 40 percentage points ) to four subjects ( s6 , s7 , s10 , and s13 ) , while some subjects ( s3 and s12 ) had minimal improvement with bimodal hearing . in summary , especially , listeners appeared to have greater bimodal benefits for the 2-talker listening condition , which was more difficult listening situation . however , the notable individual differences in bimodal benefits were observed across participants as well as the type of materials for the recognition performance . 5 illustrates individual and mean scores obtained from three domains of k - ssq , consisting of speech - hearing , spatial - hearing , and quality domains . mean data showed that , on average , k - ssq score was 49.59% on the speech domain , 46.09% on the spatial domain , and 52.48% on the quality domain ( in total , 49.5% ) . results of pearson correlation analyses revealed that the k - ssq scores among three domains were all significantly ( p<0.05 ) related to each other . although k - ssq responses are entirely based on self - report , this may be indicative of a high interconnection among responses of three domains , meaning that someone with greater subjective benefits on one scale also shows greater benefit on other scales . however , as seen from fig . 5 , some participants ' ( s6 and s13 ) subjective ratings seemed consistent across domains whereas some ( s2 and s9 ) showed discrepant results . the present study conducted additional pearson correlation analyses to address following issues . first , we determined the associations between objective performances and subjective reports obtained with bimodal hearing . remind that the k - ssq responses were estimated from three domains , the speech , spatial , and quality domains . using reports from each of the speech , spatial , and quality domains , it was advantageous to analyze the relations between localization performance and subjective responses in the spatial domain separately from the relationship between recognition scores and subjective reports related to speech and quality domains . table 2 shows those associations separately . as seen , the spatial - related subjective reports were only significantly ( p<0.05 ) related to the environmental sound localization ( r=0.57 ) or identification ( r=0.55 ) , yet not related to other speech materials . the subjective bimodal benefits in the domain of sound quality were significantly ( p<0.05 ) correlated with bimodal recognition scores in all three materials ( r=0.54 - 0.66)(table 2 ) . however , the subjective bimodal benefits on the speech domain were not associated with any recognition performance . this indicates that the listeners with greater recognition performance seem to have better perceived sound quality such as sound naturalness and clearness , yet not related to the subjective benefits to speech understanding . second , the current study examined any relationship between ci participants ' demographic information such as age , aided hearing thresholds , bimodal experience , and their objective and subjective outcomes . results showed that relationships between listeners ' demographic information and outcomes were dependent on the test materials or tasks . for the localization of environmental sounds , participants with longer bimodal experience had relatively better localization acuity ( r=0.55 , p<0.05 ) . however , when recognizing environmental sounds , younger ci users had significantly better identification ( r=-0.79 , p<0.01 ) despite no negative relationship between bimodal experience and age . in contrast , the identification of 1-talker speech was significantly correlated with pta with ci ( r=-0.75 , p<0.01 ) . a significant correlation was also found between pta and k - ssq responses averaged across three domains ( r=-0.64 , p<0.05 ) . mean performances of localization ( % ) are shown in fig . 1 when the environmental sounds , 1-talker , and 2-talker speech materials were presented . here , the scores with 1-talker speech show performance averaged across one - male and one - female conditions because of no significant effect of target - talker gender ( one male vs. one female ) or no related interactions . statistical results revealed that , on average , the localization scores with ci&ha were significantly greater than the scores with ci alone ( p<0.01 ) . the post - hoc pairwise multiple comparison results revealed that the localization performance of environmental sounds was significantly superior to the localization performance of 1-talker speech , which was significantly greater than the scores obtained with 2-talker speech ( p<0.01 ) . a two - way interaction between test material and device condition was also significant ( p<0.01 ) , indicating that the amount of bimodal benefits differed by the type of test materials . concerning the emphasis on individual results in binaural advantages , the present study explored whether all the ci recipients localized better with ci&ha than with ci alone and also whether the individual bimodal benefits in localization performance were consistent across test materials . 2 shows individual and mean bimodal benefits ( score with ci&ha - score with ci alone ) on the localization performance . as shown at the far right of fig . 2 , the mean performance improved by 9 - 12 percentage points with bimodal hearing , regardless of the test material . however , the amount of improvement varied across participants and test materials . when localizing environmental sounds , the bimodal benefits were greater than 20 percentage points to some participants ( s4 , s9 , and s11 ) while other participants ( s2 , s12 ) exhibited little bimodal benefits . when localizing 1-talker speech , three participants ( s10 , s12 , and s13 ) showed very minimal performance difference between their ci and ci&ha conditions . when localizing 2-talker speech , bimodal hearing provided relatively greater benefits ( 24 - 28 points ) to some ci recipients ( s5 , s6 , and s7 ) , whereas no improved ( s1 , s12 ) or even worsened localization performance ( s2 ) was observed with bimodal stimulation . summarizing , bimodal hearing appears to be beneficial to localizing target sounds based on the group - mean data . however , bimodal hearing does not lead to better localization performance to all ci participants . besides a substantial inter - subject variability in localization bimodal benefits , some participants ( s3 , s5 , and s13 ) showed a large intra - subject variability in bimodal benefits depending on the test material . average recognition scores ( % ) of the three test materials are plotted in fig . 3 . the recognition scores with 1-talker speech show performance averaged across one - male and one - female talker conditions . results showed significantly higher recognition scores with ci&ha compared to with ci alone ( p<0.01 ) . the pairwise multiple comparisons revealed that the overall performance of 1-talker speech recognition was significantly better than the recognition performance of environmental sounds , which was significantly superior to the 2-talker speech performance ( p<0.01 ) . 3 , the degree of bimodal benefits on recognition performance was substantially greater for the 2-talker speech than for other test materials . this tendency appeared to be significant from a two - way interaction between test material and device condition ( p<0.01 ) , due possibly to a greater room to be increased for 2-talker recognition performance with ci alone . 4 shows individual and mean bimodal benefits ( score with ci&ha - score with ci alone ) on the recognition scores . as shown at the far right of fig . 4 , the mean bimodal benefit was approximately 6 percentage points when recognizing both environmental sounds and 1-talker speech . the bimodal hearing facilitated the mean performance of 2-talker speech recognition by about 21 percentage points . considering the large individual variability in bimodal advantages for localization , a question of how the individual bimodal benefits varied across participants and test materials was also addressed for recognition performance . first , when recognizing environmental sounds , bimodal hearing did not yield any advantage to five ( s3 , s7 , s8 , s10 , and s13 ) out of 14 participants . when recognizing 1-talker sentence , the benefits from bimodal device were substantially lower ( 4 percentage points ) for five subjects ( s2 , s7 , s8 , s9 , s11 , and s12 ) , and even two subjects ( s4 and s5 ) recognized slightly poorer with ci&ha than with ci alone , as shown in fig . 4 . for the 2-talker speech recognition , bimodal hearing was greatly beneficial ( improvement of 30 - 40 percentage points ) to four subjects ( s6 , s7 , s10 , and s13 ) , while some subjects ( s3 and s12 ) had minimal improvement with bimodal hearing . in summary , especially , listeners appeared to have greater bimodal benefits for the 2-talker listening condition , which was more difficult listening situation . however , the notable individual differences in bimodal benefits were observed across participants as well as the type of materials for the recognition performance . fig . 5 illustrates individual and mean scores obtained from three domains of k - ssq , consisting of speech - hearing , spatial - hearing , and quality domains . mean data showed that , on average , k - ssq score was 49.59% on the speech domain , 46.09% on the spatial domain , and 52.48% on the quality domain ( in total , 49.5% ) . results of pearson correlation analyses revealed that the k - ssq scores among three domains were all significantly ( p<0.05 ) related to each other . although k - ssq responses are entirely based on self - report , this may be indicative of a high interconnection among responses of three domains , meaning that someone with greater subjective benefits on one scale also shows greater benefit on other scales . however , as seen from fig . 5 , some participants ' ( s6 and s13 ) subjective ratings seemed consistent across domains whereas some ( s2 and s9 ) showed discrepant results . first , we determined the associations between objective performances and subjective reports obtained with bimodal hearing . remind that the k - ssq responses were estimated from three domains , the speech , spatial , and quality domains . using reports from each of the speech , spatial , and quality domains , it was advantageous to analyze the relations between localization performance and subjective responses in the spatial domain separately from the relationship between recognition scores and subjective reports related to speech and quality domains . table 2 shows those associations separately . as seen , the spatial - related subjective reports were only significantly ( p<0.05 ) related to the environmental sound localization ( r=0.57 ) or identification ( r=0.55 ) , yet not related to other speech materials . the subjective bimodal benefits in the domain of sound quality were significantly ( p<0.05 ) correlated with bimodal recognition scores in all three materials ( r=0.54 - 0.66)(table 2 ) . however , the subjective bimodal benefits on the speech domain were not associated with any recognition performance . this indicates that the listeners with greater recognition performance seem to have better perceived sound quality such as sound naturalness and clearness , yet not related to the subjective benefits to speech understanding . second , the current study examined any relationship between ci participants ' demographic information such as age , aided hearing thresholds , bimodal experience , and their objective and subjective outcomes . results showed that relationships between listeners ' demographic information and outcomes were dependent on the test materials or tasks . for the localization of environmental sounds , participants with longer bimodal experience had relatively better localization acuity ( r=0.55 , p<0.05 ) . however , when recognizing environmental sounds , younger ci users had significantly better identification ( r=-0.79 , p<0.01 ) despite no negative relationship between bimodal experience and age . in contrast , the identification of 1-talker speech was significantly correlated with pta with ci ( r=-0.75 , p<0.01 ) . a significant correlation was also found between pta and k - ssq responses averaged across three domains ( r=-0.64 , p<0.05 ) . despite the numerous earlier reports that bimodal hearing yielded significant improvements in localization as well as recognition performance , previous research has seldom focused on the individual variability in the bimodal benefits . as described above , only a few studies emphasized that bimodal hearing was not always beneficial to all ci recipients . mok , et al.15 ) reported that 6 out of 14 bimodal users received bimodal benefits for open - set speech perception measures while only 5 of the 14 subjects showed bimodal advantages for closed - set recognition , revealing inconsistent bimodal benefits across test formats . seeber , et al.17 ) focused on the individual localization results of 11 ci recipients . their findings showed that 5 out of 11 subjects demonstrated no or limited localization abilities whereas only one subject had dramatic improvements and the others received bimodal benefits overall . consistently , the current individual data also revealed a greater individual variability in bimodal advantages across participants and test materials , notwithstanding the bimodal advantage based on group results . another study12 ) separately analyzed the bimodal benefits into head shadow , binaural summation , and binaural squelch effects . the results showed that each of the binaural effects appeared not to be uniform across twelve ci participants , and bimodal disadvantages were even observed from some subjects depending on the location of sound sources . this study illustrated that some subjects were side dominant yet some were more dominant to midline , and so on . here , we found that participants were proficient in localizing the target sounds when sounds occurred from the implanted side , regardless of using either ci alone or ci&ha . however , even though the sounds were presented from the front and back sides , the listeners incorrectly thought that the sounds were coming from the implanted ear . when the sounds were presented from either the implanted ear or non - implanted ear , the localization errors appeared somewhat inconsistent among possible speaker sources . when localizing the environmental sounds , the participants thought that the stimuli were presented from the back side , regardless of the use of bimodal devices or the ci alone . in contrast , when localizing the target sentences , listeners incorrectly responded that the sounds originated from the front side . therefore , this suggests that individual variability on localization errors depends on the location of sound source as well as the test material . as described above , it is somewhat surprising that not many studies yet investigated both objective and subjective bimodal benefits . thus , this study raised the question of whether the objective and subjective outcomes would be related to each other . like the objective performance , however , the association between objective and subjective outcomes depended on the target stimulus and tasks . this finding would be important since various types of target material and task may not be ideal for the clinical purpose . since the subjective outcomes were evaluated in each of the three domains , the relationships were separately analyzed and described below . first , the subjective disability on spatial hearing was significantly associated with the localization and recognition performances of environmental sounds . this implies that the listeners who were more accurate at localizing and recognizing environmental sounds actually felt that they could localize sounds more adequately as well as orient the sound direction in various spatial situations . in contrast , this relationship was not observed in performances with 1-talker and 2-talker speech . this suggests clinical implication that localization or recognition evaluation using environmental sounds would be more efficient to predict localization - related subjective functioning compared to the use of speech material . second , the quality - related self reports were also associated with recognition performance regardless of the test material . this association may reflect great abilities to process two different types of signals , as suggested by potts , et al.11 ) that the ssq ratings in the quality domain may be related to the ability to process as well as integrate electric and acoustic signals with bimodal devices . last , for the speech - related domain , the present study found no significant relationships between speech - related subjective reports and any performances obtained with speech . similar to this , ching , et al.16 ) found that 9 of 21 participants reported better functioning in their everyday life despite having no improvement with bimodal devices in objective measures . fitzpatrick , et al.19 ) also reported large individual differences in subjective reports with bimodal devices . for example , 5 out of the 24 bimodal users reported unbalanced sounds from bimodal stimulation , and the negative comments on bimodal use occurred from limited bimodal benefit for speech understanding , reduced speech clarity , excessive noise in the car , and discomfort from the hearing aid use . as described in correlation analyses , we failed to find any single strong factor to predict individual differences in objective or subjective outcomes . for example , bimodal experience or chronological age appears to play a role in environmental sound performance . considering that different stimulus processing between ci and ha may complicate sound integration through bimodal input,17 ) the longer experience may provide better opportunity for using bimodal stimulation input . although this study did not directly measure binaural loudness balance or growth , the audibility by bimodal stimulation as well as speech intelligibility index were significantly relevant to speech recognition and localization abilities.11 ) although the use of a ha with linear frequency transposition on the non - implanted ear did not significantly influence the bimodal speech recognition,25 ) further studies are needed on the effect of ha fitting prescription , frequency response slope and gain on binaural loudness balance as well as bimodal advantages . however , it is essential that more research be conducted on individual bimodal advantages using various measures considering that only a limited number of studies has focused on the relations between objective and subjective outcomes with bimodal hearing . in particular , this study only used k - ssq questionnaire such that various self - report questionnaires should be further considered for the measurement of subjective bimodal benefits . another limitation in this study was the presentation of target sound either in quiet or with one competing talker , which might not reflect speech recognition abilities of multi - talker conversation . since the binaural advantage seems dependent on specific details of the listening environment , this requires further investigations to apply various listening conditions to examine the bimodal benefits . however , the data also illustrates the importance of individual bimodal benefits for localizing and identifying sounds . the individual bimodal benefits substantially varied across tasks as well as test materials . concerning the discrepant relations between objective and subjective results , clinicians may need to be careful when predicting the subjective bimodal advantages in everyday listening environments from the traditional localization or recognition measures .
background and objectivesgiven that only a few studies have focused on the bimodal benefits on objective and subjective outcomes and emphasized the importance of individual data , the present study aimed to measure the bimodal benefits on the objective and subjective outcomes for adults with cochlear implant.subjects and methodsfourteen listeners with bimodal devices were tested on the localization and recognition abilities using environmental sounds , 1-talker , and 2-talker speech materials . the localization ability was measured through an 8-loudspeaker array . for the recognition measures , listeners were asked to repeat the sentences or say the environmental sounds the listeners heard . as a subjective questionnaire , three domains of korean - version of speech , spatial , qualities of hearing scale ( k - ssq ) were used to explore any relationships between objective and subjective outcomes.resultsbased on the group - mean data , the bimodal hearing enhanced both localization and recognition regardless of test material . however , the inter- and intra - subject variability appeared to be large across test materials for both localization and recognition abilities . correlation analyses revealed that the relationships were not always consistent between the objective outcomes and the subjective self - reports with bimodal devices.conclusionsoverall , this study supports significant bimodal advantages on localization and recognition measures , yet the large individual variability in bimodal benefits should be considered carefully for the clinical assessment as well as counseling . the discrepant relations between objective and subjective results suggest that the bimodal benefits in traditional localization or recognition measures might not necessarily correspond to the self - reported subjective advantages in everyday listening environments .
there are multiple genetic variants of this enzyme and clinical circumstances that might influence the activity of plasma cholinesterase and eventually lead to prolonged neuromuscular blockade following succinylcholine application . here , we report a parturient woman with atonic bleeding who suffered significant blood loss ( hemoglobin 6.0 gdl ) . for surgical curettage , general anesthesia was performed by using short - acting succinylcholine . by the end of the 105-minute procedure , after extubation she showed signs of the prolonged neuromuscular blocking action of succinylcholine . at this time , the patient received an ab0-compatible red blood cell transfusion and recovered instantly from neuromuscular blockade . the plasma cholinesterase ( 3.200 ul ) was below the normal range ( 4.90012.000 ul ) . after red blood cell transfusion , serum potassium was elevated ( 5.7 mmoll ; 4.4 mmoll prior to transfusion ) . pregnancy , blood loss and genetic variation contributed to impairment of plasma cholinesterase . due to high - speed red blood cell transfusion , hemolytic release of erythrocyte cholinesterase might have terminated the neuromuscular blocking succinylcholine effect . the rapid action of succinylcholine makes this depolarizing muscle relaxant favorable for facilitating tracheal intubation in emergency patients and clinical situations with high aspiration risk . the neuromuscular blocking effects of succinylcholine and mivacurium are terminated by rapid hydroxylation by the butyrylcholinesterase enzyme ( bche ; plasma cholinesterase ) . unfortunately , approximately 25% of individuals in a white population have a hereditary variation of the enzyme , extending the neuromuscular blocking effects of both muscle relaxants up to several hours . apart from genetic variability , acquired diseases such as hepatic failure or physiologic changes during pregnancy are known to reduce the amount of plasma cholinesterase or the efficiency of its enzymatic action . therapeutic alternatives are few ; either the patients are ventilated for 48 hours until the end of prolonged neuromuscular block , or injection of cholinesterase may lead to a shorter duration of action of the neuromuscular blocking agent mivacurium . here , we report a parturient woman with severe atonic bleeding and prolonged succinylcholine block after uterine abrasion under general anesthesia , whose prolonged muscle relaxation was terminated by application of packed red cells . a 31-year - old parturient woman ( 70 kg body weight ) without history of previous anesthesia was admitted to the hospital with atonic bleeding after 25-hour labor preceding successful delivery at home . in order to replace perinatal blood loss , 1 l colloid and 1 l crystalloid solution were given by the emergency team before the patient arrived at the hospital . at admission the patient appeared fully conscious , and heart rate [ hr ] and blood pressure [ bp ] were measured to be 90 beatsmin and 120/60 mmhg , respectively . after rapid sequence induction of general anesthesia with 200 mg propofol , 100 mg succinylcholine ( 1.25 mgkg ) , and 1 mg rapifen , the tubus was successfully placed into the trachea . during general anesthesia maintained with sevoflurane ( 1.5 vol-% ) , blood pressure and heart rate remained stable , obviating the need for immediate blood transfusion with ab0-untested red packed cells . as blood coagulation appeared to be clinically impaired , 4 g fibrinogen and 2 g tranexamic acid were given intravenously . removal of residual placenta was complicated by a retroflected uterus , prolonging the surgical procedure to 105 minutes . after extubation of the trachea at stable cardiovascular conditions , the hr increased to 140 bpm , the tongue was obstructing the airway , and tachydyspnoea could be observed . oxygenation was maintained by applying jaw thrust and supply of 100% oxygen using a face mask . neuromuscular monitoring , manually tested , showed no fading of the train of four , thereby excluding dual block . the patient was awake but she could not open her eyes or give hand signs . furthermore , uncoordinated muscle activity was visible . as at this time , automatic bp stopped measuring values in a detectable range , making blood loss the most likely cause . consequently , ab0-compatible red blood cells ( 250 ml ) were transfused at high flow by using a pressure bag and a warming system ( ranger ) . while reinduction of general anesthesia was prepared , the patient immediately regained neuromuscular function , tachydyspnoea stopped , and she was able to open her eyes , give hand signs , and speak . simultaneously , the hr decreased to 90 beatsmin and automatic bp displayed values in the normal range , enabling transfer to the intermediate care unit . the following morning , plasma cholinesterase level was 3.200 ul , which is below the normal range ( 4.90012.000 ul ) , and the patient s blood dna testing revealed that she was a heterozygous carrier of the k variant of plasma cholinesterase . in our patient , signs of physical stress and the inability fof automatic blood pressure measurement ( probably due to shivering ) were misinterpreted to be caused by intravascular volume deficiency , in particular as a hemoglobin level as low as 6.0 gdl . retrospectively , it became clear that she had a prolonged action of succinylcholine due to a genetic variation , namely , the k variant of the butyrylcholinesterase enzyme . the frequency of the k variant of plasma cholinesterase is described to be at 13% , and the enzyme activity is typically decreased by 30% . even in patients carrying the heterozygous k variant , effects of mivacurium or succinylcholine might be prolonged . pregnancy and hemodilution as a result of volume therapy might have further contributed to decreased plasma cholinesterase activity . furthermore , significantly lower levels of plasma cholinesterase are described to occur in up to 10% of parturients . it can be assumed that the immediate improvement of neuromuscular distress was either caused by plasma cholinesterase in the residual serum of packed red cells , or by release from hemolyzed erythrocytes . epstein et al have shown that the activity of serum cholinesterase in stored whole blood was around 87% of initial values after 21 days . it has been demonstrated in patients with k variant that administration of plasma cholinesterase reverses the effect of mivacurium . measured cholinesterase activity in erythrocytes and plasma by hydrolysis of acetyl- , butyryl- , and succinylcholine . determination of activity correlated well among the 3 substrates ( r>0.94 ) , with erythrocyte acetylcholinesterase being 3.7-fold more effective compared to plasma cholinesterase . our patient recovered , most probably due to transfusion of red blood cells , which were hemolyzed in part by high speed transfusion , leading to an increase in serum potassium from 4.4 mmoll to 5.7 mmoll after transfusion . lovely et al reported a patient with compromised plasma cholinesterase activity undergoing first surgery without prolonged succinylcholine blockade , but experiencing it after a second intervention . the authors assumed that packed red blood cells given perioperatively masked atypical plasma cholinesterase the first time succinylcholine was administered . in another study , concentrations of the short - acting opioid remifentanil were lower when incubated with red blood cells compared to plasma incubation , suggesting a role of erythrocyte cholinesterase in remifentanil esterase - dependent metabolism . moreover , in organophosphorus poisoning , erythrocyte cholinesterase might be a bioscavenger when given as whole blood transfusion , as reported by ryniak et al . . in addition to the k variant of plasma cholinesterase , there are other genetic mutations , like the atypical ( a ) and silent ( s ) variant , with different impact on enzyme activity . although the modest reduction of plasma cholinesterase due to the k variant ( 67% of normal enzyme activity ) usually does not cause significant prolongation of succinylcholine effect , the combination with another variant , chronic illness , organophosphorus poisoning , or , as in our case , pregnancy and major blood loss , might lead to clinical appearance . this is in line with the study of levano et al , who genotyped 9 patients with prolonged neuromuscular block after succinylcholine , but 2 of them displayed normal molecular genetic results . application of succinylcholine or mivacurium in these patients must be carefully considered , since rapid - sequence induction can be performed alternatively with rocuronium [ 2022 ] . the routine use of red blood cells to determine prolonged muscle dysfunction is certainly not recommended , but it helped in the case reported .
summarybackgroundthe muscle - relaxing effects of succinylcholine are terminated via hydrolysis by plasma cholinesterase . there are multiple genetic variants of this enzyme and clinical circumstances that might influence the activity of plasma cholinesterase and eventually lead to prolonged neuromuscular blockade following succinylcholine application.case reporthere , we report a parturient woman with atonic bleeding who suffered significant blood loss ( hemoglobin 6.0 gdl1 ) . for surgical curettage , general anesthesia was performed by using short - acting succinylcholine . by the end of the 105-minute procedure , the patient s trachea was extubated . after extubation she showed signs of the prolonged neuromuscular blocking action of succinylcholine . at this time , the patient received an ab0-compatible red blood cell transfusion and recovered instantly from neuromuscular blockade . the plasma cholinesterase ( 3.200 ul1 ) was below the normal range ( 4.90012.000 ul1 ) . patient s blood dna analysis revealed heterozygously the genetic k variant of plasma cholinesterase . after red blood cell transfusion , serum potassium was elevated ( 5.7 mmoll1 ; 4.4 mmoll1 prior to transfusion).conclusionspregnancy , blood loss and genetic variation contributed to impairment of plasma cholinesterase . due to high - speed red blood cell transfusion , hemolytic release of erythrocyte cholinesterase might have terminated the neuromuscular blocking succinylcholine effect .
urinary tract infection is one of the commonest bacterial infections encountered in daily clinical practice . it has been estimated that worldwide about 150 million people suffer from asymptomatic and symptomatic utis each year . in most parts of the sub - saharan africa , as well as in other developing parts of the world , uti is among the most common health problems occurring both in the community and hospitalized patients . since the last two to three decades , just as many community and hospital acquired bacterial infections , utis due to multidrug resistant uropathogens have caused a growing concern worldwide [ 1 , 46 ] . investigators [ 1 , 7 , 8 ] explained that the drug resistance problem in africa stems from factors like indiscriminate use of antibiotics , inappropriate advertisement , and erratic prescription by unqualified drug sellers . since the previous two decades , the problem of utis due to uropathogens resistant to the commonly used antibiotics was reported by many authors in ethiopia in general and in gondar region in particular [ 1 , 912 ] . consequently , the prevalence of urinary tract pathogens and their resistance to the different antibiotics may have changed over the years in the study area . hence , studies are needed as a guide in the community and hospital health care settings . the objectives of this study therefore were to assess the changing prevalence and resistance patterns of the uropathogens to commonly used antibiotics in a two - year study period . this hospital based cross - sectional study was conducted at the gondar university hospital from september 1 , 2011 , to june 30 , 2012 . gondar university hospital is found in gondar town , located 727 km from addis ababa to the northwest ethiopia . urine samples were collected by a clean - catch midstream , catheterization , or use of urine bags in a sterile container from each study participant whom the clinicians suspected for uti and who has not received antibiotic therapy during the previous 14 days . isolation of uropathogens was done by a surface streak procedure on cysteine lactose electrolyte deficient ( cled ) ( oxoid , ltd , uk ) medium using a 0.001 ml calibrated inoculating wire loop . after 1824 hours of incubation at 37c aerobically , colonies were counted and multiplied by 1000 which resulted in 10 colony forming unit ( cfu)/ml of urine sample . subculture of the colonies was done on blood agar ( oxoid , ltd , uk ) and macconkey agar ( oxoid , ltd , uk ) to characterize the isolate . bacterial identification was then done by standardized biochemical tests , namely , indole production , lactose fermentation , hydrolysis of urea , citrate utilization , lysine decarobxylation , motility test , oxidase test for gram negative bacteria and for gram positive bacteria , mannitol fermentation , and catalase and coagulase tests . antibiotic susceptibility was tested for all the isolates by the disc diffusion techniques according to bauer et al . and clinical laboratory standard institute ( clsi ) guidelines . the pure culture colony suspension of the isolate was made using sterile physiological saline and adjusted to 0.5 mcfarland standards . muller hinton agar plate was swabbed with the suspension using sterile cotton swap and the antibiotic discs were placed over the agar and left for 30 minutes for diffusion of the antibiotics in the disc . the plates were inverted upside down and incubated at 37c for 18 to 24 hours . the zones of inhibition were then read as resistant and sensitive using calibrated ruler and compared with the standard chart . antibiotics agents employed for susceptibility testing were ampicillin ( 10 g ) , amoxicillin ( 30 g ) , co - trimoxazole ( 25 g ) , gentamicin ( 10 g ) , ciprofloxacin ( 5 g ) , penicillin ( 10 iu ) , and erythromycin ( 15 g ) ( oxoid , ltd , uk ) . this study was done using the same method conducted by moges et al . , 2002 , 10 years back in the same study area , and the present results standard control strains of e. coli atcc 25922 and s. aureus atcc 25923 were used during culturing and antibiotics susceptibility testing as a control throughout the study . data were checked for completeness , cleaned manually , entered , and analyzed using spss version 16 statistical software . the chi - square test ( ) was used to measure the association and a p value less than 0.05 was considered statistically significant . ethical clearance was obtained from the research and publication office of the university of gondar , college of medicine and health sciences . the data were collected after a written informed consent was sought from each study participant . of the total 538 consecutive urine samples cultured , 284 ( 52.8% ) gave significant bacteriuria . the majority ( 58.8% ) of the positive cases were females while the remaining ( 41.2% ) were males . the age of the study participants ranged from 1 year to 50 years with the median age of 24 . the frequency of positive urine cultures ( 28.2% ) was high in the age group of 2029 years followed by the age group of 50 years ( table 1 ) . as it is seen from table 2 , the most common isolate of the uropathogens was e. coli , ( 42.3% ) , followed by klebsiella spp . , ( 14.4% ) , cons , ( 12.3% ) , s. aureus ( 9.2% ) , proteus spp . , and enterobacter spp . . showed the highest rate of resistance to amoxicillin ( 97.7% ) , ampicillin ( 95.1% ) , tetracycline and cotrimoxazole ( 82.9% ) , and chloramphenicol ( 78% ) compared to e. coli to the same antibiotics . citrobacter , enterobacter , and proteus species revealed higher rate of resistance patterns to tetracycline , ampicillin , amoxicillin , cotrimoxazole , and chloramphenicol . s. aureus and cons also demonstrate higher resistance rates to tetracycline , cotrimoxazole , amoxicillin , ampicillin , and penicillin . all gram negative uropathogens were resistant to 2560% ciprofloxacin , while 53.8% s. aureus and 54.3% cons were resistant to this antibiotic . referring to table 3 , of the 282 total urinary bacterial isolates tested for antibiotics resistance patterns , 86.5% have shown multidrug resistance ( resistant to 2 antibiotics ) . the rest , enterobacter , proteus , streptococcus , providencia , and pseudomonas spp . , were resistant to five antibiotics tested , whereas citrobacter spp . were resistant to four antibiotics . most of the uropathogens ' isolates compared in the two study periods ( 2002 and 2012 ) showed no statistically significant differences in the isolation rates , except s. aureus which revealed a statistically significant decrease ( 18% to 9.2% ) ( p = 0.002 ) and enterobacter spp . which revealed a significant increase ( 1.7% to 5.6% ) ( p < 0.001 ) in the current study ( table 4 ) . table 5 shows that the resistance rate ( 34.2% ) of e. coli for gentamicin in the present study was significantly higher than the rate ( 14.1% ) of ten years back ( p = 0.04 ) . similarly , the resistance rate ( 38.4% ) of s. aureus isolates for ciprofloxacin in our study is significantly higher than the rate ( 6.5% ) of the previous study ( p = 0.03 ) . the uropathogens ( e. coli , klebsiella spp . , cons , citrobacter spp . , and proteus spp . ) in the previous study were found to be 100% sensitive to ciprofloxacin except the few isolates of s. aureus 2 ( 6.5% ) . table 6 shows that e. coli was more resistant to the tested antibiotics in our study than the previous ones . klebisella spp . was resistant to seven antibiotics in this study than the previous ones which were resistant to five antibiotics . previous isolates of proteus spp . were less resistant to three and four antibiotics than in the present study . were resistant to six antibiotics , whereas they were resistant to five in the previous study . in this study , the overall rate of isolation of the uropathogens was significantly higher than the previous rate ( 41% ) reported from the same study area but lower than the rate reported in nepal ( 71.7% ) .this disparity of rates may be attributed to the differences in the study samples and improper collection and processing of specimens . in our study , women have higher rate of uti than men ( table 1 ) , because in females the urethra has been known to be shorter and closer to the anus . the high prevalence of uti in age groups of 2029 and more than 50 years may be related to sexually active age group and older study participants whose immune system may be impaired , respectively . the distribution of the uropathogens isolated in our study was almost similar to the results reported previously except with s. aureus . the most commonly isolated uropathogen in the present study was e. coli and it is consistent with the previous study done in the same study area . however , the frequency of e. coli in urine samples varies in different studies [ 20 , 21 ] : these may be due to the large variation of different species of bacteria in the study and variations in specimen collection and processing . antibiotic resistance is a major clinical problem in treating infections caused by different bacterial pathogens . a higher proportion of isolates of members of enterobacteriaceae was in average resistant to ampicillin ( 84% ) , tetracycline ( 83% ) , amoxicillin ( 80% ) , cotrimoxazole ( 77% ) , chloramphenicol ( 69% ) , gentamicin ( 50% ) , and ciprofloxacin ( 45% ) , whereas the resistance patterns of these isolates , a decade ago , were ampicillin ( 81% ) , tetracycline ( 78% ) , cotrimoxazole ( 67% ) , gentamicin ( 36% ) , and ciprofloxacin ( 0% ) . as has been clarified here , the most significant change among uropathogens in 10 years period has been the significant increase of resistance to gentamicin , and the emergence of resistance to ciprofloxacin from zero in the study conducted 10 years ago , to 45% in our case . in comparing the two periods of study ( 2002 versus 2012 ) ( table 5 ) , the resistance rate of e. coli ( 44.2% ) for gentamicin in the present study was significantly higher than the rate ( 14.1% ) of the previous study ( p = 0.04 ) . this finding is higher than studies from france ( 1.6% ) and iran ( 30.1% ) . this decreasing trend in activity of gentamicin against major uropathogens such as e. coli raises a great concern regarding the empirical treatment of urinary tract infections . similarly , the resistance rate of s. aureus isolates for ciprofloxacin in our study is significantly higher than the rate ( 6.5% ) of the previous study ( p = 0.03 ) which is supported by a report from teaching hospital in saudi arabia where there was high ciprofloxacin resistance in gram positive cocci , particularly s. aureus . hence , the overall trend of the present study indicates the emergence of increasing number of different multidrug resistant isolates of uropathogens than those in the previous study . increased resistant patterns of the isolates for ciprofloxacin may be explained by the fact that the widespread use of the drug in the area might have favored the resistant isolates due to selective pressure . multiple drug resistance clinical isolates are increasing every time and some of the drugs are approaching to be no more essential for the treatment of uti patients [ 17 , 24 ] . the overall trends of the present study indicated that there are increasing multidrug resistant spp . in the present study ( table 3 ) compared to the previous isolates . these studies urge a need for a large scale monitoring of drug resistance problems in different parts of the country and evaluate susceptibility patterns of the isolates . this would have a paramount importance in using empiric treatment which would be safe , effective , and economical for the patient . this study has showed more resistant e. coli and klebsiella spp . and s. aureus and cons to seven antibiotics tested over a ten - year period . the resistance rates of e. coli for gentamicin and s. aureus for ciprofloxacin in the present study were also higher than the rates of a decade ago . the uropathogens ( e. coli , klebsiella spp . , cons , citrobacter spp . , and proteus spp . ) ten years back were found to be all sensitive to ciprofloxacin except the few isolates of s. aureus . gentamicin and ciprofloxacin have been recommended for empirical treatment of urinary tract infections in areas where diagnostic bacteriologic services are not available .
background . in most hospitals of developing countries , urinary tract infections are treated empirically because of lack of culture facilities . this leads to emergence of multiresistant uropathogens . culturing and drug susceptibility testing are essential to guide therapy . objectives . to assess changing prevalence and resistance pattern of uropathogens to commonly used antibiotics in a two - year study period . methods . urine specimens were collected and cultured . uropathogens were identified by standard methods and tested for antibiotics resistance . data were analyzed using spss version 16 statistical sofware . p value < 0.05 was considered statistically significant . results . the commonest isolates in both the previous and present studies were e. coli , klebsiella , cons , s. aureus , proteus , and citrobacter species . previous isolates of enterobacteriaceae were 100% sensitive to ciprofloxacin , whereas present isolates developed 31% to 60% resistance to it . previous isolates were less resistant to gentamycin than the present ones . multiresistance isolates were predominant in present study than previous ones . conclusion . e. coli was predominant in the two study periods . present isolates were more resistant than previous ones . some previous isolates were 100% sensitive to ciprofloxacin , whereas present isolates were increasingly resistant . ciprofloxacin and gentamicin have been recommended for empiric treatment of urinary tract infections .
aggressive periodontitis was seen as a specific type of periodontitis in the 1999 international workshop in which microbiological criteria were generally included as elevated proportions of actinobacillus actinomycetemcomitans ( a.a ) and , in some populations , porphyromonas gingivalis ( p.g ) . it has long been recognized that the interactions between these bacterial pathogenic microflora and the inflammatory responses of a susceptible host produces the progressive destruction of periodontal tissues . however , adequate oral hygiene instructions , supragingival and subgingival plaque and calculus removal by scaling and root planing ( srp ) are essential to reduce the amount of subgingival bacteria , but it is unlikely that mechanical debridement will eradicate and permanently clear these pathogens from a diseased site . in particular , as probing depth ( pd ) increases , the effectiveness of srp decreases , leaving subgingival plaque and calculus on the root surfaces . therefore , systemic antibiotics and locally applied antimicrobial agents have been suggested to enhance the clinical parameters . this is especially worthy as some bacteria strains have the ability to invade the soft tissues and escape from the mechanical debridement access . especially , the combination of mechanical therapy and systemic application of amoxicillin and metronidazole together has been shown to resolve periodontal inflammation effectively in these patients . however , administration of systemic antibiotics such as metronidazole , which require recommendation of large dosages to obtain suitable concentrations at the site of disease , have the risk of developing drug interactions , need the patient compliance for use and may lead to significant risk of nausea , headache , anorexia , vomiting and gastro - intestinal adverse reactions . to avoid these limitations of systemic administration , a different approach has been introduced that uses local delivery systems that contain antibiotic or antiseptic agents . the objective of this study was to evaluate the efficacy of metronidazole dental gel as an adjunct to subgingival debridement compared to subgingival debridement alone in the treatment of aggressive periodontitis . it was carried out among the patients referred to the periodontology department , dental school of tehran university of medical sciences . twenty patients sellected of all patients were referred to the periodontology department and diagnosed as aggressive periodontitis by the periodontist of this department in the last year . the inclusion criteria were as follows : ( 1 ) the presence of aggressive periodontal criteria ( 2 ) , age between 2045 years old ( 3 ) , patient s proper cooperation ( 4 ) presence of bilateral symmetric greater than 5 mm pockets positive in p.g . the exclusion criteria were as follows : ( 1 ) presence of systemic disease ( 2 ) , poor oral hygiene ( oleary plaque index higher than 35% after oral hygiene instruction ) ( 3 ) , smoking ( 4 ) periodontal treatment over the previous 6 months ( 5 ) , antibiotic therapy over the last 8 months . these patients had active pockets larger than 5 mm with bleeding on probing in two quadrant of their teeth . their low calculus and microbial plaque was not proportionate to their rapid bone loss shown in the radiographic images which were taken during their follow up periods in the last year . diagnosis of aggressive periodontitis in these patients was confirmed by other periodontics specialists of the periodontology department and selected for the study . the study was approved by the ethical committee of tehran university of medical sciences . after explaining objectives of the study for each patient and obtaining written consent , pocket depth attachment and bleeding were recorded and supragingival plaque was removed by sterile cotton swabs prior to sampling . the samples were taken from the deepest bleeding pocket of the tooth in each quadrant by using a paper point no . the paperpoints were transferred to a 1 microliter reduced transfer media and sent to the laboratory immediately . transfer media containing samples were vortexed for 30 seconds and using a bacteriologic loop , 100 microliter of the samples were asceptically cultured on brucella agar enriched with sheep blood ( hemin ) and vitamin k1 . the cultured plates were placed in an anaerobic jar containing a gaspack system and incubated for 34 days at 37c . after incubation , black pigmented gram negative p.g colonies were identified and counted . following the arrival of the laboratory report , the clinical indices of clinical attachment level ( cal ) , pocket probing depth ( ppd ) and bleeding on probing ( bop ) were recorded for pockets in which laboratory proof of positive p.g was documented . in each patient in a split mouth design a quadrant containing a pocket larger than 5 quadrant , the deepest pockets were selected for the test ( test pockets ) or control ( control pockets ) group of the pocket study . each patient was put for full mouth subgingival and supragingival scaling and root planning ( srp ) program . the test pocket group was treated with 25% metronidazole gel ( elyzol ) instantly by a periodontist other than the authors and the whole pocket was filled up with gel some of which was visible on the surface . this procedure ( application of elyzol in the test group ) was repeated a week later by the same clinician other than authors . six weeks after primary treatment , the clinical indices including cal , bop and ppd were measured again in both test and control pockets . besides , new samples of test and control pocket groups were recollected and sent to the laboratory without hesitation as the same way described earlier and the p.g colonies were counted . collected data were analyzed for paired condition using wilcoxon signed ranks tests in the spss statistical program . it is mentioned that the oral hygiene instruction and maintenance was applied all throughout the study . twenty patients ( 13 females and 7 males ) aged from 2042 years ( mean , 31.4 ) were selected . totally , 92 pockets ( 46 in each of the test and control groups ) were investigated . the pockets average depth and standard deviation among test group were 3.02 mm and 0.91 mm , respectively 12 weeks after the primary treatment ; whereas , the similar figures for the control group were 3.76 mm and 1.21 mm , respectively and the differences were significant ( table 1 ) . however , there was no significant difference between the test and control groups ( p=0.78 ) . table 3 shows a comparison of bleeding on probing ( bop ) variation in the test and control groups over 3 stages of therapy . the bop average was almost the same among the two groups at the beginning of treatment , but as the time passed on , there was more reduction in the test group compared with the control group which produced a statistical significant difference among the two sets ( p=0.005 ) . this showed clinical improvement in both groups with a more evident effect in the case group . by assessing the average of p.g count after 6-and 12-week intervals following treatment , there was statistically significant ( p=0.006 ) improved results observed in the test group comparing the colony counts before and after the gel application in contrast to the follow up intervals in the control group ( table 4 ) . our study was carried out on 20 patients selected from patients referred to the periodontology department , dental school of tehran university of medical sciences . the selection was based on initial diagnosis ( clinical / radiological ) carried out by department professors . other tasks such as taking written agreement , oral hygiene control , srp and also sampling were performed by clinicians who were blinded to the test and control area . all laboratory studies associated with the current study were carried out in the microbiology department , faculty of medicine , shahed university and all the bacterial colony counting was performed by a designated member of staff . in this study , we selected an aggressive form of periodontitis with documentation of high presence of p.g . mombelli and coworkers showed persisting p.g and actinobacillous actinomycetemcomitans in the pocket after mechanical therapy . they thought that local antibiotic therapy must be guided by microbiologic diagnosis of pocket microflora . however , the administration of antibiotics has to be limited only for patients with advanced periodontitis and aggressive forms of periodontitis and local antibiotic therapy is not necessary in the chronic form to avoid microbial resistance . in the split mouth design the degree of similarity between genetic , socioeconomic , health , defense and microbiological conditions of the samples are very high . this is a valuable feature of our study particularly in the treatment of aggressive periodontitis , because the initial conditions are the same for the teeth . this feature has repeatedly been used in many previous investigations and we believe that , it is the best plan for studying the effect of an antibiotic . in 1992 , pedrazzoli et al . in addition , in 2000 , griffiths et al . , pointed out the same scheme in a multi centered study . our study was specifically carried out on aggressive periodontitis ; whereas , in other studies , the therapeutic effect of metronidazole gel and systemic metronidazole alone or with other antimicrobial agents were tested on patients with chronic periodontitis . in our study , the time of treatment was not a determinant factor , but successfully srp was important in contrast to suggestions of griffiths and palmer . they believed that the time of treatment is an important factor in the treatment of aggressive form pockets . in our opinion this variation depends on a series of mechanical and therapeutic factors and is also related to the skill of the operator , the patient s cooperation and the rate of calculus in the area . griffiths proposed the performance of srp on all quadrants for a maximum of 60 minutes ; whereas , palmer recommended a fixed protocol for successive scaling in two weeks for 90 minutes each time . there are different views on the therapeutic effect of metronidazole on clinical and microbiological parameters . some clinicians have used metronidazole in therapeutic surgery and did not find better results . in some studies , the systemic metronidazole as mono therapy did not produce encouraging results , while in others , this type of mono therapy was accompanied with good responses [ 1618 ] . some investigators have used a combination therapy composed of metronidazole and amoxicillin in the treatment of advanced periodontitis and have obtained promising results . the basis of such treatment was based on the use of two bactericidal and bacteriostatic agents . in a study by kaner et al . , srp plus adjunctive systemic amoxicillin / metronidazole was compared with srp plus adjunctive chx chip placement for the treatment of generalized aggressive periodontitis . there was significantly higher pd reduction and gain of cal for srp plus adjunctive systemic amoxicillin / metronidazole patients . besides , interestingly , there was a further continuous decrease of supragingival plaque measures in the amoxicillin / metronidazole group only and they presented significantly less supragingival plaque after 6 months . in our study , twenty aggressive periodontitis patients were treated who showed the effect of local 25% metronidazole gel ( elyzol ) alone or with srp . this has been investigated in many studies . in the study by griffiths et al . , the clinical effects of subgingival scaling ( srp ) with srp plus subgingival application of 25% metronidazole gel , elyzol were compared in patients with chronic adult periodontitis . the results showed that the combination therapy of srp gel was superior to the conventional treatment of srp alone regarding ppd , bop and cal and the differences were consistent for 9 months . in a systematic review done by arthur et al . in 2005 , of the 11 studies of srp plus locally delivered metronidazole , four yielded statistically significant reductions in pd . three reported data showed a statistically significant difference in the net pd reduction that favored the treatment group . another study reported that the net difference between the treatment and control groups was significant at 12 weeks ( p<0.01 ) and two studies reported statistically significant cal gains ; 0.66 mm at 6 weeks ( p<0.01 ) and 0.4 mm at 39 weeks ( p<0.001 ) . according to our study ; in the case group a considerable reduction in the number of p.g colonies 6 and 12 weeks after treatment was demonstrated which was significant statistically ( p<0.05 ) when compared with the control group ( srp ) . this finding was both clinically and statistically evident and significant , the therapeutic use of metronidazole gel can inhibit the bacterial growth in periodontal pockets . in the present study the srp was performed by one designated clinician and was the same for all the patients . the type of metronidazole therapy was consistent with those of klinge et al . in 1992 who determined the most effective concentration of metronidazole when applying the drug in two successive weeks , one immediately after scaling and the second a week later . this protocol has been used by many researchers . however , in the study by riep et al . , in order to have a more constant influence on the subgingival microflora , they decided to apply metronidazole gel more often and in shorter intervals . the other remarkable fact was excluding the patients who had received antibiotic therapy within 6 months prior to the study . in our study , the srp was done immediately prior to the application of metronidazole gel . in the study by salvi ge et al . , one of the explanations for not achieving any changes in the microbiologic quantity and composition of the subgingival microbiotic after placing the antimicrobial agents has been stated the reestablishment of the subgingival biofilm after initial therapy that protects the microorganisms from the antimicrobial agents . comparison of statistical values of ppd among the case and control groups shows that the p - value was initially 0.58 ( insignificant ) which turned to 0.002 ( significant ) and less than 0.001 ( significant ) following 6 and 12 weeks after primary treatment , respectively . so , there was a significant statistical difference between the case and control groups and that , the case group showed a higher ppd reduction compared to the control group . in 1992 , pedrazzoli et al . obtained a ppd average of 1.14 mm after gel treatment and 0.88 mm after scaling with no significant difference statistically , when compared with the initial conditions . ( 1998 ) also failed to show any clinical differences among the two groups and rejected the necessity of metronidazole application in routine periodontal therapies . in another study by knoll- kohler ( 1999 ) , it was concluded that the use of metronidazole gel as a therapeutic and mechanical substitution for adult periodontitis treatment is unsuitable . first , it was not clear whether metronidazole gel can affect other types of periodontitis , and second , the possibility of metronidazole gel plus srp application as a therapeutic alternative . in 1992 , ainamo et al . reported that the pocket depth decreased to 1.2 mm and 1.5 mm in the case and control groups , respectively . however , the differences were significant statistically but clinically it was not important as there was 88% reduction of bop in both groups . regarding the split mouth design of our study and the similarity of inclusion and exclusion criteria , the same level of initial conditions considering the limited number of studies on the effect of metronidazole gel on aggressive periodontitis , the current study highlighted the importance of the clinical application of such an intervening procedure and produced a suitable basis to be used by all dentists and researchers . in addition , by extending the period of study more reliable bacteriological and clinical findings may be obtained .
objective : systemic antibiotics and locally applied antimicrobial agents have been suggested to enhance clinical parameters . patients exhibiting aggressive periodontitis in particular benefit from adjunctive antibiotic therapy . the purpose of this investigation was to evaluate the effect of local antibiotic therapy with metronidazole adjunctively to scaling and root planning ( srp ) in the treatment of aggressive periodontitis.materials and methods : twenty patients diagnosed with aggressive periodontitis were placed in a spilt mouth design . microbial specimens were taken from the deepest pocket of the teeth . the sites that had positive results of porphyromonas gingivalis ( p.g ) were located randomly to receive srp treatment in the control group and srp plus metronidazole gel in the test group . pocket probing depth ( ppd ) , clinical attachment level ( cal ) and bleeding on probing ( bop ) parameters and numbers of p.g . colony were taken at baseline , 6 weeks and 12 weeks later . all data were collected and analyzed and tested by wilcoxon and paired t test.results:the case group patients had significantly better results in bop , ppd and the number of p.g colony count reduction in comparison with the control group ( p<0.05 ) . according to the measurements of cal , the statistical difference was non significant ( p>0.05).conclusion : in non - surgical periodontal treatment of aggressive periodontits adjunctive metronidazole gel therapy has a better effect on the reduction of porphyromonas gingivalis content of pockets .
total joint replacement by endoprosthesis is a widely used procedure to restore functionality of joints in patients with osteoarthritis . although surgery is usually safe and successful , complications may arise , particularly due to bacterial infections on and around the implant . according to the literature , the risk of infection is approximately 1 to 2% in primary arthroplasty [ 13 ] . considering the ever - increasing number of prostheses which are implanted every year , infections result in high socioeconomic costs since the treatment is often prolonged and expensive . the common cause of implant - associated infection is the formation of bacterial biofilms on the implant . first , bacteria adhere to foreign surfaces , and then they produce and embed themselves in an extracellular substance , the name - giving film . among others , bacteria in biofilms acquire a relative resistance towards many antibiotics [ 6 , 7 ] ( reviewed in [ 6 , 812 ] ) . therefore , extensive antibiotic treatment often fails , which makes revision surgery with tissue debridement mandatory . because bone infections are associated with loss of bone substance ; loosening of implants is a common complication and requires an exchange of the prosthesis . however , each revision surgery bears an increased risk of yet another infection . in implant infection , staphylococci species are prevalent , but other species including enterococci or streptococci are also found and possibly also infections with multiple species [ 12 , 13 ] . bacterial biofilms elicit a profound local immune response with infiltration of neutrophils , monocytes , and t cells , associated with the local generation of proinflammatory cytokines [ 14 , 15 ] . basically , neutrophils are able to attack and destroy biofilms [ 1619 ] , but in the case of implant infections , host - defence mechanisms may be inefficient and a persistent and progressive inflammatory response might ensue , causing tissue damage and bone resorption ( osteolysis ) . presumably , the cytokine - rich proinflammatory environment promotes the generation of bone resorbing osteoclasts from myeloid precursor cells , but the exact mechanisms are still unclear . in this context , the possible participation of the macrophage inflammatory proteins mip1 ( ccl3 ) and mip2 ( cxcl2 ) was assessed in this study . their participation in host defence against infection and in acute or chronic phases of inflammation is well documented . there is , however , increasing evidence for production of these cytokines by cells other than monocytes , macrophages , or neutrophils , for example , by endothelial cells , fibroblasts , neural tissue , and a variety of tumor cells ( for review see [ 2026 ] ) . both , ccl3 and cxcl2 , are also described in the context of osteoclast generation and osteolysis , particularly in the mouse [ 2729 ] . to assess their participation in implant - associated infection , we analysed gene expression and protein expression in biopsies derived from patients with implant - associated infection and for comparison in patients with aseptic loosening . the latter is an example for a sterile inflammation , which presumably is caused by the uptake of implant - derived wear particles by phagocytic cells and which also eventually leads to implant loosening . furthermore , in a series of vitro experiments , primary osteoblasts as a possible source of ccl3 and cxcl2 were assessed , as well as their role in the induction of osteoclastogenesis . patients who underwent revision surgery due to a prosthetic infection and patients suffering from aseptic loosening of a total joint replacement ( articulating materials either metal - on - polyethylene or ceramic - on - polyethylene ) were included in the study . diagnosis of loosening was based on patients ' complaints , clinical examination , and examination by conventional x - ray and/or ct scan . from five patients with an infection and five patients with an aseptic loosening of an implant , the samples were immediately placed into rna later ( ambion life technologies , darmstadt , germany ) for quantitative pcr analysis . immediately before surgery , blood samples from patients with implant - associated osteomyelitis ( n = 39 ) , aseptic loosening ( n = 22 ) , or healthy donors ( n = 10 ) were collected for gene expression analysis and elisa ( see below ) . the tissue specimens were formalin - fixed , decalcified in ethylenediaminetetraacetic acid ( edta ) , and paraffin embedded . the biopsies were examined , the diagnosis of an acute or chronic osteomyelitis was made , and the cellular infiltrates in particular the pmn , lymphocytes , and monocytes / macrophages were quantified . the paraffin - embedded tissue sections ( 3 - 4 m ) were also used for immunohistochemical analyses . prior to antibody incubation , heat pretreatment in citrate buffer ( ph 6.1 ) was performed . as primary antibody , the monoclonal mouse anti mip-1alpha was used ( r&d systems , darmstadt , germany ) . from cells , mrna was isolated with the magnapure - lc device using the mrna - i standard protocol . tissue samples were disrupted with ribolyser devices ( thermohybaid , heidelberg , germany ) containing 400 l lysis buffer from the magnapure mrna isolation kit containing 1% dtt ( v / w ) ( roche diagnostics , mannheim , germany ) . mrna was isolated with the magnapure - lc device using the mrna - standard protocol for cells . mrna was reversely transcribed using amv - rt and oligo-(dt ) as primer ( first strand cdna synthesis kit , roche , mannheim , germany ) according to the manufactures protocol . primer sets optimized for the lightcycler ( ras , mannheim , germany ) were purchased from search - lc gmbh ( http://www.search-lc.com/ ) . the pcr was performed with the lightcycler faststart dna sybr greeni kit ( ras ) according to the protocol provided . to control for specificity , the copy number was calculated from a standard curve , obtained by plotting known input concentrations of four different plasmids at log dilutions to the pcr - cycle number ( cp ) at which the detected fluorescence intensity reaches a fixed value . to correct for differences in the mrna content , the transcript numbers were normalized according to expression of the housekeeping gene peptidylprolyl isomerase b ( ppib ) . staphylococcus aureus ( seattle 1945 , atcc 25923 , wesel , germany ) and staphylococcus epidermidis ( rp62a , atcc 35984 , wesel , germany ) were grown overnight on a blood agar plate at 37c ( number pb5039a , thermo scientific , germany , wesel ) . the following day , two to three colonies were picked from the agar plate and placed in phosphate buffered saline and adjusted to 1 10 cells / ml . monocytes were isolated from the peripheral blood of healthy donors ( informed consent was obtained and the institutional guidelines were observed ) . the blood was layered on polymorphprep ( axis shield , oslo , norway ) , and the monocyte fraction was recovered . monocytes were positively selected using anti - cd14 micro beads ( miltenyi biotec , bergisch gladbach , germany ) . the cells were seeded into 24-well dishes ( nunctm , wiesbaden , germany ) at a concentration of 1 10 cells / ml in rpmi containing 10% fetal calf serum , 1% glutamine , and 1% penicillin / streptomycin ( medium and supplements were obtained from gibco life technologies , darmstadt , germany ) . primary osteoblast cultures derived from bone marrow of patients undergoing autologous bone graft harvesting using the reamer - irrigator - aspirator ( ria ) technique were cultivated in osteoblast growth medium ( promocell , heidelberg , germany ) containing 0.1% penicillin / streptomycin ( gibco life technologies ) . cells were subcultivated following digestion with trypsin ( 0.05% trypsin - edta , life technologies , uk ) for 5 minutes at 37c and resuspended in osteoblast growth medium . after 2 days , homogenous cell layers were seen ; osteoblasts were identified by expression of collagen type i and lack of markers for myeloid cells . , osteoblasts were seeded into 24-well dishes ( nunctm , wiesbaden , germany ) at a concentration of 2 10 cells / ml osteoblast growth medium . for the stimulation assays , 1 10 monocytes or 2 10 osteoblasts were each placed in 1 ml medium ( rpmi or osteoblast growth medium , resp . ) into a 24-well plate . bacteria ( s. aureus or s. epidermidis ) were added in a ratio of 20 , 100 , or 500 bacteria per osteoblast and incubated for 2 hours at either 4c or 37c . the cells were washed twice with phosphate buffered saline ; then , 400 g of vancomycin was added in 1 ml culture medium for 30 minutes at 37c . the medium was replaced by fresh medium containing 20 g vancomycin , and cells were incubated for 24 hours or 48 hours . for stimulation with lta , osteoblasts or monocytes were incubated with lta ( sigma , munich , germany ) for 24 to 48 h. all experiments were carried out in duplicates and repeated at least three times with cells of different patients . ccl3 and cxcl2 in cell culture supernatants and in serum samples were determined using commercially available elisa kits according to the protocol provided by the manufacturer . the human cxcl2 elisa kit was purchased from hlzel diagnostika ( cologne , germany ) , the human ccl3 kit from r&d systems ( minneapolis , usa ) . cd14 + monocytes were seeded into 24-well dishes ( nunctm , wiesbaden , germany ) at a concentration of 1 10 cells per well and allowed to adhere for 24 hours in medium ( rpmi , gibco life technologies , darmstadt , germany ) . then , nonadherent cells were removed by washing , and the remaining cells were incubated in rpmi supplemented with 10% fcs ( pantm biotech , aidenbach , germany ) , 1% penicillin / streptomycin , 1% glutamine ( all obtained from gibco ) , and m - csf ( 25 ng / ml ; r&d systems , minneapolis , usa ) . for stimulation rankl ( 50 ng / ml , peprotech , hamburg , germany ) was added or ccl3 ( mip1 ) ( r&d systems , minneapolis , usa ) in different concentrations . cultures were incubated at 37c in 5% co2 for up to 14 days with a change of medium and removal of nonadherent cells at day 7 . for the followup differentiation , the cells were fixed with 4% pfa for 15 minutes at 37c and identified by their morphological appearance as giant cells with multiple nuclei . binding of fitc - labeled phalloidin ( sigma - aldrich ; 1 : 20 dilution for 40 minutes ) revealed the typical actin ring formation . nuclei were stained using dapi ( invitrogen , oregon , usa ) , ( diluted 1 : 30000 for 5 minutes ) . additionally , staining with an antibody against cathepsin k was performed ( anti - cathepsin k ( santa cruz biotechnology , heidelberg , germany ) was diluted 1 : 50 ) , and detected with anti - mouse igg - cy3 . fluorescence was visualized using a digital fluorescence microscope ( keyence , neu - isenburg , germany ) . for quantification , cells were counted on images of six high - power fields and the percentage of osteoclasts in relation to the total cell number was calculated . following stimulation with ccl3 or rankl ( santa cruz biotechnology , heidelberg , germany ) , cells ( 3 10 ) were lysed with ripa buffer ( santa cruz biotechnology , santa cruz , usa ) and mixed with sds - gel sample buffer and separated by sds - polyacrylamide gel ( 12% ) electrophoresis , followed by blotting to a pvdf membrane ( millipore , eschborn , germany ) . the antibody to nfatc1 was purchased from santa cruz biotechnology ( heidelberg , germany ) , and as secondary antibody peroxidase - labelled anti - mouse igg ( jackson immuno research , pennsylvania , usa ) was used . for detection , amersham ecl plus western blotting detection system ( ge healthcare limited differences between groups were calculated using mann - whitney test using origin 9.0 software . significance level was determined as p < 0.05 . gene expression varied among the patients , but , in all , expression was higher in tissue from osteolytic sites compared to muscle . cxcl2 expression was also higher in patients with infection compared to patients with aseptic loosening , whereas expression of ccl3 did not differ between patients with infection and those with aseptic loosening ( data summarised in figure 1 ) . immunohistological examination confirmed the presence of ccl3 positive inflammatory cells particularly neutrophils , lymphocytes , and monocyte / macrophages . osteoclasts were seen in the proximity of ccl3 positive inflammatory cells in the eroded bone ( an example for a patient with infection and osteolysis is shown in figure 2 ) . by analysing gene expression of cd14 , infiltration of mononuclear cells into affected sites could be confirmed , with higher expression of cd14 at osteolytic sites compared to muscle ( 2132.9 1487.9 cd14 gene transcripts versus 864.6 512.5 in muscle in patients with infection ; 671.7 479.2 versus 316.6 189.9 in patients with aseptic loosening ) and higher expression in patients with infection compared to tissue from aseptic loosening ( figure 1 ) . expression of cathepsin k , a marker for osteoclasts and hence of osteolysis , did not differ between the two patient groups ( figure 1 ) . in the peripheral blood , ccl3 was found in 8 of 14 patients with aseptic loosening ( 51.5 to 92.8 pg / ml ) and in 5 of 34 patients with an infection ( 47.5 to 118.8 pg / ml ) ; cxcl2 was not detected in sera of patients with aseptic loosening and in 5 of 34 patients with an infection ( ranging from 9.4 to 514.5 pg / ml ) . of note , these were not the same patients as those with measurable ccl3 serum concentrations . in serum of healthy donors neither ccl3 nor cxcl2 gene expression of cxcl2 and ccl3 in peripheral blood cells did not differ between the two patient groups , and peripheral blood cells responded essentially similar to stimulation with either pma or lps ( figures 1(e ) , and 1(f ) ) . infiltrating monocytes are a likely source of cytokines , but also osteoblasts are known to produce and release cytokines in response to infectious agents ( [ 34 , 35 ] ) . to follow up on that issue , primary osteoblasts were cocultivated with lta as an example for a bacteria - derived entity . within 2 to 6 hours , an increase in gene expression of ccl3 and cxcl2 bacteria were then killed and cell culture was continued for 24 hours or 48 hours . mips were released into the supernatant depending on the number of bacteria present ( representative experiment in figure 3(b ) ) . on average , s. epidermidis when added in a relation of 500 bacteria / cell induced cxcl-2 production of 22014.75 12815.2 pg / ml , s.aureus 13966 6128.36 pg / ml . for unstimulated cells , 6608.2 3412.2 pg / ml was determined ( values are the mean sd of three experiments with cells derived from different patients ) . ccl3 release was only seen with 500 s. epidermidis / cell and amounted to 71.44 27.3 pg / ml versus 0 in unstimulated cells . s. aureus in similar bacteria to cell ratio did not elicit a ccl3 response . of note , when osteoblasts were exposed to the bacteria at 4c as opposed to 37c , ccl3 and cxcl2 release was within the same range ( data not shown ) . also , there was no significant difference between cultivation for 24 h and 48 h. as expected , monocytes released both , ccl3 and cxcl2 , into the supernatant . both bacterial strains were equally efficient ( on average 317385 pg / ml of ccl3 and 31890 pg / ml of cxcl2 were released ) and again there was no major difference between 37 and 4c ( data not shown ) . to link generation of mips to osteolysis , the effect of ccl3 on the differentiation of monocytes towards osteoclasts was assessed . after 14 to 18 days in culture , giant cells with multiple nuclei appeared , expressing cathepsin k and trap , enzymes characteristic of osteoclasts ( example in figure 4(a ) ) . because osteoclast generation depends on an extended activation and de novo synthesis of nfatc1 [ 36 , 37 ] , lysates of ccl3 treated monocytes were analysed by western blotting . enhancement of nfatc1 was seen , though to a lesser extent when compared to rankl - treated cells ( figure 4(b ) ) . tissue samples of patients with implant - associated infections revealed gene expression of ccl3 and cxcl2 at sites of osteolysis , exceeding the amount detected in unaffected muscle tissue . expression of cd14 , a marker of infiltrating mononuclear cells , followed essentially the same pattern , suggesting that in accordance with data in the literature ccl3 and cxcl2 are predominately produced by macrophages ( reviewed in ) . in patients with aseptic loosening basically a similar expression pattern of cxcl2 , ccl3 , and cd14 was seen , though transcript numbers for cxcl2 and cd14 were lower compared to those seen in infected tissue . aseptic loosening is a sterile inflammation presumably caused by prosthesis - derived wear particles which activate primarily myeloid cells [ 30 , 38 , 39 ] . the presence of very potent stimulators of myeloid cells in infectious cases ( particularly bacteria - derived lipopolysaccharides or lipoteichoic acid ) could explain the more prominent reaction seen in bacterial infection . moreover , neutrophils , which are found primarily in infected but rarely in aseptic tissue , could contribute to ccl3 and cxcl2 production and cause a more pronounced inflammatory response . differences in the extent of the inflammatory response could explain why aseptic loosening usually progresses slower in some patients , 10 to 20 years after primary arthroplasty . eventually , however , the extent of bone degradation is rather similar , compatible with our data , showing similar transcripts for cathepsin k , a parameter for osteoclast generation . the fact that cxcl2 gene expression in infected tissue was enhanced compared to tissue of patients with aseptic loosening , but that of ccl3 was not , suggests that its production is differently regulated or involves cells others than macrophages . indeed , ccl3 , for example , is also produced by a subset of cd8 + t cells [ 40 , 41 ] , or endothelial cells . fibroblasts produce both , ccl3 and cxcl2 , , as do neutrophils after stimulation . important for our studies was the possible production of these cytokines by osteoblasts [ 28 , 45 ] , a fact we were able to confirm by exposing cultivated osteoblasts to staphylococci or lipoteichoic acid ( lta ) , a major component of the bacterial cell wall . lta stimulated both , ccl3 and cxcl2 expression , whereas the bacteria induced predominantly cxcl2 , suggesting different signalling pathways . lta most likely activates the osteoblasts via toll - like receptor 2 , whereas staphylococci express in addition to lta also other surface molecules which may mediate binding and activation of target cells . among those is protein a on s. aureus which binds to the tumor necrosis factor receptor on osteoblasts [ 46 , 47 ] . others include fibronectin - binding proteins which are expressed by bacteria and mediate binding to surface - associated fibronectin on osteoblasts [ 4850 ] . because s. aureus uses a different binding site on fibronectin as s. epidermidis , different signalling pathways are triggered , which could explain that synthesis of cxcl2 is stimulated by s. aureus , but that of ccl3 is not . activation of cxcl2 synthesis occurred even when the osteoblasts were exposed to bacteria at 4c , indicating that the mere contact of bacteria to cell surface receptors is sufficient to trigger the cells and ruling out phagocytosis as a crucial signal . enhanced local cytokine production can result in enhanced serum concentrations , and serum cytokines can serve as biomarkers to monitor disease activity . elevated serum concentrations of mips were found in various chronic inflammatory diseases , including rheumatoid arthritis or systemic lupus erythematosus [ 5155 ] , as well as in experimentally induced infection in mice [ 56 , 57 ] . differentiating between aseptic implant loosening and implant failure due to an infection can be difficult , because the standard laboratory parameters for infection ( serum crp concentration or leukocyte count ) can be negative in infectious cases and thus misleading . taking the different therapeutic approaches in aseptic and infectious cases into consideration , the search for a reliable preoperative marker has become crucial in orthopaedic surgery . however , neither the ccl3 and cxcl2 protein concentrations in serum , nor the gene expression by peripheral blood cells differed between aseptic and infectious cases . most likely , in contrast to the above mentioned systemic diseases , the expression and effects of ccl3 and cxcl2 are exhibited exclusively locally , with no spill - over into the peripheral blood . locally generated ccl3 and cxcl2 could contribute as chemoattractants to the infiltration of cells ; cxcl2 is a major chemokine for neutrophils , which could account for the neutrophil infiltration into infected tissues since expression of cxcl2 is enhanced in these patients as opposed to aseptic cases ; ccl3 attracts predominantly cd8 + t cells , in line with the shift of the cd4/cd8 ratio towards cd8 + in the cellular infiltrate in implant - associated infection . aside from attracting immune cells , cxcl2 and ccl3 could have an additional function in implant loosening . mips have been shown to participate in osteoclast generation in patients with multiple myeloma and the expression correlated with bone degradation [ 5961 ] . moreover , in vitro studies and various rodent models provided proof of a connection between mip - production and bone degradation [ 6265 ] . in a series of in vitro studies , we were now able to show that ccl3 induced the differentiation of cd14 + monocytes to osteoclasts , which might be relevant for bone degradation in osteomyelitis , because peripheral blood monocytes are known to be osteoclast precursors . osteoclast differentiation induced by ccl3 was associated with nfatc1 synthesis , in line with the effect of rankl , a well - known and major inducer of osteoclastogenesis [ 67 , 68 ] . under our experimental conditions , ccl3 was less effective when compared to rankl , which , however , not necessarily diminishes their role in osteoclast generation in vivo . the relevance of ccl3 and cxcl2 in the process of bone resorption was shown in mouse experimental models . in conclusion , our study demonstrates that , under infectious conditions , but also in sterile inflammation , cxcl2 and ccl3 are produced locally . because mips may contribute to osteoclast generation , these findings provide a link between local inflammation and bone resorption which further leads to implant loosening . colocalisation with cd14 suggests synthesis by cells of the monocyte / macrophage lineage , but , because osteoblasts can also produce mips when appropriately stimulated , it is feasible that they initiate the inflammatory response by recruiting leukocytes . this in turn creates a proinflammatory environment which results in a progressive course of the disease and leads to extensive tissue damage , as well as loss of bone .
bacterial infections of bones remain a serious complication of endoprosthetic surgery . these infections are difficult to treat , because many bacterial species form biofilms on implants , which are relatively resistant towards antibiotics . bacterial biofilms elicit a progressive local inflammatory response , resulting in tissue damage and bone degradation . in the majority of patients , replacement of the prosthesis is required . to address the question of how the local inflammatory response is linked to bone degradation , tissue samples were taken during surgery and gene expression of the macrophage inflammatory proteins mip1 ( ccl3 ) and mip2 ( cxcl2 ) was assessed by quantitative rt - pcr . mips were expressed predominantly at osteolytic sites , in close correlation with cd14 which was used as marker for monocytes / macrophages . colocalisation of mips with monocytic cells could be confirmed by histology . in vitro experiments revealed that , aside from monocytic cells , also osteoblasts were capable of mip production when stimulated with bacteria ; moreover , ccl3 induced the differentiation of monocytes to osteoclasts . in conclusion , the multifunctional chemokines ccl3 and cxcl2 are produced locally in response to bacterial infection of bones . in addition to their well described chemokine activity , these cytokines can induce generation of bone resorbing osteoclasts , thus providing a link between bacterial infection and osteolysis .
in palliative care research and among palliative care providers , a consensus has grown regarding the importance of spirituality . the need to pay attention to palliative care patients spiritual needs and concerns is generally recognized . therefore , it is no surprise that in the world health organization ( who ) 's well - known definition of palliative care spirituality is mentioned as one of the main problems that should be addressed by palliative care teams . also , the indian association of palliative care has recognized the necessity to address spiritual distress by explicitly mentioning it in its contextualized definition of palliative care . given this broad consensus , it is surprising to note that only limited attention has been paid to the study of spirituality in palliative care in india . among indian palliative care patients or patients with palliative care needs , spirituality has most often been studied as an aspect or domain of quality of life , as one of the coping mechanisms used by patients , or as part of psychosocial problems faced by them . the limited attention that has been paid to spirituality in palliative care research in india is even more surprising given the fact that india is a very large country with its own distinctive cultures , social organization , and religions . therefore , it can be surmised that observations regarding spirituality in palliative care in other countries can not necessarily be applied to india . one of the factors that may explain the limited attention to spirituality in indian palliative care research is the lack of validated research tools or scales regarding spirituality in this setting . there are no spirituality scales specifically designed and validated for the indian palliative care context . questionnaires and scales that are developed elsewhere and then validated in indian palliative care populations may still be helpful . however , given the particularities of the indian palliative care context , specific questionnaires especially designed for palliative care patients in india can be expected to represent better their spiritual issues and concerns . with this study , we intended to develop a questionnaire and undertake a psychometric assessment of it . the outcome of the study would be a coherent spirituality questionnaire that could be directly used in future studies , and it would be a reliable starting point for the development of a more condensed spirituality scale for the study of spirituality among palliative care patients in india . to enable us to design appropriate items for the questionnaire , we undertook a systematic review of the literature following the recommendations of the prisma statement . the review of the literature led to two important observations that guided the development of the questionnaire . first , a distinction was made between three - dimensions of spirituality in indian palliative care : the relational dimension , the existential dimension , and the values dimension . the review of the literature made clear that these three - dimensions constitute a meaningful way of looking at spirituality in indian palliative care . we , therefore , decided to use these three - dimensions to construct our questionnaire . the three - dimensions were used as benchmarks to cover comprehensively spirituality in indian palliative care . we did not hypothesize beforehand that a factor analysis would lead to these three - dimensions , because many of the developed items could potentially load on various dimensions . also , there was no compelling evidence from the literature that these dimensions were effective distinctive facets of spirituality among patients . second , the review showed that belief in the existence of a power , force , principle , dimension or entity that transcends human life and the world plays a very important and decisive role in spirituality in indian palliative care . this finding stimulated us to focus on this transcending aspect in the development of the questionnaire . by emphasizing this aspect , we would also be able to make a distinction between spirituality and other aspects of health care , such as the physical , ethical , psychological and social . for instance , when a patient expresses his desire for reconciliation with his estranged brother , this could be seen as mainly a social issue , if it is accepted that transcendence is a central aspect of spirituality . when this same patient states that the love he feels for his family is stronger than death , this could be interpreted as an expression of spirituality , because the patient refers to a power , force , principle , dimension or entity that transcends human life and the world , that is , a particular kind of love . as shown by walter , in many more encompassing interpretations of spirituality the borders of spirituality have become so ill - defined that it becomes virtually impossible to distinguish spirituality from other aspects of healthcare or even science . for a focused empirical study , a more restrictive interpretation may , therefore , be helpful . since the literature review had shown that belief in the existence of a power , force , principle , dimension , or entity that transcends human life and the world is central in spirituality in indian palliative care , an interpretation that focuses on transcendence was deemed culturally appropriate . using the literature participants were able to express their view on these statements through a five - point likert scale . in the questionnaire that we designed , the spirituality items were preceded by questions soliciting demographic information , including age , gender , marital status , diagnosis , prognosis , educational level , and religious affiliation . participants were also requested to indicate their experience of pain on a numerical rating pain scale . in september 2013 , the list with items was sent out to an international team of experts with research expertise in palliative care , psychology , ( pastoral ) theology , and religious studies . with their input , the questionnaire was amended , and spirituality items were altered , deleted , or added . to the questionnaire , we added a participant information sheet and a participant informed consent form . in the participant information sheet , we explained in an easy - to - understand way the purpose and aims of the study , the interview procedure , confidentiality issues , and expected long - term benefits to palliative care . in order to facilitate discussion among the scholars who were involved in the preparation of the questionnaire and who had different mother tongues , all documents that we had generated were in english . since the questionnaire was going to be administered to patients who could be expected to be fluent in hindi , we had the questionnaire , participant information sheet , and a participant informed consent form translated into hindi by a professional translator . the investigators checked this translation for accuracy and made changes when the translated text was deemed inaccurate or too difficult to be understood by a substantial number of patients . when the questionnaire had been finalized , we applied for ethical clearance from the ethics committee ( institutional review board ) of the all india institute of medical sciences ( aiims , new delhi ) where the study would be conducted . , the questionnaire was piloted among 30 patients attending the pain clinic of the dr . the interviewers were asked to indicate the questions that patients found difficult to understand , and they were to propose changes based on their interactions with the patients during the interviews . as a result , some items were changed , and one spirituality item was dropped because that item turned out to be too abstract to be comprehended by a majority of the patients . in the demographic section , we decided not to ask the patients to give their diagnosis and prognosis . in indian healthcare , patients are often not properly informed about their diagnosis and prognosis . instead , for the data collection with the final questionnaire the interviewers completed the information on diagnosis and prognosis on the basis of the patient 's medical file , to which the patients had granted them access in the informed consent form . i do not know anything about my prognosis , very poor , the interviewers also observed difficulties when they inquired about the participants religious affiliation . in the questionnaire , religion was translated into hindi with the word dharm . however , the word dharm is a philosophical term that has a broader meaning than just religion , and it can also refer to concepts such as duty , morality , or law of nature . in this way , unfortunately , a substantially better translation for the english term religion is not available in hindi . therefore , the interviewers were instructed first to inquire about the patient 's religion or dharm . in cases that the patient did not mention a general religious tradition , the interviewers were to determine the patient 's religious affiliation on the basis of sociocultural characteristics , such as particular first names and surnames that are bound to religious communities . in the final questionnaire , the number of answer categories in the likert scale for the spirituality items was reduced . the interviewers had noticed that many participants found it hard to distinguish between strongly agree and agree , and between disagree and strongly disagree . therefore , we decided to reduce the answer categories to agree , neither agree nor disagree , and disagree . sorted factor loadings from september to december 2014 , hindi - speaking patients , who were 18 years or older and attended the pain clinic of the dr . ambedkar institute rotary cancer hospital , aiims , were requested to participate in the study . we excluded patients who were showing signs of extreme pain , who were visibly too distressed , who had a history of neurological or psychiatric impairment , cognitive dysfunction , or alcohol or substance abuse , and patients who had received treatment with investigational drugs within the last 30 days preceding the interview . patients who initially agreed received more information about the study , were given the participant information sheet , and were asked to sign the informed consent form . having done that , the patients were interviewed by one of the two trained interviewers who had previously been involved in the pilot study . on average , patients completed the questionnaire in 10 min . subsequently , the collected data were entered into an excel file . when all data had been entered into the file , it was imported into ibm spss statistics 22 , which was used for the data analysis . pereira 's spss r - menu for ordinal factor analysis , because in spss the pearson 's correlation matrix is the only correlation matrix that is available to perform exploratory factor analysis . this is not a suitable correlation matrix when dealing with ordinal likert - type data . subsequently , we undertook a descriptive analysis of the factors , and we searched for associations between the factors , demographic variables , and pain scores using relevant statistical tests , that is , pearson 's correlation co - efficient , the mann to enable us to design appropriate items for the questionnaire , we undertook a systematic review of the literature following the recommendations of the prisma statement . the review of the literature led to two important observations that guided the development of the questionnaire . first , a distinction was made between three - dimensions of spirituality in indian palliative care : the relational dimension , the existential dimension , and the values dimension . the review of the literature made clear that these three - dimensions constitute a meaningful way of looking at spirituality in indian palliative care . we , therefore , decided to use these three - dimensions to construct our questionnaire . the three - dimensions were used as benchmarks to cover comprehensively spirituality in indian palliative care . we did not hypothesize beforehand that a factor analysis would lead to these three - dimensions , because many of the developed items could potentially load on various dimensions . also , there was no compelling evidence from the literature that these dimensions were effective distinctive facets of spirituality among patients . second , the review showed that belief in the existence of a power , force , principle , dimension or entity that transcends human life and the world plays a very important and decisive role in spirituality in indian palliative care . this finding stimulated us to focus on this transcending aspect in the development of the questionnaire . by emphasizing this aspect , we would also be able to make a distinction between spirituality and other aspects of health care , such as the physical , ethical , psychological and social . for instance , when a patient expresses his desire for reconciliation with his estranged brother , this could be seen as mainly a social issue , if it is accepted that transcendence is a central aspect of spirituality . when this same patient states that the love he feels for his family is stronger than death , this could be interpreted as an expression of spirituality , because the patient refers to a power , force , principle , dimension or entity that transcends human life and the world , that is , a particular kind of love . as shown by walter , in many more encompassing interpretations of spirituality the borders of spirituality have become so ill - defined that it becomes virtually impossible to distinguish spirituality from other aspects of healthcare or even science . for a focused empirical study , a more restrictive interpretation may , therefore , be helpful . since the literature review had shown that belief in the existence of a power , force , principle , dimension , or entity that transcends human life and the world is central in spirituality in indian palliative care , an interpretation that focuses on transcendence was deemed culturally appropriate . using the literature participants were able to express their view on these statements through a five - point likert scale . in the questionnaire that we designed , the spirituality items were preceded by questions soliciting demographic information , including age , gender , marital status , diagnosis , prognosis , educational level , and religious affiliation . participants were also requested to indicate their experience of pain on a numerical rating pain scale . in september 2013 , the list with items was sent out to an international team of experts with research expertise in palliative care , psychology , ( pastoral ) theology , and religious studies . with their input , the questionnaire was amended , and spirituality items were altered , deleted , or added . to the questionnaire , we added a participant information sheet and a participant informed consent form . in the participant information sheet , we explained in an easy - to - understand way the purpose and aims of the study , the interview procedure , confidentiality issues , and expected long - term benefits to palliative care . in order to facilitate discussion among the scholars who were involved in the preparation of the questionnaire and who had different mother tongues , all documents that we had generated were in english . since the questionnaire was going to be administered to patients who could be expected to be fluent in hindi , we had the questionnaire , participant information sheet , and a participant informed consent form translated into hindi by a professional translator . the investigators checked this translation for accuracy and made changes when the translated text was deemed inaccurate or too difficult to be understood by a substantial number of patients . when the questionnaire had been finalized , we applied for ethical clearance from the ethics committee ( institutional review board ) of the all india institute of medical sciences ( aiims , new delhi ) where the study would be conducted . , the questionnaire was piloted among 30 patients attending the pain clinic of the dr . the interviewers were asked to indicate the questions that patients found difficult to understand , and they were to propose changes based on their interactions with the patients during the interviews . as a result , some items were changed , and one spirituality item was dropped because that item turned out to be too abstract to be comprehended by a majority of the patients . in the demographic section , we decided not to ask the patients to give their diagnosis and prognosis . in indian healthcare , patients are often not properly informed about their diagnosis and prognosis . instead , for the data collection with the final questionnaire the interviewers completed the information on diagnosis and prognosis on the basis of the patient 's medical file , to which the patients had granted them access in the informed consent form . i do not know anything about my prognosis , very poor , the interviewers also observed difficulties when they inquired about the participants religious affiliation . in the questionnaire , religion was translated into hindi with the word dharm . however , the word dharm is a philosophical term that has a broader meaning than just religion , and it can also refer to concepts such as duty , morality , or law of nature . in this way , unfortunately , a substantially better translation for the english term religion is not available in hindi . therefore , the interviewers were instructed first to inquire about the patient 's religion or dharm . in cases that the patient did not mention a general religious tradition , the interviewers were to determine the patient 's religious affiliation on the basis of sociocultural characteristics , such as particular first names and surnames that are bound to religious communities . in the final questionnaire , the number of answer categories in the likert scale for the spirituality items was reduced . the interviewers had noticed that many participants found it hard to distinguish between strongly agree and agree , and between disagree and strongly disagree . therefore , we decided to reduce the answer categories to agree , neither agree nor disagree , and disagree . from september to december 2014 , hindi - speaking patients , who were 18 years or older and attended the pain clinic of the dr . ambedkar institute rotary cancer hospital , aiims , were requested to participate in the study . we excluded patients who were showing signs of extreme pain , who were visibly too distressed , who had a history of neurological or psychiatric impairment , cognitive dysfunction , or alcohol or substance abuse , and patients who had received treatment with investigational drugs within the last 30 days preceding the interview . patients who initially agreed received more information about the study , were given the participant information sheet , and were asked to sign the informed consent form . having done that , the patients were interviewed by one of the two trained interviewers who had previously been involved in the pilot study . on average , patients completed the questionnaire in 10 min . subsequently , the collected data were entered into an excel file . when all data had been entered into the file , it was imported into ibm spss statistics 22 , which was used for the data analysis . pereira 's spss r - menu for ordinal factor analysis , because in spss the pearson 's correlation matrix is the only correlation matrix that is available to perform exploratory factor analysis . this is not a suitable correlation matrix when dealing with ordinal likert - type data . subsequently , we undertook a descriptive analysis of the factors , and we searched for associations between the factors , demographic variables , and pain scores using relevant statistical tests , that is , pearson 's correlation co - efficient , the mann hundred and fifty - two patients ( 50.7% ) were male , and 148 ( 49.3% ) were female . a large majority of the patients ( n = 271 , 90.3% ) were married at the time of the interview , a few were either unmarried ( n = 19 , 6.3% ) or widowed ( n = 9 , 3% ) , and one was divorced ( 0.3% ) . more than one in four patients ( 28% , n = 84 ) indicated to have had no formal education . 21.3% ( n = 64 ) had studied up to 7 grade ( 12 years ) or less . 23% ( n = 69 ) had studied until 10 grade ( 16 years ) . 10.7% ( n = 32 ) had an undergraduate degree , and 5% ( n = 15 ) had completed a postgraduate course . upon comparison of the two items regarding religious affiliation ( cf . n = 241 ) were classified as hindu , 13.7% ( n = 41 ) muslim , 2.7% ( n = 8) sikh , 1.3% ( n = 4 ) jain , 1% ( n = 3 ) christian , and 0.7% ( n = 2 ) buddhist . as the survey was undertaken in the out - patient pain clinic of a cancer hospital , all patients were suffering from cancer - related pain . pain scores varied from one ( no pain ) to 10 ( worst possible pain ) with the mean at 3.22 ( standard deviation 2.10 ) . the most common cancers were ca breast ( n = 45 , 15% ) , ca lung ( n = 26 , 8.7% ) , ca gallbladder ( n = 15 , 5% ) and ca rectum ( n = 13 , 4.3% ) . as per the medical files , the prognosis of almost two - thirds of the patients was poor ( n = 192 , 64% ) or very poor ( n = 6 , 2% ) . however , when the patients were asked to rate their own prognosis , 40.3% ( n = 121 ) stated that their prognosis was either good or very good , while only 28.4% ( n = 85 ) thought that their prognosis was poor or very poor . 14% ( n = 42 ) believed that their prognosis was neither poor , nor good , and 16% ( n = 48 ) attested that they did not know anything about their prognosis . when the patients were requested to discuss what they knew about their disease , it turned out that most did not know much about their disease other than that they had some kind of cancer , although a few patients did not even know that much . for the factor analysis , we used the above mentioned spss menu for ordinal factor analysis with the orthogonal varimax rotation . initial eigenvalues indicated that the first factor explained 26% of variance , the second 14.63% , the third 7.2% , and the fourth 6.8% . we opted to retain this four - factor solution because the slope of the curve in the scree plot clearly leveled off after the fourth factor , and this solution yielded a meaningful interpretation that could be theoretically supported . the factors represent four spiritual demeanors that can be frequently perceived among palliative care patients in india : shifting moral and religious values ( factor 1 ) , support from religious relationship ( factor 2 ) , existential blame ( factor 3 ) , and spiritual trust ( factor 4 ) . in the names of these factors , the three - dimensions of spirituality that we had used to construct the questionnaire ( values dimension , relational dimension , and existential dimension ) resurface in a modified form , although during the factor analysis a fourth factor ( spiritual trust ) appeared . items that loaded on the first factor ( shifting moral and religious values ) showed that values that had earlier been important to patients had become less central since the onset of the illness , or patients at least seriously pondered upon the meaning of these values . there were items that assessed to what extent patients were displeased with their religious views and considered changing their religion or felt agitated when they thought of god . clearly related to these last items were items that showed loss of faith in god or a higher benevolent power . last , items showed confusion and concern about which personal acts were good and right . items that loaded on the second factor ( support from religious relationship ) assessed to what extent patients felt supported in their illness by god or a higher power . besides items that directly inquired about that feeling of support , there were items that assessed whether patients felt better or at peace due to religious activities . indulgence in such activities can be seen as an expression of a supportive relationship with an ultimate reality . items that loaded on the third factor ( existential blame ) illustrated that patients answered existential questions by blaming themselves for their illness . relevant items addressed self - blame , belief in karma , belief in illness as a ( divine ) punishment for sin , and consideration of the illness as personal fate . in the fourth factor ( spiritual trust ) , the relevant items loaded negatively . therefore , items that assessed fear and frustration implied trust when they loaded on the fourth factor . originally , these items inquired about worry and fear about what would happen to themselves or their family in the future or after they had died . the items also assessed the feeling of unfairness : were others to blame for the illness or had they committed unforgivable sins ? did patients keep wondering why the illness had happened to them ? when these items are interpreted reversely , they indicate that patients are at ease with existential answers and feel confident about the future . after interpreting the four - factor solution , composite scores were created for each of the four factors , based on the mean of the items that had their primary loadings on each factor . this enabled us to compute descriptive statistics for the four factors [ table 2 ] . descriptive statistics for the four factors the skewness and kurtosis for factors one , three , and four were within a tolerable range for assuming a normal distribution . however , factor 2 appeared to be highly skewed toward greater inclination to the demeanor support from religious relationship . the alphas ranged from moderate ( 0.64 for factor 3 ) to good ( 0.78 for factor 4 ) , suggesting that the four factors have an acceptable internal consistency . in a next step , we tested associations between the four factors and demographic variables and pain scores . , there was only significant correlation with factor 3 ( r = 0.67 , n = 300 , p = 0.004 ) . scatter plot with loess curve for age and factor 3 a mann whitney test indicated a significant association between gender and factor 4 ( spiritual trust : u = 9283 , z = 2448 , p = 0.014 ) . women showed less spiritual trust ( median = 2.33 , mean = 2.21 , standard deviation = 0.49 ) than men ( median = 2.09 , mean = 2.06 , and standard deviation = 0.50 ) . since the number of patients who were either unmarried , widowed , or divorced was small ( n = 29 ) , we decided to treat these patients as one group for marital status , and we checked whether there were differences between these not - married patients on the one hand and married patients on the other hand at the level of the four factors . whitney tests showed significant associations between marital status and factors 3 ( existential blame : u = 2565.5 , z = 3.106 , p = 0.002 ) and 4 ( spiritual trust : u = 2420 , z = 3.414 , p = 0.001 ) . married patients showed higher degrees of existential blame ( median = 1.47 , mean = 1.55 , and standard deviation = 0.45 ) than not - married patients ( median = 1.79 , mean = 1.85 , and standard deviation = 0.51 ) , while patients who were not married scored better , that is , lower scores , for factor 4 ( spiritual trust : median = 1.84 , mean = 1.81 , and standard deviation = 0.44 ) than married patients ( median = 2.27 , mean = 2.17 , and standard deviation = 0.50 ) . wallis tests revealed no significant associations for prognosis as rated by patients and the four factors . however , kruskal wallis tests did indicate significant associations between educational level and factors 3 ( existential blame : = 37.86 , df = 5 , p < 0.001 , with a mean rank factor score of 122.74 for uneducated , 135.43 for less than class 7 , 140.26 for until 10 , 186.06 for inter , 202.28 for undergraduate , and 213.97 for postgraduate ) and 4 ( spiritual trust : = 32 , df = 5 , p < 0.001 , with a mean rank factor score of 180.34 for uneducated , 158.65 for less than class 7 , 152.43 for until 10 , 125.93 for inter , 88.80 for undergraduate , and 118.73 for postgraduate ) . table 3 shows that patients who had had less formal education displayed more existential blame ( factor 3 ) and less existential trust ( factor 4 ) in comparison to more educated patients . comparisons of factors 3 and 4 with educational level pain scores were significantly correlated with factors 1 ( r = 0.24 , n = 299 , p < 0.001 ) , 2 ( r = 0.23 , n = 299 , p < 0.001 ) , and 3 ( r = 0.20 , n = 299 , p = 0.001 ) . as shown in graph 2 , patients with higher pain scores were more likely to be reconsidering their moral and religious values ( factor 1 ) , derived less support from a religious relationship ( factor 2 ) , and more strongly experienced existential blame ( factor 3 ) . the present study found four factors representing four spiritual demeanors in indian palliative care patients . these factors are shifting moral and religious values , support from religious relationship , existential blame , and spiritual trust . the first three factors correspond to the three - dimensions that were used to construct the questionnaire ( i.e. , values dimension , relational dimension , and existential dimension ) . it includes items probing about fear and worries regarding what will happen to the patients themselves or their families in the future or after their death . it also includes items measuring the feeling of unfairness and injustice , such as : why did they fall sick ? are the sins committed by patients unforgiveable ? or , who is to blame for this illness : the patients themselves or others ? in our study , this fourth - dimension turned out to be an important aspect of spirituality among indian palliative care patients . therefore , this dimension should be considered in future research and scale development . by contrast , the skewness and kurtosis were outside a tolerable range for factor 2 ( support from religious relationship ) . this means that virtually without exception indian palliative care patients derive support from their relationship with the divine or ultimate reality . this corresponds to earlier observations that in indian palliative care belief in god is almost universal , and most patients are convinced that god will help them overcome their disease . therefore , in future research the predictive value of the factor support from religious relationship may be limited , and researchers developing more condensed spirituality scales should consider omitting or refocusing it . nevertheless , overall , it can be argued that the current study has led to the discovery of significant spirituality factors . this claim can be further supported by referring to the meaningful associations of the factors with demographic variables and pain scores . the present study observed a significant association of increasing age with increasing existential blame . at first hui et al . , noted a signification association of spiritual distress with younger age in a sample of advanced cancer patients admitted to an acute palliative care unit . likewise , studies with the who quality of life ( qol)-hiv instrument showed that spiritual quality of life was better in elderly people than in younger hiv / aids patients . however , there need not be a contradiction between these findings and ours . although the name of factor 3 existential blame may evoke negative associations , as such the factor does not refer to distress or poor spiritual quality of life . patients who are more inclined to existential blame were more likely to see their disease as a consequence of karma , punishment for sin , or the result of their own wrongdoing . it can be argued that elderly patients may find such views easier to accept than younger patients , who may be more likely to see their illness as unfair and unjust because they see that most people their age are healthy . so , actually this latter group can be expected to be more prone to existential distress . also , the observation that women showed less spiritual trust makes sense when we analyze the items that loaded on factor 4 ( spiritual trust ) . several of these items can be related to fear for what will happen to one 's children and spouse . indian palliative care patients have indeed been found to worry about what will happen to their children and partner after their death . given the traditional caring roles of women in indian society indeed , the whoqol - hiv group , which studied quality of life in six countries , including india , reported that females were more fearful of the future and reported poorer spirituality than men . the fact that the absence of fear for what will happen to their children and spouse constitutes an important aspect of the demeanor of spiritual trust also helps to explain why married patients scored less well on this factor than not - married patients . married patients have a spouse , and they often also have children for whom they care and worry about . patients who are not married are thus less likely to have similar worries . did not find an association of the spirituality domain of quality of life with gender and marital status among a sample of hiv - positive patients in india . their findings can be explained by the fact that they used the whoqol - hiv instrument for their study . the concerns about the future that are addressed in that questionnaire have more to do with the respondents specific hiv status and seem to exclude anxiety about the future of loved ones . the association of educational level with factors 3 ( existential blame ) and 4 ( spiritual trust ) may be related to the generally worse socioeconomic condition of the patients with lower levels of education . since they are economically less well off , they may worry more often about what will happen in the future to their family or who is going to pay the medical bills . poorer living conditions may lead to a less healthy living environment and substance abuse for which the patients might blame themselves . also , the association of pain scores with the first three factors lies within the line of expectations and shows the interconnection between physical pain and spirituality . spirituality may help patients to cope better with pain , and in this way reduce their experience of physical pain . the role of spirituality as a coping mechanism for pain has been well described in the literature . yet , at the same time physical symptoms may be so severe that they make patients to question the validity of existential answers , and in this way lead to a spiritual crisis . to be sure , not all earlier studies on spirituality and physical pain have noted a clear association between the two . in the study of hui et al . , pain was significantly associated with spiritual distress in univariate analysis , although in multivariate analysis this association was no longer significant . likewise , mako et al . , did not observe a correlation between spiritual pain and physical pain among advanced cancer patients in palliative care . the contrasting observations regarding the association between physical pain and spirituality may be due to the complexity of the phenomenon spirituality . as a coping mechanism , spirituality can lead to both adaptive or positive coping and maladaptive or negative coping . for example , positive coping entails feelings of divine support , while negative coping can include feeling abandoned by god . such opposite coping strategies can have a very different impact on the ways in which patients experience their disease and pain . therefore , while studying spirituality , it is better to look at specific dimensions of spirituality as we did in the current study . our observations that patients with higher pain scores were more likely to be reconsidering their moral and religious values , felt less supported by a religious relationship , and more strongly experienced existential blame do show that in this population spiritual insecurity and blame are associated with higher levels of physical pain . although we have been able to show that we have developed an appropriate questionnaire for the study of spirituality in indian palliative care , researchers should apply some caution when using the observations in future research , as our study has some limitations . first , the patients were interviewed only when they indicated that their pain was stable . however , spirituality in patients with severe pain may vary substantially from those with adequate pain relief . the studied hospital largely caters to the needs of north indian patients ; thus , our observations may not be valid for non - hindi speaking populations in south india . moreover , the questionnaire may not lead to equally meaningful results among palliative care patients suffering from diseases other than cancer . last , in our sample , the number of participants from religious minorities was small . since religion is an important aspect of spirituality in palliative care in india , the results could have been different if the share of religious minorities in the studied sample had been more substantial . in this study , we have shown that the developed spirituality questionnaire is a good starting point for further studies on spirituality in indian palliative care . the questionnaire has acceptable psychometric characteristics , and it has revealed four spirituality factors out of which at least three , that is , shifting moral and religious values , existential blame and spiritual trust , deserve elaborate attention in future studies . we recommend that the presented results are used for the development of a brief scale , which can then be tested among larger samples and in more palliative care centers in different parts of india .
introduction : there are only a few studies on spirituality among palliative care patients in india . this gap in research may be caused by the absence of relevant questionnaires and scales specifically designed for indian palliative care populations . in this study , we describe the development of such a questionnaire and explain its psychometric characteristics.methods:we designed a questionnaire on the basis of a systematic review of the literature . after a review of the questionnaire by specialists and a subsequent pilot study , the questionnaire was amended . the final questionnaire consisted of a list of 36 spirituality items . it was administered to a sample of 300 cancer patients attending the pain clinic of a tertiary hospital in new delhi.results:a factor analysis led to four factors explaining 54.6% of variance : shifting moral and religious values ( factor 1 ) , support from religious relationship ( factor 2 ) , existential blame ( factor 3 ) , and spiritual trust ( factor 4 ) . the skewness and kurtosis for factors 1 , 3 , and 4 were within a tolerable range for assuming a normal distribution , but factor 2 was skewed . the alphas showed that the four factors have an acceptable internal consistency . statistically significant associations were observed for age and factor 3 ( p = 0.004 ) , gender and factor 4 ( p = 0.014 ) , marital status and factors 3 ( p = 0.002 ) and 4 ( p = 0.001 ) , educational level and factors 3 ( p < 0.001 ) and 4 ( p < 0.001 ) , and pain scores and factors 1 ( p < 0.001 ) , 2 ( p < 0.001 ) , and 3 ( p = 0.001).conclusion : the questionnaire offers promising prospects for the study of spirituality among palliative care patients in india .
in recent years , studies in embryonic and somatic stem cells have provided basic insight into the molecular and cellular properties of stem cells . it is recognized that pluripotent stem cells such as embryonic stem cells ( esc ) can replenish differentiated cell types and achieve long - term tissue reconstitution . similar to esc , adult stem cells also have the capacity for self - renewal and multilineage differentiation . adult stem cells constitute ~12% of the total cell population within a specific tissue and are essential for maintaining homeostasis . these cells are normally quiescent and are held in an undifferentiated state within their niche until they receive a signal to self - renew or differentiate . they reside in various tissue types including the bone marrow , brain , digestive system , skin , retina , muscles , pancreas , and liver . hematopoietic stem cells ( hsc ) are the most widely studied and characterized adult stem cells . they play an essential role in sustaining the formation of the blood and the immune system . these adult stem cells reside in the bone marrow along with mesenchymal stem cells ( msc ) . it was previously thought that adult stem cells were lineage restricted ; however , recent studies have shown that hsc and mesenchymal stem cells have enormous plasticity . moreover , they offer several advantages including ease of manipulation , lack of serious ethical issues and , in the autologous setting , the absence of immunogenicity . micrornas ( mirnas ) are short single - stranded rna molecules of about 1725 nucleotides that control gene expression post - transcriptionally in many different cellular processes either by blocking translation or by inducing mrna degradation through sequence complementation . although numerous signaling pathways , transcription factors and epigenetic changes are essential cellular regulators in determining stem cell fate , recent studies have shown that mirnas are also implicated in coordinating the necessary changes in gene expression . typically , mirnas are capable of controlling the fate of cells in a time and tissue specific manner through regulation of cellular differentiation , developmental patterning , and morphogenesis . therefore , manipulation of mirnas could potentially be a useful approach to developing strategies for stem cell therapy . in this study , we investigated the role of mirnas in an adherent subpopulation of cd34 cells isolated from granulocyte colony - stimulating factor mobilized peripheral blood cells . we identified several clusters of mirnas that were differentially expressed in these stem cells by mirna profiling . further analysis of one of the clusters revealed a mirna that targets the stem cell gene nanog . our data provide evidence that mir-181a * targets nanog in a subpopulation of cd34 cells . we performed mirna profiling on a subpopulation of adherent cd34 cells mobilized peripheral blood cells . using a 466 mirna chip , we compared the mirna signatures of adherent and nonadherent cd34 cells ( figure 1a ) . these two subpopulations of cd34 cells have previously been established as having distinct morphology , immunophenotype , and gene expression profile . moreover , the adherent cd34 cells display greater plasticity than the nonadherent population as they have the potential to express determinants specific to liver , pancreas , heart , muscle , and nerve cell differentiation . hierarchical clustering revealed eight unique mirna clusters that were differentially expressed in the adherent and nonadherent populations . this finding is not entirely surprising since the biological roles of mirnas are known to vary according to their expression in distinct cell populations in normal tissues . interestingly , there were several mirnas that have not been previously characterized for human in cluster 8 ( table 1 ) . we were particularly interested in the mirnas in cluster 8 because among the mirnas in this cluster , mir-181a * ( mir-181a-3p ) was highly upregulated and studies have also shown that the mir-181 family are associated with regulation of cd34 cells . however , the mrna targets are largely unknown . we did identify some conserved regions within the mature human mir-181 family of sequences which consist of mir-181a , mir-181b , mir-181c , and mir-181d ( figure 1b ) . we have taken the first step toward better understanding the role of mir-181a * in cd34 cells . higher alkaline phosphatase activity is generally associated with stem cells that are in a less differentiated state . we found increasing levels of alkaline phosphatase activity in cells transfected with mir-181a * inhibitor when compared to transfection with mir-181a * mimic ( figure 1c ) . the data raises the possibility that these stem cell population could be maintained in a less differentiated state by inhibiting mir-181a * expression . we next applied an in - house genomic - bioinformatics database to identify and validate potential candidate target messages for mir-181a*. being important factors in stem cell maintenance , the genomic loci of nanog , stat3 , hic1 , sox2 , hoxb4 , and pou5f1 ( oct4 ) were scanned for putative target sites that was complementary to the mir-181a * sequence ( 5-accaucgaccguugauuguacc-3 ) . specifically , the annotated 3 utr sequences of these genes were scanned for seed sites with perfect reverse - complementarity to mirna-181a seed sequence ( nucleotides 27 from the 5 end ) and sites with strong overall complementarity to mirna-181a . of the putative target genes , we discovered that mir-181a * formed the most stable base pairing at the nanog 3utr ( figure 2a ) . since nanog is an important regulator of stem cell maintenance and self - renewal , we determined whether mir-181a * targeted nanog transcripts . using endpoint reverse transcription - pcr ( rt - pcr ) ( figure 2b ) and quantitative rt - pcr ( figure 2c ) in transfected cd34 stem cells , we found that inhibiting mir-181a * significantly upregulates transcript levels of nanog . it has been reported that there exists a sensitive feedback loop that maintains the differentiation of stem cells through the control of essential stem cell genes such as nanog . this loop enables where by environmental or molecular cues to influence the expression levels of genes , leading to a binary decision to switch downstream differentiation genes on or off . the data raises the possibility that mir-181a * may be involved in directly regulating nanog expression in cd34 stem cells . to gain more insight into the functional interaction between mir-181a * and nanog mrna , we further interrogated the entire sequence alignment between the two rna molecules . we discovered a high degree of base pairing at the 3 region ( 7 nucleotides ) and a weak base pairing at the 5 seed site of mir-181a * ( figure 3a , top panel ) . in general most mirna target sites have a strong base pairing at the 5 seed site ( 78 nucleotides ) . however , the 5 seed site rule is not always the case and studies have shown that the 3 region of mirna also play an important role in targeting mrna but are rare events . in addition to the 3 sites , a recent report has identified another site called the centre site suggesting that mirna targeting is more complex and diverse . in our case , because the base pairing at the 5 seed site of mir-181a * was weak , we speculated that the strong complementarity pairing at the 3 region would compensate and may follow the 3-compensatory site rule similar to one of the earlier mirna that was discovered such as let-7 ( figure 3a , bottom panel ) . both mir-181a * and let-7 mirnas , in this setting show a very similar overall structural identity in the way they bind to their targets . to determine whether the 3 region of mir-181a * was important , we generated , using rnahybrid modeling , the most energy stable complementarity base pairing between mir-181a * and nanog 3 utr mrna ( figure 3b , top panel ) as well as determining the best mutations that would disrupt the 3 region base pairing . this was generated by replacing two bases at the 3utr of nanog ( figure 3b , bottom panel ) . to test this modeling we generated a dual - luciferase reporter construct for mir-181a * and nanog 3 utr mrna . we inserted , upstream of the firefly luciferase gene , either the wild - type 3utr of nanog or a mutant variant containing the two point mutations predicted to abolish mir-181a * targeting ( figure 3b , bottom panel ) . transfecting the wild - type nanog 3utr reporter construct by itself or with the mir-181a * mimic into cd34 stem cells significantly reduced expression of luciferase ( figure 3c ) . transfecting mir-181a * inhibitor caused a significant reversal in suppression of luciferase expression indicating that binding of mir-181a * to the 3utr of nanog was suppressed thus allowing expression of the luciferase reporter . by contrast , transfection of the mutant nanog 3utr reporter alone or in combination with mir-181a * mimic or inhibitor had no repressive effect on expression of the luciferase reporter ( figure 3c ) . this is the first attempt to characterize mir-181a * in cd34 cells and we have identified nanog as its potential target . we performed mirna profiling on a subpopulation of adherent cd34 cells mobilized peripheral blood cells . using a 466 mirna chip , we compared the mirna signatures of adherent and nonadherent cd34 cells ( figure 1a ) . these two subpopulations of cd34 cells have previously been established as having distinct morphology , immunophenotype , and gene expression profile . moreover , the adherent cd34 cells display greater plasticity than the nonadherent population as they have the potential to express determinants specific to liver , pancreas , heart , muscle , and nerve cell differentiation . hierarchical clustering revealed eight unique mirna clusters that were differentially expressed in the adherent and nonadherent populations . this finding is not entirely surprising since the biological roles of mirnas are known to vary according to their expression in distinct cell populations in normal tissues . interestingly , there were several mirnas that have not been previously characterized for human in cluster 8 ( table 1 ) . we were particularly interested in the mirnas in cluster 8 because among the mirnas in this cluster , mir-181a * ( mir-181a-3p ) was highly upregulated and studies have also shown that the mir-181 family are associated with regulation of cd34 cells . however , the mrna targets are largely unknown . we did identify some conserved regions within the mature human mir-181 family of sequences which consist of mir-181a , mir-181b , mir-181c , and mir-181d ( figure 1b ) . we have taken the first step toward better understanding the role of mir-181a * in cd34 cells . higher alkaline phosphatase activity is generally associated with stem cells that are in a less differentiated state . we found increasing levels of alkaline phosphatase activity in cells transfected with mir-181a * inhibitor when compared to transfection with mir-181a * mimic ( figure 1c ) . the data raises the possibility that these stem cell population could be maintained in a less differentiated state by inhibiting mir-181a * expression . we next applied an in - house genomic - bioinformatics database to identify and validate potential candidate target messages for mir-181a*. being important factors in stem cell maintenance , the genomic loci of nanog , stat3 , hic1 , sox2 , hoxb4 , and pou5f1 ( oct4 ) were scanned for putative target sites that was complementary to the mir-181a * sequence ( 5-accaucgaccguugauuguacc-3 ) . specifically , the annotated 3 utr sequences of these genes were scanned for seed sites with perfect reverse - complementarity to mirna-181a seed sequence ( nucleotides 27 from the 5 end ) and sites with strong overall complementarity to mirna-181a . of the putative target genes , we discovered that mir-181a * formed the most stable base pairing at the nanog 3utr ( figure 2a ) . since nanog is an important regulator of stem cell maintenance and self - renewal , we determined whether mir-181a * targeted nanog transcripts . using endpoint reverse transcription - pcr ( rt - pcr ) ( figure 2b ) and quantitative rt - pcr ( figure 2c ) in transfected cd34 stem cells , we found that inhibiting mir-181a * significantly upregulates transcript levels of nanog . it has been reported that there exists a sensitive feedback loop that maintains the differentiation of stem cells through the control of essential stem cell genes such as nanog . this loop enables where by environmental or molecular cues to influence the expression levels of genes , leading to a binary decision to switch downstream differentiation genes on or off . the data raises the possibility that mir-181a * may be involved in directly regulating nanog expression in cd34 stem cells . to gain more insight into the functional interaction between mir-181a * and nanog mrna , we further interrogated the entire sequence alignment between the two rna molecules . we discovered a high degree of base pairing at the 3 region ( 7 nucleotides ) and a weak base pairing at the 5 seed site of mir-181a * ( figure 3a , top panel ) . in general most mirna target sites have a strong base pairing at the 5 seed site ( 78 nucleotides ) . however , the 5 seed site rule is not always the case and studies have shown that the 3 region of mirna also play an important role in targeting mrna but are rare events . in addition to the 3 sites , a recent report has identified another site called the centre site suggesting that mirna targeting is more complex and diverse . in our case , because the base pairing at the 5 seed site of mir-181a * was weak , we speculated that the strong complementarity pairing at the 3 region would compensate and may follow the 3-compensatory site rule similar to one of the earlier mirna that was discovered such as let-7 ( figure 3a , bottom panel ) . both mir-181a * and let-7 mirnas , in this setting show a very similar overall structural identity in the way they bind to their targets . to determine whether the 3 region of mir-181a * was important , we generated , using rnahybrid modeling , the most energy stable complementarity base pairing between mir-181a * and nanog 3 utr mrna ( figure 3b , top panel ) as well as determining the best mutations that would disrupt the 3 region base pairing . this was generated by replacing two bases at the 3utr of nanog ( figure 3b , bottom panel ) . to test this modeling we generated a dual - luciferase reporter construct for mir-181a * and nanog 3 utr mrna . we inserted , upstream of the firefly luciferase gene , either the wild - type 3utr of nanog or a mutant variant containing the two point mutations predicted to abolish mir-181a * targeting ( figure 3b , bottom panel ) . transfecting the wild - type nanog 3utr reporter construct by itself or with the mir-181a * mimic into cd34 stem cells significantly reduced expression of luciferase ( figure 3c ) . transfecting mir-181a * inhibitor caused a significant reversal in suppression of luciferase expression indicating that binding of mir-181a * to the 3utr of nanog was suppressed thus allowing expression of the luciferase reporter . by contrast , transfection of the mutant nanog 3utr reporter alone or in combination with mir-181a * mimic or inhibitor had no repressive effect on expression of the luciferase reporter ( figure 3c ) . this is the first attempt to characterize mir-181a * in cd34 cells and we have identified nanog as its potential target . understanding the cellular and molecular mechanisms responsible for the multi - pluripotency of stem cells will be critical for their practical use in therapy . micrornas have been shown to be important and necessary for proper stem cell regulation . in this study , we generated a mirna profile from a subpopulation of adherent cd34 cells isolated from g- colony - stimulating factor mobilized peripheral blood and demonstrated a marked difference in expression patterns for a small cluster of mirna . using bioinformatics , we identified nanog as a potential target for mir-181a*. interestingly , there have been works published regarding other potential targets for the mir-181 family . for example , mir-181b has been shown to be an important regulator of nuclear factor-b signaling in the vascular endothelium by targeting importin-3 . in another cell type , mir-181b has been shown to target tcl1 oncogene in chronic lymphocytic leukemia . similar to mir-181b , mir-181a also has several targets such as prox1 in lymphatic endothelial cells , c2h2 zinc - finger proteins , and multiple phosphatases such as shp2 , ptpn22 , dusp5 , and dusp6 . although mir-181a*s binding site within the 3utr of nanog displayed a weak canonical 5 mirna seed pairing , it also showed strong complementarity at the mirna 3 end and at the central ago2 catalytic site 1011 nucleotides from the 5 mirna site . importantly , by introducing two point mutations to disrupt the 3 and central complementary sites , we abolished mir-181a * regulation of a reporter construct containing the 3utr of nanog . our studies highlight a new stem cell - related target for the mir-181 family and show that mir-181a * directly targets nanog . the hematopoietic blood samples were obtained with informed patient consent and approved by the hammersmith hospital research ethics committee . samples of granulocyte - colony stimulating factor mobilized peripheral blood progenitor cells were processed by leukapheresis at the stem cell laboratory at the hammersmith hospital . briefly , human mobilized peripheral blood samples were diluted in a ratio of 1:4 in hanks'-buffered saline solution ( gibco , paisley , uk ) , the mononuclear cells were separated by centrifugation over a lymphoprep ( dundee , scotland ) density gradient at 1,800 rpm for 30 minutes . the mononuclear cell fraction at the interface was aspirated and washed twice with hanks'-buffered saline solution , and finally with macs buffer ( phosphate - buffered saline solution ) at ph 7.2 supplemented with 0.5% bovine serum albumin and 2 mmol / l edta ) . cd34 cells were isolated using a cd34 isolation kit ( miltenyi biotec , cologne , germany ) according to the manufacturer 's protocol . briefly , isolated cd34 cells were added to 24-well or 35-mm tissue - culture treated dishes ( nunc , roskilde , denmark ) at a density of 2.55 10 cells in -minimum essential medium to isolate the adherent cd34 cell population . after 30-minute incubation , nonadherent cells were removed and adherent cells were rinsed three times with phosphate - buffered saline or -minimum essential medium . the adherent cd34 cell population was grown in a serum - free medium ( cellgro ; cellgenix , freiburg , germany ) containing three cytokines : 250 ng / ml of stem cell factor , 250 ng / ml of interleukin-6 , and 250 ng / ml of interleukin-3 ( invitrogen , paisley , uk ) in 0.5% penicillin / streptomycin antibiotics . total viable cells were counted using the trypan exclusion assay . for the alkaline phosphatase assay , ~2.5 10 progenitor cells in 24-wells were transfected twice with the oligonucleotides at 100 nmol / l and the cells were harvested 72 hours later as described in the alkaline phosphatase assay kit ( cell biolabs , san diego , ca and millipore , billerica , ma ) . equal protein load at 100 g of protein was used for the assays and the reaction was measured after 1-hour incubation at 37 c at 405 adherent and nonadherent cells were added into a pcr tube and heat - treated at 95 c for 5 minutes . then the mirnas were reverse transcribed into cdnas by 460 mirna - specific stem - looped primers . then these mirna cdnas were amplified by 18 cycles of pcr by 460-specific forward primers and a universal reverse primer . finally , the cdnas were split and individual mirna was measured by taqman probe - directed real - time pcr . the pcr was done as following by ab7900 with 384-well plates : first , 95 c for 10 minutes to activate the taq polymerase . then 40 cycles of 95 c for 15 seconds ( for denaturation ) and 60 c for 1 minute ( for annealing and extension ) were performed . two independent allogenic donor samples were used in the analysis . in order to obtain sufficient total rnas , the mirna-181a * mimic and inhibitor were purchased from dharmacon , lafayette , co. the oligonucleotides were transfected ( at day 0 and again at 24 hours ) at 100 nmol / l into 1 10 adherent cd34 stem cells using nanofectamine reagent following the manufacturer 's recommendation ( paa , pasching , austria ) . total rna was harvested using the rnaqueous - micro kit ( ambion , paisley , uk ) 72 hours post - transfection . five hundred nanogram of total rna from each sample was reverse transcribed using the one - step rt - pcr kit from qiagen ( hilden , germany ) following the manufacturer 's recommendation . expression of human nanog was measured semiquantitatively by pcr using primer pair from r&d systems ( minneapolis , mn ) after 32 cycles at 94 c for 45 seconds . gapdh primers : forward ( 5gtgaaggtcggagtcaacg3 ) and reverse ( 5ggtgaagacgccagtggactc3 ) was used as a loading control after 30 cycles at 94 c for 45 seconds . the samples were separated on agarose gel and analyzed using uvp geldoc system ( uvp , upland , ca ) . four sets of band intensity across three independent experiments were used for semiquantitative analysis . for the quantitative real - time rt - pcr , 500 ng of total extracted rna ( as described above ) was processed for elimination of genomic dna followed by reverse transcription using the quantitect reverse transcription kit from qiagen . the first strand cdna synthesis was then amplified for quantitative analysis of human nanog ( nm_024865 ) and the reference gene , human gluceraldehyde-3-phosphate - dehydrogenase ( gapdh ) ( nm_002046 ) using quantifast sybr green pcr kit from qiagen . amplification was performed using applied biosystems 7900ht fast - real - time system with 40 cycle conditions at 95 c15 seconds and 60 c45 seconds with a total volume of 25 l per sample . sequence annotations and data were downloaded from version hg18 of the ucsc table browser 's refseq genes track . the genomic loci nanog , stat3 , hic1 , sox2 , hoxb4 , and pou5f1 ( oct4 ) were scanned for putative target sites for mir-181a * ( 5-accaucgaccguugauuguacc-3 ) . more specifically , the genes ' annotated 3 utr sequences were scanned for ( i ) seed sites with perfect reverse - complementarity to the oligonucleotide 's seed sequence ( nucleotides 27 from the 5 end ) and ( ii ) sites with strong overall complimentarily to the oligonucleotide . such sites could be target sites for mirna - like translational suppression and mrna degradation , and small interfering rna - like mrna cleavage . the former scan used a custom python script , whereas the second scan used rnahybrid with default parameter settings to evaluate potential hybridization between the oligo and target sequence . none of the five genes ' 3 utrs contained mirna - like seed sites for the oligonucleotide . of the sites that formed the most stable interactions with the oligonucleotide , the nanog site was the most stable site that contained paired bases at the putative ago2 cleavage site . the ago2 cleavage site would presumably be between nucleotides 10 and 11 from the 5 end . nanog 3 utr was amplified from hela genomic dna by nested pcr using two different forward primers and a single reverse primer ( primers are listed below ) . for both pcrs , 50 l sample volumes were prepared using 0.3 mol / l each of forward and reverse primers , 1 accuprime pfx reaction mix ( invitrogen ) , and 1.0 unit of accuprime pfx dna polymerase ( invitrogen ) . one hundred nanogram of genomic dna and 0.5 l of pcr product were used as templates in the first and the second pcr , respectively . the forward 2 and the reverse primers each contained two restriction enzyme cut sites ; xhoi and sgfi for forward 2 and noti and ecori for reverse . the nanog 3 utr construct was cloned into the psicheck 2.2 vector ( promega , madison , wi ) , using the unique restriction enzyme cut sites for noti and xhoi . two point mutations were inserted in the nanog 3utr target site of hsa - mir-181a * using two mutagenic primers and psicheck 2.2 with nanog 3 utr insert as template . a 25.5 l pcr sample volume was prepared using 10 ng of template , 0.5 mol / l of each primer , 1 reaction buffer ( agilent technologies , santa clara , ca ) , dntp mix ( 0.2 mol / l each , finnzymes ) , and 1.25 units of pfuturbo dna polymerase ( stratagene ) . sequence of mutated hsa - mir-181a * target site ( mutations in bold and underlined ) : gtgaagtggcgaggtcttggc . list of primer sequences : forward 1 , agcaaccagacccagaacatccag ; forward 2,gcgatcgctcgagagatgagtgaaactgatattactcaatttcagtctgg;reverse , gaattcgcggccgcatgtttaagctgtatatttactcattgaaacactcgg ; psicheck , aggacgctccagatgaaatg ; nanog seq , tcactgcaagctccgtctcc ; rev psicheck , caaaccctaaccaccgctta ; nanog mut fr , ggctggagtgaagtggcgaggtcttggctc ; nanog mut rev , gagccaagacctcgccacttcactccagcc . for the reporter luciferase reporter assay , 100 nmol / l of mir181a * mimic or its inhibitor ( dharmacon ) were transfected into cd34 progenitor cells ( 2.5 10 cells / well ) in a 24-well plate for 24 hours . the nanog 3utr wild - type or mutant with two point mutations was cloned downstream of the renilla translational stop codon in psicheck-2 vector ( promega ) . 100 ng of the 3-utr - nanog ( 3-utr - nanog - psi - check-2 ) or its mutated variant was cotransfected into the cells pre - conditioned with mir181a * mimic or inhibitor for further 24 hours before harvesting . empty ( psicheck-2 ) vector was used for normalization and 3-utr - nanog alone was used as a control . renilla and firefly luciferase assay was carried out using the dual - luciferase reporter assay system ( promega ) . readings were measured the victor plate reader ( waltham , ma ) ( perkin - elmer victor ) . statistical analysis .
exploiting the properties of stem cells by microrna ( mirna ) profiling offers an attractive approach to identify new regulators of stem cell fate . although numerous mirna have been screened from hematopoietic stem cells ( hsc ) , the targets corresponding to many of these mirna have not yet been fully elucidated . by mirna profiling in a subpopulation of cd34 + cells isolated from peripheral blood , we have identified eight clusters of mirna that were differentially expressed . further analysis of one of the clusters by bioinformatics revealed that a mirna , mir-181a * , which is highly expressed in the adherent cd34 + cells , affects the expression levels of nanog , a stem cell surrogate marker . we show specifically by reporter assay and mutational analysis that mir-181a * targets a seedless 3 compensatory site in the 3utr of nanog and affects gene expression . we demonstrate that inhibiting mir-181a * upregulates the nanog expression level , in addition to an increase in alkaline phosphatase activity . our studies suggest that mir-181a * may be important in controlling the expression level of nanog in a subpopulation of cd34 + cells .
development and differentiation are characterized by genetic circuitry or gene regulatory networks ( grns ) that have inherent forward momentum encoded by a number of regulatory motifs ( davidson , 2010 ) . to self - renew and maintain differentiation potential , stem cells must structure their grns so as to arrest or buffer this forward trajectory . networks at early multipotent stages may bear little relation to those of mature differentiated cells , making comparison between them difficult . detailed time - series data are useful in this regard ( bruno et al . , 2004 ; may et al . , 2013 ) , but there is likely substantial asynchrony between individual cells at any given time point . cells also may undergo lineage commitment through different initial gene expression trajectories ( pina et al . , 2012 ) . together , these factors can confound attempts to infer network architectures and gain molecular insights into commitment and subsequent lineage specification from averaged gene expression profiles . analysis of gene expression in single cells offers a different approach that , in principle , makes use of cellular heterogeneity as a source of variation for establishing gene - gene associations . 2013 , 2015 ) or inferred pairwise gene associations using only co - expressing cells ( sthlberg et al . , 2011 ) . it has been suggested that levels of expression are better accounted for in cells that co - express both genes , and may be obscured by presence / absence effects when all cells are considered ( rusnakova et al . , 2013 ) . we have tried to address this constraint in our exploration of gene expression networks around the erythroid versus myelo - monocytic lineage choice of multipotent hematopoietic progenitor cells . additionally , we have focused on capturing networks from closely related cells in the vicinity of the commitment boundary , to gain insight into the evolution of grns relevant to lineage specification . the erythro - myeloid bifurcation is an intensively studied paradigm , and both transcription factors ( tfs ) and regulatory motifs involved in physiological transcriptional programming of these alternative fates have been described ( wolff and humeniuk , 2013 ) . key players include gata factors , the ets family protein pu.1 , and c / ebp family members , whose potency has been demonstrated in the experimental reprogramming of blood lineages ( graf and enver , 2009 ) . we used two distinct cell commitment scenarios to obtain high resolution around the early phase of commitment and lineage specification . first , we identified and prospectively isolated cells spontaneously committing to both lineages under culture conditions that maintain self - renewing ( sr ) cells and lack pro - differentiative cytokines . second , we used inducible variants of the lineage - affiliated tfs gata1 and pu.1 to drive cells into lineage specification , again in the absence of pro - differentiative cytokines . this approach allows timed sampling after instigation of a discrete lineage trigger , and it may provide a more homogeneous molecular entry into commitment and lineage development . we describe state - distinct networks in multipotent and early lineage - committed cells and , in particular , highlight the existence of lineage - conflicting programs at the emergence of lineage choice . we further identify an axis involved in lineage specification that includes gata2 and ddit3 , a c / ebp family member previously implicated in stress response ( zinszner et al . , 1998 ) and described as a potential target of erythropoietin signaling in erythro - leukemic cell lines ( coutts et al . , 1999 ) . we have explored commitment in the non - transformed bone marrow ( bm)-derived hematopoietic multipotent cell line fdcpmix . fdcpmix is karyotypically normal , il-3 dependent , and capable of multilineage differentiation in response to the appropriate environmental cues . under maintenance culture conditions , sr and lineage - committed cells ( erythroid- or myeloid - committed progenitors [ ecps or mcps ] ) co - exist in culture ( figure 1a ) and can be isolated on the basis of their surface phenotype ( figure 1b ) . sr cells are kit+gr1 cells ( figure 1b ) with proliferative capacity in bulk and clonal cultures ( figures s1a and s1b ) and are uniquely able to faithfully reconstitute the cellular heterogeneity observed in maintenance cultures ( figure s1c ) . lineage - committed cells devoid of sr potential are gr1 + mcps , with an early myeloid morphology ( figure s1d ) and no erythroid differentiation capacity ( figure s1e ) , and kitgr1 ecps , with accelerated erythroid differentiation ( figure s1e ) but minimal or no contribution to neutrophil cultures ( figure s1f ) . the transcriptional signatures of sr , mcp , and ecp compartments are readily distinct ( figure s1 g ) and confirm their lineage affiliation ( table s1 ) . we next explored cellular heterogeneity within these cell compartments using single - cell multiplex qrt - pcr . the results showed substantial cell - to - cell heterogeneity ( figure 1c ) and overlap ( figure 1f ) within and among all three compartments ; nevertheless , the compartments may be robustly identified using single and dual - gene classifiers ( table s1 ) . the transcriptional heterogeneity observed within individual populations may highlight the capture of multiple contemporaneous molecular programs underlying lineage commitment under self - renewal conditions . since tfs are potent instigators of lineage determination or reprogramming , we next examined cellular and transcriptional heterogeneity in fdcpmix cells driven to erythroid or myeloid lineages through expression of inducible gata1 or pu.1 estrogen receptor fusions , respectively ( figure s1h ) . we analyzed the transcriptional programs of single cells captured at various time points ( figure s1i ) after induction . in parallel , we studied the temporal dynamics of lineage commitment in this setting and functionally tested their commitment status by evaluating the following : ( 1 ) their retention of self - renewal potential , i.e. , their capacity to re - initiate maintenance cultures ; and ( 2 ) their lineage potential in response to various cytokine cues . this experimental design affords a dynamic appreciation of cellular and molecular mechanisms employed in lineage specification . activation of gata1 in sr cells led to phenotypic changes at as early as 46 hr ( figure 1d ) , accompanied by the loss of neutrophil potential ( at 6 hr ) and followed by the loss of sr capacity ( at 45 hr ) ( figure 1e ) . enforced pu.1 activity resulted in the loss of clonogenic sr potential and elicited a myeloid differentiation bias in a more extended time frame ( figures s1j and s1k ) . single - cell transcriptional profiling during tf - driven commitment confirmed the lineage identity of the cells obtained , which broadly separated away from the sr state along erythroid ( gata1 ) and myeloid ( pu.1 ) axes ( figure 1f ) . gata1-driven cells co - occupied the same transcriptional space as ecp cells and showed a similar extent of cell - to - cell variation . in contrast , pu.1-driven cells , while similarly heterogeneous to mcps , appeared to occupy a distinct territory ( data not shown ) . this presumably reflects the neutrophilic status of mcps and a monocytic bias of pu.1-ert - differentiated cells , consistent with prior reports of pu.1-driven cell fate ( laslo et al . , 2006 ) . we exploited the heterogeneity of cells at early stages of spontaneous and tf - driven lineage commitment to explore the transcriptional networks controlling lineage specification . inspection of patterns of expression for individual genes revealed a fraction of cells in which the gene is off , and a fraction of cells expressing the gene to varying levels ( on ) ( figure 2a ) . the on / off status can be described as binary while the distribution of on values represents a continuous component of the data . thus , for any given gene pair , both binary and continuous relationships are possible ; this is exemplified for gata1 and epor in figure 2b . methodologically , we used odds ratio ( or ) to quantify on / off gene - to - gene associations ( figure 2c ) and spearman rank correlation to measure correlations between gene expression levels ( figure 2d ) . we combined gene associations obtained by both methodologies to infer putative regulatory networks characterizing sr states and the different modes of lineage commitment ( figure 2e ) . at coarse grain , the networks revealed increased connectivity in the lineage - committed compared to the sr state . also , commitment appeared associated with a higher frequency of negative associations between genes ( figures 2f and s2a ) , including known lineage - determining factors ( table s1 ) . while this may be , to some extent , a function of the genes analyzed , it also may reflect mechanistically distinct processes governing acquisition of lineage identity versus exit from self - renewal . negative associations are less prominent in the full - activation time courses of tf - driven commitment , as the networks capture not only the early processes of lineage specification , but also the later consolidation of the differentiation program . in contrast , detailed temporal analysis of gata1-ert - driven lineage specification revealed that cross - antagonistic associations between lineage determinants peak at 6 hr ( figure 2 g ) , coincident with early loss of neutrophil differentiation potential ( figure 1e ) en route to lineage commitment , suggesting that resolution of lineage conflicts is an early step in acquisition of lineage identity . in this respect , ddit3 emerges as an interesting candidate in lineage cross - antagonism : it is positively associated with gata2 , both in sr and committed cells ( figure s2b ) , and negatively associated with the neutrophil determinant cebpa , either directly or through gata2 , in mcps and at early stages of erythroid lineage commitment ( figure s2b ; table s1 ) . since ddit3 has not previously been tabled as a central regulator of erythro - myeloid lineage specification , we functionally tested its impact in loss- and gain - of - function experiments . knockdown of ddit3 ( figures s3a and s3b ) in fdcpmix cells resulted in the loss of erythroid and mixed - lineage colonies , with no change to myelo - monocytic potential ( figure 3a ) . the same loss of erythroid potential in colony - forming assays was observed in stem and progenitor cells ( kls ) from mouse bm upon knockdown ( figure 3b ) and constitutive knockout ( figure 3c ) of ddit3 expression . the data are compatible with a requirement for ddit3 in the erythroid lineage , while it is dispensable for the development of the myeloid lineage . the negative association observed between ddit3 and cebpa in inferred transcriptional networks from early stages of lineage specification ( figures 2e and s2b ; we tested this in myeloid - committed granulo - monocytic progenitors ( gmps ) by enforcing ddit3 expression ( figure s3c ) , resulting in a transient re - acquisition of self - renewal potential ( figure 3d ) and a dramatic change in the nature of the colonies obtained ( figure 3e ) , with the predominance of large gm colonies of immature appearance ( figure 3f ) . cells in these colonies expressed immature surface markers and were predominantly lineage - negative kit+cd34+cd16/32 + , thus presenting an essentially gmp phenotype albeit with variable levels of sca1 expression ; in contrast , cells in control colonies exhibited a differentiated gr1+mac1 + phenotype ( data not shown ) . taken together , the data suggest that ectopic expression of ddit3 in gmps blocks lineage progression and transiently re - activates self - renewal capacity . we used single - cell gene expression profiling of gmps , either wild - type or transduced with a control vector or a ddit3-expressing lentivirus , to interrogate the transcriptional program changes imposed by enforced expression of ddit3 and to inspect its role in remodeling of the transcriptional networks underlying lineage progression and/or identity . enforcement of ddit3 changed the expression of two - thirds of genes ( figures s3d and s3e ) predicted as its neighbors in our inferred transcriptional networks ( figure s2b ) , attesting to the robustness of our inference approach . principal component analysis ( pca ) of the populations of individual wild - type and transduced gmp cells separated ddit3-expressing cells from controls ( figure 3 g ) . this separation is mostly attributable to the increased expression of early erythroid regulators gata2 , tal1 , zfpm1/fog1 , and gfi1b and the relative loss of m , gm , and g - csf receptors ( csf1r , csf2ra , and csf3r , respectively ) as well as of c / ebp family members ( figure 3h ) . the relative gain in the expression of erythroid - affiliated genes and loss of myeloid csf receptors and c / ebp family tfs further developed with prolonged expression of ddit3 in gmps under differentiation conditions that support multilineage output ( figures s3f and s3 g ) . these data confirm ddit3 as a positive regulator of erythroid lineage specification at the expense of myeloid fate , providing an experimental validation of the predictive power of the networks we derived by analyzing the heterogeneity of single cells undergoing lineage specification . we next asked if the relative gain in importance of erythroid - affiliated regulators in ddit3-transduced gmps was associated with a global remodeling of the transcriptional networks underlying gmp lineage identity . indeed , we observed an overall loss in network connectivity specific to the activity of ddit3 ( figure 4a ) moreover , there was a relative gain in connectivity of gata2 at the expense of myeloid hubs , as quantified in figure s4a . for a broader appreciation of the transcriptional changes induced by ddit3 , we performed rna sequencing ( rna - seq ) . gmps transduced with ddit3 or control vector ( csiem ) were cultured for up to 5 days under conditions supportive of multilineage output . similarly to cells obtained from colony - forming assays , ddit3-transduced cells retained a gmp - like phenotype , while control cells acquired differentiated myeloid surface markers ( figure s4b ) . the global transcriptional profiles of cells with enforced expression of ddit3 ( figure s4c ) were clearly distinct from control - transduced and wild - type gmps . gene set enrichment analysis ( gsea ) showed that ddit3 expression is associated with global loss of gmp programs and concomitant upregulation of meg - e - affiliated signatures ( figure 4b ) . interestingly , signatures representative of pre - gm cells , the developmental precursors of gmps ( figure 4c ) , also were upregulated ( figure 4b ) . these data suggest that ddit3 acts through the development or stabilization of a more primitive precursor with inherent meg - e potential ( figure 4c ) . analysis of the networks derived from wild - type gmps ( figure s4d ) as well as ddit3-transduced cells exposed to conditions supportive of multilineage output for 2 days ( figure 4a ) revealed increased importance of specific erythroid versus myeloid regulatory nodes . given the association of gata2 and ddit3 seen in our network analysis of lineage commitment ( figure 2e ) and the increase in activity of gata2 as a hub in ddit3-transduced gmps ( figure 4d ) , we explored the behavior of gata2 target genes , previously identified by chromatin immunoprecipitation sequencing ( chip - seq ) in fdcpmix ( may et al . , 2013 ) , in response to ddit3 expression . gsea on the rna - seq data from ddit3 and control vector - transduced cells provided evidence for a coincidence of gata2 and ddit3-driven gene expression programs ( figure 4e ) . to further explore the ddit3-gata2 axis in lineage specification , we focused on gene expression programs resident in those single cells that co - expressed the two genes , and derived networks from multipotent and lineage - committed compartments ( table s1 ) . within the ecp compartment , this analysis revealed the following : ( 1 ) an association between the two genes that was not seen when cells were used irrespective of ddit3/gata2 status , and ( 2 ) the involvement of both these genes in anti - correlations with myeloid - affiliated regulators . a similar picture now also emerges in multipotent cells , highlighting the gains in network information obtainable from interrogating single cells selected on the basis of specific co - expression patterns . our analysis of cells in the vicinity of commitment highlights the existence of lineage - conflicting programs at the emergence of lineage choice , and it identifies the importance of a ddit3-gata2 axis in this process . in revealing this association , it was instrumental that our network inference approach acknowledged and took account of both binary and continuous components of single - cell gene expression . as such , we captured both on / off relationships and the associations seen between distributions of on expression levels in co - expressing cells . furthermore , having established potentially interesting associations , we zoomed in on single cells where the associations were present to refine their specific network identity . in the case of ddit3-gata2 , this supported the importance of cross - antagonistic interactions in lineage decisions . while in principle this approach can be applied to any gene - gene interaction in an unsupervised manner , it would require profiling of considerably higher numbers of individual cells to ensure statistical robustness and systematically explore all possible interactions . to validate our inferred networks , we elected to experimentally test the predicted role of ddit3 in erythroid lineage specification . functional experiments revealed an early erythroid effect from ddit3 loss of function produced by knockdown or genetic knockout . however , we note that the constitutive ddit3 knockout mice used in this study did not display any discernible erythroid defect ( c.f . , unpublished data ) . thus , lineage - determining networks may be robust to ddit3 deletion or constitutive deletion may be compensated during development . forced ddit3 expression does promote erythroid programming , highlighting a potential role for the ddit3 node in early development of the erythroid lineage . previous reports of ddit3 function in late differentiation of erythro - leukemic cells ( coutts et al . , 1999 ) interestingly , our inspection of cfu - e potential in mouse bm stem and erythroid progenitor compartments upon ddit3 ablation did not reveal a late erythroid defect ( c.f . , unpublished data ) . the capacity of tfs to re - program cells has been used as a test of their lineage - determining capacity . in the case of gata1 , its introduction into gmps results in the expression of erythroid potential with the appearance of large blast - like multipotential colonies in vitro ( heyworth et al . , 2002 ) . molecular analysis suggests that ddit3-enforced expression in gmps leads to expression of erythroid - affiliated genes and an overall transcriptional state similar to that of pre - gm , the precursors of gmps . one may presume that since pre - gm cells lie upstream of gmps their transcriptional programs should have diverged less from multipotent cells that retain both gm and e potential . this would explain the e signatures seen in ddit3-expressing gmps . by which cellular mechanism does ddit3 effect these changes ? one possibility is that rare pre - gms exist within prospectively isolated gmp populations and that these are preferentially selected for by ddit3 . this seems unlikely , given the kinetics of the changes in cells and gene expression observed . alternatively , ddit3 may regulate a subset of the erythroid program that is simply overlaid on the existing gmp program , resulting in a mixed - lineage program that is reminiscent of pre - gm cells . in such a model , ddit3 effects a pre - gm state from gmps , recapitulating its physiological role in lineage programming . recently , nerlov and colleagues have suggested that high levels of erythropoietin ( epo ) may have instructive effects on lineage specification in vivo ( grover et al . , 2014 ) , and interestingly ddit3 has been suggested as a target of epo signaling in erythro - leukemic cells ( coutts et al . , 1999 ) . the strong network association observed between ddit3 and gata2 may indicate that ddit3 acts on an early erythroid signature primed by gata2 in cells of mixed - lineage potential ( may et al . , 2013 ) and present in the pre - gm state . elements of this signature may be required for erythroid lineage progression and , thus , explain the erythroid defect observed upon ddit3 loss of function . it is interesting to speculate as to the existence of cross - antagonistic interactions between gata2-centered networks and c / ebp - driven myeloid programs putatively effected through ddit3 . ddit3 heterodimerizes with c / ebp family members to form complexes that can not bind dna , thus blocking activation of c / ebp - driven programs , a mechanism that has been described to block differentiation in mesenchymal lineages ( han et al . , 2013 ; shirakawa et al . , 2006 ) . a combination of ddit3 structure - function mutant studies and direct investigation of gata2 and c / ebp dna binding in ddit3-expressing gmps will contribute to clarifying dislodgement of c / ebp complexes from their target genes as a putative mechanism of gmp lineage remodeling . b6.129s - ddit3tm1dron / j ( ddit3 ko ) mice ( jackson immunoresearch laboratories ) and c57bl/6 mice were maintained in the john radcliffe hospital and cr - uk london research institute animal facilities in accordance with home office regulations . fdcpmix culture conditions , lentiviral transductions with gata1-ert and pu.1-ert constructs , and tamoxifen activation were performed as described previously ( may et al . , 2013 ) . lentiviral transductions of fdcpmix cells with ddit3-small hairpin rna ( shrna ) were performed under maintenance culture conditions ; transductions of primary bm cells were performed in serum - free expansion medium ( sfem ) ( stemcell technologies ) supplemented with mouse stem cell factor ( scf ) and flt3l ( 50 ng / ml ) . , gfp gmps were cultured for up to 5 days in iscove s modified dulbecco s medium ( imdm ) + 10% fetal calf serum ( fcs ) supplemented with mouse scf ( 50 ng / ml ) , mouse il-3 and il-6 ( 10 ng / ml ) , and human recombinant erythropoietin ( eprex , 10 u / ml ) . colony - forming cell ( cfc ) assays used m3234 supplemented with rat scf ( 100 ng / ml ) ; mouse il-3 ( 0.01 ng / ml ) and eprex ( 10 u / ml ) ( fdcpmix ) ; and m3434 or m3234 supplemented with mouse scf ( 100 ng / ml ) , mouse il-3 , il-11 , gm - csf , and tpo ( 10 ng / ml ) , and eprex ( 10 u / ml ) . all mouse cytokines were from peprotech and cfc media were from stemcell technologies . transcriptional profiling of up to 48 genes in individual cells was performed on a fluidigm platform and the data retrieved and quality - controlled as described previously ( teles et al . , 2014 ) . the ct values were calculated to the mean of the three control genes utilized . heatmap representation of z score - normalized ct values was performed in genesis ; pca plots used the statistical toolbox in matlab ( mathworks ) . single - cell gene expression data were linearly transformed as described previously ( teles et al . , 2013 ) . logistic regression linear classifiers were used to infer the best predictor genes in the separation between two cell populations ( teles et al . , 2013 ) . single - cell transcriptional networks were inferred by calculating significant pairwise associations using both continuous ( spearman rank correlations ) and binary ( or ) components of linearly transformed expression data . spearman rank correlations were calculated between all pairs of genes co - expressed by a minimum of ten cells in a given population . correlation coefficients > 0.4 with p < 0.01 were considered to be significant . or and respective 95% confidence intervals ( cis ) were calculated based on presence / absence patterns of expression for all pairs of genes in a given population . significant positive and negative associations were called when lower95ci > 1 and upper95ci < 1 , respectively . network representations of significant pairwise associations in both methods were produced using cytoscape ( smoot et al . t.e . supervised the project . c. pina and t.e . wrote the paper with input from j.t .
summarywe explore cell heterogeneity during spontaneous and transcription - factor - driven commitment for network inference in hematopoiesis . since individual genes display discrete off states or a distribution of on levels , we compute and combine pairwise gene associations from binary and continuous components of gene expression in single cells . ddit3 emerges as a regulatory node with positive linkage to erythroid regulators and negative association with myeloid determinants . ddit3 loss impairs erythroid colony output from multipotent cells , while forcing ddit3 in granulo - monocytic progenitors ( gmps ) enhances self - renewal and impedes differentiation . network analysis of ddit3-transduced gmps reveals uncoupling of myeloid networks and strengthening of erythroid linkages . rna sequencing suggests that ddit3 acts through development or stabilization of a precursor upstream of gmps with inherent meg - e potential . the enrichment of gata2 target genes in ddit3-dependent transcriptional responses suggests that ddit3 functions in an erythroid transcriptional network nucleated by gata2 .
a 28-year - old female born out of a second - degree consanguineous marriage presented with a gradual onset of decrease in vision in both eyes for 5 years . the patient was alright till the age of 10 years , when she developed skin changes , failure to gain weight , and had oligomenorrhea and irregular menses . she was on treatment for diabetes mellitus , high lipid profile and hypothyroidism , which developed as a consequence of radiotherapy for thyroid enlargement . , she had a short stature ( 134 cm ) , weighed 25 kg , looked emaciated , had gray , sparse scalp hair , bird - like facies , hoarse voice , thinned , hyperpigmented skin and lean arms and legs [ fig . ( a ) external photograph of a 28-year - old patient with ws with bilateral cataracts , emaciated look , gray sparse scalp hair , a bird - like facies , thin hyperpigmented skin ; ( b ) external photograph showing short stature and lean arms and legs on ophthalmic examination , best corrected visual acuity was 20/60 , n12 in the right eye ( re ) and counting fingers 6 ft , n36 in the left eye ( le ) . slit - lamp examination showed nuclear sclerosis grade 2 in the re and total cataract in the le . she underwent a clear corneal phacoemulsification with hydrophilic foldable intraocular lens ( iol ) implantation in the le under peribulbar anesthesia . intraoperatively , a thick posterior capsular calcified plaque was noticed which could not be removed by peeling with a 26 g needle . primary posterior capsulotomy ( ppc ) was avoided for the fear of inducing cystoid macular edema ( cme ) . after iol implantation , the corneal tunnel and side ports were closed with 10/0 nylon suture . postoperatively , the patient was started on ketorolac tromethamine ophthalmic solution 0.4% four times daily and gatifloxacin eye drops 0.3% four times daily . the patient was started on a weak steroid ( fluorometholone eye drops ) twice daily for a week on the 4th postoperative day because of the increased anterior chamber reaction . on subsequent visits , the eye was quiet . at 1 month , the best corrected visual acuity was 20/40 n12 . she was operated in the re 6 months after the first cataract surgery with similar precautions . yag capsulotomy was done 4 months from the date of surgery in le [ fig . ( a ) slit - lamp photograph of the le showing pseudophakia with posterior capsular plaque ; ( b ) slit - lamp photograph of the le showing pseudophakia after yag laser capsulotomy preoperative , postoperative and post yag capsulotomy endothelial cell counts about 1300 cases have been reported around the world from 1916 to 2002 , including about 1000 japanese patients . the international registry of ws ( www.wernersyndrome.org ) uses the above findings [ table 2 ] to establish a definite , probable , or a definitive diagnosis requires all the cardinal signs and two signs from other signs . our patient had all the cardinal signs and two others ( diabetes mellitus , hoarse voice ) , thus satisfying the criteria for a definitive diagnosis . showing clinical features of ws cataract is one of the typical ocular manifestations of ws . corneal decompensation occurred in 8 of the 18 eyes of patients with ws after cataract surgery when surgery was done by intracapsular or conventional extracapsular surgery . decreased endothelial function in ws is due to prematurely aged cornea the more recent studies in which cataract surgery was done by phacoemulsification show that it can be done safely without an increased rate of complications . in this patient , cataract surgery was done by phacoemulsification with the following precautions : ( 1 ) small incision size of 2.8 mm ; ( 2 ) liberal use of sodium hyaluronate 1.4% to protect the corneal endothelium ; ( 3 ) closure of the corneal tunnel and side ports using 10/0 nylon suture to prevent wound dehiscence ( impaired wound healing is a feature of ws ) ; ( 4 ) weak steroids were used postoperatively so as not to suppress fibroblast proliferation . decreased fibroblast proliferation rate has been proved by cell culture in ws and could be the cause for impaired wound healing . endothelial count in le , 4 months post surgery , showed a 7% ( 141 cells / mm ) reduction and , in re , 2 months post surgery , showed a 5% ( 110 cells / mm ) reduction which falls within the normal range . studies report endothelial cell loss rates from 4% to 15% after phacoemulsification by experienced surgeons . ppc was avoided as the incidence of cme after ppc was higher than without it . a study carried out by allan r. slomovic gives a cell loss of 2.3% after yag capsulotomy . in our patient , the cell count showed a 0.48% ( 9 cells / mm ) reduction , 4 months after yag capsulotomy . there was no change in the morphology of the cells . in case of ws with an already compromised cornea , we expected the cell loss to be more than the expected . the last follow - up 15 months postoperatively in the le and 9 months postoperatively in the re showed an 8.6% ( 174 cells / mm ) decrease in cells in le and 7.3% ( 160 cells / mm ) decrease in re , which is within the normal range of cell loss . we conclude that short - term results after cataract surgery and yag capsulotomy were excellent with modern microsurgical techniques in a patient with ws . through this case , we want to highlight that ws should be kept in mind when operating on any patient with features of premature aging and special precautions should be taken when doing the cataract surgery .
werner 's syndrome ( ws ) is a rare autosomal recessive disorder with multisystem manifestations of premature aging from the second decade of life . cataract is one of the features of ws . cataract surgery is complicated with postoperative wound dehiscence and bullous keratopathy when the surgery is done by intracapsular or conventional extracapsular method . we report the short - term result of phacoemulsification and neodymimum yettrium - aluminum - garnet laser ( nd yag ) capsulotomy in a case of ws with bilateral cataracts . postoperatively and post capsulotomy , there was no change in the endothelial cell morphology . there was an 8.6% decrease in endothelial cell count at the end of 15 months postoperatively and 11 months post yag capsulotomy . this decrease is within the acceptable range of cell loss after phacoemulsification and yag capsulotomy . to the best of our knowledge , this is the first reported case of yag laser capsulotomy in ws .
researchers have recently developed neuroimaging technologies that provide us with powerful tools to better understand the complexity of human brain behavior relationships with the goal of discovering and developing novel , safe , effective and personalized therapeutics to treat brain disorders . recognizing the potential of these new tools for advancing clinical neuroscience , the european union and united states launched the human brain project and brain research through advancing innovative neurotechnologies ( brain ) initiatives with estimated budgets of $ 1.3 billion and $ 4.5 billion in research support , respectively , to accelerate the development of such neurotechnologies ( brain , 2013 ; kandel et al . , 2013 ) . at the leading edge of neuroimaging technology development is real time functional magnetic resonance imaging ( rtfmri ) , which allows a non - invasive view of brain function2 in vivo and in real time3 . rtfmri has the potential to be used as a clinical neuroimaging tool in diagnosis , monitoring of disease , tracking of therapeutic response , and uniquely , in treatment itself via rtfmri neurofeedback . rtfmri neurofeedback is an application of this technology that can be used to assess and/or alter patterns of brain activity associated with cognition or behavior while an individual is inside the mri scanner in real time ( birbaumer et al . , 2009 ; the therapeutic potential for this approach lies in its ability to alter neural plasticity and learned behavior to modify brain function to optimize and/or restore healthy cognition and behavior . brain structure and function are modified in response to changes within and outside the central nervous system via both normal and disordered processes ( kolb et al . , 2010 ) . compared to standard fmri experiments in which behavior is manipulated and subsequent changes in brain activity are measured , rtfmri switches the direction of the relationship between brain and behavior so that we can determine if directly changing brain function leads to changes in behavioral or experiential outcomes ( weiskopf , 2012 ) . this approach of facilitating specific changes in brain function to produce changes in cognition , experience , or behavior is theorized to occur by skill learning ( birbaumer et al . , 2013 ) and the acceleration and optimization of systems - level neuroplasticity ( sagi et al . , 2012 ) , as has been observed with other brain - based training protocols ( anguera et al . , 2013 ) . other neurotherapeutic technologies , including electroconvulsive therapy , vagus nerve stimulation , deep brain stimulation , and transcranial magnetic stimulation or transcranial direct current stimulation , are also being used or investigated for the treatment of brain disorders and may also produce clinical change via altered neuroplasticity . each of these technologies has potential benefits and may also be limited by constraints in spatial resolution or by their invasive nature . neurofeedback is a training method in which real time information about changes in neural activity is provided to an individual to facilitate learned self - regulation of this neural activity to produce changes in brain function , cognition , or behavior . the earliest studies of neurofeedback employed electroencephalography ( eeg ) and demonstrated feedback - related changes in electrical brain activity and related behavior and cognition in humans ( keizer et al . , 2010 ; kouijzer et al . , 2009 ; 2011 ) and other animals ( philippens and vanwersch , 2010 ; schafer and moore , 2011 ; sterman et al . , 1969 ) . brain change after eeg neurofeedback has been shown using eeg and event related potentials ( egner and gruzelier , 2001 ; kropotov et al . , 2005 ) . likewise , changes in fmri response after eeg neurofeedback have been shown in targeted neural networks after a single 30-minute eeg training session ( ros et al . , 2013 ) and in specific symptom - related brain regions of interest ( rois ) after multiple training sessions ( levesque et al . , 2006 there have been several randomized controlled trials ( rcts ) using eeg - based feedback , primarily in patients with attention deficit hyperactivity disorder ( adhd ) ( hirshberg et al . , a recent meta - analysis of existing rcts indicates that eeg feedback training is associated with a reduction of adhd symptoms with a large effect size ( arns et al . , 2009 ) and a large randomized , sham - controlled trial is currently underway ( lh , personal communication ) . however , while eeg has superior temporal resolution compared to standard fmri , poor spatial resolution including the so - called inverse problem ( grech et al . , 2008 ) limits the clinical utility of eeg . by contrast , rtfmri can be used to target brain regions and networks with improved anatomical precision beyond eeg and improved temporal resolution beyond standard block design fmri . finally , rtfmri and eeg neurofeedback can be used simultaneously to take advantage of the spatial resolution of fmri and the temporal resolution of eeg with the hope that this combined approach will lead to more efficient neuroadaptive changes and more effective clinical outcomes ( zotev et al . , 2014 ) . rtfmri was developed in 1995 ( cox et al . , 1995 ) , and proof - of - concept for rtfmri as a potential neurotherapeutic tool for the treatment of brain disorders was demonstrated in 2005 ( decharms et al . , 2005 ) . there have since been substantial advancements related to rtfmri technology and implementation ( hinds et al . , 2011 ; laconte , 2011 ; weiskopf et al . , 2005 ) , with reports of rtfmri modification of function in several brain structures . although rtfmri has multiple potential applications as a clinical neuroimaging tool , the research to date has been focused on the use of rtfmri neurofeedback to alter brain function and behavior . from this research , several groups have reported successful application of rtfmri to modify cognitive and behavioral processes relevant for the treatment of clinical disorders ( for review of these studies see birbaumer et al . , 2009 ; caria et al . , 2012 ; chapin et al . , 2012 ; decharms , 2007 ; decharms , 2008 ; sulzer et al . studies have demonstrated promise of rtfmri neurofeedback in the treatment of chronic pain ( decharms et al . , 2005 ) , tinnitus ( haller et al . , 2010 ) , stroke ( sitaram et al . , 2012 ) , depression ( linden et al . , 2012 ) , schizophrenia ( ruiz et al . , 2013 ) , obesity ( frank et al . , 2012 ) , and addiction ( hartwell et al . . given the early stage of this research , it is not surprising that there are many limitations to these studies . most notably , small sample sizes ( typically between 6 and12 participants ) and lack of critical control conditions limit their potential use as evidence - based interventions . there are several plausible alternative hypotheses for the key variable(s ) that account for the changes observed following rtfmri neurofeedback training . these include , but are not limited to , effects due to experimenter monitoring , self - monitoring , positive reinforcement , cognitive and emotion regulation strategies , enhanced self - efficacy and motivation to change due to successful performance , and placebo response . to date , there have been no large rcts of rtfmri neurofeedback . rcts involve random allocation of participants to treatment and control groups , minimizing bias in treatment assignment and facilitating concealment of treatment assignment to experimenters and participants ( schulz and grimes , 2002 ) . rational therapeutics in clinical medicine ( meldrum , 2000 ) and are critical for establishing an evidence - based clinical practice ( the cochrane collaboration , 2011 ) . nevertheless , this important early work supports the investment in rcts of rtfmri for the treatment of some brain disorders . the aim of this paper is to define guidelines to establish the therapeutic utility of rtfmri neurofeedback by emphasizing clinical issues that should be considered beyond the technical considerations that have been the primary focus of more recent reviews ( birbaumer et al . , 2013 ; although the guidelines were developed with regard to the use of rtfmri neurofeedback to treat brain disorders , resolution of these issues is also necessary to advance development of rtfmri as a tool in clinical neuroimaging more generally . for each guideline , we delineate the challenges and potential limitations of rtfmri that need to be addressed to advance development of this neurotechnology , and outline a research strategy to address these challenges and limitations including potential experimental and neuroinformatics approaches . several technical , neuroscientific , and clinical issues must be addressed before rtfmri neurofeedback can advance as a clinical neuroimaging tool , and in particular for direct therapeutic applications . due to the complexity of rtfmri neurofeedback experiments , it is advisable to have considered these issues and have solutions in place in order to maximize the likelihood that the experiment will be a success . we have outlined the issues we felt are most critical to clinical applications of rtfmri neurofeedback and have offered potential solutions to help guide researchers . necessary preconditions for any successful rtfmri experiment are that the brain state of an individual is detectable and can be reliably and reproducibly converted into a feedback signal over the time - scale in question . here we propose possible metrics that can be used to evaluate these prerequisites . from a methodological perspective , the neurofeedback signal is generally derived from fmri paradigms of two broad categories : general linear model ( glm)-based methods , and more recently , multivariate pattern analysis ( mvpa ) methods . for recent reviews of these methods , glm - based methods define an a priori roi , either anatomically ( using anatomical landmarks or atlas - based techniques ) or with a functional localizer . the glm is used to regress out nuisance parameters , and the resulting bold signal at each voxel in the roi is combined into a neurofeedback signal using either averaging or a weighted average based on the standard deviation of the residual of the glm in each voxel ( hinds et al . , mvpa methods use supervised learning techniques , usually support vector machines , to determine the optimal set of weights ( from either the whole brain or a restricted roi ) used to combine the bold signal across voxels into a single neurofeedback score . in the context of rtfmri , real time is often used to describe both neurofeedback signals estimated from a single brain volume acquisition ( hinds et al . , 2011 ) and across several brain volume acquisitions ( cox et al . , 1995 ; johnson et al . , 2012 ; yoo et al . , 1999 in order to estimate a reliable bold signal in a single measurement , it is important for models to include a moment - to - moment estimate of noise . one example of this approach is the incremental glm method described in hinds et al . ( 2011 ) and implemented in murfi2 , software that is freely available on github ( http://github.com/gablab/murfi2 ) . regardless of whether a glm- or mvpa - based model is used to compute the neurofeedback signal or whether the signal is estimated in a single brain volume acquisition or across several acquisitions , the signal is a one - dimensional , usually linear combination of the bold signal across the brain . we can use the signal - to - noise ratio ( snr ) to compute how well the neurofeedback signal conforms to the experimental design . let f represent the ( stochastic ) neurofeedback signal and x the ( deterministic ) experimental design vector . under the standard glm assumptions ( monti , 2011 ) snr can be calculated by : snrf = corr(f , x)21corr(f , x)2 where corr(f , x ) represents the pearson correlation coefficient of vectors f and x. this quantity can be used to estimate how many repetition times ( trs ) the neurofeedback signal would need to be averaged over to ensure it is accurate with a confidence level of ( 1 f ) . after theoretical modeling , we arrived at an equation that relates three key quantities : the confidence in the neurofeedback signal ( 1 f ) , the signal to noise ratio ( snrf ) , and the number of trs used to compute the neurofeedback signal ( n ) . the relationship between these 3 variables is:f=1p(snrf2n > 0 ) where p ( ) is the standard cumulative normal distribution and n is the length ( in trs ) of both the task and fixation blocks . using this formula , we can determine the block length necessary to estimate an accurate neurofeedback signal with 95% confidence . we tested this formula using three rtfmri feedback paradigms with regional rois with small ( ventral striatum or vs ) , medium ( fusiform face area and parahippocampal place area or ffa / ppa ) , and large ( somatomotor cortex or smc ) expected snr values . the results are illustrated in fig . 1 and summarized in table 1 . the concordance correlation coefficient can be used to determine the reproducibility of the rtfmri signal for a given subject from one run to the next , given the model employed . the concordance correlation coefficient is a simple metric that has been applied to fmri to evaluate repeatability of various models ( lange et al . , 1999 ) . let w1 and w2 represent the weights used to aggregate the feedback signal ( derived from either a glm or mvpa - based model ) from runs 1 and 2 , respectively . the concordance correlation coefficient between these weight vectors is then : c=2cov(w1,w2)var(w1)+var(w2)+(w1w2)2 where cov ( . ) represents the variance and w1 represents the mean . from this work , we determined that the ffa / ppa and smc rois were feasible as neurofeedback brain regions to target , but vs with low snr was not feasible . it should be emphasized that detection of activation in ffa / ppa and smc rois is feasible relative to the vs roi ; however , there are still substantial challenges in estimating neural activity from a single noisy bold volume ( hinds et al . , 2011 ) that should be considered when deciding whether moment - to - moment neurofeedback from an roi , set of rois , or components will produce the intended study outcome . at a minimum , it is recommended that researchers establish the quality of the neurofeedback signal in an independent dataset using either the snr and concordance coefficient approach described above or some analogous method . if an experimenter finds that a signal does not meet these minimum standards , efforts should be made to optimize the experimental parameters and/or target roi(s ) before collecting data for a larger planned study . in cases where neurofeedback occurs from a region or network with low snr , e.g. , ( sulzer et al . , 2013b ) , reporting snr and methods used to optimize snr , will help guide future researchers targeting these brain areas for neurofeedback . one use of rtfmri is to provide feedback aimed at inducing learning that is difficult to achieve , or is less efficient , using other methods . this can be contrasted with alternative uses of rtfmri , such as triggering task events or optimizing task parameters , where the goal is not necessarily to produce a lasting learning effect . to understand the learning induced by rtfmri neurofeedback , three aspects of this process should be considered : ( 1 ) how is learning measured ? ( 2 ) which mechanisms are responsible ? and learning can be said to occur when experience influences behavior and/or alters brain structure or function . in the case of rtfmri neurofeedback , the relevant experience can consist of elements of the task , feedback about regional brain activation , multivariate patterns of brain activity , or connectivity , and cognitive processes that arise due to the task , feedback , or attempts to control feedback with strategies . the consequences of this experience can be assessed using various dependent measures linked to learning in more standard experiments in cognitive psychology and neuroscience . in behavior , learning can be reflected in improved perception ( fahle , 2002 ) , memory recall and recognition ( yonelinas , 2002 ) , anticipation / prediction ( bubic et al . , 2010 ) , priming ( tulving and schacter , 1990 ) , and motor action ( stadler and frensch , 1998 ) . in the brain ( particularly fmri ) , learning can be reflected in enhanced ( schwartz et al . , 2002 ) or attenuated activation within sensory systems ( grill - spector et al . , 2006 ; turk - browne et al . , 2008 ) , activation in learning and memory systems ( brewer et al . , 1998 ; , 2001 ; wagner et al . , 1998 ) , changes to the multivariate representational space of brain regions ( folstein et al . , 2013 ; schapiro et al . , 2013 ) , changes to functional connectivity ( buchel et al . , 1999 ) , increased gray matter volume ( draganski et al . , 2004 ) , and alterations in white matter ( zatorre et al . , 2012 all of these measures are potential targets for rtfmri studies seeking to induce learning with neurofeedback . one proposed mechanism is reward - based skill learning via cortical - basal ganglia brain networks ( birbaumer et al . feedback from a brain region may produce a type of instrumental conditioning , whereby activation of that region becomes rewarding . an increase in the activity of the region , and possibly additional inputs from the reward system and regions involved in cognitive control , may induce local plasticity . this plasticity could be reflected in alterations of the selectivity and circuitry of neurons in that region ( sur and rubenstein , 2005 ) . the region / representation used as the basis for feedback may become more involved in general , or more selective for an ongoing task . this could be analogous to establishing a compensatory mechanism , as occurs naturally after brain damage or in aging ( bedny et al . however , the region(s ) being compensated for ( i.e. , initially involved but not used for neurofeedback ) remain intact , and could possibly be recruited less over time . other regions that implement cognitive strategies for controlling feedback may become engaged in addition to the region being targeted for neurofeedback and the other brain areas recruited by this target region(s ) . these learning effects differ in several ways that will impact the likelihood of obtaining an effect , where the effect will be observed in the brain , and whether the effect will be manifested in behavior . for instance , learning occurs over a range of timescales , from immediately in the case of priming to over weeks in the case of perceptual learning . relatedly , effects persist for different durations depending on the type of learning and brain system involved , from milliseconds for adaptation in the visual system ( grill - spector et al . , 2006 ) to years for episodic memories consolidated in the association cortex ( mcclelland et al . , 1995 ) . finally , learning procedures vary in terms of whether the effects generalize to other contexts , from being hyperspecific to the training context ( jiang and song , 2005 ) to more flexible ( turk - browne and scholl , 2009 ) . considering these parameters when designing dependent measures , neural mechanisms , and timing / generalization properties allow rtfmri neurofeedback studies to be classified , and opportunities for new research to be identified . take , for example , a study of perceptual learning induced by rtfmri ( shibata et al . , 2011 ) . the dependent measures in this study were improved ( 1 ) accuracy in identifying a trained visual target orientation and ( 2 ) multivariate classification of this orientation from early visual cortex . the proposed mechanism is that rtfmri feedback encouraged participants to generate orientation - specific neural activity patterns in this region , which resulted in local plasticity . the properties of learning in this task are that it took 510 sessions of training over a month , the effects lasted at least that long , and the benefit of training was specific to one orientation at a particular contrast . various aspects of this classification could be investigated in future studies , such as what other brain systems are responsible for creating the activity patterns in the visual cortex , and whether other forms of perceptual learning ( e.g. , xiao et al . , 2008 ) could lead to more generalized benefits . a variety of approaches have been used for training subjects to control their brain patterns via rtfmri neurofeedback . as it is yet unclear which approach yields optimal learning , more work is needed to provide evidence - based guidelines for clinical trial design . in most studies , the nature of the neurofeedback signal is made explicit to the subject , but there have also been paradigms where training occurs covertly ( bray et al . , 2007 ; shibata et al . , 2011 ) . some studies present feedback while subjects are processing auditory , visual , or tactile stimuli ( bruhl et al . , 2014 ; decharms et al . , 2005 ; scheinost et al . , 2013 ; yoo et al . , 2007 ) or while they are performing an assigned cognitive task ( chiew et al . , other rtfmri studies employ an unconstrained paradigm in which the neurofeedback and the cues to increase or decrease brain activity are the only stimuli provided and the subjects are free to use a variety of cognitive strategies to control brain function and neurofeedback ( caria et al . , 2007 ; hampson et al . , 2011 ; rota et al . , 2009 ) . one open question is the importance of providing initial support ( e.g. , neurostimulation , pharmacotherapy , computerized cognitive training , and/or cognitive strategies ) to subjects that will enable them to exert some initial level of control over the relevant brain activity patterns . early reports suggested that learning was greatly facilitated by providing cognitive strategies to the subjects before they began neurofeedback ( caria et al . generally , rtfmri neurofeedback studies have either provided all subjects with strategies or have not provided any subjects with strategies , making it impossible to determine the degree to which discussing strategies with subjects before they began neurofeedback helped the subjects to gain control over their patterns of brain activity . there have been no published studies to date that have used neurostimulation , pharmacological aids , or computerized cognitive training to enhance subjects ' ability to utilize rtfmri feedback , which may be an important avenue for future studies to explore . it is not always necessary to provide initial strategies to subjects in order to achieve learning . successful learning was achieved in subjects who were trained using instrumental conditioning ( bray et al . , 2007 ) or were not provided with any initial strategies ( shibata et al . , 2011 ) . further , subjects who have learned to control their brain activity patterns via rtfmri neurofeedback have not always been consciously aware of the mental functions that were being molded by the training , even after completion of the neurofeedback ( shibata et al . , although this is encouraging in terms of the potential utility of rtfmri for training mental function , it also has ethical implications that must be carefully considered . it is also important to consider the schedule of delivery of neurofeedback , whether it is continuous or intermittent , in order to optimize learning . continuous neurofeedback or feedback delivered as soon as data is acquired , generally every tr ( ~12 s ) , has the advantage of delivering somewhat immediate ( relative to the 26 s hemodynamic delay ) feedback , which may be important to aid in efficient learning . for continuous rtfmri neurofeedback the hemodynamic delay must be accounted for in the feedback display or explained to subjects . a disadvantage of continuous neurofeedback is that single measurements are often noisy , leading to the potential for inaccurate feedback if delivered on a tr - by - tr basis . with continuous neurofeedback , subjects are asked to simultaneously attend to the task and the feedback signal , which increases cognitive load for the subject , and may disrupt optimal learning ( van merrinboer and sweller , 2005 ) . other brain systems will be engaged by feedback that may be unrelated or even counterproductive to the task or training . ( 2014 ) , subjects were better able to use neurofeedback to increase nucleus accumbens activity by visualizing exciting events than to decrease activity by visualizing boring events . subjects may have been less capable of decreasing nucleus accumbens activity with neurofeedback because the reward response to successful self - regulation of brain activity conflicted with the concurrent task of visualizing neutral or non - arousing events . in such cases additional brain regions appear to be recruited related to neurofeedback itself which have not yet been well - characterized . a study by haller et al . ( 2013 ) reported increased functional connectivity during neurofeedback between an auditory target region and low level visual , insula , and working memory networks that was not found during a transfer phase with no feedback . another study found activations in a broad frontoparietal and insula network as well as a broadly distributed negative network when subjects controlled neurofeedback as compared to viewing the feedback with no control ( papageorgiou et al . , 2013 ) . control over feedback was further associated with improved whole - brain task signal - to - noise and increased pattern classification accuracy . whether additional brain regions activated during neurofeedback are related to attention , control of feedback , or other factors such as learning and memory , has yet to be determined , including how these brain regions interact to produce neurofeedback - related brain changes . this work highlights the need for studies which investigate brain changes during continuous neurofeedback to consider the confounding effects of the neurofeedback ( and learning ) itself . finally , there is evidence that continuous feedback may interfere with the consolidation of a learned response . animal and human studies of operant learning have shown improved learning when subjects are provided with a period of delay after reward for post - reinforcement synchronization ( sherlin et al . , 2011 ) . intermittent neurofeedback or neurofeedback delivered after data acquisition over several trs , generally between 8 and 60 s , allows for averaging of the feedback signal to improve snr and accommodate the hemodynamic delay , and also minimizes cognitive load and other potential confounds by separating task strategy from the evaluation of feedback . johnson and colleagues found that subjects were better able to manipulate activity in the premotor cortex when imagining movements with intermittent neurofeedback ( at the end of each 20 s block ) as compared to continuous neurofeedback ( johnson et al . . however , the optimal delivery of neurofeedback likely depends on the specific application . while intermittent neurofeedback might be more effective by reducing cognitive load in studies in which individuals are provided with specific practice strategies , continuous neurofeedback might be useful to train individuals to fine - tune cognitive strategies related to specific patterns of brain activity . finally , it is important for researchers to consider human computer interface design principles , especially as they relate to the display of the neurofeedback signal in order to aid in effective learning . computer interface design alone could lead to failed trials , or in some cases , adverse consequences such as increased frustration , confusion , and/or fatigue . no studies have been conducted to evaluate or optimize an rtfmri neurofeedback interface design . a review of the human computer interface design is beyond the scope of this paper ( see brown , 1998 for a general overview of this topic ; wickens et al . , 2004 ) ; however , one area where a human most rtfmri neurofeedback paradigms , to date , have used visual feedback , but some subjects and populations may benefit from auditory , haptic , virtual reality / immersion , or some combination of these modalities for neurofeedback . in one application , an eeg - based neurofeedback signal was displayed on a participant 's head using 3-dimensional cameras and a mirror to create a more realistic individualized display of brain function in real time ( mercier - ganady et al . , 2014 ) . future studies might query user experience ( e.g. , by questionnaires ) to evaluate the functionality of the neurofeedback and the ease to which the user could learn to control the feedback signal , and compare this with a measure of accuracy with which the user could control the feedback , i.e. , performance . it is also important to establish guidelines for how best to assess rtfmri training success . to date , there have been two common approaches : subjects show improved ( 1 ) control of brain activity while receiving neurofeedback and/or ( 2 ) control of brain activity without neurofeedback ( i.e. , by comparing brain regulation without neurofeedback before and after training with feedback ) . a few studies have tested for transfer from training runs in which cognitive strategies were provided to control the feedback , to transfer runs in which cognitive strategies were used to control brain activity without any fmri information . young and colleagues reported that after several runs of neurofeedback training to increase activity in the left amygdala , subjects were able to significantly increase activity in the left amygdala using only cognitive strategies without neurofeedback ( young et al . , 2014 ) . ( 2014 ) trained subjects to control interhemispheric visual cortex balance over 3 hour - long neurofeedback training sessions comprised of both feedback and transfer runs . they found that participants who learned to control the feedback signal were able to maintain control during transfer runs with no neurofeedback . in other studies , subjects had success self - regulating brain activity with the aid of neurofeedback , but they were not able to significantly self - regulate activity when no longer receiving neurofeedback ( berman et al . , 2013 ; caria et al . , 2007 ; when creating an operational definition for training success , it will be important to consider : the expected timescale of training effects , expected pattern of change ( e.g. , linear or non - linear , monotonic or non - monotonic ) , and how best to account for individual differences . for example , training effects may be observed immediately or following some delay depending on the type and nature of learning impacting or impacted by training . successful training may occur via gradual , incremental improvement characterized by a linear , monotonic function or trial - and - error testing characterized by a non - linear , non - monotonic function . it is also unclear whether the experimenter should fix the training interval or allow for adaptive training based on individual differences in optimal learning strategies and performance . finally , the experimenter will need to design the study to adequately capture potential brain changes related to training over time , which could include reduced activity in the target roi(s ) , change in the extent of activation within the roi(s ) , and/or recruitment of different neural systems to support improved performance . the experimenter could consider including a resting state fmri scan before and after training as one strategy for capturing complex brain changes over time ( hampson et al . in order to determine whether rtfmri neurofeedback training - induced changes are clinically significant , it will be important to introduce a metric of change such as the reliable change index ( jacobson and truax , 1991 ) that accounts for measurement error and determines how functioning compares to a normative population . this is often used in clinical and neuropsychological assessments / studies where clinical significance is a question . neuropsychological and clinical measures used for this type of an assessment typically have established psychometric properties ( normative data , test retest reliability , etc . ) , which make calculating reliable change indices possible . as the human connectome project and other large neuroimaging databases are developed and data is shared , normative databases could be developed for fmri data in order to calculate a reliable change index for neuroimaging data . the behavioral effects of rtfmri training may be manifest in improvement on the task used during rtfmri neurofeedback training , improvement on related tasks or on the same task in other contexts , or improvement that generalizes to real - world outcomes ( for review , see ruiz et al . , 2014 ) . in some studies , subjects have been trained to self - regulate brain activity by manipulating the neurofeedback signal and a behavioral response to some other , often concurrent stimulus . for example , decharms and colleagues reported that training self - regulation of activity in the dorsal anterior cingulate cortex , a brain region implicated in pain perception and regulation , led to a corresponding change in the perception of pain caused by a noxious thermal stimulus as well as in spontaneous pain perception in patients with chronic pain ( decharms et al . , 2005 ) . for example , zhang and colleagues trained subjects to increase activation in the left dorsolateral prefrontal cortex , a brain region involved in working memory , and reported improvements on digit span and letter memory tasks across training , indicating improved verbal working memory with rtfmri neurofeedback training ( zhang et al . , 2013 ) . however , another study by lawrence and colleagues found that although rtfmri feedback could be used to train subjects to increase activity in the right anterior insula , training did not lead to changes in skin conductance response nor subjective valence ratings across pre- and post - training affective probes ( lawrence et al . , 2013 ) . because so few evidence - based guidelines exist for rtfmri studies , it is difficult to determine whether a lack of behavioral change is related to the specific brain behavior relationship tested , or to methodology , such as only one rtfmri training session in that study . there has been limited work in non - clinical populations targeting emotional brain regions and function . rota and colleagues have shown improved detection of emotional tone with rtfmri training from the right inferior frontal gyrus in healthy participants ( rota et al . , 2009 ) . on the other hand , another study ( johnston et al . , 2011 ) found that rtfmri training from brain regions involved in positive emotions failed to improve mood ratings in healthy participants . although methodology must be considered , the authors suggest that rtfmri training of emotional control to enhance mood may be most effective in individuals with abnormal emotional control ( as in their prior study in depression , linden et al . , 2012 ) , and less effective in individuals who are capable of normal mood regulation ( but see allen et al . , 2001 , for a study demonstrating improved mood in healthy controls using eeg neurofeedback ) . a recent study of individuals with major depressive disorder ( young et al . , 2014 ) found that rtfmri neurofeedback training to increase activity in the amygdala during positive autobiographical memory recall led to improved self - reported mood post - scan compared to controls . there is limited evidence of behavioral change from rtfmri that has generalized to other tasks or real - world outcomes . prior studies in clinical populations have shown decreased pain ratings in individuals with chronic pain ( decharms et al . , 2005 ) , decreased symptoms in individuals with tinnitus ( haller et al . , 2010 ) , decreased craving ratings and physiological response to smoking cues in nicotine - dependent individuals ( canterberry et al . , 2013 ; hanlon et al . , 2013 ) , decreased mood symptoms in people with depression ( linden et al . , 2012 ) , increased motor speed and clinical ratings of motor symptoms in individuals with parkinson 's disease ( subramanian et al . , 2011 ) , and decreased contamination anxiety in people with sub - clinical anxiety ( scheinost et al . , 2013 ) . however , with one exception ( scheinost et al . , 2013 ) , these studies measured behavior at the time of the rtfmri study , did not test retention , and , with few exceptions ( scheinost et al . the dependent measure of behavioral change with rtfmri was assessed with self - report measures that may reflect non - specific training effects . moving forward , it will be important for experimenters to show a causal link between the brain region(s ) trained and the behavior targeted for modification in order to establish that specific brain behavior changes account for any observed clinical changes and are not simply epiphenomena . it is a challenge to demonstrate cause - and - effect beyond correlation between rtfmri neurofeedback training and behavioral change . related to this , researchers should consider the specificity of the hypothesized relationship between the brain activation pattern(s ) trained and behavioral changes . in the study by shibata et al . ( 2011 ) described above , for example , causality was established between rtfmri neurofeedback training from the early visual cortex corresponding to a specific visual orientation and improved accuracy in identifying the target orientation as compared to untrained orientations . in such studies the specific brain activation pattern related to behavior must first be determined , for example using multivariate pattern analysis as in shibata et al . , ( 2011 ) and as described above ( laconte , 2011 ) . in another recent study , zhao et al . ( 2013 ) used dynamic causal modeling with rtfmri to measure causal interactions between the dorsal premotor cortex target region and other motor regions during a motor imagery task with neurofeedback . the experimental group showed increased interactions from the target brain region to the other regions across four training sessions as compared to a sham control group . rtfmri methods need to be further refined to establish causality not only between neurofeedback training and changes in behavior , but also between changes in the specific neurofeedback signal and other brain changes . despite important early work suggesting that it is possible to use rtfmri as a non - invasive brain - based clinical tool , to our knowledge there has been only one rct , recently completed , that has investigated the efficacy of rtfmri neurofeedback to effect meaningful clinical change ( ch , personal communication ) . several methodological considerations for the design of rtfmri studies and clinical trials remain open questions that likely depend on the specific application . to demonstrate behavioral change that is directly related to rtfmri feedback training and establish causality most studies that have included a control condition have either used false feedback or no feedback . false feedback can involve providing subjects with arbitrary feedback not related to brain function , actual neurofeedback from a brain region or network theoretically unrelated to the experimental variables of interest either within - group ( e.g. , garrison et al . , 2013a ) or between groups ( e.g. , lawrence et al . , 2013 ; young et al . , 2014 ) , or yoked neurofeedback from a matched subject ( e.g. , hampson et al . , 2012 ) . in a recent study , false feedback based on a recording of eeg neurofeedback was found to engage a broad network of frontal , parietal and cingulate regions involved in cognitive control ( ninaus et al . , 2013 ) . in another study , fixed randomized feedback not based on an actual fmri signal was compared to no feedback as a control for training self - regulation of activity in the premotor cortex ( johnson et al . , 2012 ) . false feedback again produced a widespread pattern of activation involving frontal , temporal , and parietal regions , which was distinct from the more localized activation associated with actual neurofeedback . in addition , subjects reported more frustration with the task in the false feedback group as compared to the no feedback or actual neurofeedback groups . based on these findings , the authors reasoned that the negative impact of false feedback runs made it a less suitable control group than no feedback . however , the drawbacks to providing no feedback are first that it is unlikely to be as engaging as a feedback task , and second , that it does not control for the perception of success that subjects experience when they do well in controlling their brain patterns . these differences between a neurofeedback group and a no feedback control group can lead to false positives related to unmatched motivation and placebo effects . another option is to deliver control feedback using more cost - effective methods such as autonomic biofeedback ( decharms et al . , 2005 ) . other important design considerations for rtfmri clinical trials include the optimal number of rtfmri sessions , number of neurofeedback runs per session , appropriate timing between sessions if multiple sessions are used , and the combination of rtfmri training with behavioral or other interventions . a recent study addressed a number of these issues by tracking change across three rtfmri sessions in which nicotine - dependent individuals were trained to reduce activation in the anterior cingulate cortex and reduce smoking cue - related craving ( canterberry et al . , 2013 ) . of 15 enrolled smokers , 60% completed three 1-hour rtfmri sessions , 12 weeks apart . within each rtfmri session reduced anterior cingulate cortex activity and reduced self - reported craving were evident at the first rtfmri session and consistent across sessions and runs . the reduction in cue - induced craving with rtfmri neurofeedback was significant at the third session , indicating that at least two feedback sessions were necessary to see any effect of neurofeedback , and more than two sessions may be needed to observe clinical improvement . finally , it will be critical to compare the effects of rtfmri - based neurofeedback to existing therapies or biofeedback using more cost - effective neuroimaging tools such as eeg in order to demonstrate the value added by rtfmri - based neurofeedback above other treatment options . in a domain where reproducibility has been a non - trivial goal , there is a need for consensus on common standards and sharing of data , paradigms , software , and analytic tools . this will provide an additional benefit of lowering the barrier to entry for researchers to use rtfmri , which will also help generate new research questions and the development of novel algorithms , solutions , and tools to advance the field . although digital imaging and communications in medicine ( dicom ) is a standard for communicating imaging data to the picture archiving and communication system ( pacs ) and other systems , many scanners do not have the capability to reconstruct and send dicom images as they are acquired . as such there is no common standard across scanners to communicate rtfmri data from the scanner to an analysis or presentation computer . in the absence of such standards , several existing software packages rely on monitoring the file system to detect reconstructed images . while simpler to set up , this can introduce unnecessary delays and limit the possibilities of neurofeedback paradigms . in scanners manufactured by siemens ( http://www.siemens.com ) and philips ( http://www.philips.com ) , users can transmit data over the network . in recent work published openly on github ( http://github.com/gablab/murfi2 ) , a formal specification for rtfmri communication has been developed to describe a set of information necessary to be transmitted from the scanner to an analysis or presentation computer . software developers can use this standard to create both new sequences on scanners as well as new analysis platforms that communicate with these sequences . however , if manufacturers were able to send dicom images in real time , it would benefit from an established protocol . along with available standards , a repository for or notification of the availability of such resources is needed . a common neuroinformatics portal for rtfmri coupled with question answer sites ( e.g. , http://neurostars.org ) and code repositories ( e.g. , github , http://github.com ) can significantly simplify the dissemination of information and allow for community discussion of approaches and issues . with the increased focus on data sharing and reproducibility of imaging studies , it is critical to utilize such resources to increase sharing of rtfmri data , experimental paradigms , and software . a primary goal of current research using rtfmri neurofeedback is to aid in the development of safe , effective and personalized therapies for many brain related disorders including : pain , addiction , phobia , anxiety , and depression . rtfmri neurofeedback has direct clinical application as a standalone treatment or as an augmentation strategy for interventions that work by training volitional control of brain activity . as described , rtfmri neurofeedback has been used to train individuals to self - regulate brain activation patterns related to basic and clinical processes , and rcts are in progress to corroborate potential clinical outcomes . rtfmri may be especially effective as targeted neurofeedback in conjunction with behavioral interventions based on brain behavior relationships . additionally , and on the other end of the central nervous system disease spectrum , there is the potential application of rtfmri neurofeedback to enhance performance ( gruzelier et al . , 2006 ) , learning ( yoo et al . , 2012 ) , and perception ( scharnowski et al . , 2012 ) , or to promote wellness optimization . in clinical neurotherapeutics , improvements in our understanding of the neural underpinnings of psychiatric disorders have yielded potential neural targets for rtfmri interventions . for example , dysfunction of the subgenual cingulate has been implicated in refractory depression , and deep brain stimulation targeted to that brain region has shown preliminary efficacy for the treatment of depression ( mayberg et al . , 2005 ) . as testing the efficacy of deep brain stimulation is invasive , it is possible that rtfmri may be used for targeted neurofeedback to test this hypothesis prior to more invasive procedures . more generally , rtfmri has the potential to test the robustness of neurobiological hypotheses prior to more invasive procedures . looking forward , there is a clear need for cost - effective therapies . at this time however , rtfmri research can inform the development of more cost - effective and scalable clinical tools , such as eeg or functional near - infrared spectroscopy ( fnirs ) . a translational step is to test multimodal approaches such as simultaneous rtfmri - eeg . in a recent study using this approach , participants were able to simultaneously increase bold signal in the amygdala and frontal high - beta eeg asymmetry when provided both modes of neurofeedback during a positive emotion induction task ( zotev et al . , 2014 ) , a technique which may help improve mood regulation in individuals with major depressive disorder ( young et al . , 2014 ) . the combined rtfmri - eeg approach may provide more efficient training based on improved temporal and spatial resolution compared to either modality alone . the concurrent use of these modalities may also help to translate rtfmri neurofeedback into more feasible eeg or other imaging applications ( e.g. , fnirs ) by characterizing the eeg ( or fnirs ) signal correlated to the fmri signal of interest to be used for neurofeedback . resolution of the issues outlined here will contribute to the development and use of rtfmri as a clinical neuroimaging tool beyond the direct therapeutic applications of rtfmri neurofeedback that are the focus of current rtfmri research and likewise of this paper . in addition to the use of rtfmri as a tool for treatment via neurofeedback , rtfmri has potential utility in exploring the nature of the pathological condition , and in clinical diagnosis , monitoring disease course , and tracking therapeutic response ( including the effects of neurofeedback ) . rtfmri offers a significant new opportunity for understanding and addressing these broad clinical problems . at the basic or translational level in particular , rtfmri can be used to improve our understanding of how cognitive processes are represented in the brain and how cognition is related to behavior in real time . for example , subjective information can help to elucidate cognition ( or disordered cognition ) , yet traditional self - report measures have limitations . rtfmri can be used to relate subjective experience to objective neuroimaging data to gain a more complete understanding of these brain behavior relationships , including in individual subjects . a recent study by garrison et al . ( 2013a ; 2013b ) used rtfmri in this way to link the subjective experience of focused attention to brain activity in the default mode network in experienced meditators . short fmri task runs and immediate self - report were paired with offline feedback ( shown after self - report ) , real time feedback , or volitional manipulation of the feedback stimulus . meditators reported that their subjective experience corresponded with feedback , and showed a significant percent signal change in the target brain region upon volitional manipulation , confirming their reports . this approach obviates the problem of reverse inference whereby cognitive processes are inferred from brain activity ( poldrack , 2006 ) , and reduces the opacity of cognitive strategy in fmri studies . however , as meditators have been shown to be more accurate at introspection than non - meditators ( fox et al . , 2012 ) , the accuracy of self - report must be considered when determining these brain behavior relationships in other groups , including clinical populations . nevertheless , rtfmri may be used in this way to help determine the specific brain activation pattern(s ) related to cognitive processes or behaviors of interest . this approach may aid in rtfmri neurofeedback training and provide insight into the mechanisms of treatment in rcts using rtfmri neurofeedback . more generally , this use of rtfmri may further our understanding of cognitive processes including those relevant to clinical applications . as a tool in clinical neuroimaging , rtfmri neurofeedback has the potential to be used to inform clinical diagnosis , track the natural history of disease , track treatment progress , and provide more specific and effective treatments . the use of rtfmri neurofeedback could lead to individualized brain - based treatment by clarifying the neural underpinnings of disordered behavior in an individual through real time testing . this could be accomplished by : ( 1 ) manipulating different cognitive processes that may be disrupted in a given disorder to observe the change in brain function in real time ; ( 2 ) presenting a cognitive task when different patterns of brain function are observed in real time ; or ( 3 ) altering brain function in different regions with reversible brain stimulation tools such as transcranial magnetic stimulation ( tms ) to determine the effects on brain function , cognition , and clinical symptomatology . rtfmri neurofeedback may then be used to modify these disordered individual patterns of brain activation toward a more normative state , potentially leading to more healthy , adaptive brain function . rtfmri neurofeedback may be calibrated to the individual 's current state , for example , to enhance learning as an individual improves across an intervention . likewise , interventions may be tailored to the specific strategies found to be useful for the individual in rtfmri neurofeedback studies ( lawrence et al . , 2011 ) . further , behavioral interventions may be augmented by targeted neurofeedback of a brain activation pattern or cognitive process of interest . finally , rtfmri may be used to find predictors of not only clinical outcomes , but also of responsiveness to rtfmri neurofeedback training . research contributing to evidence - based guidelines is sorely needed for clinical trials of rtfmri neurofeedback . as outlined , researchers must establish that the rtfmri signal is accurate and reliable , rtfmri neurofeedback leads to learning , there is an appropriate test of training success , rtfmri neurofeedback leads to clinically meaningful changes in cognition and behavior , an appropriate clinical trial design is in place , and rtfmri resource sharing protocols and tools are established to allow for efficient advancement toward the urgent clinical goals discussed in this paper . important beginning work in these areas has been conducted , contributing to an overall promising outlook for the application of rtfmri neurofeedback to develop novel , safe , and effective treatments for brain disorders . the ultimate goal is for this tool to assist clinicians and patients in designing personalized assessment and intervention approaches that may enhance resilience in at - risk populations by correcting known maladaptive patterns of brain function in advance of developing a disorder , accelerating adaptive compensatory neuroplastic changes in those with brain disorders , and/or directly targeting the disrupted brain region or system underlying brain disorders in order to restore healthy brain overall , rtfmri offers the opportunity to further our understanding of how the brain works and pushes the limits of our potential for self - directed healing and change .
while reducing the burden of brain disorders remains a top priority of organizations like the world health organization and national institutes of health , the development of novel , safe and effective treatments for brain disorders has been slow . in this paper , we describe the state of the science for an emerging technology , real time functional magnetic resonance imaging ( rtfmri ) neurofeedback , in clinical neurotherapeutics . we review the scientific potential of rtfmri and outline research strategies to optimize the development and application of rtfmri neurofeedback as a next generation therapeutic tool . we propose that rtfmri can be used to address a broad range of clinical problems by improving our understanding of brain behavior relationships in order to develop more specific and effective interventions for individuals with brain disorders . we focus on the use of rtfmri neurofeedback as a clinical neurotherapeutic tool to drive plasticity in brain function , cognition , and behavior . our overall goal is for rtfmri to advance personalized assessment and intervention approaches to enhance resilience and reduce morbidity by correcting maladaptive patterns of brain function in those with brain disorders .
colorectal cancer ( crc ) is the fourth leading cause of cancer - specific mortality worldwide , with 610,000 related deaths each year1 . crc is the fourth most common form of cancer in the united states2 and the third leading cause of cancer - related death in the western world3 . laparoscopic resection for crc was first described in 19914 and has since been widely applied by surgeons to treat patients with crc . several articles have reported the short - term advantages of laparoscopic colorectal surgery ( lcrs ) over conventional open colorectal surgery ( ocrs ) and have concluded that laparoscopic surgery causes less pain , results in better pulmonary function , shorter duration of postoperative ileus , less fatigue , and a better quality of life5 - 7 . however , the value of laparoscopic colorectal surgery has remained controversial because the long - term outcomes have not been clarified . the long - term results of colorectal surgery , such as tumor recurrence rate , disease - free survival rate , and mortality rate , have been gradually published8 - 10 . several randomized control trials ( rcts ) that compare lcrs with ocrs have been conducted8 - 30 . therefore , we conducted a meta - analysis of the data from these rcts and compared the outcomes of lcrs and ocrs by considering several factors listed below . in addition , we selected the rcts for which the follow - up period was at least 3 years to evaluate the long - term outcomes of lcrs . to identify papers relevant to our study we searched through the major medical databases such as medline , embase , science citation index , and cochrane controlled trial register for studies published between january 1990 and may 2011 . the following search terms were used : laparoscopy , laparoscopy - assisted , surgery , colorectal cancer , and all related articles . furthermore , we limited our literature search to those studies that involved a follow - up period of 3 or more years to examine the long - term outcomes of lcrs . we treated studies that are part of a series or studies described by the same author as a single study . most appropriate data of a series of studies were used for this meta - analysis . ) extracted data from each article by using a structured sheet and entered the data into a database . because this analysis was performed by the principle of intention - to - treat31 , all patients converted from the laparoscopic group to the conventional open surgery group remained in the laparoscopic group for analysis . for the short - term analysis , we collected data on the duration of the operation , estimated blood loss , number of patients requiring transfusion , number of harvested lymph nodes , time required for resumption of oral intake , duration of hospital stay , length of operation wound , complications , and perioperative mortality . for the long - term analysis , we used data on the rate of tumor recurrence , disease - free survival rate , and mortality . if necessary weighted mean differences ( wmds ) and odds ratios ( ors ) were used for the analysis of continuous and dichotomous variables , respectively . random - effects models were used to identify heterogeneity between the studies32 and the degree of heterogeneity was assessed using the 2 test . the confidence interval ( ci ) was established at 95% and p values of less than 0.05 were considered to indicate statistical significance . statistical analyses were performed using the review manager ( revman ) software version 5.0.25 provided by the cochrane collaboration , copenhagen , denmark . weighted mean differences ( wmds ) and odds ratios ( ors ) were used for the analysis of continuous and dichotomous variables , respectively . random - effects models were used to identify heterogeneity between the studies32 and the degree of heterogeneity was assessed using the 2 test . the confidence interval ( ci ) was established at 95% and p values of less than 0.05 were considered to indicate statistical significance . statistical analyses were performed using the review manager ( revman ) software version 5.0.25 provided by the cochrane collaboration , copenhagen , denmark . we identified 12 papers reporting rcts that compared lcrs and ocrs for colorectal cancer8 - 24 . our meta - analysis included 4458 patients with colorectal cancer ; of these , 2375 had undergone lcrs , and 2083 , ocrs . the results of the short- and long - term are shown in fig . 1 and fig the outcomes of lcrs and ocrs in the short- and long - term are reported below . the operative duration for lcrs was significantly longer than for ocrs , i.e. , by 39.32 min ( wmd = 39.32 ; 95% ci = 30.72 - 47.91 ; p < 0.00001 ) . eleven of the 12 rcts included data on operative duration , and the 11 rcts indicated that the duration of operations using lcrs was significantly longer than that of operations using ocrs . blood loss in patients who underwent lcrs was significantly lesser than patients in those who underwent ocrs , by an average volume of 133.05 ml ( wmd = -133.05 ; 95% ci = -201.30 to -64.81 ; p = 0.0001 ) . we found no significant differences between patients who underwent lcrs and those that had ocrs for the number of transfused patients or the number of dissected lymph nodes . patients in the lcrs group resumed oral intake on an average of 1.08 days sooner than did patients in the ocrs group , and the difference was significant ( wmd = -1.08 ; 95% ci = -1.36 to -0.80 ; p < 0.00001 ) . the duration of hospital stay was significantly shorter by an average of 2.80 days for patients in the lcrs group than for those in the ocrs group ( wmd = -2.80 ; 95% ci = -4.78 to -0.81 ; p = 0.006 ) . the average length of the wound caused by each operation was significantly shorter by 10.97 cm in the lcrs group than in the ocrs group ( wmd = -10.97 ; 95% ci = -14.37 to -7.57 ; p < 0.00001 ) . differences in overall perioperative complications and anastomotic leakage between the lcrs group and the ocrs group were insignificant for treatment of the colorectal cancer . we also found no significant differences in perioperative mortality between the surgery groups when we pooled data for treatment of the colorectal cancer . the rate of wound - site recurrence for patients in the lcrs group was significantly higher than for those in the ocrs group in our analysis of the pooled data for crc treatment ( or = 2.87 ; 95% ci = 1.08 - 7.68 ; p = 0.04 ) . restricting wound - recurrence to isolated abdominal - wall recurrences , in the absence of recurrent disease elsewhere , our analysis of the local and distant metastasis recurrence between the lcrs group and the ocrs group for treatment of the colorectal cancer indicated no significant difference . there was also no significant difference between the surgery groups for the overall recurrence of tumors . we found no significant differences in the 3- and 5-year disease - free survival rates between patients who underwent lcrs and those who underwent ocrs . there was no significant difference between the lcrs and ocrs groups for cancer - related mortality for treatment of the colorectal cancer . likewise , there was no significant difference in overall mortality between the lcrs and ocrs groups . in the short - term period , significant heterogeneity was detected between studies with respect to the following 4 factors : intraoperative blood loss , duration of hospital stay , length of operation wound , and overall complications . in the long - term period the operative duration for lcrs was significantly longer than for ocrs , i.e. , by 39.32 min ( wmd = 39.32 ; 95% ci = 30.72 - 47.91 ; p < 0.00001 ) . eleven of the 12 rcts included data on operative duration , and the 11 rcts indicated that the duration of operations using lcrs was significantly longer than that of operations using ocrs . blood loss in patients who underwent lcrs was significantly lesser than patients in those who underwent ocrs , by an average volume of 133.05 ml ( wmd = -133.05 ; 95% ci = -201.30 to -64.81 ; p = 0.0001 ) . we found no significant differences between patients who underwent lcrs and those that had ocrs for the number of transfused patients or the number of dissected lymph nodes . patients in the lcrs group resumed oral intake on an average of 1.08 days sooner than did patients in the ocrs group , and the difference was significant ( wmd = -1.08 ; 95% ci = -1.36 to -0.80 ; p < 0.00001 ) . the duration of hospital stay was significantly shorter by an average of 2.80 days for patients in the lcrs group than for those in the ocrs group ( wmd = -2.80 ; 95% ci = -4.78 to -0.81 ; p = 0.006 ) . the average length of the wound caused by each operation was significantly shorter by 10.97 cm in the lcrs group than in the ocrs group ( wmd = -10.97 ; 95% ci = -14.37 to -7.57 ; p < 0.00001 ) . differences in overall perioperative complications and anastomotic leakage between the lcrs group and the ocrs group were insignificant for treatment of the colorectal cancer . we also found no significant differences in perioperative mortality between the surgery groups when we pooled data for treatment of the colorectal cancer . the rate of wound - site recurrence for patients in the lcrs group was significantly higher than for those in the ocrs group in our analysis of the pooled data for crc treatment ( or = 2.87 ; 95% ci = 1.08 - 7.68 ; p = 0.04 ) . restricting wound - recurrence to isolated abdominal - wall recurrences , in the absence of recurrent disease elsewhere , the differences between the groups was insignificant ( p = 0.09 ) . our analysis of the local and distant metastasis recurrence between the lcrs group and the ocrs group for treatment of the colorectal cancer indicated no significant difference . there was also no significant difference between the surgery groups for the overall recurrence of tumors . we found no significant differences in the 3- and 5-year disease - free survival rates between patients who underwent lcrs and those who underwent ocrs . there was no significant difference between the lcrs and ocrs groups for cancer - related mortality for treatment of the colorectal cancer . likewise , there was no significant difference in overall mortality between the lcrs and ocrs groups . in the short - term period , significant heterogeneity was detected between studies with respect to the following 4 factors : intraoperative blood loss , duration of hospital stay , length of operation wound , and overall complications . in the long - term period previous articles showed that laparoscopic surgery for crc is associated with low morbidity , less pain , fast recovery , and short hospital stay , compared to conventional open surgery in the short - term5 - 7 . recent articles reporting rcts have shown that long - term oncological results for lcrs are comparable to those for ocrs33 . therefore , we examined the oncological results of lcrs and compared to those of ocrs in short- and long - term periods by a meta - analysis of 12 rcts . in the short - term period , this meta - analysis showed that lcrs has a significantly long operative time but significantly reduces the intraoperative blood loss compared with ocrs . potential explanations for the abovementioned results are meticulous dissection facilitated by instruments for laparoscopic surgery and videoscopic magnification34 . we also found that there was no significant difference in the number of patients requiring blood transfusions between the lcrs and ocrs groups . the lack of difference in the number of harvested lymph nodes between the 2 groups may suggest that the quality of the operative techniques is the same . patients who underwent lcrs resumed oral intake significantly earlier and had significantly shorter hospital stays than did patients who underwent ocrs ; this finding suggests that lcrs leads to faster recovery . the safety and feasibility of lcrs is similar to that of ocrs as shown by insignificant differences in the overall perioperative complications , anastomotic leakage , and perioperative mortality between the surgery groups . in the long - term period , this study showed that there is no significant difference in the overall recurrence , local recurrence , or distant recurrence of metastases between the lcrs and ocrs groups . the rate of wound - site recurrence for the lcrs group was significantly higher than that for the ocrs group . in 7 of the 9 studies that reported data on wound - site recurrence , the rates of wound - site recurrence for lcrs were similar to the rates for ocrs . in the clasicc trial , the number of extraction - site recurrences was higher than that of trocar - site recurrences in the lcrs group . therefore , the authors emphasize the need for adequate wound protection during specimen extraction13 . in the color trial , the number of trocar - site recurrences was higher than that of extraction - site recurrences in the lcrs group . in this meta - analysis the differences of wound - site recurrence between the groups was insignificant , restricting wound - recurrence to isolated abdominal - wall recurrences , in the absence of recurrent disease elsewhere . reported that port - site metastasis may be a part of the systemic disease rather than an unfortunate sequelae of the learning curve for laparoscopic surgery35 . we found no significant difference between the lcrs and ocrs groups for overall mortality , 3- and 5-year disease - free survival rate and cancer - related mortality . these results suggest that the long - term oncological results of lcrs are similar to those of ocrs . reported that lcrs significantly prolongs cancer - related survival in treatment of colon cancer10 , but our meta - analysis of the pooled data did not show this difference . quality of life ( qol ) after laparoscopic surgery is improved in the early postoperative period compared with qol after open surgery . in the long - term period , however , qol after lcrs is similar to qol after ocrs9 , 36 . from the cosmetic viewpoint , lcrs is superior to ocrs because the length of operation wound was significantly shorter in lcrs than in ocrs . significant heterogeneity was observed between the 12 rcts for intraoperative blood loss , duration of hospital stay , length of operation wound , overall complications in the short - term period , and overall mortality in the long - term period . this heterogeneity may be attributable to variation in the skills of the surgeons and the condition of the tumor . in conclusion , this meta - analysis showed that lcrs has the benefits of reducing intraoperative blood loss , earlier resumption of oral intake , and shorter duration of hospital stay in short - term and seems to be similar in the long - term oncological outcomes , comparing to ocrs .
purpose : we conducted a meta - analysis to evaluate and compare the short- and long - term results of laparoscopic colorectal surgery ( lcrs ) and conventional open surgery ( ocrs ) for colorectal cancer ( crc).methods : we searched relevant papers published between january 1990 and may 2011 . we analyzed the outcomes of each type of surgery over the short- and long - term periods.results : in the short - term period , we found no significant differences in overall perioperative complications and anastomotic leakage between lcrs and ocrs groups . we found no significant differences in overall , distant , local and wound - site recurrence , overall mortality , 3 and 5 year disease - free survival rate , and cancer - related mortality between the 2 groups.conclusions : lcrs has the benefits of reducing intraoperative blood loss , earlier resumption of oral intake , and shorter duration of hospital stay in the short - term . the long - term outcomes of lcrs seem to be similar to those of ocrs .
lumbar instability is a common symptom and also one of the causes of low back pain . the definition of lumbar segmental instability is decreased stiffness of the spinal motion segments2 . previous studies have indicated that lumbar instability is associated with pain possibly3 ; and it may be due to a defect in spinal segment movement control , leading to compression of the neural structure4 , 5 . trunk muscular strength may protect the spine during daily activities6,7,8 . weakness of the trunk muscles and poor muscular endurance are also characteristics of lbp9 . the severity of trunk muscular weakness or fatigability may be examined using isokinetic or isometric tests10,11,12 . numerous studies have investigated the difference in trunk muscular strength and endurance between chronic lbp patients and healthy subjects13 , 14 . some reported subjects with lbp have significantly less muscular strength and endurance than healthy subjects13 , 14 . this may be explained by lbp clients being unwilling to make maximal effort during the muscular strength test due to pain or fear of injuries15 , 16 . previous studies have investigated the trunk muscular activation and muscle fatigue of lbp patients using electromyography ( emg ) and compared the results with those of healthy adults . the most frequent site showing pathological changes is the 4th and 5th lumbar vertebrae , where the multifidus muscles are located17 . the median frequency of emg has been used as a fatigue index to compare the back muscular fatigability of the left and right sides between 40% maximal voluntary contraction ( mvc ) and 80% mvc , and the median frequency imbalance was significantly larger in lbp than in healthy subjects16 . regarding exercise training , numerous exercise types have been developed as exercise therapy for clients with lbp , such as hip joint exercises , trunk muscular strengthening exercises , and aquatic exercise18 . it aims to train injured and healthy supporting tissue , facilitate tissue repair and prevent structural weakness from excessive loading19 . exercise training for lbp is not only concerned with positional correctness , but also deep muscle and neuromuscular control training . previous studies have demonstrated that exercise on an unstable surface , such as exercises on a swiss ball and sling exercise training ( s.e.t ) , increases muscular activation levels20,21,22,23 . the activation levels of the internal and external oblique muscles increased during bridge exercise with vibration training on an unstable surface24 . exercise on an unstable surface challenges the motor control system , the increasing the speed and intensity of lumber stabilizers , contraction and the activation ratio as well as improving muscle activation synergy19 , 25 , 26 . postnatal women with pelvic pain reported significantly reduced pain , improved physical function and better quality of life after 20 weeks of s.e.t training27 . baseball players with lbp participated in 12 weeks of exercise training , using ultrasound biofeedback training or s.e.t training . the ultrasound biofeedback training comprised stretching and general trunk muscle strengthening under ultrasound monitoring . the ultrasound biofeedback training helped subjects practice and realize how the deep muscles work . the results showed s.e.t training could improve pain , physical function and lumbar instability more significantly than ultrasound biofeedback training28 . in general , subjects who suffer from lbp show improved trunk proprioception , physical function and trunk stability after six weeks of s.e.t29 . to the best of our knowledge , most studies have measured the effects of interventions for lbp using functional fitness or a subjective questionnaire . few studies have measured the effects of exercise intervention on muscular strength and endurance . in addition , due to the possible influence of psychological factors , using the slope of the median frequency may be a relatively objective way of measuring muscular endurance compared to using maintenance time only . thus , the purpose of this study was to examine the effects of 6 weeks s.e.t for clients with lbp on pain , disability , muscular strength and muscular endurance . this study recruited chronic lbp patients . they were randomly divided into a control group and a training group . the pain area was located between the lower ribs and gluteus folds , and the pain duration had persisted for at least three months . the investigators explained the purposes and procedures of the assessment and obtained basic personal information and informed consent before conducting the experiment . the participants provided their written consent to participation and the study was approved by the kaohsiung medical university ethics committees . participants subjective parameters ( pain intensity and disability levels ) , and objective parameters ( muscular strength and endurance ) participants in the training group performed stabilization exercise using a s.e.t system for six weeks . low scores represented low pain intensity , and high scores represented high pain intensity . the chinese version of the oswestry disability scale for lbp was used to measure the disability level30 . each item is scored from 0 to 5 , with higher the scores indicating greater disability . the maximum score for this questionnaire is 50 points , and the raw scores are converted to percentages . according to fairbank31 , 020% represents mild disability , 2140% represents moderate disability , 4160% represents severe disability , 6180% means most physical functions are impaired by back pain , and it is classified as disabled , and 81100% means the subject is bed - bound . the muscular strength assessment was measured by a custom - designed muscular strength dynamometer . subjects were instructed to carry out the trunk extension and rotation to the left and right in a sitting position . for each movement they aimed to exert maximal voluntary isometric contraction for 5 seconds in three trials ( fig . ( a ) back extension , ( b ) rotation to left and right ) . during the trunk flexion and extension test , the torque sensor was placed on the left of the body with its height parallel to the iliac crest . muscular strength measurements . ( a ) back extension , ( b ) rotation to left and right for the trunk extension test , a fixed bar was set on the spine at the height of the scapula to fix the trunk , and an investigator applied a strength with force along the femoral bone . the torque sensor was placed on the head to measure trunk rotation the fixed bar set at the height of the sternal notch . subjects rested for ten minutes after the maximal muscular strength test , and then carried out the endurance test at about 52% mvic test32 in one trial . subjects performed trunk extension and sustained the contraction until they could not maintain the standard testing posture , their hand touched the bed , or the posture was sustained for 240 seconds . the investigators recorded the time the subject sustained the posture , and the change in the median frequency slope was used as an index of fatigue . participants in the training group attended an exercise course of three sessions a week with each session comprising 30 minutes of training and 10 minutes of warm up . in the training program , participants had to hold the end position for 810 seconds in 1215 repetitions of each exercise . the exercise intensity was adjusted by the distance from the point of sling suspension and the distance between the slings and the bed . the repetitions and intensity of exercise investigators considered the fitness levels differed between the participants , thus , the exercise prescriptions were individually decided with different exercise maintenance times and repetitions in the initial training session . investigators instructed participants to perform a pelvic backward tilt and keep their back straight during exercise to prevent injury through excessive loading of the lumbar spine during exercise . exercise ( 1 ) : participants were instructed to flex the elbow to 90 degrees and kneel on the bed under the sling point . exercise ( 2 ) : participants stood on the floor and under the sling point . exercise ( 3 ) : the straps were 30 centimeters apart from the bed . exercise ( 4 ) : participants lay supine on the bed with the ankles under the sling point . exercise ( 5 ) : participants lay prone on the bed and the ankles were under the sling point . straps were set at the height of the participants upper arm to make the body parallel to the bed during exercise . exercise ( 6 ) : participants lay prone on the bed and the ankles were under the sling point . straps were set as high as the participants upper arm to make the body parallel to the bed during the exercise , and the participants supported their body with their forearms and ankles combined with knee flexion . 2.exercise training programs 1 ) subjects knelt with their arms in the slings and gradually extended their arms while keeping their arms straight.2 ) subjects stood with their hands in the slings and gradually extended their arms while keeping their backs straight.3 ) subjects lay on the bed with their ankles in the slings and executed a bridging exercise.4 ) subjects lay on the bed with their ankles in the slings , and executed a bridge . then , they gradually flexed their knees to increase the instability.5 ) subjects lay prone on the bed with their ankles in the slings . then , they executed the plank exercise.6 ) subjects lay prone on the bed with their ankles in the slings . they executed the plank exercise , then gradually flexed their knees to increase the instability . . exercise training programs 1 ) subjects knelt with their arms in the slings and gradually extended their arms while keeping their arms straight.2 ) subjects stood with their hands in the slings and gradually extended their arms while keeping their backs straight.3 ) subjects lay on the bed with their ankles in the slings and executed a bridging exercise.4 ) subjects lay on the bed with their ankles in the slings , and executed a bridge . then , they gradually flexed their knees to increase the instability.5 ) subjects lay prone on the bed with their ankles in the slings . then , they executed the plank exercise.6 ) subjects lay prone on the bed with their ankles in the slings . they executed the plank exercise , then gradually flexed their knees to increase the instability . subjects knelt with their arms in the slings and gradually extended their arms while keeping their arms straight . subjects stood with their hands in the slings and gradually extended their arms while keeping their backs straight . subjects lay on the bed with their ankles in the slings and executed a bridging exercise . subjects lay on the bed with their ankles in the slings , and executed a bridge . they executed the plank exercise , then gradually flexed their knees to increase the instability . investigators calculated the mean of maximal torque of 10 consecutive data minus the mean baseline torque for 10 consecutive data to calibrate the error . the 10 consecutive data of maximal torque were chosen as the 5 data before the maximal value and the 5 data after maximal value . the value divided by the lever arm was used to obtain the force value . the trunk muscular endurance was measured during extension , and the effects of s.e.t on trunk muscular endurance . the sampling rate of the emg system was 1,500 hz . fast fourier transform ( 512 point , window processing ) were used to convert the time - domain signal to the frequency domain and the median frequency was calculated13 . the calculated median frequency values were fitted using a first - order curve approximation to calculate the slope of the median frequency . a positive slope indicates neuromuscular fatigue did not build up ; a negative slope indicates neuromuscular fatigue is present and a more negative slope indicates a higher level of neuromuscular fatigue16 . the median frequency slope calculation was performed using matlab ( version r2007b mathworks inc . wilcoxon s rank test was used to compare the differences in parameters between pre - and post - intervention . the statistical analyses were performed using jmp statistical software ( version 9.0.0 sas institute inc . ) . this study recruited 16 lbp subjects , who were randomly assigned to the training group and the control group . nine were in the training group and the remaining seven were in the control group . however , two subjects in the training group dropped out of the study due to their work pattern changing , which made them unable to participate in the training sessions . in addition , two subjects in the control group dropped out of the study due to personal reasons . thus , the total number of subjects was 12 , with seven in the training group and the remaining five in the control group . the characteristics of the subjects are listed in table 1table 1.characteristics of the subjectscontrol group(n=5)training group(n=7)age ( yrs)27.6 ( 6.7)27.6 ( 5.6)height ( m)1.65 ( 0.07)1.60 ( 0.04)body weight ( kg)57.6 ( 12.2)57.0 ( 9.9). this study used a visual analog scale to measure the pain intensity . higher scores on this scale indicated higher pain intensity . the pain intensity of the control group and training group before training was 3.75 ( 0.87 ) and 4.29 ( 1.44 ) , respectively , with no significant difference between the groups . in the control group , the pain intensity had reduced after six weeks , but it did not improve significantly ( table 2table 2.values of the subjective parameters of each group at pre - and post - trainingcontrol group ( n=4)training group ( n=7)pre trainingpost trainingpre trainingpost trainingpain intensity3.75 ( 0.87)2.38 ( 1.03)4.29 ( 1.44)1.33 ( 1.17)*oswestry ( % ) 19.00 ( 16.20)18.50 ( 11.82)14.29 ( 3.90)8.86 ( 6.41)*the wilcoxon rank test was used to compare the pre - and post - training values of each group , and * significant difference ( p<0.05 ) . ) . in the training group , after six weeks of training , pain intensity was reduced to 1.33 ( 1.17 ) cm , and there was a significant improvement in pain intensity between pre- and post - training ( p<0.05 ) ( table 2 ) . the wilcoxon rank test was used to compare the pre - and post - training values of each group , and * significant difference ( p<0.05 ) . the training group showed a slightly higher disability level than the control group at the baseline assessment , but there was no statistically significant difference between the groups ( table 2 ) . after six weeks , there was no significant improvement in the oswestry disability index for the control group ( table 2 ) . the disability level in the training group before training was 14.29 ( 3.90 ) percent , and after training , the disability level was significantly lower at 8.86 ( 6.41 ) percent ( p<0.05 ) ( table 2 ) . a comparison of baseline measurements between the groups showed the muscular strengths in extension of the control and training groups were 0.57 ( 0.10 ) kg - m / bw and 0.39 ( 0.15 ) kg - m / bw , that of rotation to the right was 0.37 ( 0.12 ) kg - m / bw and 0.30 ( 0.10 ) kg - m / bw , and that of rotation to left and 0.43 ( 0.12 ) kg - m / bw 0.27 ( 0.11 ) kg - m / bw , respectively . the control group had greater absolute muscular strength than the training group in extension and rotation to the left and right . however , there were no significant differences between the groups . in the control group , extensor and rotator muscular strength had slightly decreased after six weeks without training . however , the results were not significantly different ( table 3table 3.the values of muscular strength each group at pre - and post - trainingcontrol group ( n=5)training group ( n=7)pre trainingpost trainingpre trainingpost trainingextension ( kg - m / bw)0.57 ( 0.10)0.54 ( 0.12)0.39 ( 0.15)0.59 ( 0.14)*rotation to right ( kg - m / bw)0.37 ( 0.12)0.35 ( 0.12)0.30 ( 0.10)0.41 ( 0.08)*rotation to left ( kg - m / bw)0.43 ( 0.12)0.38 ( 0.04)0.27 ( 0.11)0.38 ( 0.08)*the wilcoxon rank test was used to compare the pre - and post - training values of each group , and * significant differences ( p<0.05 ) . ) . in the training group , muscular strength improved after six weeks training . the absolute extensor muscular strength was 0.39 ( 0.15 ) kg - m / bw before training , and it increased to 0.59 ( 0.14 ) kg - m / bw after six weeks of s.e.t ( p<0.05 ) ( table 3 ) . the results showed muscular strength of rotation to the right was 0.30 ( 0.10 ) kg - m / bw before training , and it increased significantly to 0.41 ( 0.08 ) kg - m / bw after six weeks of training ( p<0.05 ) . the muscular strength of rotation to the left was 0.27 ( 0.11 ) kg - m / bw before training , and it increased significantly to 0.38 ( 0.08 ) kg - m / bw ( p<0.05 ) after 6 weeks of training ( table 3 ) . the wilcoxon rank test was used to compare the pre - and post - training values of each group , and * significant differences ( p<0.05 ) . comparison of the slope of the median frequency between the control and training group showed no significant difference at baseline for all the muscles measured . in the control group , the slope of the median frequency for all muscle sites showed no improvement after six weeks . the slope of median frequency in the training group showed a significant improvement on the left side of the multifidus after training ( the slopes at baseline and post - training were 0.11 and 0.08 , respectively ) ( p<0.05 ) ( table 4table 4.median frequency comparison of the values of each group at pre - and post - trainingslope of mf on each muscle sitecontrol group ( n=5)training group ( n=7)pre trainingpost trainingpre trainingpost trainingl - es0.04 ( 0.02)0.04 ( 0.02)0.06 ( 0.01)0.05 ( 0.01)r - es0.04 ( 0.01)0.05 ( 0.03)0.04 ( 0.01)0.05 ( 0.02)l - mf0.06 ( 0.03)0.06 ( 0.03)0.11 ( 0.01)0.08 ( 0.01)*r - mf0.06 ( 0.04)0.05 ( 0.04)0.11 ( 0.02)0.08 ( 0.01)the wilcoxon rank test was used to compare the pre - and post - training values of each group , and * significant differences ( p<0.05 ) . ( units : hz / s ) l - es : left side erector spinae ; r - es : right side erector spinae ; l - mf : left side multifidus ; r - mf : right side multifidus ) . however , the other muscle sites did not show any significant changes after training . the wilcoxon rank test was used to compare the pre - and post - training values of each group , and * significant differences ( p<0.05 ) . ( units : hz / s ) l - es : left side erector spinae ; r - es : right side erector spinae ; l - mf : left side multifidus ; r - mf : right side multifidus that study recruited 12 lbp baseball players , and carried out three stages of exercise training . in the first stage , the second stage was the trunk muscular strengthening course , and the third stage was stabilization exercise training on slings . pain intensity was significantly reduced after s.e.t , but it was not apparent at trunk muscular strengthening stage28 . that is , the s.e.t was more effective at reducing pain than the trunk muscular strengthening course for lbp patients . chang et al . also investigated the effects of six weeks of s.e.t on lbp patients29 . they found that the disability level , functional fitness and trunk proprioception improved after six weeks of training . the studies of chang and chu et al . both demonstrate that six weeks of s.e.t is effective at reducing the pain intensity and disability levels of lbp patients . however , these two studies did not measure the pain intensity and disability level simultaneously28 , 29 , and they did not utilize a control group . in the present study , there was a significant improvement in muscular strength and endurance after six weeks training , a result which is similar to those of previous studies . bronfort et al . compared muscular strength among three different types of exercise mode . they found that trunk strengthening exercise combined with spinal manipulation and trunk strengthening exercise combined with non - steroid anti - inflammatory drugs elicited greater improvements than spinal manipulation combined with the trunk stretching exercise32 . they also found a significant improvement in trunk muscular strength at the 11th week . according to a previous study18 , a significant increase in the activation of the rectus abdominis was elicited by exercising on a swiss ball indicating that exercise on an unstable surface had increased the difficulty of exercise and the muscular activation . chok et al . measured the maintenance time of trunk extensor endurance as the training outcome . in their study , sub - acute lbp patients were randomly assigned to a control group or a experiment group . the experimental group attended exercise training for six weeks , but the control group did not . after the exercise training , the maintenance time of trunk extensor endurance was not a significantly different between the two groups , despite the experimental group having better maintenance time of trunk extensor endurance than the control group at weeks 3 and 633 . in contrast , bronfort et al . found that subjects in the trunk muscular strength exercise groups showed greater improvements in back extensor endurance than the other two groups at week 11 , but not at week 532 . the slope of the median frequency indicates neuromuscular fatigue and a positive slope indicates the absence of neuromuscular fatigue ; a negative slope indicates the presence of neuromuscular fatigue , and a more negative slope indicates a higher level of neuromuscular fatigue . the present study found that the slope of the median frequency of the multifidus muscles was a more negative value at baseline than after training . this result means the multifidus muscles had a lower level of neuromuscular fatigue in the endurance test after training . in the study of oddsson et al.16 , the lbp group carried out trunk extensor endurance tests at 40% and 80% mvc in a standing position . their results of that study show the slope of the median frequency at 40% mvc ranged from 0.03 to 0.26 ( hz / s ) , and the median value was 0.035 ( hz / s ) , indicating neuromuscular fatigue did not accumulate . in that study , subjects performed 40% mvc , as in our study ( about 52% mvc ) , but the testing position in that study was standing , which differed from our study . to the best of our knowledge , most studies which have measured trunk extensor endurance as an exercise outcome have used the maintenance time rather than the slope of the median frequency . few studies have used the slope of median frequency to compare the difference between healthy subjects and the lbp subjects . our present study , used the slope of the median frequency , and found there was a significantly more negative slope for the left multifidus at baseline in pre - training for the training group , indicating a higher level of neuromuscular fatigue at the pre - training measurement than at the post - training measurement . the training group had a border - line significantly higher level of neuromuscular fatigue at the pre training measurement for the right multifidus relative to the post - training measurement . twelve patients participated in this study , and there were randomly allocated to the training group and the control group , with seven subjects in the training group and five subjects in the control group . a trail with 80% power and a level of significance of 5% ( two tailed ) was calculated to require approximately 20 patients in the training group to detect significant differences between pre- and post - training . another limitation of this study was that the training lasted for only 6 weeks . this may not have been long enough time to improve local muscular endurance . in our results , the slope of the median frequency showed a significant improvement for the left side multifidus but not for the other back muscles . prolonged exercise training may lead to greater improvements in muscular endurance of the other back muscles . the exercise program should be prolonged for chronic lbp patients to try to achieve greater improvement . the slope of the median frequency for objectively measures neuromuscular fatigue and should be considered as a parameter for assessing the training effects .
[ purpose ] the purpose of this study was to investigate the effects of 6 weeks sling exercise training for clients with low back pain on the levels of pain , disability , muscular strength and endurance . [ subjects and methods ] twelve chronic lbp subjects participated in this study . subjects were randomly divided into a control group and a training group . subjects in the training group performed sling exercise training for six weeks , and participants in the control group did not perform any exercise . [ results ] pain , disability levels and muscular strength significantly improved in the training group , but not in the control group . the left multifidus showed a significant improvement in muscular endurance , measured as the slope of the median frequency after training . [ conclusion ] six weeks of sling exercise training was effective at reducing pain intensity , and improving the disability level and trunk muscular strength of subjects with low back pain .
the inhalational anaesthetic agents presently available are metabolised only to a small extent and are largely exhaled unchanged . this property can be taken advantage of , to perform successful , economic and safe low flow anaesthesia ( lfa ) . the aim of our survey was to get data on the current practice of lfa in india . the amount of volatile anaesthetic agents extracted is directly proportional to the fresh gas flow ( fgf ) into the breathing circuit and system . when high fgf are used , 90% of the volatile agents are unused and are emitted as waste anaesthetic gases ( wag ) into the operation theatre ( ot ) environment or to the atmosphere , exposing those in the ot to health hazards and adding on to the greenhouse effect as well as ozone depletion . a survey on lfa found that the routine use of lfa would circumvent the initial expenditure in months by saving on expenses on volatile agents and carrier gases . another study found that educating the anaesthesiologists was very effective in reducing the fgf rates used thereby contributing to overall cost reduction of anaesthesia . in a geostatistical assessment of anaesthetic gases in ot and exposure to staff , high average concentration of nitrous oxide ( 8445 ppm with peak 1345 ppm ) was detected with high occupational hazard potential for staff in ot . gas scavenging is the most practical way to control or remove wag from ot environment . it is the responsibility of the institution to provide effective scavenging system or continuous flow fresh air ventilation systems to prevent waste gas accumulation in the ot environment , as well as to organise and document a programme of maintenance and checking of all anaesthetic equipment . questionnaires on the use of lfa and the choice of inhalational anaesthetic agents were distributed among 200 anaesthesiologists who visited a business promotion stall during the national conference of indian society of anaesthesiologists . the questionnaire was validated by collecting data from anaesthesiologists working in our centre . from the same group of anaesthesiologists , the difference between the survey responses at these time intervals was tested and found to have no significant difference . this , validated the questionnaire and we found it to be reliable . the questionnaire contained sixteen questions pertaining to the demography , practice of lfa , routine use of workstations , scavenging systems , gas analysers and choice of volatile agents as well as carrier gas preference . the questionnaire contained two parts , the first part intended to collect general information such as years of experience in anaesthesia , region of practice , subspecialty of the participant if any and the practice setting of the participant . the second part dealt with questions specific to the practice of lfa , use of oxygen analysers and agent analysers , routine use of etco2 monitors and bispectral index ( bis ) monitors , type of anaesthesia machine being used routinely , preferred carrier gas and volatile agent as well as the volatile agent in routine use [ appendix 1 available online ] . survey responses were analysed using statistical package for the social sciences version 11 , by spss inc . categorical data were analysed using pearson 's chi - square test and fisher 's exact test and was considered statistically significant if p < 0.05 . a total of 166 questionnaires were returned , making a response rate of 83% . of these two were omitted due to the disparity in facts presented , thus obtaining a response rate of 82% . demographic variables the maximum number of respondents to our survey were in the early years ( 05 ) of anaesthesiology practice ( 42% ) . response analysis showed that 52.4% were from south india whereas 39% were from north india , with a skewing of response population to south india . the question on practice setting of the respondents yielded responses as 48.7% practicing in the general surgery setup , 37.8% respondents practicing paediatric anaesthesia and other subspecialties together accounted for 23.6% . responding to the question on routine practice of lfa , 73.8% of the respondents practiced lfa routinely [ figure 1 ] . regarding the use of low flow routinely in government hospitals , our survey revealed that 63% of those who practiced in teaching government hospitals practiced lfa . of those respondents who used low flows routinely , 31.9% used a low flow rate of 0.51 l. of the respondents who claimed to use low flows , 10.4% were using flows more than 2 l , which does not qualify as low flow [ figure 2 ] . regarding reduction of flows , 48.5% reduced the flows after 10 min of induction while 32.1% reduced the flows after 15 min . most of the respondents ( 44.5% ) used oxygen concentration of 3040% whereas 26.8% used 4150% o2 concentration . routine practice of low flow anaesthesia fresh gas flow rates during routine use of low flow anaesthesia oxygen analysers were used by 50.6% respondents while using low flows whereas agent analysers were used by only 36% . of the respondents , 54.8% preferred nitrous oxide as their carrier gas while performing general anaesthesia ( ga ) . workstations were available for performing lfa for 64.6% anaesthesiologists and minimum alveolar concentration ( mac ) values were displayed by 43.9% of the machines used . analysis of our data showed that of the 32% respondents from government teaching hospitals who performed lfa only 27% had workstations to perform the same , revealing that 5% of those who used low flows were lacking adequate facilities to conduct the same . there seemed to be a paucity of workstations , especially in the nonteaching government hospitals . only 33% of respondents worked in a setup with scavenging systems [ table 2 ] . of those who practiced low flow in paediatric setting , 50% had agent analysers whereas 98% used etco2 monitoring and 20.6% bis monitoring . the maximum percentage of the respondents used fgf at the rate of 0.51 l and 56% used o2 concentration of 3040% [ table 3 ] . availability of workstations , scavenging systems and minimum monitoring equipment for anaesthesiologists practicing low flow anaesthesia in india practice of low flow anaesthesia in paediatric subspecialty by survey respondents and monitoring facilities utilised by them the use of etco2 , oxygen analysers , agent analysers and bis monitoring were compared between the government and private setup using chi - square test and no statistically significant difference was found . the concentration of o2 used during lfa in both government as well as private setup was also analysed using fisher 's exact test and found to have no statistical difference ( p = 0.584 ) . on routine overall use of volatile agents , 55.5% said they used sevoflurane , 54.7% used isoflurane,30.3% used halothane and 11% used desflurane [ figure 3 ] . when asked about the agent of their choice , 32.9% preferred sevoflurane , 15.2% preferred isoflurane and only 1.2% preferred halothane . volatile agents routinely used ( some respondents chose more than one volatile agent as routinely used ) with the availability of sophisticated and modern anaesthesia workstations anaesthesiologists can practice safe lfa , cutting down the economic burden as well as contributing to a greener earth . we conducted this survey to collect evidence on the practice of lfa in india as we found lack of surveys on this practice in indian setup . the practice is prevalent among anaesthesiologists of india with no statistically significant difference between government and private sectors . even now , there is a significant number who do not practice lfa in india ( 26.2% of respondents ) . high flows without scavenging system is a far from ideal situation posing significant health , financial and environmental risks . analysis of our survey results revealed that there are lacunae in concepts regarding true lfa as 10.4% respondents answered that they used > 2 l flows and still were under the impression that they were performing lfa . lfa starts with high flows of 46 l / min and then is reduced to 1 l / min after 10 min . for minimal flow anaesthesia how long after induction are flows reduced , 48.5% responded that they reduced flows after 10 min , which is in accordance with the teaching of lfa . of the respondents , 32.1% decreased the flows in 15 min whereas 15.7% in 20 min . the more reliable method has to be one based on mac and the end tidal concentration of gases , including volatile anaesthetic agents . during anaesthesia initially , the uptake of n2 o and volatile agents are high and decreases with duration of anaesthesia . once the fgf is reduced , an inspiratory oxygen concentration level of 30% can be maintained with a fresh gas o2 concentration of 5060% . on querying about o2 concentrations used routinely with low flows , 45.1% responded that they still use 3040% o2 concentration in fresh gas flow . the minimum monitoring required for lfa include the use of oxygen and agent analysers , inspired and expired co2 monitoring , monitoring minute ventilation and peak pressure . to know the monitoring standards while using low flows , we included questions on the use of agent and oxygen analysers and use of etco2 and bis . evaluation of survey responses reveal that there is a paucity of monitoring equipment as well as provision of modern workstations and scavenging systems in our country which may be an obstacle in practicing lfa safely [ table 2 ] . nitrous oxide is used in current anaesthesia practice primarily to facilitate a reduction in the use of opioids and other anaesthetic agents and to facilitate quicker induction when newer inhalational agents are unavailable . when using air as a carrier gas during lfa , a mild increase in the concentration of the inhaled anaesthetic agent ( 0.20.25% of mac value ) is to be used . bis monitoring is desirable when air is used as a carrier gas for detection of intraoperative awareness . nitrous oxide is still the preferred carrier gas for 54.2% respondents . n2 o accounts for around 6% of the heating effect of greenhouse gases in the atmosphere . the national institute for occupational safety and health , usa recommend 25 ppm as recommended exposure limit for n2 o ( for 8 h ) . there is a lack of use of scavenging systems in most of the ots in india as revealed by our survey . all gases delivered from the anaesthesia machine are released to the atmosphere which adds to the greenhouse effect . the molecules of halothane , isoflurane and enflurane pass to the stratosphere where they are dissociated by the uv radiation to release free chlorine that acts as a catalyst in the breakdown of ozone . although the contribution to the global release is very small from anaesthesia practice , we have a clear duty to minimise the release of these chemicals into our atmosphere . the atmospheric lifetimes of desflurane are 21.4 years , sevoflurane 1.4 years and isoflurane 3.6 years . as revealed by our survey results , although only 3% opted for halothane as their agent of choice , 30.3% were forced to use halothane routinely , most probably because there were no alternatives in their workplace . provision of modern anaesthesia workstations with mac monitoring is essential to the safe and successful practice of lfa . around 80% of the respondents had workstations although mac value display was available only for 43.9% respondents . the initial investment cost of workstations with agent analysers and scavenging system may be an obstacle for the widespread practice of lfa in our country . ryan and nielsen in their article on global warming potential of inhaled anaesthetics have suggested methods to reduce the environmental pollution by a certain change of practice by anaesthesiologists such as avoiding n2 o use and using low flows . the limitations of the study were that , as the conference was conducted in south india , there is a skewing of population to the south , and second , the cross section who participated in the survey itself is very small . in future , more information can be gathered by more institution based studies comparing the cost effectiveness of lfa in india . continuing education , feedback enquiries and hospital and government implemented guidelines can contribute to better and safe anaesthetic practices in our country . our survey revealed that low flow anaesthesia is being practiced in india by many anaesthesiologists . there is a lack of adequate monitoring facilities and scavenging systems . in a large country like ours , with lots of health care facilities performing surgeries under general anaesthesia , our role in adding to global warming and ozone depletion
background and aims : with the availability of modern workstations and heightened awareness on the environmental effects of waste anaesthesia gases , anaesthesiologists worldwide are practicing low flow anaesthesia ( lfa ) . although lfa is being practiced in india , hard evidence on the current practice of the same from anaesthesiologists practicing in india is lacking and hence , we conducted this survey.methods:a questionnaire containing 16 questions was distributed among a subgroup of anaesthesiologists who attended the 2014 national conference of indian society of anaesthesiologists . the filled - in questionnaires were computed and analysed with spss version 11.results:the response rate to the survey was 82% . about 73% of the respondents practiced lfa routinely , with 65% having workstations . most of the anaesthesiologists used fresh gas flows < 1.5 l / min with 45.1% using o2 concentrations at a range of 3040% . etco2 monitoring was used routinely by most whereas use of agent analysers and bispectral index monitoring were restricted . the availability of scavenging system was also limited to only 33.5% . majority preferred n2 o as carrier gas and sevoflurane as volatile agent of their choice.conclusion:our survey revealed that practice of lfa in india has numerous lacunae . provision of better monitoring facilities , workstations as well as awareness regarding the environmental issues of waste anaesthetic gases need to be addressed .
alzheimer s disease ( ad ) and related dementias cause impairment in functional abilities , including ability to drive . over half a million individuals in canada have a diagnosis of ad , and in nova scotia , approximately 5,400 individuals with a diagnosis of ad continue to drive . following a diagnosis of ad , almost 50% of individuals will be involved in a motor vehicle collision ( mvc ) within five years . ad affects driving by reducing reaction time and the ability to shift visual attention from one stimulus to another for example , from a car in front of the vehicle to a pedestrian crossing the street . early loss of insight may prevent individuals with ad from accurately appraising their driving abilities and foster optimistic bias , the idea that bad things ( mvcs ) only happen to other people . thus , individuals with ad rarely relinquish their driving privileges voluntarily and often cease driving only after being involved in an mvc . caregivers frequently do not plan for driving cessation , and there is often a lag between the recognition of cognitive deficits on the part of the caregiver and the initiation of the driving cessation process . this lag may be due to the caregivers lack of knowledge about dementia and its impact on driving or fear over increased burden of care if the affected individual can no longer drive . therefore , physicians are routinely responsible for initiating the driving cessation process by contacting the appropriate authorities . in canada , reporting guidelines concerning fitness to drive vary by province and territory . all but three canadian provinces mandate that physicians report potentially unsafe drivers to provincial licensing authorities ; however , national survey data indicate that many physicians , regardless of mandatory reporting , do not feel comfortable in assessing driving safety . the canadian medical association ( cma ) guidelines for the assessment of driving in dementia are designed to provide a unified physician approach to the assessment of dementia patients ; however , these guidelines does not offer conclusive answers for case - by - case usage , and there is no failsafe test to predict which individuals with dementia are at significant risk of mvc . in nova scotia , reporting of unsafe drivers is at the discretion of the physician . physicians must therefore consider not only the underlying disease , but also the interest of the patient and family ( many of whom reside in rural areas and are highly dependent on personal vehicles for transportation ) , the welfare of the community , medical ethics , and their own personal comfort and confidence in assessing fitness to drive . this study sought to assess perceived barriers to addressing driving safety in dementia among nova scotian primary care physicians ( pcps ) and to determine whether these barriers differ between urban and rural physicians or according to years of practice . this cross - sectional study targeted nova scotian pcps . for study inclusion , physicians surveyed were required to be english speaking with a practice in nova scotia that included patients with dementia . drawing upon published literature an anonymous 33-item survey was developed with questions evaluating pcp demographics and general practice ( n = 7 questions ) , practices in evaluating fitness to drive ( n = 13 ) , opinions regarding the assessment and reporting of fitness to drive ( n = 8) , and resource use ( n = 6 ) . the survey was reviewed by four geriatricians who provided feedback on content validity and readability prior to survey circulation . surveys ( n = 134 ) were distributed to pcps attending a canadian medical education refresher held in halifax , nova scotia in 2008 . an electronic version of the questionnaire ( hosted on dalhousie university s opinio web server ; opinio version 5 , object planet , inc , oslo , norway ) was distributed via email to a registry of approximately 700 pcps practicing in nova scotia . as an incentive survey participants were asked to email their name and address to a generic email account for entry into a draw for a $ 100 gift card to a nova scotian gas station . the institutional research ethics board of the capital district health authority in halifax approved the study protocol . implied consent was obtained ; pcps reviewed a cover letter describing the research and decided whether to complete and submit the survey . survey response data were examined using descriptive statistics and multivariate linear and logistic regression controlling for sex , community of practice , and years of practice . all descriptive statistics reported are based on the number of responses obtained for each question . this cross - sectional study targeted nova scotian pcps . for study inclusion , physicians surveyed were required to be english speaking with a practice in nova scotia that included patients with dementia . drawing upon published literature an anonymous 33-item survey was developed with questions evaluating pcp demographics and general practice ( n = 7 questions ) , practices in evaluating fitness to drive ( n = 13 ) , opinions regarding the assessment and reporting of fitness to drive ( n = 8) , and resource use ( n = 6 ) . the survey was reviewed by four geriatricians who provided feedback on content validity and readability prior to survey circulation . surveys ( n = 134 ) were distributed to pcps attending a canadian medical education refresher held in halifax , nova scotia in 2008 . an electronic version of the questionnaire ( hosted on dalhousie university s opinio web server ; opinio version 5 , object planet , inc , oslo , norway ) was distributed via email to a registry of approximately 700 pcps practicing in nova scotia . as an incentive survey participants were asked to email their name and address to a generic email account for entry into a draw for a $ 100 gift card to a nova scotian gas station . the institutional research ethics board of the capital district health authority in halifax approved the study protocol . implied consent was obtained ; pcps reviewed a cover letter describing the research and decided whether to complete and submit the survey . survey response data were examined using descriptive statistics and multivariate linear and logistic regression controlling for sex , community of practice , and years of practice . all descriptive statistics reported are based on the number of responses obtained for each question . of the 159 surveys completed ( 79 paper , 80 electronically ) , 134 met the inclusion criteria and were included for analysis . surveys excluded were completed by physicians who did not practice in nova scotia ( n = 19 ) or did not treat patients with dementia ( n = 6 ) . physicians were primarily female ( 71 , 53% ) , practicing in an urban community ( 77 , 58% ) with a mean sd of 17.911 years experience as a pcp . driving evaluations for patients with a diagnosis of dementia were typically considered to be a part of routine practice ( 95 , 71% ) , with assessments most often being done on diagnosis ( 73 , 55% ) or by mild stage ( 42 , 31% ) and taking less than 30 minutes ( 124 , 93% ) . physicians reported referring patients for on - road assessment ( 94 , 70% ) and to other health care professionals ( 88 , 66% ) , usually a geriatrician ( 66/88 , 75% ) . number of years of practice was associated with more lengthy discussions about driving cessation ( p = .03 ) , and was positively associated with the probability both of having a routine discussion about driving and dementia ( p = .03 ) and of referring for an on - road assessment ( p = .02 ) . some ( n = 17 ) physicians reported feeling comfortable in assessing driving safety ( 10 , 59% male , 10 , 59% rural ) . however , more than half of those surveyed ( 93 , 69% ) said they at least sometimes avoid discussions about driving cessation . neither comfort in assessing driving safety nor avoidance of discussions was associated with type or years of practice . concern about personal or corporate liability was most common , as indicated by 78% ( n = 105 ) of respondents . physicians were instructed to select all of the tools they used to assess fitness to drive for patients with dementia and were given the opportunity to include items not listed . almost all pcps reported using the mini - mental state examination ( mmse ) when assessing driving ability ( 124 , 92% ) . of those surveyed , 84% ( n = 112 ) were aware of the cma guidelines for determining medical fitness to operate a motor vehicle . while 60% ( n = 80 ) reported using the guidelines in practice , only half of respondents rated it as useful ( 63 , 47% ) . no association was found between use of the national guidelines and years of practice , sex , or type of practice . few physicians ( 32 , 24% ) indicated that they used other resources regarding driving cessation in dementia ( such as information from the nova scotia registry of motor vehicles and the alzheimer society of canada ) . when asked specifically , 97% ( n = 130 ) of respondents indicated their interest in accessing more education tools and resources such as a website regarding driving cessation in dementia . most respondents considered discussions about driving safety to be a part of the routine assessment of patients with dementia and recognized their role in reporting elderly drivers . the results of a recent american study examining physician attitudes and practice regarding fitness to drive for individuals with dementia are comparable with our findings that physicians with more years experience are more likely to routinely address driving issues . many of our respondents reported lack of familiarity with current guidelines as a barrier to assessing driving safety in dementia . physician relationships was a common barrier to driving assessment in a national survey , regardless of discretionary or mandatory reporting policies , our result may be in part related to nova scotia s provincial discretionary reporting policy , whereby physicians are not obligated to report concerns about unsafe drivers to the registry of motor vehicles . interestingly , national data indicate that physicians in provinces with mandatory reporting are less likely to assess fitness to drive than those practicing under a discretionary reporting system , but are more likely to report unsafe drivers . ultimately , until there is a reliable and validated office tool , pcps will continue to face challenges in assessing fitness to drive in dementia . although it has been proposed that fitness to drive is not maintained once mmse scores fall to 24 , a recent meta - analysis found that mmse scores are no more reliable than a simple driving knowledge test in predicting on - road driving performance ( e.g. , recognizing traffic signs ) during driving assessments . the clock draw test , less often used by nova scotian pcps , has been shown to predict poor performance on driving simulators ( overall prediction 90% ) . however , these results have yet to be replicated and confirmed with on - road performance . furthermore , while the american academy of neurology recently recommended using the clinical dementia rating ( cdr ) scale combined with caregiver input , driving history , changes in driving behavior , an mmse score 24 , and aggressive behavior as useful for identifying patients at increased risk for unsafe driving , the cdr is not often used by pcps . few respondents listed the montreal cognitive assessment ( moca ) as a tool they use to inform driving assessment . while screening tools for mild cognitive impairment ( mci ) such as the moca are gaining popularity among general practitioners , there is no evidence supporting the use of the moca as an indicator of fitness to drive in mci or dementia . in particular , the implications of a diagnosis of mci for driving safety are not addressed by national guidelines . further , the moca has variable specificity for the diagnosis of mci and dementia , and research indicates that individuals with mild dementia may still drive safely . given the discomfort associated with addressing driving safety for patients with dementia , and the lack of a validated in - office assessment tool , it is not surprising that many physicians refer their patients either for additional assessment by another health care professional or for on - road assessment . the recently released screen for the identification of cognitively impaired medically at - risk drivers , a modification of the demtec ( simard md ) tool a pen - and - paper test that evaluates memory , attention , judgment , and decision making is being pilot tested in british columbia . unfortunately , at least one - half of patients tested will still need on - road evaluation due to an indeterminate result . we do not have data regarding the practices of pcps who did not complete the survey . however , our sample did include a variety of practice profiles in terms of urban compared with rural practice , practitioner s sex , and number of years of practice , and our results are consistent with those of other studies of physician s attitudes toward assessing fitness to drive for dementia , as well as the elderly in general . nova scotian pcps continue to report discomfort with assessing fitness to drive in dementia and are eager to access information and resources . in response to this identified gap in knowledge transfer , we partnered with the canadian dementia knowledge translation network ( www.lifeandminds.ca ) to create an online educational resource for nova scotian physicians and caregivers of individuals with dementia ( www.notifbutwhen.ca ) . the resource contains educational materials , assessment information , and tools for both physicians and caregivers to promote healthy driving cessation . further study , following release and promotion of a provincially relevant online resource , will help clarify the impact of the resource on practice habits .
background and purposeover half a million canadians have a diagnosis of dementia , approximately 2530% of whom continue to drive . individuals with dementia have a risk of motor vehicle collision up to eight times that of drivers without dementia . in nova scotia , the responsibility of reporting unsafe drivers is discretionary , but national survey data indicate that many physicians do not feel comfortable assessing driving safety . we report on barriers to addressing driving safety as identified by nova scotian primary care physicians ( pcps).methodswe conducted a cross - sectional study of surveys completed by 134 english - speaking , nova scotian pcps ( mean years of practice 17.911 ; 53% female ; 58% urban ) . statistical analysis included descriptive statistics and multivariate linear and logistic regression ( controlling for sex , urban / rural , and years of practice).resultsmost pcps ( 96% ) routinely address driving safety in dementia , but physicians at all levels of experience find these discussions uncomfortable and sometimes avoid them . pcps experience multiple barriers to assessing driving in dementia and desire further education and resources.conclusionsin nova scotia , driving assessment is considered part of routine care in dementia , but general lack of comfort in administering these assessments is a risk . to improve physician comfort further education and resources are required .
brca1 and brca2 are the most well known gene mutations responsible for an increased risk for developing breast cancer . a brca1 or brca2 mutation carrier ( brca - mc ) has approximately a 3% risk of getting breast cancer before the age of 30 . this risk increases to almost 50% when she reaches the age of 50 and becomes 5080% at the age of 70 [ 1 , 2 ] . to reduce this risk , these women can choose between bilateral prophylactic mastectomy , oophorectomy or chemoprevention . in breast cancer , close surveillance contributes to a more favorable stage of disease at detection and may reduce the rate of death from breast cancer [ 6 , 7 ] . in the surveillance or general screening for breast cancer , however , due to the young age and thus in most cases dense breast tissue , the sensitivity for mammography is moderate . false - negative rates of up to 62% have been reported for mammography in screening gene mutation carriers [ 8 , 9 ] . a malignant lesion in the breast is mammographically best detected if it presents itself as an ill - defined or spiculated mass , a group of microcalcifications or as an architectural distortion . a smoothly outlined well - defined mass detected on mammography has a chance of less than 1% of being malignant [ 10 , 11 ] . kaas et al . [ 13 , 14 ] have evaluated the mammographic appearance of breast cancer in brca - mc . tilanus and coworkers found the mammographic appearance suspicious for a malignancy in only 38% of the gene carriers in comparison with 71% in a control group . prominent pushing margins caused by a continuous front of tumor cells not separated by connective tissue were described in the brca - mc group as the main reason for a false - negative evaluation of mammograms . kaas and coworkers concluded in their study of 31 breast cancer cases in brca - mcs that all mammographically detected lesions should be further evaluated by ultrasound and biopsy regardless of their appearance . well - defined mammographic tumors correlated in 83% with histologic circumscribed tumor margins in brca1-mcs . for women with an increased risk for developing breast cancer magnetic resonance imaging ( mri ) should be included for close surveillance [ 15 , 16 ] . the superior sensitivity of mri ( 81% ) for the detection of breast cancer in these women compared with mammography ( 40% ) has been proven in literature . however the classification of a lesion detected on mr as benign or malignant still remains a challenge . focal masses with smooth borders are associated with a high negative predictive value for malignancy . an irregular lesion contour , inhomogeneous enhancement pattern and rim enhancement have been reported as features indicating malignancy . the dynamic evaluation is often based on the enhancement characteristics 27 min after the injection of a paramagnetic contrast agent . in this approach , the decrease of signal intensity , often referred to as a type 3 curve or washout , is highly predictive for breast cancer , with a likelihood of malignancy of 87% . until now the appearance of breast malignancies in brca - mcs has only been investigated for mammography . in this study we analyzed the mri characteristics of brca - mc - associated tumors compared with sporadic cases of breast cancer . all available ( 35 ) brca - mcs with a biopsy - proven malignancy , imaged with mri for screening or pre - operative evaluation in the period from july 2000 until november 2006 , were included in the study : 23 brca1 carriers and 12 brca2 carriers . in order to compare tumor characteristics with sporadic cases of breast cancer an age , tumor type and tumor size matched control group was composed from 206 consecutive sporadic breast cancer cases imaged with mri in the period from november 2001 until january 2007 . all brca - mc cases were age matched within 5 years with sporadic breast cancer cases . cases were also matched for tumor type ( idc , ilc or dcis ) and pathological tumor size . for size matching , the brca - mc cases were matched to the closest tumor size in the sporadic cases available , with a limit for the maximum size difference of 0.5 cm for tumors smaller than 1 cm , 1-cm difference for tumors up to 5 cm and 1.5-cm difference for tumors larger than 5 cm . mammograms were obtained in the mediolateral oblique and craniocaudal direction on a digital mammographic unit ( senograph 2000 d or a senograph ds , ge healthcare , wis . , usa ) . detection , density of the lesion compared with breast tissue , lesion morphology , and size were scored . in the morphologic assessment , lesion type was classified as either a mass , a calcifications or as an architectural distortion . lesion shape was described as rounded , lobulated or irregular and lesion margins as sharp , vague or spiculated . the size of the tumor was measured by determining the longest axis through the displayed lesion . spiculae surrounding a solid lesion were interpreted as desmoplastic reaction and not included in the measurement . mri investigations were performed on a 1.5-tesla system with a double breast coil ( magnetom vision , sonata or symphony , siemens , erlangen , germany ) . in the scanning , we used a coronally orientated three - dimensional fast low - angle shot ( flash 3d ) with the following parameters : te 4 ms , tr 8.1 ms , fa 20 , fov 360 mm , ta 96 s , image resolution 1.5 mm 1.5 mm 1.5 mm for all patients scanned prior to june 2004 and te 4 ms , tr 7.5 ms , fa 8 , fov 320 mm , ta 87 s , image resolution 1.3 mm 1.3 mm 1.3 mm for all patients scanned after june 2004 . all patients were placed in the prone position , with the breasts in the double breast coil and positioned at the isocenter of the magnet . after localizer images were obtained in three directions and a precontrast flash 3d series was recorded , 0.1 mmol / kg bodyweight gadolinium chelate ( magnevist , schering , germany or dotarem , guerbet , the netherlands ) was administered using a power injector ( spectris , medrad , usa ) at 2.5 ml / s followed by a 15-ml saline flush at the same injection rate . all mri examinations were retrospectively evaluated on a dedicated breast mri workstation ( dynacad , invivo , usa ) scoring lesion detection , size , morphology and enhancement kinetics . maximum intensity projections , coronal images and axial reconstructions of both the t1 weighted and subtracted images and time - intensity curves were displayed . the enhancement pattern of a lesion was classified as homogeneous , heterogeneous or rim enhanced . lesion enhancement kinetics were evaluated according to the criteria described by kuhl et al . . type 2 shows a plateau after initial increased enhancement , where the maximum signal intensity is reached approximately 23 min after contrast injection and remains constant . this type of curve is seen in both benign and malignant lesions . in a type 3 curve , the peak enhancement is reached in the early postcontrast phase , and this is followed by a decrease of signal intensity ( wash - out ) . the dynamic curves were evaluated based on a single voxel or by selecting a region of interest within the lesion , the workstation allowed the readers to use both methods . because of the possible bias in this retrospective study , a bi - rads classification could not be scored objectively and was therefore not included in the evaluation . except from the knowledge of a malignancy being present , the radiologists were blinded to any other clinical information . , the tumor type , size and mitotic activity index ( mai ) were recorded . the study was approved by the institutional review board ; since the study was performed retrospectively , informed consent was not required according to the review board . in the statistical evaluation , differences in patient and tumor characteristics between the brca - mc and control group were analyzed using an independent sample t - test if variables were continuous and normally distributed . for categorical variables , the pearson chi - square test was used and we used fisher s exact test when any of the expected values was less than five . pearson s correlation coefficients were calculated for both mammographic size and mri size versus pathologic size . six brca - mc cases could not be matched according to the criteria defined ; these cases were excluded from the study . four brca - mcs were excluded because no match could be found based on patient s age ; the other two were excluded because no match could be found based on tumor size . the mean age and tumor size of the excluded cases were , respectively , 33 years ( range 2736 , median 35 , sd 3.4 years ) and 1.4 cm ( range 0.62.8 cm , median 1.1 cm , sd 0.8 cm ) . a total of 29 brca - mc cases were included for this study . in the brca - mc group , five women were symptomatic ( 17% ) ; 21 women were symptomatic in the control group ( 83% ) . mean age in the brca - mc group was 42 years ( range 3268 years , median 40 years , sd 8.0 years ) ; this was 44 ( range 3764 years , median 43 years , sd 5.6 years ) for the control group . the mean pathological tumor size was 2.0 cm ( range 0.47.0 cm , median 1.4 cm , sd 1.5 cm ) in the brca - mc group and 2.3 cm ( range 0.67.0 cm , median 1.9 cm , sd 1.7 cm ) in the control group . no significant difference was found for patient age ( p = 0.289 ) or maximal pathological tumor size ( p = 0.371 ) . the mean tumor size on mammography was 2.1 cm ( range 0.57.0 cm , median 1.5 cm , sd 1.49 cm ) . the mean tumor size on mri was 2.4 cm ( range 0.67.1 cm , median 1.8 cm , sd 1.75 cm ) . there was a significant correlation between imaging measurements and pathological measurements < 0.001 ) for mri measurements . in both the brca - mc and control groups , 23 cases were based on invasive ductal carcinoma ( idc ) , two cases on invasive lobular carcinoma ( ilc ) , one case on ductal carcinoma in situ grade 1 ( dcis1 ) and three cases on ductal carcinoma in situ grade 2 ( dcis2 ) . in the brca - mc group , a mean mai of 33.0 ( range 6100 , median 27 , sd 27.1 ) was found , compared with 17.5 ( range 160 , median 14 , sd 15.9 ) in the control group . the difference in mai between the brca - mc and control groups was found to be significant ( p = 0.044 ) . in the control group , therefore , the overall detection is significantly better with mri than with mammography ( p = 0.021 ) . mammography detected 22 ( 76% ) lesions in the brca - mc group and 22 ( 79% ) in the control group . all lesions missed on mammography in the brca - mc were idc . in the control group , lesions in the brca - mc group were significantly more described as rounded ( 12//19 vs 3/13 , p = 0.036 ) and were more often described to have sharp margins ( 9/19 vs 1/13 , p = 0.024 ) . lesions in the control group were significantly more described as irregular ( 10/13 vs 6/19 , p = 0.029 ) . from the six brca - mcs that were excluded , only three lesions were detected on mammography . in two cases a mass was detected and in one case calcifications . table 1mammographic lesion characteristics for both groups brca - mc groupcontrol groupp valuelesions detectedn = 22n = 22lesion typemass19130.042arch . distortion140.345calcification250.216lesion densityhyperdense810.050isodense11120.050lesion morphologyrounded1230.036lobulated11.000irregular6100.029lesion marginssharp910.024vague880.473spiculated240.194lesion density , morphology and margins of mass - like lesions only mammographic lesion characteristics for both groups lesion density , morphology and margins of mass - like lesions only on mri , 27 lesions ( 93% ) were detected in the brca - mc group , 28 ( 97% ) in the control group . the lesions missed in the brca - mc group were both cases of dcis , one case of dcis1 , seen on mammography as an architectural distortion , and one case on dcis2 , seen on mammography as a mass . the lesion missed in the control group was based on dcis2 , seen on mammography as calcifications . their was no significant difference found for the detection of breast cancer between mammography and mri within the brca - mc ( p = 0.18 ) or the control group ( p = 0.13 ) . lesions in the brca - mc group were significantly more often described as rounded ( 16/27 vs 7/28 , p = 0.010 ) , with sharp margins ( 20/27 vs 7/28 , p < 0.001 ) and to show rim enhancement ( 7/27 vs 1/28 , p = 0.025 ) . lesions in the control group were significantly more often described as irregular ( 18/28 vs 8/27 , p = 0.010 ) , with vague margins ( 15/28 vs 6/27 , p = 0.017 ) and with a heterogeneous enhancement pattern ( 22/28 vs 12/27 , p = 0.009 ) . no significant difference between the two groups was found for enhancement kinetics ( p = 0.667 ) . from the six brca - mcs that were excluded , five were detected on mri . the delineation was described as sharp in four and as vague in one of these cases . the enhancement pattern was described as homogeneous in two , heterogeneous in one and as rim - enhancement in two of these cases . table 2mri lesion characteristics for both groups brca - mc groupcontrol groupp valuelesions detectedn = 27n = 28lesion morphologyrounded1670.010lobulated331.000irregular8180.010lesion marginssharp207<0.001vague6150.017spiculated160.049enhancement patternhomogeneous850.304heterogeneous12220.009rim710.025enhancement kineticstype in this study , the overall false - negative rate for mammography was significantly higher compared with mri . although it is expected that the sensitivity for mri in both the control group and the brca - mc is higher compared with mammography , no significant difference was found in this study within the two groups . described in their mammographic study on brca1 and brca2 mutation carriers a sensitivity of 64% for the detection of a tumor in the original reports . in this study , since this was a retrospective study and the radiologist was aware of the fact that a tumor was present at the time of the evaluation , no conclusion can be drawn from the difference in detection between both studies . on mammography , the mass like lesions detected in the brca - mc group were significantly more often described as rounded . also , lesions were found to differ in margin appearance ; tumor margins in the brca - mc group were significantly more often described as sharp . a smooth , nonspiculated mass has previously been described by tilanus et al . as a reason for a false - negative mammographic evaluation in brca - mc . thus , although sickles et al . described that nonpalpable , circumscribed , noncalcified breast masses ( probably benign ) should be managed with periodic mammographic surveillance regardless of lesion size and patient age , and sardanelli et al . published that both the well - defined margins and the rounded shape are more often associated with benign lesions , these findings are not applicable to the brca - mcs studied in this or other studies on this subject . . stated that any mammographic mass in brca - mcs must be regarded with suspicion . an additional evaluation using ultrasound and biopsy of all lesions detected in brca - mc is mandatory , regardless of their morphological appearance . in their study of 28 brca - mcs , hamilton et al . also described the appearance of breast tumors on ultrasound . on ultrasound , 53% of the tumors were classified as either benign or indeterminate , making a biopsy of any detected mass inevitable . we are also of the opinion that any solid lesion detected in brca - mcs should be evaluated by a biopsy . in the screening of women with an increased risk for developing breast cancer , more tumors are detected by mri compared with mammography [ 8 , 9 ] . in this study , mri is known to have a lower sensitivity in detecting dcis compared with invasive carcinomas , especially in low - grade dcis . the low or intermediate contrast uptake that is often observed in pure dcis and the absence of a type 3 curve can result in a false - negative evaluation . kriege et al . found in the screening of 1,909 women with an increased risk for developing breast cancer , including 358 carriers of germ - line mutations , that mri missed five cases of dcis that were detected on mammography , with six noninvasive tumors detected in total in the study . however , kuhl et al . reported mri to be more sensitive for dcis compared with mammography in a prospective study of women with an increased risk for developing breast cancer . although mri proved to be more sensitive for the detection of dcis compared with mammography , not all cases of dcis were detected by either modality . therefore , at this point both modalities are still needed in the screening of women with an increased risk for developing breast cancer . similar to mammography , on mri a significantly higher number of lesions were described as rounded and with sharp margins in the brca - mc group . rim - enhancement was found to be significantly higher in the brca - mc group . the presence of this enhancement pattern has been associated with malignant lesions [ 26 , 27 ] . because mri enables the radiologist to evaluate the enhancement pattern of the lesion , where mammography does not , these lesions will become more suspectedly malignant , even though other morphologic features are more often seen in benign lesions . 1 ) with central necrosis or insufficient microvessel growth can be an indicator for the growth rate of tumors . jimenez and coworkers have described centrally necrotizing carcinomas to have an accelerated clinical course and early systemic metastasis . an accelerated growth rate can be associated with a high mai . in this study , this is in agreement with tilanus et al . , who also found the mitotic count to be significantly higher in tumors found in gene mutation carriers . the higher rate of sharp tumor margins and rim - enhancement may thus be explained by the more aggressive nature of tumors in brca - mcs . several authors have implied that , due to the rapid growth rate of tumors in gene mutation carriers , the screening frequency should be adjusted [ 13 , 29 ] . suggest a higher screening frequency in carriers because of the high number of interval cancers found in their group . mammography in carriers is not sensitive , particularly because the women are young and thus more often have dense breasts [ 30 , 31 ] . the use of mri in screening has already been a step forward since mri can detect smaller tumors , often occult for mammography , that are less likely to have progressed into lymph - node involvement . 1a an mlo mammogram from the right breast of a 42-year - old brca1-mutation carrier . an 11-mm sharply delineated rounded lesion is present on the mammogram projecting over the upper quadrants ( arrow ) . on mri , ultrasound guided core biopsy proved this lesion to be an invasive duct carcinoma a an mlo mammogram from the right breast of a 42-year - old brca1-mutation carrier . b a coronal subtraction mr image of the same breast . an 11-mm sharply delineated rounded lesion is present on the mammogram projecting over the upper quadrants ( arrow ) . on mri , ultrasound guided core biopsy proved this lesion to be an invasive duct carcinoma rounded , homogeneous enhancing lesions found on mri are in general not considered suspicious . a homogeneous enhancement pattern , found in nine brca - mcs , does not contribute to the malignant nature of these lesions . the dynamic analysis showed in both the brca - mc and the control groups a type 3 curve in , respectively , 82% and 71% of the cases . as described by kuhl et al . , a type 3 enhancement curve is highly indicative for malignancy . using this characteristic , even rounded , sharply delineated , homogeneous enhancing lesions become suspect malignant ( fig . 2 ) . 2a a coronal subtraction mr image from the right breast of a 49-year - old brca1-mutation carrier . lateral located in the right breast , a sharply delineated rounded , homogeneous enhancing lesion is visible with a longest diameter of 9 mm ( arrow ) . b the relative enhancement versus time curve . the type 3 curve seen for this lesion was the only characteristic indicating a possible malignancy . pathology proved this lesion to be an invasive duct carcinoma a a coronal subtraction mr image from the right breast of a 49-year - old brca1-mutation carrier . lateral located in the right breast , a sharply delineated rounded , homogeneous enhancing lesion is visible with a longest diameter of 9 mm ( arrow ) . b the relative enhancement versus time curve . the type 3 curve seen for this lesion was the only characteristic indicating a possible malignancy . pathology proved this lesion to be an invasive duct carcinoma despite all the findings discussed in this study , it remains questionable if the characterization of a lesion detected on either mammography or mri in brca - mcs is even necessary . as the chance for these women to develop breast cancer is significantly increased , almost any detected lesion will in practice be classified as suspect malignant until proven otherwise . found a positive predictive value for mr in women with an increased risk of only 53% due to a high number of false positives . as stated previously for mammographically detected lesions , additional evaluation by core biopsy is the only definitive classification for lesions detected in this group of women . in the case of mri screening in high risk women , short - term follow - up , target ultrasound or mri - guided biopsies are therefore often indicated . what the best strategy in this group of women will be , also in terms of cost effectiveness , needs to be further studied . we conclude that in brca - mc malignant lesions frequently have morphological characteristics that are commonly seen in benign lesions , like a rounded morphology or a sharp delineation . however , the possibility of mri to evaluate the enhancement pattern and enhancement kinetics of lesions enables the radiologist to detect characteristics suggestive for a malignancy .
the appearance of malignant lesions in brca1 and brca2 mutation carriers ( brca - mcs ) on mammography and magnetic resonance imaging ( mri ) was evaluated . thus , 29 brca - mcs with breast cancer were retrospectively evaluated and the results compared with an age , tumor size and tumor type matched control group of 29 sporadic breast cancer cases . detection rates on both modalities were evaluated . tumors were analyzed on morphology , density ( mammography ) , enhancement pattern and kinetics ( mri ) . overall detection was significantly better with mri than with mammography ( 55/58 vs 44/57 , p = 0.021 ) . on mammography , lesions in the brca - mc group were significantly more described as rounded ( 12//19 vs 3/13 , p = 0.036 ) and with sharp margins ( 9/19 vs 1/13 , p = 0.024 ) . on mri lesions in the brca - mc group were significantly more described as rounded ( 16/27 vs 7/28 , p = 0.010 ) , with sharp margins ( 20/27 vs 7/28 , p < 0.001 ) and with rim enhancement ( 7/27 vs 1/28 , p = 0.025 ) . no significant difference was found for enhancement kinetics ( p = 0.667 ) . malignant lesions in brca - mc frequently have morphological characteristics commonly seen in benign lesions , like a rounded shape or sharp margins . this applies for both mammography and mri . however the possibility of mri to evaluate the enhancement pattern and kinetics enables the detection of characteristics suggestive for a malignancy .
assuming that psychological status affects all medical conditions , researchers have focused on these psychological status ' roles especially on noncommunicable disease with almost unknown origin . the relationship of depression , anxiety , and psychological distress with chronic metabolic disease such as diabetes mellitus , insulin resistance , and dyslipidemia has been established . metabolic syndrome ( mets ) is a combination of metabolic risk factors such as impaired glucose level , dyslipidemia , hypertension , and central obesity that predispose persons to cardiovascular mortality and morbidity . obvious causes for this chronic condition have not been introduced and contributory factors in mets have been receiving attention . for instance , it was shown that mets associated with long - term depressive symptoms [ 5 , 6 ] , while another study reported absence of any association between mets , depression and anxiety . other lines of evidence have introduced prolong exposure to chronic psychological distress as an important risk factor for mets and have claimed there is an association between daily life stressors and metabolic syndrome ; however , empirical data on this field is little and needs more evaluation . on the other hand , the relationship of lower physical well - being and social function as indicators of qol with mets has been shown ; however , a study ascribed this association to obesity rather than mets . in general , findings about association of mets and poor quality of life ( qol ) are scarce . mets prevalence in iranian population comparing with other asian societies is high , varied from 11% of young adolescents under twenty years of age to 33% of persons who aged more [ 11 , 12 ] . similarly , the number of iranian patients who suffer from anxiety , depression , and psychological distress is high . therefore , we aimed to investigate association of depression , anxiety , psychological distress , and quality of life with metabolic syndrome in a sample of iranian as a population with high prevalence of mets . this cross - sectional study was designed among participants of isfahan cohort study ( ics ) . ics is a population - based cohort study on 6504 participants who were 35 years old from three counties of central iran ( isfahan , arak , najafabad ) [ 15 , 16 ] , which started in 2001 , for detecting mortality , morbidity , and risk factors of cardiovascular disease . informed consents were obtained from participants of both groups . there were 1520 subjects available in isfahan city from which 599 participants met adult treatment panel iii ( atpiii ) criteria for detecting mets at baseline that was described in details elsewhere . it was calculated that 254 subjects in each group would be required to detect a difference of at least 1 ( effect size ) in scores of psychological factors between mets and non - mets groups with 80% power ( = 0.2 ) at the 2-tailed 0.025 level of significance ( = 0.05 ) and standard deviation of 4 in both groups . using random sampling procedure in spss , 254 individuals with mets and the same number without it were selected and invited for filling questionnaires and new anthropometric and biochemical measurements . the response rate in mets group was lower than non - mets group ( 86.6% versus 96.4% ) ; therefore , the sample size of control group was increased to 300 subjects using this equation : 1/ncase + 1/ncontrol = 2/ncalculation . according to the new measurements , 5 participants did not fulfill atpiii criteria for mets anymore . in turn , 47 subjects without history of mets based on baseline measurements met mets criteria based on new measurements . in order to evaluate persistent mets , these individuals were excluded and 215 subjects with mets and 253 without it were included in analysis . power analysis was carried out using g*power 3.1.3 ( 18 ) for the ghq12 scores as the factor with the weakest association in this study ( table 2 ) . considering the actual sample size and real findings on this score , the minimum power of study was calculated as 81.7% ( post hoc power analysis ) . waist circumference ( wc ) was measured by tape , horizontally 1 cm above the navel . blood pressure was taken two times after five minutes resting in calm and comfortable room with 15-minutes interval ; finally mean of two blood pressure recordings was used for analysis . triglyceride ( tg ) , fasting plasma glucose ( fpg ) , and high - density lipoprotein cholesterol ( hdl - c ) were detected by an enzymatic method in elan 2000 autoanalyzer . friedewald formula was used for calculating low - density lipoprotein cholesterol ( ldl - c ) level except in individuals with tg 400 mg / dl which ldl - c level was measured directly . self - administered 12-item general health questionnaire ( ghq12 ) was used for assessing distress [ 18 , 19 ] . less than usual , no more than usual , fairly more than usual , or much more than usual were answers to questions of this questionnaire , which were scaled as ghq score method ( 0 - 0 - 1 - 1 method ) . according to this method sum of answers to total items were scored on a scale ranging from 0 to 12 . were evaluated by the hospital anxiety and depression scale ( hads ) [ 20 , 21 ] . the hads is a 14-item questionnaire consisting of two anxiety and depression subscales ; each one includes seven items . four point scale used for rating anxiety and depression , ranged from 0 to 21 with a cut - off value of 7 . in each subscales , higher score showed higher anxiety and depression . self - administered instrument european quality of life-5 dimensions ( eq-5d ) was used to evaluate qol . five dimensions of health including mobility , self - care , usual activity , pain / discomfort and anxiety / depression were evaluated by this instrument . three levels of severity presented for each domain as 1 ( no problems ) , 2 ( some problems ) , and 3 ( extreme problems ) . data entry was done using epi info , version 6 ( centers for disease control , atlanta , ga ) . data were analyzed by spss software , version 15 ( spss inc , chicago , il ) . student 's t - test for continuous variables and chi - square test for discrete variables were used . binary logistic regression analysis was used to find the association among the mets and four psychological variables . independent variables included scores of depression , anxiety , distress , and qol , as well as smoking , body mass index ( bmi ) , total cholesterol , age , sex , and education . linear regression analyses were used to evaluate the relationship of each psychological variable with the number of mets components as dependent variable . male / female ratio was 0.86 ( 217/251 ) ( table 1 ) . in non - mets group , 55 ( 21.7% ) , 95 ( 37.5% ) , and 103 ( 40.8% ) participants had 0 , 1 , and 2 components of mets , respectively . in mets group , 133 ( 61.8% ) , 66 ( 30.7% ) and 16 ( 7.4% ) individuals were detected that had 3 , 4 , and 5 component , respectively . seventy persons ( 32.5% ) in mets group and 7 ( 2.7% ) individuals in non - mets group had fpg 110 mg / dl ( p < 0.001 ) . one hundred and ninety three ( 89.7% ) subjects in mets group and 86 ( 33.9% ) in non - mets group had tg 150 mg / dl ( p < 0.001 ) . in mets group , 171 ( 79.5% ) individuals had low hdl - c level ( < 40 mg / dl for men and < 50 mg / dl for women ) , but it was detected only in 86 ( 33.9% ) subjects in non - mets group ( p < 0.001 ) . high wc ( 102 cm in men and 88 cm in women ) was detected in 167 ( 77.6% ) and 48 ( 19% ) participants in mets and non - mets group , respectively ( p < 0.001 ) . likewise , 143 ( 66.5% ) and 81 ( 32% ) participants in these groups had high blood pressure ( systolic blood pressure 130 or diastolic blood pressure 85 ) , respectively ( p < 0.001 ) . mean score of depression , anxiety , distress , and qol was significantly higher in mets group as were represented in table 2 . as shown in table 3 , the multivariate logistic regression analysis after adjusting for demographic risk factors , showed the significant association of depression , anxiety , distress , and quality of life score with mets . by adjusting age , sex , smoking , bmi , and cholesterol , distress role attenuated but depression , anxiety , and figure 1 illustrates significant worsening trends of scores for depression , qol , and anxiety as the number of mets components increased ; however , distress scores did not show this pattern . among components of mets , central obesity was significantly associated with detrimental increase of all four psychological factors ( p < 0.001 except for ghq-12 that p = 0.03 ) . depression score and qol were significantly lower in high fpg ( p = 0.002 , p = 0.008 ) . conversely , ghq-12 score was slightly lower in those without tg component of mets ( p = 0.037 ) . there were rare reports of drugs that have effect on mood ( n = 15 , including 8 for tcas , 4 for sodium valproate , and 6 for ssris , some reported concurrent use of 2 drugs ) . present study participants with clinically verified mets had a significant higher score for depression , anxiety , and distress . current study suggested the association between mets and depression . in line with our findings , a community - based study found that mets is associated with self - perceived depression . in a cohort study , mets could predict depression . while another research on depressed patients indicated the association of long - term depressive symptoms and emergence of mets , rikkonen et al . hence , it seems there is a two - way street between depression and mets . in spite of different study methods , our results are in agreement with rikknen et al . and carroll et al . and showed that anxiety is associated with mets in both sexes . other findings of rikknen 's studies demonstrated that feeling intense , anger , and distress increased risk for mets [ 6 , 25 ] . furthermore , other researchers have suggested emergence of mets after 5 years exposure to high psychological distress . statistically significant association of our participants ' distress with mets was lost after adjusting for bmi , smoking , age , sex , and cholesterol level . different measurement methods of psychological distress , type of research , study population , and adjusting factors in present study compared to rikknen et al . researches may justify these differences . our findings showed that individuals with mets had impaired qol in terms of health , mobility , self - care , usual activity , pain / discomfort , and anxiety / depression , even after controlling confounding factors . two different studies [ 9 , 13 ] have demonstrated that people with mets have impaired qol including physical and social function as well as general and mental health . although studies about qol and mets are few , but present study findings were in accordance with them and have suggested impaired quality of life in patients with mets . some mechanisms were suggested as possibly responsible for association of psychological disorders , impaired qol and mets . first mechanism is biological alternation such as autonomic nervous system changes like heart rate variability , dysregulation of endocrine organ like hypothalamic - pituitary - adrenal axis , and alternation of inflammatory and hemostatic markers and neurotransmitters especially blunted level of serotonin . second mechanism is separated correlation of psychological problems with mets components , for instance , association of depression with visceral fat accumulation , insulin resistance , and dyslipidemia . last one is the similar risk factors of psychological , and metabolic disorders , for example , low intensity of leisure time physical activity , unhealthy dietary habits , high consumption of alcohol , and low education , and so forth . this study benefited from participants with wide range of age , enough sample size , and recruiting individuals who had mets for about 7 years . first , self - reported questionnaires such as hads give limited data about participants ' depression and anxiety at one time but no information about lifetime psychological problems . second , in spite of wide level of adjustment in analyses of present study , it is still possible that unmeasured confounders interfere with part of the association between mets and psychological disorders . third , recall bias may occur because participants with mets may report poorer social and emotional situation because of the syndrome . in addition , cross - sectional design of study makes temporality problem that causes difficulties in interpretation of cause and effect . mets in addition to biological causes might be a combination of psychological problem such as depression , anxiety , psychological distress , and impaired qol . thus , a person with metabolic disease should be recognized as a patient with biological , psychological , and environmental risk factors and screened for all of them .
objective . current study was designed to investigate the association of metabolic syndrome ( mets ) with depression , anxiety , psychological distress , and quality of life ( qol ) . design . two hundred and fifteen contributors with mets and 253 participants without mets were randomly selected from 2151 participants of isfahan cohort study who were residents of isfahan city . measurements consisted of fasting blood samples , anthropometrics , and self - reported data of 12-item general health questionnaire , hospital anxiety and depression scale , and european quality of life-5 dimension . binary logistic regression analysis was used to find the association between mets and four psychological factors . results . participants mean age was 56.3 9.8 years . male / female ratio was 0.86 ( 217/251 ) . mean score of depression ( p = 0.003 ) , anxiety ( p = 0.018 ) , distress ( p = 0.047 ) , and qol ( p 0.001 ) was significantly higher in mets group . there were significant increasing relationships between depression ( or 1.10 , 95% ci 1.031.22 ) , anxiety ( or 1.03 , 95% ci 1.051.11 ) , and qol ( or 1.13 , 95% ci 1.051.23 ) and mets when associations were adjusted for other risk factors , but it was not the case for distress ( or 1.03 , 95% ci 0.991.08 ) . conclusion . it might be better to consider mets as a combination of biological and psychological risk factors . thus , a person with metabolic disease should be recognized as a patient with these factors and be screened for all of them .
increased intraspinal pressure exerted by an expanding mass such as a slow - growing intraspinal tumor is a common cause of erosion ( scalloping ) of the posterior vertebral wall [ 18 ] . as for other causes of scalloping , communicating hydrocephalus , marfan syndrome , ehlers danlos syndrome , ankylosing spondylitis , neurofibromatosis , achondroplasia , morquio syndrome , hurler syndrome , acromegaly , tuberculosis , and fungal infections have been reported [ 4 , 815 ] . erosion of the spinal osseous structure by herniated nucleus pulposus ( hnp ) has rarely been reported . only 10 hnp cases with scalloping we describe an uncommon case of hnp causing erosion of the vertebral body , the pedicle , and the lamina , which was initially diagnosed to be a tumorous lesion located in the spinal canal . the patient was an 81-year - old woman with 3-year history of low - back pain and left leg radiating pain . her symptoms had gradually worsened until she was not able to walk unaided . finally , she was referred to our hospital for surgical intervention . neurological examination showed a positive straight - leg raising test at 20 and positive femoral nerve stretching testing on the left side . muscle weakness found in the left quadriceps was 4-/5 , and that of the left tibialis anterior was 4/5 . plain ap and lateral radiographs of the lumbar spine are shown in fig . 1 . there was no spinal abnormality except for osteoporosis ( fig . 1 ) . dual - energy x - ray absorptiometry ( dxa ) demonstrated an l2l4 t - score of 2.5 . computed tomographic ( ct ) myelography following myelography at l3l4 showed a tumorous mass with partial calcification in the spinal canal , and erosion of the adjacent l4 vertebral body , pedicle , and lamina . the right panel in fig . 2 shows the slice corresponding to the cranial aspect of the l4 pedicle , and the left panel shows the one corresponding to the caudal aspect of the l4 pedicle . red arrows indicate the location of scalloping , and white arrows , the calcification in the mass.fig . 2ct myelography following myelography at l3l4 showing a tumorous mass with partial calcification in the spinal canal . the right panel shows the slice corresponding to the cranial aspect of the l4 pedicle . the left panel shows the slice corresponding to the caudal aspect of the l4 pedicle . red arrows indicate the location of scalloping , and white arrows , the calcification in the mass plain ap and lateral radiographs of the lumbar spine ct myelography following myelography at l3l4 showing a tumorous mass with partial calcification in the spinal canal . the right panel shows the slice corresponding to the cranial aspect of the l4 pedicle . the left panel shows the slice corresponding to the caudal aspect of the l4 pedicle . red arrows indicate the location of scalloping , and white arrows , the calcification in the mass magnetic resonance ( mr ) sagittal images showed a mass at l3l4 ( fig . axial mr images showed that the mass was located on the right side and caused scalloping ( fig . b axial mr images showing the mass located on the right side and the scalloping ( red arrows ) a mr sagittal images showing a mass at l3l4 . b axial mr images showing the mass located on the right side and the scalloping ( red arrows ) because of the long clinical history and the mr images , we considered the tumor to be not malignant , but rather most likely to be an hnp , and therefore did not perform biopsy prior to removing it . however , we should have done a biopsy for differential diagnosis of slow - growing malignant tumors to ensure safer treatment . after removal of the mass , erosion of the vertebral body was noted . figure 4 shows the removed tissue 3 days after fixation in 10% formic acid . scalloping was also clearly seen on postoperative mri ( arrows in the right panel ) . the patient was asked whether data concerning her case could be submitted for publication , and she consented.fig . 4the surgical specimen shown after fixation in 10% formic acid . on macroscopic examination , it seems to be an hnpfig . scalloping was also clearly seen on postoperative mri ( arrows in the right panel ) the surgical specimen shown after fixation in 10% formic acid . on macroscopic examination , it seems to be an hnp postoperative mr images revealed that the thecal sac was totally decompressed . it is well known that increased intraspinal pressure exerted by an expanding mass such as an intraspinal tumorous lesion may cause erosion ( scalloping ) of the spinal osseous structures . ependymoma , dermoid cysts , epidermoid cysts , schwannoma , lipomas , and lymphomas frequently show thinning of laminae and pedicles [ 4 , 7 , 8 , 20 ] . dural ectasia , associated with inherited disorders such as marfan syndrome , and ehlers danlos syndrome , and neurofibromatosis is also a cause of scalloping of vertebral bodies [ 4 , 8 , 9 , 11 , 12 , 15 ] . there have been few reports , however , of scalloping of the spinal osseous structures caused by hnp . the present case showed erosion of the l4 vertebral body , pedicle , and lamina by a calcified herniated mass of the l3l4 intervertebral disc . there have been 10 cases of bone erosion due to hnp reported in the literature [ 1620 ] . most cases showed erosion in the posterior wall of the vertebral bodies ( table 1 ) . . stated that thinning of the laminae and pedicles was commonly seen associated with a tumorous lesion , and that this kind of scalloping was not observed in cases with hnp . an hnp would usually cause scalloping of the vertebral bodies only , if there were any . in the present case , no previous report showed such wide erosion of the spinal osseous structure by hnp as shown in the present case.table 1summary of the characteristics of previous casescaseauthorssex , age ( years)clinical historylocation of herniationlocation of scallopingcalcification1vadala et al . female , 39more than 1 yearl5vertebral body2male , 457 yearsl5vertebral body3male , 41several yearsl5/svertebral body4female , 553 yearsl5vertebral body5norfray et al . female , 433 yearss1vertebral body6male , 487 yearsl4neural foramen7male , 413 yearsl5vertebral body+8briceno et al . male , 61several weekst10vertebral body+present caseyoshioka et al.female , 823 yearsl4vertebral body , pedicle , and lamina+ summary of the characteristics of previous cases several authors have advocated that long clinical history of pain and chronic pressure due to large - size hnp could cause bone erosion [ 1620 ] . nine of the 11 cases reported so far , including the present case , had history of pain longer than 1 year ( table 1 ) . . also suggested that old hnps might cause a mechanical irritating action on the small vascular structures of the bone cortex . we supposed that an elderly patient with osteoporosis suffering for a long period from pain caused by an hnp was likely to show erosion of spinal osseous structures .
erosion of spinal osseous structure , so - called scalloping , has been rarely reported associated with herniated nucleus pulposus ( hnp ) . we report a rare case of hnp causing erosion of the spinal osseous structure ( including lamina ) . the patient was an 81-year - old woman with 3-year history of low - back pain and left leg radiating pain . muscle weakness of the left leg was also apparent . computed tomography following myelography showed severe compression of the dural sac at the level of l3l4 ; furthermore , erosion of the lamina , pedicle , and vertebral body was noted , indicating that the space - occupying mass was most probably a tumorous lesion . the mass also showed calcification inside . during the surgery , the mass was confirmed to be an hnp with calcification . following resection , the pain disappeared . surgeons should be aware of the possibility of scalloping of the vertebrae caused by hnp mimicking a tumorous lesion .
an 80-year - old woman presented to the emergency department complaining that she had defecated a 40-cm corded piece of dark - red tissue , without severe symptoms , after taking laxatives . laboratory data revealed a white blood cell count of 7.8 10 and a hematocrit of 31.9% . the rest of the laboratory test results , including levels of serum albumin , hepatic and pancreatic enzymes , and electrolytes , were within normal limits . on physical examination , there was a slight tenderness in the lower abdomen without guarding or rebound on palpation . we observed approximately 20 cm of a necrotic bowel segment ( colon cast ) protruding from her anus ( fig . 1 ) . approximately 20 cm of a necrotic bowel segment ( colon cast ) protruding from the patient 's anus an emergency colonoscopy revealed that the sigmoid colonic mucosa located between 40 and 20 cm from the anal verge was edematous and congested . colonoscopy could not be performed past 40 cm from the anal verge because the patient complained of pain . the dark - red segment of tissue she passed before admission was considered a colon cast because the colonic mucosa of the corresponding segment was desquamated ( fig . the residual segment of the colon cast was still attached to the sigmoid colonic wall ( fig . 3 ) . colonoscopy finding of deciduous sigmoid colon epithelium with edema and congestion colonoscopic finding of residual colon cast ( arrows ) . histologic examination of the passed material indicated that the mucus layer had dissected from the colon , resulting in necrosis ( fig . computed tomography demonstrated thickening of the wall of the sigmoid colon , but no free intraperitoneal air , free fluid , fecal contamination , aortic aneurysm , or thrombi in superior or inferior mesenteric arteries were detected . histologic examination ( 12.5 , 100 ) revealed infarcted mucosa in the discharged colon cast . initially , oral intake was withheld for 10 days for maintaining the rest of the digestive tract in optimal condition for mucosal tissue healing ; subsequently , the patient successfully tolerated fluids and then food in 2 weeks . however , she began to present melena again when she started low - residue diets . colonoscopy revealed persistent inflammation in the sigmoid colon ; therefore , conservative treatment was continued for 2 months . two months later , a follow - up colonoscopy demonstrated mucosal regeneration and a stenotic lumen in the sigmoid colon ( fig . a water - soluble contrast enema revealed a slight stricture measuring approximately 4 cm in the sigmoid colon , although the patient was asymptomatic . the patient was discharged from the hospital 111 days after admission . at the 8-month follow - up , in 1984 , speakman and turnbull first reported spontaneous anal passage of a full - thickness infarcted colonic segment , also known as a colon cast . colon cast passage has been associated with a preceding circulatory disorder resulting in ischemic colitis . about 50% of these cases of colonic ischemia were secondary to blockage of the inferior mesenteric artery ( i m a ) in abdominal aortic aneurysm ( aaa ) repair surgeries and colorectal surgeries . five of the remaining cases had no relation with vessel obstruction secondary to operations , but with ischemic colitis from preceding circulatory disorders . in the 22 previously reported cases of colon cast , the colon segment often originated from the left side of the colon , including the descending colon , sigmoid colon , and rectum , with the exception of 3 cases in which the segment originated from the ascending colon . because of its peristaltic motion and vulnerability of the submucosal connecting tissue , the sigmoid colon appears to be a frequent site of colon cast development . peristaltic motion of the sigmoid colon mobilizes intestinal contents toward the rectum 1 or 2 times per day . the 22 cases , blockage of the feeding arteries , including the i m a , was the main cause . in 5 of the 12 cases , the etiology was occlusion of the i m a during aaa repair . in the 7 remaining cases , colonic ischemia was caused by sacrifice of the main blood vessel ( i m a in 5 cases ) during colon cancer surgery . in another 10 cases , the causes included diabetic ketoacidosis , pancreatitis , trauma , graft - versus - host disease , and ischemic colitis secondary to arteriosclerotic cardiovascular disease in patients receiving anticoagulant drugs . in the present case , the patient had arteriosclerosis , as can be inferred from her prescribed medications including aspirin for prophylaxis of angina pectoris . the continuous elevated pressure on the large bowel and decrease in blood flow as a result of atherosclerosis were likely the causes of ischemic colitis in this case . moreover , the elevated pressure on the large intestine and consequent vessel extension may have induced further circulatory compromise . the extended severe ischemic colitis was presumably the etiology of the colon cast in this case . data on the extent of infarction of the colonic wall were available in 19 of the reported cases . the extent of infarction from the mucosa to the muscularis propria or subserosal layer was reported in 13 cases . such cases required management with surgical resections because of colonic stenosis / obstruction or bowel perforation . however , 2 patients did not undergo surgery owing to their deteriorated status . in 6 patients , four of the 6 patients were successfully managed by conservative therapy with endoscopic dilation of strictures . two patients had strictures at the colorectal anastomosis site after colorectal surgery and required surgical resections . circulatory disorders affecting surgical manipulation may also cause stenosis of the colorectal anastomosis . despite the submucosal layer of the colon many cases are asymptomatic , so initial conservative treatment should be chosen together with regular examinations in cases without digestive tract perforation . when the specimen contains muscularis propria or the patients have colorectal anastomosis , we suggest following a surgical approach . we made a flowchart to describe the algorithm for the management of the cases with colon cast ( fig . we report a case of colon cast passage in a patient with severe ischemic colitis successfully treated by conservative therapy . the pathologic depth of the layer of the excreted colon cast may be crucial in determining the appropriate treatment . patients with casts consisting of the mucosa / submucosa layer alone and without colorectal anastomosis may likely be successfully managed by conservative therapy . when the specimens contain muscularis propria or the patients have colorectal anastomosis , surgery should be considered .
colon cast passage , which is the spontaneous passage of a full - thickness , infarcted colonic segment per rectum , is a rare occurrence . the main cause is acute ischemic colitis resulting from a circulation compromise . most of the colon cast cases reported were secondary to abdominal aortic aneurysm repairs or colorectal surgery . we report a case of an 80-year - old woman with ischemic colitis who excreted a 20-cm colon cast . in most cases that involve a colon cast containing a muscle layer component , invasive therapy is required owing to colonic obstruction or stenosis . however , in the present case , the colon cast consisted only of a mucosa layer and was not associated with severe stenosis or obstruction ; therefore , it was successfully treated by conservative therapy . histologic examination of the colon segment may be crucial in determining the appropriate treatment .
when treating pulmonary cancer complicated by interstitial pneumonia , it is critical to determine whether or not surgery is indicated . furthermore , the greatest problem when considering treatment for pulmonary cancer complicated by interstitial pneumonia is acute exacerbation , which presents an added risk in cases of surgery , anti - cancer drug treatment and radiotherapy . at present , radiotherapy and many anti - cancer drugs are prohibited as treatments for interstitial combined pulmonary cancer . as such , in cases of pulmonary cancer complicated by interstitial pneumonia , surgery is the only treatment that offers hope of a cure . in cases such as those in this study , where multiple nodules are found in other lung lobes , the authors consider how to assess the surgical indications for pulmonary cancer complicated by interstitial pneumonia , and whether determination is possible using imaging diagnosis alone . the authors report their experience of two cases of pulmonary cancer complicated by interstitial pneumonia in which multiple lung nodes were identified by proactive thoracoscopy , and were subjected to simultaneous curative surgery . the patient was a 76-year - old man in whom abnormal shadows were observed on a chest x - ray examination . he had a smoking history of 20 cigarettes per day for the past 46 years . auscultation of the chest resulted in the discovery of fine crackle sounds on both upper dorsal sides . blood biochemistry tests showed kl-6 : 622 u / ml , spd : 79.4 ng / ml , ldh : 215 iu / l , cea : 6.9 ng / ml , scc : 1.8 ng / ml , and cyfra : 4.0 ng / ml . blood gas analysis showed ph 7.419 , pco2 : 36.2 mmhg , and po2 : 71.6 mmhg , so2 : 93.9% . respiratory function testing demonstrated vc : 3.27 l , % vc : 111 , fev1 : 2.70 , % fev1 : 135 , and fev% : 82.8 . a chest x - ray examination showed a shadow with pale nodules measuring 20 mm in size with unclear margins in the left upper lung . a chest contrast ct examination indicated a node shadow measuring 19 mm in size in the left upper lobe s3 . both lower lobes had five nodules measuring from 6 to 12 mm in size . bronchoscopic examination including exfoliative cytodiagnosis from the b3c area resulted in a positive finding for non - small cell lung cancer ( nsclc ) . based on the findings of the above examinations , the patient was diagnosed as having pulmonary cancer complicated by interstitial pneumonia , ct1an0m0 , stage i a or ct4n0m0 , stage iii b. in order to determine the surgical indications , nodules from the left lung lower lobe were thoracoscopically biopsied and a swift diagnosis was thus obtained during surgery , based on the policy that if the findings did not indicate lung metastasis , curative surgery would be performed ; whereas , if they did indicate metastasis , surgery would not be performed . thoracoscopic observations of the lungs confirmed that the intrapulmonary lymph nodes were located directly below the lower lobe pleura . the nodules observed on ct images were biopsied after s9 pulmonary wedge resection , and were immediately examined to afford a swift diagnosis ; which showed that they were intrapulmonary lymph nodes with no malignancy . upper division segmentectomy of the left lung and mediastinal lymph node dissection were subsequently performed . the post - surgical progress was good , with the patient leaving the hospital eight days after surgery . at 25 months following surgery he had a smoking history of 20 cigarettes per day for the past 43 years . regarding his family history , his father had suffered from pulmonary fibrosis , and his mother had a history of stomach cancer and stroke . chest auscultation revealed the presence of bilateral fine crackle sounds on the upper dorsal sides . blood biochemistry findings indicated kl-6 : 832 u / ml , spd : 189 ng / ml , ldh : 228 iu / ml , cea : 5.2 mg / ml , scc : 1.4 ng / ml , and cyfra : 1.8 ng / ml . blood gas analysis showed ph 7.453 , pco2 : 39.0 mmhg , po2 : 98.9 mmhg , and so2 : 97.2% . respiratory function testing indicated vc : 4.20 , % vc : 119.3 , fev1 : 2.96 , % fev1:106 , fev% : 72.3 , and % dlco : 129.7 . a chest x - ray examination showed increasing density in the area overlapping the pulmonary artery in the right lung . chest contrast ct examination demonstrated the presence of a shadow measuring 29 mm in size and the presence of nodules with a cavity located directly below the right lung lower lobe s6 pleura . within the same lung lobe , seven nodule shadows measuring between 2 and 3 mm in size both sides indicated reticular shadows in the lower dorsal lobe , with interstitial lesions ( fig . based on the above findings , the patient was diagnosed as having pulmonary cancer complicated by interstitial pneumonia , ct2an1m0 , stage ii a , or ct4n1mo , stage iii b. in order to determine the surgical indications , the right s10 nodules were biopsied thoracoscopically , thus affording a swift diagnosis during surgery , based on the policy that if the findings did not indicate lung metastasis , curative surgery would be performed ; whereas , if they did indicate lung metastasis , surgery would not be performed . thoracoscopic observation of the lungs revealed the presence of black nodules directly below the lower pleura , leading to the determination of intrapulmonary lymph nodes . the s10 nodes depicted in the ct image also led to the diagnosis of an intrapulmonary lymph node , and consequently , biopsy was not performed . middle and lower lobectomy of the right lung and mediastinal lymph node dissection were subsequently performed . the ultimate pathological diagnosis was squamous cell carcinoma , pt2an1n0 , pstage ii a. a s10 node lung lymph tissue specimen showed no malignancy ( fig . thereafter , the patient made good progress and left the hospital eight days after surgery . he did not undergo any chemotherapy after surgery . at 28 months after undergoing surgery , the patient is alive and has had no recurrence . the patient was a 76-year - old man in whom abnormal shadows were observed on a chest x - ray examination . he had a smoking history of 20 cigarettes per day for the past 46 years . auscultation of the chest resulted in the discovery of fine crackle sounds on both upper dorsal sides . blood biochemistry tests showed kl-6 : 622 u / ml , spd : 79.4 ng / ml , ldh : 215 iu / l , cea : 6.9 ng / ml , scc : 1.8 ng / ml , and cyfra : 4.0 ng / ml . blood gas analysis showed ph 7.419 , pco2 : 36.2 mmhg , and po2 : 71.6 mmhg , so2 : 93.9% . respiratory function testing demonstrated vc : 3.27 l , % vc : 111 , fev1 : 2.70 , % fev1 : 135 , and fev% : 82.8 . a chest x - ray examination showed a shadow with pale nodules measuring 20 mm in size with unclear margins in the left upper lung . a chest contrast ct examination indicated a node shadow measuring 19 mm in size in the left upper lobe s3 . both lower lobes had five nodules measuring from 6 to 12 mm in size . bronchoscopic examination including exfoliative cytodiagnosis from the b3c area resulted in a positive finding for non - small cell lung cancer ( nsclc ) . based on the findings of the above examinations , the patient was diagnosed as having pulmonary cancer complicated by interstitial pneumonia , ct1an0m0 , stage i a or ct4n0m0 , stage iii b. in order to determine the surgical indications , nodules from the left lung lower lobe were thoracoscopically biopsied and a swift diagnosis was thus obtained during surgery , based on the policy that if the findings did not indicate lung metastasis , curative surgery would be performed ; whereas , if they did indicate metastasis , surgery would not be performed . thoracoscopic observations of the lungs confirmed that the intrapulmonary lymph nodes were located directly below the lower lobe pleura . the nodules observed on ct images were biopsied after s9 pulmonary wedge resection , and were immediately examined to afford a swift diagnosis ; which showed that they were intrapulmonary lymph nodes with no malignancy . upper division segmentectomy of the left lung and mediastinal lymph node dissection were subsequently performed . the post - surgical progress was good , with the patient leaving the hospital eight days after surgery . at 25 months following surgery he had a smoking history of 20 cigarettes per day for the past 43 years . regarding his family history , his father had suffered from pulmonary fibrosis , and his mother had a history of stomach cancer and stroke . chest auscultation revealed the presence of bilateral fine crackle sounds on the upper dorsal sides . blood biochemistry findings indicated kl-6 : 832 u / ml , spd : 189 ng / ml , ldh : 228 iu / ml , cea : 5.2 mg / ml , scc : 1.4 ng / ml , and cyfra : 1.8 ng / ml . blood gas analysis showed ph 7.453 , pco2 : 39.0 mmhg , po2 : 98.9 mmhg , and so2 : 97.2% . respiratory function testing indicated vc : 4.20 , % vc : 119.3 , fev1 : 2.96 , % fev1:106 , fev% : 72.3 , and % dlco : 129.7 . a chest x - ray examination showed increasing density in the area overlapping the pulmonary artery in the right lung . chest contrast ct examination demonstrated the presence of a shadow measuring 29 mm in size and the presence of nodules with a cavity located directly below the right lung lower lobe s6 pleura . within the same lung lobe , seven nodule shadows measuring between 2 and 3 mm in size both sides indicated reticular shadows in the lower dorsal lobe , with interstitial lesions ( fig . based on the above findings , the patient was diagnosed as having pulmonary cancer complicated by interstitial pneumonia , ct2an1m0 , stage ii a , or ct4n1mo , stage iii b. in order to determine the surgical indications , the right s10 nodules were biopsied thoracoscopically , thus affording a swift diagnosis during surgery , based on the policy that if the findings did not indicate lung metastasis , curative surgery would be performed ; whereas , if they did indicate lung metastasis , surgery would not be performed . thoracoscopic observation of the lungs revealed the presence of black nodules directly below the lower pleura , leading to the determination of intrapulmonary lymph nodes . the s10 nodes depicted in the ct image also led to the diagnosis of an intrapulmonary lymph node , and consequently , biopsy was not performed . middle and lower lobectomy of the right lung and mediastinal lymph node dissection were subsequently performed . the ultimate pathological diagnosis was squamous cell carcinoma , pt2an1n0 , pstage ii a. a s10 node lung lymph tissue specimen showed no malignancy ( fig . thereafter , the patient made good progress and left the hospital eight days after surgery . he did not undergo any chemotherapy after surgery . at 28 months after undergoing surgery , the patient is alive and has had no recurrence . the increasing use of ct scans and improved image resolution has led to increased opportunities to discover nodule shadows . it has been reported that between 0 and 1% of nodules measuring less than 5 mm , and between 6 and 28% of nodules measuring 510 mm are malignant lesions , and consequently , it is necessary to be able to identify lung cancer and metastatic lung tumors , among other malignant conditions , . examined 26 cases of nodular shadows in the lungs , measuring 10 mm or less , in which resection was implemented , ultimately leading to 3 cases of primary lung cancer , 2 cases of metastatic lung tumor , 12 cases of intrapulmonary lymph nodes , 6 cases of lung hamartoma , and 3 cases of pulmonary tuberculosis , with intrapulmonary lymph nodes found to be the most common condition ( 46% ) , . the two cases in this study involved intrapulmonary lymph nodes , that were characteristic in that : ( 1 ) the border was sharp in most cases ; ( 2 ) iplns were found just under or up to several millimeters away from the pleura ; ( 3 ) more than one node was sometimes observed ; ( 4 ) they could cause pleural indentations ; and ( 5 ) the border might be rough similar to that of lung cancer . furthermore , fellow et al . and kradin et al . studied intrapulmonary lymph nodes that were confirmed during open - chest biopsy , and reported that in many cases , they were between 5 and 10 mm in size , were multiple , and were present below the pleura in the lower lobe . in these cases , all the nodules were also present in the pleural region , and apart from one that measured 13 mm , all measured 10 mm or less . furthermore , the rate of positive testing for lung cancer in fdg / pet was high , 8791% , between 21 and 30 mm , but at 15 mm or smaller this fell to 7582% , indicating that malignancy can not be ruled out even if the test shows negative results . this supports that observing nodules , roughly 10 mm in size , in the pleural area in ct images , whether singular or multiple , means that the possibility of intrapulmonary lymph nodes needs to be considered . as a result , transbronchial biopsy and needle biopsy using a ct guide have low accuracy rates for lesions measuring 1 cm or less , and consequently , it is necessary to implement thoracoscopic surgery , which offers the least invasive method , . in case 1 , the largest nodule on the left lower lobe , which measured 13 mm , was resected from the lung area for diagnosis . in case 2 , the surface of the lung had multiple black nodule shadows , allowing visual diagnosis of intrapulmonary lymph nodes . in both cases , nodules also existed in the lung that were not subject to surgery ; however , these were all subpleural and measured less than 10 mm , and were diagnosed as intrapulmonary lymph nodes . the implementation of swift diagnoses during surgery allowed a reduction in the risk of interstitial pneumonia acute exacerbation , since it allowed the diagnosis of the nodules and curative surgery of the cancer in a single process . observation of subpleural nodules , roughly 10 mm in size , whether singular or multiple , means that the possibility of intrapulmonary lymph nodes needs to be considered , and if surgery is indicated , proactive diagnosis must be carried out . even in cases of pulmonary cancer complicated by interstitial pneumonia , it should be implemented without hesitation if surgery is indicated ,
highlightsit is difficult to determine whether surgery is indicated in patients with lung cancer with multiple nodular shadows in multiple lung lobes.physicians are reluctant to perform surgery for patients with lung cancer and interstitial pneumonia.however , surgery is the only treatment method that is expected to achieve cure of lung cancer with interstitial pneumonia.10-mm nodular shadows located near the pleura may represent an intrapulmonary lymph node.even for patients with lung cancer with interstitial pneumonia , a biopsy should be actively performed to determine the indication for surgery .
the global program to eliminate lymphatic filariasis ( gpelf ) currently implements two diagnostic tools : detection of microfilariae ( mf ) and the detection of circulating filarial antigen ( cfa ) . both tools have proven to be extremely useful during the elimination program stages , where parasite prevalence is relatively high , but there is concern that they might not be sensitive enough to detect residual endemnicity or resurgence in the postprogram phase [ 1 , 2 ] . of particular concern is the slow - evolving nature of the disease since individuals may not become cfa or mf positive until up to 12 months post infection . filarial antibodies develop in response to exposure to the parasite and in endemic countries occur during the first few years of life . in the past , antibody assays in endemic areas were not useful , since the community was constantly exposed and thus antibody positive . with the approach of the end of the mass drug administrations ( mdas ) , the age prevalence should have shifted , with younger individuals born after the mda theoretically antibody negative if there has been a cessation of lf transmission . therefore , it has been suggested that antibody serology be included in the repertoire of lf diagnostics . the lf research community has witnessed the move from earlier antibody assays , reliant on crude parasite lysates , to the recent more specific and sensitive recombinant antigen - based antibody assays ( for review see ) . the earlier assays based on crude parasite lysate were limited in terms of specificity [ 6 , 7 ] , making their use in lf programs inadequate . the advent of recombinant antigen detection systems has increased the specificity of the antibody assays by reducing cross - reaction with other parasitic diseases . the recombinant antigens commercially available are the bm14 , wbsxp , and the bmr1 . bmr1 is a brugia malayi recombinant antigen , which has been shown to react specifically with sera from b. malayi - infected individuals [ 9 , 10 ] ; however its specificity for w. bancrofti has been reported as quite low . the use of the recombinant antigen bm14 in the commercially available filariasis celisa ( cellabs pty ltd . the bm14 assay is an igg4-specific elisa whereby the plates are coated with the recombinant bm14 antigen ( cellabs pty ltd , australia ) . the bm14 gene belongs to a family of genes encoding proteins that are strong immunogens and was originally isolated from a cdna library in 1992 for its potential application in lf diagnostics . these initial studies demonstrated the affinity of antibodies isolated from microfilaraemic individuals for the expressed recombinant antigen [ 12 , 13 ] . the recombinant antigen has been demonstrated to react with sera from patients with brugian or bancroftian filariasis with reported sensitivities of 96% and 91% , respectively , and no cross reaction was reported with 19 serum samples from strongyloides patients . unfortunately the assay reacted with 72% of the loa loa and onchocerca volvulus positive sera limiting its usefulness in african regions . although the bm14 antibody assay has been commercially available from cellabs , pty ltd australia as a diagnostic tool since 2006 , application to large population sizes in field studies has not been thoroughly assessed . concerns about cross - reactivity in population 's endemic for other helminth parasites , similar to earlier antibody assays , as well as interlaboratory variation have been raised . however , there have been many studies utilising the bm14 , in a research laboratory - based elisa format , with favourable results [ 1417 ] . the commercially available filariasis celisa anti - bm14 igg4 assay differs slightly from the original prototype research - based elisa . however , a recent multicentre evaluation has shown promising results with serum ( weil et al . , in press ) but for any long - term survey work an easier sampling method would be required since venous collection , transportation , and storage of serum can be difficult in endemic areas . filter paper sampling is more cost - effective , easier , and there has been reports of limited sample variation due to fluctuations in temperature since specimens thoroughly dried can be stable at room temperature for up to a week . samples could be collected by filter paper method , which has been shown to be a suitable alternative for antifilarial igg4 antibody assays based on crude protein lysate . filter paper studies for the recombinant antigen bm14 in the filariasis celisa are yet to be ascertained , and the aim of this study was to assess the efficacy of filter paper sampling in a w. bancrofti endemic country . areas of low lf prevalence were chosen for comparison of sampling techniques and for the effect of storage temperature on filter paper samples . the research was conducted under the human ethics approval numbers h1423 and h2816 , as approved by the james cook university research human ethics committee . forty - five nonendemic volunteers , irrespective of age and gender , from townsville , australia were selected as negative controls . ninety four individuals in the south pacific country tuvalu were randomly selected irrespective of age , gender , or previous lf test results . the study was conducted with the assistance of the ministry of health , tuvalu . following verbal consent , 495 participants in the village of siufaga in samoa were screened for antifilarial igg4 antibodies using the filariasis celisa ( filariasis celisa , cellabs pty ltd . the 200 samples chosen were based on the initial optical density ( od ) value , whereby a sample was considered reactive if the od reading was 0.400 , as per manufacturer 's instructions . one hundred and one of the chosen samples were reactive , where 50 samples were high reactors with an od reading > 1.1 . the remaining 51 of the reactive samples had lower od readings ranging from 0.400 to 0.611 . fifty one of the nonreactive samples had initial od readings close to the positive cut - off value of 0.400 in order to determine if after storage these nonreactive samples became false positives . the study protocol was reviewed by the samoan ministry of health for approval prior to commencing the research and carried out with the assistance of world health organisation , samoa . filter paper used for collection was the tropbio filter paper disc ( tropbio pty ltd , qld , australia ) , with six protrusions that specifically soak 10 l of blood each . blood was collected by fingerprick method directly onto the six protrusions of the filter paper . blood was collected from the same individual for a paired plasma and filter paper sample . approximately 200 l of blood was collected using the fingerprick method by capillary action into edta vacutainers ( bd biosciences , becton , dickinson and company , north ryde , nsw , australia ) . following collection , six x 10 l blood was blotted onto filter paper , using a micropipette , and left to dry overnight . the remaining blood in the vacutainer was left overnight at 4c to allow red cell sedimentation . both filter papers and plasma samples were stored at 4c and transported back to australia at 4c at the conclusion of the study . upon arrival to the australian laboratory , both filter papers and plasma were stored at 20c until tested . blood was collected by fingerprick and soaked directly onto each of the 6 protrusions of the filter paper . following collection , filter papers were left to thoroughly dry , then placed in ziplock bags , and transported back to australia . sample diluent was prepared according to manufacturer 's instructions and 500 l was transferred into separate serum tubes using a micropipette . a single blood - soaked protrusion was excised into the serum tube , which was then vortexed to ensure complete saturation of the disc . as each protrusion soaks exactly 10 l , it was assumed that half of this volume constituted serum . diluting 5 l of serum in 500 l of sample diluent the following day the eluates were warmed to room temperature ( rt ) before commencing the assay . antifilarial igg4 antibodies were detected using the commercially available filariasis celisa kit ( cellabs pty ltd , manly , australia ) and samples were tested in duplicate . initial sample incubation was for 2 hours at 37c , incubation with secondary igg4 conjugate was for 45 minutes at 37c , and the final incubation with tetramethylbenzidine ( tmb ) substrate was in the dark at rt for 15 minutes . the washing steps between incubations were performed with an automated plate washer ( multidrop combi nl , pathtec , vic , australia ) using 200 l of washing buffer per well . on completion the od of the samples was measured at a dual wavelength of 450 nm/650 nm with a multiskan ex type 355 primary v.2.1 - 0 ( pathtec , vic , australia ) using the software labsystems genesis version 3.00 ( pathtec , vic , australia ) . serum samples have been shown to have a lower cut - off value for positivity of od > 0.250 . all analyses were performed using the statistical software spss version 17.0 . the chi - squared test , with the kappa agreement statistic , was used to analyse the sensitivity , specificity , positive predictive value ( ppv ) , and the negative predictive value ( npv ) of the filter paper sample compared to the gold standard . differences in od readings , between sampling techniques and following storage , were analysed using the mann - whitney u test . the average od absorbance value obtained for the 45 nonendemic samples was 0.08 , and thus well below the positive cut - off value for reactivity of 0.400 ( figure 1 ) . there was a significant correlation between the two methods of sampling using the kappa agreement statistic ( r = 0.90 ; p < .01 ) , although there was a significantly higher average od absorbance value for filter paper samples ( 0.550 ) than serum ( 0.401 ) ( z = 6.273 ; p < .001 ) . in comparison to the gold standard , the sensitivity , specificity , ppv , and npv for filter paper sampling the filter paper technique reported a sensitivity of 92% ( 95%-ci 7599 ) , specificity of 77% ( 95%-ci 6586 ) , ppv of 60% ( 95%-ci 4375 ) , and an npv of 96% ( 95%-ci 87100 ) . the initial maximum and minimum od values of the filter paper samples , prior to storage , were 3.9 and 0.013 respectively , with a median of 0.415 . following 10 months of storage at 20c , the od maximum and minimum values decreased to 3.5 and 0 , respectively , with a median drop to 0.08 . this loss of reactivity was significant by mann - whitney u test ( z = 10.9 ; p < .001 ) . following 10-month storage , 67 of the original 101 reactive samples dropped below the reactivity cut - off value of 0.400 and were deemed nonreactive ( table 2 ) . to preserve integrity of samples for sero - epidemiological studies it is important to implement not only the correct collection method but also the correct storage prior to testing . thus serum collection in endemic countries is often infeasible , not only for difficulties concerning sample preservation but also for cumbersome large - scale sampling that is required . there are many advantages for collecting blood by fingerprick including : less invasive , less patient side effects such as reduced risk of haematoma , and reduced risk of needlestick injury to collector . the reduced risk of needlestick injury is particularly important in areas where night bleeding is still required , or areas where there is potential transmission of blood - borne infectious diseases such as human immunodeficiency virus ( hiv ) . it is an easy sample to collect and also can be easily obtained from individuals where venous collection is difficult such as children . another favourable aspect of filter paper sampling is that it has been found in other neglected tropical disease ( ntd ) programmes , such as the onchocerciasis programme , that introduction of filter paper techniques has increased the number of volunteers willing to participate in blood collection , again contributing to economical feasibility and ease of surveying . the present study clearly demonstrates the applicability of filter paper sampling for detection of antifilarial igg4 antibodies using the filariasis celisa . although filter paper sampling requires overnight elution , the sample preparation is quicker and easier . filter paper sampling requires submerging the protrusion in sample diluent prior to elution , whereas serum samples are diluted by pipetting . compared to the gold standard , filter paper sampling had excellent sensitivity of 92% , only missing 2 positive serum samples . the specificity was lower ( 77% ) as 16 samples tested positive by filter paper but negative by plasma . this dropped the ppv to be 60% ; so when testing a sample , it could possibly be a false positive 40% of the time . the npv was also excellent ( 96% ) making filter paper sampling quite robust for accurately testing for nonreactive status . the lower specificity , coupled with a low ppv , means that filter paper sampling may result in false positives at an approximate rate of 40% ( 95%-ci 25% to 57% of the time ) . controlled laboratory experiments , utilising blood spiked with a known amount of antibody onto filter paper , showed no significant differences between serum samples and filter paper samples . there could be a number of reasons for the higher od readings for filter paper samples in the field setting . however , addition of a blocking step for nonspecific proteins did not alter the results ( data not shown ) . it was assumed that 5 l of serum was eluted from 10 l of blood . if the individual was anaemic with a low haematocrit , which can be common in lf endemic countries , the serum to whole blood ratio would increase and potentially more than 5 l could be eluted . eluting a higher volume of serum in an antifilarial igg4 positive individual would alter the od readings of the assay . further studies would be required to ascertain the cause of the higher reactivity observed in the field setting . forty percent of samples potentially being false positive ( a low ppv ) could be disadvantageous for diagnostic testing . however , from a programmatic perspective , the low ppv should not impact greatly on survey work since antifilarial igg4 prevalence rates would be compared annually . any increase in antifilarial igg4 prevalence rates would flag a problem , rather than the individual 's results . if follow - up studies in problem areas required individual diagnostic results , serum samples could be used for confirmation . the high sensitivity and npv are the crucial aspect for sero - epidemiological studies since a high percentage of false negatives would be more detrimental to the lf program . therefore , the high npv and sensitivity observed in this study when using filter paper sampling are advantageous for the lf program . however , until the question of alleged false positivity has been resolved , filter paper test results should be regarded with caution . the decrease in sensitivity observed following 10 months of storage was in agreement with previous studies , which detected antibodies against onchocerca volvulus . in the previous study a significant decrease in antibody detection was observed following 7 months of filter paper storage at 70c , 20c , 4c , and rt . therefore , the results from the current study suggest that in order to detect individuals with low antifilarial igg4 titres , filter paper testing should occur within the first 10 months of storage . the filter papers utilised in the previous study were the whatman no.2 papers , which may be less robust than the tropbio filter paper discs . to ascertain the effect of storage of blood - soaked tropbio filter paper discs , further storage studies need to be conducted looking at several time points and storage conditions , including 70c , 20c , 4c , and rt . in conclusion , the filter paper collection technique for the detection of antifilarial igg4 antibodies by the commercial kit filariasis celisa is a feasible option for future sero - epidemiological surveys . if serology is pursued as part of the lf diagnostic repertoire , filter paper sampling in endemic countries would be more cost - effective and less laborious than venepuncture techniques . for filter paper sampling , the high npv , coupled with high assay sensitivity , would be advantageous as lf prevalence drops in endemic countries , adding to the usefulness of the assay in post - mda surveys or future surveillance work . future work to ascertain the robustness of the assay in large - scale filter paper sampling in an endemic country would be required , including further evaluating the efficacy of storage of filter papers . overall , filter paper sampling would be more cost - effective and easier than venepuncture and is a favourable alternative method for detection of antifilarial igg4 during survey work in lf endemic areas .
demonstration of successful elimination of lymphatic filariasis ( lf ) in endemic countries requires sensitive diagnostics for accurate definitions of endpoints and future surveillance . there has been interest in complementing available diagnostics with antibody serology testing in children , since negative serology would correspond with cessation of lf transmission . the filariasis celisa detects antifilarial igg4 and has favourable results with serum samples but field application requires an easier sampling method . ninety - four paired plasma and filter paper samples were assayed with promising results . the filter paper method resulted in a sensitivity of 92% and a specificity of 77% when compared to the paired plasma . one hundred and one filter paper samples were assessed for storage effects . following 10-month storage at 20c there was a significant reduction in reactivity ( p < .001 ) . overall the results indicated that filter paper sampling would be a favourable sensitive and specific alternative for blood collection in surveys .
rapid detection and identification of infectious pathogens in clinical samples is very challenging , but it is essential to guide the therapy and predict the outcome . traditional clinical microbial diagnostic methods like physiology and biochemical identification , serological tests , and automated detection technology , are mainly based on the conventional culturing of clinical samples . the culture turnaround time is usually 12 days for most samples , or longer for samples that require prolonged incubation , like blood cultures . more recently , once an isolate has been detected , species identification and genotyping could be performed following identification of a susceptibility test . in fact , the whole procedure could take several days or even weeks , for example , in terms of the culture time required for tuberculosis , which is 42 days in the clinical laboratory . therefore , it is not only a time - consuming process , but also is a barrier that impedes the rapid detection and identification of infectious pathogens . interestingly , these culture - based methods usually fail to identify those pathogens that can not be cultivated under standard techniques , such as viruses that can be identified through antibody - specific elisa or sequence - specific molecular methods such as polymerase chain reaction ( pcr ) assay and array hybridization technologies . with traditional culture - based diagnostic techniques being partially superseded by several methods , like matrix - assisted laser desorption ionization time - of - flight mass spectrometry , pcr , real - time pcr and molecular hybridization - based technologies , the speed and accuracy of both the diagnosis and prevention of infectious diseases have been greatly improved . for instance , an internal transcribed spacer - targeted oligonucleotide chip was successfully used to detect and identify important bacterial pathogens associated with sepsis directly from the blood sample . another study also reported the use of a multiplex real - time pcr assay to identify members of the mycobacterium tuberculosis complex . although the accuracy of pathogen identification has been improved , some newly emerging and unknown pathogens still can not be identified using these current technologies . in recent years , unbiased high - throughput sequencing ( hts ) has been applied in medical microbiology as an emerging and powerful technique due to its low cost and rapid turnaround time . some notable observations are the detection of a rapid hospital spread of antibiotic - resistant klebsiella pneumonia , distinguishing legionella pneumophila outbreak isolates from nonoutbreak isolates and identifying methicillin - resistant staphylococcus aureus outbreak isolates . recently , the use of metagenomic analysis methods , which applies hts has been proposed for infectious disease detection . although hts has an important impact on the detection of pathogens , some challenges remain due to a lack of standard operating procedures . here , we have developed an efficient , accurate and comprehensive method based on hts for the rapid detection and identification of infectious pathogens directly from clinical specimens , which can be used in the context of more challenging and troublesome diseases such as a fever of unknown origin ( fuo ) . the blood samples were collected from five patients , when they were transferred immediately to the intensive care unit ( peking union medical college hospital ) with the same symptoms as fuo . and then blood samples were processed as the following steps : centrifuged ( 4c , 10 min , 1600 g ) within 8 h , transfer plasma to another tube and delivered in dry ice type environments . two blood samples , which were referred to as updid2017 and updid2011 - 1 , were blood culture positive for pseudomonas aeruginosa and streptococcus viridians , respectively . the remaining three samples , which were referred to as updid2020 , updid2026 and updid0559 - 1 were blood culture negative . all samples were collected in sterile tubes and were centrifuged at 1600 g , and then the plasma was transferred to another tube for performing the follow - up analyses . ethical approval for the study was obtained from the institutional review board of bgi - shenzhen . all patients had signed informed consent , and samples could then be used for research only . nucleic acid ( including dna and rna ) was extracted directly from the clinical samples with qiaamp viral rna mini kit ( qiagen ) . after extraction , the reverse transcription reaction was performed with primescript rt - pcr kit to generate single strand cdna . next , the double strand cdna was obtained according to the second strand cdna synthesis kit manufacture 's instruction . finally , the reaction product was purified using the qiaquick pcr purification kit ( qiagen ) . the cdna library was constructed after end repairing , a - tailing , adapter ligation and pcr . the high - quality sequence data were generated through removing low quality reads , adapter contamination , duplication reads and discarding reads shorter than 35 bp . to eliminate the effect of the human sequence , the data were removed that was mapped to a human reference sequence hg19 using burrows subsequently , we mapped the remaining sequence to the bacterial , virus , and fungi database . for a nonredundant bacterial database , we downloaded the complete genome set of version 20140829 from ncbi ( http://www.ncbi.nlm.nih.gov/ ) . for the nonredundant viral database , we chose 100 different viruses that are associated with human health based on version r194 from genbank ( http://www.ncbi.nlm.nih.gov/genbank ) . for the nonredundant fungal database , we downloaded the fungal genomic sequences associated with human disease from ncbi . at present , our databases contain 580 genus of bacteria , and 110 species of virus that are related to human diseases , and 14 species of fungi that can cause infectious in humans . the time cost of our projected pipeline is almost 3 days ( 2 days and 10 h ) based on the current technology of library construction and sequencing [ figure 1a ] . ( a ) the framework of rapid pathogen detection , which includes dna / rna extraction , sample preparation , dna library construction , sequencing , and data analysis . the analysis took 2 days and 10 h. h stands for hour and d stands for day ; ( b ) the complete data analysis process , followed by qc , trim host sequences , and database alignment . we used the software named soapcoverage from the soap website ( http://soap.genomics.org.cn/ ) to calculate the depth and coverage of each position . for bacterium , the result with coverage more than 1% and the number of stringent reads more than 10 was adopted . for fungi , the result with coverage of more than 0.1% and the number of stringent reads of more than 50 was reserved . because of the high virus mutation rate , we chose the result with coverage of more than 10% and sequence length more than 1000 bp . the relative abundance of each microbe was made according to the following definition that modified the rpkm definition , because the pathogen content is ultimately low : rpmm = ( 10 c)/(n l ) the rpmm represents the relative abundance of 1 million base - pairs in length , c is the number of reads that aligned to this microbe reference , n is the total number of reads , and we carried out 16s rrna identification for p. aeruginosa and s. viridians , and sequence - specific pcr identification for epstein barr virus ( ebv ) with a target fragment of 250 bp to validate the result , respectively . the primers for 16s are ( forward and reverse ) : 5-caacgcgaagaaccttacc-3 , and 5-gacgggcrgtgwgtrca-3 the ebv specific primers we used were : 5-tctggcagcttttggcctt-3 , and 5-gttggagttagagtcagat-3 subsequently , we sequenced these target products by sanger sequencing . the blood samples were collected from five patients , when they were transferred immediately to the intensive care unit ( peking union medical college hospital ) with the same symptoms as fuo . and then blood samples were processed as the following steps : centrifuged ( 4c , 10 min , 1600 g ) within 8 h , transfer plasma to another tube and delivered in dry ice type environments . two blood samples , which were referred to as updid2017 and updid2011 - 1 , were blood culture positive for pseudomonas aeruginosa and streptococcus viridians , respectively . the remaining three samples , which were referred to as updid2020 , updid2026 and updid0559 - 1 were blood culture negative . all samples were collected in sterile tubes and were centrifuged at 1600 g , and then the plasma was transferred to another tube for performing the follow - up analyses . ethical approval for the study was obtained from the institutional review board of bgi - shenzhen . all patients had signed informed consent , and samples could then be used for research only . nucleic acid ( including dna and rna ) was extracted directly from the clinical samples with qiaamp viral rna mini kit ( qiagen ) . after extraction , the reverse transcription reaction was performed with primescript rt - pcr kit to generate single strand cdna . next , the double strand cdna was obtained according to the second strand cdna synthesis kit manufacture 's instruction . finally , the reaction product was purified using the qiaquick pcr purification kit ( qiagen ) . the cdna library was constructed after end repairing , a - tailing , adapter ligation and pcr . the high - quality sequence data were generated through removing low quality reads , adapter contamination , duplication reads and discarding reads shorter than 35 bp . to eliminate the effect of the human sequence , the data were removed that was mapped to a human reference sequence hg19 using burrows subsequently , we mapped the remaining sequence to the bacterial , virus , and fungi database . for a nonredundant bacterial database , we downloaded the complete genome set of version 20140829 from ncbi ( http://www.ncbi.nlm.nih.gov/ ) . for the nonredundant viral database , we chose 100 different viruses that are associated with human health based on version r194 from genbank ( http://www.ncbi.nlm.nih.gov/genbank ) . for the nonredundant fungal database , we downloaded the fungal genomic sequences associated with human disease from ncbi . at present , our databases contain 580 genus of bacteria , and 110 species of virus that are related to human diseases , and 14 species of fungi that can cause infectious in humans . the time cost of our projected pipeline is almost 3 days ( 2 days and 10 h ) based on the current technology of library construction and sequencing [ figure 1a ] . ( a ) the framework of rapid pathogen detection , which includes dna / rna extraction , sample preparation , dna library construction , sequencing , and data analysis . the analysis took 2 days and 10 h. h stands for hour and d stands for day ; ( b ) the complete data analysis process , followed by qc , trim host sequences , and database alignment . we used the software named soapcoverage from the soap website ( http://soap.genomics.org.cn/ ) to calculate the depth and coverage of each position . for bacterium , the result with coverage more than 1% and the number of stringent reads more than 10 was adopted . for fungi , the result with coverage of more than 0.1% and the number of stringent reads of more than 50 was reserved . because of the high virus mutation rate , we chose the result with coverage of more than 10% and sequence length more than 1000 bp . the relative abundance of each microbe was made according to the following definition that modified the rpkm definition , because the pathogen content is ultimately low : rpmm = ( 10 c)/(n l ) the rpmm represents the relative abundance of 1 million base - pairs in length , c is the number of reads that aligned to this microbe reference , n is the total number of reads , and we carried out 16s rrna identification for p. aeruginosa and s. viridians , and sequence - specific pcr identification for epstein barr virus ( ebv ) with a target fragment of 250 bp to validate the result , respectively . the primers for 16s are ( forward and reverse ) : 5-caacgcgaagaaccttacc-3 , and 5-gacgggcrgtgwgtrca-3 the ebv specific primers we used were : 5-tctggcagcttttggcctt-3 , and 5-gttggagttagagtcagat-3 subsequently , we sequenced these target products by sanger sequencing . species of p. aeruginosa and s. viridians in sample updid2017 and updid2011 - 1 were found to be positively grown . for each sample , we adopted pooling sequencing with an 8 bp index for all of the samples , which improved the utilization of proton . the raw - data output was 5.1 m , 46.2 m , 4.9 m , 6.1 m and 55.7 m reads for updid2017 , updid2011 - 1 , updid2020 , updid2026 and updid0559 - 1 respectively , which fulfilled the analytical standard quantity . the result of blood culture in clinical laboratory + represents positive , and the remaining data were mapped to the bacterial database with the mapping rate from 0.08% to 15.22% . however , for viruses whose genome is short , the proportions were all lower than the bacterial data . only updid2026 and updid0559 - 1 samples had a higher proportion of 2.27% and 2% . using our method based on proton sequencing , we detected the presence of p. aeruginosa in sample updid2017 with the coverage of 6.7% . p. aeruginosa is a common opportunistic pathogen , and is capable of causing serious infections that can cause wound infection , otitis media , meningitis , respiratory tract infection , urinary tract infection and septicemia , with varying degrees of fever . in addition , we also found traces of other bacteria with low coverage and depth , such as azotobacter vinelandii ( a nitrogen fixing bacteria ) , escherichia coli and shigella sonnei . e. coli is an opportunistic pathogen that mainly colonizes the human gut and sometimes causes intestinal diseases and genitourinary disorders . by contrast , shigella is a pathogen that can cause bacillary dysentery . given their low coverage and depth , we thought they may be the homologous sequences that can not cause such infectious symptoms . according to our parameters and clinical symptoms , we confirmed that p. aeruginosa was the cause of fever in sample updid2017 . in sample updid2011 - 1 that was positive for s. viridians after blood culture , we did not find any trace of s. viridians or other bacteria or viral species , which suggested the possibility of a false positive in the blood culture . in fact , s. viridians is an important bacteria among normal human flora that mainly colonizes the oral microbiome , followed by the respiratory tract , gastrointestinal tract , and female genital tract . interestingly , we found ebv , namely human herpesvirus 4 , with the coverage of 86% in the sample updid0559 - 1 , which was negative when we performed blood culture . ebv is the cause of nasopharyngeal carcinoma , which is also associated with chronic fatigue syndrome , infectious mononucleosis , and lymphoproliferative diseases . in addition to ebv , we did not detect any other pathogens . due to the uncultured nature of ebv using the conventional blood culture approach for the two remaining blood culture negative samples , in addition to e. coli and shigella that were detected in other samples as fragmented and homologue sequences , we did not find any closely or relevant pathogens . to profile for positive results whatever based on culture and sequencing , detailed information on data statistics is listed in table 3 , and the coverage and depth of p. aeruginosa , s. viridians and ebv along the genomic sequence in sample updid2017 , updid2011 - 1 and updid0559 - 1 were figured out . we found that the coverage distribution of p. aeruginosa and ebv genomes were dispersed and uniform , although s. viridians contained reads in only some special regions [ figure 2 ] . the annotation result for each sample rpmm : represents the relative abundance of 1 million base pairs in length , which was similar with the definition of rpkm value . the horizontal axis represents the position of each species while the vertical axis is the corresponding bin depth ; ( b ) the coverage profile of pseudomonas aeruginosa we detected . the horizontal axis represents the position of each species while the vertical axis is the corresponding bin depth ; ( c ) the coverage profile of epstein barr virus we detected . the horizontal axis represents the position of each species while the vertical axis is the corresponding bin depth . sanger sequencing was carried out on the original sample with 16s rrna identification for updid2017 and updid2011 - 1 , as well as sequence - specific pcr identification for updid0559 - 1 . the results showed that p. aeruginosa and ebv were present in the original samples updid2017 and updid0559 - 1 , and in rti2011 - 1 there was no trace of s. viridians , respectively [ figure 3 ] . ( a ) the result of 16s pcr validation ( updid2011 - 1 , updid2020 , updid2026 and updid2017 ) . the marker we used is trans 2k plus dna maker ; ( c and d ) is the sanger sequence of target fragments . m and n represent marker and negative control , respectively . the current diagnostic paradigm consisted of four main stages , starting with the detection of a pathogen in the sample . if a clinically relevant pathogen was detected , then this might be further tested for identification of drug susceptibility and epidemiological typing . however , for most viruses , drug susceptibility , and epidemiological typing are not performed . the traditional method of detection and identification always takes several days or even weeks , which might delay the most optimal treatment times . besides this , due to the limited resolution of the method itself , the accuracy still needs to be improved . therefore , in order to detect the pathogen directly in the clinical sample , we developed a rapid , efficient and accurate method containing experimental and bioinformatics analysis processes based on proton sequencing . the whole process including sample preparation , library construction , sequencing , data analysis and issuing reports , could take almost 3 days ( 2 days and 10 h ) . compared with the traditional clinical microbial diagnostic methods based on conventional culturing , it shortens the whole period greatly . in addition , its ability to detect pathogens that are not cultivable or unknown has improved dramatically . despite the advantage of our method shows , there are still several problems to be improved upon . in regard to the experiment process , more technologies are essential to be developed such as with low dna input based on proton sequencing . for most of the clinical samples , like blood samples , the nucleic acid content that is used for library construction after removing the majority of human cells is very low , and even at the nanogram ( ng ) scale , which will cause false negative result . this process is not only applied to blood samples , but it is also necessary to develop various methods of sample preparation for different types of samples . to optimize this process further , sample preparation must be simplified , which would reduce the turnaround time to a few hours and the need for highly skilled and trained technical staff . in the context of bioinformatics analysis , considering the present opportunistic pathogens belong to the human normal microbial flora , the threshold to determine whether a pathogen is clinically relevant should be more stringent . thus , the research aiming at the distribution , coverage and abundance of the normal microbial flora should be carried out . besides this , the database we used will be updated continuously . it would not only encompass bacterial and viral genomes , but will also incorporate fungal and protist genomes . it will also represent a catalogue of point mutations or genes that account for drug resistance , which would also be added . in the present study , we only employed our method to perform detection and identification of clinically relevant pathogens . for those sequences that are both unmapped to human sequences and microbial databases , we should determine whether they are contaminated or whether this is due to homologous sequence of other eukaryotic genomes , or novel sequences of the human genome , or even perhaps novel microbial genomic sequences that we had not discovered thus far . however , unknown pathogen identification should be considered such as mapping to the nr database according to protein sequence homology . the sensitivity of hts will cause false positive result . finally , the advancement of hts sequencing technology will reduce the time and bring down the cost of hts . with the increasing demand for rapid detection and identification of infectious pathogens in clinical samples , the method we developed would play an important role in the clinical laboratory and potentially revolutionize the capability of identifying infectious and novel pathogens .
background : the dilemma of pathogens identification in patients with unidentified clinical symptoms such as fever of unknown origin exists , which not only poses a challenge to both the diagnostic and therapeutic process by itself , but also to expert physicians.methods:in this report , we have attempted to increase the awareness of unidentified pathogens by developing a method to investigate hitherto unidentified infectious pathogens based on unbiased high - throughput sequencing.results:our observations show that this method supplements current diagnostic technology that predominantly relies on information derived five cases from the intensive care unit . this methodological approach detects viruses and corrects the incidence of false positive detection rates of pathogens in a much shorter period . through our method is followed by polymerase chain reaction validation , we could identify infection with epstein barr virus , and in another case , we could identify infection with streptococcus viridians based on the culture , which was false positive.conclusions:this technology is a promising approach to revolutionize rapid diagnosis of infectious pathogens and to guide therapy that might result in the improvement of personalized medicine .
anterior chamber ( ac ) aqueous tube shunt surgery improves intraocular pressure ( iop ) control in glaucoma patients . initially used as a treatment for refractory glaucoma , its use is now more widespread [ 13 ] . one of the possible complications of tube shunt surgery , however , is corneal endothelial cell loss which may lead to corneal decompensation [ 46 ] . the exact mechanism for this is unclear , with the leading theories being turbulent aqueous flow around the tube or intermittent touching between the tube and the cornea [ 4 , 7 ] . in addition to the easily recognized direct touch of the corneal endothelium by the tube tip , the site where the tube enters the ac may also be a location of corneal endothelial contact and damage . in cataract surgery , the location of the incision is one of the factors that induce endothelial cell changes and decrease cell density [ 8 , 9 ] . while there are many studies in which optical coherence tomography ( oct ) has been used to image the anterior segment of the eye [ 1014 ] , only two have focused on aqueous tube shunts . in those reports , a time - domain oct with limited resolution , 17 m full - width - half - maximum depth , was used to identify aqueous tube shunt patency and position in the presence of corneal opacities [ 15 , 16 ] . due to the relatively low resolution , fine structures such as the corneal endothelium and trabecular meshwork could not be visualized , and the level of the tube entry relative to schwalbe 's line could not be established . in this study , we used a fourier - domain oct system with higher speed and resolution ( 5 m ) . the current study evaluates the position of the tube shunt relative to schwalbe 's line , as well as patency of the tube opening . patients that had previously undergone ac aqueous tube shunt implantation ( baerveldt glaucoma implant 350 , abbot medical optics , inc . , santa ana , ca , usa ) by one surgeon ( baf ) and were seen in followup at the glaucoma service of the doheny eye institute ( keck school of medicine , university of southern california , los angeles , ca , usa ) between july and september 2009 were included . clinical data as well as slit lamp findings were collected from patient records , and gonioscopy was performed on all patients . oct images of the shunts were acquired and analyzed and compared to slit lamp findings . approval for data collection and analysis was obtained from the institutional review board of the university of southern california , and the research adhered to the tenets set forth in the declaration of helsinki . longitudinal imaging of the shunt was performed with a commercially available fourier - domain oct system , the rtvue ( optovue , inc . , the system functions at 830 nm wavelength and is capable of 26,000 axial scans per second . it achieves a full - width - half maximum axial resolution of 5 m in tissue . was designed to provide telecentric scanning so that the oct beam remains parallel to the central axis across the transverse scan range . this lens allows the acquisition of anterior segment images with a transverse resolution ( focused spot size ) of 15 m . high - resolution scan mode ( 1024 a - scans ) was used with the scan line parallel to the axis of the aqueous tube shunt . the tissue scan depth was 2.0 mm , and the scan length was 6 mm . these scans were registered , and the image frames were averaged to enhance signal strength and suppress speckle noise . using the two - dimensional image recorded by the rtvue , the length of corneal endothelium covered by fibrous proliferation was measured with the software caliper tool provided by the instrument . it was measured between the anterior edge of the fibrous tissue on the corneal endothelium to schwalbe 's line . all data were analyzed using the statistical package for the social sciences software ( version 13.0k , spss inc , chicago , il , usa ) . a wilcoxon rank test was used to compare the followup period between patients in which the inner limbal entrance could or could not be visualized . the study cohort included 18 consecutive patients ( 23 eyes ) who received ac aqueous shunt implants at the doheny eye institute by one surgeon ( baf ) . the patients included 6 females and 12 males with a mean age of 70.8 14.9 years ( range : 3789 years ) . self - reported ethnic backgrounds included 8 hispanic , 5 caucasian , and 5 asian . for the 23 eyes , 13 were diagnosed as primary open angle glaucoma ( poag ) , 5 as chronic angle closure glaucoma ( cacg ) , and 5 as neovascular glaucoma ( nvg ) . at the time of their visit , patients were using 2.0 1.0 ( range 04 ) topical glaucoma medications . with this treatment , iop was less than or equal to 16 mmhg except in all but one patient , for whom it was 47 mmhg . the iop ranged from 4 to 47 mmhg with a mean of 14.0 8.4 mmhg . optic nerve cup to disc ( c / d ) ratio was 0.88 0.14 ( range : 0.5 to 0.99 ) . conjunctival blebs were clinically evident in 19 eyes , and there was no bleb , or the bleb was unable to be visualized due to the upper eyelid in 4 eyes . the cornea was clear in 22 eyes , including 2 with a history of penetrating keratoplasty ( pkp ) , and edematous in the one eye with 47 mmhg iop and a history of pkp . details of the ac entrance were evident in 16 eyes , and the precise position of the tube shunt entry relative to the schwalbe 's line was visualized in 9 eyes . it was lying on the anterior surface of the iris in 14 eyes ( figure 1(a ) ) , between the cornea and iris in 4 ( figure 1(b ) ) , partially indenting the iris in 2 ( figure 1(c ) ) , and disrupting the corneal endothelium at its entrance in 3 ( figure 1(b ) ) . as visualized by oct , the tube position was different from that determined by slit lamp examination in 2 eyes . slit lamp biomicroscopy found one shunt close to the cornea and another touching the cornea , while oct found that both tubes were well away from the corneal endothelium , between the iris and the cornea . based on oct imaging , the tip of the shunt was patent ( figure 1 ) in 18 eyes , completely blocked ( figures 2(a ) and 2(e ) ) in another 2 eyes , and partially blocked ( figure 2(c ) ) in 3 eyes . in the 4 of the 5 eyes with an abnormality at the tip , it was extremely high , 47 mmhg , in the one where the tip was totally blocked . compared to the other eyes , the 5 eyes with shunt tip abnormalities were not associated with high iop ( p = 0.539 ) or more glaucoma medications ( p = 0.144 ) . the incidence of abnormal findings was higher in cacg eyes than in poag eyes ( p = 0.034 , table 1 ) . both oct and slit lamp examination detected tube blockage in the one case with extremely high iop ( figure 2(a ) ) . the other instances of tube blockage found by oct were not detected by slit lamp examination and did not result in elevated iop ( figures 2(c ) and 2(e ) ) . compared to slit lamp biomicroscopy , 4 eyes had new findings by oct including the tip indenting into the iris in 2 eyes , tip blocked in one , and partially blocked in another . in 16 of 23 eyes , details of the inner entrance were evident by oct , including the position of the tube shunt relative to schwalbe 's line ( figures 1(b ) and 3 ) in 9 eyes . however in 7 eyes , oct was unable to image the internal limbal entrance of the tube ( figure 4 ) . imaging of the inner entrance was apparently blocked by shadowing from the pericardium or scleral patch graft at the external limbus . these 7 eyes had a shorter average period ( 2.1 1.6 months ) between the implantation surgery and the study visit . for the other 16 eyes in which the inner entrance was imaged , the followup interval between surgery and imaging was 23.7 23.6 months ( p < 0.001 ) . in all 16 eyes in which the inner entrance was visualized ( figures 1 and 3 ) , fibrous proliferative tissue was attached to the corneal endothelium around the inner entrance of the tube and , in some cases , the iris . in only one of them , this proliferation was recorded by the slit lamp as an unspecified white tissue at the level of the inner cornea or corneal endothelium . the clinical impression from the slit lamp exam was a corneal opacity as a sign of touching between the tube and the cornea and early corneal decompensation . however , the oct showed that the tube entry was posterior to schwalbe 's line and that the observation instead represented fibrous tissue at the tube entry site . the distance of corneal endothelium covered by proliferative fibrous tissue was 518.3 291.0 m ( n = 16 ; range : 2511130 m ) . the relative position of the tube shunt was posterior to schwalbe 's line in 7 eyes and anterior to it in 2 eyes ( figures 1 and 3 ) . there were no differences in the iop and glaucoma medications with regard to the positions relative to schwalbe 's line ( p = 0.586 and 0.540 , resp . ) . in this cross - sectional observational study , we analyzed the oct images of 23 eyes with aqueous tube shunts to study the details of the position , patency , and the inner entrance of the tube . in our study , the use of high - resolution 830 nm fourier - domain oct enabled the visualization of the fine structural details of the inner entrance of aqueous tube shunts in the anterior chamber . to our knowledge , this is the first study of this kind . in many cases , the location of the inner entrance could be localized to either anterior or posterior to schwalbe 's line . in addition , fibrous proliferative tissue attaching the tube to the corneal endothelium around the entrance was present in all eyes . in our analysis , most tubes were clear from the cornea and lay on or near the surface of the iris . the mechanism for corneal decompensation with aqueous tube shunts is not fully understood , but endothelial contact at the entry site may be a risk factor [ 4 , 7 ] . a previous study showed that the distance between the tube and the cornea was not related to the dropout of the endothelium , but intermittent touching of the corneal endothelium due to blinking and rubbing of eyes can not be ruled out . however , previous studies in phakic intraocular lens patients showed that corneal endothelial dropout is related to the distance between the lens implant and cornea , and they also showed intermittent touching of the corneal endothelium by the intraocular lens [ 2022 ] . these patients were highly myopic and tended to have a deeper anterior chamber than many glaucoma patients , and the shunt is more flexible than the intraocular lens . so placement of the tube as far from the cornea as possible is likely to be important , with the best location near the surface of the iris . using oct , the distance between the tube or tube tip and the corneal endothelium can be measured but is sometimes difficult due to the limited scan range of 1.8 mm with rtvue - cam . further study with long - term followup is required to draw a correlation between the tip to corneal endothelium distance and endothelial cell dropout . theoretically , if the aqueous outflow was blocked , there should be no posterior filtering bleb . however , in one of our two cases with apparent total blockage , the bleb was still present and the iop was controlled , indicating that there must have been a small communication at the tip of the tube . in the case with partial blockage , one oct scan showed the tip completely blocked by a membrane while another scan showed that a small cleft was present in the membrane that allowed the outflow of the aqueous . thus , it is important to acquire more than one longitudinal cross - sectional scan to avoid missing such important information . the 3d mode might be helpful in such cases , as it takes a series of scans instead of one . alternatively , the physician him / herself may need to perform the scan to see the real - time display of many sections through the tube rather than just look at one section recorded by a technician . because of the high resolution of oct , the fine structure of the inner limbal entrance was also imaged in our study . this may be related to the pericardium or scleral patch graft placed on the external surface of the sclera adjacent to the limbus . due to its high density , it blocks the transmission of light that is used in oct exam . this tissue will thin and be partially absorbed with time , so the entrance in patients with a long - term followup is more likely to be visualized . to avoid corneal endothelial trauma and possible corneal decompensation , the entry site of the tube should be posterior to schwalbe 's line . in all 16 eyes in which the entrance could be clearly visualized , some proliferative tissue was present around the tube entrance , attaching the tube to the corneal endothelium . this proliferation may cause additional damage via traction on the endothelium or by blocking the nutritive elements of aqueous from reaching the corneal endothelium . it is also important to differentiate this finding from a corneal opacity that may represent touch points between the tube and the cornea and early decompensation . the first was its small sample size . despite the many types of ac shunts implanted clinically , only one kind of aqueous shunt was studied here . as this was a cross - sectional study and corneal endothelial density was not recorded , the relationship between the endothelial density and the oct findings was not evaluated . thus , further study with long - term followup and more cases may determine the significance of the oct findings , including the position of the tube , location of the entrance , and presence of fibrous tissue proliferation . in summary , high - resolution fourier - domain oct was used to evaluate the position of aqueous tube shunts in the anterior chamber relative to the cornea and iris in all patients . for patients with longer - term followup , details of the inner limbal entrance high - resolution oct may be useful in assessing tube patency , especially if occlusion is suspected clinically . it may also be helpful to study corneal complications by showing if the entry site is anterior or posterior to schwalbe 's line and providing measurements of fibrous tissue along the endothelial surface and the distance between the tube tip and endothelium .
purpose . this cross - sectional , observational study used fourier - domain optical coherence tomography ( oct ) to examine the position , patency , and the interior entrance site of anterior chamber ( ac ) aqueous tube shunts . methods . the oct , slitlamp biomicroscopy , and gonioscopy findings of 23 eyes of 18 patients with ac shunts were collected and compared . results . oct images demonstrated the shunt position and patency in all 23 eyes , and the details of the ac entrance in 16 eyes . the position of the tube varied , with the majority ( 14/23 ) on the surface of the iris . the exact position of the ac entrance relative to schwalbe 's line ( sl ) could be determined in 9 eyes ( posterior to sl in 7 eyes , anterior in 2 eyes ) . at the ac entrance , growth of fibrous scar tissue was present between the tube and the corneal endothelium in all 16 eyes in which the entrance could be clearly visualized . it 's a new finding that could not be visualized by slitlamp examination or lower resolution oct . conclusion . compared to slitlamp examination , fourier - domain oct of ac tube shunts provided more detailed anatomic information regarding the insertion level relative to sl , scar tissue between the tube and the corneal endothelium , and patency of the tube opening .
renal transplantation is regarded as the optimal treatment for patients with end - stage renal disease . however , as long - term graft survival is still limited , most transplant patients will face graft loss after 9 - 10 years . these patients are generally more fragile and in considerable need of new grafts , in comparison to nave patients waiting for their first renal transplantation . it has been reported that the best approach to treat most patients suffering from chronic renal allograft failure is to perform a kidney retransplant , in hopes of avoiding the high risk of morbidity and mortality with a return to dialysis . these patients , however , are commonly human leukocyte antigens- ( hla- ) sensitized because of exposure to previous allograft(s ) ; thus there is a lower chance of their receiving a retransplant . retransplantation accounts for 1315% of the annual transplants performed in usa and only approximately 5% of those performed in europe . renal retransplant patients had high rates of acute rejection , from 33% to 69% , as reported in previous studies [ 46 ] . about two - thirds of these rejections were verified as antibody - mediated rejection ( abmr ) , comprising the primary cause of early graft loss . thus , it is well recognized that the risk of abmr in retransplantation increases markedly and needs to be prevented as much as possible . in contrast , the risk of t - cell mediated rejection ( tcmr ) in retransplantation is less of a concern . compared to first transplant patients , it is unclear whether the incidence of acute tcmr would significantly increase in retransplant patients without early abmr . in other words , if de novo donor - specific antibody ( dsa ) and its mediated abmr could be prevented successfully in retransplantation , would tcmr be brought to the forefront as an important issue ? here , we report on the early transplant outcomes of 33 second , third , and fourth kidney transplants performed at our hospital within the last 3 years . analysis focused particularly on the incidence and patterns of the early acute rejection episodes , as well as one - year graft and patient survival . between january 2013 and december 2015 , a total of 703 kidney transplants were performed at tongji hospital , including 521 transplants from deceased donors ( donation after brain death or cardiac death ) and 182 from living - related donors . of these , 662 ( 94% ) were first transplantations and 41 ( 6% ) were retransplantations . in the current retrospective study , for the retransplant group , we included 33 adult patients , who received a second , third , or fourth renal allograft with thymoglobulin induction therapy and tacrolimus - based maintenance therapy . the exclusion criteria were as the following : ( 1 ) pediatric recipients ; ( 2 ) renal allografts from pediatric donors ; ( 3 ) patients who received no induction therapy or received induction therapy other than thymoglobulin ; ( 4 ) patients who received a multiorgan transplant . for the control group , we selected 90 patients who received a first renal allograft during the same period and fulfilled the same inclusion and exclusion criteria . this study was performed after approval by the ethics committee at tongji hospital , tongji medical school , huazhong university of science and technology . data on transplantations and hospital stays , as well as follow - up data , were collected from hospital records . baseline characteristics , such as recipient age and gender , donor type ( deceased or living ) , number of previous transplants , cold ischemia time , number of hla mismatches , pretransplant panel reactive antibody ( pra ) percentages divided into groups ( 010% , > 10%50% , and 50% ) , and preformed dsa , were collected and analyzed . in addition , early clinical outcomes , including the generation of de novo dsa , rate of delayed graft function ( dgf ) , the frequency and type of acute allograft rejection ( cellular or antibody - mediated rejection ) , and one - year graft and patient survival , were analyzed . dgf was defined as the need for more than 1 dialysis during the first week after transplant . hla class i and ii antibody screenings were performed using flowpra ( one lambda , inc . , canoga park , ca ) , and the specificity determination was measured by luminex using labscreen single antigen beads ( one lambda , inc . , canoga park , ca ) . all patients received induction therapy with thymoglobulin and maintenance immunosuppression with tacrolimus , mycophenolate mofetil , and steroids . because of differences in immunological risk , the dosage and duration of the thymoglobulin administration were slightly different for the retransplant group , compared to the control group . the initial administration of thymoglobulin was finished intraoperatively , before the graft reperfusion , at a dose of 50 mg in the retransplant group and a dose of 25 mg in the control group . then , it was used daily by the retransplant group from day 1 to day 4 , reaching a total dosage of 125150 mg . in the control group , thymoglobulin was given from day 0 to day 2 at a daily dose of 25 mg . the peripheral blood lymphocyte counts were frequently monitored within the first 2 weeks after renal transplantation . methylprednisolone was given intravenously from day 0 to day 2 ( 500 mg / d ) , followed by oral doses of prednisone at 50 mg / d , which was then tapered every other day to a maintenance dose of 10 mg / d . mycophenolate mofetil was administered at a dose of 1.5 g / d and was subsequently reduced to 1 g / d depending on the individual 's white blood cell count . tacrolimus was started at day 3 , with a targeted trough level of 810 ng / ml initially and 68 ng / ml one month after transplantation . in our center , the decision of desensitization was mainly based on the laboratory testing results for pretransplant pra , preformed dsa , hla mismatch ( mm ) , and flow complement - dependent cytotoxicity ( cdc ) . as shown in figure 1 , sensitized patients were not required to be desensitized in the following two situations : ( 1 ) hla 0 mm between donor and recipient and ( 2 ) hla mm 1 , pra < 50% with negative dsa and flow cdc . in contrast , desensitization was suggested for sensitized patients in any of the following conditions : ( 1 ) hla mm 1 , dsa positive , and negative or weakly positive flow cdc ( 1015% ) ; ( 2 ) hla mm 1 and pra 50% with negative dsa and flow cdc . for a few highly sensitized patients with flow cdc 15% , the upcoming transplantation was then avoided due to the limitations of current desensitization therapy . the protocol we used to desensitize patients involved a combination of plasmapheresis ( pp ) , intravenous immunoglobulin ( ivig ) , and/or rituximab ( rtx ) . ivig was used at a dose of 300400 mg / kg each time and rtx was given once at a dose of 200 mg . in general , acute rejection was diagnosed using kidney biopsies upon banff 2007 or 2013 classification . when a tissue analysis was not available , the clinical diagnosis was based on an otherwise unexplained elevation of serum creatinine levels , coupled with appropriate physical signs ( including edema , oliguria , fever , or weight gain ) . all allograft biopsies were routinely stained for hematoxylin and eosin ( he ) and immunohistochemistry for c4d , cd3 , cd4 , and cd8 . the diagnosis of acute tcmr was based on the following criteria : ia , cases with significant interstitial infiltration ( > 25% of parenchyma affected , i2 or i3 ) , and foci of moderate tubulitis ( t2 ) ; ib , cases with significant interstitial infiltration ( > 25% of parenchyma affected , i2 or i3 ) , and foci of severe tubulitis ( t3 ) ; iia , cases with mild - to - moderate intimal arteritis ( v1 ) ; iib , cases with severe intimal arteritis comprising > 25% of the luminal area ( v2 ) ; iii , cases with transmural arteritis and/or arterial fibrinoid change and necrosis of medial smooth muscle cells with accompanying lymphocytic inflammation ( v3 ) . acute abmr was defined as a biopsy with or without c4d , evidence of acute renal injury and microvascular inflammation , in the presence of circulating dsa . if an episode of abmr occurred together with acute tcmr , it was also defined as abmr . early acute rejection referred to a rejection that developed < 90 days after transplantation . in our descriptive statistical analysis , results are expressed as numerical values and percentages for categorical variables and as mean values with standard deviation ( sd ) for continuous variables . the retransplant group comprised 28 ( 84.9% ) second , 4 ( 12.1% ) third , and 1 ( 3% ) fourth kidney transplants . the majority of patients received kidneys from deceased donors ( 72.7% in retransplant group and 100% in control group ) . no statistical difference was observed between the two groups in terms of cold ischemia time and the global hla mismatch ( 3.2 1.2 in the retransplant group versus 3.5 1.2 in the control group ) . however , in relation to the pretransplant pra levels , a much higher incidence of hla presensitization was present in the retransplant recipients than in the first transplant recipients ( 57.6% versus 3.3% , p < 0.001 ) . in particular , 11 ( 33.3% ) retransplanted patients were highly presensitized , as evidenced by the high pretransplant pra levels that were detected ( class i or class ii 50% ) . based on our criteria , 7 sensitized patients , including 3 patients with positive preformed dsa , received desensitization therapy to decrease anti - hla antibody levels and ensure a negative flow cdc before their retransplants . early transplant outcomes were then evaluated on the basis of the frequency of dgf and acute rejection , as well as one - year graft and patient survival . the incidence of dgf in both groups was not high , with 12.1% in the retransplant group and 17.8% in the control group ( p > 0.05 ) . the rates of acute abmr in both groups were similarly low , with 6.1% ( 2/33 ) in the retransplant group and 4.4% ( 4/90 ) in the control group ( p > 0.05 ) . in the retransplant group , two patients unexpectedly generated large amounts of de novo dsa in the first week after transplantation , resulting in severe acute abmr of renal allografts and eventual graft loss . in the control group , 3 grafts developed mild or moderate acute abmr , which was successfully reversed by treatment with pp + ivig . unfortunately , severe acute abmr was also seen in the control group , leading to graft loss in 1 patient . in the control group , acute tcmr was only seen in 5.6% ( 5/90 ) of the patients with an induction therapy of low thymoglobulin doses . however , even when a higher total dosage of thymoglobulin was administered , resulting in a satisfactory decline in peripheral blood lymphocyte count ( figure 2 ) , a much higher rate of tcmr was still observed in the retransplant group ( 30.3% versus 5.6% in the control group , p < 0.001 ) . a total of 14 acute tcmr episodes were observed in 10 of 33 retransplant patients . among them , 4 patients had 2 sequential episodes of early acute tcmr . the acute tcmr usually occurred around 2 weeks after the retransplantation and could be successfully reversed by either the high - dose steroid pulse therapy alone or its combination with thymoglobulin . his first renal allograft was from his sister ( half hla match ) , and the graft developed chronic failure after 10 years . his preretransplant pra levels were not significantly elevated ( class i : 18% and class ii : 2% ) . for his second transplant with hla 3 mm , ivig was given at a daily dose of 1020 g from day 0 to day 11 . the second renal graft achieved immediate function with serum creatinine ( scr ) levels decreasing rapidly and reaching normal levels at day 7 . however , increased scr levels were subsequently observed at around day 14 without detected dsa . acute tcmr was the suspected clinical diagnosis , and thus 3 doses of methylprednisolone ( mp , 500 mg / d ) were administered . after the treatment , the patient 's scr levels decreased to 117 mol / l at day 23 . surprisingly , at day 31 after transplantation , the patient once again had elevated scr levels ( 221 mol / l ) , and a biopsy was performed ( figure 3(a ) ) . pathological results indicated acute tcmr , banff 2007 grade iia ( i3 , t2 , v1 , and g0 ) , with extensive t - cell infiltration and negative c4d staining ( figure 3(b ) ) . the patient fully recovered after treatment with thymoglobulin ( 25 mg / d ) for 4 days and subsequent mp doses ( 500 mg / d ) for 3 days ( figure 3(a ) ) . interestingly , almost all the episodes of tcmr were observed in lower presensitized retransplant patients with pretransplant pra < 50% ( table 2 ) . in contrast , only 1 of 10 highly sensitized patients ( pra 50% ) developed acute tcmr . this patient did not receive desensitization due to 0 mm of hla to his donor . furthermore , none of the highly sensitized patients with desensitization therapy ( n = 7 ) developed acute tcmr , indicating that desensitization may have some role in the prevention of early tcmr ( table 2 ) . both groups had high rates of graft and patient survival at the one - year mark ( table 1 ) . in the retransplant group , graft and patient survival at 1 year were 93.9% and 100% , respectively . renal allograft failure was only seen in 2 retransplant patients , as a result of early severe acute abmr . in the control group , one female patient lost her graft in the early period after transplantation because of severe acute abmr . two patients lost their grafts due to renal artery rupture caused by donor - derived infections of candida albicans . additionally , the other 4 patients in the control group died with a functioning graft : 3 patients died from severe interstitial pneumonia which might be cytomegalovirus- ( cmv- ) relevant , while 1 patient died of cardiac arrest during surgery for renal graft rupture . since the recipients of retransplantation are usually sensitized to certain mismatched hla antigens because of exposure to previous allograft(s ) , they are at high risk for the development of acute abmr . this process is mediated by either preformed or induced dsa that is produced as a result of an anamnestic response by memory b cells . consequently , considerable efforts have been made to prevent abmr in kidney retransplantation , including a stringent immunological selection of donors , pretransplant desensitization therapy , and more potent induction therapy . as a result , since the hla presensitization may also result in the generation of alloantigen - specific memory t cells , which could mediate the so - called second - set rejection that is rather difficult to block or inhibit [ 11 , 12 ] , it is important to investigate the incidence and patterns of acute rejection in kidney retransplantation . in the current retrospective study , we included 33 retransplant patients and 90 first transplant patients with similar protocols of induction therapy and maintenance therapy . excellent short - term clinical outcomes were obtained in both groups , as evidenced by high rates of one - year graft and patient survival and low incidences of early acute abmr . even so , a much higher rate of early acute tcmr was observed in the retransplant group than in the first transplant group , which has been rarely reported or emphasized in the literature . it is well known that despite attempts devoted to improving outcomes in highly sensitized patients by using desensitization protocols , acute abmr rates remain high , afflicting about 28%40% of all cases [ 13 , 14 ] . in our cohort , however , a much lower incidence of acute abmr ( 6.1% ) was observed in retransplant patients , leading to significantly improved short - term graft survival . this result is different from previous studies , which could be explained by our cautious selection of patients and donors ( by avoiding flow cdc positive transplantation ) , the expanded indications for desensitization ( patients who had negative dsa and flow cdc but with pra 50% were given desensitization ) , and the lack of routine primary allograft nephrectomies ( implying no massive reduction in immunosuppressive drugs after the return to dialysis ) . in addition , compared to other studies which mainly focused on third and fourth renal transplant patients , the majority of our retransplant population were second graft recipients , who may have fewer anti - hla immunization and memory responses . finally , the ethnic background of our patients differs from caucasian and african american patients , which could influence transplant outcomes as well . notably , even with more potent thymoglobulin induction therapy , the retransplant patients in our study had a much higher incidence of early acute tcmr compared to the first transplant group . one study showed a relatively higher rate of both abmr ( 22% ) and tcmr ( 40% ) in 37 presensitized kidney transplant patients without any desensitization treatment . however , they mainly focused on abmr in their study and did not discuss anything about the problem of acute tcmr . in the present study , we found that the type of acute tcmr had the following characteristics : ( 1 ) usually occurring around 2 weeks after the retransplantation ; ( 2 ) repeated occurrence in some of the patients ; and ( 3 ) the fact that it could be successfully reversed by high - dose steroids and/or thymoglobulin . since almost all these episodes of tcmr were effectively reversed , the short - term clinical outcome was not affected in any way . however , long - term graft survival still warrants further observation . the mechanisms for the elevated occurrence of early acute tcmr in retransplant patients also remain unclear . in retransplant patients , there could be two potential approaches for the generation of alloreactive memory t cells : ( 1 ) direct alloantigenic stimulation of nave t cells during the course of the previous transplantation and ( 2 ) homeostatic proliferation in response to transient lymphopenia resulting from t - cell depletion therapy , which induces the proliferation and differentiation of nave t cells into memory cells . in contrast to nave t cells , memory t cells have lower activation thresholds and are less dependent on costimulation signals , are more resistant to killing by t - cell depletion therapy and regulation by regulatory t cells ( treg ) , and are less susceptible to conventional immunosuppressive agents . these features lead us to speculate that memory t cells may be responsible for the early acute tcmr observed in our retransplant patients . in the future , we will focus on memory t cells and try to provide direct evidence for our hypothesis . additionally , we found that none of the highly presensitized retransplant patients with desensitization therapy developed early acute tcmr , indicating that desensitization may have some role in the prevention of early tcmr . however , we can not draw a clear conclusion due to the small sample size in our current study . in conclusion , our data on kidney retransplantation show excellent clinical outcomes with low incidence of early acute abmr and satisfactory one - year patient and graft survival . however , the retransplant patients are at higher risk for the development of early acute tcmr , which requires accurate diagnosis and prompt treatment .
it has been reported that kidney retransplant patients had high rates of early acute rejection due to previous sensitization . in addition to the acute antibody - mediated rejection ( abmr ) that has received widespread attention , the early acute t - cell - mediated rejection ( tcmr ) may be another important issue in renal retransplantation . in the current single - center retrospective study , we included 33 retransplant patients and 90 first transplant patients with similar protocols of induction and maintenance therapy . analysis focused particularly on the incidence and patterns of early acute rejection episodes , as well as one - year graft and patient survival . excellent short - term clinical outcomes were obtained in both groups , with one - year graft and patient survival rates of 93.9%/100% in the retransplant group and 92.2%/95.6% in the first transplant group . impressively , with our strict immunological selection and desensitization criteria , the retransplant patients had a very low incidence of early acute abmr ( 6.1% ) , which was similar to that in the first transplant patients ( 4.4% ) . however , a much higher rate of early acute tcmr was observed in the retransplant group than in the first transplant group ( 30.3% versus 5.6% , p < 0.001 ) . acute tcmr that develops early after retransplantation should be monitored in order to obtain better transplant outcomes .
polymerase chain reaction ( pcr ) based cloning of gene of interest with high gc content is a long recognized problem . pcr is a most sensitive tool and various factors have to be optimized for amplification of gene of interest . high gc content of the gene generates complication during primer designing like mismatch and high annealing temperature , self - dimer formation , and secondary structure . sometimes , amplification of gene is not routinely achieved by normal pcr techniques . the most prominent problem associated is hairpin loop , which directly interferes during annealing of primers on difficult dna template that leads to no amplification . use of dmso and glycerol was reported to reduce the annealing temperature and denaturation temperature , increase the chances of breakage of secondary structure , and increase the efficiency of amplification [ 15 ] . the genes of m. tuberculosis are being cloned and expressed in e. coli cells in order to identify their possible role in mycobacterium life . the mycobacterium genome has very high gc content ( 66% ) which raised the possibility of hairpin structure in the genomic structure . from genome sequence analysis it was observed that ppe , pe , and pgrs multigene family code for proteins of approximately 11080 amino acids rich in proline and glutamic acid at n - terminal position . proline and glutamic acid residues are mainly coded by triplet of gc bases in mycobacterium genome . most of the genes for membrane proteins of m. tuberculosis were rich in gc content at terminal regions . presence of high gc content increased the annealing temperature beyond the extension temperature ( 72c ) and also repeated stretches generate the hairpin structure . in such cases , effectiveness and reproducibility of pcr amplification depend on detailed analysis of the possible secondary structures of the oligonucleotide primers as well as formation of self - dimers and cross - dimers with other interrelating oligonucleotides . though these problems have been considered by several investigators , no systematic details are available to approach this problem . in an attempt to clone gc rich genes ( rv0519c and rv0774c from m. tuberculosis and ml0314c from m. leprae ) from mycobacterium sp . , we designed primers by using standard method for gene amplification . rv0774c and rv0519c genes demonstrated 100% nucleotide identity in m. tuberculosis h37rv and m. tuberculosis h37ra . therefore , m. tuberculosis h37ra chromosomal dna was used as template for amplification of these two genes . we could amplify rv0774c gene , but rv0519c and ml0314c genes having high gc content at terminal region were not amplified by standard pcr procedures . therefore , an attempt has been made in the present investigation to standardize the conditions and ingredients that favor the amplification of gc rich sequences . taq polymerase and dntps were purchased from fermentas , usa . restriction enzymes were purchased from new england biolabs . kanamycin , middlebrook media , oadc , and tween 80 were purchased from hi - media , india . the strain mycobacterium tuberculosis h37ra was a kind gift from director of national institute of leprosy and other mycobacterial diseases , agra , india . mallika lavania of stanley browne laboratory , the leprosy mission , nandnagri , shahdara , new delhi . m. tuberculosis h37ra strains were routinely cultured for one week on middlebrook , 0.05% tween 80 , enriched with oadc . one week grown m. tuberculosis h37ra cells ( 1.5 ml ) were harvested by centrifugation at 5000 g for 20 min . harvested pellet was resuspended in 400 l tris - edta buffer ( 100 mm tris/10 mm edta , ph 8) . the cells were lysed by putting the sample in boiling water bath for 5 min followed by cooling on ice for 5 min . forty microliters of 20 mg / ml lysozyme and 5 l of proteinase k were added . after 1 h of incubation at 37c , solution a ( 56 l of 10% sds , 64 l of ctab - nacl ) was added to the reaction mixture . after 2 h of incubation at 65c , proteins were removed by 2 - 3 times of washing with phenol : chloroform : isoamyl alcohol ( 25 : 24 : 1 ) . the genomic dna was precipitated with 0.6 volume of isopropanol at room temperature for 1 h. the precipitated dna was dried and dissolved in sterile water and stored at 20c . degeneracy of codon is normally used to overcome the existing problem including change of base at wobble position specific for coding sequence of mycobacterium genome . designed forward primer of rv0519c contributes about 64% gc content and stretches of gc led to generation of complicated hairpin structure with high value of free energy change g . by carefully examining the hairpin structure , introduction of the small base / pair the incorporation we opted in the primer sequence was as follows : guanine ( g ) base turned into adenosine ( a ) at wobble position of third codon cgg and thymine ( t ) to adenine ( a ) in codon cgt ( table 1 ) . similarly in reverse primer of rv0519c primer sequence , the adenosine ( a ) base was turned into thymine ( t ) at wobble position of last sixth codon cga . the primers were designed based on the genomic sequence deposited in genbank under accession number nc_000962.3 and sequence of ml0314c was retrieved from leprosy database ( http://mycobrowser.epfl.ch/leprosy.html ) . pcr was carried out in 25 l reaction volumes containing 75 ng genomic dna templates , 2.5 mm of dntp mix , 4 mm mgso4 , 1.0 m of each primer sets , 1 u/l taq polymerase , and 1x tris buffer containing kcl ( fermentas , usa ) and 5% dmso ( v / v ) . the sequences of both forward and reverse primers are listed in table 1 . these sets of primers were used to clone rv0774c and rv0519c genes from isolated genomic dna of m. tuberculosis h37ra ( table 1 ) and ml0314c gene from m. leprae genomic dna as follows : denaturation for 4 min at 94c , then 30 cycles consisting of 50 s at 94c , 40 s at 63.3c , and 2 min at 72c and then 7 min at 72c for final extension . pcr product was analyzed on 1.5% agarose gel and purified with rbc column dna extraction kit . the gene sequences of rv0519c and ml0314c were analysed and the modified primers were reconstructed for the amplification of gene . we followed the above given pcr procedure to amplify the gene with annealing temperatures of 64.5c and 62c . to confirm the sequence of amplified product , the purified pcr products for all three genes were sent for sequencing with specific primers . strategies for the cloning of complicated dna sequences are of the most significance and it has to be optimised through simple procedures . for pcr based cloning of genes , primer is one of the crucial factors for successful amplification of the genes to be cloned . length of primer and annealed matches increase the specificity of the reaction but it may not always be an authentic reason to get desired amplicons . with the development of sequencing technology , many tools have been developed to design primers . but the noticeable points with these databases were the variability of primers properties like annealing temperature , prediction of secondary structure , and so forth . successful amplifications were performed even with primer pairs that were generated through integrative oligoanlyser tools , at annealing temperature close to predicted value ( http://eu.idtdna.com/analyzer/applications/oligoanalyzer/ ) . high gc content in the genes of mycobacterium species generate stable secondary structures which often form in the oligos dna that halt the progression of dna polymerase during amplification ( figures 1(a ) and 1(b ) ) . in the present study , the primer properties were evaluated through different most widely used oligo designing tools such as idt , sigma , oc , and manual . current study illustrated the need to balance length and melting temperature with respect to gc content of gene at terminal sites , while designing primers for the pcr . it also emphasised the importance of careful investigation of sequences for gc - rich repeats , giving rise to complicated secondary structures , which could reduce the efficiency of amplification . we successfully amplified the rv0774c gene with normal pcr primers and procedure ( figure 2(a ) , lane 3 ) . on the other hand , no amplification was observed in case of rv0519c gene ( gc content 69% ) under same reaction conditions ( figure 2(a ) , lane 4 ) . attempt had been made to amplify the gene with a long range of annealing temperatures but without success . application of dmso and glycerol was also checked with different concentrations ( 310% ) with no visible effect on the amplification of the rv0519c gene ( data not shown ) . the16s rdna was amplified with dna template ( figure 2(a ) , lane 1 ) . on analysis of terminal regions of the rv0774c and rv0519c genes the presence of stable hairpin structures was not observed in case of rv0774c , despite the high gc content while the high gc content at terminal region of rv0519c gene led to formation of strong hairpin loop structure formation during normal primer designing procedure ( table 1 ) . in normal forward primer the value of g is more towards negative side ( g = 3.67 kcal / mol ) , and a complicated hairpin structure formation was observed in case of standard reverse primer used for amplification of rv0519c gene ( table 1 ) . thus , it was essential to decrease the gc content and change of corresponding nucleotides of oligos according to the wobble hypothesis approach . therefore , we designed the primers by using the degeneracy of codon and checked the hairpin loop formation by integrative dna - oligoanalyser . all the introduced modifications at wobble position were analysed on idt tools for their effectiveness to distort hairpin . out of five changes , one by one and together , we observed that single / double point changes were able to distort the whole secondary structure ( data not shown ) . we introduced small change at nucleotide level , starting with codon cgg to cga and cgt to cga during designing of forward primer sequence while single nucleotide change cgt to cga in case of reverse primer distorted the possible hairpin structure . introduction of small changes at nucleotide level during primer designing reduced the chances of hairpin loop formation ( g = 0.31 kcal / mol ) , resulting in sharp amplification of rv0519c gene through normal pcr procedures ( figure 2(c ) , lane 2 ) . similar problem was observed in amplification of ml0314c gene ( gc content , 60% ) from m. leprae while 16s rdna was successfully amplified from m. leprae genome ( figure 2(b ) , lane 3 ) . primers designed for ml0314c gene from normal procedures demonstrated mismatch annealing temperature as well as strong hairpin loop structure ( table 1 ) . this problem was also tackled successfully by changing nucleotide as well as addition of nucleotide at terminal position , upstream to the restriction sites to sort out the annealing mismatch between the primers . g for reverse primer was changed from 1.45 to 1.19 kcal / mol . the single nucleotide modification at wobble position tcg to tcc distorted the whole hairpin structure . the strategy was successfully confirmed by amplification of ml0314c gene ( figure 2(d ) , lane 1 ) from m. leprae genome . a major benefit of this protocol was to resolve the problem of tm mismatch as well as existence of secondary structure in the primer pairs of high gc rich sequences . by using this approach we could adjust the tm mismatch without increasing the length of primers which may be responsible for dimerization . the high tm of primers , which become a setback in carrying out pcr , was easily solved by this method ( figure 3 ) . this strategy might work successfully for amplification of ppe , pe , and pgrs protein of m. tuberculosis containing large number of proline and aspartate residues that are mostly coded by repeats or stretch of g or c , which increased the chance of hairpin loop formation and annealing mismatch during standard pcr primer designing . by using the wobble hypothesis approach in primer designing , we were able to tackle the ongoing amplification problem associated with complicated gene of mycobacterium with high gc content . in this approach a single modification at base level the resulting gene sequence is different slightly from the canonical sequence of the reference genome without modification in the amino acid sequence of the protein .
the genome of mycobacterium is rich in gc content and poses problem in amplification of some genes , especially those rich in the gc content in terminal regions , by standard / routine pcr procedures . attempts have been made to amplify three gc rich genes of mycobacterium sp . ( rv0519c and rv0774c from m. tuberculosis and ml0314c from m. leprae ) . out of these three genes , rv0774c gene was amplified with normal primers under standard pcr conditions , while no amplification was observed in case of rv0519c and ml0314c genes . in the present investigation a modified primer based approach was successfully used for amplification of gc rich sequence of rv0519c through codon optimization without changing the native amino acid sequence . the strategy was successfully confirmed by redesigning the standard primers with similar modifications followed by amplification of ml0314c gene .
healthy horses : eleven foals ( 7 males and 4 females under one year old ) and an yearling female thoroughbred were used for evaluation of the development stages of the gastric mucosae of healthy horses . details of the program for endoscopic examination are summarized in table 1table 1.endoscopic examination of the healthy horsesm : male , f : female . the number of horses is shown in parentheses , eleven foals ( 7 males and 4 females under one year old ) and an yearling female thoroughbred were used for evaluation of the development stage of the gastric mucosa of healthy horses .. m : male , f : female . the number of horses is shown in parentheses , eleven foals ( 7 males and 4 females under one year old ) and an yearling female thoroughbred were used for evaluation of the development stage of the gastric mucosa of healthy horses . affected foals : in the clinical field , it has been empirically demonstrated that foals suffering from gastric ulcer frequently exhibit depression , dysorexia or diarrhea [ 1 , 3 , 11 ] . fifty - six foals having these symptoms were used for examination of gastric ulcer by endoscope , as shown in table 2table 2.endoscopic examination of the affected horsesage ( days)number of examinations at each age ( days)malefemaletotal4305383160981761901091991120718121198224total332356 . we devised a grading system for the gastric ulcers of the foals according to andrews criteria and calculated the distribution of the lesions . the grading system was as follows : a score of 1 indicates that the mucosa is intact , but associated with areas of hyperemia with erosion ( fig . 1.a grading system for the gastric ulcers of foals ( modified andrews criteria , 1999 ) . ( a ) score 1 : the mucosa is intact , but associated with areas of hyperemia with erosion ( arrows ) . ( b ) score 2 : small , single or multifocal superficial ulcers with hyperemia ( arrows ) . ( c ) score 3 : large , single multifocal or extensive superficial ulcers with hyperemia ( arrows ) . ( d ) score 4 : extensive lesions with areas of apparent deep ulceration ( arrow ) . ) . a score of 2 indicates a small , single or multifocal superficial ulcer with hyperemia ( fig . a score of 3 indicates a large , single , multifocal or extensive superficial ulcer with hyperemia ( fig . finally , a score of 4 indicates extensive lesions with areas of apparent deep ulceration ( fig . 1d ) . a grading system for the gastric ulcers of foals ( modified andrews criteria , 1999 ) . ( a ) score 1 : the mucosa is intact , but associated with areas of hyperemia with erosion ( arrows ) ( b ) score 2 : small , single or multifocal superficial ulcers with hyperemia ( arrows ) . ( c ) score 3 : large , single multifocal or extensive superficial ulcers with hyperemia ( arrows ) . ( d ) score 4 : extensive lesions with areas of apparent deep ulceration ( arrow ) . endoscopic examination : the endoscope ( vq-8303a , olympus , tokyo , japan ) used in the present study has an effective length of 3,000 mm , a tip diameter of 10.6 mm , a suction unit and an image recording apparatus . the endoscopic procedure was performed according to previous reports [ 10 , 13 ] . for the purpose of sedation and pain relief , a combined solution of xylazine ( 0.5 mg / kg , iv , nippon zenyaku kogyo co. , ltd . , koriyama , japan ) and butorphanol ( 0.01 to 0.02 mg / kg , iv , bristol - myers squibb co. , tokyo , japan ) was used before endoscopic examination . the endoscope was inserted via the nasal cavity of foals and reached the stomach cavity expanded by air from a biopsy channel . endoscopic examination was performed on 4 regions of the squamous mucosa in the lesser curvature ( lc - s ) , squamous mucosa in the greater curvature ( gc - s ) , glandular mucosa in the greater curvature ( gc - g ) and pylorus ( p ) . statistical analysis of the mean scores was performed with the t - test . healthy horses : at the 6th day after birth , the margo plicatus was clear , and serrated ridges were not noticeable . the squamous mucosa ( lc - s and gc - s ) wall was very thin , and part of the spleen attached to the outer wall of the stomach was observed through the thin gastric mucosa . the gc - g exhibited a thin membrane - like appearance with a clear color . the margo plicatus became clear at 14 days old , and the formation of serrated ridges was not observed at that time . the squamous mucosa wall thickened somewhat , had a translucent luster and appeared to be wet . the squamous mucosa wall thickened further , and the clarity of the stomach wall was lost . the gc - g was wet and had a surface structure containing irregularities that were finely granular . at 28 days old , a serrated ridge was evident at the boundary of the squamous mucosa and glandular part . the gc - g also thickened , and the granular structure of the mucosal surface showed a more pronounced pink color . throughout the period from 6 to 28 days old , epithelial desquamation although epithelial desquamation of the lc - s was noted until 60 days old , it was still observed in the gc - s at 90 days old ( fig . old , the squamous mucosa wall had an increased thickness , and the serrated ridges had grown , appearing similar to those observed in the squamous mucosa of a yearling horse . after 30 days , the gm thickened and showed a reddish color . the thickened squamous mucosa wall of the yearling lacked epithelial desquamation , and the surface of the mucous membrane showed dryness . the mucosa of the gastric fundus and pylorus exhibited a shiny and smoothly granular structure . during the period of endoscopic examination , there were no abnormalities in the gastric mucosa in any of the foals . affected foals : the number of foals having a gastric ulcer during the 198 days after birth is summarized for each 30-day period in fig . the incidence ( 30.4% ) of gastric ulcer sharply increases between 31 and 60 days old . the highest incidence ( 33.9% ) of gastric ulcer is between 61 and 90 days old . the incidence ( 14.3% ) of gastric ulcer sharply declines at 91 days old or older .. the minimum age of the foals having a gastric ulcer was 4 days old . the incidence of gastric ulcer sharply increased by 30.4% after 31 days old . the highest incidence ( 33.9% ) of gastric ulcer after 91 days old , the incidence of gastric ulcer sharply declined ( 14.3% ) . the incidence ( 30.4% ) of gastric ulcer sharply increases between 31 and 60 days old . the highest incidence ( 33.9% ) of gastric ulcer is between 61 and 90 days old . the incidence ( 14.3% ) of gastric ulcer sharply declines at 91 days old or older . the age ( days old ) at the time of endoscopic examination and distribution of gastric ulcers in 56 foals are shown in fig . 3.fig . gastric ulcers occurred more frequently in the squamous mucosa ( lc - s and gc - s ) ( 74.8% ) than in the glandular mucosa ( gc - g and p ) ( 25.2% ) during the period of examination . gastric ulcer occurred more frequently in the squamous mucosa ( lc - s and gc - s ) ( 74.8% ) than the glandular mucosa ( gc - g and p ) ( 25.2% ) during the period of examination . in the group of foal at up to 30 days old , gastric ulcer was frequently observed in the gc - s . in the group of foal at 31 to 60 days old , the ulcers increased in the lc - s in a manner similar to that in the gc - s . in the group of foals at 61 to 90 days old , the incidence of gastric ulcer sharply increased by more in the gc - s than in the lc - s . gastric ulcers formed predominantly in the gc - s between 4 and 90 days old and had a peak incidence between 61 and 90 days old . in the group of foals at 91 to 120 days old , the incidence of ulcers was reduced , and they were found predominantly in the squamous mucosa ( lc - s and gc - s ) . at over 120 days , there were no differences observed in the incidence of ulcer in the 4 parts of the gastric mucosa . gastric ulcers occurred more frequently in the squamous mucosa ( lc - s and gc - s ) ( 74.8% ) than in the glandular mucosa ( gc - g and p ) ( 25.2% ) during the period of examination . the age ( days old ) at the time of endoscopic examination , and the grading scores of gastric ulcers in 56 foals are shown in fig . 4fig . 4.the average score of gastric ulcers in all parts of the gastric mucosa . in the group of foals at up to 30 days old , the mean sd grading score of ulcers for each mucosal site was 0.53 0.24 ( lc - s , 0.13 0.13 ; gc - s , 0.75 0.16 ; gc - g , 0.88 0.40 ; p , 0.38 0.26 ) . in the group of foals at 31 to 60 days old , the mean sd grading score for each mucosal site was 0.53 0.21 ( lc - s , 0.24 0.14 ; gc - s , 0.71 0.22 ; gc - g , 0.69 0.27 ; p , 0.50 0.20 ) . in the group of foals at 61 to 120 days old , the mean sd grading score in the gc - s was between 1.26 0.25 and 1.13 0.55 . the mean sd grading score in the gc - g was between 2.00 0.38 and 1.50 0.60 . in the group of foals at more than 120 days old , the mean sd grading score for each mucosa was 1.19 0.68 . the grade of gastric ulcer shows a tendency to increase with age in days .. the average score for gastric ulcers in each of the parts showed a tendency to increase over time . in the group of foals at up to 30 days old , the mean sd grading score for ulcers at each mucosal site was 0.53 0.24 ( lc - s , 0.13 0.13 ; gc - s , 0.75 0.16 ; gc - g , 0.88 0.40 ; p , 0.38 0.26 ) . in the group of foals at 31 to 60 days old , the mean sd grading score for each mucosal site was 0.53 0.21 ( lc - s , 0.24 0.14 ; gc - s , 0.71 0.22 ; gc - g , 0.69 0.27 ; p , 0.50 0.20 ) . in the group of foals at 61 to 120 days old , the mean sd grading score in the gc - s was between 1.26 0.25 and 1.13 0.55 . the mean sd grading score in the gc - g was between 2.00 0.38 and 1.50 0.60 . in the group of foals at more than 120 days old , the mean sd grading score in each mucosa was 1.19 0.68 . the average score of gastric ulcers in all parts of the gastric mucosa . in the group of foals at up to 30 days old , the mean sd grading score of ulcers for each mucosal site was 0.53 0.24 ( lc - s , 0.13 0.13 ; gc - s , 0.75 0.16 ; gc - g , 0.88 0.40 ; p , 0.38 0.26 ) . in the group of foals at 31 to 60 days old , the mean sd grading score for each mucosal site was 0.53 0.21 ( lc - s , 0.24 0.14 ; gc - s , 0.71 0.22 ; gc - g , 0.69 0.27 ; p , 0.50 0.20 ) . in the group of foals at 61 to 120 days old , the mean sd grading score in the gc - s was between 1.26 0.25 and 1.13 0.55 . the mean sd grading score in the gc - g was between 2.00 0.38 and 1.50 0.60 . in the group of foals at more than 120 days old , the mean sd grading score for each mucosa was 1.19 0.68 . healthy horses : a few reports have described the development process of the gastric mucosa of neonatal foals using an endoscope [ 9,10,11 , 13,14,15 ] . however , long and continuous observations of the mucosal development of the stomach for 119 days after birth have not been reported as far as we know . in this report , endoscopic observation revealed the development process of the gastric mucosa of the foal , during the 4 months following birth . immediately after birth , part of the spleen attached to the outside stomach wall and after 28 days of development , the stomach wall was thick enough to prevent observation of the spleen through the wall . the appearance of the mucosal surface was very similar to that of a yearling horse . during examination , formation of epithelial desquamation on the mucosal surface was characteristically observed in the squamous mucosa ( lc - s and gc - s ) . histologically , the stratum corneum of the squamous mucosa forms beginning in the late fetal stage , and the stratum corneum grows slowly thicker after birth . the keratinized epithelium of the stratum corneum detaches from the mucosal surface gradually , and this is called epithelial desquamation . epithelial desquamation is considered a physiological phenomenon and is characteristic of the development process of the gastric mucosa [ 11 , 15 ] . in our study , endoscopic examination revealed the physiological development process of the gastric mucosa during the 4 months following birth . earlier studies reported that epithelial desquamation of the squamous mucosa disappears at around 40 days old . however , epithelial desquamation was observed in the lc - s in our foals until 60 days old and in the gc - s until 90 days old . this finding suggests that there is a difference in the development of the gastric mucosa by region and that desquamation can continue over a long term , a term longer than studies have previously reported . affected foals : as reported in western countries , gastric ulcers of foals in japan ( hidaka district ) occur between 30 and 90 days old , but the reason for this is still unclear . a deficiency in passive immunity is considered to be one of the internal factors that contribute to gastric ulcers that occur frequently in this period [ 7 , 8 ] . many severe diseases , such as pneumonia ( e.g , rhodococcus equi ) , enteritis ( e.g , rotavirus ) [ 5 , 6 , 22 ] , infectious arthritis and osteomyelitis occur frequently in foals with immunodeficiency . on the other hand , changes in feed and rearing environment can be considered as external factors . in the hidaka district , the weaning of foals usually begins at around 100 days old and ends at around 180 days . in the healthy foals , the mother s milk and secretion of by the foal prompts the proliferation of epithelial cells and maturation of the gastric mucosa in preparation for weaning . while living with the mother , the growing foal may frequently eat the concentrated feed given to the mare . the decreases in gastric juice ph , intake of the mother s milk and saliva secretion caused by this surreptitious eating are considered to disturb the development of the gastric mucosa before controlled weaning . our study revealed that maturation of the gastric mucosa of the foal occurs up to at least 90 days old . before weaning , surreptitious ingestion of the mother s feed therefore , the deficiency of passive immunity and failure of feeding management can be considered important factors in the occurrence of gastric ulcers in foals before weaning . the increased gastric ulcer score along with age in the affected foals suggests that these factors may contribute to formation of severe lesions before weaning of the foals . on the other hand , ulcers in the weaning period after 120 days old showed a high score in the present study . weaning of foals may be involved in weakening the immune system and weight loss . the gastric ulcers were found to have occurred mostly in the squamous mucosa ( lc - s and gc - s ) throughout the examination period . the results suggest that gastric ulcers may occur given the specific background of the development process of the mucous membrane and structure of the stomach . the mucosal surface of the gm is protected by mucus produced by the surface mucus cells , and secretion of digestive juice is not active in the lactation period . the membrane of the squamous mucosa ( lc - s and gc - s ) lacks surface mucus cells and is protected solely by the action of saliva . the mother s milk in the lactation period contributes to protect the mucosal membrane and to the development of the gastric mucosal epithelium . therefore , anatomical and functional differences of the stomach , which are horse specific , may cause the differences in sites of lesions and scores of gastric ulcers caused by the various internal and external factors . in other words , when the causes of gastric ulcer overlap , the squamous mucosa is the most affected region , and the lesion may occur most frequently in the gc - s , in which development of the mucosa continues until around 90 days old . the process of development of the gastric mucosa of healthy foals during the 119 days from the 6th to the 125th day after birth was revealed in this study . characteristic changes were seen in the squamous mucosa ( lc - s and gc - s ) , and the maturation of the squamous mucosa ( lc - s ) was more rapid than that in gc - s . the epithelial desquamation of the squamous mucosa ( lc - s and gc - s ) indicates the process of development of the squamous mucosa membrane and is considered to be a normal physiological phenomenon . gastric ulcers formed predominantly in the squamous mucosa ( especially in the gc - s ) due to the immature mucosa of the foals before the weaning period , and the peak incidence was between 61 and 90 days .
to contribute to early diagnosis and treatment of gastric ulcer of foals , we examined the gastric mucosa of healthy and affected foals using an endoscope . in healthy foals , the characteristic changes in the development of the squamous mucosa were seen mainly in the squamous mucosa , and maturation of the squamous mucosa in the greater curvature ( gc - s ) occurred more slowly than that of the squamous mucosa in the lesser curvature ( lc - s ) . epithelial desquamation in the lc - s and gc - s was observed between 6 and 90 days but was not observed in the lc - s at about 60 days , whereas it was observed in the gc - s until 90 days old . these findings suggest that there is a difference in the development of the gastric mucosa by region and that desquamation continues over a term longer than studies have reported in the past . in the affected foals , the minimum age at which gastric ulcer was observed was 4 days old . gastric ulcers formed predominantly in the squamous mucosa ( lc - s and gc - s ) of foals with an immature mucosa before the weaning period , and the peak incidence occurred between 61 and 90 days old . the differences in the ulceration sites were considered to depend on the difference in the development ( maturation ) stage of the squamous mucosa . the grading score of the gastric ulcer increased with the growth of the affected foals . the gastric ulcer might be enhanced greatly by stress in the weaning period .
micrornas ( mirnas ) are small non - coding rnas ( 2123 nt in length ) that post - transcriptionally regulate gene expression by blocking translation or inducing degradation of the targeted mrna ( 1 ) . since their first identification in caenorhabditis elegans in 1993 ( 2 ) , the number of annotated mirnas and mirna - related publications increase in a super linear rate , clearly depicting their central position in the rna revolution ( 3 ) . in silico mirna target identification is a crucial step in most mirna experiments , as the mirna interactome has not yet been adequately mapped , even for the most studied model organisms . early mirna - related research efforts have highlighted the necessity of computational analyses in order to assist the experimental identification of mirna targets . this has resulted to the development of numerous mirna target prediction algorithms ( 4 ) , which are now considered indispensable for the design of relevant experiments . these algorithms identify in silico mirna targets as candidates for further experimentation or for computational processing , such as target enrichment analyses . predictions of the available computational algorithms can be acquired from relevant interaction databases or web servers ( 4,5 ) . the diana - microt web server v4.0 ( 6 ) is focused on providing in silico predictions of mirna mrna interactions . it is characterized by a user - friendly interface and provides extensive information for predicted mirna target gene interactions such as a global score for each interaction , as well as detailed information for all predicted target sites . each target site can be visualized , and the user can examine its local prediction score , target site conservation and mirna mrna binding structure . the server also provides connectivity to online biological databases and offers links to nomenclature , sequence and protein databases . here , we present diana - microt web server v5.0 , a significantly updated version , which hosts the state - of - the - art target prediction algorithm , diana - microt - cds ( 7 ) . microt - cds is the only algorithm available online , specifically designed to identify mirna targets both in 3 untranslated region ( 3utr ) and in coding sequences ( cds ) . the new server detects mirna targets in mrna sequences of homo sapiens , mus musculus , drosophila melanogaster and c.elegans . furthermore , it has been updated to mirbase v18 ( 8) and ensembl v69 ( 9 ) . specific attention has been paid to the web server interface , which follows the diana design framework , to be instantly familiar to users of previous versions , or other diana tools ( figure 1 ) . on the other hand , online help , informative tooltips and easy - to - use menus the fifth version of the diana - microt web server focuses also on advanced users and laboratories requiring support for sophisticated pipelines . the server provides programmatic access to services of multiple diana algorithms and a complete integration with the taverna workflow management system ( wms ) ( 10 ) , using the in - house developed diana - taverna plug - in . furthermore , a new section of the web interface hosts ready - made advanced workflows that can perform extensive mirna - related analyses on results derived from high - throughput techniques , such as microarrays or next - generation sequencing ( ngs ) . the interface presents information regarding the specified predicted mirna mrna interactions . mirna and gene - related information , as well as the advanced search options have been expanded . links to external databases , graphical representation of the binding sites , as well as mirna - recognition elements ( mres ) conservation and prediction scores are displayed in the relevant sections . the left side of the page is devoted to personal user space , reporting latest searches and bookmarks . the interface presents information regarding the specified predicted mirna mrna interactions . mirna and gene - related information , as well as the advanced search options have been expanded . links to external databases , graphical representation of the binding sites , as well as mirna - recognition elements ( mres ) conservation and prediction scores are displayed in the relevant sections . the left side of the page is devoted to personal user space , reporting latest searches and bookmarks . initial research efforts have unveiled that mirnas regulated gene expression through their binding on the 3utr of protein - coding genes ( 2 ) . however , accumulated experimental evidence has revealed that mirna - binding sites within coding sequences are also functional in controlling gene expression ( 11 ) . the new algorithm microt - cds ( 7 ) can identify mirna targets in 3utr , as well as in cds regions . further details on the microt - cds algorithm and the utilized training sets can be found in the relevant publication by reczko et al . diana - microt - cds provides increased accuracy and the highest sensitivity at any level of specificity over other available state - of - the - art implementations , when tested against pulsed stable isotope labeling by amino acids in cell culture ( psilac ) proteomics data sets ( 12 ) . the selection of diana - microt - cds as its core algorithm renders the new web server the only available online resource capable of incorporating mirna targets in 3utr as well as in cds . the server is compatible with the new mirna nomenclature ( 3p/5p ) introduced in mirbase v18 , as well as with previous mirna naming conventions . it currently supports 7.3 10 h.sapiens , 3.5 10m.musculus , 4.4 10 d.melanogaster and 2.5 10c.elegans interactions between 3876 mirnas and 64 750 protein - coding genes . gene ( 9 ) and mirna ( 13 ) expression annotation has been incorporated into the web server , enabling the user to perform advanced result filtering based on tissue expression . furthermore , users can also restrict predictions between uploaded lists of expressed genes and/or mirnas . for example , this feature can be used to identify interactions between a list of repressed ( or overexpressed ) genes and overexpressed ( or repressed ) mirnas , in the case of a differential expression analysis pipeline . moreover , the web server hosts an updated version of the kegg database providing a relevant search module based on kegg pathway descriptions ( 14 ) . a redesigned optional user space has also been implemented , which provides personalized features and facilitates the interconnectivity between the web server and the available diana software and databases ( figure 1 ) . as high - throughput data have become the new backbone of biological research the new diana - microt web server aims to facilitate users , not having access to extensive computational infrastructures and support , to perform ready - to - use sophisticated pipelines . diana - microt web server v5.0 hosts numerous integrated analyses in the form of ready - made advanced pipelines , covering a wide range of inquiries regarding predicted or validated mirna gene interactions and their impact on metabolic and signalling pathways . these pipelines can be used to analyse user data derived from small scale and high - throughput experiments directly from the diana - microt web server interface , without the necessity to install or implement any kind of software . for instance , one of the available workflows ( figure 2 ) can analyse mrna and mirna expression data ( expression and fold change ) . the workflow performs enrichment analysis of experimentally validated targets derived from diana - tarbase v6.0 ( 3 ) or / and predicted interactions from microt - cds . this step is considered crucial to identify mirnas that significantly regulate the differentially expressed genes . interactions between user - defined mirna and gene sets are in silico identified in 3utr and cds regions using diana - microt - cds . a subsequent mirna target enrichment analysis identifies mirnas controlling significantly the sets of differentially expressed genes . the pipeline is automatically repeated for different prediction thresholds ( from more sensitive , to more stringent ) . by using meta - analysis statistics , the server combines the p - values from each repetition into a total p - value for each mirna , signifying its effect on the selected genes for all used thresholds . in the last step of the pipeline , mirna - targeted pathway analysis is implemented with diana - mirpath v2 . interactions between user - defined mirna and gene sets are in silico identified in 3utr and cds regions using diana - microt - cds . a subsequent mirna target enrichment analysis identifies mirnas controlling significantly the sets of differentially expressed genes . the pipeline is automatically repeated for different prediction thresholds ( from more sensitive , to more stringent ) . by using meta - analysis statistics , the server combines the p - values from each repetition into a total p - value for each mirna , signifying its effect on the selected genes for all used thresholds . in the last step of the pipeline , mirna - targeted pathway analysis is implemented with diana - mirpath v2 . the prediction score threshold can significantly affect the analysis steps that follow . in the case of predicted interactions , the pipeline can be optimized by automatic repetitions of different prediction thresholds ( from sensitive to more stringent ) , to minimize the effect of the selected settings to the result . by using meta - analysis statistics , the server combines the p - values from each repetition into a total p - value for each mirna , signifying its effect on the selected genes for all used thresholds ( 15,16 ) . in the last step of the pipeline , the identified mirnas are subjected to a functional analysis , where pathways controlled by the combined action of these mirnas are detected using diana - mirpath v2.1 ( 16 ) . other available pipelines can handle mirna and gene lists , to perform the enrichment analysis , or even select the type of used interactions ( predicted or experimentally validated ) . in the latter workflow , the algorithm it initially identifies the number of available interactions in diana - tarbase and diana - microt - cds ( validated versus predicted ) and automatically selects to use validated targets only in the cases of well - annotated mirnas . the new diana - microt web server enables users to perform such analyses directly from the on - line user interface , or create even more extensive pipelines programmatically or by using visual tools ( taverna wms ) . diana - microt web server v5.0 was completely redesigned to provide the necessary building blocks for easily incorporating mirna functional analysis in complex pipelines . the new diana - microt web server aims to facilitate advanced users in creating novel or enhancing existing pipelines with mirna target identification and functional analysis tools . to this end , diana - microt web server v5.0 provides a complete integration with the taverna wms , using our in - house developed diana - taverna plug - in . diana - taverna plug - in enables the user to directly access our target prediction server ( microt - cds ) from the graphic interface of taverna and incorporate advanced mirna analysis functionalities into custom pipelines . furthermore , the plug - in enables the extension of such pipelines through the use of other diana tools and databases , providing access to the most extensive collection of validated mirna targets ( diana - tarbase v6.0 ) and to diana - mirpath v2.1 , a tool designed for the identification of mirna targeted pathways . furthermore , the web server also supports direct programmatic access to all aforementioned utilities in the form of services , to facilitate users having already implemented pipelines using scripting or programming languages . initial research efforts have unveiled that mirnas regulated gene expression through their binding on the 3utr of protein - coding genes ( 2 ) . however , accumulated experimental evidence has revealed that mirna - binding sites within coding sequences are also functional in controlling gene expression ( 11 ) . the new algorithm microt - cds ( 7 ) can identify mirna targets in 3utr , as well as in cds regions . further details on the microt - cds algorithm and the utilized training sets can be found in the relevant publication by reczko et al . diana - microt - cds provides increased accuracy and the highest sensitivity at any level of specificity over other available state - of - the - art implementations , when tested against pulsed stable isotope labeling by amino acids in cell culture ( psilac ) proteomics data sets ( 12 ) . the selection of diana - microt - cds as its core algorithm renders the new web server the only available online resource capable of incorporating mirna targets in 3utr as well as in cds . the server is compatible with the new mirna nomenclature ( 3p/5p ) introduced in mirbase v18 , as well as with previous mirna naming conventions . it currently supports 7.3 10 h.sapiens , 3.5 10m.musculus , 4.4 10 d.melanogaster and 2.5 10c.elegans interactions between 3876 mirnas and 64 750 protein - coding genes . gene ( 9 ) and mirna ( 13 ) expression annotation has been incorporated into the web server , enabling the user to perform advanced result filtering based on tissue expression . furthermore , users can also restrict predictions between uploaded lists of expressed genes and/or mirnas . for example , this feature can be used to identify interactions between a list of repressed ( or overexpressed ) genes and overexpressed ( or repressed ) mirnas , in the case of a differential expression analysis pipeline . moreover , the web server hosts an updated version of the kegg database providing a relevant search module based on kegg pathway descriptions ( 14 ) . a redesigned optional user space has also been implemented , which provides personalized features and facilitates the interconnectivity between the web server and the available diana software and databases ( figure 1 ) . as high - throughput data have become the new backbone of biological research , there is an increasing need to support advanced high - throughput analysis pipelines . the new diana - microt web server aims to facilitate users , not having access to extensive computational infrastructures and support , to perform ready - to - use sophisticated pipelines . diana - microt web server v5.0 hosts numerous integrated analyses in the form of ready - made advanced pipelines , covering a wide range of inquiries regarding predicted or validated mirna gene interactions and their impact on metabolic and signalling pathways . these pipelines can be used to analyse user data derived from small scale and high - throughput experiments directly from the diana - microt web server interface , without the necessity to install or implement any kind of software . for instance , one of the available workflows ( figure 2 ) can analyse mrna and mirna expression data ( expression and fold change ) . the workflow performs enrichment analysis of experimentally validated targets derived from diana - tarbase v6.0 ( 3 ) or / and predicted interactions from microt - cds . this step is considered crucial to identify mirnas that significantly regulate the differentially expressed genes . interactions between user - defined mirna and gene sets are in silico identified in 3utr and cds regions using diana - microt - cds . a subsequent mirna target enrichment analysis identifies mirnas controlling significantly the sets of differentially expressed genes . the pipeline is automatically repeated for different prediction thresholds ( from more sensitive , to more stringent ) . by using meta - analysis statistics , the server combines the p - values from each repetition into a total p - value for each mirna , signifying its effect on the selected genes for all used thresholds . in the last step of the pipeline , interactions between user - defined mirna and gene sets are in silico identified in 3utr and cds regions using diana - microt - cds . a subsequent mirna target enrichment analysis identifies mirnas controlling significantly the sets of differentially expressed genes . the pipeline is automatically repeated for different prediction thresholds ( from more sensitive , to more stringent ) . by using meta - analysis statistics , the server combines the p - values from each repetition into a total p - value for each mirna , signifying its effect on the selected genes for all used thresholds . in the last step of the pipeline , mirna - targeted pathway analysis is implemented with diana - mirpath v2 . the prediction score threshold can significantly affect the analysis steps that follow . in the case of predicted interactions , the pipeline can be optimized by automatic repetitions of different prediction thresholds ( from sensitive to more stringent ) , to minimize the effect of the selected settings to the result . by using meta - analysis statistics , the server combines the p - values from each repetition into a total p - value for each mirna , signifying its effect on the selected genes for all used thresholds ( 15,16 ) . in the last step of the pipeline , the identified mirnas are subjected to a functional analysis , where pathways controlled by the combined action of these mirnas are detected using diana - mirpath v2.1 ( 16 ) . other available pipelines can handle mirna and gene lists , to perform the enrichment analysis , or even select the type of used interactions ( predicted or experimentally validated ) . in the latter workflow , the algorithm it initially identifies the number of available interactions in diana - tarbase and diana - microt - cds ( validated versus predicted ) and automatically selects to use validated targets only in the cases of well - annotated mirnas . the new diana - microt web server enables users to perform such analyses directly from the on - line user interface , or create even more extensive pipelines programmatically or by using visual tools ( taverna wms ) . diana - microt web server v5.0 was completely redesigned to provide the necessary building blocks for easily incorporating mirna functional analysis in complex pipelines . the new diana - microt web server aims to facilitate advanced users in creating novel or enhancing existing pipelines with mirna target identification and functional analysis tools . to this end , diana - microt web server v5.0 provides a complete integration with the taverna wms , using our in - house developed diana - taverna plug - in . diana - taverna plug - in enables the user to directly access our target prediction server ( microt - cds ) from the graphic interface of taverna and incorporate advanced mirna analysis functionalities into custom pipelines . furthermore , the plug - in enables the extension of such pipelines through the use of other diana tools and databases , providing access to the most extensive collection of validated mirna targets ( diana - tarbase v6.0 ) and to diana - mirpath v2.1 , a tool designed for the identification of mirna targeted pathways . furthermore , the web server also supports direct programmatic access to all aforementioned utilities in the form of services , to facilitate users having already implemented pipelines using scripting or programming languages . high - throughput techniques have significantly increased the number of users requiring in - depth analysis of mirna mrna interactions . these techniques provide great numbers of differentially expressed mirnas and genes , which have to be analysed in sophisticated pipelines . the new diana - microt web server aims to further increase the target prediction accuracy and usability of the server interface , while facilitating users aiming to perform complex mirna - related analyses . compared with the previous version , the new web server has received a major upgrade and is currently up to date with key mirna / gene repositories , such as ensembl ( v69 ) and mirbase ( v18 ) . the taverna plug - in and the integration of cutting - edge workflows in the web interface provide the missing link between experimental results and state - of - the - art functional meta - analyses . the project [ 09 syn-13 - 1055 ] mikrorna by the greek general secretariat for research and technology and the project tom which is implemented under the aristeia action of the operational programme education and lifelong learning and is co - funded by the european social fund ( esf ) and national resources . funding for open access charge : projects tom and mikrorna .
micrornas ( mirnas ) are small endogenous rna molecules that regulate gene expression through mrna degradation and/or translation repression , affecting many biological processes . diana - microt web server ( http://www.microrna.gr/webserver ) is dedicated to mirna target prediction / functional analysis , and it is being widely used from the scientific community , since its initial launch in 2009 . diana - microt v5.0 , the new version of the microt server , has been significantly enhanced with an improved target prediction algorithm , diana - microt - cds . it has been updated to incorporate mirbase version 18 and ensembl version 69 . the in silico - predicted mirna gene interactions in homo sapiens , mus musculus , drosophila melanogaster and caenorhabditis elegans exceed 11 million in total . the web server was completely redesigned , to host a series of sophisticated workflows , which can be used directly from the on - line web interface , enabling users without the necessary bioinformatics infrastructure to perform advanced multi - step functional mirna analyses . for instance , one available pipeline performs mirna target prediction using different thresholds and meta - analysis statistics , followed by pathway enrichment analysis . diana - microt web server v5.0 also supports a complete integration with the taverna workflow management system ( wms ) , using the in - house developed diana - taverna plug - in . this plug - in provides ready - to - use modules for mirna target prediction and functional analysis , which can be used to form advanced high - throughput analysis pipelines .
recent estimates indicate that nearly 17.2% of americans aged older than 40 years have a cataract in either eye , and this percentage is expected to rise to about 50% in the next 10 years.1 according to national eye institute estimates , more than 50% of americans have a cataract or have undergone cataract surgery by the age of 80 years.2 apart from being associated with age , cataract development is associated with certain chronic diseases such as diabetes , chronic renal failure , mitral valve prolapse , and bifid aortic valve.3 of the methods available for cataract surgery , phacoemulsification is preferred over extracapsular cataract extraction because of its clinical superiority and cost - effectiveness.4 although cataract extraction is relatively safe and patients return to normal activity quickly , one of the biggest concerns associated with cataract surgery is the occurrence of postoperative infection , particularly endophthalmitis.5 endophthalmitis includes a broad range of bacterial and fungal eye infections that can have deleterious outcomes such as reduced visual acuity , high intraocular pressure,6 and permanent vision loss.7 studies have revealed that the normal ocular and periocular flora of the patient represent the biggest source of bacteria causing infection.8,9 occasionally , nosocomial factors and/or colonized health care professionals may increase the risk of endophthalmitis.3 apart from various external factors , the surgical procedure itself may contribute to the risk of endophthalmitis . for example , the type , size , and location of the incision in cataract surgery have been associated with the occurrence of endophthalmitis.10 prophylactic treatments aimed at minimizing microbes causing endophthalmitis include using topical antibiotic eye drops before surgery , applying 5% povidone iodine to the conjunctival sac , preparing the periocular skin with 10% povidone iodine , careful sterile draping of the eyelid margins and eyelashes , adding antibiotics to the irrigating solution , instilling intracameral antibiotics at the close of surgery , injecting subconjunctival antibiotics , and applying topical antibiotic eye drops after surgery.11 research has shown that topical quinolones , specifically gatifloxacin and moxifloxacin,12,13 when administered perioperatively can significantly reduce the risk of endophthalmitis following cataract surgery . a recent online survey reported that a majority of the members of the american society of cataract and refractive surgery also preferred topical antibiotic prophylaxis prior to and after cataract surgery.14 emerging bacterial resistance is an important consideration when choosing a topical antibiotic for infection prophylaxis in the surgical setting.13 in a recent study , it was reported that the majority of bacteria present in the periocular flora belong to the staphylococcus family and mainly include staphylococcus epidermidis ( about 62% ) and staphylococcus aureus ( about 14%).15 of the bacterial cultures that were isolated in the study , about 47% of s. epidermidis and 29% of s. aureus exhibited methicillin resistance.15 results from the antibiotic resistance monitoring in ocular microrganisms ( armor ) surveillance study indicate that methicillin - resistant staphylococci are also likely to be resistant to a number of other antibiotics , including aminoglycosides , macrolides , and some fluoroquinolones.16 moreover , a study of bacterial isolates from patients with endophthalmitis reported that among gram - positive bacteria , resistance to fluoroquinolones was common , with a significant number of isolates resistant to gatifloxacin and moxifloxacin.17 thus , there is a constant need for the development of broad - spectrum antibiotics that are effective against drug - resistant staphylococci . besifloxacin ophthalmic suspension 0.6% ( besivance ; bausch and lomb inc , rochester , ny ) was approved in 2009 by the us food and drug administration for ophthalmic use , and has been shown to be effective for the treatment of bacterial conjunctivitis.1822 it is a topical chlorofluoroquinolone that targets both dna gyrase and topoisomerase iv,23 and has been indicated for use against a broad range of bacteria , including staphylococcus , streptococcus , and corynebacterium species.24 in addition to the gram - positive bacteria , besifloxacin has also shown efficacy in treating infections caused by gram - negative bacteria , such as moraxella species and haemophilus influenzae.25 the besifloxacin formulation includes durasite ( insite vision inc , alameda , ca ) , a mucoadhesive vehicle designed to increase the ocular surface residence time of a drug . the main component of durasite is polycarbophil , a mucoadhesive polymer consisting of polyacrylic acid molecules cross - linked with divinyl glycol that does not degrade or breakdown in the body.26 the use of polycarbophil for sustained release of drugs was suggested in the 1980s,27 and has subsequently been extensively validated for ocular antibiotic drug delivery.2830 on coming into contact with tears on the ocular surface , the polycarbophil expands , forming large , stable , gel - like particles that exhibit increased viscosity and are less likely to get washed away with lacrimal discharge.26 this increases the overall residence time of the drug on the ocular surface and , therefore , its bactericidal activity . although the efficacy and safety of the durasite vehicle for ophthalmic drug delivery has been previously demonstrated,30 authors of a recent preclinical study in rabbits , in which durasite - containing antibiotic formulations were injected directly into the anterior chamber , suggested that such formulations should be used with caution in cataract surgery with clear corneal incisions.31 the objective of this study was to evaluate the safety and tolerability of besifloxacin ophthalmic suspension 0.6% as compared with a non - durasite - based antibiotic formulation , moxifloxacin ophthalmic solution 0.5% ( vigamox , alcon laboratories inc , fort worth , tx ) , when used prophylactically for infections associated with uncomplicated sutureless cataract extraction by phacoemulsification . this prospective , parallel - group , investigator - masked study ( clinicaltrials.gov identifier : nct01455233 ) was carried out at two clinical sites in the us following approval by schulman associates institutional review board incorporated ( cincinnati , oh ) , and was conducted in accordance with the international conference on harmonisation of good clinical practices guidelines and the declaration of helsinki ( 1996 ) . consecutive patients undergoing cataract surgery were alternately assigned to treatment with besifloxacin ophthalmic suspension 0.6% or moxifloxacin ophthalmic solution 0.5% used prophylactically to prevent postoperative endophthalmitis . the primary objective of the study was to compare the adverse event rates of besifloxacin ophthalmic suspension and moxifloxacin ophthalmic solution . patients included in the study were 18 years of age and scheduled to undergo cataract extraction by phacoemulsification with posterior chamber intraocular lens implantation . patients were excluded from the study if they were scheduled to undergo other procedures during cataract surgery , with the exception of a limbal relaxing incision for astigmatism correction . patients were also excluded from the study if any of the following were noted : topical ocular or systemic antibiotic usage within 14 days prior to the surgery ; history of fuch s corneal endothelial dystrophy ; ocular inflammation , ocular pain , or aqueous flare greater than grade 0 in the study eye at baseline ; recent ocular trauma or surgery in the study eye within the previous 6 months ; history of chronic or recurrent inflammatory eye disease or uncontrolled glaucoma in the operative eye ; congenital ocular anomaly ; a nonfunctional fellow eye defined as an eye with best - corrected visual acuity < 35 etdrs letters ( 20/200 snellen equivalent ) ; participation in any drug or device study within 30 days before cataract surgery ; or known or suspected allergy / hypersensitivity to any component of either of the study treatments . women of childbearing age were excluded from the study if they were pregnant , breastfeeding , intended to become pregnant , or did not agree to use adequate , approved birth control measures during the study . in addition , a patient could be considered ineligible because of a valid medical reason based on the investigator s discretion . at each clinical site , eligible patients undergoing cataract surgery were alternately assigned to treatment with either besifloxacin ophthalmic suspension 0.6% or moxifloxacin ophthalmic solution 0.5% as they enrolled in the study . to mask the investigators to treatments , baseline measurements were recorded any time between week 4 and day 4 before the surgery . patients were instructed to instill one drop of the assigned study treatment topically four times per day , starting 3 days prior to the surgery . on the day of surgery ( day 0 ) , clinical study coordinators reviewed the dosing regimen with patients , following which all patients underwent cataract extraction with a stellaris phacoemulsification machine ( bausch and lomb inc . , rochester , ny ) by one of three surgeons via a clear corneal incision accompanied by stromal hydration . the following parameters indicative of safety and tolerability were measured on the day of surgery ( day 0 ) and on days 7 ( 1 day ) and 28 ( 2 days ) following surgery : corneal thickness measured using the dgh-55 pachmate ( dgh technologies , exton , pa ) or pachette 3 pachymeters ( dgh technologies , exton , pa ) ; endothelial cell count , using a konan noncon specular microscope ; overall and central corneal staining , using the 03 national eye institute scale ; best - corrected visual acuity ; and intraocular pressure measured using goldmann applanation tonometry . best - corrected visual acuity and intraocular pressure were also measured on day 1 after the surgery . in addition to the assigned study treatment , all patients instilled prednisolone acetate ( omnipred , alcon laboratories inc , fort worth , tx ) four times per day , and bromfenac ( xibrom , ista pharmaceuticals , irvine , ca ) two times per day for 4 weeks . the primary outcome measure of the study was the rate of occurrence of treatment - emergent adverse events in the 28-day period following surgery . secondary endpoints included changes in corneal thickness and endothelial cell count as assessments of corneal integrity , overall corneal staining and central corneal staining as tolerability assessments , and intraocular pressure and best - corrected visual acuity as additional safety assessments . statistical analysis was performed using sas software ( v 9.1.3 ; sas institute inc , cary , nc ) . the difference between the least squares mean of besifloxacin ophthalmic suspension 0.6% and least squares mean of moxifloxacin ophthalmic solution 0.5% was tested at a significance level of 5% and was considered significantly different if the observed p value was < 0.05 . this prospective , parallel - group , investigator - masked study ( clinicaltrials.gov identifier : nct01455233 ) was carried out at two clinical sites in the us following approval by schulman associates institutional review board incorporated ( cincinnati , oh ) , and was conducted in accordance with the international conference on harmonisation of good clinical practices guidelines and the declaration of helsinki ( 1996 ) . consecutive patients undergoing cataract surgery were alternately assigned to treatment with besifloxacin ophthalmic suspension 0.6% or moxifloxacin ophthalmic solution 0.5% used prophylactically to prevent postoperative endophthalmitis . the primary objective of the study was to compare the adverse event rates of besifloxacin ophthalmic suspension and moxifloxacin ophthalmic solution . patients included in the study were 18 years of age and scheduled to undergo cataract extraction by phacoemulsification with posterior chamber intraocular lens implantation . patients were excluded from the study if they were scheduled to undergo other procedures during cataract surgery , with the exception of a limbal relaxing incision for astigmatism correction . patients were also excluded from the study if any of the following were noted : topical ocular or systemic antibiotic usage within 14 days prior to the surgery ; history of fuch s corneal endothelial dystrophy ; ocular inflammation , ocular pain , or aqueous flare greater than grade 0 in the study eye at baseline ; recent ocular trauma or surgery in the study eye within the previous 6 months ; history of chronic or recurrent inflammatory eye disease or uncontrolled glaucoma in the operative eye ; congenital ocular anomaly ; a nonfunctional fellow eye defined as an eye with best - corrected visual acuity < 35 etdrs letters ( 20/200 snellen equivalent ) ; participation in any drug or device study within 30 days before cataract surgery ; or known or suspected allergy / hypersensitivity to any component of either of the study treatments . women of childbearing age were excluded from the study if they were pregnant , breastfeeding , intended to become pregnant , or did not agree to use adequate , approved birth control measures during the study . in addition , a patient could be considered ineligible because of a valid medical reason based on the investigator s discretion . at each clinical site , eligible patients undergoing cataract surgery were alternately assigned to treatment with either besifloxacin ophthalmic suspension 0.6% or moxifloxacin ophthalmic solution 0.5% as they enrolled in the study . to mask the investigators to treatments , baseline measurements were recorded any time between week 4 and day 4 before the surgery . patients were instructed to instill one drop of the assigned study treatment topically four times per day , starting 3 days prior to the surgery . on the day of surgery ( day 0 ) , clinical study coordinators reviewed the dosing regimen with patients , following which all patients underwent cataract extraction with a stellaris phacoemulsification machine ( bausch and lomb inc . , rochester , ny ) by one of three surgeons via a clear corneal incision accompanied by stromal hydration . the following parameters indicative of safety and tolerability were measured on the day of surgery ( day 0 ) and on days 7 ( 1 day ) and 28 ( 2 days ) following surgery : corneal thickness measured using the dgh-55 pachmate ( dgh technologies , exton , pa ) or pachette 3 pachymeters ( dgh technologies , exton , pa ) ; endothelial cell count , using a konan noncon specular microscope ; overall and central corneal staining , using the 03 national eye institute scale ; best - corrected visual acuity ; and intraocular pressure measured using goldmann applanation tonometry . best - corrected visual acuity and intraocular pressure were also measured on day 1 after the surgery . in addition to the assigned study treatment , all patients instilled prednisolone acetate ( omnipred , alcon laboratories inc , fort worth , tx ) four times per day , and bromfenac ( xibrom , ista pharmaceuticals , irvine , ca ) two times per day for 4 weeks . the primary outcome measure of the study was the rate of occurrence of treatment - emergent adverse events in the 28-day period following surgery . secondary endpoints included changes in corneal thickness and endothelial cell count as assessments of corneal integrity , overall corneal staining and central corneal staining as tolerability assessments , and intraocular pressure and best - corrected visual acuity as additional safety assessments . statistical analysis was performed using sas software ( v 9.1.3 ; sas institute inc , cary , nc ) . the difference between the least squares mean of besifloxacin ophthalmic suspension 0.6% and least squares mean of moxifloxacin ophthalmic solution 0.5% was tested at a significance level of 5% and was considered significantly different if the observed p value was < 0.05 . the mean ( standard deviation ) age was 68.5 11.1 years in the besifloxacin group and 69.0 8.4 years in the moxifloxacin group . the groups were similar in distribution of the operated eye ( od / os ) and distribution of preoperative visual acuity . the majority of patients had medical and ocular histories consistent with those of the seventh decade of life . two thirds of the patients in each group had a history of cardiovascular disorders , and approximately one third of eyes in each group had a history of glaucoma . one patient in the besifloxacin treatment group withdrew consent prior to the final exit visit , and one patient in the moxifloxacin treatment group had a nonevaluable endothelial cell image at screening . therefore , 58 patients ( 29 per treatment group ) were included in the per protocol analysis . the mean baseline values for endothelial cell count , overall and central corneal staining , and intraocular pressure were similar between the treatment groups ( p 0.1323 ) . the mean ( standard deviation ) central corneal thickness was slightly greater in the moxifloxacin treatment group than in the besifloxacin treatment group at baseline ( 569.6 33.9 m versus 547.6 41.5 m , respectively ; p = 0.0312 ) . the most commonly implanted intraocular lens in both groups was the softport aspheric silicone lens ( bausch and lomb inc . , . a slightly higher number of eyes in the moxifloxacin group ( n = 10 ) were implanted with the hydrophobic acrylic lenses as compared with the besifloxacin group ( n = 4 ) . there were no adverse events observed in either the besifloxacin or the moxifloxacin treatment group . an adverse event was defined as any patient complaint such as burning , stinging , pain , and vision changes . table 2 presents mean values for central corneal thickness , endothelial cell count , overall and central corneal staining , and intraocular pressure at baseline , day 7 , and day 28 , along with p values for differences in the least squares means between treatments in these outcomes . the potential for corneal edema and toxicity were assessed by measuring the central corneal thickness and endothelial cell count . as shown in figure 1a , mean central corneal thickness in the besifloxacin and moxifloxacin treatment groups were comparable on day 7 and day 28 ( p 0.1403 ) . likewise , the change from baseline in corneal thickness was comparable between treatments at day 7 ( 20.5 25.1 m versus 11.8 20.6 m ; p = 0.1549 ) and day 28 ( 17.3 24.6 m versus 10.4 20.7 m ; p = 0.2554 ) . the mean endothelial cell count in the besifloxacin and moxifloxacin treatment groups were similar at baseline , day 7 , and day 28 ( p 0.6200 ) , as was the change from baseline at day 7 ( 127.3 259.3 cells / mm versus 100.8 237.3 cells/ mm ; p = 0.6865 ) and day 28 ( 116.7 252.2 cells / mm versus 163.2 230.0 cells / mm ; p = 0.4664 ) . the mean overall and central corneal staining , assessed as tolerability endpoints , increased in both treatment groups relative to baseline ( figure 2 ) , but were similar between treatments at baseline and follow - up visits ( p 0.0690 ) . the mean change from baseline in overall corneal staining was similar between treatments on day 7 ( 0.72 1.07 versus 0.45 1.12 ; p = 0.3409 ) and day 28 ( 0.52 1.06 versus 0.24 0.95 ; p = 0.3004 ) , as was the mean change from baseline in central corneal staining at day 7 ( 0.62 1.15 versus 0.48 0.83 ; p = 0.6017 ) and day 28 ( 0.72 1.03 versus 0.38 0.82 ; p = 0.1643 ) . local tolerability was also assessed by recording the incidence of burning or stinging associated with the use of the study drugs . as indicated above , there were no subjective complaints reported by any patients in either the besifloxacin or moxifloxacin treatment groups throughout the study . intraocular pressure was comparable between treatment groups at all follow - up visits ( figure 3 ) . the intraocular pressure increased in both treatment groups immediately following surgery ; the mean intraocular pressures at day 1 were 18.5 3.7 mm hg and 19.3 3.6 mm hg in the besifloxacin and moxifloxacin treatment groups , respectively , and two eyes in each treatment group experienced an intraocular pressure increase of 10 mm hg above baseline . by day 7 , the mean intraocular pressures returned to baseline values in both treatment groups and remained at baseline values at day 28 . the difference between treatments in the change from baseline in intraocular pressure were similar at day 7 ( 1.3 2.6 mm hg versus 0.7 2.6 mm hg ; p = 0.3696 ) and day 28 ( 0.2 2.5 mm hg versus 0.2 2.6 mm hg ; p = 0.5094 ) . as expected , visual acuity improved in all patients following cataract surgery ( figure 4 ) . at the final visit , the distribution of best - corrected visual acuity was comparable between the two treatment groups ( data not shown ) , and best - corrected visual acuity was 20/30 or better in 85% of the patients . the mean ( standard deviation ) age was 68.5 11.1 years in the besifloxacin group and 69.0 8.4 years in the moxifloxacin group . the groups were similar in distribution of the operated eye ( od / os ) and distribution of preoperative visual acuity . the majority of patients had medical and ocular histories consistent with those of the seventh decade of life . two thirds of the patients in each group had a history of cardiovascular disorders , and approximately one third of eyes in each group had a history of glaucoma . one patient in the besifloxacin treatment group withdrew consent prior to the final exit visit , and one patient in the moxifloxacin treatment group had a nonevaluable endothelial cell image at screening . therefore , 58 patients ( 29 per treatment group ) were included in the per protocol analysis . the mean baseline values for endothelial cell count , overall and central corneal staining , and intraocular pressure were similar between the treatment groups ( p 0.1323 ) . the mean ( standard deviation ) central corneal thickness was slightly greater in the moxifloxacin treatment group than in the besifloxacin treatment group at baseline ( 569.6 33.9 m versus 547.6 41.5 m , respectively ; p = 0.0312 ) . the most commonly implanted intraocular lens in both groups was the softport aspheric silicone lens ( bausch and lomb inc . , . a slightly higher number of eyes in the moxifloxacin group ( n = 10 ) were implanted with the hydrophobic acrylic lenses as compared with the besifloxacin group ( n = 4 ) . there were no adverse events observed in either the besifloxacin or the moxifloxacin treatment group . an adverse event was defined as any patient complaint such as burning , stinging , pain , and vision changes . table 2 presents mean values for central corneal thickness , endothelial cell count , overall and central corneal staining , and intraocular pressure at baseline , day 7 , and day 28 , along with p values for differences in the least squares means between treatments in these outcomes . the potential for corneal edema and toxicity as shown in figure 1a , mean central corneal thickness in the besifloxacin and moxifloxacin treatment groups were comparable on day 7 and day 28 ( p 0.1403 ) . likewise , the change from baseline in corneal thickness was comparable between treatments at day 7 ( 20.5 25.1 m versus 11.8 20.6 m ; p = 0.1549 ) and day 28 ( 17.3 24.6 m versus 10.4 20.7 m ; p = 0.2554 ) . the mean endothelial cell count in the besifloxacin and moxifloxacin treatment groups were similar at baseline , day 7 , and day 28 ( p 0.6200 ) , as was the change from baseline at day 7 ( 127.3 259.3 cells / mm versus 100.8 237.3 cells/ mm ; p = 0.6865 ) and day 28 ( 116.7 252.2 cells / mm versus 163.2 230.0 cells / mm ; p = 0.4664 ) . the mean overall and central corneal staining , assessed as tolerability endpoints , increased in both treatment groups relative to baseline ( figure 2 ) , but were similar between treatments at baseline and follow - up visits ( p 0.0690 ) . the mean change from baseline in overall corneal staining was similar between treatments on day 7 ( 0.72 1.07 versus 0.45 1.12 ; p = 0.3409 ) and day 28 ( 0.52 1.06 versus 0.24 0.95 ; p = 0.3004 ) , as was the mean change from baseline in central corneal staining at day 7 ( 0.62 1.15 versus 0.48 0.83 ; p = 0.6017 ) and day 28 ( 0.72 1.03 versus 0.38 0.82 ; p = 0.1643 ) . local tolerability was also assessed by recording the incidence of burning or stinging associated with the use of the study drugs . as indicated above , there were no subjective complaints reported by any patients in either the besifloxacin or moxifloxacin treatment groups throughout the study . intraocular pressure was comparable between treatment groups at all follow - up visits ( figure 3 ) . the intraocular pressure increased in both treatment groups immediately following surgery ; the mean intraocular pressures at day 1 were 18.5 3.7 mm hg and 19.3 3.6 mm hg in the besifloxacin and moxifloxacin treatment groups , respectively , and two eyes in each treatment group experienced an intraocular pressure increase of 10 mm hg above baseline . by day 7 , the mean intraocular pressures returned to baseline values in both treatment groups and remained at baseline values at day 28 . the difference between treatments in the change from baseline in intraocular pressure were similar at day 7 ( 1.3 2.6 mm hg versus 0.7 2.6 mm hg ; p = 0.3696 ) and day 28 ( 0.2 2.5 mm hg versus 0.2 2.6 mm hg ; p = 0.5094 ) . as expected , visual acuity improved in all patients following cataract surgery ( figure 4 ) . at the final visit , the distribution of best - corrected visual acuity was comparable between the two treatment groups ( data not shown ) , and best - corrected visual acuity was 20/30 or better in 85% of the patients . the results of this prospective , parallel - group , investigator - masked study suggest that besifloxacin ophthalmic suspension 0.6% , a durasite - based formulation , is similar to moxifloxacin ophthalmic solution 0.5% , a non - durasite - based formulation , in terms of safety and tolerability when used prophylactically in patients undergoing routine , uncomplicated , sutureless cataract surgery . there were no adverse events reported in either the besifloxacin ophthalmic suspension or the moxifloxacin ophthalmic solution treatment groups during the 28-day period following surgery . the results for corneal thickness and endothelial cell count were comparable between the treatment groups at follow - up visits , demonstrating that neither drug compromised the corneal endothelium when used in the perioperative period of cataract surgery . the results for overall and central corneal staining , in conjunction with a lack of reports of stinging and burning , indicated that the treatments have similar tolerability profiles . in addition , changes in intraocular pressure and best - corrected visual acuity were similar between treatment groups . besifloxacin is a broad - spectrum antibiotic that is not marketed in any form other than the topical ophthalmic preparation . this avoids any bacterial exposure resulting from systemic use of the drug and minimizes the overall selective pressure that can contribute to the emergence of resistant strains , potentially contributing to the potency of this drug against drug - resistant staphylococci , the pathogens most commonly associated with recent cases of endophthalmitis.15,17,32 in fact , in vitro studies have demonstrated that besifloxacin is more potent than gatifloxacin and moxifloxacin against multidrug resistant staphylococcal isolates,16,25,33,34 and similar in potency to vancomycin,16,35 a drug currently reserved for suspected methicillin - resistant s. aureus infections.3638 the inclusion of durasite in the besifloxacin formulation increases the retention time of besifloxacin on the ocular surface , theoretically increasing ocular surface sterilizing efficiency , although studies are needed to confirm this . a recent study raised a concern about the use of durasite - based antibiotic formulations in cataract surgery . an animal study showed that the durasite vehicle may block the trabecular meshwork and damage the corneal endothelium when introduced directly into the anterior chamber.31 briefly , a 0.1 ml dose of various formulations , or the equivalent of three drops from a standard eye drop bottle , was injected into the anterior chamber of new zealand rabbits through the anterior sclera and conjunctiva . glaucomatous damage , presumably from the durasite vehicle blocking the trabecular meshwork , and corneal edema from endothelial cell morphological changes were observed in eyes injected with besifloxacin ophthalmic suspension 0.6% and those injected with azithromycin ophthalmic solution 0.1% ( azasite , inspire pharmaceuticals inc , nc ) , also formulated with durasite . the study was characterized by the authors as simulating an extremely leaky wound , which would presumably allow topically used durasite - containing antibiotics to enter the anterior chamber . as a safety precaution , they also recommended suturing of the incision following cataract surgery if durasite - based drug formulations were used for postoperative endophthalmitis prophylaxis . however , the clinical relevance of these rabbit studies is not known . in a follow - up study , goecks et al injected smaller volumes ( 12.5 l , 25 l , and 50 l ) of azithromycin with or without durasite directly into the anterior chamber of rabbit eyes or applied several drops of these formulations directly to a 2.8 mm limbal incision followed by repeated opening of the wound with forceps.39 slit lamp examination and histopathology showed toxicity with the durasite - containing formulation relative to the exposure volume . we propose that it is unlikely that a topically administered drug would penetrate into aqueous humor at volumes approaching even the smallest volume tested in these studies through the leakiest of clear corneal incisions . furthermore , the mucoadhesive polycarbophil used in durasite has a very high molecular weight ( in billions ) . therefore , there is little possibility of the polymer gaining entry into the anterior chamber in the presence of a clear corneal incision created for cataract surgery.40 furthermore , a surgical wound that is severely compromised is more likely to be associated with vision - threatening complications ( eg , infection , endophthalmitis , hypotony , choroidal effusion ) than any possible toxicity from the drug vehicle . in our study , the safety of besifloxacin ophthalmic suspension 0.6% , and by extension , the safety of the durasite vehicle , in uncomplicated post - cataract surgery was demonstrated by the fact that no adverse events were reported , and there was no evidence of compromised corneal endothelium ( by cell counts and pachymetry ) or unusual elevations in intraocular pressure , despite the use of sutureless clear corneal incisions . outcomes were remarkably similar to those observed with moxifloxacin ophthalmic solution 0.5% , a non - durasite formulation . these results are also consistent with a previous preclinical study by krenzer et al who examined the effects of topical administration of the durasite vehicle using two dosing schedules on surgically compromised rabbit eyes , including those with laser - assisted in situ keratomileusis ( lasik ) flaps or a 3 mm clear corneal incision.40 in the first dosing schedule , one drop of durasite ( 50 l ) was instilled immediately after surgery , with the second dose instilled later in the day , followed by four times daily for 14 days . the second schedule involved instilling one drop of durasite four times daily on the day prior to surgery and 0.25 hours prior to surgery , and at hours 0.125 , 4 , and 8 postoperatively , followed by four times daily for 9 days . no adverse effects were observed in both the lasik flap and corneal incision models with either dosing schedule . the wound and anterior chamber of the eye in the corneal incision model did not show the presence of the polymer at any time , and the corneal endothelium appeared normal as in the controls . the lasik flap also did not show any presence of the durasite at the interface . histopathology examination did not indicate any unique safety concerns associated with the use of the durasite vehicle in these settings . 40 taken together , these studies suggest that in routine , uncomplicated postoperative conditions , the use of besivance for postoperative antibacterial prophylaxis does not appear to present safety concerns . a slight increase from baseline in overall and central corneal staining was observed at day 7 and day 28 in both treatment groups in this study , but the change from baseline in overall and central corneal staining was similar between treatments . increases in corneal staining are not unexpected following cataract surgery and may result from a combination of factors including the trauma of the surgical procedure itself , mechanical effects of the use of irrigating solutions , desiccation of the cornea , or any of the topical medications used perioperatively ( steroids , nonsteroidal anti - inflammatory drugs , or antibiotics ) . regardless of the cause , the lack of a difference in the change from baseline in corneal staining between treatments suggests that neither the durasite vehicle nor the benzalkonium chloride preservative used in besifloxacin ophthalmic suspension 0.6% had an adverse effect on the corneal epithelium . these results are consistent with those of a pooled safety analysis of besifloxacin ophthalmic suspension in the treatment of bacterial conjunctivitis that reported punctate keratitis at an incidence of 0.3% , which was considered insignificant as compared with an incidence of 0.5% for the preservative - free moxifloxacin ophthalmic solution.21 a limitation of our study was the single - masked design . the lack of subjective adverse event reports in either of the treatment groups suggests that patients were not biased . the relatively small number of patients enrolled and the lack of a priori power calculations to define an appropriate sample size for rejection of a prestated null hypothesis for the primary and secondary outcomes was also a limitation . while large differences between treatments at follow - up visits would likely have been detected , small differences between treatments may not have been detectable . despite these limitations , the results of our study suggest that besifloxacin 0.6% is safe when used as a prophylactic antibiotic to minimize the possibility of postoperative infections in patients undergoing uncomplicated sutureless cataract extraction surgery . in this study , besifloxacin ophthalmic suspension 0.6% was safe and well tolerated when used as a prophylactic antibiotic during routine , uncomplicated , sutureless cataract surgery . the safety and tolerability profile of besifloxacin ophthalmic suspension 0.6% was similar to that of moxifloxacin ophthalmic solution 0.5% , although larger studies are needed to confirm these findings .
backgroundthe purpose of this study was to evaluate the safety and tolerability of besifloxacin ophthalmic suspension 0.6% compared with moxifloxacin ophthalmic solution 0.5% , when used for infection prophylaxis following uncomplicated phacoemulsification clear cornea surgery using sutureless corneal incision.methodsthis prospective , two - site , parallel - group , investigator - masked clinical study included patients aged 18 years scheduled to undergo phacoemulsification with intraocular lens implantation . patients received one drop of either besifloxacin ophthalmic suspension or moxifloxacin ophthalmic solution four times daily , beginning 3 days prior to surgery , which was continued for 7 days postoperatively . the primary endpoint was the rate of adverse events . secondary endpoints included endothelial cell count , central corneal thickness , and overall and central corneal staining measured on days 7 ( 1 day ) and 28 ( 2 days ) following surgery , and intraocular pressure and best - corrected visual acuity measured on days 1 , 7 ( 1 day ) , and 28 ( 2 days ) following surgery.resultsof the 60 patients enrolled , 58 ( 29 per treatment group ) completed the study . no adverse events were reported in either treatment group . changes in the central corneal thickness , endothelial cell count , and corneal staining were small and similar between treatments at follow - up visits ( p 0.1549 ) . intraocular pressure was similar between treatment groups at each visit , as was the distribution of best - corrected visual acuity . the final best - corrected visual acuity was 20/30 or better in 85% of the patients.conclusionin this study , besifloxacin ophthalmic suspension 0.6% was well tolerated when used prophylactically to prevent postoperative endophthalmitis following sutureless cataract surgery .
pythiosis is a chronic granulomatous disease caused by the oomycete pythium insidiosum belonging to the kingdom stramenopila . these opportunistic pathogens live in warm stagnant water and are most often reported in regions with tropical and subtropical environments . in brazil , the disease occurs predominantly in horses , however , outbreaks have been reported in sheep and cattle , . pythiosis has three distinct forms of clinical presentation in domestic animals : cutaneous , , , gastrointestinal and rhinofacial . in cattle , the cutaneous form of the disease is sporadic and widely described and usually occurs during the rainy season in subtropical areas . the clinical diagnosis is based on epidemiological characteristics and pathological lesions . however , for definitive diagnosis , cultivation and identification of the agent are crucial . techniques of immunohistochemistry , serological testing by elisa and polymerase chain reaction ( pcr ) are employed to establish the definitive diagnosis of the disease , . the aim of this study is to report the epidemiological , pathological and mycological findings of cutaneous pythiosis in cattle in southern brazil . during the month of february of 2016 , 23 calves presented ulcerated cutaneous lesions in thoracic and pelvic limbs , sometimes extending to the ventral thoracic region . the herd consisted of 150 beef cattle ( 100 adults and 50 calves ) in moderate body condition , belonging to a property in the city of triunfo in southern of brazil ( 295608.2 s 512754,2w ) . the cattle were kept next to a river , in native grass areas with extensive marshy regions ( fig . the cutaneous lesions were observed after an initial period of 15 days after the animals were introduced into the area and had a clinical course of 2030 days , with subsequent spontaneous regression in all affected calves after this period . calves affected received supportive therapy , to prevent secondary skin infections with basic wound management techniques . cutaneous biopsies were performed in eight calves , from which six samples were fixed in 10% neutral buffered formalin , processed routinely for histopathology , and stained with hematoxylin - eosin ( he ) and gomori methenamine silver ( gms ) . two samples were kept at room temperature , and later submitted to cultivation and isolation of the agent . grossly , the lesions were located predominantly in the distal regions of the thoracic and pelvic limbs , and sometimes in carpal - ulnar region of forelimbs and ventral thoracic region . these consisted of multifocal ulcerated areas , with approximately 5 cm in diameter , reddish surface , sometimes covered by crusts ( fig . histopathological examination revealed multifocal pyogranulomas in the superficial and deep dermis characterized by inflammatory infiltrate of neutrophils , eosinophils and a marked amount of epithelioid macrophages in the central region , surrounded by rare multinucleated giant cells ( fig . , there were still occasional transverse and longitudinal sections of non - stained hyphae , surrounded often by eosinophilic radiated material morphologically compatible with splendore - hoeppli reaction . skin sections stained with gms showed rare centrally located hyphae with approximately 49 m in diameter , ramified and rarely septate . these hyphae were also stained by immunohistochemistry , predominantly observed in the center of these pyogranulomas ( fig . 1d ) , employing the polyclonal antibody ( non - commercial ) anti - p . insidiosum produced in rabbits , at a 1:100 dilution in phosphate buffered saline ( pbs ) , developed with a red chromogen , 3-amino-9-ethylcarbazole ( aec , dako north america , carpinteria , usa ) . plates of polystyrene of 96 wells were sensitized with the antigen diluted in pbs and incubated overnight at 4 c . each well received 100 l of bovine serum albumin 0.2% and , after the incubation period , the plates were washed and stored at 4 c until the moment of the use . the tested serums were diluted at 1:2000 in pbs in ph 7.2 , distributed 100 l in each well in the plates and incubated at 37 c for 1 h. then , the plates were incubated with a specific secondary antibody for the species ( anti - igg bovine conjugated with peroxidase ) with dilution of 1:5000 . the plates then received the chromogen buffer ( ortho - phenylene - diamine ) and the reading was carried out through a spectrophotomer of plates with 490 nm . the determination of levels of antibodies by elisa showed positive results for the detection of anti - pythiumantibodies for all cattle , suggesting that these animals did develop pythiosis . the cutaneous biopsies were cultivated on corn meal agar ( cma ) at 37 c for 48 h. a hyaline colony with a short and whitish radiating mycelium was observed . the microscopic evaluation revealed the presence of sparsely septate hyphae similar to p. insidiosum growth . for molecular identification , total dna was extracted of the isolate according to the protocol described in the literature , . the sample was sequenced and data obtained were deposited in genbank under the accession number kx369614 . it is usually considered a sporadic disease , which occurs during the rainy season in subtropical areas . the diagnosis of cutaneous pythiosis in cattle in the present outbreak was obtained through the epidemiological and the pathological findings associated with the molecular techniques , serological analyses and cultivation of p. insidiosum . the epidemiological findings described , are similar to those seen in this study , in which only young animals that remained in swampy regions were affected . in a previous report , the time between introduction of the animals in flooded areas and the onset of clinical signs was 15 days with a clinical course that extended over a period of two months , similar to that observed in this study . high rainfall and heavy flooding in the region , influenced by el nio , suggests that the precipitation factor predisposed the occurrence of this outbreak associated with the presence of the animals for long periods in this marshy environment . the clinical and pathological findings observed in this study were similar to those described by other authors , , , , that reported ulcerated lesions with thickening of the dermis and edema in distal regions of fore and hind limbs . one aspect observed in this outbreak and not described to date , was the presence of lesions in the proximal regions located in radio - ulnar region of forelimbs and ventral thoracic region . the location of the lesions is therefore directly related to the parts of the body that stay in direct contact with water containing zoospores of p. insidiosum . in bovines , histopathological lesions are characterized by multifocal pyogranulomas in superficial and deep dermis , composed of polymorphonuclear cells and a predominance of epithelioid macrophages and multinucleated giant cells . a limited number of ramified septate hyphae , surrounded by splendore - hoeppli reactions suggest deposition of antigen - antibody complexes around the agent , similarly observed in this study . pcr assays , immunohistochemistry , and immunoblot analyses have been developed for identification and differentiation of p. insidiosum . the differentiation of p. insidiosum from other species and organisms that cause similar clinical signs is very important to select the appropriate treatment . pithiosis is a self - limiting condition in cattle , and spontaneous healing has been reported to occur after a few weeks to two months . thus , it does not require specific treatment , . in horses , it is a chronic disease and effective treatment is obtained with wide surgical excision followed by the use of immunotherapy . immunotherapic treatment in horses has an effectiveness of 72% when employed alone and of 90% when combined to surgical debridement of diseased tissue , , . the microbial culture is a traditional method to identify p. insidiosum ; however , it requires expertise to identify this specific microorganism . in this study the pcr test followed by sequencing confirmed the previous morphological identification in the cattle samples of the present work . the molecular techniques represent an important sensitive and specific diagnostic tool for pythiosis . the serological analysis by elisa , proved to be a specific , sensitive and rapid technical in the diagnosis of bovine pythiosis . the combination of pathological , serological , cultivation and molecular techniques employed in this study were crucial and allowed to characterize the outbreak of cutaneous pythiosis in cattle in southern brazil . the author(s ) declared no potential conflicts of interest with respect to the research , authorship , and/or publication of this article .
this study reports the epidemiological , pathological and mycological findings of cutaneous pythiosis in cattle in southern brazil . 23 calves , that were kept next to a river with extensive marshy regions , presented ulcerated cutaneous lesions in thoracic and pelvic limbs , sometimes extending to the ventral thoracic region . histopathological examination revealed multifocal pyogranulomas in the superficial and deep dermis . the grocott - methenamine silver , immunohistochemistry anti - pythium insidiosum , elisa serology and molecular characterization demonstrated the agent p. insidiosum in these cases .
diatoms are globally distributed , eukaryotic brown microalgae that participate in various biogeochemical cycles and play key roles in maintaining the ecological balance of the earth . they are major contributors to global primary production and co2 sequestration ( 1,2 ) , and are also receiving attention as a potential source of biofuels ( 3 ) . they fall within the heterokont branch of the eukaryotic tree ( 4 ) and are believed to have evolved from a secondary endosymbiotic process ( 57 ) . previous expressed sequence tag ( est ) studies ( 8,9 ) together with the first whole genome sequences from diatoms , thalassiosira pseudonana ( 10 ) and phaeodactylum tricornutum ( 11 ) , have shown that less than 50% of diatom genes can be assigned a putative function using homology - based methods , due to the lack of genomic information from well studied taxonomically related organisms . similar observations were also made in a pilot study of ests derived from the polar diatom fragilariopsis cylindrus grown at low temperature ( 12 ) . our earlier diatom est database ( 9 ) enabled comparative studies of eukaryotic algal genomes and revealed some interesting differences in genes involved in basic cell metabolism ( 13,14 ) . it also aided the study of key signalling and regulatory pathways ( 15 ) , silica metabolism ( 16,17 ) , nitrogen metabolism ( 18 ) and carbohydrate metabolism ( 19 ) . furthermore , elucidation of the functions of diatom - specific genes can be facilitated by identifying conditions in which they are expressed . non normalized est libraries made from cells grown in different growth conditions can therefore provide a good dataset for comparative , functional as well as phylogenetic studies . for example , comparative study of the mrnas expressed under different conditions can provide a systematic exploration of the molecular adaptations of a cell by differential gene expression . as a case in point , est collections derived from cells grown under different conditions have proven to be a good tool for transcriptomics studies and genome annotation in the green alga chlamydomonas reinhardtii ( 2024 ) . by comparing the expression profiles from more than one growth condition , differential gene expression studies can therefore provide a useful means to explore diatom gene function and genome annotation . in this update we describe est collections derived from diatom cells grown under different conditions and statistical methods used to explore gene expression . this digital gene expression database contains more than 200 000 ests from the two recently sequenced diatom genomes , t. pseudonana ( 10 ) and p. tricornutum ( 11 ) . t. pseudonana is a centric diatom and has been a model organism for physiological studies of widely distributed species belonging to the order thalassiosirales . p. tricornutum is a pennate diatom for which a range of reverse genetics tools have been generated ( 25 ) , therefore making it a good model for functional genomic studies . the sequenced diatoms revealed many interesting features of diatom genes and metabolic pathways , although comparative studies also revealed a high level of molecular divergence ( 11,15 ) . bearing in mind these striking differences , the updates in the diatom est database described here provide key insights into differential gene expression in diatoms grown in a range of ecologically relevant conditions . the diatom est database was initially made with 12 136 ests from p. tricornutum and 15 174 ests from t. pseudonana , each obtained from a single growth condition ( 9 ) . these libraries were expanded with 120 411 ests from p. tricornutum and 61 913 ests from t. pseudonana obtained from cells grown in 15 and 6 additional growth conditions , respectively . the new sets of ests were subjected to preliminary analysis such as vector clipping , quality control , etc . ( 9 ) and sequence assembly and redundancy checking was then done in two steps . first , the ests were clustered together with the predicted gene models from their respective genomes ( http://genome.jgi-psf.org/thaps3/thaps3.home.html and http://genome.jgi-psf.org/phatr2/phatr2.home.html ) . we were able to assign 120 575 ests to 8944 of the 10 402 gene models in p. tricornutum and 43 114 ests to 7268 of the 11 776 gene models in t. pseudonana using the blastn programme ( cut - off e - value 10 ) ( 26 ) . these 8944 and 7268 transcriptional units ( tus ) with predicted gene models were directly added to the non - redundant transcript sets with new sequence identifiers containing g as a prefix along with the gene model identifier , e.g. , g10065 for gene model 10065 . the number of ests clustering to each gene model gives the redundancy or cluster size of the transcript . secondly , transcripts which did not have a predicted gene model ( 11 513 ests from p. tricornutum and 18 073 ests from t. pseudonana ) , mainly due to the fact that ests from only a few libraries were used for training the gene prediction programmes ( 11 ) , were subjected to analysis by cap3 ( 27 ) . sequences with greater than 95% identity over a region longer than 30 base pairs were clustered using this programme and we thus obtained 1330 contigs and 2096 singletons for p. tricornutum and 1769 contigs and 2039 singletons for t. pseudonana . these were added to the non - redundant transcript set with sequence identifiers starting with c for contigs and s for the singletons . adding the tus with gene models to the contigs and singletons obtained from cap3 , we counted 12 370 non - redundant tus in p. tricornutum and 11 076 tus in t. pseudonana . among the non - redundant tus which do not have a predicted gene model , we found only 612 tus in p. tricornutum and 1 083 tus in t. pseudonana that do not align in their respective genomes , likely because of remaining gaps in the genome sequences . the contribution of ests from different libraries to the cluster size of each tu gives the abundance of each expressed transcript across different libraries . the counts were normalized to the library size by converting the counts to frequencies , which allows a statistical comparison to be made of expression levels of transcripts in different conditions . specifically , the log - likelihood ratio was calculated for each contig ( 28 ) to statistically validate whether a difference in frequency across different libraries was random or due to differential expression . the database schematized in figure 1 provides access to frequency distribution plots ( figure 1e ) and log - likelihood ratios ( r - values ) for each tu , which are catalogued by library ( figure 1c ) as well as across libraries ( figure 1d and h ) . figure 1e shows an example of a tu with high r - value ( i.e. a gene that is strongly differentially expressed in the conditions tested ) . by cataloguing the tus based on their r - values we were then able to identify transcripts that are differentially expressed under each condition . for example , transcripts expressed during iron limitation served as a useful starting point to explore the molecular response of p. tricornutum to life at low iron concentrations ( 29 ) , providing experimental validation of our statistical methods . tus were also subjected to hierarchical clustering ( 30 ) to identify transcripts with similar expression profiles in the different conditions . these analyses figure 1f shows a screen shot of hierarchical clustering ( 30 ) of p. tricornutum contigs . the updated dataset and the accompanying results are stored in upgraded servers with the linux debian etch platform in dell1850 hosting the relational database postgresql 8.3 and dell1855 with the web server apache 2.0 and php 5 . the relational database was migrated to postgresql for faster access and to enable the dynamic clustering of expression data . the new web interface is also linked to the gene models on the jgi diatom genome browsers ( http://genome.jgi-psf.org/thaps3/thaps3.home.html and http://genome.jgi-psf.org/phatr2/phatr2.home.html ) , which enables the user to have direct access to annotation and gene structure for each tu ( figure 1 g ) . the database provides access to details of each cdna library and corresponding growth conditions ( figure 1a ) . the raw sequences are catalogued by library and each raw sequence table gives access to dna sequence , length and blast output . the contig tables give access to the tu of each library , catalogued based on the abundance of ests in each condition ( figure 1c ) . the cluster size of each tu is linked to the dynamically generated frequency plot ( figure 1e ) , which enables comparison of expression levels in the other libraries . the expression of each tu across all the libraries can be accessed by two different methods ( figure 1d ) , either in tabular form ( figure 1h ) or as a hierarchical cluster visualized using java treeview ( figure 1f ) . the tabular view gives access to all tus expressed more than once in any given condition and they are catalogued based on cluster size , which is again linked to each frequency plot ( figure 1e ) . this table also provides a link to the ortholog if present in the other diatom and its expression profile , as well as the corresponding gene models hyperlinked to the genome databases hosted at jgi , providing access to further functional annotation and visualization of neighbouring genes ( figure 1 g ) . the java treeview visualizes the two - way hierarchical clustering of all the transcripts which are expressed more than once , helping to identify libraries that cluster together and transcripts with similar expression patterns . the annotations for each tu are hyperlinked to the frequency plots and to the jgi genome browsers . the new web interface is inspired by google , having a simplified , self - explanatory look and easy retrieval of data . the database is queryable by keyword , based on annotation from homology search methods and the tu identifier , and sequence retrieval is possible by using either the sequence identifier or tu identifier . homology searches , using blast against each library and the total non - redundant sets are also available via the web interface . for example , the genomes of two additional pennate diatoms , pseudo - nitzschia multiseries and f. cylindrus , are currently nearing completion at jgi , together with accompanying est collections . the database analysis and pipeline described here are semi - automated and can easily incorporate these and other data sets from diatoms and related species . pilot microarray projects in t. pseudonana and p. tricornutum have already provided experimental validation for this est - based digital transcriptomics database under some conditions ( 29,32 ) and possibilities to link microarray based studies to the existing database are currently being explored , as is the incorporation of transcriptomics data from massively parallel sequencing platforms . reverse genetics studies are providing additional experimental validation for the expression , localization and functions of individual tus ( 33 ) and so information derived from the database can also be used to train the gene prediction programmes to improve in silico gene annotation in diatoms and related organisms . tricornutum ests have been submitted to the ncbi dbest ( genbank accession numbers cd374840cd384835 , bi306757bi307753 , cd374840cd384835 , bi306757bi307753 , ct868744ct950687 and cu695349cu740080 ) . requests for bulk queries of the expression data and to house est data from other diatoms can be addressed to dr chris bowler . partial funding for the diatom est database was obtained from the eu - funded diatomics ( lshg - ct-2004 - 512035 ) and marine genomics europe projects ( goce - ct-2004 - 505403 ) and the agence nationale de la recherche . generation of t. pseudonana ests was funded by a gordon and betty moore foundation marine microbiology investigator award ( eva ) .
the diatom expressed sequence tag ( est ) database was constructed to provide integral access to ests from these ecologically and evolutionarily interesting microalgae . it has now been updated with 130 000 phaeodactylum tricornutum ests from 16 cdna libraries and 77 000 thalassiosira pseudonana ests from seven libraries , derived from cells grown in different nutrient and stress regimes . the updated relational database incorporates results from statistical analyses such as log - likelihood ratios and hierarchical clustering , which help to identify differentially expressed genes under different conditions , and allow similarities in gene expression in different libraries to be investigated in a functional context . the database also incorporates links to the recently sequenced genomes of p. tricornutum and t. pseudonana , enabling an easy cross - talk between the expression pattern of diatom orthologs and the genome browsers . these improvements will facilitate exploration of diatom responses to conditions of ecological relevance and will aid gene function identification of diatom - specific genes and in silico gene prediction in this largely unexplored class of eukaryotes . the updated diatom est database is available at http://www.biologie.ens.fr/diatomics/est3 .
the mucous membrane that covers the digestive and urogenital tracts , the respiratory canal , the eye conjunctiva , the inner ear , and layers of most of the exocrine glands , is a strong component of the immune system , with very specialized mechanical and chemical barriers that either prevent the entry of foreign bodies or facilitate their degradation through a series of chemical processes , most of which are yet to be fully clarified . the mucosa prevents colonization and invasion by foreign pathogens , and prevents any aggravated response of the immune system to such pathogens that could harm the organism . this is a rather local but specialized version of the immune system , and is well interlinked with the lymphatic system , and thus is known as mucosa - associated lymphatic tissue or , in a more functional sense , the mucosal immune system . there are various subsets of this broad term , including gut - associated lymphatic tissue , bronchus - associated lymphatic tissue , and nasal - associated lymphatic tissue . the mucosal immune system has two parts , ie , the innate system and the adaptive system . the innate system comprises various recognition molecules and natural killer cells , while the adaptive system comprises various antigen - presenting cells and the t and b lymphocytes.1 the recognition of foreign bodies at the mucosal surface takes place in a number of ways . cell - intrinsic recognition involves the dendritic cell recognizing cytosolic pathogen - associated microbial patterns ( pamps ) using various pattern recognition receptors , followed by the presentation of pathogens , either by the major histocompatibility complex ( mhc ) class i pathway ( via rough endoplasmic reticulum ) or the mhc class ii pathway ( via autophagy ) . signaling by pattern recognition receptors induces costimulatory molecules and cytokines that activate t cells . in cell - intrinsic recognition , the mhc i pathway depends on an abundance of antigens , while the mhc ii pathway depends on autophagy machinery . on encountering an infected cell , pattern recognition receptors induce the secretion of interferons ( ifns ) and dendritic cell - activating cytokines . if toll - like receptors are involved in recognition , they induce costimulatory molecules and cytokines , thus activating the t cell response . on an encounter , pathogen toll - like receptors recognize the pathogen and move , along with the pathogen , into the cell phagosome where antigen processing and presentation occurs only via the mhc class ii pathway , followed by secretion of t cell activation molecules24 ( see figure 1 ) . the mucosal immune system is unique , being characterized by the presence of specific types of lymphocytes which are not found in the bloodstream and have a very different type of immune reaction , with the presence of the secretory antibody , immunoglobulin ( ig)a.5 another characteristic feature of this system is the ability to differentiate , via pattern recognition receptors , between a pathogenic particle and a nonpathogenic one.6 toll - like receptors , a class of pattern recognition receptors , are specialized antigen- and adjuvant - sensing molecules found on almost all mucosal antigen - presenting cells . they not only recognize foreign pathogens , but also commensals , and thus maintain a steady - state environment inside the gut . similar molecules , like nod - like receptors and type c lectins , also provide an immediate response to pathogens and tissue damage by recruiting innate immune cells , like macrophages and neutrophils , thus triggering tissue repair and switching over to adaptive immune mechanisms.7 the gastrointestinal tract is the largest mucosal surface in all mammalian systems , and most pathogens try to invade the body system through the gut mucosa . intestinal epithelial cells comprise the most vital part of the gut mucosa and regulate the various gut processes , including digestion , secretion , absorption , and defense . their main function is the transport of polymeric immunoglobulins produced by plasma cells in the lamina propria to the intestinal lumen via a receptor - mediated pathway and the recognition of foreign matter via pattern recognition receptors.8 they also have an important role in antigen presentation , and have the dual ability to present both class i and class ii antigens and also secrete immunologically active proteins in response to proinflammatory cytokines , thus preventing any damage to the intestinal lumen and mucosa.9 in addition , epithelial cells express cd14 molecules that bind to lipopolysaccharides and also control the interaction between commensals and the mucosa.10 the second class of cells in the mucosa basically comprises t lymphocytes expressing cd8 , cd45ro , integrins , and perforins.11 another specialized class of cells , called m cells , found in the mucosal membrane , help absorb antigens and then transport them to peyer s patches , followed by antigen activation of t cells.12 innate immunity cells release proinflammatory cytokines that subsequently activate the components of the adaptive immune system . specialized epithelial and intraepithelial cells also form a part of the mucosa , and maintain a balance by self - renewal , and also maintain a balance between the commensal colonies residing in the mucosa . migration of t and b lymphocytes from the lymph nodes to the common mucosa has been observed , and is related to activation , recirculation , and activation of lymphocytes , and also the development of memory lymphocytes . such movements are controlled by specific integrin - type molecules and chemokines secreted in the mucosa , including cc chemokine ligand 25.13,14 regulatory t cells secrete lymphokines , including interleukin ( il)-10 and transforming growth factor beta ( tgf- ) , that result in oral immunosuppression / tolerance , thus preventing any immune response to food particles during ingestion.15 similar mechanisms are hypothesized to work in the colorectal immune response , which has no effect on the small intestine , and in the nasal immune response in the upper respiratory tract mucosa that is exposed to large amounts of nasal and lacrimal secretions . the populations of various intra - epithelial t lymphocytes increase gradually , but markedly , in both germ - free and normal mice after birth upon colonization by commensal microbiota , and are thus important in controlling their growth and interaction with cells in the local environment of the gut mucosa.11 a study of bronchus - associated lymphatic tissue in patients with lung carcinoma showed t cells surrounding b cell follicles , and most cd4 t cells also exhibited cd45ro , and thus had memory responses as well . all the b cells exhibited 4 integrin and l - selectin , while only 43% and 20% of the total population of t cells showed 4 integrin and l - selectin , respectively . in lung mucosa - associated disease , there is a strong combined mucosal and systemic immune response regulated by cd4-expressing th2 cells and th1 cells in patients with asthma and tuberculosis , respectively.16 l - selectin , a receptor molecule prominent in the head and neck mucosa and in the lymph nodes , regulates the trafficking of lymphocytes to these sites . another set of molecules , known as -defensins , regulates the mucosal immune system of the gut and prevents microbial invasion at the epithelial surface . these are of six types , ie , human neutrophil peptides 1 , 2 , 3 , and 4 , and human defensins 5 and 6 . human defensin 5 is expressed in disorders like gastritis , ulcerative colitis , and crohn s disease . human neutrophil peptides 1 , 2 , and 3 are strongly expressed in all types of inflammatory bowel disease . activation of -defensins and cryptidins requires a colocalized molecule known as metalloproteinase matrilysin.17 in metalloproteinase matrilysin - mutant mice , there is a prominent absence of cryptidins and accumulation of cryptidin precursors . human defensins not only prevent invasion by pathogens , but also trigger the influx of different populations of t lymphocytes for further adaptive responses . c type lectins , like regiii , are expressed in the intestinal mucosa , have antimicrobial properties , interact with bacteria via a peptidoglycan mechanism , and aid the recruitment of symbiotic bacteria in the intestine.18 mucosal immunity is directly involved in a number of infectious diseases and allergies . in the upper respiratory tract , where active influx of iga and igm occurs in response to any immune aggravation , with some locally produced igg , waldeyer s ring exhibits adhesion molecules and various chemokine receptors expressed in b lymphocytes present there , due to a higher possibility of airborne allergens , which are more frequent.19 a general hypothesis that can be made from all the studies done to date at the mucosa is that innate immunity is the true regulator of the immune system . this hypothesis is at the basis of almost all mucosal disease , as well as mucosal vaccine development . because the mucosal surface serves as a portal for many infectious diseases , almost all types of pathogens , ie , bacteria , virus , fungi , and parasites , cause disease at the mucosa while trying to invade the body . the main disease of concern affecting the intestinal mucosa is inflammatory bowel disease , in particular , crohn s disease and ulcerative colitis . crohn s disease is a transmural inflammation of the bowel at the terminal ileum and right colon preferentially , but sometimes also involves the colon , rectum , and peritoneal area . the main symptoms are diarrhea , abdominal pain , and weight loss , often accompanied by extradigestive manifestations , including fever , ulcers , arthralgia , and erythema nodosum . about 20% of people with crohn s disease have a blood relative with some form of inflammatory bowel disease , often a brother or sister , and sometimes a parent or child . crohn s disease can occur in people of all age groups , but is more often diagnosed in people aged 2030 years . ulcerative colitis causes inflammation and ulcers in the top layer of the lining of the large intestine . ulcerative colitis primarily affects the colonic mucosa , and the extent and severity of colon involvement are variable . in its most limited form , it may be restricted to the distal rectum , while in severe cases , the entire colon is involved . both genders are equally affected . in western europe and in the us , ulcerative colitis has an incidence of approximately 68 cases per 100,000 and an estimated prevalence of approximately 70150 per 100,000 . the leading initial symptom of ulcerative colitis is diarrhea with blood and mucus , sometimes with pain . extraintestinal symptoms can be an initial manifestation or can occur later in the course of the disease . in proctitis , obstipation can very occasionally be the initial symptom . eighty percent of patients have only proctitis or proctosigmoiditis , and only 20% have extensive colitis . the etiology of both crohn s disease and ulcerative colitis remains unknown , although very recent studies have hypothesized multiple factors leading to the disease , ranging from tobacco smoking to malnutrition or unhealthy eating habits.20,21 helicobacter pylori is a gram - negative bacterium that colonizes the gastric mucosa and causes chronic gastritis and gastric ulcers . the bacterium adheres strongly to the surface of gastric epithelial cells without actually invading them . pylori infection is relatively common worldwide , although less than one - quarter of infected individuals progress to the development of gastric disease . about 20% of people younger than 40 years of age and half of those over 60 years of age have the disease . whether or not an individual proceeds to a disease state may be influenced by any combination of host , bacterial , and environmental factors . h. pylori weakens the protective mucous coating of the stomach and duodenum , which allows acid to get through to the sensitive lining beneath . both the acid and the bacteria serious problems may occur , including perforation ( when the ulcer burrows through the stomach or duodenal wall ) , bleeding ( when acid or the ulcer breaks a blood vessel ) , and obstruction ( when the ulcer blocks the path of food trying to exit the stomach).22 diarrhea is the second leading cause of childhood morbidity and mortality worldwide , and each year almost two million children under five years of age die from severe gastroenteritis . rotaviruses are the single leading cause of diarrhea - related deaths in this age group . it is estimated that each year , amongst children younger than five years of age , rotaviruses account for 114 million episodes of diarrhea , 25 million clinic visits , 2.4 million hospital admissions , and more than 500,000 deaths worldwide . about 99% of rotavirus - associated deaths occur in middle- and low - income countries , predominantly affecting infants in the first year of life living in socioeconomically deprived rural regions of africa and asia . in india alone , rotaviruses cause more than 120,000 deaths , 400,000 hospital admissions , 5 million clinic visits , and 25 million episodes of diarrhea annually . one in 250 children from the low - income countries of africa and asia die from rotavirus gastroenteritis before the age of five years . after an incubation period of 13 days , rotavirus gastroenteritis typically begins abruptly with fever and vomiting , followed by watery diarrhea . less commonly , it may present with vomiting and diarrhea only , or even with either symptom alone with or without fever . symptoms usually last for 38 days , with dehydration , and electrolyte and acid - base disturbance as the most serious complications . compared with other enteric pathogens , children hospitalized with rotavirus gastroenteritis are more likely to have high fever , vomiting , and dehydration . the most common acute symptoms are diarrhea and nausea followed by vomiting , abdominal pain , fever , and fecal incontinence . various nonspecific symptoms are also reported on the first day of illness , with anorexia being most frequent , followed by thirst and lethargy , then headache and vertigo.2326 entamoeba histolytica is a pathogenic organism that is widespread throughout the world , but is especially common in developing countries , where many people do not have access to clean water . the parasite causes invasive disease in over 50 million people and an estimated 100,000 deaths per year , making it a leading cause of parasitic death in humans . infection with e. histolytica can lead to asymptomatic colonization , amoebic colitis , or disseminated extraintestinal disease . the infectious cycle of e. histolytica begins with ingestion of the cyst , a nondividing , quadrinucleate form that is able to survive in the environment . after ingestion , the cyst undergoes excystation in the small intestine to produce the proliferative trophozoite form . trophozoites colonize the colon , adhering to the mucous layer by means of lectin , which binds colonic mucins . disease results when this mucous layer is penetrated and the trophozoites attack the intestinal epithelial cells after entering the mucous layer due to a protective , chitin - containing cell wall.2729 influenza is a highly contagious acute respiratory disease caused by infection of the host respiratory tract by the influenza virus . the global morbidity and mortality burden of influenza is considerable , with an estimated one million deaths annually worldwide . in temperate regions , there are clear seasonal variations in the occurrence of influenza , with a marked peak in the cold winter months . in contrast , seasonality is less well - defined in tropical regions , where there is high background influenza activity throughout the year , with epidemics occurring in the intermediate months between the influenza season in temperate countries of the northern and southern hemispheres . the major limitation of current influenza vaccines is that they are strain - specific and thus ineffective against new variants of the viruses resulting from genetic changes that cause antigenic drifts in hemagglutinin or antigenic shifts to another hemagglutinin subtype . administration of vaccines is also limited by the potential for sensitivity to the egg - propagated vaccine and by the fact that , as a preventative measure , vaccination can not provide a means of immediate treatment or prophylaxis.30,31 human papilloma virus ( hpv ) infections occur all over the world . hpv is associated with a plethora of clinical conditions , ranging from innocuous lesions to cervical cancer . hpv infects the skin and mucosa , and may induce the formation of both benign and malignant tumors . the infection starts when the virus penetrates the new host through micro injury . the development of the incubation phase into active expression depends on three factors , ie , cell permeability , virus type , and host immune status . mucosal hpv infects and replicates in the mucous membranes ( genital , oral , and conjunctival papillomas ) , and induces epithelial proliferation . in recent years , hpv has become one of the most common sexually transmitted diseases in both men and women worldwide . a potentially fatal manifestation of hpv infection , recurrent respiratory papillomatosis is characterized by multiple warty excrescences on the mucosal surface of the respiratory tract.32,33 mucosal immune regulation is activated and induced by various pathways utilizing a variety of biomolecules , including lectin , selectins , integrins , nod - like receptors , pyrin domain - containing nod - like receptors ( nalps ) , and retinoic acid - inducible protein-1 ( rig - i)-like receptors , with the most important being the toll - like receptors . mammalian toll - like receptors are a class of pattern recognition receptors that play a major role in the initiation of innate mucosal immune responses and the following adaptive immune responses to microbial pathogens . activation of the toll - like receptor signaling pathway leads to the expression of numerous genes regulating host defense , including inflammatory cytokines , chemokines , antigen - presenting molecules , and costimulatory molecules . these evolutionarily conserved receptors , homologs of the drosophila toll gene , recognize highly conserved structural motifs only expressed by pamps . pamps are very different from host cell - surface molecular patterns , and toll - like receptors have unique recognition ability for pamps . tlr1 , tlr2 , tlr4 , and tlr6 recognize lipid microbial ligands , tlr3 , tlr7 , tlr8 , and tlr9 recognize nucleotide ligands , tlr5 recognizes protein ligands , and uropathogenic organisms are recognized by tlr11.1 toll - like receptors are type 1 transmembrane proteins characterized by an extracellular domain containing leucine - rich repeats and a cytoplasmic tail that contains a conserved region called the toll / il-1 receptor domain . the structure of the extracellular domain of tlr3 was recently revealed by crystallography studies as being a large horse shoe shape . stimulation of toll - like receptors by pamps initiates signaling cascades that involve a number of proteins , including myeloid differentiation primary response gene ( 88 ) , toll / il-1 receptor domain - containing adapter - inducing ifn- , and il receptor - associated kinase.1 these signaling cascades lead to the activation of transcription factors , such as activator protein-1 , nuclear factor kappa b ( nfb ) , and ifn regulatory factors , inducing the secretion of proinflammatory cytokines and effector cytokines that direct the adaptive immune response . il receptor - associated kinase-4 then activates il receptor - associated kinase-1 by phosphorylation . both il receptor - associated kinase-1 and il receptor - associated kinase-4 leave the myeloid differentiation primary response gene ( 88)-toll - like receptor complex and associate temporarily with tnf receptor - associated factor ( traf)6 , leading to its ubiquitination . bcl10 and malt1 form oligomers that bind to traf6 , and promote traf6 self - ubiquitination . following ubiquitination , traf6 forms a complex with tgf- activated kinase ( tak)2/tak3/tak1 , inducing tak1 activation . tak1 is then coupled to the inhibitor of kappa b kinase gamma complex , which includes the scaffold protein , nuclear factor kappa b essential modulator , leading to the phosphorylation of ib and subsequent nuclear localization of nfb . activation of nfb triggers the production of proinflammatory cytokines , such as tumor necrosis factor alpha ( tnf- ) , il-1 , and il-12 , which direct the adaptive immune response.3436 in one study , it was found that the expression pattern and function of toll - like receptors in different murine b cell subsets including follicular , marginal zone , b-1 , and peyer s patches , were different . b cell subsets express all known toll - like receptors , except tlr5 and tlr8 . strong proliferation and antibody secretion was recorded on stimulation by different toll - like receptor ligands , particularly ligands to tlr1 and 2 , tlr2 and 6 , and tlr4 , 7 , and 9 . marginal zone b cells have a similar pattern of toll - like receptor expression and response . in contrast , peyer s patch b cells respond strongly to tlr2 , 6 , and 7 ligation , but poorly to ligands for tlr9 and 4 . follicular b cells that stimulate the t cell - dependent immune response express and secrete antibodies to igg3 and igm in response to a variety of toll - like receptor agonists in vitro . an experiment done with cells of gut - associated lymphatic tissue revealed strong expression of tlr9 specifically in peyer s patches and mesenteric lymph nodes . in the peyer s patches they were prominent on dendritic cells , b cells , follicle - associated epithelium , and m cells . tlr9 confers a wide range of innate immune defenses against foreign oligonucleotides derived from bacteria.37 it was found that there was a high upregulation of costimulatory molecules in shigella dysenteriae porin , such as c80 and cd86 , followed by a marked increase in iga secretion . these cells were found to express tlr2 and tlr6 for the detection of porin , and can thus be directly correlated with mucosal regulation in the case of shigella infection.38 induction of tlr2 by synthetic pam3 cyssk4 in intestinal mucosa demonstrated a tight junction - associated barrier assembly preventing stress - induced damage via the induction of akt - mediated cell survival using the myeloid differentiation primary response gene ( 88 ) . inflammatory stress - like colitis results in breakage of tight junctions in intestinal cells , while treatment with tlr2-pcsk4 effectively restores tight junction integrity and suppresses mucosal inflammation , thus providing a way to use toll - like receptors to modulate mucosal injury.39 shigella infection induces the production of nfb and il-8 in intraepithelial cells and is mediated by nod1.40 it has also been established that type i fimbriae on shigella are detected by toll - like receptors.41 ethanol intake causes great stress to the intestinal mucosa and damages epithelial cells . a study in c57bl/6j mice with ethanol injury demonstrated the expression of tlr4 following cyclo - oxygenase-2 and prostaglandin e2 expression , that was further followed by expression of macrophage inflammatory protein-2 . thus tlr4 can have a protective role in ethanol poisoning of the gut.42 it was demonstrated in a murine study of helicobacter - dependent colitis that mice lacking tlr4 showed low expression of il-10 and thus had dysregulation in t cell functioning and lack of homeostasis in mucosal cells.43 in another study , using v - tlr4 transgenic mice , it was demonstrated that tlr4 has a role in the recruitment of b cells in the lamina propria of the mucosa and also upregulates the expression of iga and iga - mediated class switching of b cells.44 expression of tlr5 and tlr9 in the apices of gastric epithelial cells due to h. pylori infection was detected , although this expression was lost in h. pylori gastritis.45 tlr5 was shown to detect h. pylori flagellin , although this reaction has low immunogenicity.46 similarly , heat shock protein 60 of h. pylori induces activation of tlr2 and 4 , resulting in upregulation of nfb and il-8 secretion in gastric epithelial cells.47 elevation of tlr4 expression in epithelial cells of the colon has been observed in ulcerative colitis and crohn s disease , and asp299gly and thre399ile polymorphisms have been correlated with development of these diseases.48 upregulation of tlr2 expression in colitis has been observed in mice.27 it has also been found in inflammatory bowel disease that flagellin - specific antibodies are present in high amounts in serum , which links this condition with tlr5.49 intestinal myofibroblasts were shown to express tlr2 and tlr4 in response to lipopolysaccharide and lipoteichoic acid , and were linked to the development of fibrosis related to crohn s disease.50 various toll - like receptors of the enteric mucosa are known to work alongside nod2 , and control inflammatory bowel disease with excessive expression of nfb.51 in the event of e. histolytica infection , neutrophil influx to the infection site followed by il-8 expression was identified a long time ago , and later found to be a tlr2-and tlr4-dependent mechanism induced by lipopeptide phosphoglycan from e. histolytica.52,53 commensal - dependent colitis is a condition that mostly arises due to deficiency of the anti - inflammatory and immune tolerance pathways . in a study carried out in il-10-mutant and il-2-mutant mice , it was observed that in the absence of toll - like receptor signaling pathways , both these mutant strains developed commensal - dependent colitis due to a possible lack of innate immune regulation.54 tlr4 was shown to be the immediate responder to salmonella infection while tlr2 was linked to a later response.55 salmonella flagellin has been shown to induce tlr5 activation in intestinal epithelial cells.56 studies in tlr4-mutant mice have confirmed the role of tlr4 in infection control and production of tnf- and several other chemokines.57 salmonella - susceptible mice were shown to be deficient in tlr5 , and this was linked to the spi2 pathogenicity island and sope2 guanine exchange factor in salmonella.58,59 salmonella typhi was shown to inhibit tlr4 and tlr5 responses , and such infection were unable to produce il-8 or neutrophil activation.60 resolution of primary salmonella infection , the major causative agent of typhoid fever , resulting in enteric bleeding from peyer s patches , was demonstrated to be controlled by the expression of a toll / il-1r domain - containing adaptor protein through downstream signaling via tlr1 , 2 , 4 , and 6.61 a common cause of enteric diarrhea is escherichia coli , the lipopolysaccharide of which is readily recognized by tlr4 of intestinal epithelial cells.62 in the event of infection by pathogenic strains , it was found that tlr5 induced activation of nfb and il-8 production by intraepithelial cells.63 e. coli type 2 enterotoxin was shown to activate tlr2 through an interaction of its b subunit.64 it is also established that fimbriae on e. coli activates tlr2 and tlr4 and causes inflammation , followed by il-8 secretion.65 it has been shown that tlr9-deficient mice have upregulation in the population of cd4foxp3 regulatory t cells ( t - regs ) and a reduction in the expression of il-17- and ifn--producing effector t cells . in such strains of mice , engagement of tlr9 from hematopoietic - derived cells controlled the t - reg population and gut priming for the immune response to encephalitozoon cuniculi infection.66 studies of total parenteral feeding showed upregulation of various toll - like receptors in the intestinal mucosa to prevent bacteria - mediated septic shock arising from ifn--mediated epithelial cell apoptosis due to lack of enteric feeding . the major toll - like receptors involved were tlr4 , tlr5 , tlr7 , and tlr9.67 a toll - like receptor study in goats ( capra hircus ) revealed expression of all toll - like receptors in peripheral blood mononuclear cells , as well as lung mucosal lymphocytes , with high amounts of tlr10 . tlr3 , 4 , and 10 were expressed at lower levels in the uterine and jejunal mucosa , while the mucosa of the uterus and skin expressed high tlr6 levels.68 the detection of viral influenza has been linked to tlr3 , 7 , and 8 for a long time . a case study in rat h3n2 influenza showed stimulation of type 1 ifn , tnf- , il-1 , and ifn- by tlr7 and tlr8 . prophylactic administration of these toll - like receptors suppresses viral titers in the lung with local ifn secretion , hinting at the potential prophylactic and/or therapeutic use of these toll - like receptors.69 another study of haemophilus influenza in mice demonstrated the role of tlr4 in intranasal immunization by activating the th1 response followed by mucosal iga and igg secretion , all of which were absent in tlr4-mutant mice.70 it was also shown in another study that cigarette smoke mixed with double - stranded dna induces expression of rantes ( regulated on activation normal t cell expressed and secreted ) in patients suffering from chronic rhinitis , followed by activation of tlr3 , leading to high levels of human -defensin 2 , while cell activation was also upregulated.71 nasal mucosa inflammation has been reported to be mediated by tlr4 via a local th1 and th2 response and upregulation of il-10 . this tlr4-mediated activation is induced by lipopolysaccharide and expression of the tlr4 receptor by cd3 t cells.72 smooth muscle cells in human airways have been shown to express all toll - like receptors . tnf- and double - stranded rna were found to be the most potent inducers of tlr2 and tlr3 , and along with these two cytokines , ifn- helped activation of tlr4 . toll - like receptor activation led to the release of il-8 and eotaxin . when dexamethasone is administered with ifn- and tnf- , together , tlr2 , 3 , and 4 were found to be major activators of chemokine release and mucosal tolerance in human airways.73 epithelial nasal polyp cells were found to express tlr3 strongly on induction by double - stranded rna and then mediated very strong proinflammatory responses via the secretion of rantes , ip-10 , il-8 , and granulocyte - macrophage colony - stimulating factor . similar studies with lipopolysaccharide also mediated similar responses but were comparatively weaker.74 a study of bovine nasal - associated lymphatic tissue infected with foot and mouth disease virus demonstrated high expression of tlr4 mrna from the dorsal soft palate cells in the acute stages of the disease , along with strong expression of mrna for ifn- , with some expression of ifn- , il-1 , tnf- , and il-2.75 a study of airway epithelial cells in cystic fibrosis showed high expression of tlr2 in diseased cells on induction and mediated proinflammatory responses in the airway mucosa.76 stimulation of lung mucosal tlr2 and tlr6 by malp-2 showed secretion of il-8 and macrophage inflammatory protein - i and enhances phagocytosis.77 patients suffering from chronic rhinosinusitis with nasal polyps exhibited high expression of tlr2 followed by induction of high quantities of macrophage inflammatory protein- , rantes , and granulocyte - macrophage colony - stimulating factor.78 the virulence of group b streptococcus is mainly due to the pbp1a protein required for cell wall synthesis and encoded by the pona gene . an experiment in tlr2-mutant mice using two different strains of group b streptococcus , ie , wild - type and pona - mutant , revealed that tlr2-mutant mice were more susceptible to infection by both strains of group b streptococcus , indicating the involvement of tlr2 in the immune response to group b streptococcus infection.79 tlr2 and tlr4 show strong expression in the middle ear of the rat , and thus have a specific role in the detection of the airborne pathogens that usually invade the ear mucosa and lead to otitis.80 it was found that oral mucosal langerhans cells express tlr4 , and stimulation of tlr4 showed expression of coinhibitory molecules , such as b7-h1 and b7-h3 , and downregulation of the costimulatory molecule , cd86 , while there was a high increase in il-10 secretion followed by the induction of tgf-1 , foxp3 , ifn- , and il-2 in t cells . thus , tlr4 has great importance in oral tolerance via langerhans cells.81 it has been established that toll - like receptors have a role in activating both the cellular and humoral immune response in candida albicans infection , along with c type lectin receptors.82 gingival epithelial cells showed expression of tlr2 , tlr4 , and tlr6 , with the production of il-6 , and il-8 , and human -defensins 1 and 2 in the oral mucosa . in the same study , it was found that a quorum - sensing molecule , farnesol , that regulates the virulence of c. albicans , had a synergistic effect in the production of these cytokines , along with tlr2 , tlr4 , and tlr6.83 tlr2 and soluble cd14 expression was found to be unregulated in the oral mucosa in diseases such as oral lichen planus and burning mouth syndrome . these molecules are present in saliva , and thus , can be used as biomarkers to give an indication of such diseases . however , the expression of tlr2 was found to be lowered in oral mucosa epithelial cells.84 papillomavirus is a great threat to the mucosal membrane because it invades the human body through the mucosa and is a potential cause of cancer at a number of sites , including the vulva , uterus , intestine , and anus . tlr4 can be used as a biomarker to study papillomavirus infection . in a bovine study , infection with the e7 and e2 strains of bovine papillomavirus-1 was demonstrated to reduce expression of tlr4 in fibroblasts significantly.85 the human fallopian tube is also lined by mucosa and exhibits mucosal tolerance against several viral infections . these cells , when treated with a tlr3 agonist , showed upregulation of il-8 , tnf- , human -defensin 2 , and ifn- , and also induced tlr2 , tlr3 , and tlr7.86 viral infection caused by rotavirus , calicivirus , and adenovirus of the gut is usually sensed by tlr3 and tlr8 . single - stranded rna viruses are usually detected by tlr7 and tlr8.87,88 tlr2 expressed in trophoblast cells of the human placenta has been linked to disorders such aschorioamnionitis . localized expression of tlr2 in cytotrophoblast and syncytiotrophoblast mucosal cells and decidual stromal cells was shown to be decreased in chorioamnionitis.89 recent research has also shown a link between tlr5 expressed in gut mucosa and obesity - related metabolic disorders . tlr5-deficient mice exhibited hyperphagia , hyperlipidemia , insulin resistance , and hyperadiposity.90 in one study , staphylococcus aureus - mediated allergic conjunctivitis of the eye was linked to tlr2 , with high production of il-4 , il-5 , il-13 , and eotaxin , mediated by a th2 response , while tlr2-mutant mice failed to exhibit any of these responses.91 in a study of tlr4 in the vaginal mucosa of pregnant women , it was found that a single nucleotide polymorphism in tlr4 ( 896 a > g ) resulted in a tlr4 variant causing high vaginal ph , leading to infection by gardnerella vaginalis and some anaerobic gram - negative rods , while women without this polymorphism were immune against such infection.92 a study of vaginal trichomonas vaginalis infection indicated the activation of tlr4 via secretion of proinflammatory cytokines , in particular tnf-. this resulted in a heavy influx of leukocytes to the infection sites.93 a general conclusion that can be drawn from the aforegoing observations is that all the different pattern recognition receptors and molecules of innate mucosal immunity are the first to encounter and recognize a pathogen or antigen , and they further induce proinflammatory cytokine production , leading to adaptive immunity . nod - like receptors constitute a recently identified family of intracellular pattern recognition receptors , which contains more than 20 members in mammals . nod - like receptors are characterized by tripartite - domain organization , with a conserved nucleotide binding oligomerization domain and leucine - rich repeats . nod1 and nod1 senses d--glutamyl - meso - dap dipeptide which is found in the peptoglycans of all gram - negative and some gram - positive bacteria , whereas nod2 recognizes the muramyl dipeptide structure found in almost all bacteria.94,95 nod1 and nod2 signal via receptor - interacting serine / threonine - protein kinase 2 ( ripk2 ) . ripk2 mediates ubiquitination of the inhibitor of kappa b kinase gamma , leading to activation of the receptor activator of nfb and the production of inflammatory cytokines , including tnf- and il-6 . in addition to the nfb pathway , stimulation of nod1 and nod2 induces the activation of mitogen - activated protein kinases . studies have shown the involvement of caspase - recruiting domain - containing protein ( card)9 in the selective control of nod2-dependent p38 and c - jun n - terminal kinase signaling.9698 genetic variations in nod2 are associated with crohn s disease.99 several nod1 polymorphisms are linked with the development of atopic eczema and asthma.100 nod2 is required for the expression of an antimicrobial peptide , cryptidin , found in the gastrointestinal mucosa.98 nod1-deficient mice are highly susceptible to infection with h. pylori , whereas nod2-deficient mice are more susceptible to oral infection with listeria monocytogenes.101 nod2 deficiency results in abnormal development and function of peyer s patches in mice . this phenotype is peyer s patch - specific and not apparent after birth but progresses with time , having been observed for up to 52 weeks . peyer s patches in nod2-deficient mice are larger than in controls , with increased numbers of both m cells and cd4 + t cells . knockout mice exhibit increased translocation of yeast and bacteria across peyer s patches and higher concentrations of tnf- , ifn- , il-12 , and il-4.102 pyrin domain - containing nod - like receptors play a key role in the regulation of caspase-1 by forming a multiprotein complex known as the inflammasome . caspase-1 participates in the processing and subsequent release of proinflammatory cytokines , including il-1 and il-18 . at least two types of nalp inflammasomes have been identified , ie , the nalp1 inflammasome comprising nalp1 , nucleotide - binding oligomerization domain , leucine - rich repeat and pyrin domain containing protein 1 , card7 , asc ( apoptosis - associated speck - like protein containing a card ) , caspase-1 and caspase-5 , and the nalp3 inflammasome containing nalp3 ( nlrp3 , cryopyrin , cold - induced auto - inflammatory syndrome 1 ) , asc , cardinal , and caspase-1 . activation of caspase-1 induced by nalp3 appears to be toll - like receptor - independent , whereas secretion of mature il-1 seems to require two stimuli involving the toll - like receptor and nalp3 . the first stimulus , a toll - like receptor ligand , such as lipopolysaccharide , triggers the generation of pro - il-1 , while the second , a stimulus such as adenosine triphosphate , induces oligomerization and inflammasome assembly . a murine variant of nalp1 ( nalp1b ) was shown to respond to the anthrax toxin , suggesting an engagement of the nalp1 inflammasome in the immune response to bacillus anthracis infection . nalp3 mediates caspase-1 activation in response to a wide variety of bacteria , including l. monocytogenes and s. aureus.103105 rig - i - like receptors ( also known as ddx58 ) contain rig - i - like helicases , which are a family of cytoplasmic rna helicases that are prominent in antiviral responses . rig - i and melanoma differentiation - associated gene 5 ( mda-5 ) sense double - stranded rna , a replication intermediate for rna viruses , leading to the production of type iifns in infected cells.106,107 upon recognition of double - stranded rna , they are recruited by the adaptor ips-1 to the outer membrane of the mitochondria , leading to the activation of several transcription factors , including ifn regulatory factors 3 and 7 , as well as nfb . ifn regulatory factors 3 and 7 control the expression of type i ifns , while nfb regulates the production of inflammatory cytokines . interferon regulatory factor 3 and 7 activation involves traf3 , nak - associated protein 1 , tank ( traf family member - associated nfb activator ) , and the protein kinase , tank - binding kinase 1 ( tbk1 ) or ib kinase epsilon.108110 experiments in rig - i- and mda-5-deficient mice have demonstrated that conventional dendritic cells , macrophages , and fibroblasts isolated from these mice have impaired ifn induction after rna virus infection.111 rig - i disruption in mice resulted in reduced body weight caused by severe damage and inflammatory infiltration into the colonic mucosa . the number of peyer s patches was significantly reduced in rig - i - deficient mice , and rig - i was found to control the transcriptional activity of g i2 , a negative regulator of t cell responses , which may mediate the modulatory effects of rig - i.112,113 the -defensins are a family of antimicrobial peptides that are diversely expressed on mucosal surfaces , and in airways and submucosal gland epithelia . these small cationic peptides are products of individual genes and demonstrate broad - spectrum activity against bacteria , fungi , and some enveloped viruses . b - defensins also act as chemokines for adaptive immune cells , including immature dendritic cells and t cells via the ccr6 receptor , and provide a link between innate and adaptive immunity.114 lipocalin is a more recently identified mucosal molecule that responds to bacterial enterobactin and inhibits the colonization of klebsiella pneumoniae followed by induction of il-8 from cultured respiratory cells.115 this is followed by a strong influx of neutrophils to the site of infection . specialized molecules known as cathelicidins , a type of defensin , also harbor the apical granules of epithelial cells and have shown antimicrobial activity in preventing the entry of larger pathogens . they also act as a bridge between innate and adaptive immunity by chemotactically attracting dendritic cells and t cells in the presence of severe immune aggravation.116 a case study of avian infectious bronchitis revealed potent th1 adaptive immunity accompanied by il- activation after primary immunization , with strong activation of t cells and iga upregulation , and a local memory response governed by igg at the bronchial mucosal surface after second immunization.117 tgf- in the gut is known to suppress mucosal inflammation and to heal damaged mucosa by upregulating the deposition of extracellular matrix in the mucosal mesenchymal cells . it was found that in smoking - related chronic obstructive pulmonary disease , the population of mucosal mast cells showed a large increase , with altered expression of tgf- , cd88 , and renin . conversely , in acute necrotizing pancreatitis , the total mast cell population in the gut was found to decrease . antigen - processing in the gut is a well orchestrated process whereby m cells lacking the mhc class ii pathway take up foreign antigens through their irregular microvilli , transport them to follicular areas where they are processed by dendritic cells , and then iga - secreting plasma cells are directed to produce iga . dimeric secretory immunoglobulin iga prevents bacteria from adhering to the mucosa and their further penetration into local cells . iga has resistance to proteolysis and helps transport bactericidal chemicals like lactoferrin and lactoperoxidase to the bacterial surface.118 a study of trachoma infection of the eye mucosa revealed a high concentration of proinflammatory cytokines , such as tnf- , which were instrumental in attracting and activating neutrophils , and low levels of th1 and th2 cytokines were observed in chronic trachoma . conversely , prolonged production of tnf- and il- together was associated with a reduction in the il-1ra inhibitory mechanism . furthermore , there was the il-2 class of cytokines were highly involved , including il2 , il2-r , and il-15.119 innate mucosal immunity , although not well - studied to date , plays a significant role in pathogen trafficking in the body . it recognizes pathogens using its various molecules , and triggers cascades of signals to eliminate the foreign body , induce tissue repair , and further trigger the adaptive immune response . innate mucosal immunity has its own special memory stores in the form of pattern recognition receptors which are heritable and highly specialized . each pattern recognition receptor has the capability to distinguish a pamp and , unlike the adaptive response , is genetic and evolutionarily conserved , thus making mucosal immunity the primary line of defense in almost all mammalian body systems . similarly , mucosal vaccines trigger an innate immune response as a starting signal , which leads to adaptive memory , giving rise to specific immunity against diseases . after skin , mucosal surfaces are the largest area of host - pathogen interaction in mammalian systems . the prospect of using the mucosal route for vaccination is increased by the fact that almost all infection either begins at or encounters this route . most gastrointestinal , respiratory , urinary , and sexually transmitted diseases use the mucosal route for primary and subsequent infection . vaccines are being developed to prevent the pathogen from attaching or colonizing the mucosal surface or their subsequent penetration and replication . the primary role of vaccines is to provide strong stimulation of iga that further controls the adaptive immune response . due to bystander suppression , mucosal tolerance can be activated using t - regs to produce suppressive cytokines.120 this is primarily seen in human systems to prevent self - antigenic responses . it has been observed that nasal vaccines stimulate t - regs to produce il-10 , while oral vaccines stimulate t - regs to produce tgf-. increased doses had been shown to deplete the population of killer t cells and even higher doses cause their apoptosis.121 innate mucosal immunity and mucosal vaccine development based on pattern recognition receptors has been a neglected area of research for years . however , recent research has given an idea of the involvement of innate mucosal immunity in different defense mechanisms , and has paved the way for ongoing research in this area . mucosal pattern recognition receptor pathways , pattern recognition receptor structure - activity relationships , development of new mucosal adjuvant and pattern recognition receptor mimetics , are currently hot topics in mucosal immunity research . in this review , we have attempted to establish the importance of innate immunity which may lead to the development of future therapeutics for better disease management and control .
the body defense mechanism has evolved to protect animals from invading pathogenic microorganisms and cancer . it is able to generate a diverse variety of cells and molecules capable of specifically recognizing and eliminating a limitless variety of foreign invaders . these cells and molecules act together in a dynamic network and are known as the immune system . innate mucosal immunity consists of various recognition receptor molecules , including toll - like receptors , nod - like receptors , and rig - i - like receptors . these recognition receptor molecules recognize various invading pathogens effectively , and generate an immune response to stop their entry and neutralize their adverse consequences , such as tissue damage . furthermore , they regulate the adaptive response in cases of severe infection and also help generate a memory response . most infections occur through the mucosa . it is important to understand the initial host defense response or innate immunity at the mucosal surface to control these infections and protect the system . the aim of this review is to discuss the effects and functions of various innate mucosal agents and their importance in understanding the physiological immune response , as well as their roles in developing new interventions .
in the field of anesthesia postoperative pain management is an important and challenging matter , and at present , as optimal for diminishing postoperative pain , there is no method of preemptive analgesia accepted . for the management of postoperative pain , different methods have been assessed in many studies . in an outpatient setting arthroscopy of the knee under general anesthesia it seems that the majority of patients prefer the ambulatory arthroscopic surgery of the knee . as this common procedure may cause pain , which has a negative impact on the patient 's psychology , causing discomfort and affects the patient 's activity level and satisfaction . a significant number of patients have reported moderate to severe pain 24-h after knee arthroscopy in a particular day . in care previously , studies using different drugs and regimes have been published an effort to provide an effective , safe and long lasting after arthroscopy analgesia , also , to control pain after arthroscopic knee surgery systemic medication , peripheral or central blocks , and intraarticular ( ia ) drug administration , have been used . intraarticular route is one of the analgesic techniques for pain management after knee arthroscopy , and has been used by many orthopedic surgeons during arthroscopic procedures , and previously , the efficacy of this technique has been reported in some studies for midazolam , tramadol , bupivacaine , ropivacaine , dexmedetomidine , morphine , and etoricoxib . midazolam as one of the clinically available water soluble benzodiazepines is effective in the pediatric , adult , and obstetric population when administered by the centroneuraxial route and has been reported to have an analgesic effect through neuraxial pathways . after knee arthroscopy ia administration of local anesthetic solutions is used to provide better analgesia and reduce consumption and possible side - effects of intravenous anesthetic . to the best of our knowledge , published studies reporting the comparison of intravenous versus ia administration of midazolam on postoperative pain after knee arthroscopy are limited and the site of midazolam action ( systemic absorption versus local peripheral action ) is questioned . thus , this study was aimed to assess the comparison of intravenous versus ia administration of midazolam on postoperative pain after knee arthroscopy in a randomized controlled trial . this study was a randomized , parallel - group , double - blind study which was conducted between april , and october , 2013 , on 75 patients who scheduled for knee arthroscopy under general anesthesia in kashani hospital in isfahan , iran . the ethics committee of isfahan university of medical sciences investigates and approves this study , and written informed consent was obtained from all studied patients . eligibility was define as age older than 18 years old in both gender , american society of anesthesiologists classification i and ii , no history of chronic disease , no use of nonsteroidal antiinflammatory drugs up to 2 weeks before surgery . furthermore , patients with history use of opioids , patients with postoperative complications that increased postoperative pain , and those whose pain evaluation was judged unreliable because of neurologic disease did not enrolled in the study . using random - maker software group i include patients who received 75 mc / kg ia injection of midazolam and 10 cc intravenous injection of isotonic saline . group ii include patients who received 75 mc / kg intravenous injection of midazolam and 10 cc ia injection of isotonic saline . patients in group iii received ia and intravenous injection of isotonic saline ( 10 cc ) . in all groups , standardized general anesthesia was selected , and in the entire cases anesthesia was induced intravenously with fentanyl ( 2 mcg / kg ) , sodium thiopental ( 5 mg / kg ) and atracurium ( 0.5 mg / kg ) . balanced anesthesia was maintained using with inhalation of isoflurane ( 1.2% ) and morphine ( 0.1 mg / kg ) . patients lungs were mechanically ventilated with the same setting during ventilation ( 10 ml / kg and respiratory rate , 10 min ) . the patients were monitored and observed using an electrocardiogram , noninvasive arterial blood pressure device , end tidal co2 , and pulse oximeter . studied drugs were prepared in syringes in a double - blind fashion by a team member who was not involved in data recording . . collected data included age , and sex combination , weight , duration of anesthesia ( from induction of anesthesia until disconnecting of anesthesia drug ) , duration of surgery ( from the beginning of incision until last suture ) , extubation time ( from disconnecting of anesthesia drugs until extubation of trachea ) , duration of recovery ( from extubation until achieving modified alderet score 9/10 ) time to first analgesic requirement , 24-h analgesic consumption , number of patients requiring analgesics , sedation , complications ( desaturation , bradycardia , allergy , hypotension , local infection ) satisfaction , pain and mean arterial pressure ( map ) which were assessed in all patients . degree of sedation 30 min after extubation evaluated and recorded in the postanesthesia care unit ( pacu ) ; ( scale 1 - 5 , 1 = completely awake , 2 = awake but drowsy , 3 = asleep but responsive to verbal commands , 4 = asleep but responsive to tactile stimulus , 5 = asleep and not responsive to any stimulus time to first analgesic requirement assessment of pain was done by a 10-score visual analogue scale ; 0 , no pain ; 10 , worst imaginable pain , after arrival in the recovery room and 2- , 4- , 5- , 12- and 24-h after surgery by an independent nurse blinded to group allocation . also , patients were asked to indicate the degree of overall satisfaction on a five - point satisfaction scale : 0 = unsatisfactory , 1 = somewhat satisfactory , 2 = satisfactory , 3 = very good , 4 = excellent . the sample size was calculated using the comparison of means formula with two - sided log - rank test , = 0.05 , and 80% power . all statistical analyses were performed using ( statistical package for social sciences ) spss software for windows , version 20 . descriptive data are reported as mean standard deviation , median ( interquartile range ) or number ( percent ) as appropriate . one - way anova , chi - square test , and kruskal wallis were used to comparing all studied variables between groups as appropriate . of 84 reviewed patients , nine patients did not enter to the study ( six patients were not eligible and three patients refused informed consent ) . patients were followed for 24-h ; finally , 75 patients ( each group 25 patients ) completed the study and analyzed [ figure 1 ] . patients who entered to the study , divided into the study groups and analyzed the mean age of the studied patients was 27.3 5 years , 61 patients ( 88% ) were male and 14 patients ( 22% ) were female . no significant differences were noted between intervention groups for the mean of age and sex combination , weight , duration of anesthesia , and duration of surgery ( p 0.5 ) . duration of recovery and extubation time in group ii was significantly higher than groups ( p < 0.05 ) . baseline characteristics in 75 studies patients by groups mean of time to first analgesic requirement in group iii ( 33.6 min ) was significantly lower than group ii ( 288.8 min ) and group i ( 427.5 min ) , and in group ii was significantly lower than group i. all patients in group ii and iii requiring analgesics , whereas only 16 of 25 patients in group i requiring analgesics . furthermore , mean of 24-h analgesic consumption was increased in group ii compared with group i and in group iii compare with groups i and ii ( 1635.5 and 70 mg , respectively , p < 0.0001 ) . differences in sedation score among groups were statistically significant , patients in group ii had higher sedation score than other groups in the pacu ( p < 0.0001 ) . frequency of complications desaturation and apnea in pacu , bradycardia , allergy , hypotension , local infection ) among groups was significantly different ( p < 0.0001 ) and occurred only in 3 of 25 patients in group i in contrast to 20 of 25 patients in group iii [ table 2 ] . comparison of analgesic requirement , sedation and complications among study groups pain score among groups was compared at time points [ table 3 ] and as a trend in the follow - up period time [ figure 2 ] . at baseline and hours 12 and 24 median of pain score was not significantly different among groups ( p > 0.05 ) . at hours 2 , 4 and 8 pain score decreased in all groups , however decrease in group i was significantly more than other groups ( p < 0.0001 ) . also , as shown in figure 2 , the difference in the trend of pain in time points during the follow - up period was statistically significant among groups ( p < 0.0001 ) . comparison of pain score among study groups at time points comparison of pain among study groups by repeated measurements of anova . group i , included 25 patients who received intraarticular ( ia ) midazolam and intravenous placebo ; group ii , included 25 patients who received ia placebo and intravenous midazolam ; group iii , included 25 patients who received ia and intravenous placebo . the difference of the trend of pain was statistically significant among groups ( p < 0.0001 ) table 4 shows the comparison of patients satisfaction and map between study groups . all patients in group i reported very good and excellent satisfy , most of the patients in group ii reported somewhat satisfactory and satisfactory and in group iii no patient reported excellent and one patient reported very good . i was significantly lowers than other groups at baseline and hour 1 ( p < 0.0001 ) , but at hour 2 the difference in the mean of map was not statistically significant ( p = 0.057 ) . arthroscopic surgery is associated with a variable amount of postoperative pain , but it may be quite considerable . the pain is caused by an irritation of free nerve endings of the synovial tissue , anterior fat pad , and joint capsule due to surgical excision and resection . in this randomized study , we found that the administration of ia midazolam improved postoperative pain , and patient satisfaction . it was also associated with lower sedation scores following administration , decreased total postoperative analgesic consumption , and delayed the time of first analgesic administration compared with intravenous midazolam and saline controls group . this is supported by a significant decrease in pain scores during the first eight postoperative hours and by a prolonged delay between the ia administration of midazolam and additional analgesic requirement . these beneficial effects of midazolam were not as marked when the drug was given intravenous and it produced a limited improvement in postoperative pain and less effect on postoperative analgesic requirement and the time of first analgesic administration compared with saline controls group . based on our results , the analgesic effect of ia midazolam appears to be mainly act at a peripheral site in the joint , as this effect was less pronounced after systemic administration , however , a central analgesic effect resulting from systemic absorption can not be excluded . opioid receptors are existed on peripheral nerve endings and opioid peptides are produced in various immune cells of synovial tissue after knee trauma . corticotropin - releasing hormone ( crh ) acts through its receptors on endorphin - containing immune cells , likar et al . investigated whether the ia injection of crh reduces postoperative pain intensity and supplemental analgesic consumption in patients undergoing arthroscopic knee surgery . they found evidence for a short analgesic effect of a single dose of ia crh in patients undergoing arthroscopic knee surgery . in a double - blinded , randomized study by batra et al . , postoperative pain , the time to first analgesic consumption and the total dose of analgesics used over 48-h after ia administration of midazolam 50 g / kg , 75 g / kg , or isotonic saline were assessed in 60 patients undergoing knee arthroscopy . authors in this study reported that both doses of midazolam decreases postoperative pain after arthroscopic knee surgery in compared with placebo . also , a prolonged delay between the ia administration of midazolam and additional analgesic requirement , and during the first four postoperative hours a significant decrease in pain scores were reported in this study in both doses of midazolam compared with the placebo group . they did not demonstrate a dose dependent effect with administration of midazolam 50 g / kg or 75 g / kg doses . like batra et al . we found greater analgesic effect after ia administration than placebo , and lower additional analgesic requirement . results of these studies show the effect of ia administration of midazolam as an analgesic technique for postoperative pain management after knee arthroscopy . to the best of our knowledge , there are no published studies reporting the comparison of intravenous versus ia administration of midazolam on postoperative pain after knee arthroscopy and other studies were done using different drugs . a double - blinded , randomized study assessed the effect of intravenous versus ia administration of tramadol on postoperative pain after knee arthroscopy . in this study , different doses of tramadol were used and results are shown that ia tramadol provide longest duration of analgesia , lower pain scores and minimal analgesic consumption during 24-h with few side - effects in compare with intravenous administration of tramadol . effect of dexmedetomidine after ia and intravenous administration was evaluated in al - metwalli et al . study , and reported that ia dexmedetomidine enhanced postoperative analgesia after arthroscopic knee surgery , with an increased time to first analgesic request and a decreased need for postoperative analgesia compared with intravenous administration . in another randomized study , ho et al . assessed the effect of intravenous versus ia administration of morphine on postoperative pain after knee arthroscopy and reported that patients who received ia morphine consumed less rescue analgesia than those who received intravenous morphine with fewer side - effects . arti and arti studied the analgesic effects of different opioids in the early postoperative period in comparison to control group . they found that morphine in comparison to meperidine or methadone is more useful in reducing pain or analgesic need when is added to bupivacaine injection following arthroscopic menisectomy . studied ia injection of ketamine or ketamine plus levobupivacaine on postoperative analgesia in patients undergoing arthroscopic meniscectomy . they found that ia ketamine provides effective postoperative analgesia , and addition of ia levobupivacaine to ketamine may provide better pain relief after outpatient arthroscopic meniscectomy . in agreement with these three studies , our results show that greater analgesic effect and lower side - effects of midazolam after ia administration than after intravenous injection . although , studied drugs in these studies is different but their findings display that the mechanism of the analgesic effect of intraarticularly administered of these drugs is not due to the systemic effects and there is limited absorption of the drug . strength of our study is that to determine the site of midazolam action and the utility of ia midazolam , patients were assessed in three comparing groups receiving ia midazolam with intravenous saline , ia saline with intravenous midazolam , and ia saline with intravenous saline . furthermore , the low number of sample size is the possible main limitation of our study . therefore , future studies with appropriate sample size are necessary to specifically assess the effect of ia administration of midazolam compare to intravenous injection . for the purpose of ethical considerations and study limitations , because we used ia midazolam , then before starting of administration we discussed the procedure for every patient and received written informed consent , also we coordinated about the study with the surgical team as study coworker before starting of the study , therefore no ethical barrier or limitation has been determined . the results of our study show the greater analgesic effect after ia administration of midazolam than after intravenous injection , with better patient satisfaction score , lower sedation scores following administration , decreased total postoperative analgesic consumption , and delayed the time of first analgesic administration and lower side - effects . thus , ia administration of midazolam may be the method of choice for pain relief after arthroscopic knee surgery .
background : this double - blinded , randomized clinical trial was designed to evaluate the comparison of intravenous versus intraarticular ( ia ) administration of midazolam on postoperative pain after knee arthroscopy.materials and methods : in this study , 75 patients randomized in three groups to receive 75 mc / kg ia injection of midazolam and 10 ml intravenous injection of isotonic saline ( group i ) , 75 mc / kg intravenous injection of midazolam and 10 cc ia injection of isotonic saline ( group ii ) or ia and intravenous injection of isotonic saline ( group iii ) at the end of knee arthroscopy . pain scores , time until the first request for analgesics , cumulative analgesic consumption , satisfaction , sedation , and complications as studied outcomes were assessed . patients were observed for 24-h.results:ia administration of midazolam significantly reduced pain scores in the early postoperative period compared with intravenous injection . mean of time to first analgesic requirement in group iii ( 33.6 min ) was significantly lower than group ii ( 288.8 min ) and group i ( 427.5 min ) . cumulative analgesic consumption was increased in groups ii ( 35.5 mg ) , and iii ( 70 mg ) compared with group i ( 16 mg ) , ( p < 0.0001 ) . complications significantly occurred in 3 of 25 patients in group i in contrast to 20 of 25 patients in group iii ( p < 0.0001 ) . at 2- , 4- and 8-h after arthroscopy pain score significantly decreased in group i than other groups ( p < 0.0001 ) . patients in group i were significantly satisfy than other groups ( p < 0.0001).conclusion : results show the greater analgesic effect after ia administration of midazolam than after intravenous injection and hence , ia administration may be is the method of choice for pain relief after knee arthroscopy .
the use of dual antiplatelet therapy ( dapt ) with aspirin and p2y12 receptor inhibitors is recommended by current clinical guidelines for at least 12 months in patients with acute coronary syndrome ( acs ) or percutaneous coronary intervention ( pci ) . , proton pump inhibitors ( ppis ) , during the past few years , however , concerns have been raised about the potential for ppis , especially omeprazole and esomeprazole , to attenuate the antiplatelet effects of clopidogrel. this phenomenon may be interpreted by the ability of ppis to competitively inhibit cytochrome p450 2c19 ( cyp2c19 ) isoenzyme , which is involved in the conversion of clopidogrel to its active metabolite. observational studies showed conflicting data regarding the effects of concomitant use of clopidogrel and ppis on cardiovascular events. and the results of randomized controlled trial indicated no apparent cardiovascular interaction between clopidogrel and omeprazole . , in contrast , ticagrelor is a direct p2y12 receptor inhibitor without need of biotransformation . subgroup analysis of plato trial revealed concurrent use of ppis increased risk of adverse events in both clopidogrel and ticagrelor groups , but it may be just a marker for higher rates of cardiovascular events . herein , whether the use of ppis affects the clinical efficacy of ticagrelor remains less known . given the uncertainties as to a possible adverse interaction between ppis and p2y12 receptor inhibitors , we analyzed data from a large real world registry named bleemacs ( bleeding complications in a multicenter registry of patients discharged with diagnosis of acute coronary syndrome ) to determine the impact of concomitant administration of ppi and clopidogrel or ticagrelor on clinical outcomes in patients with acs after pci . the details of the design and methods of the bleemacs registry have been previously described . in brief , the bleemacs registry is an international , multi - center , investigator - initiated , retrospective observational registry , and aims to explore the real world burden of long - term bleeding in acs patients . a total of 18,077 patients were enrolled from 16 centers in 11 countries : north america ( canada ) , south america ( brazil ) , europe ( germany , netherlands , poland , spain , italy , macedonia , greece ) , and asia ( japan and china ) . data from one center ( macedonia , n = 2676 ) were excluded from bleemacs registry because of high percentage of missing values . therefore , the final bleemacs database was constructed by merging the individual databases from the remaining 15 centers , making up a large cohort of 15,401 consecutive patients . patients were eligible if they were at least 18 years old and were discharged alive with a diagnosis of acs and treated with pci from 2003 to 2014 . patients using p2y12 receptor inhibitors ( clopidogrel or ticagrelor ) with or without ppis at discharge were included in the final cohort ( n = 9,429 ) . the institutional review boards or ethics committees of each center approved participation in bleemacs registry , and all patients gave written informed consent . this study was approved by the institutional ethical committee of beijing anzhen hospital , capital medical university ( no.2015009x ) . laboratory tests , index pci , and adjunctive therapy were also documented . at discharge , cardiovascular outcomes and bleeding data on cardiovascular and bleeding events were systematically obtained by telephone or face - to - face talk , and also reviewed by the medical records of the index events . the primary endpoint was a composite of all - cause death , re - infarction , or severe bleeding events . re - infarction was identified as ischemic symptoms ( or new electrocardiographic changes ) and new elevation of troponin and/or creatine kinase ( ck ) or ck - mb . bleeding was defined as intracranial bleeding or any other bleeding leading to hospitalization and/or red blood transfusion . bleeding and/or transfusion related with any type of surgery were excluded from the analysis . prior bleeding included any episode of serious bleeding previous to the qualifying acs hospitalization , and was defined as intracranial bleeding or any other bleeding leading to hospitalization and/or red blood transfusion . malignancy indicated any active cancer or any non - active cancer who was treated during the last five years . the measurements of serum creatinine were standardized according to the recommendations of the national kidney disease educational program and the european federation of clinical chemistry and laboratory medicine , to reduce inter - laboratory variation in creatinine assay calibration . complete revascularization indicated a final angiographic result without coronary stenosis 70% in left anterior descending , left circumflex , or right coronary arteries , or stenosis 50% in left main coronary artery . baseline characteristics are presented as percentages ( numbers ) for categorical variables and as means sd for continuous variables . categorical variables were compared by or fisher 's exact test and continuous variables by t test or mann - whitney test . patients were divided into four groups according to ppi use and use of clopidogrel or ticagrelor . cox proportional hazard models were used to analyze the effects of ppis versus no - ppis within each p2y12 receptor inhibitors ( clopidogrel or ticagrelor ) on clinical outcomes . hazard ratios ( hr ) and 95% confidence intervals ( 95% ci ) were calculated . to consolidate our findings , we carried out a propensity score adjusted cox model in which propensity score was included besides aforementioned factors . a logistic regression was used to estimate propensity score . in this logistic model , age , sex , diabetes mellitus , hypertension , peripheral arterial disease , history of cancer , serum creatinine at admission and hemoglobin at admission were included according to variables screening ( backward method ) or that were prespecified ( sex , diabetes mellitus and hemoglobin at admission ) . in order to further analyze the impact of concomitant use of ppi on composite primary end point cox model with or without propensity score adjustment was performed . since most subjects included in our study , whose records of ppi use ( or not ) are complete , have no missing data , we did not conduct an imputation . all p values were two - sided , and a p value of less than 0.05 was considered to indicate statistical significance . all analyses were performed using sas version 9.2 ( sas institute inc ; cary , nc ) statistical software . the details of the design and methods of the bleemacs registry have been previously described . in brief , the bleemacs registry is an international , multi - center , investigator - initiated , retrospective observational registry , and aims to explore the real world burden of long - term bleeding in acs patients . a total of 18,077 patients were enrolled from 16 centers in 11 countries : north america ( canada ) , south america ( brazil ) , europe ( germany , netherlands , poland , spain , italy , macedonia , greece ) , and asia ( japan and china ) . data from one center ( macedonia , n = 2676 ) were excluded from bleemacs registry because of high percentage of missing values . therefore , the final bleemacs database was constructed by merging the individual databases from the remaining 15 centers , making up a large cohort of 15,401 consecutive patients . patients were eligible if they were at least 18 years old and were discharged alive with a diagnosis of acs and treated with pci from 2003 to 2014 . patients using p2y12 receptor inhibitors ( clopidogrel or ticagrelor ) with or without ppis at discharge were included in the final cohort ( n = 9,429 ) . the institutional review boards or ethics committees of each center approved participation in bleemacs registry , and all patients gave written informed consent . this study was approved by the institutional ethical committee of beijing anzhen hospital , capital medical university ( no.2015009x ) . laboratory tests , index pci , and adjunctive therapy were also documented . at discharge , cardiovascular outcomes and bleeding data on cardiovascular and bleeding events were systematically obtained by telephone or face - to - face talk , and also reviewed by the medical records of the index events . the primary endpoint was a composite of all - cause death , re - infarction , or severe bleeding events . re - infarction was identified as ischemic symptoms ( or new electrocardiographic changes ) and new elevation of troponin and/or creatine kinase ( ck ) or ck - mb . bleeding was defined as intracranial bleeding or any other bleeding leading to hospitalization and/or red blood transfusion . bleeding and/or transfusion related with any type of surgery were excluded from the analysis . prior bleeding included any episode of serious bleeding previous to the qualifying acs hospitalization , and was defined as intracranial bleeding or any other bleeding leading to hospitalization and/or red blood transfusion . malignancy indicated any active cancer or any non - active cancer who was treated during the last five years . the measurements of serum creatinine were standardized according to the recommendations of the national kidney disease educational program and the european federation of clinical chemistry and laboratory medicine , to reduce inter - laboratory variation in creatinine assay calibration . complete revascularization indicated a final angiographic result without coronary stenosis 70% in left anterior descending , left circumflex , or right coronary arteries , or stenosis 50% in left main coronary artery . baseline characteristics are presented as percentages ( numbers ) for categorical variables and as means sd for continuous variables . categorical variables were compared by or fisher 's exact test and continuous variables by t test or mann - whitney test . patients were divided into four groups according to ppi use and use of clopidogrel or ticagrelor . cox proportional hazard models were used to analyze the effects of ppis versus no - ppis within each p2y12 receptor inhibitors ( clopidogrel or ticagrelor ) on clinical outcomes . hazard ratios ( hr ) and 95% confidence intervals ( 95% ci ) were calculated . to consolidate our findings , we carried out a propensity score adjusted cox model in which propensity score was included besides aforementioned factors . a logistic regression was used to estimate propensity score . in this logistic model , age , sex , diabetes mellitus , hypertension , peripheral arterial disease , history of cancer , serum creatinine at admission and hemoglobin at admission were included according to variables screening ( backward method ) or that were prespecified ( sex , diabetes mellitus and hemoglobin at admission ) . in order to further analyze the impact of concomitant use of ppi on composite primary end point since most subjects included in our study , whose records of ppi use ( or not ) are complete , have no missing data , we did not conduct an imputation . all p values were two - sided , and a p value of less than 0.05 was considered to indicate statistical significance . all analyses were performed using sas version 9.2 ( sas institute inc ; cary , nc ) statistical software . of the 15,401 patients enrolled in the bleemacs registry , patients with single antiplatelet therapy with aspirin ( n = 1245 ) , dapt with prasugrel ( n = 665 ) , oral anticoagulant ( oac ) plus aspirin ( n = 79 ) , oac ( n = 37 ) , and missing values of ppis use ( n = 3946 ) were excluded . finally , 9429 patients using p2y12 receptor inhibitors ( clopidogrel or ticagrelor ) with or without ppis at discharge were included in the final analysis . of these , 5165 patients ( 54.8% ) claimed at least one prescription for ppis at discharge . patients who were treated with a ppi were older , were more often female , and were more likely to have a history of hypertension , dyslipidemia , diabetes mellitus , peripheral arterial disease , myocardial infarction , chronic kidney disease , peptic ulcer , coronary artery bypass grafting , prior bleeding or malignancy ; were more likely to have an index diagnosis of unstable angina or non st elevation myocardial infarction and had higher rate of killip class 2 ; had lower baseline hemoglobin and higher baseline creatinine levels . moreover , the use of angiotensin converting enzyme inhibitors / angiotensin receptor blockers and statins were more common in patients with ppis . acs : acute coronary syndrome ; dapt : dual antiplatelet therapy ; oac : oral anticoagulants ; pci : percutaneous coronary intervention ; ppis : proton pump inhibitors . nine hundred and fourteen ( 9.7% ) adjudicated all - cause deaths , re - infarctions or bleedings events were registered . the rate of composite primary endpoint was significantly higher in patients on a ppi than those not on a ppi ( 10.9% vs. 8.3% ; unadjusted hr : 1.329 ; 95% ci : 1.1631.518 ) ( table 2 ) . however , using the propensity score generated from logistic regression models and adjusting for baseline covariates , there were no significant difference regarding the primary endpoints between patients with ppis and those without ppis ( adjusted hr : 1.044 ; 95% ci : 0.9121.196 ) ( table 2 ) . in addition , the use of ppis was associated with higher rate of re - infarction event ( 4.9% vs. 4.4% ; unadjusted hr : 0.960 ; 95% ci : 0.7891.168 ; adjusted hr : 0.808 ; 95% ci : 0.6620.987 ) , but was not associated with increased risk of all - cause death / re - infarction and all - cause death , or a decreased risk of bleeding ( table 2 ) . acei : angiotensin converting enzyme inhibitor ; arb : angiotensin receptor blocker ; cabg : coronary artery bypass grafting ; nstemi : non - st - segment elevation myocardial infarction ; stemi : st - segment elevation myocardial infarction ; pci : percutaneous coronary intervention ; ppis : proton pump inhibitors ; ptca : percutaneous transluminal coronary angioplasty . hr : hazard ratios ; ppis : proton pump inhibitors . for patients treated with clopidogrel , the rate of the composite primary endpoint was 11.1% for individuals on a ppi and 8.4% for those not on a ppi ( unadjusted hr : 1.331 ; 95% ci : 1.1611.524 ) . for patients treated with ticagrelor , the rate of the composite primary endpoint was 8.0% for individuals on a ppi and 3.6% for those not on a ppi ( unadjusted hr : 2.191 ; 95% ci : 0.8465.674 ) ( figure 2 , table 3 ) . after adjusting for potential confounders and the propensity to be on a ppi at discharge , no significant association remained between use of a ppi and the primary endpoint both for patients receiving clopidogrel ( adjusted hr : 1.036 ; 95% ci : 0.9031.189 ) and for those receiving ticagrelor ( adjusted hr : 2.320 ; 95% ci : 0.8756.151 ) ( interaction between p2y12 inhibitor treatment and ppi use , p = 0.2004 ) ( table 3 ) . similarly , use of a ppi was not associated with increased risk of all - cause death , re - infarction , or a decreased risk of bleeding for patients treated with either clopidogrel or ticagrelor ( table 3 ) . we also performed analyses in other seven subgroups and the results showed no significant association between ppis use and the composite primary endpoint , which were consistent with the main results . in these analyses , there were no significant interactions with baseline or procedural variables , including the use of drug - eluting stent ( figure 3 ) . in a large real world registry of patients with acs undergoing pci , concomitant use of ppi was not associated with increased risk of composite adverse clinical outcomes ( all - cause death , re - infarction , or severe bleeding ) in patients receiving either clopidogrel or ticagrelor . our results are consistent with findings from propensity - matched analysis or randomized trial that reported no associated risk of cardiovascular events in patients treated with ppis in combination with p2y12 receptor inhibitors . , current guidelines recommend use of ppis in combination with dapt in patients at higher than average risk of gastrointestinal bleeding . , , however , several pharmacokinetic and pharmacodynamics studies have indicated that ppis , especially omeprazole and esomeprazole , could blunt the antiplatelet effect of clopidogrel. conflicting data exist regarding use of ppis on cardiovascular events in patients treated with clopidogrel . most of observational studies showed ppis increased risk of adverse events when co - administrated with clopidogrel., in the subgroup analysis of plato trial , the use of ppis was also associated with increased rate of cardiovascular events or even major bleeding in the clopidogrel group . it can be speculated that ppis use is likely a marker for higher risk of cardiovascular events . , in our study , patients who were treated with ppis were older and had more comorbidities , thus indicating a cluster of patients with high risk of ischemic and bleeding events . ckd : chronic kidney disease ; nste - acs : non - st - segment elevation acute coronary syndrome ; ppis : proton pump inhibitiors ; stemi : st - segment elevation myocardial infarction . after adjusting for potential confounders and the propensity to be treated with a ppi , our study demonstrated that concomitant use of ppis and clopidogrel was not associated with a greater risk of net adverse clinical events . these results confirm and extend the findings of triton - timi 38 , , which showed no associated risk with clopidogrel and ppis use . the only clinical trial cogent also failed to demonstrate a clinically significant cardiovascular interaction between clopidogrel and omeprazole . therefore , despite the observed attenuation of in vitro anti - platelet effects of p2y12 receptor inhibitors in patients treated with a ppi , it may not have significant effect on clinical outcomes . in contrast to clopidogrel , ticagrelor is a direct - acting p2y12 receptor inhibitor that does not require biotransformation and has no potential interaction with ppis . yet , limited studies evaluated the impact of ppis use on clinical benefit of ticagrelor . in the prespecified analysis of plato trial , ticagrelor in combination with a ppi this finding was similar to that observed with clopidogrel and ppi use . in the present study , despite the observed tendency of higher risk of adverse events in the ticagrelor group when co - administrated with a ppi , the impact on clinical outcomes was non - significant after adjusting for potential confounders . to date , there is no pharmacologic or clinical evidence to support the interaction between ticagrelor and ppis . therefore , in the context of current guidelines , which recommend use of ticagrelor as first choice in acs patients , concomitant use of a ppi is reasonable when the patients were at high risk of gastrointestinal bleeding . first , as with other retrospective study , confoundings by unknown / unmeasured factors could not be entirely excluded . however , the components of the primary endpoint , including all - cause death , re - infarction , and bleeding , are hard endpoints and less subject to observation bias . second , the use of a ppi was not randomized and depended on the decision of the treating physicians . despite multivariable adjustment and propensity score matching for the ppi use , unobserved differences may still exist , which may lead to residual selection bias . however , this study enrolled consecutive patients from a retrospective , multi - center , observational registry , which may have less inclusion bias . third , this study did not show an increased risk of primary endpoint in patients treated with concomitant ticagrelor and ppi , although there was a tendency toward a higher risk compared with no - ppi group . the small sample size and low incidence of all - cause death , re - infarction , and bleeding events in the ticagrelor subgroup may affect the power to detect such difference . forth , although standard definitions were provided for the primary endpoints , events ( including type of death ) were not systematically validated or centrally adjudicated . finally , in most cases the follow - up information was based upon patient self - report and this could likely lead to under- and over - estimates of medical therapy , procedures , and events . in conclusion , in a real world registry of patients with acs following pci , the use of ppis in combination with clopidogrel was not associated with increased rate of adverse outcomes . moreover , no association was observed between ppi use and adverse events in patients receiving ticagrelor . therefore , in the context of current acs guidelines with p2y12 receptor inhibitors as first - line therapy , concomitant use of ppis is reasonable , especially in patients with a higher risk for gastrointestinal bleeding . our study has several limitations . first , as with other retrospective study , confoundings by unknown / unmeasured factors could not be entirely excluded . however , the components of the primary endpoint , including all - cause death , re - infarction , and bleeding , are hard endpoints and less subject to observation bias . second , the use of a ppi was not randomized and depended on the decision of the treating physicians . despite multivariable adjustment and propensity score matching for the ppi use , unobserved differences may still exist , which may lead to residual selection bias . however , this study enrolled consecutive patients from a retrospective , multi - center , observational registry , which may have less inclusion bias . third , this study did not show an increased risk of primary endpoint in patients treated with concomitant ticagrelor and ppi , although there was a tendency toward a higher risk compared with no - ppi group . the small sample size and low incidence of all - cause death , re - infarction , and bleeding events in the ticagrelor subgroup may affect the power to detect such difference . forth , although standard definitions were provided for the primary endpoints , events ( including type of death ) were not systematically validated or centrally adjudicated . finally , in most cases the follow - up information was based upon patient self - report and this could likely lead to under- and over - estimates of medical therapy , procedures , and events . in conclusion , in a real world registry of patients with acs following pci , the use of ppis in combination with clopidogrel was not associated with increased rate of adverse outcomes . moreover , therefore , in the context of current acs guidelines with p2y12 receptor inhibitors as first - line therapy , concomitant use of ppis is reasonable , especially in patients with a higher risk for gastrointestinal bleeding .
backgroundthere is great debate on the possible adverse interaction between proton pump inhibitors ( ppis ) and clopidogrel . in addition , whether the use of ppis affects the clinical efficacy of ticagrelor remains less known . we aimed to determine the impact of concomitant administration of ppis and clopidogrel or ticagrelor on clinical outcomes in patients with acute coronary syndrome ( acs ) after percutaneous coronary intervention ( pci).methodswe retrospectively analyzed data from a real world , international , multi - center registry between 2003 and 2014 ( n = 15,401 ) and assessed the impact of concomitant administration of ppis and clopidogrel or ticagrelor on 1-year composite primary endpoint ( all - cause death , re - infarction , or severe bleeding ) in patients with acs after pci.resultsof 9429 patients in the final cohort , 54.8% ( n = 5165 ) was prescribed a ppi at discharge . patients receiving a ppi were older , more often female , and were more likely to have comorbidities . no association was observed between ppi use and the primary endpoint for patients receiving clopidogrel ( adjusted hr : 1.036 ; 95% ci : 0.9031.189 ) or ticagrelor ( adjusted hr : 2.320 ; 95% ci : 0.8756.151 ) ( pinteraction = 0.2004 ) . similarly , use of a ppi was not associated with increased risk of all - cause death , re - infarction , or a decreased risk of severe bleeding for patients treated with either clopidogrel or ticagrelor.conclusionsin patients with acs following pci , concomitant use of ppis was not associated with increased risk of adverse outcomes in patients receiving either clopidogrel or ticagrelor . our findings indicate it is reasonable to use a ppi in combination with clopidogrel or ticagrelor , especially in patients with a higher risk of gastrointestinal bleeding .
data , clinical data in particular , is essential to create clinically relevant information in healthcare for treatment s diagnosis and prognosis besides other concerns , such as the information of potential conflicting treatments or contraindication drugs . as technology advances , new ways of acquiring and processing clinical data are emerging to better enable patient care . pervasive healthcare , for example , uses information and communication technology ( ict ) , to obtain clinical data from remotely monitored ambulatory patients and it often employs automated clinical decision support systems ( cdss ) to process the data at the point of care . this way the patient is more closely treated , while financial and human resource requirements are lowered . however , the cdss needs to deal with uncertainties in order to provide safe and efficient care to the patient . the sources of uncertainty are diverse : from patients who can not describe their situation to laboratories that report erroneous clinical data . the quality of the clinical data ( qod ) contributes to the decisions uncertainty . in case the clinical data quality is unknown , the clinical decisions can be done based on the assumption that the clinical data fulfils the medical requirements , resulting in a certain but erroneous decision . in the traditional medical practice , in intramural settings ( such as a hospital ) , medical domain experts usually trust the clinical data used for their decision making process since they study and evaluate the data before using it in their decision making process . in case they determine that the data is suspicious ( e.g. , erroneous , noisy or out of date ) , they perform additional measurements or make use of complementary data . nevertheless , in some cases the medical domain experts store erroneous or incomplete data in medical registries or laboratory report results may contain errors , . furthermore , performance issues regarding ict - based technological resources ( e.g. , weak internet signal or low device battery ) might cause qod degradation , . qod - unawareness can thus lead to risky treatment guidance , particularly in extramural settings where the ambulant outpatient is guided by an automated cdss , and where the cdss makes use of ict - based clinical data . moreover , in the extramural settings , there are no quality controls from hospitals or medical domain experts . accordingly , nobody supervises the data at the point of care , which further increases the possibility of unnoticed quality problems . this paper , therefore , addresses the problem of qod degradation in extramural settings for pervasive healthcare . in order to develop a telemedicine system resilient to technological disruptions we need to build a qod - framework that defines the relation between clinical treatments and technological context characterized by the performance of ict - based technological resources . this ontological characterization of the clinical and technological relation provides a formal way to represent the knowledge , which is to be used by the qod - aware telemedicine system . the developed ontology is the output of a refined requirements elicitation ( re ) method supported with a layering technique . the following section summarizes the re method and layering technique to build a qod - framework for telemedicine systems . section iv presents the application of the qod - framework in a telemedicine study and its results . finally , section v discusses the potential impact of the presented methodology for telemedicine systems and future work directions . quality of data ( qod ) is addressed in several healthcare studies , . there are several ways of addressing qod in healthcare . the qod is one of the uncertainties that healthcare must study in order to provide best treatment to the patients . grade considers the necessity to involve quality of evidence ( qoe ) and strength of recommendation ( sor ) in clinical guidelines in order to guarantee best evidence - based care to patients . other studies focus on how to determine the quality of data stored in medical databases , such as for electronic health records , and its impact on healthcare , . additionally , the impact of the performance of technological resources on clinical data quality or in the treatment is studied in , , and . telemedicine systems often aim to provide treatment guidance to ambulatory outpatients in extramural settings for pervasive healthcare . these systems are data - driven and their guidance at the point of care is mainly based on the monitored clinical data by using body area networks ( ban ) , which consist of sensors , actuators , communication and processing facilities that are connected via a wireless network , and personal medical devices , such as blood pressure ( bp ) monitors or heart rate ( hr ) sensors . therefore , the quality of this data also has a significant effect on the guidance and its degradation may negatively affect the treatment , putting the patient s safety at risk . in order to prevent such a treatment risk increment by erroneous treatment guidance , we present a method to build a qod - framework for these telemedicine systems to make them qod - aware . some of the factors are related to the performance of the technology used to obtain the data ( i.e. , internal factors ) , and other factors are related to the usage of the technological resources by the user ( i.e. , external factors ) . firstly , we study performance properties , i.e. , quality of service ( qos ) of technological resources . in this paper , qos of technological resources is described by a set of resource qualifying parameters ( rqp ) . since the quality of the data that is provided by a technological resource will depend on the qos of this resource , rpqs for example , the mobile internet coverage , the robustness against noise , or the battery capacity of a specific technological resource may influence the clinical data quality used for the treatment . furthermore , other factors , such as environmental circumstances also contribute to the technological resources performance and they are modeled as rqps . for example , the temperature of the place where the measurement is done may influence the performance of a device , or a rainy weather can alter the internet connectivity to transmit the data causing data transmission delays or data loss , which characterize the quality of the clinical data . secondly , we also study the usage of technological resources ( by the user ) since its usage has an influence on the quality of the clinical data . patient education is one of these characteristics that influence the proper usage of a device . for example , bp must be measured sitting and in a relaxed condition to provide an accurate bp measurement . if the patient is not educated to make the measurement correctly and stands up , the qod of bp degrades and the bp value may not be clinically valid . some patients for example , perform measurements at their convenience in order to obtain the clinical data values that they are content with . besides , when the data is input manually , potential typing errors might occur . therefore , the trustworthiness value ( used to compute qod ) for manual input is set medium whereas for automatic device input it is set to high . additionally , the system checks if the value is within range given by the bp monitor manufacturer to prevent accidental typing errors ( e.g. , 1000 instead of 100 ) and determine the final qod . therefore , in the ontology presented in section iii , we model these user characteristics as rqps of , for example , manual input device , which can be categorized under a sensing or a processing component . all these characteristics or rqps comprise what we call technological context , defined as technical information provided by a collection of technological resources that characterizes patient s treatment , . we focus on the impact of technological context on the qod and the impact of qod on the treatment in order to build a qod - aware telemedicine system . to achieve such a system , we develop an ontology that represents the relation between clinical data at the technological level and clinical data at the clinical decision making level . this ontology is the result of applying a refined re method and the layering technique from , which is summarized here . to acquire requirements of the envisioned qod - aware telemedicine system we adopt the role of requirement engineers and apply the ipact - fics re method , , this method has been applied in several healthcare projects , since it was easily understood by medical domain experts and produced successful results . here , we summarize the ipact - fics re method as follows . ipact describes the intention of the envisioned system s usage ( e.g. , supporting out - patients treatment guidance ) by people who directly interact with this system ( e.g. , patient ) and their treatment related activities ( e.g. , walking physical exercise ) in a particular context ( e.g. , outdoors exercise activity ) supported by technology , which is the envisioned system ( e.g. , a mobile patient guidance system ) . this ipact analysis is used to build a medical scenario from a user perspective ; i.e. , the thread of main activities for the patient treatment prescribed by the medical practitioner using the envisioned system . fics stands for functionality of the intended telemedicine system , user - system interactions , content of these interactions , and the intended system s services which are constituted by the interactions . the fics analysis is concluded with an augmented ipact scenario , which describes the people - envisioned system interactions . the ipact - fics scenario is finalized after approval from medical domain experts . in order to study the influence of the technological context on the treatment and incorporate adaptation mechanisms in the system , this re method is applied as follows . in the first ipact - fics iteration the envisioned technology is a telemedicine system assumed to perform without disruptions ( i.e. , ideal case ) and the context has no influence on the system performance . in the second iteration we focus on the technological resources disruptions ( i.e. , non - ideal case ) , which leads to a new technological \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { c}$ \end{document } ontext ( ipa\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { c}\text{t}$ \end{document } ) , and their impact on patient treatment . now we introduce a telemedicine system , which is qod - aware as the selected technology ( ipac\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { t}$ \end{document } ) . additionally , we make medical domain experts aware about the potential technological disruptions that can occur . next , these medical domain experts determine how to adapt patient treatment activities ( ip\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { a}$ \end{document}ct ) , by taking precautionary actions to ensure patients safety and system efficacy . therefore , this results in a new ipact-fics , where the intention of the envisioned system and the people involved in the scenario remain the same . medical practitioners considered the requirements presented in this new ipact-fics scenario as a guarantee of patient safety . , the context corresponds to the treatment activities and the patient where no possible technological disruptions occur . accordingly , the envisioned system and the treatment activities are not affected . however , in the non - ideal case , the context also involves the technological context variations . consequently , this new ( technological ) context leads to a new technology which needs to be qod - aware and further leads to new treatment activities that must guarantee patients safety . for example , for both cases , the intention ( ipact ) can be to support out - patient s physical exercise treatment guidance and the people ( ipact ) can be a cardiac out - patient . in the ideal case , the activity is to perform physical exercise in an outdoors context with the support of the envisioned telemedicine system technology . in contrast , in the non - ideal case , the context is an outdoors exercise with degraded quality of the data caused by data communication disruptions . consequently , the envisioned system is a qod - aware telemedicine system technology , which provides treatment adaptation mechanisms , so that the physical exercise activity is modified by informing the patient to slow down or stop the physical exercise treatment . as presented in , the re method refinement to design technological context and qod - aware telemedicine systems focuses on the detailed specification of the ipact context analysis . this makes the technological context an explicit part of the medical activities context that triggers an additional re cycle , i.e. , ipact-fics. as a result , the intended telemedicine system is qod - aware , set for technological disruptions . the layering technique , described in , defines the functional ( i.e. , conceptual ) relation and non - functional ( i.e. , qualitative ) relation between clinical layer and technological layer of a telemedicine system . the functional relation refers to the direct dependency between the data being used in the clinical layer and technological layer . as presented in , the clinical layer comprises clinical abstractions , which are high - level medical concepts ( events ) obtained typically from temporal patterns of elementary clinical variables . the elementary clinical variables ( e.g. , bp , hr ) are the concepts of clinical data that require additional patient and treatment context information to become a meaningful clinical information , i.e. , clinical abstractions . the clinical abstractions are used by the clinical decision making agents ( e.g. , medical practitioners or cdss ) to treat patients . hence , the clinical abstraction is the data in the clinical layer that can trigger clinical recommendation from the cdss for the treatment guidance . an example of a clinical abstraction is the over - exertion of a patient during physical exercise , defined as the event when monitored heart rate ( hr ) is above the recommended target hr range for more than 30 seconds . as a result the decision making agent , such as the cdss , may send a clinical recommendation to the patient to slow down . the technological layer comprises technological variables , which are unprocessed raw data handled by technological resources that do not apply or require any clinical interpretation . technological resources measure data at point of monitoring , ( pre)process and transfer these technological variables . for example , a sensor monitors the electrode signal technological variable , which is processed and transported by other technological resources . at the point of decision , where the cdss is executed , technological variables are interpreted as clinical variables , usually represented by patient s vital signs , like the hr . complementary to the functional relation is the non - functional relation between qod of clinical abstraction , clinical variables and technological variables . being qod vulnerable to technological disruptions , as seen in , the technological context plays a significant role in this non - functional relation . in the first phase of this non - functional relation of the data , the technological context is compliant with the medical requirements ( i.e. , ideal case ) . this means that the qos of the technological resources fulfil the requirements to provide high quality data . thus , the qos of the relevant technological resources is specified in this phase , so that the qod of technological variables , and as a consequence the qod of clinical variables and clinical abstractions , fulfil the clinical quality requirements . in the second phase ( i.e. , non - ideal case ) , the potential technological disruptions that alter the technological context and their effects on the qod are studied . thus , the qos of the technological resources affects the qod of the technological variables in the technical layer . this has an effect on the qod of clinical variables and ultimately on the qod of clinical abstractions used for the treatment in the clinical layer . in order to ensure the patient s safety and maintain treatment s efficacy , the applied re method refinement and the layering technique results in an ontology , which we refer to as the qod - framework ontology . this ontology captures the necessary knowledge for qod - aware telemedicine systems that aim at preventing the risk of treatment increment when the technological context varies . as described by paganelli and giuli , ontologies may help in : 1 ) specifying contextual knowledge in terms of classes of objects , relationships , and constraints on their properties ; 2 ) describing contexts semantically in a way which is independent of programming languages , underlying operating systems , or middleware ; 3 ) enabling formal analysis of domain knowledge , i.e. , context reasoning using first - order logic , or temporal logic ; 4 ) deriving fresh knowledge and facts through reasoning on context data by using inference engines ; and 5 ) enabling knowledge reuse , as ontologies of different domains can be composed and extended with new concepts in order to produce new ontologies without starting from scratch . there are existing ontologies that represent the context for smart home applications and healthcare . in , paganelli and giuli presents a personal context ontology for a specific home care application that supports patients in the context entities include persons ( e.g. , patient , medical practitioner ) and locations ( e.g. , patient s home and care center ) ; and the related context items include information on the patient s biomedical parameters ( e.g. , vital signs ) and home living environment ( e.g. , temperature ) . alert situations are attributed to the patient s clinical status ( e.g. , heart rate out of range ) or external environmental situations ( e.g. , temperature out of range ) . other studies address qod related ontologies , which describe the qod dimensions that represent different aspects of qod . moreover , in recent years ontologies have been often used to represent clinical guidelines , . the usage of clinical guidelines in information systems , such as cdss , has contributed to this ontology application . the formalization of the guideline in an ontology supports the implementation of a computer interpretable guideline ( cig ) , applied in guideline - based cdss ( section iv . we target an ontology that captures the relations between the following three concepts technological context , quality of clinical data , and patient treatment in order to represent the knowledge for a qod - aware telemedicine system . however , most of the studied ontologies address either clinical guidelines , quality of data , or personal ( user ) context . the qod - framework ontology has been specified with the web ontology language ( owl ) . in fig . 1 , the owl ontology is represented by means of unified modeling language ( uml ) class diagrams . uml classes represent owl classes , uml class attributes represent owl datatype properties , and uml associations among classes are used for representing owl object properties . the qod - framework ontology is designed to formalize the relation between the technological context and the clinical context and support the delivery of specific guidance based on the technological context . additionally , the qod - framework ontology was validated and used by medical practitioners to understand and formalize these relations . the qod - framework is based on the layering technique and it consists of two parts : a ) the technical domain ontology , which captures the knowledge on the technological layer , including the relation between the technological context and the qod relevant to clinical variables ; and b ) the clinical domain ontology , which captures the knowledge on the clinical layer , including the relation between the qod relevant to clinical variables and the patient treatment . as described before , the ict - based technological resources make it possible to obtain clinical data from remotely monitored ambulatory patients . on the other hand , additionally , the technological context , which comprises technological resources , provides clinical variables with qod related information . the performance of each technological resource , determined by resource qualifying parameters ( rqp ) , corresponds to the quality of service ( qos ) of each technological resource . the static rqps are usually given by the technological resource manufacturer and represent the constant properties of the device . for example , the bioharness sensor manufacturer provides the specification of the sensor , such as the sample frequency of the general log data ( e.g. , 1hz ) . for example , the battery level of the bioharness sensor at a particular moment in time . the rqps have a name , type ( static or dynamic ) , a maximum and minimum value ( usually for static rqps ) , a unit and a value ( see fig . 1 and table 2).table 1.example of the technological context.classindividualtechnological contextresource perform failure type 2technological resourcesubclasssensingbh sensorprocessingbh processorcommunicationbluetoothtable 2.example of individuals of technological resources.classindividualsrqp ( bh sensor)- rqp_name : bh_sensor_battery , rqp_type : dynamic , max:100 , min:0 , unit:% , value:5- rqp_name : bh_sensor_snr , rqp_type : dynamic , max:30 , min:30 , unit : db , value:0rqp ( bh processor)- rqp_name : bh_processor_battery , rqp_type : dynamic , max:100 , min:0 , unit:% , value:86rqp ( bluetooth)- rqp_name : bluetooth_range , rqp_type : static , max:10 , min:0 , unit : meter , value:-- rqp_name : bluetooth_range_value , rqp_type : static , max:10 , min:0 , unit : meter , value:5 the rpqs of the technological resources , which are given in a specific technological context , are associated with one or more qod dimensions of the provided clinical variables , . 1 shows that the qod of the clinical variable uses rqps for its qod dimensions computation . to select the required qod dimensions , we first did a literature survey , , , , where we came up with potential relevant quality dimensions for the applied study . secondly , we conducted discussions with the medical practitioners of the mobiguide project to ascertain the qod dimensions that needed consideration . , it was agreed to adopt the following five qod dimensions : accuracy , timeliness , dependability , cost , and quality of evidence . these qod dimensions also cover other similar quality dimensions ( e.g. , delay under timeliness ) , which may be applicable in other studies and do not overwhelm the system or medical practitioners with additional qod information . by using the rqps in the computational models presented in , high , medium , low , or very low by using the stratification model described in . these grades , commonly used in the medical practice and identified by grade healthcare working group , were also easily understood and validated by the medical practitioners involved in the study . the stratification model is treatment context specific , and therefore , the medical practitioner is the one in charge of determining the scalar value ranges that correspond to each quality grade . for example , the scalar value ( e.g. , 85% ) of a computed dependability qod dimension is based , among others , on the hr sensor battery level ( e.g. , 50% ) , which might have different interpretations depending on the treatment context . in a treatment context that consists of an outdoors 1 hour duration physical exercise , where the mobile hr sensor needs to have a battery level higher than 49% , this dependability qod dimension scalar value of 85% is mapped to high quality grade . in contrast , in a 24 hours monitoring treatment , the dependability of 85% corresponds to medium quality grade since the mobile hr sensor needs to have a higher battery level to provide the hr data for the 24 hour monitoring treatment . the overall qod is based on the five qod dimensions and it is used to obtain an easier qod interpretation . the technological context can vary not only due to the performance variation of the technological resources , but also due to the specific technological resources used . in certain scenarios , it is possible to choose between alternative technological resources in the complete technological resource configuration chain . these alternative resources ( e.g. , wi - fi or 4 g connection for data communication ) have the same functionalities , but different rqp characteristics . therefore , depending on the chosen technological resource , the rqps ( e.g. , subscription cost , transmission delay , and trustworthiness ) will differ and consequently , we will have a different technological context that provides the same data but potentially with qod grade variations . we address ict - based technological resources that influence qod from the technological context point of view , since the focus of the paper is the impact of technological context on qod . hence , we exclude other technological resources that may deal with other issues , such as technological resources integration and security . accordingly , this study classifies the technological resources into three high - level categories : sensing components , processing components and communication components . sensing components comprise of a comprehensive set of sensors and data acquisition devices , which provide all relevant raw physiological measurements of the patient ( e.g. , electrocardiogram signals ) . an instance ( individual ) of a sensing component can be the bioharness 3 sensor device which provides rqps , such as the battery level and noise related information ( see table 2 ) . processing components comprise of algorithms or processes that can analyze and interpret the sensed raw data . first , it acquires an electrocardiogram signal and detects , for example , the r peaks of the electrocardiogram , which are higher level clinical data abstractions . this bh processor can have rqps , such as robustness against noise , determined by sensitivity and specificity . communication components are composed of wire and wireless components that enable data transmission between the set of sensing and processing components from the point of monitoring to the point of decision . the wireless communication involves , for instance , bluetooth , wi - fi and 4 g , and wire communication involves fiber - optic communication among others . rqps that may characterize the performance of the communication components are the data transmission cost , bandwidth and availability . in the following tables ( table 1 , table 2 , table 3 and table 4 ) , we present a simplified example of a use case study used in the qod - aware system development . table 1 presents an example of a technological context , which comprises three technological resources , table 2 provides the rqps of each of these technological resources and table 3 lists the provided clinical variable and its associated qod.table 3.example of the qod of the clinical variable.classdatatypeindividualclinical variablenameheart_ratecontentvalue85unitbpmqodaccuracylowtimelinesshighdependabilityvery lowcostlowqoevidencehighoverallqodlowtable 4.example of the treatment adaptation.classindividualtreatmentthrmax = 0.6 hrmaxthrmin = 0.5 hrmaxtreatment delay : 1 hour table 2 contains the rqp individuals of each technological resource presented in table 1 , which characterize the performance of the technological resources , and consequently the technological context . the rqp individuals of table 2 are specified by the rpq datatype properties ( name , type , a maximum and minimum value , a unit and the value ) . table 3 presents the heart rate clinical variable and its associated qod grades of the five qod dimensions and the overall qod . in the upper part of fig . 1 , we present the clinical domain ontology , which corresponds to the treatment adaptation knowledge acquired during the re method ( section ii . the clinical domain ontology shows that a patient receives a treatment , and has one medical practitioner , who provides the treatment . the treatment class has a context , i.e. , treatment context , which makes use of clinical variables to conduct the treatment . the qod of the clinical variables characterize the treatment context , and consequently it has an impact on the treatment activities , which are adapted based on the medical requirements ( see section ii ) . adding to the previous example , on the one hand , the clinical variable has certain quality grades ( table 3 ) , which are based on a specific technological context . on the other hand , the treatment ( e.g. , a physical exercise treatment ) is provided by a medical practitioner ( e.g. , peter the cardiologist ) to a patient ( e.g. , cardiac patient john ) . in a treatment context that consists of an unsupervised outdoor physical exercise with degraded qod of the hr clinical variable ( table 3 ) , the telemedicine system that supports john needs to adapt the treatment according to this clinical variable qod degradation . therefore , the clinical domain ontology , which is the clinical knowledge used by the system , specifies the treatment adaptation mechanisms caused by degraded qod defined during the re method . table 4 presents some of the potential treatment adaptations that are described in the ontology , which are triggered when the treatment context uses the hr clinical data with qod grades of table 3 in an unsupervised outdoors physical exercise treatment . for example , target heart rate parameters ( thrmax , thrmin ) , which are the clinical abstractions used to determine the intensity level of the prescribed physical exercise treatment based on a measured patient maximum hr ( hrmax ) , are lowered ( table 4 ) . consequently , the qod - aware system ensures that the patient will not be recommended to perform a strenuous exercise due to the unreliable hr measurement . besides , due to a very low grade of dependability qod dimension , the treatment is being request to be delayed for 1 hour ( table 4 ) . mg aims to develop qod and context - aware evidence - based cdss for guiding mobile patients during their treatments ubiquitously . hence , one of the challenges addressed in this paper is to develop a qod and context - aware telemedicine system to adapt the treatment according the patients technological context . as discussed before , the technological context characterizes the quality of the clinical data used by the system to guide the patient during his / her treatment activities . in order to design and develop a qod - aware telemedicine system we require two main components : ( 1 ) qos broker , which is a component that translates the technological context information into qod , and ( 2 ) cdss , which is a component that uses potentially relevant information , such as the clinical data and its quality , to guide patients during their treatment ( fig . 2 ) . the qod - framework ontology represents the knowledge required by the qod broker schemas and cdss schemas in order to provide the we made extensions or modification to the ontology whenever inconsistencies between the current ontology and information from the medical practitioners were found . additionally , this ontology was used in the mg prototype , resulting in several instances of the qod - framework ontology . figure 2.high level design of the qod - aware telemedicine system with qod - framework knowledge ontology formalized in the ccc and qod manifesto . high level design of the qod - aware telemedicine system with qod - framework knowledge ontology formalized in the ccc and qod manifesto . the presented ontology in section iii represents the qod broker knowledge schema and the cdss knowledge schema ( fig . qod broker , which is the mg telemedicine system component in charge of translating technological context information into qod , computes the qod of clinical variables based on the acquired technological resources specific performance information ( i.e. , rqps ) , and by applying computational models described in . the knowledge used by qod broker is specified in a so - called generic qod manifesto , xlm file , which contains the technical domain ontology described in section iii , a. depending on the treatment , qod broker will run the specific treatment qod manifesto , so that the computation of qod corresponds to the specific treatment requirements . the computed qod information is sent to the mg cdss , so that the cdss can process the qod together with the clinical data in order to provide qod - aware treatment support ( fig . 2 ) . the mg cdss uses evidence based clinical guidelines to provide the best treatment guidance to the patient . , these guideline - based cdss need to create a computer interpretable representation of the clinical knowledge contained in the guidelines , i.e. , a computer interpretable guideline ( cig ) . the presented clinical domain ontology ( section iii.b ) is merged with the original guideline , therefore augmenting the cig with technological context . this results in a context customized cig ( ccc ) , which has been developed in asbru cig modeling language . as a result , 2 ) , and the output of the cdsss will be a safe qod - aware treatment guidance induced by the technological context in terms of the qod and the clinical data . the guidance ( usually implemented in terms of clinical recommendations ) will be adapted when necessary to the qod to ensure patient s treatment safety ( see table 4 ) . this paper describes the effects that technological resources disruptions have on the clinical data quality ( qod ) and the potential impact of this qod degradation on patient treatment . as discussed in the paper , pervasive healthcare often deals with uncertainties , namely the quality of the clinical data used to treat patients . best quality care to patients , even when qod does not fulfil the medical requirements due to undesirable technical disruptions that modify the technological context . in telemedicine systems that support ubiquitous ( unsupervised ) patients guidance therefore , an unreliable ( i.e. , low qod ) clinical data can lead to an erroneous treatment guidance , potentially putting the patient at risk . to formalize this knowledge and develop a qod - aware telemedicine system resilient to technological disruptions , we present a qod - framework ontology . this ontology is the result of applying a re method together with the layering technique described in section ii . qod - framework ontology covers both the technological domain knowledge to translate technological context into qod and the clinical domain knowledge to interpret the qod into a treatment . this separation of concerns is necessary since medical practitioners are not used to specific technical information and clinical guideline should not be polluted with technological information . besides , the chosen approach makes it possible to discuss technological context issues in terms of qod with medical practitioners , who understand this quality concept . as a result , the ontology has been validated in a participatory design fashion involving the medical practitioners of the mg project . the medical practitioners defined the adaptation mechanisms needed to guarantee patient s safety for all instances addressed in the applied ontology . this was conducted via semi - structured interviews carried out by requirement engineers with medical practitioners , who systematically derived the requirements in an iterative process for completeness and requirements confirmation . additionally , this study will be further validated through independent trials in order to obtain empirical evidence . furthermore , the qod - framework ontology locates the clinical domain ontology in the cdss knowledge based ccc and the technical domain ontology in the qod broker knowledge based qod manifesto , avoiding the clinical guideline being polluted . 1 ) . we present a simple use case where a particular technological context characterized by the performance of technological resources leads to a clinical variable quality that affects the treatment ( section iii ) . the use case also illustrates how the technical domain ontology can be stored in a software agent that outputs qod and also shows how the clinical domain ontology can be stored in a different software agent that uses qod and other relevant clinical information ( e.g. , clinical data ) to provide patient treatment guidance ( section iv ) . this separation of concern makes it possible to include , on the one hand , additional technological resources information into the qod manifesto without the necessity of modifying the ccc and , on the other hand , augment the ccc without modifying the qod manifesto . in this paper nevertheless , in future works , we plan to extend this ontology with qod optimization mechanisms , such as the method provided by widya et al . or with simpler strategies ( e.g. , send technological recommendations to the patient in order to improve the performance of the system , and hence , the qod ) . furthermore , the overall qod computation and potential qod management requirements will be detailed in future work . we have shown that the proposed qod - framework ontology for developing a qod - aware telemedicine system is feasible and validated by domain experts . our vision of the future is a whole qod - aware healthcare system , where medical experts and telemedicine systems not only make use of the clinical data , but also its associated qod , since quality of the clinical data may have a major effect on patient treatment . therefore , our qod - framework ontology represents knowledge of a qod - aware telemedicine system that can be used to support development of future pervasive healthcare applications that are resilient to technological resources disruptions .
clinical data are crucial for any medical case to study and understand a patient s condition and to give the patient the best possible treatment . pervasive healthcare systems apply information and communication technology to enable the usage of ubiquitous clinical data by authorized medical persons . however , quality of clinical data in these applications is , to a large extent , determined by the technological context of the patient . a technological context is characterized by potential technological disruptions that affect optimal functioning of technological resources . the clinical data based on input from these technological resources can therefore have quality degradations . if these degradations are not noticed , the use of this clinical data can lead to wrong treatment decisions , which potentially puts the patient s safety at risk . this paper presents an ontology that specifies the relation among technological context , quality of clinical data , and patient treatment . the presented ontology provides a formal way to represent the knowledge to specify the effect of technological context variations in the clinical data quality and the impact of the clinical data quality on a patient s treatment . accordingly , this ontology is the foundation for a quality of data framework that enables the development of telemedicine systems that are capable of adapting the treatment when the quality of the clinical data degrades , and thus guaranteeing patients safety even when technological context varies .
a 52-year - old male had been treated for chronic renal failure and had been on continuous ambulatory peritoneal dialysis for 9 years . abdominopelvic computed tomography ( ct ) revealed a round mass in the lower pole of the left kidney and marked hydronephroureter with cortical thinning of bilateral kidneys ( fig . chest ct showed segmental consolidation with surrounding ground glass opacity in the right upper lobe , suggesting pulmonary tuberculosis . grossly , a well - circumscribed , round , solid mass measuring 2.52.01.5 cm was found at the lower pole of the left kidney . microscopically , most of the mass was composed of solid and thin tubules of eosinophilic oncocytic cells mixed with mature fat ( fig . the polygonal - shaped tumor cells had abundant eosinophilic granular cytoplasm and round nuclei with prominent nucleoli ( fig . the tumor demonstrated only focal large papillary fronds that contained delicate fibrovascular cores ( fig . 2e , right ) . occasionally , the oncocytic cells had mallory body like eosinophilic cytoplasmic hyaline globules ( fig . immunohistochemically , both the oncocytic and clear cells were diffusely strongly positive for vimentin ( prediluted , v9 , dako , glostrup , denmark ) , pancytokeratin ( prediluted , ae1/ae3 , dako ) , and -methylacyl - coa racemase ( amacr ; 1:50 , epum1 , novocastra , new castle upon tyne , uk ) . some of the oncocytic cells were weakly positive for cd10 ( 1:100 , 56c6 , dako ) . the tumor cells were negative for epithelial membrane antigen ( prediluted , e29 , dako ) , cytokeratin 7 ( ck7 ; 1:100 , ov - tl , dako ) , moc31 ( moc31 ; 1:70 , novocastra ) , e - cadherin ( 1:50 , 36b5 , dako ) , carcinoembryonic antigen ( prediluted , dako ) , progesterone receptor ( 1:50 , pgr636 , dako ) , cd15 ( 1:50 , c3d-1 , dako ) , human melanoma black 45 ( hmb-45 ; prediluted , dako ) , transcription factor e3 ( 1:50 , mrq-37 , cell marque corporation , rocklin , ca , usa ) , and c - kit ( 1:30 , t595 , novocastra ) . these cells were also negative for hale s colloidal iron and periodic acid schiff ( pas ) staining . mallory body like eosinophilic hyaline globules were stained with pas and diastase - resistant ( fig . 2f , right ) , and they were slightly positive for cam 5.2 ( prediluted , bd bioscience , san diego , ca , usa ) and negative for -fetoprotein ( prediluted , dako ) . surrounding parenchyma as well as renal pelvis and ureter showed chronic granulomatous inflammation with caseation necrosis . electron microscopy revealed that the ovoid - shaped tumor cells had abundant cytoplasm and round nuclei with a euchromatic pattern . the mass was diagnosed as oncocytic rcc with a tubulopapillary growth pattern . during 9 years of postoperative institutional review board ( irb ) of gachon university gil medical center ( irb no . under light microscopy , the present renal tumor showed the characteristic pathologic findings of oncocytic tumor composed of mainly solid architecture with thin tubules , i.e. , short papillae and intermixed fat . there are several oncocytic renal cell neoplasms with these histopathological features , which poses a diagnostic problem in differentiation between rcc with oncocytic features , oncocytoma - like epithelioid angiomyolipoma ( aml ) , and renal oncocytoma . renal oncocytoma shows typical gross features of a solitary , well - circumscribed , slightly lobulated , solid appearance with a mahogany brown or dark red cut surface with a frequent central scar . microscopically , the small , round , uniform tumor cells of oncocytoma have abundant , faintly eosinophilic granular cytoplasm , and the cells are arranged in nests and tubulocystic , solid , or trabecular patterns with a myxomatous or hyalinized stroma . immunohistochemistry can be helpful for arriving at the correct diagnosis because the distinct immunopositivity for c - kit and the immunonegativity for ck7 and vimentin are characteristic of renal oncocytoma . clear cell rcc has diverse architecture of solid , alveolar , and acinar patterns , but prominent papillary architecture is not common . a focal tubular growth pattern with small papillae may be also seen in papillary rcc , but extensive tubular structures with intraluminal papillary projections have been rarely described . recent studies reported that a variant of oncocytic rcc having papillotubular growth shows the histology of an extensive small tubular growth pattern , often with papillary fronds . such tumors are mainly composed of oncocytic cells with eosinophilic granular cytoplasm and some scattered clear vacuolar cells [ 2 - 4 ] . either the oncocytic cells or the clear cells in those studies were positive for amacr , cd10 , ck7 , epithelial membrane antigen , and vimentin , but they were negative for c - kit and e - cadherin . these histological and immunohistochemical findings are partly shared by those of the present case . yet in the present case , the microscopic presence of mature fat among the monotonous polygonal cells with oncocytic cytoplasm suggested a possible diagnosis of oncocytoma - like epithelioid aml . epithelioid aml was often misdiagnosed as granular , chromophobe , or high - grade unclassified rcc until it was included in the classification system of renal tumors . therefore , this uncommonly encountered histologic feature should be distinguished from perinephric and sinus fat invasion of rcc . negative reaction for melanoma markers , such as hmb-45 , melan - a , microphthalmia transcription factor , and tyrosinase , and immunopositivity for such rcc markers as cd10 and epithelial membrane antigen , can exclude oncocytoma - like epithelioid aml . the present immunohistochemical results matched those of the tumor cells of papillary rcc and partly matched those of the oncocytic cells of papillary rcc showing papillotubular growth , as reported by masuzawa et al . recent molecular studies that have focused on oncocytic papillary rcc have revealed similar results to those of traditional papillary rcc showing frequent trisomies 7 , 12 , 16 , 17 , and 20 . park et al . demonstrated that comparative genomic hybridization showed gains of 3p22 and 11q12-q13 in addition to chromosome 17 or loss of 4q . they also demonstrated a loss of chromosome 4 in one case of oncocytic papillary rcc . these molecular changes of oncocytic papillary rcc are similar to other types of papillary rcc . the mallory body like eosinophilic hyaline globules are not commonly encountered in rcc , but they were first reported by datta in 1977 . these structures are morphologically similar to those seen in alcoholic liver disease , which is composed of a parallel array or granular aggregates of intermediate filaments . these prekeratin - like structures show similar immunohistochemical and special staining results as the present case . the present tumor arose in the background of tuberculous kidney . to date , less than 50 cases of rcc with renal tuberculosis have been reported . establishing a causative relationship between the chronic inflammation of tuberculosis and rcc is rather complicated , especially since we know from previous literature that bacillus calmette gurin interaction with the uroepithelium upregulates interleukins and various forms of interferon , which are currently the primary immunotherapies for rcc . we emphasize a rare morphology of oncocytic rcc with tubulopapillary growth pattern containing a mature fat component . this combination of pathologic findings are rarely encountered and should be distinguished from other types of rcc as well as oncocytoma - like epithelioid aml .
we report a rare case of oncocytic renal cell carcinoma ( rcc ) with tubulopapillary growth in the background of tuberculous end - stage kidney disease . histology of the renal mass consisted of oncocytic cells forming solid , thin tubules and rare papillae . the tumor had abundant eosinophilic oncocytic cells containing occasional cytoplasmic mallory body like hyaline globules and a tiny focus of clear cells with intervening mature fat . both the oncocytic cells and clear cells were immunoreactive for a - methylacyl - coa racemase , vimentin , pancytokeratin , and cd10 , and negative for transcription factor e3 , cd15 , human melanoma black 45 , and c - kit . mallory body like hyaline globules were positive for cam 5.2 and periodic acid schiff with or without diastase . ultrastructurally , the tumor cells had abundant cytoplasmic mitochondria . the present case is a rare case of oncocytic rcc with tubulopapillary growth pattern . the case is unique in that the tumor was mixed with fat component , which is not common in rcc and thus can lead to misdiagnosis .
autosomal recessive distal renal tubular acidosis ( drta ) is usually a severe disease of childhood , which most often presents as failure to thrive in infancy or systemic upset , with vomiting and/or dehydration in the context of intercurrent illness . the fundamental defect in drta is an inability of the kidneys to remove the daily metabolic load of excess nonvolatile acid , which is necessary to maintain normal systemic ph close to 7.4 . although both proximal and distal nephron segments are involved in the strict homeostatic control of acid - base balance , fine regulation falls to the collecting duct , where a combination of urine acidification and bicarbonate generation is carried out by alpha - intercalated cells . functional failure of this cell type leads to the cardinal features of normal anion gap metabolic acidosis accompanied by inappropriately alkaline urine ( always > 5.5 ) . prior to treatment , drta is almost always accompanied by hypokalemia , calcification of the renal tract ( either nephrocalcinosis , stone formation , or both ) , and metabolic bone disease.1 the exact mechanism for the hypokalemia is unclear . secondary activation of the renin / aldosterone system as well as increased potassium secretion to maintain electrical neutrality have been postulated as the responsible mechanisms . hypocitraturia , together with alkaline urinary ph , is believed to be responsible for the renal tract calcification . urinary citrate is low in drta because citrate reabsorption by the proximal tubule is upregulated to provide new bicarbonate . long - standing acidosis leads to bone thinning , which presents as rickets in children . in addition , some , but not all , patients with recessively inherited drta have progressive bilateral sensorineural hearing loss ( snhl).2 failure of ph homeostasis in the cochlea is believed to be the responsible mechanism . many of the problems associated with drta can be minimized by prompt diagnosis and treatment , usually with alkali therapy , such as potassium citrate . however , although this serves to correct the biochemical abnormalities , improve health , and reduce the incidence and/or progression of renal tract calcification , rickets , and hypokalemic muscle weakness,3,4 it can not prevent the onset or progression of snhl,5 probably because of the anatomic isolation of the cochlea . aside from the very few affected kindreds from south east asia segregating two mutations in slc4a1 ( encoding the chloride bicarbonate exchanger ae1 ) , all reported mutations associated with recessive drta affect one of two genes , ie , atp6v0a4 or atp6v1b1.69 these genes encode the a4 and b1 subunits of h - atpase and , of the major organs , both are expressed only in the kidney . h - atpases are multisubunit pumps that are essential for the acidification of various intracellular compartments , as well as pumping protons across the plasma membranes of a number of different cell types . in addition to the distal renal intercalated cell , the function of which is summarized above , these cell types include cells in the inner ear , osteoclasts , and male genital tract.6,8,10 the h - atpase located at the apical surface of renal intercalated cells is the one containing a4 and b1 subunits , rather than their ubiquitously expressed counterparts a1 and b2 ( figure 1 ) . hence , individuals who have inherited mutations in either atp6v0a4 or atp6v1b1 are unable to acidify urine , leading to often severe acidosis with arterial ph < 7.2.68 initial studies suggested that mutations in atp6v1b1 resulted in recessive drta with snhl , whereas mutations in atp6v0a4 allowed for preserved hearing.6,7 subsequently , a4 , like b1 , was found to be expressed within the inner ear , and mutations in atp6v0a4 are now known to occur in some recessive drta kindreds with snhl.8,9 the kindred investigated here highlights the importance of routine audiologic assessments of all children with recessive or apparently sporadic drta , irrespective either of age at diagnosis or of which gene is mutated . in addition , when diagnostic genetic testing is undertaken , both the h - atpase genes should be screened , irrespective of current hearing status . a strategy for this is outlined . a 14-year - old girl and her younger brother , from a family of armenian turkish descent , were referred for genetic investigation of drta with bilateral snhl . the initial clinical scenario has been described elsewhere.2 briefly , a febrile episode with weight loss and hypokalemic metabolic acidosis at 10 weeks of age in the index case prompted the diagnosis of drta by a pediatrician . her brother presented with a similar biochemical picture at five months , but with growth retardation . the kindred was defined as recessive because both parents were clinically and biochemically unaffected , once the diagnoses of drta were confirmed , systemic alkali therapy and potassium supplementation were commenced in both children . it was noted that the girl progressively increased the volume of the television , radio , and her own speech , and that the boy had nasal speech , which results from impaired accuracy of palatal obstruction during the production of non - nasal sounds , leading to increased nasal resonance . unfortunately , bilateral snhl was not formally diagnosed using pure - tone audiometry until the ages of 10 and 13 years , respectively . at that time , otologic examination and radiologic investigation revealed no abnormalities of middle or inner ear structures . the snhl of both children was thereafter managed using bilateral hearing aids , in conjunction with communication and education enhancement . the genetic basis for drta genetic studies were conducted with ethics committee approval and written informed consent from the parents . because recessively inherited drta is genetically heterogeneous , simple analysis of possible linkage to either known locus previously identified intragenic biallelic single nucleotide polymorphisms that function as restriction fragment length polymorphisms in atp6v0a4 ( three ) and in atp6v1b1 ( four ) were used.8 polymerase chain reaction - amplified products of the relevant exons were digested with appropriate enzymes ( see table 1 ) and resolved by agarose gel electrophoresis , and the resulting genotypes were used to construct haplotypes . evidence for linkage to atp6v0a4 and/or atp6v1b1 was considered likely if the haplotypes of the affected offspring were identical by descent , and possible if identical by state . as displayed in figure 2a and b , linkage could not be excluded to either of these loci because the children were haploidentical at both ( by state at atp6v0a4 and by descent at atp6v1b1 ) . therefore , both genes were screened for mutations by dna sequencing of all coding exons and exon intron boundaries . however , in both cases , the same two heterozygous mutations were detected in exon 22 of atp6v0a4 ; 2308c > t ( r770x ) and 2420 g > a ( r807q ) . only once has either mutation previously been identified in drta kindreds , in each case as a homozygous alteration in a single kindred.8,9 dna sequencing of both parents in the present family confirmed that the two mutations had been inherited in trans by both children ( figure 2c ) . in codon 770 , the replacement of an arginine residue with a premature stop codon that truncates the protein by 72 amino acids is likely to result in a loss of functional protein . in codon 807 , the loss of positive charge by substitution of glutamine for arginine could alter protein structure or stability and therefore function , and we have shown elsewhere that a yeast model of this mutation results in dramatically lower protein levels.10 genetic studies were conducted with ethics committee approval and written informed consent from the parents . because recessively inherited drta is genetically heterogeneous , simple analysis of possible linkage to either known locus previously identified intragenic biallelic single nucleotide polymorphisms that function as restriction fragment length polymorphisms in atp6v0a4 ( three ) and in atp6v1b1 ( four ) were used.8 polymerase chain reaction - amplified products of the relevant exons were digested with appropriate enzymes ( see table 1 ) and resolved by agarose gel electrophoresis , and the resulting genotypes were used to construct haplotypes . evidence for linkage to atp6v0a4 and/or atp6v1b1 was considered likely if the haplotypes of the affected offspring were identical by descent , and possible if identical by state . as displayed in figure 2a and b , linkage could not be excluded to either of these loci because the children were haploidentical at both ( by state at atp6v0a4 and by descent at atp6v1b1 ) . therefore , both genes were screened for mutations by dna sequencing of all coding exons and exon intron boundaries . however , in both cases , the same two heterozygous mutations were detected in exon 22 of atp6v0a4 ; 2308c > t ( r770x ) and 2420 g > a ( r807q ) . only once has either mutation previously been identified in drta kindreds , in each case as a homozygous alteration in a single kindred.8,9 dna sequencing of both parents in the present family confirmed that the two mutations had been inherited in trans by both children ( figure 2c ) . in codon 770 , the replacement of an arginine residue with a premature stop codon that truncates the protein by 72 amino acids is likely to result in a loss of functional protein . in codon 807 , the loss of positive charge by substitution of glutamine for arginine could alter protein structure or stability and therefore function , and we have shown elsewhere that a yeast model of this mutation results in dramatically lower protein levels.10 drta is usually a severe disease of childhood , with a wide spectrum of clinical features . hearing impairment is a common , but not invariant , accompaniment of recessive disease , occurring in about 80% of our initial genetically analyzed cohort.68 it is not found where slc4a1 is the causative drta gene , because slc4a1 is not expressed in the inner ear . hearing loss may develop contemporaneously with , before , or much later than the systemic acidosis . there is also considerable variability in its severity , which may not mirror the course of the acidosis.6,8,9 in addition , widened vestibular aqueducts may occasionally be found on detailed cranial imaging.11,12 in this report , we present genetic findings in two siblings whose drta was diagnosed at an early age , but where snhl was not documented until later , even though some clinical features suggestive of hearing impairment were present from an early age . with improved surveillance , such children could have measures instituted to improve their hearing at a younger age , which might reduce the impact of snhl on language , education , and social development , a point emphasized in previous reports but not necessarily routinely performed.13 conversely , the situation may arise whereby hearing loss is observed but acidosis is mild and potentially missed.11 it is therefore prudent to consider drta among the differential diagnoses where snhl is found in childhood or adolescence . both hearing aids and cochlear implants have been found to be successful in the management of snhl in children with drta . for example , a study of children with severe to profound snhl who received cochlear implants showed that they performed significantly better on tests of spoken language than those with hearing aids , but that hearing aids were equally as effective as implants in children where snhl was only mild to moderate.14 however , given the surgical risks and potential adverse effects , cochlear implants are recommended in severe to profound snhl only , or where hearing aids are no longer effective . because snhl may not be clinically evident at the time of diagnosis of drta , and because it progresses despite treatment , every child presenting with drta should be offered early and serial audiologic assessment . this kindred also has important implications for diagnostic genetic screening , because the early conclusion of an association between snhl and one particular disease - causing gene6,7 has not been borne out by subsequent genetic investigation.8,9 thus , in situations where diagnostic genetic screening is available , the hearing status of the child should not a priori influence a decision about which of the genes to screen . in addition , because mutations in atp6v0a4 do not preclude children with drta from developing later snhl , finding such mutations should not preclude ongoing attempts to diagnose and treat any snhl .
autosomal recessive distal renal tubular acidosis is usually a severe disease of childhood , often presenting as failure to thrive in infancy . it is often , but not always , accompanied by sensorineural hearing loss , the clinical severity and age of onset of which may be different from the other clinical features . mutations in either atp6v1b1 or atp6v0a4 are the chief causes of primary distal renal tubular acidosis with or without hearing loss , although the loss is often milder in the latter . we describe a kindred with compound heterozygous alterations in atp6v0a4 , where hearing loss was formally diagnosed late in both siblings such that they missed early opportunities for hearing support . this kindred highlights the importance of routine audiologic assessments of all children with distal renal tubular acidosis , irrespective either of age at diagnosis or of which gene is mutated . in addition , when diagnostic genetic testing is undertaken , both genes should be screened irrespective of current hearing status . a strategy for this is outlined .
a pilot expanded newborn screening programme to detect inherited metabolic disorders by means of liquid chromatography coupled with tandem mass spectrometry ( lc - ms / ms ) began in the campania region , southern italy , in 2007 . by october 2009 , > 8,800 dried blood samples on filter paper from 11 hospitals in the region had been screened in our laboratory . within this programme , we detected mitochondrial acetoacetyl - coenzyme a ( coa ) thiolase deficiency ( -kt deficiency ) in a newborn asymptomatic girl and in her older sister who had a metabolic decompensation event a few months earlier ( fig . 1 ) . in the proband , -kt deficiency was diagnosed by analysing the patient s acylcarnitine profile on a dried blood spot and in urine by using liquid chromatography coupled with tandem mass spectrometry ( lc - ms / ms ) and gas chromatography coupled with mass spectrometry ( gc / ms ) using previously described procedures ( chace 2009 ; millington et al . 1dual function of acetoacetyl - coenzyme a ( coa ) thiolase [ acat 1 ( -kt ) ] in isoleucine and ketone body metabolism . metabolite biomarkers of -kt deficiency are boxed dual function of acetoacetyl - coenzyme a ( coa ) thiolase [ acat 1 ( -kt ) ] in isoleucine and ketone body metabolism . the proband , a girl , was born after 41 weeks of an uncomplicated pregnancy , the second child of healthy parents who were third cousins . birth weight was 3,390 g ( 50th centile ) , length 53 cm ( 50th75th centile ) and head circumference 36 cm ( 50th75th centile ) . the apgar score was 9 at 1 min and 10 at 5 min . the mother was 25 years old and the father 27 . the amino acid profile determined in a dried blood spot when patient 1 was 4 days old was normal , whereas acylcarnitine analysis revealed increased concentrations of tiglylcarnitine ( c5:1 = 0.34 mol / l ; upper cut - off = 0.23 mol / l ) , 3-hydroxybutyrylcarnitine ( c4oh = 2.19 mol / l ; upper cut - off = 0.55 mol / l ) and 2-methyl-3-hydroxybutyrylcarnitine ( c5oh = 1.17 mol / l ; upper cut - off = 0.28 mol / l ) . analysis of acylcarnitines in urine samples confirmed elevated concentrations of c5:1 ( 2.68 mmol / mol creatinine ; upper cut - off = 0.20 mmol / mol creatinine ) and c5oh ( 1.08 mmol / mol creatinine ; upper cut - off = 0.54 mmol / mol creatinine ) . c5:1 and c5oh concentrations are elevated in both -kt deficiency and 2-methyl-3-hydroxybutyryl - coa dehydrogenase deficiency ( mhbd deficiency ) ( matern et al 2003 ) , whereas increased concentrations of c4oh have been identified only in cases of -kt deficiency ( han et al 2007 and http://region4genetics.org ) . therefore , elevated c4oh concentrations were highly suggestive of -kt deficiency in patient 1 . to verify the diagnosis , we analysed urine organic acids . results showed that patient 1 had abnormal excretion of 2-methyl-3-hydroxybutyric acid ( 441 mmol / mol creatinine ; upper cut - off = 2 mmol / mol creatinine ) and tiglylglycine ( 87 mmol / mol creatinine ; upper cut - off = 2 mmol / mol creatinine ) . detection of 2-methylacetoacetic acid in the urine organic acid profile is considered a key factor for a diagnosis of -kt deficiency ; 2-methylacetoacetic acid is unstable because it undergoes spontaneous decarboxylation to 2-butanone , which is highly volatile and is therefore not easily determined ( korman 2006 ) . its absence in the urine of patient 1 can probably be attributed to her good health because of the earlier diagnosis consequent to neonatal screening . birth weight of the older sister of patient 1 was 3,240 g ( 25th centile ) . she was born after an uncomplicated pregnancy . at 18 months of age , after gastroenteritis and a vomiting event , she entered an emergency unit because of lethargy and metabolic acidosis ( ph 7.07 , hco3 5.2 ) . -kt deficiency was diagnosed when the patient was 23 months old and in an asymptomatic condition soon after the metabolic defect was discovered in her sister . serum and urine acylcarnitine analysis in patient 2 revealed elevated concentrations of both c5:1 ( serum : 0.96 mol / l with an upper cut - off = 0.12 mol / l ; urine : 12.8 mmol / mol creatinine with an upper cut - off = 0.2 mmol / mol creatinine ) and c5oh ( serum : 0.70 mol / l with an upper cut - off = 0.13 mol / l ; urine : 2.06 mmol / mol creatinine with an upper cut - off = 0.54 mmol / mol creatinine ) . urine organic acid analysis revealed massive excretion of 2-methyl-3-hydroxybutyric acid ( 1,354 mmol / mol creatinine ; upper cut - off = 2 mmol / mol creatinine ) and tiglylglycine ( 825 mmol / mol creatinine ; upper cut - off = 2 mmol / mol creatinine ) and small amounts of 2-methylacetoacetic acid ( 25 mmol / mol creatinine ) . thus , taken together , the data suggested -kt deficiency in this patient and indirectly confirmed the same diagnosis in the younger sister . to reach a more robust diagnosis , we carried out a genomic analysis in both sisters and their parents . we sequenced the amplified fragments corresponding to exons 112 of the acat1 gene and identified the c.471c > a p.s547s ( rs35188041 ) polymorphism in exon 6 and the c.1189c > g p.h397d mutation in exon 12 , both at the homozygous state in the two patients . the parents were found to be heterozygous for both the polymorphism and the mutation , thus confirming the homozygosity of the two daughters . the h397d mutation provokes a null allele in the sense that it causes the total loss of acetoacetyl - coa thiolase activity for which the potassium ion is critical ( fukao et al 2003 , 2008 ; haapalainen et al 2007 ) . such a severe three - dimensional perturbation destabilises the overall integrity of the mutant enzyme ( zhang et al 2004 ) . the proband , a girl , was born after 41 weeks of an uncomplicated pregnancy , the second child of healthy parents who were third cousins . birth weight was 3,390 g ( 50th centile ) , length 53 cm ( 50th75th centile ) and head circumference 36 cm ( 50th75th centile ) . the apgar score was 9 at 1 min and 10 at 5 min . the mother was 25 years old and the father 27 . the amino acid profile determined in a dried blood spot when patient 1 was 4 days old was normal , whereas acylcarnitine analysis revealed increased concentrations of tiglylcarnitine ( c5:1 = 0.34 mol / l ; upper cut - off = 0.23 mol / l ) , 3-hydroxybutyrylcarnitine ( c4oh = 2.19 mol / l ; upper cut - off = 0.55 mol / l ) and 2-methyl-3-hydroxybutyrylcarnitine ( c5oh = 1.17 mol / l ; upper cut - off = 0.28 mol / l ) . analysis of acylcarnitines in urine samples confirmed elevated concentrations of c5:1 ( 2.68 mmol / mol creatinine ; upper cut - off = 0.20 mmol / mol creatinine ) and c5oh ( 1.08 mmol / mol creatinine ; upper cut - off = 0.54 mmol / mol creatinine ) . c5:1 and c5oh concentrations are elevated in both -kt deficiency and 2-methyl-3-hydroxybutyryl - coa dehydrogenase deficiency ( mhbd deficiency ) ( matern et al 2003 ) , whereas increased concentrations of c4oh have been identified only in cases of -kt deficiency ( han et al 2007 and http://region4genetics.org ) . therefore , elevated c4oh concentrations were highly suggestive of -kt deficiency in patient 1 . to verify the diagnosis , we analysed urine organic acids . results showed that patient 1 had abnormal excretion of 2-methyl-3-hydroxybutyric acid ( 441 mmol / mol creatinine ; upper cut - off = 2 mmol / mol creatinine ) and tiglylglycine ( 87 mmol / mol creatinine ; upper cut - off = 2 mmol / mol creatinine ) . detection of 2-methylacetoacetic acid in the urine organic acid profile is considered a key factor for a diagnosis of -kt deficiency ; 2-methylacetoacetic acid is unstable because it undergoes spontaneous decarboxylation to 2-butanone , which is highly volatile and is therefore not easily determined ( korman 2006 ) . its absence in the urine of patient 1 can probably be attributed to her good health because of the earlier diagnosis consequent to neonatal screening . birth weight of the older sister of patient 1 was 3,240 g ( 25th centile ) . she was born after an uncomplicated pregnancy . at 18 months of age , after gastroenteritis and a vomiting event , she entered an emergency unit because of lethargy and metabolic acidosis ( ph 7.07 , hco3 5.2 ) . -kt deficiency was diagnosed when the patient was 23 months old and in an asymptomatic condition soon after the metabolic defect was discovered in her sister . serum and urine acylcarnitine analysis in patient 2 revealed elevated concentrations of both c5:1 ( serum : 0.96 mol / l with an upper cut - off = 0.12 mol / l ; urine : 12.8 mmol / mol creatinine with an upper cut - off = 0.2 mmol / mol creatinine ) and c5oh ( serum : 0.70 mol / l with an upper cut - off = 0.13 mol / l ; urine : 2.06 mmol / mol creatinine with an upper cut - off = 0.54 mmol / mol creatinine ) . urine organic acid analysis revealed massive excretion of 2-methyl-3-hydroxybutyric acid ( 1,354 mmol / mol creatinine ; upper cut - off = 2 mmol / mol creatinine ) and tiglylglycine ( 825 mmol / mol creatinine ; upper cut - off = 2 mmol / mol creatinine ) and small amounts of 2-methylacetoacetic acid ( 25 mmol / mol creatinine ) . thus , taken together , the data suggested -kt deficiency in this patient and indirectly confirmed the same diagnosis in the younger sister . to reach a more robust diagnosis , we carried out a genomic analysis in both sisters and their parents . we sequenced the amplified fragments corresponding to exons 112 of the acat1 gene and identified the c.471c > a p.s547s ( rs35188041 ) polymorphism in exon 6 and the c.1189c > g p.h397d mutation in exon 12 , both at the homozygous state in the two patients . the parents were found to be heterozygous for both the polymorphism and the mutation , thus confirming the homozygosity of the two daughters . the h397d mutation provokes a null allele in the sense that it causes the total loss of acetoacetyl - coa thiolase activity for which the potassium ion is critical ( fukao et al 2003 , 2008 ; haapalainen et al 2007 ) . such a severe three - dimensional perturbation destabilises the overall integrity of the mutant enzyme ( zhang et al 2004 ) . here we report the clinical and biological investigations carried out in two sisters in whom we identified -kt deficiency . using lc - ms / ms within a pilot extended metabolic screening programme , we diagnosed -kt deficiency by analysing the blood spot of patient 1 . subsequently , we identified the same metabolic defect in the patient s sister by analysing a serum sample . in the next level of diagnosis this analysis revealed abnormal excretion of 2-methyl-3-hydroxybutyric acid and tiglylglycine in both patients and a small amount of 2-methylacetoacetic acid in the older sister . familial genomic analysis confirmed that both sisters are affected by -kt deficiency and showed that they are homozygotes for the c.1189c > g ( p.h397d ) mutation in exon 12 of the acat1 gene ; the parents are heterozygotes for the same mutation . the mutation has been classified as a severe defect because it abolishes protein expression , as demonstrated in an in vitro assay ( zhang et al 2004 ) .
a pilot expanded newborn screening programme to detect inherited metabolic disorders by means of liquid chromatography coupled with tandem mass spectrometry ( lc - ms / ms ) began in the campania region , southern italy , in 2007 . by october 2009 , > 8,800 dried blood samples on filter paper from 11 hospitals had been screened . within this screening programme , we identified a case of mitochondrial acetoacetyl - coenzyme a ( coa ) thiolase deficiency [ -ketothiolase ( -kt ) deficiency ] by analysing the acylcarnitine profile from a dried blood spot with lc - ms / ms . gas chromatography coupled with mass spectrometry analysis of urinary organic acids and lc - ms / ms analysis of urinary acylcarnitines were in line with this disorder . in fact , concentrations were well beyond the cut - off values of tiglyl carnitine , 3-hydroxybutyrylcarnitine and 2-methyl-3-hydroxybutyrylcarnitine , 2-methyl-3-hydroxybutyric acid and tiglyl glycine . the absence of 2-methylacetoacetic acid in urine may be attributed to : ( i ) the instability of this -ketoacid because it undergoes spontaneous decarboxylation to 2-butanone , which is highly volatile and thus difficult to detect , and ( ii ) the good health of the patient in the first days of life . -kt deficiency was subsequently diagnosed in the patient 's older sister , who showed increased levels of the same metabolites but also small amounts of 2-methylacetoacetic acid , which is considered a key marker for -kt diagnosis . genomic analysis revealed mutation c.1189c > g in exon 12 of the acat1 gene , which results in a severe defect because of the p.h397d amino acid change in both alleles of both patients .
in the food industry , sucrose is the most commonly used sweetener as a result of its physical and chemical and sensory characteristics . however , because of its high caloric value and cariogenic properties , alternative sweeteners are being studied . in the past two decades , there has been an increasingly high interest in the production of isomaltulose ( also known as palatinose or lylose ) . isomaltulose is found naturally in small amounts in both honey and sugarcane and has been considered a promising sucrose replacement . isomaltulose is a reducing disaccharide , a sucrose isomer obtained by microbial enzymatic conversion of sucrose [ 1 , 2 ] . isomaltulose has low cariogenic potential and reduced rates of hydrolysis and monosaccharide formation in the body , and it is therefore recommended for use in beverages and foods intended for diabetics and athletes [ 1 , 3 ] . such items as intermediate disaccharides , polymers such as biodegradable detergents , and surfactants for industrial use may be obtained [ 4 , 5 ] . isomaltulose can also be applied to produce isomaltulose oligomers , which act as prebiotics , stimulating proliferation of intestinal microbiota bifidobacteria . the main isomaltulose derivative is isomalt , a sugar alcohol obtained by hydrogenation resulting in an equimolar mixture of [ 6-o-(-d - glucopyranosido)-d - sorbitol ] and [ 1-o-(-d - glucopyranosido)-d - mannitol ] , a noncariogenic compound with low caloric value . microbial conversion of sucrose into isomaltulose has attracted great commercial interest due to its complexity of chemical synthesis . isomaltulose is currently produced in large scale by using stable continuous columns of immobilized cells . alginate is one of the most commonly used supports for immobilizing whole microbial cells , because its use is simple and cheap ; it is also a reproducible technique and gentle during the immobilization process [ 9 , 10 ] . some papers have recently reported the use of transglutaminase to immobilize cells and enzymes [ 1115 ] . transglutaminase is a microbial enzyme that catalyzes the formation of protein cross - links by creating a link between the carboxyl group of glutamine and the -amino group of lysine . in this paper , experimental design technique and response surface analysis were used to assess both immobilization parameters and effects of gelatin and transglutaminase addition to a calcium alginate immobilization process on the stability and conversion of sucrose into isomaltulose . d12 strain that produces the intracellular enzyme sucrose isomerase , capable of converting sucrose into isomaltulose . the culture was grown in slant test tubes containing 6.0% sucrose ( w / v ) , 4.0% peptone ( w / v ) , 0.4% meat extract ( w / v ) , and 2.0% agar ( w / v ) , for 15 hours , at 30c . after incubation , sterile vaseline was added to the test tubes and the culture was kept at 5c , with transfers every 2 months . d12 strain cell mass was obtained by fermenting the microorganism in a culture medium containing 150 g / l of sugarcane molasses , 20 g / l of corn steep liquor , and 15 g / l of yeast hydrolysate ( prodex lac sd ) , a commercially available yeast extract ; ph was adjusted to 7.5 . the 15-hour culture of that microorganism , as described previously , was inoculated into 250 ml erlenmeyer flasks , containing 50 ml of the above - mentioned culture medium . these flasks were incubated in a shaker ( model series 25 , new brunswick scientific , edison , nj , usa ) at 200 rpm and kept at 30c , for 15 hours . a 300 ml aliquot of preinoculum , prepared following the above description , and 3 ml of dow corning fg-10 ( d'altomare qumica , so paulo , sp , brazil ) , an antifoam agent , were aseptically added to a new brunswick bioflo iic 6.6-liter fermenter ( new brunswick scientific , edison , nj , usa ) containing 2700 ml of that culture medium . after 8 hours of fermentation at 27c , that cell mass was retrieved by centrifuging at 9600 g for 15 minutes ( centrifuge model j2 - 21 , beckman coulter , inc , fullerton , calif , usa ) , at 5c , and washing twice under aseptic conditions , using presterilized distilled water . the experimental design technique was used to assess the effect of immobilization parameters on converting sucrose into isomaltulose . the parameters assessed were sodium alginate concentration , wet cell mass concentration , and cacl2 concentration . the granules containing immobilized cells , following the conditions described in tables 1 and 4 , were transferred to erlenmeyer flasks containing a sucrose solution ( granulated sugar ) and maintained in a new brunswick scientific series 25 shaker incubator ( new brunswick scientific , edison , nj , usa ) . the sugar solutions in each flask were replaced with new sucrose solution samples after every 24 hours of reaction time . the erwinia sp . d12 wet cell mass was obtained as described previously . for immobilization , a cell suspension of wet cells in sterilized distilled water was mixed with sterilized solution ( autoclaved at 121c for 15 minutes ) of sigma sodium alginate ( sigma chemical co. , st . louis , mo , usa ) at a 1 : 2 ratio ( v : v ) . the mixture was then dripped with a masterflex l / s peristaltic pump ( cole - parmer instruments co. , vernon hills , ill , usa ) into a previously sterilized cacl2 solution in order to form small granules , which were kept immersed in the same cacl2 solution , at 5c , for 12 hours . the reducing sugars formed were determined by the somogyi method , using glucose as a standard . blank was used to adjust the spectrophotometer at 540 nm ( du-70 , beckman coulter , inc . , fullerton , calif , usa ) , replacing 50 l of the sample with 50 l of distilled water in the reaction mixture . carbohydrate analysis was performed using a dionex dx-600 chromatograph ( dionex corporation , 1228 titan way sunnyvale , calif , usa ) equipped with an ip25 isocratic pump and an ed50 gold electrochemical detector . sugars were separated using a carbopac pa 1 column ( 4 mm 250 mm ) , a carbopac pa 1 guard column ( 4 mm 50 mm ) , and 250 mm sodium hydroxide solution as the mobile phase , with 1 ml / min flow , at 20c . carbohydrates were analyzed for retention time , by comparison with fructose , glucose , sucrose , and isomaltulose standards ( sigma ultra , sigma chemical co. , st . gelatin and transglutaminase concentrations were tested in cell immobilization , using experimental design technique and response surface analysis . this solution was autoclaved at 121c for 15 minutes and cooled to room temperature . after cooling , the activa tg transglutaminase enzyme ( ajinomoto interamericana indstria e comrcio ltda ) was added to that gelatin and alginate solution to increase reticulation of the alginate gel . the cell suspension and gelatin+alginate+transglutaminase solution mixture , at a 1 : 2 ( v : v ) ratio , was dripped in cacl2 with a masterflex l / s peristaltic pump , in order to form small granules , which were kept immersed in the same solution at 5c , for 12 hours . the conversion of sucrose into isomaltulose in a batch process by erwinia sp . d12 immobilized cells was assessed using experimental design technique . this study showed that the independent parameters assessed had a significant impact on isomaltulose stability and conversion . the parameters assessed in both immobilization and conversion of sucrose into isomaltulose were sodium alginate concentration , wet cell mass concentration , and cacl2 concentration . these tests were performed in 250 ml erlenmeyer flasks and kept in an incubator , shaken at 100 rpm and at 30c . each flask contained 50 ml of 35% sucrose solution ( w / v ) and 10 g of granules containing immobilized cells . the sucrose solution in the flasks was replaced with a new 35% sucrose solution ( w / v ) every 24 hours . samples containing such reducing sugars as isomaltulose , trehalose , glucose , and fructose were analyzed using the somogyi - nelson method . a 2 central composite rotatable design ( ccrd-2 ) was used to assess the following independent parameters : sodium alginate concentration , wet cell mass concentration and cacl2 concentration . table 1 presents the ccrd-2 matrix of 18 tests , including 8 tests for the complete factorial design 2 ( 1 ) , 8 tests for the axial points ( = 1.68 ) , the central point quadruplicate ( 0 ) , and the reducing sugars ( isomaltulose , trehalose , glucose and fructose ) as the dependent parameter as well as the levels studied with their decoded values . table 1 shows the total of sucrose conversion into isomaltulose in each of the 18 tests , reusing those immobilized cells in 7 batches . it was found that most tests presented high conversion in the batches . those granules containing immobilized cells in tests 7 , 8 , 12 , and 14 were more stable in comparison with the other tests and 647.02 mg / ml , 688.42 mg / ml , 812.93 mg / ml , and 582.20 mg / ml were obtained , respectively . table 2 presents effects of independent parameters on converting sucrose into reducing sugars . regarding the main effects , it was observed that the independent parameters , sodium alginate ( l ) , cell mass ( l ; q ) , and cacl2 ( l ; q ) had positive and significant effects within the range studied , with a 95% ( p < 0.05 ) confidence level . only the interaction between sodium alginate and cell mass did not present any significant effect in the levels studied . these results indicate that increasing the concentrations of those independent parameters within the studied range would result in an increased conversion of sucrose into reducing sugars . it was observed that the interactions between sodium alginate and cacl2 and also between cell mass and cacl2 had positive effects , indicating some synergism between those parameters . table 2 also presents the t and p values used to create the quadratic polynomial equation of a sucrose conversion into reducing sugars based on those studied parameters . the p values were used to check the significance of each coefficient and also to indicate how important each independent parameter or interaction between parameters in the equation result is . the greater the t value and the lower the p value , the greater the significance of the coefficient , as observed in table 2 , where only sodium alginate ( q ) and interactions between sodium alginate and cell mass and also between cell mass and cacl2 were not significant at a 95% confidence level ( p < 0.05 ) . cell mass and cacl2 presented the strongest effects and regression coefficient values , indicating a greater influence of such parameters on the conversion of sucrose into reducing sugars . the correlation measurements used to estimate that equation were the correlation coefficient ( r ) and the coefficient of determination ( r ) . the closer r is to one , the stronger the correlation between the equation - predicted conversion values and the observed values . a determination coefficient of 0.92 was obtained , indicating that only 8% of the total variation in responses obtained is not explained by the equation . the f value obtained from anova was 17.63 ( 5.61 times greater than the value of ftabulated = f0;95;7;10 = 3.14 ) , indicating that the equation to convert sucrose into reducing sugars may be considered statistically significant at a 95% confidence level . the quadratic polynomial equation ( 1 ) was obtained after these studied parameters were validated . the statistically non significant parameters were eliminated from the equation and added to lack of fit ( 1)y=439.14 + 15.66x12 + 49.99x22 + 89.75x2 + 11.74x32 + 68.07x3 + 17.33x1x3 + 40.92x2x3 , where x1 , x2 , and x3 are sodium alginate concentration , cell mass concentration , and cacl2 concentration , respectively , and y refers to the dependent parameter , reducing sugars ( % ) . figures 1(a ) and 1(b ) were created based on that equation . after analyzing these figures , it can be verified that the concentration of sodium alginate in which the greatest conversion of sucrose into isomaltulose would be obtained was above 2.5% ( w / v ) . regarding the cacl2 variable , a concentration above 0.50 m would be beneficial for cell immobilization , resulting in greater conversion into reducing sugars . figure 1(b ) shows that a cell mass concentration above 40% ( w / v ) would increase conversion by erwinia sp . d12 cells immobilized in calcium alginate in a batch process . to confirm those results , a second test was performed with parameters previously used from tests 7 , 8 , 12 , and 14 , which achieved the best results in converting sucrose into reducing sugars from table 1 ( 2 central composite rotatable design matrix ) . a test designated as a ( alginate 4.7% ( w / v ) , cell mass 47.0% ( w / v ) , and cacl2 ( w / v ) solution 0.54 moll ) was included to represent the immobilization parameters obtained by ( 1 ) and figures 1(a ) and 1(b ) , by which the best cell immobilization and isomaltulose conversion results would be obtained in a batch process . these tests were performed in duplicate 250 ml erlenmeyer flasks and kept in a shaker incubator , at 100 rpm and 30c , as described above . parameters for test 7 ( 3.0% sodium alginate concentration ( w / v ) , 47.0% cell mass concentration ( w / v ) , and 0.3 moll cacl2 concentration ) were chosen for cell immobilization and for continuous testing , as a result of the need for lower sodium alginate and cacl2 concentrations and , consequently , a lower immobilization process cost . effects of adding gelatin and transglutaminase were assessed when converting sucrose into isomaltulose by erwinia sp . the erwinia sp . d12 cell mass used in these tests was obtained as described previously . the immobilization process for a mixture containing both cell mass suspension and alginate solution plus gelatin and transglutaminase was performed as described previously . a 2 central composite rotatable design ( ccrd-2 ) was used to assess effects of a gelatin and transglutaminase concentration on increased reticulation of the granules of cells immobilized in calcium alginate and on conversion of sucrose into isomaltulose . table 4 presents the ccrd-2 matrix of 12 tests , including 4 tests for a complete factorial 2 ( 1 ) , 4 tests for axial points ( = 1.41 ) , the central point quadruplicate ( 0 ) , and the dependent parameter , isomaltulose ( % ) , as well as the studied levels with their decoded values . these tests were performed in 250 ml erlenmeyer flasks and kept in a shaker incubator at 75 rpm and 25c . five grams of granules containing immobilized cells in 25 ml of 35% sucrose solution ( w / v ) were added to each flask . this sucrose solution in those flasks was replaced with a new 35% sucrose solution ( w / v ) every 24 hours . gelatin ( q ) and transglutaminase ( q ) significantly affected ( p < 0.05 ) the conversion of sucrose into isomaltulose ; effects were positive , suggesting that their increased concentration within the range studied would have resulted in increased isomaltulose conversion . table 6 shows the analysis of variance ( anova ) to convert sucrose into isomaltulose . the equation obtained can be considered predictable and significant at a 95% confidence level , as shown by the f - test , in which the f value obtained in our tests ( fexperimental = 10.30 ) was greater than ftabulated = 4.07 . fit of the equation was verified by the correlation coefficient ( r = 0.83 ) . pure error was 1.02 , a low value , indicating good reproducibility of the obtained values . these results were sufficient and satisfactory to obtain an equation representing the actual relationship between the parameters studied and the conversion of sucrose into isomaltulose . after anova and validation of the studied parameters , the quadratic polynomial equation representing isomaltulose production by cells immobilized in calcium alginate plus gelatin and transglutaminase was used to create a response surface and isocurve ( figure 3 ) . equation ( 2 ) predicts the conversion of sucrose into isomaltulose within the studied parameter range : ( 2)y=57.23 + 1.48x12 + 2.03x220.79x2 , where x1 and x2 are gelatin and transglutaminase concentrations , respectively , and y is the dependent parameter , isomaltulose ( % ) . both response surface and contour curve are represented in figure 3 . note that an increased rate of sucrose conversion into isomaltulose by immobilized cells would take place at the ( maximum and minimum ) extremities of gelatin and transglutaminase concentration , within the studied range . three duplicate tests were performed , with concentrations used in tests 1 , 2 , and 7 of ccrd-2 , in order to confirm the best gelatin and transglutaminase concentrations for immobilization of erwinia sp . the chosen parameter values were based on responses presented in table 4 and figure 3 , in which greater isomaltulose conversion was obtained when lower transglutaminase concentrations were used . new tests with high transglutaminase concentration were not performed due to the high cost of this enzyme . tests were performed as described above , and cells were reused in six batches . d12 cells immobilized in calcium alginate plus gelatin and transglutaminase , in a batch process at 25c . the sucrose conversions into isomaltulose obtained in all three tests were similar , around 5060% . however , from the sixth batch on there was a large decrease in conversion of tests 1 and 7 , in which 28.07% and 14.59% of isomaltulose were obtained , respectively . granules containing immobilized cells in test 2 were more stable , maintaining a constant isomaltulose conversion of about 50% . comparative studies have shown that erwinia rhapontici ncppb 1578 cells immobilized in 5% sodium alginate ( w / v ) and 0.1 moll cacl2 solution , kept in stable continuous columns at 30c , and fed with sucrose solution 1.6 m were 350 times more stable than free cells , reaching a half - life of around 8,600 hours . it was found that activity of immobilized cells decreased with increasing cell concentration , something that normally occurs in diffusionally limited systems , resulting also in less mechanical resistance . the maximum immobilized cell activity , at a ph of 5.5 , was observed after 3 hours and was proportional to the amount of cells , yielding conversions of 18% , 30% , and 44% for 10 , 20 , and 40 mg of cells / ml of solution , respectively . the bacterium klebsiella planticola mx 10 was used by tsuyuki et al . to convert sucrose into isomaltulose . the cell mass was mixed with a 4% sodium alginate solution ( w / v ) at a 1 : 1 ratio ( v : v ) , and cell suspension was dripped into a shaken 0.25 moll cacl2 solution , in order to form immobilized cell granules . these granules were kept in the solution for 1 hour and were later washed with distilled water and placed in a 2% polyethyleneimine solution ( w / v ) , at ph 5.6 . after 5 minutes , these granules were separated and mixed with a 0.5% glutaraldehyde solution ( v / v ) at 5c , for 20 minutes . the polyethyleneimine- and glutaraldehyde - treated immobilized cells completely converted the 25% sucrose solution , yielding 65.4% of isomaltulose and 29.7% of trehalose . the experimental design technique and response surface analysis have been used and were considered useful tools to study the conversion of sucrose into isomaltulose by immobilized cells . ( w / v ) in 1% sodium alginate ( w / v ) and 2% cacl2 solution ( w / v ) . using stable continuous columns , they achieved a yield of about 50% of isomaltulose from sucrose solutions at 2030% concentration ( w / v ) and 35c . studied the effect of various immobilization parameters on converting sucrose into isomaltulose by immobilized cells of erwinia rhapontici ncppb 1578 . using a 30% sucrose solution ( w / v ) , the maximum production of 140 mg / ml was obtained in a batch process when cells were suspended at 5 the experimental design technique was used to assess the effect of parameters when immobilizing erwinia sp . the following independent parameters : sodium alginate concentration , cell mass concentration and cacl2 concentration , had significant effect on the stability and amounts of sucrose converted into isomaltulose . cells immobilized in 3.0% sodium alginate ( w / v ) , 47.0% cell mass ( w / v ) , 0.3 moll cacl2 , 1.7% gelatin ( w / v ) , and 0.15% transglutaminase ( w / v ) presented greater rates of isomaltulose conversion , achieving 5060% in seven consecutive batches . new studies must be performed to ascertain the influence of the parameters studied in this paper on stability and conversion of sucrose into isomaltulose in a continuous process .
isomaltulose is a noncariogenic reducing disaccharide and also a structural isomer of sucrose and is used by the food industry as a sucrose replacement . it is obtained through enzymatic conversion of microbial sucrose isomerase . an erwinia sp . d12 strain is capable of converting sucrose into isomaltulose . the experimental design technique was used to study the influence of immobilization parameters on converting sucrose into isomaltulose in a batch process using shaken erlenmeyer flasks . we assessed the effect of gelatin and transglutaminase addition on increasing the reticulation of granules of erwinia sp . d12 cells immobilized in alginate . independent parameters , sodium alginate concentration , cell mass concentration , cacl2 concentration , gelatin concentration , and transglutaminase concentration had all a significant effect ( p < 0.05 ) on isomaltulose production . erwinia sp . d12 cells immobilized in 3.0% ( w / v ) sodium alginate , 47.0% ( w / v ) cell mass , 0.3 moll1 cacl2 , 1.7% ( w / v ) gelatin and 0.15% ( w / v ) transglutaminase presented sucrose conversion into isomaltulose , of around 5060% in seven consecutive batches .
the current standard red blood cell ( rbc ) storage time of up to 42 days is not based upon a demonstrable therapeutic benefit , but instead on the observed return of 70% of the viable transfused rbcs at 24 hours after storage for 42 days or less . the structural , biochemical and immunological changes that rbcs undergo during storage are well described , but what remains controversial is the evidence that this storage lesion translates into adverse clinical outcomes for patients receiving older blood . in a previous issue of critical care , ranucci and colleagues report an adverse outcome in infants receiving older blood during cardiopulmonary bypass ( cpb ) . the effects of storage on rbcs include changes in potassium ( increased levels ) , 2,3-diphosphoglycate ( decreased levels ) , lactate ( increased levels ) , ph ( decreased values ) , glucose ( decreased levels ) , adenosine triphosphate ( decreased levels ) , methaemoglobin ( increased levels ) , red cell structure ( from biconcave disc , to echinocytes and then to spherocytes ) , and therefore red cell deformability . storage effects also include changes to the microenvironment with reduced levels of s - nitrosohaemoglobin and nitric oxide . prolonged storage prior to transfusion also results in an immunomodulatory effect , first described by opelz and colleagues who demonstrated reduced transplant rejection after stored red cell administration . this effect theoretically increases infection risk , by accumulation of proinflammatory lipids and neutrophil priming , resulting in severely reduced neutrophil function . the evidence that prolonged storage of rbcs contributes to demonstrable adverse outcomes remains controversial , however , and is hampered by many small retrospective studies with potential selection bias ; most evidence is also confounded by relatively recent changes in practice such as leucodepletion of rbcs . moreover , there is still no consensus on what constitutes old blood , with studies using variable definitions of 5 , 12 , 14 or 21 days . none of the prospective studies to date have shown a correlation between the age of rbcs and adverse outcome . two new studies in progress should provide further data - the age of blood evaluation study ( canadian clinical care trials group ) in trauma / intensive care patients and the red cell storage age study ( us national heart , lung , and blood institute 's transfusion medicine / hemostasis clinical trials network ) in cardiac surgery patients . marik and sibbald reported in 1993 that older rbcs were associated with a reduced intragastric phi value ( a surrogate for gut ischaemia ) and postulated that impaired deformability of rbcs impeded microvasculature flow . a similar study published in 2004 , however , failed to confirm these findings . offner and colleagues suggested that trauma patients receiving blood stored for > 2 weeks had higher rates of infection and multiorgan failure ; but these patients also received a greater volume of transfusion , were older and had more severe injuries . more recently , zallen and colleagues reported in a cohort of 63 trauma patients that those who received older blood had a higher risk of developing multiorgan failure ; yet again , however , these patients were older and received marginally more rbcs . van der watering and colleagues retrospectively reviewed 2,732 patients undergoing cpb ; univariate analysis , but not multivariate analysis , suggested a correlation between storage time and survival . in 2008 koch and colleagues evaluated an even larger patient group of cardiac surgical cases who received rbcs either 14 days old or > 15 days old . their results indicated excess inhospital mortality associated with older blood , but these patients were also more likely to have received more rbcs . these retrospective studies are now added to by that of ranucci and colleagues in a previous issue of critical care , who evaluated outcome in 239 infants receiving blood as either a cpb pump prime or an intra / postoperative top - up transfusion according to whether this blood was 4 days old or older . of 192 infants receiving cpb prime blood , the authors concluded that older blood recipients were more likely to have pulmonary complications . after adjusting for other possible confounders , the rbc storage time remained an independent predictor of major morbidity , although the same association was not found for patients receiving rbcs after cpb . red cell transfusion in the critically ill continues to raise many questions - including whether the storage duration of red cells affects measurable outcomes ; whether leucodepletion results in fewer storage associated complications ; the effect of red cell irradiation on relevant outcomes ; and , finally , the appropriate target haemoglobin level in the preoperative , bleeding and stable critically ill patient . clearly , more robust evidence from prospective trials is required to support the therapeutic use of blood transfusion in the critically ill , or uncertainty will remain . dw is a co - investigator in the relieve study ; a feasibility randomized trial comparing restrictive and liberal blood transfusion strategies in intensive care patients .
since the inception of blood banking , refinements in laboratory processes have allowed for progressively longer storage times of red blood cells . whilst advantageous for the logistics of stock management , the clinical impact of the duration of red blood cell storage prior to transfusion remains uncertain , and a topic of growing interest .
the wt1 gene , located on chromosome 11p13 , plays a crucial role in kidney and genital system development . recent studies have demonstrated that mutations in wt1 , leading to frasier syndrome and denys - drash syndrome ( dds ) , can also cause isolated steroid - resistant nephrotic syndrome ( isrns ) . incomplete dds is characterized as a nephrotic syndrome associated with wilms ' tumor or male pseudohermaphroditism . a previous study has reported one pair of monozygotic twins presenting discordant phenotypes with identical wt1 mutations being of paternal origin . here , we report on discordant phenotypes in monozygotic twins with identical de novo wt1 mutations . female monozygotic twins having very similar appearances and only one placenta were observed . both twins had normal female phenotypes and karyotype 46 , xx . twin a ( figure 1 ( iii4 ) ) was admitted to the department of pediatrics , fuzhou dongfang hospital , p. r. china for evaluation of edema at the age of two . she failed to respond to 6 weeks of prednisone therapy ( 2 mg / kg/24 h ) . at the age of 3.49 years , she also presented with a right abdominal mass . kidney ultrasound revealed a 9.85 cm by 8.32 cm wilms ' tumor in the right kidney , confirmed by computed tomography scan ( figure 2 ) . she was diagnosed with incomplete dds and died at the age of 3.50 years due to renal failure . . abdominal computed tomography scan of twin a at the age of 3.49 years , showing wilms ' tumor in right kidney ( arrows ) . twin b ( figure 1 ( iii5 ) ) was examined at the age of two . she had not displayed wilms ' tumor by kidney ultrasound by the age of 5.14 years , though her serum creatinine had increased to 66 mol / l . she is now 5.85 years old and has not yet displayed wilms ' tumor , verified by both kidney ultrasound and computed tomography scan . a heterozygous variant in exon 9 of wt1 , 1180c > t , leading to an arginine to tryptophan substitution ( r394w ) , was identified in both twins , whereas it was not found in 50 controls or the twins ' parents or older sister . three wt1 polymorphisms , 126c > t , 903a > g and ivs732c > a , were also found in the twins . in this study , we identified an identical de novo heterozygous wt1 mutation , r394w , in monozygotic twins presenting with incomplete dds and isrns , which was not observed in the parents . previous studies have reported wt1 mutation r394w can cause dds or isrns ; therefore , we considered this mutation to be responsible for the phenotypes observed in the twins . the twins , having very similar appearances , had only one placenta and three wt1 polymorphisms , 126c > t , 903a > g and ivs732c > a , suggesting that they were monozygotic twins . twin a presented with isrns at the age of two and developed unilateral wilms ' tumor at the age of 3.49 . twin b presented with isrns at the age of 4.02 and did not present with any renal tumors at the last follow - up when she was 5.85 . the possible reason for our observations is that discordant phenotypes in our twins with identical wt1 mutation r394w could be associated with the two - hit mutational model of wilms ' tumorigenesis . although the onset age of wilms ' tumor in dds patients with wt1 mutation r394w was from 0.3 to 2.7 years [ 5 , 7 , 8 ] , we will still continue a clinical follow - up and make a prompt report if wilms ' tumor will appear in twin b. consistent in part with our study , monozygotic twins with the same wt1 mutation presenting incomplete dds and isrns were reported by fencl et al . ; however , in that case , the wt1 mutation was r366p and inherited from the twins ' father . also , four studies have previously noted monozygotic twins with identical wt1 mutations presenting the same phenotypes [ 1 , 3 , 9 , 10 ] . in conclusion , the female monozygotic twins showed discordant phenotypes , had an identical de novo wt1 mutation r394w and presented incomplete dds and isrns .
mutations in the wt1 gene , leading to denys - drash syndrome and frasier syndrome , can also cause isolated steroid - resistant nephrotic syndrome ( isrns ) . previous studies have reported six pairs of monozygotic twins with wt1 mutations , including one presenting with discordant phenotypes with identical wt1 mutations being of paternal origin and five pairs of monozygotic twins presenting the same phenotype with identical wt1 mutations . in this study , we report on female monozygotic twins showing discordant phenotypes with an identical de novo wt1 mutation , r394w , and presenting incomplete denys - drash syndrome and isrns .
moraxella osloensis , an oxidase - positive , nonmotile , asaccharolytic , aerobic gram - negative coccobacilli is a part of the normal flora of the human respiratory tract ( 1 , 2 ) . the organism is difficult to identify because of presence of several other species with similar phenotypic characteristics . species of some glucose non - fermenting gram - negative bacilli are not only difficult to identify by routine methods , but also the clinical significance is not always easy to interpret . clinical significance of m. osloensis isolates even from normally sterile site may be difficult to determine , because the organism rarely cause invasive infections . we report three cases of m. osloensis meningitis in two children with no known underlying disease and in one adult cancer patient . a 4-yr - old girl was admitted to the pediatric department on may 27 , 2002 , with a 1-day history of headache , fever ( 38.1 ) , abdominal pain , and vomiting ( table 1 ) . her past medical history was unremarkable and she was up - to - date with her immunizations . laboratory tests revealed a peripheral white blood cell ( wbc ) count of 19,800/l ( 91% neutrophils ) , a hemoglobin level of 11.6 g / dl , and a platelet count of 356,000/l . cerebrospinal fluid ( csf ) had a hazy appearance with an increased wbc count of 890/l ( 99% neutrophils ) , but no significant change in glucose concentration of 78 mg / dl , and a protein level of 31 mg / dl ( table 2 ) . the patient became afebrile after 2 days of treatment , and her other symptoms also improved . the csf analysis showed a decreased wbc count to 9/l from 890/l at hospital day 3 . a 15-yr - old boy was admitted to the neurology department on may 18 , 2005 , with a 3-day history of headache and 2 days of generalized petechiae , nausea , and vomiting ( table 1 ) . his past medical history was unremarkable . on admission , his oral temperature was 36.9 , heart rate was 93 beats / min , and blood pressure was 125/82 mmhg . there were no motor or sensory deficits , and the rest of his physical examination was unremarkable . a laboratory investigation at the time of admission revealed a peripheral wbc count of 30,290/l ( 96% neutrophils ) , a hemoglobin level of 15.4 g / dl , and a platelet count of 151,000/l . csf had a cloudy appearance with an increased protein concentration of 575 mg / dl , and a wbc count of 35,500/l ( 90% neutrophils ) and a decreased glucose concentration of 10 mg / dl ( table 2 ) . his clinical condition was improved after 3 days , and the csf analysis showed a decreased wbc count and protein concentration to 4,150/l and 90 mg / dl from 35,500/l and 575 mg / dl , respectively . on 13th hospital day , the csf wbc count decreased to 130/l , and the patient was discharged without complications on 18th hospital day . an 81-yr - old man with a known history of pancreatic cancer ( march , 2004 ) and liver cirrhosis due to hepatitis c virus infection ( june , 2004 ) was admitted to the emergency department on june 6 , 2005 , with drowsy mental status for one day . on admission , he had icteric sclera ( table 1 ) . laboratory investigation revealed a peripheral wbc count of 6,950/l ( 73% neutrophils ) , a hemoglobin level of 12.8 g / dl , and a platelet count of 60,000/l . csf was clear with a protein level of 38 mg / dl , a slightly increased wbc count of 9/l , and a glucose concentration of 76 mg / dl ( table 2 ) . routine blood chemistry showed increased blood urea nitrogen / creatinine of 41.8/2.2 mg / dl , ammonia of 287 g / dl and total bilirubin of 3.1 mg / dl . the patient was treated with cefotaxime for 1 week . on hospital day 3 , the csf wbc count decreased to 0/l . he was managed conservatively and was discharged 18th hospital day without complications . in case no . 2 many gram - negative coccobacilli were detected on smear of a csf . in cases 2 on blood and chocolate agar plates yielded heavy growth of medium sized ( 0.5 - 1 mm ) grayish colonies after overnight co2 incubation . in case no . the gram - stained smear of colonies revealed gram - negative coccobacilli in all three cases . the correct species identification was not achieved not only by the conventional biochemical tests , but also by the api i d 32 gn system ( profile 00000 - 000002 ) , and vitek2 gn system ( biomerieux , marcy l'etoile , france ) , but suggested moraxella spp . 16s rrna gene sequencing ( 3 ) identified all three isolates as m. osloensis ( 98% agreement with genbank accession no . the antimicrobial susceptibility test performed by the disk diffusion method ( 4 ) showed all three isolates were susceptible to ampicillin , cephalothin , cefoxitin , cefotaxime , ceftazidime , cefepime , levofloxacin , imipenem , amikacin , netilmicin , and gentamicin . a 4-yr - old girl was admitted to the pediatric department on may 27 , 2002 , with a 1-day history of headache , fever ( 38.1 ) , abdominal pain , and vomiting ( table 1 ) . her past medical history was unremarkable and she was up - to - date with her immunizations . laboratory tests revealed a peripheral white blood cell ( wbc ) count of 19,800/l ( 91% neutrophils ) , a hemoglobin level of 11.6 g / dl , and a platelet count of 356,000/l . cerebrospinal fluid ( csf ) had a hazy appearance with an increased wbc count of 890/l ( 99% neutrophils ) , but no significant change in glucose concentration of 78 mg / dl , and a protein level of 31 mg / dl ( table 2 ) . the patient became afebrile after 2 days of treatment , and her other symptoms also improved . the csf analysis showed a decreased wbc count to 9/l from 890/l at hospital day 3 . a 15-yr - old boy was admitted to the neurology department on may 18 , 2005 , with a 3-day history of headache and 2 days of generalized petechiae , nausea , and vomiting ( table 1 ) . his past medical history was unremarkable . on admission , his oral temperature was 36.9 , heart rate was 93 beats / min , and blood pressure was 125/82 mmhg . there were no motor or sensory deficits , and the rest of his physical examination was unremarkable . a laboratory investigation at the time of admission revealed a peripheral wbc count of 30,290/l ( 96% neutrophils ) , a hemoglobin level of 15.4 g / dl , and a platelet count of 151,000/l . csf had a cloudy appearance with an increased protein concentration of 575 mg / dl , and a wbc count of 35,500/l ( 90% neutrophils ) and a decreased glucose concentration of 10 mg / dl ( table 2 ) . his clinical condition was improved after 3 days , and the csf analysis showed a decreased wbc count and protein concentration to 4,150/l and 90 mg / dl from 35,500/l and 575 mg / dl , respectively . on 13th hospital day , the csf wbc count decreased to 130/l , and the patient was discharged without complications on 18th hospital day . an 81-yr - old man with a known history of pancreatic cancer ( march , 2004 ) and liver cirrhosis due to hepatitis c virus infection ( june , 2004 ) was admitted to the emergency department on june 6 , 2005 , with drowsy mental status for one day . on admission laboratory investigation revealed a peripheral wbc count of 6,950/l ( 73% neutrophils ) , a hemoglobin level of 12.8 g / dl , and a platelet count of 60,000/l . csf was clear with a protein level of 38 mg / dl , a slightly increased wbc count of 9/l , and a glucose concentration of 76 mg / dl ( table 2 ) . routine blood chemistry showed increased blood urea nitrogen / creatinine of 41.8/2.2 mg / dl , ammonia of 287 g / dl and total bilirubin of 3.1 mg / dl . the patient was treated with cefotaxime for 1 week . on hospital day 3 , the csf wbc count decreased to 0/l . 2 many gram - negative coccobacilli were detected on smear of a csf . in cases 2 on blood and chocolate agar plates yielded heavy growth of medium sized ( 0.5 - 1 mm ) grayish colonies after overnight co2 incubation . in case the gram - stained smear of colonies revealed gram - negative coccobacilli in all three cases . the correct species identification was not achieved not only by the conventional biochemical tests , but also by the api i d 32 gn system ( profile 00000 - 000002 ) , and vitek2 gn system ( biomerieux , marcy l'etoile , france ) , but suggested moraxella spp . 16s rrna gene sequencing ( 3 ) identified all three isolates as m. osloensis ( 98% agreement with genbank accession no . the antimicrobial susceptibility test performed by the disk diffusion method ( 4 ) showed all three isolates were susceptible to ampicillin , cephalothin , cefoxitin , cefotaxime , ceftazidime , cefepime , levofloxacin , imipenem , amikacin , netilmicin , and gentamicin . members of the genus moraxella are oxidase - positive , nonmotile , and asaccharolytic coccobacilli . genus moraxella consists of seven species , m. atlantae , m. canis , m. catarrhalis , m. lacunata , m. lincolnii , m. nonliquefaciens , and m. osloensis ( 1 ) . graham et al . ( 5 ) reported that m. osloensis was common and the most frequent isolate from blood and csf among clinical isolates of moraxella spp . it has been rarely reported to cause local or invasive infections , including osteomyelitis , meningitis , bacteremia , pneumonia , and catheter associated infection ( 6 - 11 ) . two patients had known predisposing factors for infection such as cerebrospinal fluid shunt and c8 complement deficiency , but the remaining two patients had no known underlying disease ( 12 ) . the children in case 1 and 2 had no underlying diseases . these children had typical meningitis symptoms such as headache , neck stiffness , nausea , and vomiting , an elevated wbc count , and increased protein in csf analysis . in case 1 , we could not totally exclude the coexistence of viral and bacterial meningitis because we did not test virus culture nor virus antigen assay . the adult patient ( case no . as this patient had drowsy mental status on admission , csf examination and culture were performed to rule out meningitis . a possible explanation of low csf wbc count was due to lower peripheral wbc count resulting from various cytotoxic therapies . the clinical diagnosis of this patient was hepatic encephalopathy because of high blood ammonia and high total bilirubin level . this patient was also diagnosed as bacterial meningitis because of m. osloensis growth from csf . with appropriate antimicrobial agents ' treatment , identification of an unusual bacterial isolate is a very difficult problem in a clinical microbiology laboratory . moraxella spp . grows well in capnophilic conditions , but grows slowly in ambient air which may lead to delays in diagnosis . commercially available using conventional biochemical tests and two commercial identification kits , we were able to infer the genus moraxella . however , we could not definitively identify the species because the results of various biochemical tests are similar among the seven moraxella spp . only with 16s rrna gene sequence analysis , we were able to definitively identify the isolates as m. osloensis ( 3 ) . this new method consists of pcr amplification and sequencing of the 16s rrna gene in bacteria , followed by a comparison of the 16s rrna gene sequence with those registered in genbank . m. osloensis is usually susceptible to penicillin g , cephalosporins , and aminoglycosides ( 5 , 13 ) . there are a few reports that treatment with penicillin g and ampicillin for m. osloensis bacteremia and meningitis has been successful . all three strains were susceptible to majority of antimicrobial agents , including ampicillin , cephalothin , cefotaxime , amikacin , levofloxacin , and imipenem . all patients were treated successfully with third - generation cephalosporins alone or in combination with netilmicin . in conclusion , although m. osloensis meningitis is rare it may cause severe cns infection in children and in adult cancer patient . we were able to definitely identify the species of the isolates only by using 16s rrna gene sequencing .
we had three cases of moraxella osloensis meningitis . the species identification was impossible by conventional and commercial phenotypic tests . however , we could identify the species using the 16s rrna gene sequencing . determination of clinical significance was difficult in one patient . all three patients recovered by appropriate antimicrobial therapy .
the institute of medicine ( iom ) has fruitfully distinguished between health care difference ( in which race / ethnicity groups have divergent absolute values of health care access or outcomes ) and disparity ( the difference remaining after other potentially mediating factors have been statistically , or otherwise , accounted for ) . in the united states , disparities have been consistently demonstrated in that racial and ethnic minorities have less access to care , receive poorer quality of care , and are subsequently less satisfied with their healthcare than majority racial / ethnic groups [ 1 , 2 ] . these disparities are troubling and represent an area of need in terms of research , public health , and public policy . in particular , healthcare disparities between african americans and whites have been persistent . disparities for african americans have also been noted in other areas including : higher uninsured rates , lower proportions of a usual source of care , and higher unmet prescription needs . such disparities have been noted for the country as a whole , but there are specific differences for african americans across states as well . for instance , significant health care disparity patterns between african americans and whites have been reported in alabama , mississippi , and wisconsin , but not in california , washington , and colorado . state - by - state differences illustrate the importance of examining healthcare disparities for particular populations on a state level . in table 1 , selected indicators from kids count 2010 show virginia 's data as compared to u.s . overall . virginia 's african american population is over 55% higher than the national percentage , yet the percentage of african americans living in poverty in virginia is 22% less than that of the nation . the percentage of virginia 's children with special health care needs ( cshcn ) and the percentage of low birth weight and incidence of infant mortality among african americans are comparable to the u.s . healthcare disparities may result from the interaction of many factors , and there is no easy path to fully understand the causal links among these factors , or to define solutions to the racial disparities that have been observed between different groups in the united states . van ryn and fu provide a model of the potential mechanisms through which health and human service providers can have an impact on racial / ethnic disparities . this model includes factors related to help - seeker / patient behavior ( e.g. , self - disclosure and assertiveness in the medical encounter ) and cognitive and affective factors ( e.g. , attitude , self - efficacy ) . differences in help - seeking behavior have been examined in terms of health care utilization . potential contributors to disparities for african americans include perceptions of quality of care , perceived patient - provider relationship , perceptions of health and illness , and perceptions of overall care . provider beliefs and provider behavior in the clinical encounter may also impact racial / ethnic disparities . van ryn and fu 's model includes factors such as provider beliefs about the help seeker , interpretation of the help seeker 's symptoms , and interpersonal behavior in relation to the help seeker . providers may perceive african americans and low socioeconomic status patients more negatively on a number of dimensions ( e.g. , patient intelligence , beliefs about patient 's participation in risk behaviors , and expectations regarding patient adherence to medical advice ) . finally , the van ryn and fu model also incorporates characteristics of the clinical encounter that might act as obstacles to seeking services and engaging in treatment , exacerbating healthcare disparities . such factors include problems in communicating with providers , fear of stigma , providers ' lack of empathy or understanding of problems , and lack of opportunity to give input in treatment decisions . conceptual models such as the one proposed by van ryn and fu can help to identify potential mechanisms that lead to healthcare disparities for african americans and provide helpful directions for future research . research and applied public health work related to understanding and resolving healthcare disparities has been characterized as a moral imperative , and the healthy people 2010 initiative has a specific focus on resolving racial / ethnic disparities . current literature documents health care disparities among children with special health care needs ( cshcn ) in the u.s . african american children are more likely than white children to have shcn , as are children from low - income or single - parent households although this finding has not been entirely consistent . studies exploring family satisfaction with care , the presence of medical home components , and specialty care including dental and mental health provide examples of disparities and contributing factors . in their analysis of the 2001 national survey of cshcn , strickland et al . identified disparities in health care access and medical home for cshcn in poverty and children of racial and ethnic minority . african american and latino children were less likely to have a usual source of care or family - centered care . ngui and flores reported that african american and latino parents were significantly more likely than white parents to be dissatisfied with care and to report problems with ease of service use . factors such as minority status , low family income , lack of health insurance , and children with higher functional limitations have been linked to decreased access to and satisfaction with care [ 12 , 14 ] . racial / ethnic disparities also exist in unmet needs for specialty , dental , and mental health care services . factors associated with unmet mental health and dental health care needs for african american and latino cshcn included underinsurance and living in poverty . coker et al . reported significantly lower odds of receiving family - centered care ( fcc ) for latino and african american compared with white children even after adjustment for child health , socioeconomic , and access factors . specifically , disparities were reported for latino and african american children and children in households with non - english as a primary language with respect to the fcc components of time spent with the provider and sensitivity to the family 's values and customs . indeed , race / ethnicity disparities in accessing fcc have been reported for all children , not just cshcn . while there is strong support for the presence of race / ethnicity disparities in u.s . health care for cshcn , there is also good reason to believe that states differ in important ways with respect to the health care system for children and families ' experiences in that system [ 5 , 18 ] and that effective responses to disparities will likewise differ across states . the present study was conducted in collaboration with the virginia department of health ; the agency was particularly interested in the question of race / ethnicity disparities in health care for virginia children . the present study examined the mchb core outcomes and their components , for virginia children with special health care needs , with particular attention to race / ethnicity disparities . the study was designed to serve as a model for state - level analyses that would inform the development of health care policy that could address race / ethnicity disparities in an intentional fashion . the national survey of children with special health care needs was sponsored by the maternal and child health bureau ( mchb ) and the national center for health statistics . the survey sample was constructed to allow for both national- and state - level findings . the project screened 192,083 households for children with special health care needs using the child and adolescent health measurement initiative cshcn screener and completed 40,840 cshcn interviews , including at least 750 interviews in each state . the data for cshcn in virginia were used as the basis for the present study . personnel from the virginia state department of health title v program collaborated in this effort , guiding the topic selection and contributing to the interpretation of findings . the primary variables of interest were the six core outcomes for cshcn identified by the maternal and child health bureau ( mchb ) as reflecting goals for the system of care for this population ( see table 2 ) . cshcn survey data , along with the algorithm for determining whether the outcomes were met , are available to the public through the national center for health statistics web site http://www.cdc.gov/nchs/slaits/cshcn.htm . the goal of the study was to determine whether there were race / ethnicity disparities in the extent to which virginia cshcn met the mchb outcomes . logistic regression models were created with met / did not meet the outcome as the dependent variable . the survey was examined for other variables that might reasonably be expected to have an impact on whether a child would meet the outcomes . selected predictor variables were divided into four conceptual categories ( demographics , child characteristics , health care providers , and health care access ) . race / ethnicity of the child was included in the demographics category and was characterized as white / non - latino ( the reference group ) , african american / non - latino , and latino . additional race / ethnicity categories included in the survey were insufficiently represented in the virginia sample to warrant inclusion as a separate group and were combined in the race / ethnicity category other . data analyses were conducted using the svymean , svyprop , and svylogit procedures in the statistical analysis package , stata 8.1 . use of these procedures allows for the generation of standard errors appropriate to the complex sample design . preliminary models included only race / ethnicity as a predictor and each outcome as the dependent variable . for the primary analyses , four logistic regression models were run for each outcome , one for each category of predictors . subsequently , significant predictors from each of the four models were combined into a final model for each outcome . conclusions about significant associations between predictors and outcomes are based on the final models only . race / ethnicity disparities for each outcome were judged to be present if the race / ethnicity variable was a significant predictor in the final model . analyses were limited to the virginia cshcn sample ( n = 790 ) which was 58.5% male ( se = .02 ) . the race distribution was 67.5% white ( se = .02 ) , 25.2% african american ( se = .02 ) , 2.4% latino ( se = .005 ) , and 4.9% other ( se = .009 ) . the estimated proportion of children who met each of the outcomes , by race / ethnicity , is provided in table 4 . preliminary analyses indicated that african american children , compared to their white counterparts , were significantly less likely to meet core outcome 2 ( or = .37 ; se = .08 ; p = .000 ) , core outcome 3 ( or = .58 ; se = 14 ; p = .021 ) , core outcome 4 ( or = .42 ; se = .10 ; p = .000 ) , and core outcome 6 ( or = .33 ; se = .14 ; p = .012 ) . these findings are best described as race / ethnicity differences ; it is not clear from these results whether race / ethnicity is the critical variable determining the differences . primary analyses were then run for each outcome , using models that included hypothesized predictors , to examine the data for evidence of disparities . significant predictors in the final model for each of the first three core outcomes are provided in table 5 , along with the associated odds ratio and confidence interval . in each case , african american children were significantly less likely to meet the outcome , compared to white children , taking into account the effects of other variables associated with the outcome ; these findings represent disparities in health care for cshcn . for core outcomes 4 , 5 , and 6 , race / ethnicity was not a significant predictor in the final model , and those outcomes were not explored further . to clarify the disparities , follow - up analyses were pursued by creating logistic regression models for individual survey items associated with each of the first three outcomes . in each model , race / ethnicity was the predictor , and the individual survey item was the dependent variable . these analyses revealed that the parents of african american children were less likely to meet outcome 1 because they disproportionately fail to feel like a partner with their child 's physician ; they were not less likely to be very satisfied with services received , the other component item of outcome 1 . component items contributing to the disparity in outcome 2 ( coordinated ongoing comprehensive care within a medical home ) were more numerous and more varied . african american children were less likely than their white counterparts to have a usual source for sick and preventive care and to have a personal doctor or nurse . in addition , their parents were less likely to say that doctors spent enough time , listened carefully , were sensitive to values and customs , and made them feel like a partner ; ( parents feeling like a partner with their child 's health care provider is a component of both outcomes 1 and 2 ) . thus , a variety of health - care - related differences appear to contribute to the race / ethnicity disparity in receiving coordinated ongoing comprehensive care within a medical home . under outcome 3 , african american children were less likely to have no gaps in insurance coverage , and their parents were less likely to report that insurance usually or always meets the child 's needs . these two component items appear to be the primary contributors to the race / ethnicity disparity in having adequate insurance to pay for needed health care services . each of the family centered care items that showed race / ethnicity differences was positively associated with feeling like a partner ; if parents reported that the health care provider more often spent enough time ( chi - square = 107.78 ; p < 0.001 ) , listened carefully ( chi - square = 239.51 ; p < 0.001 ) , or was sensitive to values and customs ( chi - square = 180.80 ; p < 0.001 ) , they were more likely to report feeling like a partner . thus , race / ethnicity disparities in family - centered care , an important component of receiving coordinated ongoing comprehensive care within a medical home , are associated with differences in feeling like a partner with one 's child 's health care provider . and feeling like a partner appears to be , at least in part , a function of whether the provider spends enough time with the child , listens carefully to parents ' concerns , and is sensitive to their values and customs . race / ethnicity disparities in health care for children with special health care needs are well documented . the cshcs survey provides an opportunity for states to look more closely at those disparities and to consider their implications for remediation . in virginia , african - american families of cshcn were less likely than white families to meet mchb outcomes 1 , 2 , and 3 . in the present study , african americans felt that their cshcn were less likely to receive ongoing care within a medical home . this discrepancy is in part a function of race / ethnicity differences in health care quality indicators . african american children are much less likely to have a usual source of care and a personal doctor or nurse . however , another component of the medical home model relates to the provision of family - centered care . race / ethnicity differences in family - centered care indicators may help elucidate the medical home disparity . disparities in outcomes 1 and 2 and the component differences isolated in the present study point to the importance of investigating how patients and their parents experience the clinical encounter . results from the present study are consistent with the coker et al . finding that latino and african american cshcn were significantly less likely to receive family - centered care and that disparities remained after adjustment for child health , socioeconomic , and access factors . further investigation into the six components of fcc identified disparities with respect to the time spent with the provider and sensitivity to the family 's values and customs . exploratory analyses in the present study suggest that sensitivity to families ' values and customs may play an important role in the race / ethnicity differences with respect to whether parents feel like a partner with their child 's health care provider . in ngui and flores ' analysis of the 2001 national survey of cshcn , black and hispanic parents were significantly more likely than white parents to be dissatisfied with care ; however , those differences disappeared after adjusting for family - centered care indicators . thus , as in the present study , important health care quality indicators were conceptually linked back to differences in the clinical encounter . similar findings were reported in an analysis of 2000 national survey of childhood health data . three potential mechanisms related to provider attitudes and behavior have been proposed that might produce disparities in health care : bias against minorities , greater clinical uncertainty when interacting with minority patients , and beliefs about the behavior or health of minorities . each of these mechanisms relates to some aspect of the clinical encounter and may help explain race / ethnicity disparities with respect to family - centered care . for example , it may be the case that doctors have biases towards african americans that impact their interactions . doctors may hold negative beliefs about african americans behavior or health , of which they may not even be aware , but which might come across in subtle ways such as through nonverbal behavior . similarly , they may be less likely to collaborate with these patients in making health - related decisions , perhaps in part related to an expectation of lower compliance from african americans in terms of following through with their recommendations . this process may also be cyclical ; african american patients have decreased trust of doctors , which may result in doctors being less apt to recommend treatment or engage the patient in treatment planning . communication is an important factor in the doctor - patient relationship , and doctors have been found to have poorer communication with minority patients . this may be related to discord in certain aspects of communication , such as differences in slang , dialect , and idioms . in any case , poor communication or discordance in communication style may result in perceived racial discrimination contributing to decreased patient satisfaction and involvement in health - related decision making [ 22 , 23 ] . the mechanisms proposed by the iom offer a convenient framework to guide further research on race / ethnicity disparities . further exploration of the impact of provider bias , uncertainty , and beliefs on clinical encounters with minority patients will serve to clarify differences in the clinical encounter that produce such disparities . for example , doctor - patient race concordance has been associated with satisfaction with care , but provider race / ethnicity information is not available in the data set . the survey also fails to distinguish among type of health care provider ( e.g. , physician versus nurse practitioner ) when reporting on quality indicators including those associated with satisfaction and family - centered care . finally , parents perceptions of care received over the previous 12 months may be affected by recall bias ; strongly positive or strongly negative experiences may carry unwarranted weight in perceptions . detailed exploration of race / ethnicity disparities in health care for cshcn may suggest directions with respect to interventions . o'brien suggested that relatively little is known about the efficacy of alternative approaches to reducing disparities , or about the strategies that are effective within various racial / ethnic subpopulations ( page 6 ) . o'brien summarized reports suggesting that physician tracking and reminder systems can be effective in improving preventive care and screening services for racial and ethnic minorities , as are initiatives that bypass the physician and give responsibility for offering a service to a nurse or nurse practitioner ( e.g. standing orders for adult immunizations ) . multifaceted provider interventions may also be effective , but interventions that include only a provider education component are not generally found to be very effective in improving care or narrowing disparities . physician tracking and reminder systems can be effective in improving preventive care and screening services for racial and ethnic minorities , as are initiatives that bypass the physician and give responsibility for offering a service to a nurse or nurse practitioner ( e.g. standing orders for adult immunizations ) . multifaceted provider interventions may also be effective , but interventions that include only a provider education component are not generally found to be very effective in improving care or narrowing disparities . pending further investigation of interventions to reduce disparities , providers are left with common - sense responses . a focus on improving the clinical encounter for cshcn and their families will lead providers to focus on establishing positive interpersonal relations with patients , listening carefully and communicating respectfully , involving parents in decision making , reducing language barriers , and improving ease of use of health care services . patient education and support interventions may also hold promise such as the ask me 3 program developed by the partnership for clear health communication for the purpose of improving communication between patients and health care providers . findings from the present study emphasize the need to examine health care disparities at the state level in order to guide efforts at remediation . the cshcn survey is a useful source of data to inform policy makers in their efforts to address race / ethnicity disparities in health care .
this study analyzed virginia data from the most recent national survey of children with special health care needs . logistic regression models were run for six maternal and child health bureau core outcomes and included demographics , child characteristics , health care providers , and health care access variables as predictors . race / ethnicity disparities were judged to be present if the race / ethnicity variable was a significant predictor in the final model . examining the components of disparate outcomes , african american children were found to be less likely than their white counterparts to have a usual source for sick and preventive care and to have a personal doctor or nurse . their parents were less likely to say that doctors spent enough time , listened carefully , were sensitive to values and customs , and made them feel like a partner . these findings emphasize the need to examine health care disparities at a state level in order to guide efforts at remediation .
picture archiving and communication systems ( pacs ) and other imaging - related information technology ( it ) systems have grown in popularity over the last decade . initially used within departments as radiology - focused tools with a small number of users , these systems have now grown to become enterprise - class resources for departments outside of radiology . as demand for and reliance on these systems have continued to grow , so has the demand for an always - on infrastructure and system architectures that can support mission - critical availability and uptime.1 meeting these requirements is often a challenge for pacs and radiology it professionals . many system architectures delivered as standard offerings by industry vendors lack redundancy and/or failover capabilities . most pacs teams rely on their clinical users to alert them to problems as they occur . this is a less - than - ideal management approach because it requires that a system fail sufficiently to adversely affect users before the pacs team is notified of the problem . moreover , it places the onus of problem - reporting responsibility on the already time - challenged end - users . users often grow dissatisfied in this role and either ignore the issue or wait hours to report it , delaying the repair time , allowing the problem to affect growing numbers of their end - user colleagues , and , in worst - case scenarios , adversely affecting patient care . with the truly mission - critical nature of these systems , the need to understand possible failure modes and react quickly is high . a much preferred and more straightforward approach is proactive monitoring of system availability.2 system monitoring tools are available to automatically watch over all systems in a department or hospital.3 these tools can remotely monitor the ports of a server for activity and can alert it staff if no activity is detected . digital imaging and communications in medicine ( dicom ) , health level 7 ( hl7 ) , databases , and web services all run on different ports and can be monitored separately . by using these tools , pacs support team members can be automatically notified by pager when a possible problem exists and can work to repair issues more quickly . monitoring tools can also provide useful statistics ( e.g. , uptime reporting to the system service level ) , restart failed services , and interface with ticketing systems to perform issue tracking and trending analysis . implementation of these tools provides the added advantage of having an independent system monitor the availability of a pacs system . this can be quite useful when trying to hold a vendor accountable to an uptime guarantee in a service - level agreement . although commercial packages are available , these are often expensive and lack custom tools to monitor imaging - specific criteria ( such as dicom availability ) . commercial packages may also lack the requisite flexibility to monitor such criteria as message queues for radiology information systems ( ris ) . we report here on the implementation of an open source monitoring tool customized to our departmental needs and on our assessment of its utility in routine clinical imaging operations . we implemented the open source availability monitoring package nagios4 and configured it to be a comprehensive availability monitoring solution in a heterogeneous environment of 68 systems with 108 monitored services . we installed the nagios packages on an hp dl360 server ( hewlett - packard , palo alto , ca , usa ) with dual central processor units and 2 gb ram running the gentoo5 linux operating system . each contact had a name , e - mail address , pager e - mail address , and availability window for paging . these contacts were split into groups , such as pacs_team and ris_team . the host servers were then set up in the system . each host was configured with a name , internet protocol address , interval for monitoring ( 24 7 in most cases , but 8 5 for those up only during business hours ) , and notification options ( down , recovered , warning states ) . the interval functionality was useful for those devices and modalities that were turned off during specific time periods ( such as overnight ) . groups were created from the list of hosts and assembled on the basis of function . some of the groups we formed were pacs_archives , pacs_databases , and ris_servers . one of the most powerful features of nagios was the ability to create customized approaches to search for more than the availability of a single port . nagios uses a series of programs or scripts for monitoring as part of its standard functionality . the exit codes used are 0 ( ok ) , 1 ( warning ) , and 2 ( critical ) . one example of the utility of these codes is in a queue checker we created . in this scenario , a script connects to a database and pulls the value of a specific queue . if the value is > 50 , the program exited with a code of 2 ( critical ) . if it is between 25 and 49 , the program exited with a code of 1 ( warning ) . if the value is < 25 , the program exited normally with an exit code of 0 ( ok ) . one advantage of using an open source application in this role was the relative ease with which codes can be extended to add functionality . our system was customized to monitor criteria beyond system availability , to include port monitoring , queue status , and dicom availability of pacs gateways and subspecialty visualization work stations , and was more broadly used for an overall picture of the health of our information systems . additional plug - ins were created to restart services in the event of a failure , to log a ticket in our open source issue tracking system ( radtracker),6 as well as page our team members in the event of an issue . table 1specific ports and services used by nagios for system monitoringports and servicesicmp or ping for general availabilityport 80 for http web server availabilityport 443 for https secure web server availability ( including ssl certificate expiration)port 104 for dicom ( specifically c - echo)port 53 for domain name service port 21 for file transfer protocol port 25 for simple mail transport protocol port 3306 for mysql database availabilityport 1433 for microsoft sql availabilityport 1521 for oracle database availabilityport 389 for lightweight directory access protocol web services health checker status screen scraping of queue monitoring web pages with scripting to enable a restart of interface via url string specific ports and services used by nagios for system monitoring we installed this system in 2006 and monitored its usefulness over a 6-month period from december 2006 to may 2007 . the system was extremely effective at providing an overall view of the health level of our systems as well as specific data about availability . benefits that were realized as a result of this implementation included ( but were not limited to ) : automated monitoring with web - based access to system management data . the software provided a comprehensive view of the systems in our environment , monitoring 68 servers on a 24 7 basis . in addition , remote radiology sites were monitored , giving the added benefit of measuring wide area network ( wan ) availability to remote locations ( fig . the system was integrated with our inhouse paging system via simple mail transfer protocol to our local e - mail gateway . by integrating the system in this fashion , alerts could be sent directly to staff members pagers via e-mail.integration with problem management systems . the system was integrated with our paging system via direct open database connectivity insertion into our local issue tracking system s mysql database ( fig . 2 ) . this allowed the team to track any specific issue as part of the normal call resolution process and provided a knowledge base in the system for root cause analysis as well as a methodology for repair.service level agreement reporting . the system provided an overall system uptime view with time - frame customization reporting for availability , with detail down to the service level for each specific host or host group ( fig . the system could monitor these interfaces via a screen scrape of the web page and restart those interfaces that allowed for a restart when passed via a uniform resource locator string.health check status of systems via web service . when provided by vendors , the system could also monitor health and other status via web service capabilities.over the 6-month period , the system generated 461 issues in our issue tracking system . a breakdown of these issues by category 3service log entries.table 2breakdown of alerts submitted into ticketing system over 6 monthstype of eventnumber of occurrenceshost availability of ping209interface or queue problems104dicom c - echo51web server failure40web - services - related37lightweight directory access protocol ( ldap ) bind failures8misc . the software provided a comprehensive view of the systems in our environment , monitoring 68 servers on a 24 7 basis . in addition , remote radiology sites were monitored , giving the added benefit of measuring wide area network ( wan ) availability to remote locations ( fig . 1 ) . the system was integrated with our inhouse paging system via simple mail transfer protocol to our local e - mail gateway . by integrating the system in this fashion the system was integrated with our paging system via direct open database connectivity insertion into our local issue tracking system s mysql database ( fig . 2 ) . this allowed the team to track any specific issue as part of the normal call resolution process and provided a knowledge base in the system for root cause analysis as well as a methodology for repair . the system provided an overall system uptime view with time - frame customization reporting for availability , with detail down to the service level for each specific host or host group ( fig . the system could monitor these interfaces via a screen scrape of the web page and restart those interfaces that allowed for a restart when passed via a uniform resource locator string . when provided by vendors , the system could also monitor health and other status via web service capabilities . over the 6-month period , the system generated 461 issues in our issue tracking system . a breakdown of these issues by category these types of failures were either total system failures or network - related , oftentimes indicating a wan link failure . not all notifications were failures , however , because normal network maintenance at our facility was also included . on several occasions , the use of this tool was effective in providing warning notifications to wan vendors of a network failure or performance degradation before the vendor had been alerted to a problem . the second most common failure mode was related to interfaces either dropping or having a high number of messages that exceeded a predetermined threshold for that queue . by keeping interfaces available and within guidelines , we were able to keep the flow of data to a more real - time level . by scripting interface restarts and turning these into an automated process this failure mode was critical , because it effectively monitors the ability of systems to send images via dicom to pacs . this functionality does not normally exist in commercial monitoring packages and was of great importance since we were able to effectively monitor our system s ability to function as a dicom sender or receiver . the nagios plug - in for this feature was created using the dcmtk dicom toolkit7 to both perform the c - echo and determine if the association was completed successfully . in one case , we observed that by simply monitoring the dicom service for a particular host with c - echos at 5-min intervals , we were able to prevent dicom service failures that had previously been a frequent occurrence on the device . other remaining failure modes included web servers , web services , and lightweight directory access protocol bind issues , among others . monitoring for these failures was a critical addition and a great benefit for our group , because traditional availability - only monitoring ( through internet control messaging protocol or ping alone ) would not in most cases have revealed these failure modes as these types of failures most often occur for specific services within servers themselves . in such a scenario , servers would answer a ping and would appear to be available on a network but , in fact , would be experiencing an internal failure that would leave them nonfunctional or in a degraded state and unavailable to users . by capturing these failure modes through our monitoring efforts , we were able to respond immediately to issues that might not be obvious to standard monitoring systems . we found the nagios availability tool to be effective in the proactive support of mission - critical radiology and other clinical imaging systems . support staff were notified in real time with monitoring tool alerts to warning signs of possible system failures . although some pacs and ris vendors offer their own monitoring packages , we found that the addition of an independent monitoring tool that was outside of vendor control was effective and allowed the monitoring of multiple vendors through the same interface . this comprehensive approach to monitoring departmental and enterprise applications across all support environments provided a comprehensive view of system availability . we found that open source monitoring tools such as nagios could provide cost - effective independent monitoring . the benefits of using an open source tool included independent monitoring , agility in adaptation , and an open tool box for customizations . if a new application or system needed to be monitored , custom or prepackaged plug - ins could be utilized without the need of a purchase order or lengthy development turnaround time . the use of nagios as a system alerting and availability tool allowed us to monitor our systems for failures and notify our support staff immediately when problems occurred . the result was enhancement of our continuing efforts to achieve always - on systems and mission - critical delivery of services to our customers .
the goal of all radiology information technology ( it ) support organizations is excellent customer service through the availability of critical clinical information services , such as picture archiving communication systems and radiology information systems . despite these goals , it support personnel often act like firefighters , reacting to each problem , but unable to prevent or predict other problems . proactive support is always more desirable than reactive support . warning signs may exist well before a technical issue becomes system wide or the user is affected . the objective for it support organizations in health care should be to maximize system uptime by using proactive monitoring systems for failures and to automatically detect failures through systems management tools . we report on the implementation of nagios , an open source monitoring tool , as an availability management system in a diagnostic imaging department and on customized applications and protocols specific to radiology needs .
endovascular treatment of aortic pathologies has become the predominant form of repair.1 ) standard endovascular repair of aortic pathologies , in which the internal iliac artery is generally embolized , can lead to complications , such as buttock claudication , colon ischemia , and erectile dysfunction.2 ) therefore , antegrade flow of the internal iliac artery should be conserved , particularly in young patients . to address this problem , various scalloped , fenestrated , and branched aortic stent grafts have been developed and studied . most of these stent grafts are dedicated iliac branch grafts that require at least a 6-week customization period and are very costly.3 ) also , they are currently unavailable for use in china . modified fenestrated stent grafts ( mfsgs ) are a safe and effective alternative for treatment of patients with juxtarenal aneurysms , for whom no other alternatives are available . only a few cases of mfsg use in the treatment of iliac pathologies have been reported.4 ) the current report describes the treatment of isolated iliac dissection with an mfsg with preservation of the internal iliac artery . a 54-year - old man was admitted with complaints of backache that had lasted two weeks . cross - sectional computed tomography ( ct ) and three - dimensional reconstructed images showed a slightly dilated common iliac artery ( cia ) , as well as dissection from the cia to the external iliac artery with intimal tears in the cia , without dilation of the internal iliac artery ( fig . 1 ) . given the patient 's age , possible inflammatory adhesion around the dissection , absence of dilation of the internal artery , and the desire to minimize the risks of colon ischemia , buttock claudication , and impotence , we proceeded with an attempt at endovascular dissection repair with an mfsg . the modified graft was created using a 16 mm13 mm80 mm endurant stent graft ( medtronic , minneapolis , mn , usa ) . the first six stents of the graft were deployed , leaving the remaining stents loaded in the sheath . a sterile marking pen was used to mark the location of the fenestrations based on both length and clock face measurements that had been previously determined with image reconstruction software ( ge adw4.5 , connecticut , usa ) . an ophthalmologic cautery was used to carefully burn the dacron fabric to create the fenestration ( fig . the stent strut from the original iliac stent graft limb was secured to the polyester graft with continuous 6 - 0 prolene sutures . a longitudinal radiopaque marker was sutured to the polyester graft for orientation just below the position of the fenestrated ostium using 6 - 0 prolene sutures ( ethicon , west somerville , nj , usa ) ( fig . the modified graft was resheathed into the original sheath using interrupted silk sutures to collapse each stent . an aortogram revealed right iliac dissection with intimal tears in the common iliac artery , which was limited to the proximal end of the external iliac artery at the left anterior oblique ( lao ) 40+caudal ( caud ) 15 projection angle ( fig . proper orientation of the graft was confirmed by rotating the mfsg clockwise under fluoroscopy and adjusting the longitudinal radiopaque marker to the level of the internal iliac artery . we placed a 16 mm13 mm80 mm medtronic endurant endograft below the aortic bifurcate with the distal end positioned at the external iliac artery . the aortogram revealed that the iliac dissection successfully excluded and preserved the flow of the internal iliac artery . thus , a 12 mm40 mm fluency cover stent ( bard , karlsruhe , germany ) was placed distally to extend to the landing zone and ballooned with a coda balloon . repeat angiography showed intact flow into the internal iliac artery covering the dissection and a narrowed endoleak iv , while endoleak ib had disappeared ( fig . three - dimensional reconstructed ct images 5 months later revealed no endoleaks and showed a patent right internal iliac artery . the modified graft was created using a 16 mm13 mm80 mm endurant stent graft ( medtronic , minneapolis , mn , usa ) . the first six stents of the graft were deployed , leaving the remaining stents loaded in the sheath . a sterile marking pen was used to mark the location of the fenestrations based on both length and clock face measurements that had been previously determined with image reconstruction software ( ge adw4.5 , connecticut , usa ) . an ophthalmologic cautery was used to carefully burn the dacron fabric to create the fenestration ( fig . the stent strut from the original iliac stent graft limb was secured to the polyester graft with continuous 6 - 0 prolene sutures . a longitudinal radiopaque marker was sutured to the polyester graft for orientation just below the position of the fenestrated ostium using 6 - 0 prolene sutures ( ethicon , west somerville , nj , usa ) ( fig . the modified graft was resheathed into the original sheath using interrupted silk sutures to collapse each stent . an aortogram revealed right iliac dissection with intimal tears in the common iliac artery , which was limited to the proximal end of the external iliac artery at the left anterior oblique ( lao ) 40+caudal ( caud ) 15 projection angle ( fig . proper orientation of the graft was confirmed by rotating the mfsg clockwise under fluoroscopy and adjusting the longitudinal radiopaque marker to the level of the internal iliac artery . we placed a 16 mm13 mm80 mm medtronic endurant endograft below the aortic bifurcate with the distal end positioned at the external iliac artery . the aortogram revealed that the iliac dissection successfully excluded and preserved the flow of the internal iliac artery . thus , a 12 mm40 mm fluency cover stent ( bard , karlsruhe , germany ) was placed distally to extend to the landing zone and ballooned with a coda balloon . repeat angiography showed intact flow into the internal iliac artery covering the dissection and a narrowed endoleak iv , while endoleak ib had disappeared ( fig . three - dimensional reconstructed ct images 5 months later revealed no endoleaks and showed a patent right internal iliac artery . most cases are related to marfan syndrome , pregnancy , fibromuscular dysplasia , alpha-1-antitrypsin deficiency , athletic training , or atherosclerosis . endovascular treatment is becoming more popular in aortic pathologies.5)6)7)8 ) the risks of internal iliac artery embolization have been well described . preservation of pelvic flow is crucial in various circumstances.2)9 ) the advent of fenestrated endovascular aortic repair , which can reduce aortic pathologies while preserving blood flow to major organs through visceral branches by using fenestrated stent grafts ( fsgs ) , increases the possibility for treatment of these aortic pathologies . however , most fsgs are focused on the use of an iliac branch device or in situ fsg for endovascular treatment of iliac / aortoiliac pathologies.3 ) mfsgs are a safe and effective alternative for treatment of patients with juxtarenal aneurysms , in which no other alternatives are available.10 ) in this study , we demonstrated endovascular treatment of iliac / aortoiliac pathologies with an mfsg . the effectiveness of this procedure is exhibited by preservation of the internal iliac artery , which showed favorable patency . to our knowledge , most mfsgs are used for preservation of renal and left subclavian arteries.11)12 ) few cases of mfsg use in the treatment of iliac / aortoiliac pathologies have been reported.4 ) the current report presents our first clinical use of an mfsg for preservation of the internal iliac artery . measurements of the abdominal aorta and iliac arteries , as well as deployment of longitudinal radiopaque marker , were of paramount importance . patient access vessels must be of adequate diameter to accommodate large sheaths and areas of narrowing or tortuosity within the iliac system may prevent device advancement and positioning . hence , the choice of mfsg must be made on a case - by - case basis . several factors supported our use of an mfsg in this case . first , dedicated iliac branch grafts have been developed and tested but are currently unavailable for use because of a lack of approval from the china food and drug administration ; they also require at least 6 weeks for customization and are more complicated than standard endovascular aortic repair . second , in situ fsg is theoretically another endovascular alternative.13 ) so far , in situ fsg has mainly been used to preserve the left subclavian artery ; there are no published reports of an in situ fsg being used to treat iliac / aortoiliac pathologies . finally , the absences of severe vessel tortuosity , iliac anatomies , and internal artery dilatation are prerequisites for the selection of an mfsg . as a result , for this case , use of an mfsg avoids the need to construct a branched limb and may require minimal or no device modifications compared with other cases . the selection of the proper projection angle is a critical step for the mfsg procedure . lao 40+caud 15 , which are optimal projection angles for displaying the tear of iliac dissection , maintained the internal and external iliac arteries in the same plane for the current case . such techniques include sandwich technology and the bell - bottom technique . in the bell - bottom technique , the landing zone is usually located in a diseased segment of the common iliac artery , which can lead to future growth and development of a type ib endoleak and has a 4% reintervention rate.14 ) the sandwich technique may be difficult in patients with short common iliac arteries along with a narrow - caliber external iliac artery on the same side.15 ) this technique would have been a viable alternative in the current case , but the cost of treatment would have increased . in conclusion , we report our first clinical case of mfsg usage for preservation of the internal iliac artery . mfsg use is feasible and can be applied with devices available in most endovascular centers . it may become the best option due to comparative effectiveness and low cost if it can be shown to be just as safe and effective as commercially available custom devices . what 's more , an mfsg may be used in urgent or emergent cases ( symptomatic or ruptured aneurysms ) , in patients considered hemodynamically stable . the success of fenestrated endovascular iliac / aortoiliac pathologies can facilitate treatment of aortic pathologies involving visceral arteries . the short - term follow - up in this case indicated that the technique was successful , but there are still uncertainties regarding the long - term stability of the stent graft . further studies are required to evaluate its long - term effectiveness and assess any possible reinterventions associated with modified fenestrated stent grafts .
standard endovascular repair of iliac / aortoiliac pathologies can lead to complications , such as buttock claudication , colon ischemia and erectile dysfunction . branch grafts have been developed but require at least 6 weeks for customization and are not currently available in china ; they are also quite expensive . to our knowledge , modified fenestrated stent grafts ( mfsgs ) are a safe and effective alternative for treating patients with juxtarenal aneurysms . most mfsgs are used for the preservation of renal and left subclavian arteries . few cases of mfsgs have been reported in the treatment of iliac pathologies . the use of an mfsg is decided on a case - by - case basis . this report presents our first clinical use of an mfsg for preservation of the internal iliac artery .
diabetes mellitus ( dm ) is a systemic disease with several major complications affecting both the quality and length of life . the chronic gram - negative infection of periodontal origin may be considered a potential focus of infection that aggravates metabolic control in patients who have diabetes . the multifactorial model for the aetiology of periodontitis proposed by clarke and hirsch incorporates the role of personal , environmental and systemic factors along with the bacteria to explain individuals varying susceptibility to periodontitis . risk factors associated with periodontitis are smoking , diabetes , stress , neutrophil dysfunction , hyperlipidemia , hormonal imbalance , health care , low socio - economic status , poor oral hygiene , imbalanced diet , and alcoholism . strong evidence indicates that pathogenic bacteria or their products stimulate cells such as fibroblasts , keratinocytes , and macrophages , present in the periodontal tissue , to release a number of inflammatory cytokines , such as tumor necrosis factor alpha ( tnf- ) ; prostaglandin e2 ; interleukin il-1 , 6 and 12 ; granulocyte colony - stimulating factor ( g - csf ) ; and chemokines . the elevated serum levels of these important mediators have deleterious effects on glucose and lipid metabolism . saito et al . found that alveolar bone loss was associated with impaired glucose tolerance in japanese men without diabetes . similarly , nibali et al . found slightly , but statistically significant , higher non - fasting glucose levels in periodontitis cases compared to healthy controls . these studies suggest that periodontitis may effect glucose metabolism in general population , albeit to a lesser extent than in adults with diabetes . therefore our objective of this study was to determine the association between chronic periodontitis and hba1c in adults without diabetes and to evaluate differences in hba1c values that were obtained with the lab and the kit . a total of 140 subjects including both chronic periodontitis patients and healthy controls without diabetes were selected for the study from the outpatient department of periodontics , st . inclusion criteria for the study were the participants of 35 years of age and previously had not been diagnosed with diabetes , presence of > 10 natural teeth and who had not received any surgical / nonsurgical periodontal therapy for past 6 months . we excluded subjects with gross oral pathology ( tumors and cyst ) , pregnant women , subjects who had taken antibiotics and analgesics 6 months prior to surgery and subjects with any other systemic disease . one hundred forty non - diabetic subjects were selected after subjecting their random blood ( 90 mg / dl ) and urine sample for biochemical tests ( benedict 's test ) . the study was approved by the ethical committee of the institution and following the selection of subjects , written consents were obtained from the same . group i : chronic periodontitis patients ( cases ) subjects who were diagnosed with periodontitis having at least 10 teeth with probing depth 5 mm and 15% sites with bleeding on probing ( bop ) and clinical attachment loss > 1 mm were selected . group ii : healthy controls included clinically healthy subjects with no history of any known systemic disease and had no history of previous hospitalization and medication with probing depth < 4 mm , bop at < 15% of teeth sites , and no periodontal treatment within previous 6 months . patients smoking habits were recorded , in this study only 12 patients were smokers ( 7 in cases and 5 in controls ) out of 140 ( 8.5% ) hence , no correlation on the effects of smoking could therefore be drawn from this study . all subjects received a clinical periodontal examination by single examiner who recorded all the variables by manual procedure . gingival bleeding index , probing pocket depth ( ppd ) and clinical attachment level ( cal ) . hba1c was measured using a commercially available test kit ( a1cnow+ ) according to the manufacturer 's recommendations and also with a laboratory method ( ion exchange resin method ) using a semi - auto analyzer . hba1c was compared between cases and controls using the t - test ( unadjusted ) and multiple linear regressions ( adjusted ) . one hundred forty non - diabetic subjects were selected after subjecting their random blood ( 90 mg / dl ) and urine sample for biochemical tests ( benedict 's test ) . the study was approved by the ethical committee of the institution and following the selection of subjects , written consents were obtained from the same . group i : chronic periodontitis patients ( cases ) subjects who were diagnosed with periodontitis having at least 10 teeth with probing depth 5 mm and 15% sites with bleeding on probing ( bop ) and clinical attachment loss > 1 mm were selected . group ii : healthy controls included clinically healthy subjects with no history of any known systemic disease and had no history of previous hospitalization and medication with probing depth < 4 mm , bop at < 15% of teeth sites , and no periodontal treatment within previous 6 months . patients smoking habits were recorded , in this study only 12 patients were smokers ( 7 in cases and 5 in controls ) out of 140 ( 8.5% ) hence , no correlation on the effects of smoking could therefore be drawn from this study . all subjects received a clinical periodontal examination by single examiner who recorded all the variables by manual procedure . gingival bleeding index , probing pocket depth ( ppd ) and clinical attachment level ( cal ) . hba1c was measured using a commercially available test kit ( a1cnow+ ) according to the manufacturer 's recommendations and also with a laboratory method ( ion exchange resin method ) using a semi - auto analyzer . hba1c was compared between cases and controls using the t - test ( unadjusted ) and multiple linear regressions ( adjusted ) . a total sample size of 140 was taken , out of which 70 were cases and 70 were controls and data obtained was subjected to statistical analysis . comparison of select characteristics between chronic periodontitis cases and controls table 2 shows the comparison of hba1c values between chronic periodontitis cases and controls ( kit and lab ) . the unadjusted mean hba1c levels with kit in cases were 5.51 0.53 , while in controls they were 5.44 0.27 , but the difference was statistically not significant ( p = 0.38 ) . the unadjusted mean hba1c levels with lab in cases were 5.50 0.74 , while in controls they were 5.48 0.29 . comparison of hba1c values between cases and controls table 3 shows the comparison of hba1c levels obtained with kit and lab . the mean hba1c levels in cases with kit and lab were 5.51 0.53 and 5.50 0.74 , respectively . the mean hba1c values among kit and lab in controls were 5.44 0.27 and 5.48 0.29 , respectively . comparison of hba1c values of kit and lab table 4 shows correlation between age , bmi , hba1c kit and lab , ppd 5 mm , cal and bop among cases . age showed a positive correlation with bmi ( 0.15 ) , hba1c kit ( 0.03 ) and lab ( 0.11 ) , ppd 5 mm ( 0.20 ) , cal ( 0.26 ) and a negative correlation with bop ( -0.15 ) ; with cal being statistically significant ( p < 0.05 ) . when bmi was compared a positive correlation was found with kit ( 0.17 ) , lab ( 0.13 ) , ppd 5 mm ( 0.30 ) , cal ( 0.22 ) and a negative correlation was found with bop ( -0.14 ) , however ppd 5 mm found to be statistically significant ( p < 0.05 ) . correlation between different variables in cases hba1c kit was positively correlated with lab ( 0.93 ) and was statistically significant ( p < 0.05 ) . a negative correlation was seen when kit was compared with ppd 5 mm ( -0.04 ) and cal ( -0.05 ) while it was positively correlated with bop ( 0.16 ) . with hba1c lab being compared , a positive correlation was observed with bop ( 0.09 ) , ppd 5 mm ( 0.01 ) and a negative correlation with cal ( -0.07 ) . although , both cal ( 0.69 ) and bop ( 0.04 ) showed a positive correlation with ppd 5 mm , only cal was found to be statistically significant ( p < 0.05 ) . table 5 shows correlation between age , bmi , hba1c kit and lab in control group . when age was compared to other parameters , it was found to be positively correlated with same [ bmi ( 0.07 ) , hba1c kit ( 0.17 ) and lab ( 0.05 ) ] . when hba1c kit was compared to lab ( 0.70 ) they were positively correlated and statistically significant ( p < 0.05 ) . periodontitis is defined as an inflammatory disease of the supporting tissues of the teeth caused by specific microorganisms or groups of specific microorganisms , resulting in progressive destruction of periodontal ligament and alveolar bone with pocket formation , recession or bot . although the biologic mechanisms linking periodontitis to impaired glucose metabolism have not been fully elucidated , a popular theory is that inflammatory mediators ( particularly il-6 and tnf- ) generated within the inflamed periodontal tissues or in response to oral bacteria that translocate into the systemic circulation interfere with the actions of insulin receptors , thereby decreasing insulin sensititvity . glucose can bind irreversibly to hemoglobin through a non - enzymatic reaction to form glycosylated hemoglobin ( hba ) . hba1c is considered as a beneficial indicator of long - term homeostasis , reflecting an average blood glucose concentration for the past 2 - 3 months . diabetes treatment guidelines are based primarily on the establishment and maintenance of hba1c levels < 7% . every percentage point drop in hba1c this study was intended to determine the association between chronic periodontitis and hba1c in adults without diabetes and also to evaluate the difference in hba1c values that were obtained with lab and kit . in this study , cases and controls were of similar age . when relationship between age and hba1c was explored separately in cases and controls , each additional year of age cases had higher bmi scores than controls and after adjustment of bmi to hba1c ( kit and lab ) a positive correlation was found . in this study , hba1c levels ( kit and lab ) were positively correlated with cal and bop also showed positive correlation with hba1c . in this case - control study , hba1c levels were slightly higher and statistically significant in chronic periodontitis cases than in healthy controls ( kit - p = 0.048 ; lab - p = 0.043 ) . in this study , hba1c was measured using a chair side test kit and laboratory method . the hba1c levels that were obtained with chair side kit correlated well with laboratory values . one advantage of chair side hba1c tests is that they can be performed quickly and easily in a dental office setting . further studies are needed to determine whether the screening in the dental office can improve early diagnosis and the management of diabetes . the results of this study are consistent with the study conducted by nibali et al . , which suggested that chronic periodontitis is associated with elevated blood glucose levels in adults who have not been diagnosed with diabetes . in this study non - fasting blood glucose levels was compared between periodontally healthy patients and those with advanced disease . glucose was significantly higher in chronic periodontitis cases than in controls . in this study , in contrast we found a small , but negative correlation ( with lab ) and positive correlation ( with kit ) , between hba1c and number of sites with pd 5 mm . nonetheless , an evidence of dose - dependent relationship between disease extent and hba1c elevations was not found , which suggests that there may be a threshold above which periodontitis affects hba1c values in the general population . a number of participants in this study had elevated hba1c readings and may have had undiagnosed type-2 diabetes . although the usefulness of hba1c as a diagnostic tool for diabetes continues to be debated , several groups have proposed cutoffs ranging from 5.8% to 6.2% . the data from this study suggests that prospective large studies with full measurements of pocket depth and attachment loss , and intervention by periodontal treatment , are needed to clarify the causal relationship between periodontitis and hba1c in non - diabetics . hba1c levels ( lab and kit ) were slightly elevated in chronic periodontitis cases than in controls . this preliminary finding is consistent with earlier reports that chronic periodontitis is associated with elevated blood glucose in adults without diabetes and may increase one 's risk for type-2 diabetes . further studies with larger sample sizes are needed to clarify the causal relationship between chronic periodontitis and glycosylated hemoglobin levels in non - diabetics .
background : the aim of this study was to determine if glycosylated hemoglobin is elevated in patients with chronic periodontitis who have not been diagnosed with diabetes and also to compare the hba1c levels that were obtained with lab and chairside test kit.materials and methods : a case control study was designed . glycosylated hemoglobin ( hba1c ) was assessed using a chairside kit and laboratory method in 70 subjects without diabetes but with chronic periodontitis [ having at least 10 teeth ( at least one site around each tooth ) with probing depth ( pd ) 5 mm , bleeding on probing ( bop ) 15% and clinical attachment level ( cal ) 1 mm ] and 70 healthy controls ( pd 4 mm and bop 15% ) . groups were compared using the t - test and multiple linear regression model analysis . karl pearson 's correlation coefficient was used to compare the relationship between different variables.results:in this case control study hba1c ( lab and kit ) were slightly higher and statistically significant in chronic periodontitis cases than in healthy controls.conclusion:chronic periodontitis is associated with a slight elevation in glycosylated hemoglobin ( lab and chair side kit ) and that the clinical significance of this difference remains to be determined . this preliminary finding is consistent with earlier reports that chronic periodontitis is associated with elevated blood glucose in adults without diabetes and may increase one 's risk for type-2 diabetes .