reference stringlengths 7 774 ⌀ | aptamer_chemistry stringclasses 21
values | aptamer_name stringlengths 1 164 | target_name stringlengths 2 1.2k ⌀ | aptamer_sequence stringlengths 2 380 | origin stringclasses 6
values | target_chemistry stringclasses 11
values | external_id stringclasses 509
values | target_sequence stringclasses 357
values | new_affinity stringlengths 3 193 ⌀ |
|---|---|---|---|---|---|---|---|---|---|
Congsheng Cheng, Yong Hong Chen, Kim A Lennox, Mark A Behlke, Beverly L Davidson, "In vivo SELEX for Identification of Brain-penetrating Aptamers" Molecular Therapy-Nucleic Acids (2013)2, e67, American Society of Gene & Cell TherapyMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | A14 (ID# 7921) | Penetrating the Blood Brain Barrier (BBB) | GGGAGGACGAUGCGGGUAGCCUUUCGGUGGUCCGUUAUCUCCACAUCACGUCUGCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Other | null | null | Not Mentioned in Database |
Congsheng Cheng, Yong Hong Chen, Kim A Lennox, Mark A Behlke, Beverly L Davidson, "In vivo SELEX for Identification of Brain-penetrating Aptamers" Molecular Therapy-Nucleic Acids (2013)2, e67, American Society of Gene & Cell TherapyMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | A09 (ID# 7923) | Penetrating the Blood Brain Barrier (BBB) | GGGAGGACGAUGCGGUUACCUUUGUCCAGCAUGUUCGGAUUCGGCACCUGGUCCCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Other | null | null | Not Mentioned in Database |
A Graziani et al. High efficiency binding aptamers for a wide range of sepsis 1 bacterial agents. JMB Papers in Press. 2017: JMB16-11004.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Antibac1 (ID# 7976) | peptidoglycan | TCGCGCGAGTCGTCTGGGGACAGGGAGTGCGCTGCTCCCCCCGCATCGTCCTCCC | https://www.aptagen.com/apta-index/ | Other | null | null | 268.5 nM |
A Graziani et al. High efficiency binding aptamers for a wide range of sepsis 1 bacterial agents. JMB Papers in Press. 2017: JMB16-11004.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Antibac 2 (ID# 7977) | peptidoglycan | TCGCGCGAGTCGTCTGGGGGACTAGAGGACTTGTGCGGCCCCGCATCGTCCTCCC | https://www.aptagen.com/apta-index/ | Other | null | null | 195.9 nM |
Ferreira IM, de Souza Lacerda CM, de Faria LS, Corrêa CR, de Andrade AS. Selection of peptidoglycan-specific aptamers for bacterial cells identification. Appl Biochem Biotechnol. 2014 Dec;174(7):2548-56. doi: 10.1007/s12010-014-1206-6. Epub 2014 Sep 4. PMID: 25185503.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Antibac1 (ID# 7982) | Peptidoglycan | TCGCGCGAGTCGTCTGGGGACAGGGAGTGCGCTGCTCCCCCCGCATCGTCCTCCC | https://www.aptagen.com/apta-index/ | Other | null | null | 415 nM |
Mao, Yu et al. “Evolution of a highly functional circular DNA aptamer in serum.” Nucleic acids research vol. 48,19 (2020): 10680-10690. doi:10.1093/nar/gkaa800Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | CTBA4T-B1 (ID# 8088) | Thrombin | ATCTCGAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTTGGCTGACTCGT | https://www.aptagen.com/apta-index/ | Peptide | null | null | 19 pM |
Anisuzzaman, S., Banerjee, S., Jiang, N., Shrotriya, P., & Nilsen‐Hamilton, M. (2022). Selection and development of aptamers for pyoverdine. The FASEB Journal, 36(S1). https://doi.org/10.1096/fasebj.2022.36.s1.l7887https://www.researchgate.net/profile/Sharif-Anisuzzaman/publication/359769298_Selection_and_development_of_aptamers_for_Pyoverdine/links/624daf76b0cee02d6954821d/Selection-and-development-of-aptamers-for-Pyoverdine.pdfMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Pyoverdine Aptamer (ID# 8197) | Pyoverdine | CCAAAGAGCACUCCAUUCGAUGGUCGUUUUUCGCACAUUCGCUCCGCGAUAGACG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 100 nM |
Lupold, Shawn, et al. "Identification and Characterization of Nuclease-stabilized RNA Molecules That Bind Human Prostate Cancer Cells via the Prostate-specific Membrane Antigen." American Association for Cancer Research Journal 62, (2002): 4029-4033Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | PSMA Aptamer (A10-3) (ID# 7498) | PSMA | GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCUCAUCGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Lu et al. "New highly sensitive and selective catalytic DNA biosensors for metal ions." Biosensors and Bioelectronics, 18(2003): 529-540.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Pb(II) (ID# 7593) | Pb(II) | ACTCACTATGGAAGAGATGGCGACATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 4 nM |
Liu, C., Lu, C., & Shi, G. (2020). Selection, identification, and application of DNA aptamers against bovine pregnancy-associated glycoproteins 4. Analytical and Bioanalytical Chemistry. doi:10.1007/s00216-020-02666-wMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | A10 (ID# 8138) | Bovine pregnancy-associated glycoproteins (bPAGs) | TTGAAGTGACTCCGCACTGGGTGGGTGGGAGGGTCGTGCGGCTGGTCATAGCAGGGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 11.7 nM |
P Sazani, R Larralde, and J Szostak.(2004) "A Small Aptamer with Strong and Specific Recognition of the Triphosphate of ATP." J Am Chem Soc. 126: 8370-8371.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Adenosine Triphosphate (1-1MIN) (ID# 7510) | Adenosine Triphosphate / ATP | GGGAGAUCUACGGAUCUCAGGGCUCUUACGGGAGCUACAUGGAAGGAGUCCAUGUGU | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 4.8 µM |
Burnette et al. "RNA Aptamer Therapy for Vaso-Occlusion in Sickle Cell Disease." Nucleic Acids Therapeutics, 21(2011): 275-283. Jenison et al. "Oligonucleotide Inhibitors of P-Selectin Dependent Neutrophil-Platelet Adhesion." Antisense & Nucleic Acid Development, 8(1998): 265-279.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | P-Selectin (PF377) (ID# 7614) | P-Selectin | ACGCUCAACGAGCCAGGAACAUCGACGUCAGCAAACGCGAGCGCAACCAGUAACACC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Mannironi, C., et al. "In Vitro Selection of Dopamine RNA Ligands." Biochemistry, 36 (1997): 9726-9734.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Dopamine (dopa1.30/c.30) (ID# 7767) | Dopamine | GUCUCUGUGUGCGCCAGAGAACACUGGGGCAGAUAUGGGCCAGCACAGAAUGAGGCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | Not Mentioned in Database |
R Walsh and M DeRosa. Retention of function in the DNA homolog of the RNA dopamine aptamer. Biochem. Biophys. Res. Commun. 388(2009): 732-735.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Dopamine (DNA version of dopa1.30/c.30) (ID# 7768) | Dopamine | GTCTCTGTGTGCGCCAGAGAACACTGGGGCAGATATGGGCCAGCACAGAATGAGGCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 0.7 µM |
Z. Huang et al. RNA aptamers selected against the GluR2 glutamate receptor channel. Biochemistry 46(2007): 12648 - 12655. Z. Huang et al. One RNA aptamer sequence, two structures: a collaborating pair that inhibits AMPA receptors. Nucleic Acids Res.. 37(2009): 4022 - 4032Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | AMPA GluR2 (AN58) (ID# 7809) | AMPA GluR2 Glutamate Receptor Channel | GGGCGAAUUCAACUGCCAUCUAGGCAGUAACCAGGAGUUAGUAGGACAAGUUUCGUCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 419 pM |
Yuan Zheng, Jing Qu, Fenqin Xue, Yan Zheng, Bo Yang, Yongchang Chang, Hui Yang, Jianliang Zhang, Novel DNA Aptamers for Parkinson’s Disease Treatment Inhibit α-Synuclein Aggregation and Facilitate its Degradation, Molecular Therapy - Nucleic Acids, Volume 11, 2018, Pages 228-242, ISSN 2162-2531Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | F5R1 (ID# 8218) | alpha-synuclein | ATCGAGTGTGTACGGGGTCCGGTAGGGTGGCGAGGTCTTCCTGTCGTAGCAGGATCCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.40 nM |
Kubik, Mark F., et al. "Isolation and Characterization of 2ƒ??-Fluoro-, 2ƒ??-Amino-, and 2ƒ??-Fluoro-/Amino-Modified RNA Ligands to Human IFN-7 That Inhibit Receptor Binding." Journal of Immunology, 159 (1997): 259-267.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Interferon-γ (2’F-1) (ID# 7771) | Interferon-y/IFN-y/IFNG | GGGAGGACGAUGCGGACACCGUUAAUCUGAGGCCCUGUCCUAUUCCUUCACGCCUCAGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 4.4 nM |
Cao B, Hu Y, Duan J, Ma J, Xu D, et al. (2014) Selection of a Novel DNA Aptamer for Assay of Intracellular Interferon-Gamma. PLoS ONE 9(5): e98214. doi:10.1371/journal.pone.0098214Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | B1-4 (ID# 7903) | IFN-Gamma | CCGCCCAAATCCCTAAGAGAAGACTGTAATGACATCAAACCAGACACACTACACACGCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 74.5 nM |
Li, H. et al. Aptamer selection for the detection of Escherichia coli K88. 2011. Canadian Journal of Microbiology 57.6: 453-9.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Enterotoxigenic Escherichia coli (E. coli) fimbriae protein K88 (clone 37) (ID# 7924) | K88 | GAGACCGTACCATCTGTTCGTGGAAGCGCTTTGCTCGTCCATTAGCCTTGTGCTCGTGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 25 nM |
Wang, J., Gong, Q., Maheshwari, N., Eisenstein, M., Luz Arcila, M., Kosik, K., & Soh, T. Particle Display: A Quantitative Screening Method for Generating High-Affinity Aptamers. Angew. Chem. Int. Ed. 2014, 53, 4796ƒ??4801Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | ApoE 06 (ID# 7963) | Apolipoprotein E | GATAAACGCCTTGATTAAAGGCCCAGTTCTTTAGGCCTACACGTGCTGCGACATTAATT | https://www.aptagen.com/apta-index/ | Protein | null | null | 938 pM |
Cao, B., Hu, Y., Duan, J., Ma, J., Xu, D., & Yang, X. D. (2014). Selection of a novel DNA aptamer for assay of intracellular interferon-gamma. PloS one, 9(5), e98214.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Interferon-Gamma (ID# 7971) | Interferon-gamma (IFN-c) | CCGCCCAAATCCCTAAGAGAAGACTGTAATGACATCAAACCAGACACACTACACACGCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 74.5 nM |
Chinnappan R, Zaghloul NS, AlZabn R, Malkawi A, Abdel Rahman A, Abu-Salah KM, Zourob M. Aptamer selection and aptasensor construction for bone density biomarkers. Talanta. 2021 Mar 1;224:121818. doi: 10.1016/j.talanta.2020.121818. Epub 2020 Oct 29. PMID: 33379043.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | BC1 (ID# 8099) | Osteocalcin (OC) | ATGACGGGGGTCTAGGCAAGTAATAACGGGGGCAAGCTTTTCTATCTCGTTCTAGGGTA | https://www.aptagen.com/apta-index/ | Protein | null | null | 69.34 nM |
Chinnappan R, Zaghloul NS, AlZabn R, Malkawi A, Abdel Rahman A, Abu-Salah KM, Zourob M. Aptamer selection and aptasensor construction for bone density biomarkers. Talanta. 2021 Mar 1;224:121818. doi: 10.1016/j.talanta.2020.121818. Epub 2020 Oct 29. PMID: 33379043.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | OC10 (ID# 8100) | beta-crosslap (BC) | ATGAGTAGTGCGGAGGGATGTGAATACTGACGCGGTCATAGTCGCTGTTGTACCATTGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 148.4 nM |
Eissa S, Alkhaldi S, Chinnappan R, Siddiqua A, Abduljabbar M, Abdel Rahman AM, Dasouki M, Zourob M. Selection, characterization, and electrochemical biosensing application of DNA aptamers for sepiapterin. Talanta. 2020 Aug 15;216:120951. doi: 10.1016/j.talanta.2020.120951. Epub 2020 Mar 20. PMID: 32456943.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | SP3 (ID# 8112) | Sepiapterin reductase deficiency (SR) | AAGGATGACTGACGACGATGGGAATGGAGAGGAAGGGGATATAGGTATGTTGGATGTAG | https://www.aptagen.com/apta-index/ | Other | null | null | 37.3 nM |
Yu, F., Li, H., Sun, W., Xu, D. and He, F., 2019. Rapid selection of aptamers based on protein microarray. RSC advances, 9(17), pp.9762-9768.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | YFL-4 (ID# 8179) | Lactoferrin | GCAGGACACCGTAACACGGGCTGATGCTCTCTTTATTTTACCTAAATAAAGTGTCCTGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.953 nM |
Müller J, Wulffen B, Pötzsch B, Mayer G. Multidomain targeting generates a high-affinity thrombin-inhibiting bivalent aptamer. Chembiochem. 2007 Dec 17;8(18):2223-6. doi: 10.1002/cbic.200700535. PMID: 17990265.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HD1-60.29-15dA (ID# 8223) | Thrombin | GGTTGGTGTGGTTGGAAAAAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT | https://www.aptagen.com/apta-index/ | Protein | null | null | 4.9 nM |
Leva, S., et al. "GnRH Binding RNA and DNA Spiegelmers: A Novel Approach toward GnRH Antagonism." Chemistry and Biology, 9 (2002): 351-359.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | L-DNA | Gonadotropin-releasing hormone 1 (60-mer S42) (ID# 7493) | Gonadoliberin/Gonadotropin-releasing hormone 1 (GnRH) | GCGGCGGAGGGTGGGCTGGGGCTGGGCCGGGGGGCGTGCGTAAGCACGTAGCCTCGCCGC | https://www.aptagen.com/apta-index/ | Peptide | null | null | 45 nM |
Berens C, Thain, A, Schroeder R. (2001) A tetracycline-binding RNA aptamer. Bioorg Med Chem. 9:2549-2556.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Tetracycline (cb28 minimer) (ID# 7522) | Tetracycline | GGCCUAAAACAUACCAGAUUUCGAUCUGGAGAGGUGAAGAAUUCGACCACCUAGGCCGGU | https://www.aptagen.com/apta-index/ | Small Organic | null | null | ~1 µM |
M Ikanovic et al. Fluorescence assay based on aptamer-quantum dot binding to Bacillus thuringiensis spores. J Fluoresc 17(2007): 193-199Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Bacillus thuringiensis spores (ID# 7756) | Bacillus thuringiensis spores | CATCCGTCACACCTGCTCTGGCCACTAACATGGGGACCAGGTGGTGTTGGCTCCCGTATC | https://www.aptagen.com/apta-index/ | Cells | null | null | Not Mentioned in Database |
Ng A, Zourob M, et al. (2012) Selection, characterization and biosensing application of high affinity congener-specific microcystin-targeting aptamers. Environ. Sci. Technol. 46: 10697-10703.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Microcystin (RC6) (ID# 7827) | Microcystin | CACGCAACAACACAACATGCCCAGCGCCTGGAACATATCCTATGAGTTAGTCCGCCCACA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 28-61 nM |
Ng A, Zourob M, et al. (2012) Selection, characterization and biosensing application of high affinity congener-specific microcystin-targeting aptamers. Environ. Sci. Technol. 46: 10697-10703.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Microcystin-LR (AN6) (ID# 7828) | Microcystin-LR | GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCTCCGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 50 nM |
Nonaka, Y. "Affinity Improvement of a VEGF Aptamer by in Silico Maturation for a Sensitive VEGF-Detection System." Anal. Chem., 85 (2013): 1132-1137.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | VEGF (3R02 bivalent) (ID# 7857) | Vascular Endothelial Growth Factor (VEGF) | TGTGGGGGTGGACTGGGTGGGTACCTTTTTTTTTTTGTGGGGGTGGACTGGGTGGGTACC | https://www.aptagen.com/apta-index/ | Protein | null | null | 30 pM |
Boltz A, Plater B, Hock B, et al. (2011) Bi-specific Aptamers Mediating Tumour Cell Lysis. J Biol Chem 286: 21896-21905Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Fcγ receptor IIIα / CD16α (CLN0020) (ID# 7859) | FcγrIIIα / FcgrIIIa / CD16a | GGAGGGAAAAGTTATCAGGCCACTGCGGGGGTCTATACGTGAGGAAGAAGTGGGCAGGTC | https://www.aptagen.com/apta-index/ | Protein | null | null | 22 nM |
Eissa, S., Ng, A., Siaj, M., Tavares, A., and Zourob, M. "Selection and Identification of DNA Aptamers against Okadaic Acid for Biosensing Application." Analytical Chemistry 85.24 (2013): 11794-801.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Okadaic Acid Aptamer (OA-34) (ID# 7877) | Okadaic acid | GGTCACCAACAACAGGGAGCGCTACGCGAAGGGTCAATGTGACGTCATGCGGATGTGTGG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 77 nM |
(1) Bogomolova, A., Aldissi, M. ƒ??Real-time and label-free analyte detection in a flow-through mode using immobilized fluorescent aptamer/quantum dots molecular switches.ƒ? Biosensors and Bioelecgtronics, 66 (2015): 290-296. (2) Lou, X., et al. ƒ??Micromagnetic selection of aptamers in microfluidic channels.ƒ? PNAS, 106, 9 (2009): 2989-2994.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Botulinum neurotoxin type A (BoNT A) Aptamer (ID# 7952) | BoNT A Light Chain (BoNT/A-rLc) | CTTGAGTGTCATGGACGTTCCGGTCTTGGGCGGGATATTTGTTTGTTTTCTGCCTATGTT | https://www.aptagen.com/apta-index/ | Protein | null | null | 34 nM |
Wang, J., Gong, Q., Maheshwari, N., Eisenstein, M., Luz Arcila, M., Kosik, K., & Soh, T. Particle Display: A Quantitative Screening Method for Generating High-Affinity Aptamers. Angew. Chem. Int. Ed. 2014, 53, 4796ƒ??4801Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Thrombin 03 (ID# 7962) | Thrombin | CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG | https://www.aptagen.com/apta-index/ | Protein | null | null | 7.03 pM |
Wang, J., Gong, Q., Maheshwari, N., Eisenstein, M., Luz Arcila, M., Kosik, K., & Soh, T. Particle Display: A Quantitative Screening Method for Generating High-Affinity Aptamers. Angew. Chem. Int. Ed. 2014, 53, 4796ƒ??4801Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | PAI-1 01 (ID# 7964) | Plasminogen Activator Inhibitor-1 | CATTGAGATAGCTAGTTGTAGCTGCGTCATAGGCTGGGTTGGGTCTAGTGGTTGGGTGTG | https://www.aptagen.com/apta-index/ | Protein | null | null | 339 pM |
Wang, J., Gong, Q., Maheshwari, N., Eisenstein, M., Luz Arcila, M., Kosik, K., & Soh, T. Particle Display: A Quantitative Screening Method for Generating High-Affinity Aptamers. Angew. Chem. Int. Ed. 2014, 53, 4796ƒ??4801Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | 4-1BB 07 (ID# 7965) | 4-1BB Ligand | GTCAGATTCCACTATAGTAGGTTGGGTAGGGTGGTCGCAGTGGATGATATGTCGTAGGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.32 nM |
Paige, J. S., Wu, K. Y., & Jaffrey, S. R. (2011). RNA Mimics of Green Fluorescent Protein. Science, 333(6042), 642–646. doi:10.1126/science.1207339Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Spinach (ID# 8022) | 3,5-dimethoxy-4-hydroxybenzylidene imidazolinone (DHMBI) | GGGCUAUUGCUGGAGGGGCGCCACAUGAAAGUGGUGGUUGGGUGCGGUCGGCGAUAGCUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 512 nM |
Pęcak, Aleksandra, et al. “Anti-CD44 DNA Aptamers Selectively Target Cancer Cells.” Nucleic Acid Therapeutics, vol. 30, no. 5, 2020, pp. 289–298., doi:10.1089/nat.2019.0833.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | s5rev (ID# 8035) | CD44 | CATGCTTCCCCAGGGAGATGACCGGGGCGTACACCGTCGCGGCACATGTCTGAATGCGTTTAGTCTCTGTGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 238 nM |
Qiao, N., Li, J., Wu, X., Diao, D., Zhao, J., Li, J., … Lou, X. (2019). Speeding up in vitro Discovery of Structure-Switching Aptamers via Magnetic Cross-Linking Precipitation. Analytical Chemistry. doi:10.1021/acs.analchem.9b00081Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anti-HSA Structure-switching Aptamer (ID# 8060) | HSA (Human Serum Albumin) | CGTACCGGCCAGTGATTACGACGAGACGAGCTTATGCGTATTGATGCCTAACTATCTACA | https://www.aptagen.com/apta-index/ | Protein | null | null | 20 ± 4 nM |
Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | S6-1 (ID# 8061) | human malignant glioma cell line SHG44 | TCAAGTCACAGGTTCCAGGTAATACCTAAGGGTATGCTCTCGCCTATTATATGGAGCACG | https://www.aptagen.com/apta-index/ | Cells | null | null | 44 ± 15 nM |
Saad, M.; Chinerman, D.; Tabrizian, M.; Faucher, S. Identification of two aptamers binding to Legionella pneumophila with high affinity and specificity. Sci Rep. 2020 Jun 4; 10: 9145. doi: 10.1038/s4598-020-65973-3. PMCID: PMC7272621. PMID: 32499557.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | R10C1 (ID# 8121) | Legionella pneumophila (Lp) | GCAATGGTACGGTACTTCCCCACCCCACGCTGCTCCCAAAAGTGCACGCTACTTTGCTAA | https://www.aptagen.com/apta-index/ | Other | null | null | 135 nM |
Kim, S.; Choi, J.; Kim, A.; Lee, S.; Yoon, M. Development of ssDNA Aptamers for Diagnosis and Inhibition of the Highly Pathogenic Avian Influenza Virus Subtype H5N1. Biomolecules 2020 July 28; 10(8): 1116. DOI: 10.3390/biom10081116.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HBA1 (ID# 8130) | Avian Influenza Virus Subtype H5N1 | ATGCGGATCCCGCGCGCGACCGTGTCAGCGGGGACTAGCGGTGTAGCGCGAAGCTTGCGC | https://www.aptagen.com/apta-index/ | Other | null | null | 70 nM |
Kim, S.; Choi, J.; Kim, A.; Lee, S.; Yoon, M. Development of ssDNA Aptamers for Diagnosis and Inhibition of the Highly Pathogenic Avian Influenza Virus Subtype H5N1. Biomolecules 2020 July 28; 10(8): 1116. DOI: 10.3390/biom10081116.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HBA2 (ID# 8131) | Avian Influenza Virus Subtype H5N1 | ATGCGGATCCCGCGCGGGTCTGAGGAGTGCGCGGTGCCAGTGAGTGCGCGAAGCTTGCGC | https://www.aptagen.com/apta-index/ | Other | null | null | 122 nM |
Li, J., Ren, X., Zhao, J., & Lou, X. (2021). PD-L1 aptamer isolation via Modular-SELEX and its applications in cancer cell detection and tumor tissue section imaging. The Analyst, 146(9), 2910–2918. https://doi.org/10.1039/d1an00182eMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Clon-3 (ID# 8193) | PD-L1 | CCCTCCTCCTAACTGTTCCTACGAAACGAGCTTATGCGTAATGATGACTGTCGTAGTTCG | https://www.aptagen.com/apta-index/ | Protein | null | null | 70.1 ± 14.2 nM nM |
Ohk, S.H., Koo, O.K., Sen, T., Yamamoto, C.M., Bhunia, A.K., 2010. Antibody-aptamer functionalized fibre-optic biosensor for specific detection of listeria monocytogenes from food. J. Appl. Microbiol. 109, 808–817.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | A8 (ID# 8213) | Listeria monocytogenes Internalin A | GGAGACCGTACCATCTGTTCGTGGAAGCGCTTTGCTCGTCCATTAGCCTTGTGCTCGTGC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Feng et al. "A SELEX-Screened Aptamer of Human Hepatitis B Virus RNA Encapsidation Signal Suppresses Viral Replication." PLoS One, 6(2011): e27862Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Hepatitis B Virus (HBV) Polymerase (P protein) (A9) (ID# 7644) | Hepatitis B Virus (HBV) Polymerase (P protein) | UGUUCAUGUCCUACUGUUCAAACAAAAAAACUGUGCACAAAAAUAAAUUGGGGCAUGGACA | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
M Mie et al. (2012) Selection of DNA aptamers with affinity for Pro-gastrin-Releasing Peptide (proGRP), a tumor marker for small cell lung cancer. Appl. Biochem. Biotechnol. Published Online ahead of Print: DOI 10.1007/s12010-012-9956-5Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Pro-Gastrin Releasing Peptide (ID# 7836) | Pro-gastrin releasing peptide (proGRP) | ATACCAGCTTATTCAATTTGCACCACTTATTGTTACTAATCTGAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.2 µM |
Jorge A. Cruz-Aguado, Gregory Penner, "Determination of Ochratoxin A with a DNA Aptamer", J. Agric. Food Chem. (2008), 56, 10456-10461.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Aptamer 1.12 (ID# 7900) | Ochratoxin A (OTA) | TGGTGGCTGTAGGTCAGCATCTGATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAACG | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.36 µM |
Torabi, S., Wu, P., McGhee, C., Chen, L., Hwang, K., Zheng, N., Cheng, J., & Lu, Y. (2015) In Vitro Selection of a Sodium-Specific DNAzyme and its Application in Intracellular Sensing. PNAS 112, (19):5903-5908Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | NaA43 (ID# 7955) | Sodium Ion | GCGGCGGTACCAGGTCAAAGGTGGGTGAGGGGACGCCAAGAGTCCCCGCGGTTACATAGAG | https://www.aptagen.com/apta-index/ | Other | null | null | 39.1 mM |
Meng, L. (2012). Targeted delivery of chemotherapy agents using liver cancer-specific aptamer. PloS One, 7(4), doi: 10.1371Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Human Hepatocellular carcinoma (TLS11a) (ID# 7672) | Human Hepatocellular carcinoma cell line (LH86) | ACAGCATCCCCATGTGAACAATCGCATTGTGATTGTTACGGTTTCCGCCTCATGGACGTGCTG | https://www.aptagen.com/apta-index/ | Cells | null | null | 7.16 nM |
Seiwert, S., et al. "RNA aptamers as pathway-specific MAP kinase inhibitors." Chemistry & Biology, 7(2000): 833-834.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | ERK1/ ERK2 (Family II – Truncated) (ID# 7845) | Extracellular Regulated Kinase 1 and 2 (ERK 1 and ERK2) | GGAAAGACGCUAGCGAAUUGGUUCCUCGAAAGGGGAAAGCGUUAUUAAGAAACCAAAAUUUCC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Bing, T., Shangguan, D., & Wang, Y. (2015). Facile Discovery of Cell-Surface Protein Targets of Cancer Cell Aptamers. Molecular & Cellular Proteomics, 14(10), 2692–2700. doi:10.1074/mcp.m115.051243Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Sgc-3b (ID# 8069) | Selectin L. | TTTACTTATTCAATTCCCGTGGGAAGGCTATAGAGGGGCCAGTCTATGAATAAGTTT | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Wu X, Li F, Li Y, Yu Y, Liang C, Zhang B, Zhao C, Lu A, Zhang G. A PD-L1 Aptamer Selected by Loss-Gain Cell-SELEX Conjugated with Paclitaxel for Treating Triple-Negative Breast Cancer. Med Sci Monit. 2020 Jun 23;26:e925583. doi: 10.12659/MSM.925583. PMID: 32574155; PMCID: PMC7331476.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | XQ-P3 (ID# 8137) | PD-L1 | ACCGACCGTGCTGGACTCATCTCGCTTTTTTCACGGTCCACACTACTATGAGCGAGCCTGGCG | https://www.aptagen.com/apta-index/ | Protein | null | null | 15.36 nM |
Ken-ichiro Matsunaga, Michiko Kimoto, Vanessa Weixun Lim, Hui Pen Tan, Yu Qian Wong, William Sun, Shawn Vasoo, Yee Sin Leo, Ichiro Hirao, High-affinity five/six-letter DNA aptamers with superior specificity enabling the detection of dengue NS1 protein variants beyond the serotype identification, Nucleic Acids Research, 2021;, gkab515, https://doi.org/10.1093/nar/gkab515Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | AptD2 (ID# 8163) | DEN-NS1 | GGCTGGTCCGCTGGGAACAAGGGCGGGAGGGAGGGTGTGGGTGCGACAAGCGGACCAGCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 104 nM |
Watanabe et al. "Isolation of RNA aptamers against human Toll-like receptor 3 ectodomain." Nucleic Acids Symposium Series No. 50 (2006): 251-252.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | TLR3-ECD (Family-1) (ID# 7606) | Toll-like receptor 3 Ectodomain | GGUAGAUACGAUGGAUACCCCCUGUGGCCCGUCAACACAGGGGAAGUGGCAUGACGCGCAGCCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.1 nM |
Lee at al. "In vitro selection of Escherichia coli O157:H7-specific RNA aptamer." Biochemical and Biophysical Research Communications, 417(2012): 214-220.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | Chimeric | Escherichia coli (E. coli) O157:H7 (ID# 7660) | Escherichia coli (E. coli) O157:H7 | GGGUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAUAGAUAGUAA | https://www.aptagen.com/apta-index/ | Cells | null | null | 110 nM |
H. Hasegawa et al. Improvement of aptamer affinity by dimerization. Sensors 8(2008): 1090-1098.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Thrombin (15mer-29-mer dimer with 20T linker) (ID# 7812) | Thrombin | GGTTGGTGTGGTTGGTTTTTTTTTTTTTTTTTTTTAGTCCGTGGTAGGGCAGGTTGGGGTGACT | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.35 nM |
E F Neufeld et al. Aptamer-based endocytosis of a lysosomal enzyme. Proc. Natl. Acad. Sci. USA 105(2008): 15908-15913Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Mouse Transferrin Receptor (GS24) (ID# 7814) | Mouse Transferrin Receptor (mTfR) | GAATTCCGCGTGTGCACACGGTCACAGTTAGTATCGCTACGTTCTTTGGTAGTCCGTTCGGGAT | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Tran DT, et al. (2010) Selection and characterization of DNA aptamers for egg white lysozyme. Molecules 15: 1127 - 1140. Zou M et al. (2012) The homogeneous fluorescence anisotropic sensing of salivary lysozyme using the 6-carboxyfluorescein-labeled DNA aptamer. Biosens. Bioelectron. 32: 148-154.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Lysozyme (Apt 60) (ID# 7822) | Hen egg white lysozyme and recombinant human lysozyme | AGCAGCACAGAGGTCAGATGGCAGGTAAGCAGGCGGCTCACAAAACCATTCGCATGCGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 3-Feb nM |
Xu, D., Chatakonda, V., Kourtidis, A., Conklin, D., and Shi, H. "In Search of Novel Drug Target Sites on Estrogen Receptors Using RNA Aptamers." Nucleic acid therapeutics 24.3 (2014): 227-38.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Estrogen Aptamer (AptER-1) (ID# 7879) | Apo-estrogen receptor alpha | GGGCAGACGCACCGCGAACAAAACGCAAGACAGAGTGCCGACAAGAGCACTACAAGCTTCTGCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 16 nM |
Chatterjee, B., Kalyani, N., Anand, A., Khan, E., Das, S., Bansal, V., … Sharma, T. K. (2020). GOLD SELEX: a novel SELEX approach for the development of high-affinity aptamers against small molecules without residual activity. Microchimica Acta, 187(11). doi:10.1007/s00604-020-04577-0Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | GNP DV2 (ID# 8072) | Dichlorvos (DV) | GGAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 0.85 nM |
Urvil, P., et al. "Selection of RNA aptamers that bind specifically to the NS3 protease of hepatitis C virus." European Journal of Biochemistry, 248(1997):130-138.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Hepatitis C NS3 Protein (10G-1) (ID# 7535) | Hepatitis C NS3 Protein | GGGAGAGCGGAAGCGUGCUGGGCCAGUAGUGUAUAGGGCUCGAAAUGUUCAUGGCUCAGUGGACAU | https://www.aptagen.com/apta-index/ | Protein | null | null | 990 pM |
L Barthelmebs et al. Enzyme-linked aptamer assays (ELAAs), based on a competition format for a rapid and sensitive detection of ochratoxin A in wine. Food Control 22(2011): 737-743Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Ochratoxin A (H12) (ID# 7757) | Ochratoxin A (OTA) | GGGAGGACGAAGCGGAACCGGGTGTGGGTGCCTTGATCCAGGGAGTCTCAGAAGACACGCCCGACA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 96 nM |
Parekh, P. et al. "Biostable ssDNA Aptamers Specific for Hodgkin Lymphoma." Sensors 2013, 13: 14543-14557.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Hodgkin Lymphoma aptamer (ID# 7886) | HDLM2 | TACCAGTGCGATGCTCAGTAACTTTGAAGGAAAGGCTACAAACTCTTCCTGACGCATTCGGTTGAC | https://www.aptagen.com/apta-index/ | Cells | null | null | 10 nM |
Barfod, Anders et al. "In Vitro Selection of RNA Aptamers Directed Against Protein E: A Haemophilus influenzae Adhesin." Mol Biotech, 2014: 1-12.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Clone 2 (ID# 7902) | Protein E (PE) | CGACUGCAGAGCUUGCUACGUUGUAAUUCAAAACAAAGGUUUCCUGGACUCCCCGCAGGUCUUGUGAAUGGUACCGAGCUCGAAUUCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.2 nM |
Wang M, Wu H, Li Q, Yang Y, Che F, Wang G, Zhang L. Novel Aptamer-Functionalized Nanoparticles Enhances Bone Defect Repair By Improving Stem Cell Recruitment. Int J Nanomedicine. 2019;14:8707-8724https://doi.org/10.2147/IJN.S223164Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HM69 (ID# 8023) | Human Embryonic Stem Cells (hESC cells) | TGCGTGTGTAGTGTGTCTGCATGCCCCTGTAATCGCCCATGGGTAGCCTCTTAGGGATTTGGGCGG | https://www.aptagen.com/apta-index/ | Cells | null | null | 9.67 nM |
Zhang, L., Wang, M., Zhu, Z., Chen, S., Wu, H., Yang, Y., Che, F., Li, Q., & Li, H. (2021). A GD2-aptamer-mediated, self-assembling nanomedicine for targeted multiple treatments in neuroblastoma theranostics. Molecular therapy. Nucleic acids, 26, 732–748. https://doi.org/10.1016/j.omtn.2021.08.021Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | DB99 (Clone A) (ID# 8196) | GD2 | CCGCCCAAATCCCTAAGAGCACAAACACCAAACACAACCACCCCAACCAGACACACTACACACGCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 21.21 nM |
Sequence from C Mannironi, et al. "In Vitro Selection of Dopamine RNA Ligands." Biochemistry, 36 (1997): 9726-973. Enzyme-linked assay from H Park and I R Paeng. "Development of direct competitive enzyme-linked aptamer assay for determination of dopamine in serum." Analytica Chimica Acta, 685 (2011): 65-73.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Dopamine (dopa2/c.4) (ID# 7766) | Dopamine | GGGAAUUCCGCGUGUGCGCCGCGGAAGAGGGAAUAUAGAGGCCAGCACAUAGUGAGGCCCUCCUCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | Not Mentioned in Database |
Klug, S. J. et al. "In vitro selection of RNA aptamers that bind special elongation factor SelB, a protein with multiple RNA-binding sites, reveals one major interaction domain at the carboxyl terminus." RNA, 1995 5: 1180 - 1190.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Clone 488 (ID# 7915) | SelB | GCGCTAAGTCCTCGCTCAGCCCAUAAGUUGUCCCAAGUCUUGGGCGCAAAUACAUCCCACGCGCGACTCGGATCCG | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
X Liu, et al. "RNA aptamers speci?c for bovine thrombin." Journal of Molecular Recognition, 16 (2003): 23-27. X Liu, et al. "Screening of functional antidotes of RNA aptamers against bovine thrombin." FEBS Lett. 562(2004): 125-128Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Bovine Thrombin (T7 05 RNA) (ID# 7472) | Bovine Thrombin | GCAAUGGUACGGUACUUCCUUUGGAAGAUAGCUGGAGAACUAACCAAAAGUGCACGCUACUUUGCUAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 164 nM |
Sefah, Kwame, et al. "Molecular recognition of acute myeloid leukemia using aptamers." Leukemia, 23 (2009):235-244Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Acute myeloid leukemia cells (KH1C12) (ID# 7483) | Acute myeloid leukemia cells (HL60) | ATCCAGAGTGACGCAGCATGCCCTAGTTACTACTACTCTTTTTAGCAAACTGGACACGGTGGCTTAGT | https://www.aptagen.com/apta-index/ | Cells | null | null | 4.5 nM |
Adachi, H et al. (2011). Antagonistic rna aptamer specific to a heterodimeric form of human interleukin-17a/f. Biochimie, 93(2011), 1081-1088. doi: 10.1016/j.biochi.2011.04.003Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Interleukin 17A/F (IL-17A/F) (AptAF42dope1) (ID# 7706) | Interleukin-17A/F | GGGCUAGCUGAUCGUACCAGUAGCGUGGCCUGGGGGGCCUAGUCGUGCGAUACUAACAGCUAACACCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 35.8 nM |
S Gomes et al. A 99mTc-MAG3-aptamer for imaging human tumours associated with high level of matrix metalloproteinase-9. Bioconjugate Chem. (2012). Accepted for print. DOI: 10.1021/bc300146c.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Human Matrix Metalloprotease 9 (hMMP-9) (F3) (ID# 7742) | Human matrix metalloprotease 9 (hMMP-9) | GGUUACCAGCCUUCACUGCUCCCGGACGCGUCUGUAUCCGCUACCCGCCGCACCACGGUCGGUCACAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 8.1 nM |
Fechter, P.; Cruz Da Silva, E.; Mercier, M.C.; Noulet, F.; Etienne-Seloum, N.; Guenot, D.; Lehmann, M.; Vauchelles, R.; Martin, S.; Lelong-Rebel, I.; Ray, A.M.; Seguin, C.; Dontenwill, M.; Choulier, L. RNA Aptamers Targeting Integrin a5B1 as Probes for Cyto- and Histofluorescence in Glioblastoma. Mol. Ther. –Nucleic Acids. 2019, 17, 63-77.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | H02 (ID# 7999) | Cells expressing Integrin a5B1 & Recombinant a5B1 Integrin | GGUUACCAGCCUUCACUGCGGACGGACAGAGAGUGCAACCUGCCGUGCCGCACCACGGUCGGUCACAC | https://www.aptagen.com/apta-index/ | Cells | null | null | 226-329.6 nM |
Dion, Daniels, et al. "A tenascin-C aptamer identified by tumor cell SELEX: Systematic evolution of ligands by exponential enrichment." PNAS 100(2003): 15416-15421.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Tenascin-C (GBI-10) (ID# 7477) | Tenascin-C (TNC) | GGCTGTTGTGAGCCTCCTCCCAGAGGGAAGACTTTAGGTTCGGTTCACGTCCCGCTTATTCTTACTCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 150 nM |
Adachi, H., et al. "Antagonistic RNA aptamer specific to a heterodimeric form of human interleukin-17A/F." Biochemie, 93 (2011): 1081-1088.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Interleukin-17A/F (IL-17A/F) (APTAF42) (ID# 7525) | Human Interleukin-17A/F | GGGCUAGCUGAUCGUACCCAGUAGCGUGGCAUGGGGUGCCUAGUCGGGCGAUACUAACAGCUAACACCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 72.2 nM |
Pagratis, N., et al. "Potent 2'-amino-, and 2'-fluoro-2'- deoxyribonucleotide RNA inhibitors of keratinocyte growth factor." Nature Biotechnology, 25(1997):68-73.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Keratinocyte Growth Factor (14F) (ID# 7542) | Keratinocyte Growth Factor (KGF) | GGGAGGACGAUGCGGUGGUCUCCCAAUUCUAAACUUUCUCCAUCGUAUCUGGGCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.3 pM |
Kubik, Mark F., et al. "Isolation and Characterization of 2ƒ??-Fluoro-, 2ƒ??-Amino-, and 2ƒ??-Fluoro-/Amino-Modified RNA Ligands to Human IFN-7 That Inhibit Receptor Binding." Journal of Immunology, 159 (1997): 259-267.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-NH2-RNA | Interferon-γ (2’NH2-17) (ID# 7843) | Interferon-y/IFN-y/IFNG | GGGAGGACGAUGCGGUGGUAGCGCGAUAUAGCGCUGGUAGGGUUGCCGGUGAUCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.7 nM |
Barfod, Anders et al. "In Vitro Selection of RNA Aptamers Directed Against Protein E: A Haemophilus influenzae Adhesin." Mol Biotech, 2014: 1-12.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Clone 1 (ID# 7901) | Protein E (PE) | CGACUGCAGAGCUUGCUACGUGAUCAAAUCGAGCUUUAACCCAACAGAGCAUCCGUAUCUAUCCAAAUGGGUACCGAGCUCGAAUUCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Saad M, Chinerman D, Tabrizian M, Faucher SP. Identification of two aptamers binding to Legionella pneumophila with high affinity and specificity. Sci Rep. 2020 Jun 4;10(1):9145. doi: 10.1038/s41598-020-65973-3. PMID: 32499557; PMCID: PMC7272621.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | R10C5 (ID# 8114) | Legionella pneumophila (Lp) | GCAATGGTACGGTACTTCCGGACAGTGCTGAAAACTGTGACCCCCCAAAAGTGCACGCTACTTTGCTAA | https://www.aptagen.com/apta-index/ | Other | null | null | 116 nM |
Rhodes, Andrew, et al. "The generation and characterisation of antagonist RNA aptamers to MCP-1." FEBS Letter, 506 (2001): 85-90.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | MCP-1 (ADR7) (ID# 7463) | Monocyte chemoattractant protein-1 (mouse) | GGGAGGACGAUGCGGGAACUCACCGGGAAGAAGCCCGUUCCGUCACAGACAUGUUCCGCAUCGUCCUCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 180 pM |
Kubik, Mark F., et al. "Isolation and Characterization of 2ƒ??-Fluoro-, 2ƒ??-Amino-, and 2ƒ??-Fluoro-/Amino-Modified RNA Ligands to Human IFN-7 That Inhibit Receptor Binding." Journal of Immunology, 159 (1997): 259-267.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-NH2-RNA | Interferon-? (2’NH2-30) (ID# 7469) | Interferon-y/IFN-y/IFNG | GGGAGGACGAUGCGGCAGGUAAUUACAUGAAGGUGGGUUAGGUACUUUCAGGGUCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.7 nM |
Rhodes, Andrew, et al. "The generation and characterization of antagonist RNA aptamers to human oncostatin M." Journal of Biological Chemistry, 275 (2000): 28555-28561.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | OSM (ADR58) (ID# 7499) | Human Oncostatin M (OSM) | GGGAGGACGAUGCGGAUCGCCCUGAACCGGCCCAGCAGACUGCUGACGGCACGAUCCGCAUCGUCCUCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 7 nM |
Daniels et al. "Generation of RNA Aptamers to the G-Protein-Coupled Receptor for Neurotensin, NTS-1." Journal of Analytical Biochemistry, 305(2002): 214-226.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Neurotensin receptor NTS-1 (P19) (ID# 7580) | Neurotensin receptor NTS-1 | GGGAGGACGAUGCGGACAGAUACGGAACUACAGAGGUCAAUUACGGUGGCCACGCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.37 nM |
Jennifer M. Binning, Tianjiao Wang, Priya Luthra, Reed S. Shabman, Dominika M. Borek, Gai Liu, Wei Xu, Daisy W. Leung, Christopher F. Basler, and Gaya K. Amarasinghe, ƒ??Development of RNA aptamers targeting ebolavirus VP35ƒ? Biochemistry 2013, 52, 8406-8419.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | 1G8-14 (ID# 7934) | Ebola virus inhibitory domain (eVP35 IID) (EBOV) (eVP35) | GGGAGACAAGAAUAAACGCUCAAGGCAUUUCUGCUAGUCUGGUUGUAAGAUAUUCAACACGUGAGUUUCGACAGGAGGCUCACAACAGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 3.7 nM |
Melo, M.; Correa, C.; Cunha, P.; Goes, A.; Gomes, D.; Andrade, A. DNA aptamers selection for carcinoembryonic antigen (CEA). Bioorg. Med. Chem. Lett. 2020 May 23; 30(15): 127278. DOI: 10.1016/j.bmcl.2020.127278Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Apta 3 (ID# 8123) | Carcinoembryonic antigen (CEA) | TCGCGCGAGTCGTCTGGGGGGGTGTATCGTTGACGAGTTGCGCGTGCGTCTCGTGCCGCATCGTCCTCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 60.4 nM |
Morihiro, K.; Hasegawa, O.; Kasahara, Y.; Mori, S.; Kasai, T.; Kuwahara, M.; Obika, S. Azobenzene-modified DNA aptamers evolved by capillary electrophoresis (CE)-SELEX method. Bioorg. Med. Chem. Lett. 2021 Jan 1; 31: 127607. DOI: 10.1016/j.bmcl.2020.127607.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Azo-1 (ID# 8135) | Human Thrombin | TCGCCTTGCCGGATCGCAGAGUAAGGCAGCUUACAAACAUUAAGGCACAGUGGUCCGUGAGCCUGACACC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not given. nM |
Uemachi, H.; Kasahara, Y.; Tanaka, K.; Okuda, T.; Yoneda, Y.; and S. Obika. 2021 . Hybrid-Type SELEX for the Selection of Artificial Nucleic AcidAptamers Exhibiting Cell Internalization Activity. Pharmaceutics 2021, 13, 888. https://doi.org/10.3390/pharmaceutics13060888Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | TROP2 (Tac B1) (ID# 8162) | TROP2 FcHis / Human trophoblast antigen 2 | TCGCCTTGCCGGATCGCAGATGCTGTTGTCACCTGCCTCGTCTCCCTCGTUGGUCCGUGAGCCUGACACC | https://www.aptagen.com/apta-index/ | Protein | null | null | 153 nM |
Chen, Hui, et al. "Molecular Recognition of Small-Cell Lung Cancer Cells Using Aptamers." CHEMMEDCHEM, 3 (2008): 991-1001.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Small-Cell Lung Cancer (HCH07) (ID# 7484) | Small-cell lung cancer (SCLC) cell-surface molecular markers | TACCAGTGCGATGCTCAGGCCGATGTCAACTTTTTCTAACTCACTGGTTTTGCCTGACGCATTCGGTTGAC | https://www.aptagen.com/apta-index/ | Cells | null | null | 38 nM |
Pan, Q., et al. "Aptamers That Preferentially Bind Type IVB Pili and Inhibit Human Monocytic-Cell Invasion by Salmonella enterica Serovar Typhi." Antimicrobial Agents and Chemotherapy, 49(2005): 4052-4060.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | S. Enterica Serovar Typhi IVP Pili Protein (S-PS8.4) (ID# 7532) | S. Enterica Serovar Typhi IVP Pili Protein | GGGAACAGUCCGAGCCUCACUGUUAUCCGAUAGCAGCGCGGGAUGAGGGUCAAUGCGUCAUAGGAUCCCGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 7.2 nM |
Ray, P. (2012). Comparing human pancreatic cell secretomes by in vitro aptamer selection identifies cyclophilin b as a candidate pancreatic cancer biomarker. J. Clin. Invest., 122(5), 1734-1741. doi: 10.1172/JC162385Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Cyclophilin B (M9-5) (ID# 7702) | Cyclophilin B (CypB) pancreatic cell line | GGGAGGACGAUGCGGGGACCUAUGCAGUAGCCAGUGUGGACUGGGCUGCCCCCCCCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Garrett A. Soukup and Ronald R. Breaker. "Engineering precision RNA molecular switches" Proc. Natl. Acad. Sci. 96(1999):3584-3589.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | FMN-inhibited molecular switch (ID# 7765) | flavin mononucleotide (FMN) | GGGCGACCCUGAUGAGAUGAGGAUAUGCUUCGGCAGAAGGCUCUCGAAACGGUGAAAGCCGUAGGUUGCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | na nM |
Cheng C, B Davidson, et al. (2013) In vivo SELEX for identification of brain-penetrating aptamers. Molecular Therapy - Nucleic Acids 2: e67.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Brain Penetrating Aptamer (A15) (ID# 7840) | Brain capillary endothelia and parenchyma | GGGAGGACGAUGCGGCGUAUUGCGCGAGGAUUAUCCGCUCAUCGUUGUUGUUGUGCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Tissue | null | null | Not Mentioned in Database |
Cheng C, Chen YH, Lennox KA, Behlke MA, Davidson BL. In vivo SELEX for Identification of Brain-penetrating Aptamers. Mol Ther Nucleic Acids. 2013;2(1):e67. Published 2013 Jan 8. doi:10.1038/mtna.2012.59Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | A15 (ID# 8102) | Brain Endothelia Cell | GGGAGGACGAUGCGGCGUAUUGCGCGAGGAUUAUCCGCUCAUCGUUGUUGUUGUGCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Cells | null | null | 48.74 ± 3.11 nM |
Li, Hui et al. “A Novel Aptamer LL4A Specifically Targets Vemurafenib-Resistant Melanoma through Binding to the CD63 Protein.” Molecular therapy. Nucleic acids vol. 18 (2019): 727-738. doi:10.1016/j.omtn.2019.10.005Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | LL4A (ID# 8244) | Transmembrane Protein CD63 (vemurafenib-resistant melanoma cells) | GCTGGACTCACCTCGACCAGAGCCATTGGGTTTCCTAGGAAATAGGGCCTTTACTATGAGCGAGCCTGGCGCTGGACTCACCTCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 84.63 ± 13.04 nM |
Ferreira, C., et al. "DNA Aptamers That Bi nd to MUC1 Tumour Marker: Design and Characterization of MUC1-Binding Single-Stranded DNA Aptamers." Tumor Biology, 27(2006): 289ƒ??301.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Tumour Marker MUC1 (S1.6) (ID# 7491) | Tumour Marker MUC | GGGAGACAAGAATAAACGCTCAAGCAACAGGGTATCCAAAGGATCAAATTCGACAGGAGGCTCACAACAGGC | https://www.aptagen.com/apta-index/ | Peptide | null | null | 0.2131 nM |
C-J Huang et al. "Integrated microfluidic system for rapid screening of CRP aptamers utilizing systematic evolution of ligands by exponential enrichment (SELEX)." Biosens. Bioelectron. 25(2010):1761-1766.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | C-Reactive Protein (CRP) (ID# 7719) | C-Reactive Protein (CRP) | GGCAGGAAGACAAACACGATGGGGGGGTATGATTTGATGTGGTTGTTGCATGATCGTGGTCTGTGGTGCTGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 3.51 nM |
Garrett A. Soukup and Ronald R. Breaker. "Engineering precision RNA molecular switches" Proc. Natl. Acad. Sci. 96(1999):3584-3589.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | FMN-induced molecular switch (ID# 7759) | flavin mononucleotide (FMN) | GGGCGACCCUGAUGAGCCUUAGGAUAUGCUUCGGCAGAAGGACGUCGAAACGGUGAAAGCCGUAGGUUGCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | na nM |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.