reference stringlengths 7 774 ⌀ | aptamer_chemistry stringclasses 21
values | aptamer_name stringlengths 1 164 | target_name stringlengths 2 1.2k ⌀ | aptamer_sequence stringlengths 2 380 | origin stringclasses 6
values | target_chemistry stringclasses 11
values | external_id stringclasses 509
values | target_sequence stringclasses 357
values | new_affinity stringlengths 3 193 ⌀ |
|---|---|---|---|---|---|---|---|---|---|
Ferreira-Bravo, I. A. and J. J. DeStefano. 2021. Xeno-nucleic Acid (XNA) 2'-Fluoro-Arabino Nucleic Acid (FANA) Aptamers to the Receptor Binding Domain of SARS-CoV-2 S Protein Block ACE2 Binding. bioRxivhttps://doi.org/10.1101/2021.07.13.452259Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | Chimeric | FANA R8-3 (ID# 8173) | SARS-CoV-2 S Protein | AAAAGGTAGTGCTGAATTCGGTCGCGATTAACATTAAACCGCATAAAAAGGGTGGCCGGAUUCGCUAUCCAGUUGGCCU | https://www.aptagen.com/apta-index/ | Protein | null | null | 68.1 nM |
Alemi, F, et al. The identification of single strand DNA aptamers which specifically bind to platelets using cell SELEX technique. Iranian Journal of Veterinary Science and Technology, 13 (2021): 68-83. doi: https://dx.doi.org/10.22067/ijvst.2021.72518.1079Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | APT-1 (ID# 8204) | Platelets | GCCTGTTGTGAGCCTCCTAACGACACACCAAACTGGAGCCATGCAGGTAGGAACGGGTACATGCTTATTCTTGTCTCCC | https://www.aptagen.com/apta-index/ | Cells | null | null | 109.28 nM |
Zhou N, Wang J, Zhang J, Li C, Tian Y, Wang J. Selection and identification of streptomycin-specific single-stranded DNA aptamers and the application in the detection of streptomycin in honey. Talanta. 2013 Apr 15;108:109-16. doi: 10.1016/j.talanta.2013.01.064. Epub 2013 Feb 28. PMID: 23601877.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | STR1 (ID# 8231) | Streptomycin | TAGGGAATTCGTCGACGGATCCGGGGTCTGGTGTTCTGCTTTGTTCTGTCGGGTCGTCTGCAGGTCGACGCATGCGCCG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 199.1 nM |
Mosing et al. "Capillary Electrophoresis-SELEX Selection of Aptamers with Affinity for HIV-1 Reverse Transcriptase." Analytical Chemistry, 77 (2005): 6107-6112.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HIV-1 Reverse Transcriptase (4.3) (ID# 7470) | HIV-1 RT | AGCAGCACAGAGGTCAGATGGCAGGTTTCGACGTACAATGCTATGGAGGCTTTATGATCGCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 190 pM |
Lato et al. "In vitro selection of RNA lectins: using combinatorial chemistry to interpret ribozyme evolution." Chemistry & Biology, 2(1995): 291-303.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Kanamycin A (sla 16) (ID# 7555) | Kanamycin A | GGGAAUGGAUCCACAUCUACGAAUUCACCGCGGGGUUGCGGACCGGGAGCUCCAGCUUCACUGCAGACUUGACGAAGCUU | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 300 nM |
Illangasekare and Marus. "Phenylalanine-Binding RNAs and Genetic Code Evolution." Journal of Molecular Evolution, 54(2002): 298-311.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Phenylalanine (ID# 7559) | Phenylalanine | AUUGGAUCGGUAGUAUUUAGGGUGAGACACUUCAUGCCUUUGUUGCAGGCUGGGGUGAAGGCGCUACAUGGCGUCUGAAA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 34 µM |
Mehta et al. "Selection and characterization of PCB-binding DNA aptamers." Analytical Chemistry 84(2012): 1669-1676.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | PCB72 (Aptamer 9.3) (ID# 7620) | Polychlorinated biphenyl 72 (PCB) | AGCAGCACAGAGGTCAGATGCACTCGGACCCCATTCTCCTTCCATCCCTCATCCGTCCACCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 66 nM |
Mehta et al. "Selection and characterization of PCB-binding DNA aptamers." Analytical Chemistry, 84(2012): 1669-1676.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | PCB106 (Aptamer 9.3) (ID# 7621) | Polychlorinated biphenyl 106 (PCB) | AGCAGCACAGAGGTCAGATGCACTCGGACCCCATTCTCCTTCCATCCCTCATCCGTCCACCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 99 nM |
Berezhnoy, A, et al. (2012). Isolation and optimization of murine il-10 receptor blocking oligonucleotide aptamers using high- throughput sequencing. The American Society of Gene & Cell TherapyMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Interleukin 10 (IL-10) Receptor (R5A1) (ID# 7676) | Interleukin -10 receptor (IL-10) | GGGCUCAUGCACGUUUGCUCCUGUAAUUGGCGUAUGUAACCCAGGCACCAAACACCCCAGGCCGGGCCAUGAUCCACAUA | https://www.aptagen.com/apta-index/ | Protein | null | null | 12 nM |
J Mehta et al. In vitro selection and characterization of DNA aptamers recognizing chloramphenicol. J. Biotechnol. 155(2011): 361-369.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Chloramphenicol-binding aptamer(c7) (ID# 7711) | chloramphenicol (cam) | AGCAGCACAGAGGTCAGATGACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGTGGTAGCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 0.766 µM |
C M Dollins et al. Assembling OX40 aptamers on a molecular scaffold to create a receptor-activating aptamer. Chem Biol. 15(2008):675-682.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | OX40 (Aptamer 9.8) (ID# 7726) | Murine OX40 (a tumor necrosis factor (TNF) receptor on the surface of T Cells) | GGGAGGACGAUGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACCAGACGACUCGCUGAGGAUCCGAGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 8 nM |
Wurster, S. E, and Maher, L. J. "Selection and characterization of anti-NF-kB p65 aptamers." RNA, 14(2008): 1037-1047.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Anti-NF-kB p65 (R2) (ID# 7753) | NF-kB p65 | GAAGCUUUCACACAACAAGGCCCGGGACUGUAUUAGGGAAAUUAGAGUACAGACAGUCGCCGUGGGUCGAAUUCCGCUCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 25 nM |
Garrett A. Soukup and Ronald R. Breaker. "Engineering precision RNA molecular switches" Proc. Natl. Acad. Sci. 96(1999):3584-3589.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | ATP-inhibited molecular switch (ID# 7764) | ATP | GGGCGACCCUGAUGAGAUGGGGAAGAAACUGUGGCACUUCGGUGCCAGCCUCUCGAAACGGUGAAAGCCGUAGGUUGCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | na nM |
S.D. Mendonsa and M.T. Bowser. In vitro selection of aptamers with affinity for neuropeptide Y using capillary electrophoresis. J. Am. Chem. Soc. 127(2005): 9382-9383.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Neuropeptide Y (Clone 4.31) (ID# 7805) | Neuropeptide Y (NPY) | AGCAGCACAGAGGTCAGATGCAAACCACAGCCTGAGTGGTTAGCGTATGTCATTTACGGACCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Peptide | null | null | 300 nM |
Cox JC and Ellington AD. (2001) Automated selection of anti-protein aptamers. Bioorg. Med. Chem. 9: 2525 - 2531. Kirby R, et al. (2004) Aptamer-based sensor arrays for the detection and quantitation of proteins. Anal. Chem. 76: 4066 - 4075.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Lysozyme (Clone 1) (ID# 7823) | Hen egg white lysozyme | GGGAATGGATCCACATCTACGAATTCATCAGGGCTAAAGAGTGCAGAGTTACTTAGTTCACTGCAGACTTGACGAAGCTT | https://www.aptagen.com/apta-index/ | Protein | null | null | 29-31 nM |
Lato et al. "In vitro selection of RNA lectins: using combinatorial chemistry to interpret ribozyme evolution." Chemistry & Biology, 2(1995): 291-303.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Kanamycin A (sla 110) (ID# 7831) | Kanamycin A | GGGAAUGGAUCCACAUCUACGAAUUCGAAUUGCCGUAAUUUCCCGUGGAGCGAUGCUUCACUGCAGACUUGACGAAGCUU | https://www.aptagen.com/apta-index/ | Protein | null | null | <300 nM |
ER Martin et al. (2012) Aptamer-based molecular recognition of lysergamine, metergoline and small ergot alkaloids. Int. J. Mol. Sci. 13: 17138-17159.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Lysergamine (M3.2) (ID# 7835) | Lysergamine, metergoline, and other small ergot alkaloids | AGCAGCACAGAGGTCAGATGGCGTCAGCCCCGATCGCCATCCAGGGACTCCCCCCTACTGCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 44 nM |
Fan, M. et al. "Aptamer selection express: A novel method for rapid single-step selection and sensing of aptamers." Journal of Biomolecular Technologies, 19 (2008): 311-321.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Bacillus anthracis spores (Ba) (ID# 7850) | Bacillus anthracis spores | ACCCCTGCATCCTTTGCTGGAGAGGAATGTATAAGGATGTTCCGGGCGTGTGGGTAAGTCAGTCTAGAGGGCCCCAGAAT | https://www.aptagen.com/apta-index/ | Other | null | null | 1.5x10^12 CFU/mL |
Mi et al. ƒ??In vivo selection of tumor-targeting RNA motifsƒ?. Nature Chemical Biology 1(2010): 22-24. DOI: 10.1038/NCHEMBIO.277Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | 14-16 (ID# 7865) | Mouse P68 RNA Helicase (Ddx5) | GGGAGGACGAUGCGGCAGUGCCCAACCGGAACAACAACCACCGGCGGCUCCUGCUCAGACGACUCGCUGAGGAUCCGAGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 30.8 nM |
Cho et al. "Quantitative selection of DNA aptamers through microfluidic selection and high-throughput sequencing." PNAS 2010, 1-6/Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Aptamer ID 1 (ID# 7896) | PDGF-BB | TCCCACGCATTCTCCACATCATAAGCTGAGCATCTTAGATCCCCGTCAAGGGCAGCGTAACCTTTCTGTCCTTCCGTCAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.7 nM |
Cho et al. "Quantitative selection of DNA aptamers through microfluidic selection and high-throughput sequencing." PNAS 2010, 1-6.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Aptamer ID 2 (ID# 7897) | PDGF-BB | TCCCACGCATTCTCCACATCGATACTGAGCATCGTACATGATCCCGCAACGGGCAGTATTCCTTTCTGTCCTTCCGTCAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.5 nM |
Cho et al. "Quantitative selection of DNA aptamers through microfluidic selection and high-throughput sequencing." PNAS 2010, 1-6.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Aptamer ID 3 (ID# 7898) | PDGF-BB | TCCCACGCATTCTCCACATCAGTTGAATGGTGTGGTCACTTCCAGTCCCGCAGGGCACACCCTTTCTGTCCTTCCGTCAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.6 nM |
Fu, P., et. al. Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Mycoplasma bovis detection aptamer (WKB-14) (ID# 7899) | P48 of M. Bovis | GCTGCAATACTCATGGACAGGTTGCGAAAGACAACGAATGCTTTGCCTGCCATAATTTGCGTCTGGAGTACGACCCTGAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 15.61 nM |
Huang, Y. et al. "Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A." Anal. Methods, 2014, 6, 690-697.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | A1 (ID# 7912) | Staphylococcus aureus enterotoxin A (SEA) | AGCAGCACAGAGGTCAGATGAGGCGATTACGCTTCTTGTACTTCAATAACGACTCAACTCCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 92.17 nM |
Huang, Y. et al. "Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A." Anal. Methods, 2014, 6, 690-697.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | A15 (ID# 7913) | Staphylococcus aureus enterotoxin A (SEA) | AGCAGCACAGAGGTCAGATGTACTTATGCATTTCCTCCCACGATCTTATTTGAGAGTGACCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 48.57 nM |
Huang, Y. et al. "Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A." Anal. Methods, 2014, 6, 690-697.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | A23.2 (ID# 7914) | Staphylococcus aureus enterotoxin A (SEA) | AGCAGCACAGAGGTCAGATGATGATCGTAGTCATTTAAAATTTGAATACTATCAAAGTTACCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 235 nM |
Tran, D. T., Knez, K., Janssen, K. P., Pollet, J., Spasic, D., & Lammertyn, J. (2013). Selection of aptamers against Ara h 1 protein for FO-SPR biosensing of peanut allergens in food matrices. Biosensors and Bioelectronics, 43, 245–251. doi:10.1016/j.bios.2012.12.022Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Peanuts (Ara h 1) Aptamer (ID# 8003) | Ara h 1 | TCGCACATTCCGCTTCTACCGGGGGGGTCGAGCTGAGTGGATGCGAATCTGTGGGTGGGCTTCGCACACACGGACTTACG | https://www.aptagen.com/apta-index/ | Protein | null | null | 419 nM |
Purvis, S. H., Keefer, J. R., Fortenberry, Y. M., Barron-Casella, E. A., & Casella, J. F. (2017). Identification of Aptamers That Bind to Sickle Hemoglobin and Inhibit Its Polymerization. Nucleic Acid Therapeutics, 27(6), 354–364. doi:10.1089/nat.2016.0646Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | DE3A (ID# 8020) | Sickle Hemoglobin | GGGAGGACGAUGCGGCCGAUUAGAACUGGGCUGAGGCGUUCUGCAUUUCGGUGAUCAGACGACUCGCUGAGGAUCCGAGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.68 µM |
Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | IFNα-3 (ID# 8063) | Cytokine interferon alpha (IFN-α) | GTCTTGACTAGTTACGCCCACAAGAACCTGCTTGCCATGGTGACGCCGATCATGCTTTTTGGTCATTCAGTTGGCGCCTC | https://www.aptagen.com/apta-index/ | Protein | null | null | 3.96 ± 0.36 nM |
Kou, Q., Wu, P., Sun, Q., Li, C., Zhang, L., Shi, H., … Le, T. (2020). Selection and truncation of aptamers for ultrasensitive detection of sulfamethazine using a fluorescent biosensor based on graphene oxide. Analytical and Bioanalytical Chemistry. doi:10.1007/s00216-020-03044-2 Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | SMZ1 (ID# 8090) | Sulfamethazine (SMZ) | GACAGGCAGGACACCGTAACGTTAGACGCTGGACCGCGTGTGATCGGGTCAGCTGCAATTCTGCTACCTCCCTCCTCTTC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 167.8 nM |
Rosch, J.C., Neal, E.H., Balikov, D.A. et al. CRISPR-Mediated Isogenic Cell-SELEX Approach for Generating Highly Specific Aptamers Against Native Membrane Proteins. Cel. Mol. Bioeng. 13, 559–574 (2020). https://doi.org/10.1007/s12195-020-00651-yMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | A5 (ID# 8091) | GLUT1 Glucose transporter | TCGCACATTCCGCTTCTACCCATGGCTAGGTGTTTATTAATCCTGTAGGATTTGCGGAATCGTAAGTCCGTGTGTGCGAA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 160 ± 49 nM nM |
Ma, Y.; Li, W.; Xing, R.; Li, P.; Liu, Z. Epitope-Imprinted Magnetic Nanoparticles as a General Platform for Efficient In Vitro Evolution of Protein-Binding Aptamers. ACS Sens. 2020 Jul 7; 5(8): 2537-2544. DOI: 10.1012/acssensors.0c00846Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | M02 (ID# 8126) | Myoglobin (Mb) | CTTCTGCCCGCCTCCTTCCCGGTCGAGACCCGGGTTTACTTCCTCGGTAGTGTTCGAGGGAGACGAGATAGGCGGACACT | https://www.aptagen.com/apta-index/ | Protein | null | null | 46.3 nM |
Ma, Y.; Li, W.; Xing, R.; Li, P.; Liu, Z. Epitope-Imprinted Magnetic Nanoparticles as a General Platform for Efficient In Vitro Evolution of Protein-Binding Aptamers. ACS Sens. 2020 Jul 7; 5(8): 2537-2544. DOI: 10.1012/acssensors.0c00846Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | M03 (ID# 8127) | Myoglobin (Mb) | CTTCTGCCCGCCTCCTTCCCGGGTTACAGGATCGTAAATCTTATTCGTTGCTCGATCGGGAGACGAGATAGGCGGACACT | https://www.aptagen.com/apta-index/ | Protein | null | null | 46.3 nM |
Ma, Y.; Li, W.; Xing, R.; Li, P.; Liu, Z. Epitope-Imprinted Magnetic Nanoparticles as a General Platform for Efficient In Vitro Evolution of Protein-Binding Aptamers. ACS Sens. 2020 Jul 7; 5(8): 2537-2544. DOI: 10.1012/acssensors.0c00846Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | B01 (ID# 8128) | β2-Microglobulin (B2M) | CTTCTGCCCGCCTCCTTCCTCGTGACGCCGTGCAGTTACCGATACGAGCCTCGTTTTGGGAGACGAGATAGGCGGACACT | https://www.aptagen.com/apta-index/ | Protein | null | null | 52.9 nM |
Ma, Y.; Li, W.; Xing, R.; Li, P.; Liu, Z. Epitope-Imprinted Magnetic Nanoparticles as a General Platform for Efficient In Vitro Evolution of Protein-Binding Aptamers. ACS Sens. 2020 Jul 7; 5(8): 2537-2544. DOI: 10.1012/acssensors.0c00846Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | B03 (ID# 8129) | β2-Microglobulin (B2M) | CTTCTGCCCGCCTCCTTCCTATTTATTGAATGCTGTAATTTCGCCACGCGAAAGTAGGGGAGACGAGATAGGCGGACACT | https://www.aptagen.com/apta-index/ | Protein | null | null | 36.7 nM |
Marnissi, B.; Kamali-Moghaddam, M.; Ghram, A.; Hmila, I. Generation of ssDNA aptamers as diagnostic tool for Newcastle avian virus. PLoS One. 2020 Aug 13; 15(8): e0237253. DOI: 10.1371/journal.pone.0237253.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Apt_NDV01 (ID# 8133) | Newcastle disease virus (NDV) (avian disease) | AGTGCAAGCAGTATTCGGTCGGGTCTTGCAGGTCCCGTAGGAGGGGCCATTGGAGTGGGGTAAAGCTGATGCGTGATGCC | https://www.aptagen.com/apta-index/ | Other | null | null | 31 nM |
Reference: Marnissi, B.; Kamali-Moghaddam, M.; Ghram, A.; Hmila, I. Generation of ssDNA aptamers as diagnostic tool for Newcastle avian virus. PLoS One. 2020 Aug 13; 15(8): e0237253. DOI: 10.1371/journal.pone.0237253.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Apt_NDV03 (ID# 8134) | Newcastle disease virus (NDV) (avian disease) | AGTGCAAGCAGTATTCGGTCCGATGGAGGACCTCCGGTTTACCGTGTCGTTTTACTCTTGTAAAGCTGATGCGTGATGCC | https://www.aptagen.com/apta-index/ | Other | null | null | 78.1 nM |
Berezovski, M. Musheev, M. Drabovich, A. and Krylov, S. (2006) Non-SELEX Selection of Aptamers. Department of Chemistry, York University. https://doi.org/10.1021/ja056943jMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | h-Ras-1 (ID# 8145) | h-Ras (Human Ras protein) | CTTCTGCCCGCCTCCTTCCTATTAGGGTGCTTCGCGAAGTTCATTTTACATCCCCATAGGAGACGAGATAGGCGGACACT | https://www.aptagen.com/apta-index/ | Protein | null | null | 200 nM |
Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Sp1 (ID# 8152) | Shigella sonnei | TGAGCCCAAGCCCTGGTATGTTCTTCCCTTTTATTAGTCCTGTATTCCTCTACTGTTGCCGGCAGGTCTACTTTGGGATC | https://www.aptagen.com/apta-index/ | Other | null | null | 5.98 nM |
Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Sp20 (ID# 8153) | Shigella sonnei | TGAGCCCAAGCCCTGGTATGTCGTCGATTATTGTTTCAGTTCAGTTCCCCCGCGTTCCGAGATCCCAAAGTAGACCTGCC | https://www.aptagen.com/apta-index/ | Other | null | null | 14.32 nM |
Berezovski, M., Musheev. M., Drabovich, A., and S. N. Krylov. 2006. Non-SELEX Selection of Aptamers. Journal of the American Chemical Society. 128, 1410-1411. doi: 0.1021/ja056943jMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | h-Ras (ID# 8184) | h-Ras protein | CTTCTGCCCGCCTCCTTCCTATTAGGGTGCTTCGCGAAGTTCATTTTACATCCCCATAGGAGACGAGATAGGCGGACACT | https://www.aptagen.com/apta-index/ | Protein | null | null | 200 nM |
Guo, H.; Deng, B.; Zhao, L.; Gao, Y.; Zhang, X.; Yang, C.; Zou, B.; Chen, H.; Sun, M.; Wang, L.; et al.Programmed Aptamer Screening, Characterization, and Rapid Detection for α-Conotoxin MI. Toxins 2022, 14, 706. https://doi.org/10.3390/toxins14100706Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | MBMI-01c (ID# 8222) | α-conotoxin MI (CTX-MI) | ATTGGCACTCCACGCATAGGTTTGGGGATGGGCAACGGTAAAAAGGGTCAAAAGGCTTTTCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Peptide | null | null | 0.524 nM |
Shuming Sun, Han Liu, Yan Hu, Yanpeng Wang, Mingri Zhao, Yijun Yuan, Yafei Han, Yingying Jing, Jin Cui, Xiaoxiang Ren, Xiao Chen, Jiacan Su, Selection and identification of a novel ssDNA aptamer targeting human skeletal muscle, Bioactive Materials, Volume 20, 2023, Pages 166-178, ISSN 2452-199X, https://doi.org/10.1016/j.bioactmat.2022.05.016. (https://www.sciencedirect.com/science/article/pii/S2452199X22002377)Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HSM01 (ID# 8235) | Human Skeletal Muscle Cells | ACCGACCGTGCTGGACTCACCGGACAAAACTTCAGTTTTTATTTCCAGATCCTGGGCATTGCGCCAGGCTCGCTCATAGT | https://www.aptagen.com/apta-index/ | Cells | null | null | 109.5 nM |
Zhang X, Yang G, Zhao Y, Dai X, Liu W, Qu F, Huang Y. Selection and Identification of an ssDNA Aptamer for Fibroblast Activation Protein. Molecules. 2023; 28(4):1682. https://doi.org/10.3390/molecules28041682Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Fibroblast Activation Protein (FAP) (ID# 8243) | Fibroblast Activation Protein (FAP) | AGCAGCACAGAGGTCAGATGCCGCAGGCAGCTGCCATTAGTCTCTATCCGTGACGGTATGCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.5 nM |
Hyun et al. "An RNA Aptamer That Selectively Recognizes Symmetric Dimethylation of Arginine 8 in the Histone H3 N-Terminal Peptide." Nucleic Acid Therapeutics, 21 (2011): 157-163.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Histone H3R8Me2sym (Clone 1) (ID# 7615) | Histone H3R8Me2sym | GGGACGCGUGGUACCGAUGGGUCAGCAUGUAGCCAGGCAGGGCCGUGUGAGCUUGUGCUGAUGUGAGCUUCCGCGGGGAUC | https://www.aptagen.com/apta-index/ | Peptide | null | null | 12 nM |
Gong, Q. et al,(2012). Selection strategy to generate aptamer pairs that bind to distinct sites on protein targets. Analytical Chemistry, 2012(84), 5365-5371.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Integrin αV subunit (aV-1) (ID# 7704) | Integrin aV subunit | GGGAGGACGAUGCGGCACACAUUCCCGUCCUCGAUACGUCUAGGCUUAGUGCCACUUGCUUAAUCCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.7 nM |
Gong, Q. et al,(2012). Selection strategy to generate aptamer pairs that bind to distinct sites on protein targets. Analytical Chemistry, 2012(84), 5365-5371.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Integrin ??3 subunit (??3-1) (ID# 7705) | Integrin ??3 subunit | GGGAGGACGAUGCGGCCCAGAUUACUGUGGAGUGGUUGUCUGCGAAUCCUUCGUCCACCCAAUAGCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 6.5 nM |
Garrett A. Soukup and Ronald R. Breaker. "Engineering precision RNA molecular switches" Proc. Natl. Acad. Sci. 96(1999):3584-3589.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | ATP-induced molecular switch (ID# 7758) | ATP | GGGCGACCCUGAUGAGCCUUGGGAAGAAACUGUGGCACUUCGGUGCCAGCACGUCGAAACGGUGAAAGCCGUAGGUUGCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | NA nM |
Lee HK, Choi YS, Park YA, et al. (2006) Modulation of oncogenic transcription and alternative splicing by beta-catenin and an RNA aptamer in colon cancer cells.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | ??-Catenin (ID# 7833) | Arm 1-12 of B-catenin | GGACGCGUGGUACCAGGCCGAUCUAUGGACGCUAUAGGCACACCGGAUACUUUAACGAUUGGCUAAGCUUCCGCGGGGAUC | https://www.aptagen.com/apta-index/ | Protein | null | null | 5 nM |
Ashley J and Li S FY. (2013) Three-dimensional selection of leptin aptamers using capillary electrophoresis and implications for clone validation. Anal Biochem. 434: 146-152.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Leptin (Lep3) (ID# 7864) | Leptin | CTTCTGCCCGCCTCCTTCCGTTAATGGGGGATCTCGCGGCCGTTCTTGTTGCTTATACAGGAGACGAGATAGGCGGACACT | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.32 µM |
Escudero-Abarca BI, Suh SH, Moore MD, Dwivedi HP, Jaykus L-A (2014) Selection, Characterization and Application of Nucleic Acid Aptamers for the Capture and Detection of Human Norovirus Strains. PLoS ONE 9(9): e106805. doi:10.1371/journal.pone.0106805Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Human Norovirus SMV-19 (ID# 7931) | Human Norovirus | AGTATACGTATTACCTGCAGCCACCAGTGTGTTGAGGTTTGAGCACACTGATAGAGTGTCACGATATCTCGGAGATCTTGC | https://www.aptagen.com/apta-index/ | Other | null | null | 191 nM |
Escudero-Abarca BI, Suh SH, Moore MD, Dwivedi HP, Jaykus L-A (2014) Selection, Characterization and Application of Nucleic Acid Aptamers for the Capture and Detection of Human Norovirus Strains. PLoS ONE 9(9): e106805. doi:10.1371/journal.pone.0106805Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Human Norovirus SMV-21 (ID# 7932) | Human Norovirus | AGTATACGTATTACCTGCAGCCCATGTTTTGTAGGTGTAATAGGTCATGTTAGGGTTTCTGCGATATCTCGGAGATCTTGC | https://www.aptagen.com/apta-index/ | Other | null | null | 101 nM |
Escudero-Abarca BI, Suh SH, Moore MD, Dwivedi HP, Jaykus L-A (2014) Selection, Characterization and Application of Nucleic Acid Aptamers for the Capture and Detection of Human Norovirus Strains. PLoS ONE 9(9): e106805. doi:10.1371/journal.pone.0106805Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Human Norovirus SMV-25 (ID# 7933) | Human Norovirus | AGTATACGTATTACCTGCAGCCATCTGTGTGAAGACTATATGGCGCTCACATATTTCTTTCCGATATCTCGGAGATCTTGC | https://www.aptagen.com/apta-index/ | Other | null | null | 232 nM |
Escudero-Abarca, B. I. et al. "Selection, Characterization and Application of Nucleic Acid Aptamers for the Capture and Detection of Human Norovirus Strains." PLOS One 2014: 1-11.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Aptamer 25 (ID# 7941) | Human norovirus (SMV-VLP) | AGTATACGTATTACCTGCAGCCATCTGTGTGAAGACTATATGGCGCTCACATATTTCTTTCCGATATCTCGGAGATCTTGC | https://www.aptagen.com/apta-index/ | Other | null | null | 232 nM |
Mehta J, Van Dorst B, Rouah-Martin E, et al. (2010) In vitro selection and characterication of DNA aptamers recognizing chloramphenicol. Journal of Biotechnology 155: 361-369.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | CAP/CAM Aptamer (ID# 7981) | Chloramphenicol | AGCAGCACAGAGGTCAGATGACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGTGGTAGCCTATGCGTGCTACCCGTGAA | https://www.aptagen.com/apta-index/ | Other | null | null | 7.7 µM |
Yunn NO, Park M, Park S, Lee J, Noh J, Shin E, Ryu SH. A hotspot for enhancing insulin receptor activation revealed by a conformation-specific allosteric aptamer. Nucleic Acids Res. 2021 Jan 25;49(2):700-712. doi: 10.1093/nar/gkaa1247. PMID: 33410883; PMCID: PMC7826266.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | IR-A43 (ID# 8101) | recombinant insulin receptor extracellular domain | TATGAGTGACCGTCCGCCTGTATCCGCAGTATCGGCATTCAGCGACCCGGGCCACGACAACAGCCACACCACCAGCCAAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 70 nM |
Khedri M, Abnous K, Rafatpanah H, Nabavinia MS, Taghdisi SM, Ramezani M. Development and Evaluation of Novel Aptamers Specific for Human PD1 Using Hybrid Systematic Evolution of Ligands by Exponential Enrichment Approach. Immunol Invest. 2020 Jul;49(5):535-554. doi: 10.1080/08820139.2020.1744639. Epub 2020 May 19. PMID: 32429721.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | C42 (ID# 8109) | Human PD1 | GCTGTGTGACTCCTGCAATGGTAGCGGGTAGGGGAGGGAGGGTGAATGGAGGATGTTCATGGCAGCTGTATCTTGTCTCC | https://www.aptagen.com/apta-index/ | Cells | null | null | 23 nM |
Ashley, J. et al. Selection of bovine catalase aptamers using non-selex. Electrophoresis 33(2012):2783-2789.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Bovine Catalase (CAT 1) (ID# 7692) | Bovine Catalase | CTTCTGCCCGCCTCCTTCCGACCTAGCAGTGGACATGTGGCAGGGTGAAGTGGCATCGTCGGAGACGAGATAGGCGGACACT | https://www.aptagen.com/apta-index/ | Protein | null | null | 237 nM |
Hamedani, N. S., Müller, J., Tolle, F., Rühl, H., Pezeshkpoor, B., Liphardt, K., … Pötzsch, B. (2020). Selective Modulation of the Protease Activated Protein C Using Exosite Inhibiting Aptamers. Nucleic Acid Therapeutics. doi:10.1089/nat.2020.0844Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | G-NB3 (ID# 8113) | Activated Protein C | GATTGTTACTGTCACGAGGATTGGGGGTTGGGTGGATAGGCTGGCGTCGGGGCAGGTCAGTATAGCACATTAGTTCAGATAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.17 nM |
Jones et al. "High-Affinity Aptamers to Subtype 3a Hepatitis C Virus Polymerase Display Genotypic Specificity." Antimicrobial Agents and Chemotherapy, 50 (2006): 3019-3027.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Hepatitis C Virus RdRp (r10/43) (ID# 7476) | Hepatitis C Virus RdRp | GGGAGACAAGAATAAACGCTCAAGGGCGTGGTGGGTGGGGTACTAATAATGTGCGTTTGTTCGACAGGAGGCTCACAACAGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.3 nM |
Majerfeld and Yarus. "An RNA Pocket for an Aliphatic Hyrdrophobe." Nature Structural Biology, 1(1994): 287-292.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | L-Valine (ID# 7554) | L-Valine | GGGAGCUCAGAAUAAACGCUCAAAUCCGUGGACAGGGCGUAAGCGCCUUCGACAUGAGACACGGAUCCUGCGACGAAUUCAGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 12 mM |
Tang et al. "Generating Aptamers for Recognition of Virus-Infected Cells." Clin. Chem., 55(2009): 813-822.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Vaccinia virusƒ??infected A549 cells (TV08) (ID# 7663) | Vaccinia virus (WR Strain)ƒ??infected A549 cells | ATCGTCTGCTCCGTCCAATATGATGACACCTGCATAATTTATAGTGAGTCTTGATTCACGCTGCATTTGGTGTGAGGTCGTGC | https://www.aptagen.com/apta-index/ | Cells | null | null | 2.7 nM |
Wurster, S. E, and Maher, L. J. "Selection and characterization of anti-NF-kB p65 aptamers." RNA, 14(2008): 1037-1047.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Anti-NF-kB p65 (R1) (ID# 7752) | NF-kB p65 | GAAGCUUACAAGAAGGACAGCACGAAUAAAACCUGCGUAAAUCCGCCCCAUUUGUGUAAGGGUAGUGGGUCGAAUUCCGCUCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 11 nM |
Kang et al. Selection of DNA Aptamers against Glioblastoma Cells with High Affinity and Specificity (PLOSone)Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anti Glioblastoma Cells (GBM128) (ID# 7873) | Glioblastoma Cell | GAATTCAGTCGGACAGCGACGGTGGGAGCCCCAAATAATTCTTGCGATTATTAGTGTAAGCGGATGGACGAATATCGTCTCCC | https://www.aptagen.com/apta-index/ | Cells | null | null | 20 nM |
Dai, H. et al. "Aptamer TY04 inhibits the growth of multiple myeloma cells via cell cycle arrest." Tumor Biology 2014: 1-8.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Aptamer TY04 (ID# 7938) | Multiple myeloma cells (MM.1S) | ATCGTCTGCTCCGTCCAATATATCAAAGGCGAATTTTGTCAAGGTGTTAAACGATAGTCCCTACCTTTGGTGTGAGGTCGTGC | https://www.aptagen.com/apta-index/ | Cells | null | null | Not Mentioned in Database |
Kang D, Wang J, Zhang W, Song Y, Li X, et al. (2012) Selection of DNA Aptamers against Glioblastoma Cells with High Affinity and Specificity. PLoS ONE 7(10): e42731. doi:10.1371/journal.pone.0042731Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | GBM128 (ID# 7943) | Glioblastoma | GAATTCAGTCGGACAGCGACGGTGGGAGCCCCAAATAATTCTTGCGATTATTAGTGTAAGCGGATGGACGAATATCGTCTCCC | https://www.aptagen.com/apta-index/ | Cells | null | null | 20 nM |
Wang, Hanlu, et al. “In Vivo SELEX of an Inhibitory NSCLC-Specific RNA Aptamer from PEGylated RNA Library.” Molecular Therapy - Nucleic Acids, Cell Press, 9 Dec. 2017, www.sciencedirect.com/science/article/pii/S2162253117303013.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | RA16 (ID# 8056) | NCl-H460 | GGGAGAGAACAAUGACCUGCGGUGCCAAGCCGUCGGGUUAUGUUGAUCUCCUCAAGGACGAGUGCAUUGCAUCACGUCAGUAG | https://www.aptagen.com/apta-index/ | Cells | null | null | 24.75\u2009±\u20092.28 nM |
Boltz A, Plater B, Hock B, et al. (2011) Bi-specific Aptamers Mediating Tumour Cell Lysis. J Biol Chem. 286: 21896-21905Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Hepatocyte Growth Factor Receptor (CLN0003) (ID# 7860) | HGF-R / c-Met | GGAGGGAAAAGTTATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGATTAGTTTTGGAGTACTCGCTCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.091 nM |
Martin, J. A., Chávez, J. L., Chushak, Y., Chapleau, R. R., Hagen, J., & Kelley-Loughnane, N. (2014). Tunable stringency aptamer selection and gold nanoparticle assay for detection of cortisol. Anal. Bioanal. Chem. 2015 Mar 13; 406(19): 4637–4647. doi:10.1007/s00216-014-7883-8Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Cortisol Aptamer 15-1 (ID# 8004) | Cortisol | GAATGGATCCACATCCATGGATGGGCAATGCGGGGTGGAGAATGGTTGCCGCACTTCGGCTTCACTGCAGACTTGACGAAGCTT | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 16.1 nM |
Levay, Agata, et al. “ Identifying high-affinity aptamer ligands with defined cross-reactivity using high-throughput guided systematic evolution of ligands by exponential enrichment.” Nucleic Acids Research 12, (2015): 1-10.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | hIL-10RA Aptamer (#411-J) (ID# 8005) | hIL-10RA | CCCAUCCCUCUUCCUCUCUCCCUCGGUACUGCUACAGCAAUGCAUCUACGUCUCUGUGGAUUCGACGACUCGCUGAGAUCGAGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 18 nM |
Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | PL1 (ID# 8058) | PD-L1 | ATACCAGCTTATTCAATTGTAGAGTATAAAAAGAGTGATGATCTTTTGTAGGTTTTTTAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 81.46-110 nM |
Van Simaeys, D., Turek, D., Champanhac, C., Vaizer, J., Sefah, K., Zhen, J., … Tan, W. (2014). Identification of Cell Membrane Protein Stress-Induced Phosphoprotein 1 as a Potential Ovarian Cancer Biomarker Using Aptamers Selected by Cell Systematic Evolution of Ligands by Exponential Enrichment. Analytical Chemistry, 86(9), 4521–4527. doi:10.1021/ac500466xMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | TV06 (ID# 8067) | STIP1 (TOV-21G, Ovarian Cancer) | ATCCAGAGTGACGCAGCACGGCACTCACTCTTTGTTAAGTGGTCTGCTTCTTAACCTTCATCGACACGGTGGCTTA | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Parekh, P., Tang, Z., Turner, P. C., Moyer, R. W., & Tan, W. (2010). Aptamers Recognizing Glycosylated Hemagglutinin Expressed on the Surface of Vaccinia Virus-Infected Cells. Analytical Chemistry, 82(20), 8642–8649. doi:10.1021/ac101801jMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | PP3 (ID# 8068) | Hemagglutinin | ATCCAGAGTGACGCAGCACGAGCCAGACATCTCACACCTGTTGCATATACATTTTGCATGGACACGGTGGCTTAGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.61-3.87 nM |
Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | G123 (ID# 8206) | CXCL9 | CACGACGCAAGGGACCACAGGGAGGGAGGGTGGGCAAAGGGCCCTAAGTCCGTAACAAAAACACAGCACGACACCGCAGAGGCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 78-106 nM |
Sando, et al. "In vitro selection of RNA aptamer against Escherichia coli release factor 1." Bioorganic & Medicinal Chemistry Letters, 17(2007): 1216-1220.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | E. Coli Release Factor 1 (Clone II-1) (ID# 7528) | E. Coli Release Factor 1 | GGACCGAGAAGUUACCCUGUAAUCUUAGGAUGAAUCGCAUGCUCUAGCGACCUUUUCGGCUUCGGCGUACGCACAUCGCAGCAAC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 30 nM |
Homann and Goringer. "Combinatorial selection of high affinity RNA ligands to live African trypanosome." Nucleic Acid Research, 27(1999): 2006-2014.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Trypanosoma brucei (2-16) (ID# 7548) | Trypanosoma brucei | GGGAGACGAUAUUCGUCCAUUCGGGUGGCCCGUGUCUGAGCGGGGACGGCCACUUGAGCGCCGCUGUCCGACUGAAUUCUCGACC | https://www.aptagen.com/apta-index/ | Cells | null | null | 0.75 nM |
Srinivasan et al. "ADP-Specific Sensors Enable Universal Assay of Protein Kinase Activity." Chemistry & Biology, 11(2004): 499-508.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | ADP (ID# 7653) | ADP | GGGCGACCCUGAUGAGCACACGAGGGGGAAACCCCGGACAAUCAGACACGGUGUUCGAAACGGUGAAAGCCGUAGGUUGCCCUUU | https://www.aptagen.com/apta-index/ | Small Organic | null | null | Not Mentioned in Database |
Zhao et al. "Recognition of subtype non-small cell lung cancer by DNA aptamers selected from living cells." Analyst 134(2009):1808-1814.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Non-small Cell Lung Cancer (S6) (ID# 7662) | Non-small Cell Lung Cancer | ACGCTCGGATGCCACTACAGGTGGCCAGTCACTCAATTGGGTGTAGGGGTGGGGATTGTGGGTTGCTCATGGACGTGCTGGTGAC | https://www.aptagen.com/apta-index/ | Cells | null | null | 28.2 nM |
Wurster, S. E, and Maher, L. J. "Selection and characterization of anti-NF-kB p65 aptamers." RNA, 14(2008): 1037-1047.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Anti-NF-kB p65 (D1) (ID# 7754) | Anti-NF-kB p65 | GCAUGCAGUGUCUAUUCUCGAGUAGCGAUCGUUGAAGGGGUAUAAGGUUGGCAGAUCGCUAGCAUGCAACUGACUCGGAUAAGCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 149 nM |
Tran DT, et al. (2010) Selection and characterization of DNA aptamers for egg white lysozyme. Molecules 15: 1127 - 1140. Zou M et al. (2012) The homogeneous fluorescence anisotropic sensing of salivary lysozyme using the 6-carboxyfluorescein-labeled DNA aptamer. Biosens. Bioelectron. 32: 148-154.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Lysozyme (Apt 80) (ID# 7821) | Hen egg white lysozyme and recombinant human lysozyme | AGCAGCACAGAGGTCAGATGGCAGGTAAGCAGGCGGCTCACAAAACCATTCGCATGCGGCCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.8 nM |
Li, W.M.; Zhou, L.L.; Zheng, M.; Fang, J. Selection of Metastatic Breast Cancer Cell-Specific Aptamers for the Capture of CTCs with a Metastatic Phenotype by Cell-SELEX. Mol. Ther. Nucleic Acids 2018, 12, 707-717.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | M3 Aptamer (ID# 8007) | MDA-MB-231 cells | AAGGAGCAGCGTGGAGGATATACACCGTCATCAGAGGGAGCATCTCTAGTCAGGACTGTGATGAATTAGGGTGTGTCGTCGTGGT | https://www.aptagen.com/apta-index/ | Cells | null | null | 45.6 nM |
Ahn, Dae-Gyun,et al. "RNA aptamer-based sensitive detection of SARS coronavirus nucleocapsid protein" The Royal Society of Chemistry, (2009):1896-1901.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | RNA aptamer-1-based sensitive detection of SARS-CoV nucleocapsid protein (ID# 8030) | SARS-CoV Nucleocapsid (N) Protein | GGGAGAGCGGAAGCGUGCUGGGCCUGUCGUUCGCUGUGUCUUGCUACGUUACGUUACACGGUUGGCAUAACCCAGAGGUCGAUGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.65 nM |
Tsogtbaatar, K., Sousa, D. A., Ferreira, D., Tevlek, A., Aydın, H. M., Çelik, E., & Rodrigues, L. (2021). In vitro selection of DNA aptamers against human osteosarcoma. Investigational New Drugs. doi:10.1007/s10637-021-01161-yMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | OS-7.9 Aptamer (ID# 8190) | Human Osteosarcoma MG-63 | ATCCAGAGTGACGCAGCAGGGCACATTGTTCACACACAGATCACATTACGGAAAACACAACTACACGAAATGTCGTTGGTGGCCC | https://www.aptagen.com/apta-index/ | Cells | null | null | 12.8 nM |
J Tang et al. "The DNA aptamers that specifically recognize ricin toxin are selected by two in vitro selection method." Electrophoresis, 27 (2006): 1303-1311.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Ricin Toxin (C5) (ID# 7457) | Ricin Toxin | ATAGGAGTCACGACGACCAGAACCGTAGGTTCGGGGCGGAGTGGTCCGGAAGGTGGCGTGGTATGTGCGTCTACCTCTTGACTAAT | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 58 nM |
Lee, Seong-Wook and Sullenger, Bruce A. "Isolation of a Nuclease-resistant Decoy RNA That Selectively Blocks Autoantibody Binding to Insulin Receptors on Human Lymphocytes." Journal of Experimental Medicine, 184 (1996): 315-324.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-NH2-RNA | Insulin Receptor Antibody (MA20) (#1) (ID# 7474) | Insulin Receptor Antibody (MA20) | GGGAGAGCGGAAGCGUGCUGGGCCUGGUUGCUGUAAAAAUAGACACGAAUCUGCCGACCAUAACCCAGAGGUCGAUGGAUCCCCCC | https://www.aptagen.com/apta-index/ | Antibody | null | null | 30 nM |
Proske et al. "Prion-Protein-Specific Aptamer Reduces PrPSc Formation." Chem-Biochem, 3(2002): 717-725.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-NH2-RNA | Prion Protein (ID# 7557) | Prion Protein | GGGAGAAAGGGAAGCUUGAGGUGCUAUGGAGUGGAGGAGUUGAAGGUGUCGGGGUUGGCAGAAGAAGGCGAGCGUACGGAUCCAUC | https://www.aptagen.com/apta-index/ | Protein | null | null | 100 nM |
Kim, S. (2012). Harnessing aptamers for electrochemical detection of endotoxin. Analytical Biochemistry ,424(2012), 12-20. doi: 10.1016/j.ab.2012.02.016Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | LPS (B2) (ID# 7686) | Lipopolysaccharide (LPS) | CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 12 nM |
Y Hu et al. Novel MUC1 aptamer selectively delivers cytotoxic agent to cancer cells in vitro. PLoS ONE 7(2012): e31970.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | MUC1 (MA3) (ID# 7725) | MUC1 | AACCGCCCAAATCCCTAAGAGTCGGACTGCAACCTATGCTATCGTTGATGTCTGTCCAAGCAACACAGACACACTACACACGCACA | https://www.aptagen.com/apta-index/ | Protein | null | null | 38.3 nM |
K A Davis et al. "Staining of cell surface human CD4 with 2'-F-pyrimidine-containing RNA aptamers for flow cytometry." Nucleic Acids Res 26(1998):3915-3924.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | CD4 (aptamer 12) (ID# 7735) | CD4 protein found on CD4+ T-Cells | GGGAGACAAGAAUAAACGCUCAAGUGACGUCCUGAUCGAUUGUGCAUUCGGUGUGACGAUCUUUCGACAGGAGGCUCACAACAGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.5 nM |
Z Liu et al. Novel HER2 aptamer selectively delivers cytotoxic drug to HER2-positive breast cancer cells in vitro. J Transl Med 10(2012): 148-157.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HER-2 (HB5) (ID# 7745) | HER2 peptide | AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATATGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGCACA | https://www.aptagen.com/apta-index/ | Protein | null | null | 18.9 nM |
Ji, Kaili., Lim, Wee Siang., Li, Sam Fong Yau., Bhakoo, Kishore. (2013) A two-step stimulus-response cell-SELEX method to generate a DNA aptamer to recognize inflamed human aortic endothelial cells as a potential in vivo molecular probe for atherosclerosis plaque detection. Anal Bioanal Chem (2013) 405:6853-6861. DOI 10.1007//s00216-013-7155-zMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HAE N55 (ID# 7942) | Inflamed Human Aortic Endothelial Cells | ATACCAGCTTATTCAATTCCCAAATTGCCACCACTTACAGCATGATAACATACTACATCTTTTCATCAAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Cells | null | null | 82 nM |
Kolm C, Cervenka I, Aschl UJ, et al. DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing. Sci Rep. 2020;10(1):20917. Published 2020 Dec 1. doi:10.1038/s41598-020-77221-9Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | EF508 (ID# 8096) | Enterococcus faecalis bacteria | TAGGGAAGAGAAGGACATATGATACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACATTGACTAGTACATGACCACTTGA | https://www.aptagen.com/apta-index/ | Other | null | null | 37 nM |
Schmitz, A., Weber, A., Bayin, M., Breuers, S., Fieberg, V., Famulok, M., & Mayer, G. (2021). A SARS‐CoV‐2 Spike Binding DNA Aptamer that Inhibits Pseudovirus Infection by an RBD‐Independent Mechanism. Angewandte Chemie International Edition, 60(18), 10279-10285.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | SP6 (ID# 8169) | SARS-Co V-2 Spike (RBD independent mechanism to neutralize SARS-CoV-2) | GGGAGAGGAGGGAGATAGATATCAACCCATGGTAGGTATTGCTTGGTAGGGATAGTGGGCTTGATGTTTCGTGGATGCCACAGGAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 21 ± 4.6 nM |
Brockstedt, U., et al. "In vitro evolution of RNA aptamers recognizing carcinogenic aromatic amines." Biochemical and Biophysical Research Communications, 313 (2004): 1004-1008.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Methylenedianiline (M1) (ID# 7496) | Methylenedianiline | GGGAGACAAGAAUAAACGCUCAACUGCGAUCAGGGGUAAAUUUCCGCGCAGGCUCCACGCCGCUUCGACAGGAGGCUCACAACAGGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 450 nM |
Davis, K., et al. "Staining of cell surface human CD4 with 2'-F-pyrimidine-containing RNA aptamers for flow cytometry." Nucleic Acids Research, 26(1998): 3915-3924.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | CD4 (Aptamer 7) (ID# 7526) | CD4 | GGGAGACAAGAAUAAACGCUCAAUGUGUCGUCCUGGUACGAUUUUGGUAUAUAACCGUGGCUUUUCGACAGGAGGCUCACAACAGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.5 nM |
Pan et al. Isolation of virus-neutralizing RNAs from a large pool of random sequences." PNAS, 92(1995): 11509-11513.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Rous Sarcoma Virus (A) (ID# 7569) | Rous Sarcoma Virus | GGGAGCUCAGAAUAAACGCUCAAGGGUAGGGAUCGUUACCCCGACAUUUUAAUGGGCCGAUGUUUCGACAUGAGGCCCGGAUCCGGC | https://www.aptagen.com/apta-index/ | Cells | null | null | 20 nM |
Duan, N et al. Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus. J. Agri. Food Chem., 60(2012): 4034-4038.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | V. parahemolyticus (A3P) (ID# 7671) | Vibrio parahemolyticus | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | https://www.aptagen.com/apta-index/ | Cells | null | null | 16.88 nM |
Graham JC, Zarbl H (2012) Use of Cell-SELEX to Generate DNA Aptamers as Molecular Probes of HPV-Associated Cervical Cancer Cells. PLoS ONE 7(4): e36103. doi:10.1371/journal.pone.0036103Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HPV-HF cell line (20) (ID# 7701) | nontumorigenic HF cell line | ATACCAGCTTATTCAATTGGGGAGGGAGACACAGTCATGGAGCAGTTATTAGGGTGTACCGGGTGTAGTAGATAGTAAGTGCAATCT | https://www.aptagen.com/apta-index/ | Cells | null | null | 1.6 nM |
J. Liu et. al. "Selection of aptamers specific for adipose tissue." PLoS One, 7(2012): e37789.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Adipose Tissue (adipo-8) (ID# 7708) | Mature 3T3-L1 adipocytes (adipose tissue) | ATGAGAAGCGTCGGTGTGGTTAAACACGGAACGAAGGTGCAGGAAGATTTGTCGATGCGGTGCCTGAGCGGGCTGGCAAGGCGCATA | https://www.aptagen.com/apta-index/ | Cells | null | null | 17.8 nM |
Wu et al. Identification, Characterization and Application of a G-Quadruplex Structured DNA Aptamer against Cancer Biomarker Protein Anterior Gradient Homolog 2 (PLOSone)Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anti Anterior Gradient Homolog 2 (ID# 7872) | Anterior Gradient Homolog 2 (AGR2) | TCTCGGACGCGTGTGGTCGGGTGGGAGTTGTGGGGGGGGGTGGGAGGGTTCTTTGTTTGATCTTTCTCGCTGCCTGGCCCTAGAGTG | https://www.aptagen.com/apta-index/ | Protein | null | null | 13.16 nM |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.