image
listlengths
1
1
messages
listlengths
2
2
task_name
stringclasses
5 values
dataset_name
stringclasses
17 values
rvl_cdip_class
stringclasses
12 values
[ "./val_imgs/PubTabNet/val/PMC4299804_005_01.png" ]
[ { "role": "user", "content": "<|image|>Encode the diagram in Markdown syntax." }, { "role": "assistant", "content": "<md> | Hemin [μM] | Specific activity [U/mg] after 5 min of incubation | Specific activity [U/mg] after 72 h of incubation | \n | --- | --- | --- | \n | - | 34.8 | 35.3 | \n | 1.0 | 42.4 | 67.0 | \n | 5.0 | 46.8 | 75.4 | \n | 10.0 | 51.8 | 77.8 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3222056_002_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the illustration content behind with markdown code: <md> | Parameter | Value | \n | --- | --- | \n | Patients, n | 73 | \n | Mean age, yr ± SD | 63 ± 13; (range, 21 to 82) | \n | Sex (males/females) | 53/20 | \n | Weight, kg ± SD | 79 ± 14 | \n | Height, cm ± SD | 175" }, { "role": "assistant", "content": "± 8 | \n | APACHE II score | 24 (range, 7 to 45) | \n | Medical history, n | | \n | None | 6 | \n | Arterial hypertension | 35 | \n | Chronic obstructive pulmonary disease | 9 | \n | Coronary heart disease | 7 | \n | Diabetes | 12 | \n | Renal insufficiency | 11 | \n | Reason for hemodynamic monitoring, n | | \n | Hypovolemia (major surgery) | 19 | \n | Hypovolemia (major trauma) | 5 | \n | Peritonitis | 15 | \n | Pneumonia | 7 | \n | Resuscitated from cardiac arrest | 5 | \n | Septic shock | 22 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5537853_007_00.png" ]
[ { "role": "user", "content": "<|image|>Interpret the illustration as Markdown format." }, { "role": "assistant", "content": "<md> | Name | Size | ES | NES | NOM p-Value | FDR q-Value | \n | --- | --- | --- | --- | --- | --- | \n | Cellular component | | | | | | \n | Organellar ribosome | 22 | −0.69 | −1.56 | 0.035 | 1.000 | \n | Mitochondrial ribosome | 22 | −0.69 | −1.56 | 0.035 | 0.571 | \n | Early endosome | 15 | −0.74 | −1.53 | 0.012 | 0.582 | \n | ER Golgi Intermediate compartment | 20 | −0.52 | −1.52 | 0.004 | 0.496 | \n | Microtubule cytoskeleton | 101 | −0.41 | −1.51 | 0.025 | 0.397 | \n | Ribosomal subunit | 20 | −0.66 | −1.51 | 0.076 | 0.332 | \n | Intrinsic to endoplasmic reticulum membrane | 23 | −0.58 | −1.50 | 0.035 | 0.320 | \n | Integral to endoplasmic reticulum membrane | 23 | −0.58 | −1.50 | 0.035 | 0.280 | \n | Mitochondrial matrix | 44 | −0.55 | −1.49 | 0.066 | 0.289 | \n | Mitochondrial lumen | 44 | −0.55 | −1.49 | 0.066 | 0.260 | \n | Replication fork | 16 | −0.61 | −1.48 | 0.014 | 0.242 | \n | Nuclear chromosome part | 25 | −0.55 | −1.48 | 0.036 | 0.223 | \n | Golgi apparatus | 166 | −0.37 | −1.45 | 0.008 | 0.280 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4789033_002_00.png" ]
[ { "role": "user", "content": "<|image|>Transform the picture into Markdown format." }, { "role": "assistant", "content": "<md> | Study | Number of study subjects | Country | Proportion (%) with more than one melanoma | Median follow-up time (years) | \n | --- | --- | --- | --- | --- | \n | Martínet al. 2014 [17] | 741 | Spain | 2.56 | Not known | \n | Tóth et al. 2013 [36] | 740 | Hungary | 6 | 2 | \n | Hwa et al. 2012 [2] | 788 | USA | 7.7 | 3.7 | \n | Vecchiato 2012 [1] | 2987 | Italy | 7.2 | 4.8 | \n | Savoia et al. 2012 [4] | 4938 | Italy | 6.4 | Not known | \n | Bower et al. 2010 [5] | 2506 | USA | 1.9 | 5.5 | \n | De Giorgi et al. 2010 [15] | 672 | Italy | 5.95 | Not known | \n | Uliasz and Lebwohl 2007 [13] | 877 | USA | 12.7 | Not known | \n | Ferrone et al. 2005 [3] | 4484 | USA | 8.6 | 2.2 | \n | Doubrovsky and Menzies 2003 [14] | 5250 | Australia | 5.7 | Not known | \n | Burden 1994 [23] | 3818 | Scotland | 1.2 | Not known | \n | Slingluff Jr. et al. 1993 [25] | 7816 | USA | 3.6 | 4.8 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5242056_002_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the picture with markdown style: <md> | Type of document | FrequencyN = 3856 | Percent | \n | --- | --- | --- | \n | Article | 2948 | 76.45 | \n | Letter | 529 | 13.72 | \n | Review | 211 | 5.47 | \n | Note | 70 | 1.82 | \n | Conference Paper | 51 |" }, { "role": "assistant", "content": "1.32 | \n | Short Survey | 25 | 0.65 | \n | Editorial | 15 | 0.39 | \n | Article in Press | 7 | 0.18 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4609831_006_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the diagram into Markdown format." }, { "role": "assistant", "content": "<md> | Predictor | β | Zero-order correlation | \n | --- | --- | --- | \n | Age | 0.08 | –0.19 | \n | Gender (female) | 0.07 | –0.11 | \n | Exposure to intimate partner violence (yes) | 0.08 | 0.02 | \n | Number of traumatic events | 0.23 | 0.47** | \n | Amount of family violence | 0.50** | 0.65** | \n | Amount of institutional violence | 0.05 | 0.49** | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3673114_009_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the illustration in markdown code: <md> | <ROWSPAN=3> Electrode Type | <ROWSPAN=3> Linear Range(μM) | <COLSPAN=2> Linear Regression EquationY (μA) = A + BX (μM) | <ROWSPAN=3> R2 | <ROWSPAN=3> LOD (μM) | \n | A | B | \n | --- | --- | --- | --- | --- | --- | \n | 0.3 mg·mL−1 HRP/ SWCNT/PEI at GCE (Φ 1mm) | 18.18–79.01 | −0.003 | −6.108 x10-4 | 0.978 | 6.061 ± 0.002 | \n | 0.6 mg·mL−1 HRP/ SWCNT/PEI at GCE (Φ 1mm) | 4.08–79.01 | −0.023 | −0.002 | 0.951 | 1.365 ± 0.013 | \n | 0.3 mg·mL−1 HRP/ SWCNT/PEI at GCE(Φ 4mm) | 23.46–79.01" }, { "role": "assistant", "content": "| −0.158 | −0.020 | 0.965 | 7.823 ± 0.099 | \n | 0.6 mg·mL−1 HRP/ SWCNT/PEI at GCE(Φ 4mm) | 6.45–79.01 | −0.186 | −0.008 | 0.913 | 2.158 ± 0.068 | \n | 0.48 mg·mL−1 HRP/SWCNT/Ppy at SPE | 24.27–118.06 | −0.070 | −0.007 | 0.938 | 8.096 ± 0.102 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC1949836_007_00.png" ]
[ { "role": "user", "content": "<|image|>Express the image as Markdown code." }, { "role": "assistant", "content": "<md> | Variable | Plethysmography/Spirometry | HRCT at TLC | HRCT at RV | TLC and RV HRCT † | \n | --- | --- | --- | --- | --- | \n | RV | X | | | | \n | RV % Predicted | X | | | | \n | TLC | X | | | | \n | TLC % Predicted | X | | | | \n | RV/TLC | X | | | | \n | VC | X | | | | \n | FVC | X | | | | \n | FVC % Predicted | X | | | | \n | FEV1 | X | | | | \n | FEV1 % Predicted | X | | | | \n | FEV1/FVC | X | | | | \n | Destruction Score of Target Lobe | | X | X | | \n | Ipsilateral Heterogeneity†† | | X | X | | \n | Whole Lung Heterogeneity†† | | X | X | | \n | For RUL Treatment Subset only: RUL-RML Heterogeneity†† | | X | X | | \n | Target Lobe Volume % of TLC | | X | | | \n | Target Lobe Volume % of RV | | | X | | \n | Max Destruction Score other than target | | X | X | | \n | Min Destruction Score other than target | | X | X | | \n | Target Lobe Destruction Score % TLC-RV Delta | | | | X | \n | Target Lobe Volume % TLC-RV Delta | | | | X | \n | Fissure Score††† | | X | | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2576270_003_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the table in markdown code: <md> | N | Pattern of stimulation | \n | --- | --- | \n | | Heavily stimulated cells | \n | 1 | Blood B" }, { "role": "assistant", "content": "cells;anti-IgM+CD40L low 48 h | \n | 2 | Blood B cells;anti-IgM+CD40L high 48 h | \n | 3 | Blood B cells;anti-IgM+CD40L 24 h | \n | 4 | Blood B cells;anti-IgM 24 h | \n | 5 | Blood B cells;anti-IgM+IL-4 24 h | \n | 6 | Blood B cells;anti-IgM+CD40L+IL-4 24 h | \n | | Slightly or not stimulated cells | \n | 7 | Blood B cells;anti-IgM+IL-4 6 h | \n | 8 | Blood B cells;anti-IgM 6 h | \n | 9 | Blood B cells;anti-IgM+CD40L 6 h | \n | 10 | Blood B cells;anti-IgM+CD40L+IL-4 6 h | \n | 11 | Blood B cells;memory CD27+ | \n | 12 | Blood B cells;naive CD27- | \n | 13 | Blood B cells | \n | 14 | Cord Blood B | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4102035_003_01.png" ]
[ { "role": "user", "content": "<|image|>Render the image in Markdown format." }, { "role": "assistant", "content": "<md> | GEP signature | Methods | \n | --- | --- | \n | UAMS 70-gene [49] | Derived by comparing expression of profiles of patients with top and bottom quartile of survival treated on total therapy II | \n | IFM signature [50] | Derived by comparing expression of profiles of patients with good and poor outcome in IFM trials | \n | Centrosome index [51] | Based on expression of constituents of the centrosome | \n | HZD cell death signature [52] | Signature derived from genes homozygously deleted in myeloma as detected by array comparative genomic hybridization | \n | IL6-HMCL signature [53] | 13-gene signature from genes induced upon IL6 stimulation of human myeloma cells lines | \n | Proliferation index [54] | Curated signature based on proliferation genes | \n | EMC 92-gene signature [55] | 92-gene signature based on differentially expressed genes between patient with good and poor outcome on HOVON trial | \n | Chromosome instability genomic event count (CINGEC) signature [56] | Based on differentially expressed genes between patients with the top and bottom quartile of genomic instability score based on number of genetic abnormalities identified by array comparative genomic hybridization | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2464578_004_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the illustration in markdown code: <md> | <COLSPAN=5> a) | \n | --- | --- | --- | --- | --- | \n | Warfarin-Interacting Medications? | Number of Interacting Meds | Number of INR-Days | Days in Therapeutic Range (INR 2.0–3.0) | TTR (%) | \n | Yes | Overall | 22683 | 12028 | 53.0 | \n | | 3+ | 4328 | 2199 | 50.8 | \n | | 2 | 6608 | 3357 | 50.8 | \n | | 1 |" }, { "role": "assistant", "content": "11747 | 6472 | 55.1 | \n | No | None | 5872 | 3419 | 58.2 | \n | <COLSPAN=5> b) | \n | Physician ID# | | Number of INR-Days | Days in Therapeutic Range (INR 2.0–3.0) | TTR (%) | \n | 1 | | 2150 | 1360 | 63.3 | \n | 2 | | 3137 | 1967 | 62.7 | \n | 3 | | 1468 | 916 | 62.4 | \n | 4 | | 2310 | 1396 | 60.4 | \n | 5 | | 1083 | 619 | 57.2 | \n | 6 | | 3334 | 1823 | 54.7 | \n | 7 | | 971 | 474 | 48.8 | \n | 8 | | 6144 | 2961 | 48.2 | \n | 9 | | 700 | 337 | 48.1 | \n | 10 | | 4383 | 2011 | 45.9 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3639092_001_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the table with markdown style: <md> | Replicon name | Size of reference plasmid and amplicon (bp) | Melting temperature of amplicon (°C) | Average TM | SD | CV% | \n | --- | --- | --- | --- | --- | --- | \n | A/C | 4365 | 86.3 | 86.3 | 0.05 | 0.06 | \n | B/O | 4059 | 85.1 | 85.1 | 0.17 | 0.20 | \n | ColE | 4087 | 86.4 | 86.4 | 0.20 | 0.23 | \n | ColEtp | 4006 | 84.9 | 84.9 | 0.13 | 0.16 | \n | F | 4170 | 84.2 | 84.2 | 0.24 | 0.29 | \n | FIA | 4362 | 84.0 | 84 | 0.17 | 0.21 | \n | FIB | 4602 | 86.4 | 86.4 | 0.07 | 0.08 | \n | FIC | 4162 | 83.6 | 83.6 | 0.15 | 0.18 | \n | FIIs | 4170 | 87.7 | 87.7 | 0.18 | 0.20 | \n | HI1 | 4371 | 83.6 | 83.6 | 0.18 | 0.21 | \n | HI2 | 4544 | 86.3 | 86.3 | 0.11 | 0.13 | \n | I1 | 4039 | 83.3 | 83.3 | 0.12 | 0.15 | \n | K | 4060 | 85.2 | 85.2 | 0.09 | 0.10 | \n | L/M | 4685 | 84.7 | 84.7 | 0.08 | 0.10 | \n | N | 4459 | 86.5 | 86.5 | 0.17 | 0.19 | \n | P | 4434 | 88.4 | 88.4 | 0.15 | 0.17 | \n | R | 4151 | 84.4 | 84.4 | 0.18 | 0.21 | \n | T | 4650 | 83.8 | 83.8 | 0.19 |" }, { "role": "assistant", "content": "0.23 | \n | U | 4743 | 88.9 | 88.9 | 0.09 | 0.10 | \n | W | 4142 | 88.9 | 88.9 | 0.09 | 0.10 | \n | X | 4276 | 82.1 | 82.1 | 0.22 | 0.27 | \n | Y | 4665 | 86.6 | 86.6 | 0.31 | 0.36 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2663565_007_01.png" ]
[ { "role": "user", "content": "<|image|>Render the image in Markdown format." }, { "role": "assistant", "content": "<md> | | Responses (%) | Median OS responders | Median OSNon-responders | p value | \n | --- | --- | --- | --- | --- | \n | CT scans | 5 (25%) | 24 mo | 18.8 mo | 0.66 | \n | CA 19-9 | 12 (63%) | 20.5 mo | 26.9 mo | 0.45 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4862985_002_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the image with markdown style: <md> | <COLSPAN=2> | Controls | mTBI | \n | --- | --- | --- | --- | \n | N | | 18 | 25 | \n | Male # (%) | | 11 (61) | 18 (72) | \n | Age μ (±SD)*" }, { "role": "assistant", "content": "| | 38.7 (±12.6) | 42.7 (±16.3) | \n | mTBI mechanism | Fall | N/A | 10 (40%) | \n | | Assault | N/A | 2 (8%) | \n | | MVC | N/A | 9 (36%) | \n | | Sports | N/A | 3 (12%) | \n | | Blunt (industry) | N/A | 1 (4%) | \n | Days to MRI post-TBI (±SD) | First visit | N/A | 63.5 days (±42) | \n | | Second visit | N/A | 180 days (±38) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4228806_001_00.png" ]
[ { "role": "user", "content": "<|image|>Interpret the figure as Markdown format." }, { "role": "assistant", "content": "<md> | Demographics parameters | GERD (n = 124) | Non-GERD (n = 651) | P | \n | --- | --- | --- | --- | \n | Female patients, n (%) | 75 (60.5%) | 346 (53.1%) | 0.080 | \n | Age (mean ± SD), years | 62.70 ± 14.01 | 65.33 ± 13.62 | 0.051 | \n | Duration of diabetes, years | 10.60 ± 8.31 | 11.40 ± 7.76 | 0.205 | \n | Height (mean ± SD), cm | 163.05 ± 8.10 | 164.31 ± 8.51 | 0.129 | \n | Weight (mean ± SD), kg | 64.32 ± 12.62 | 66.10 ± 11.92 | 0.130 | \n | BMI (mean ± SD), kg/m2 | 24.09 ± 3.68 | 24.39 ± 3.84 | 0.417 | \n | WC (mean ± SD), cm | 91.08 ± 10.44 | 89.91 ± 10.88 | 0.267 | \n | HC (mean ± SD), cm | 94.40 ± 8.76 | 93.70 ± 8.93 | 0.432 | \n | WHR (mean ± SD) | 0.96 ± 0.09 | 0.97 ± 0.08 | 0.104 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC1839113_002_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the image into Markdown language." }, { "role": "assistant", "content": "<md> | Questionnaires | | \n | --- | --- | \n | OHIP | Oral Health Impact Profile | \n | VAS | Visual Analogue Scale | \n | PRI | Pain Rating Index | \n | STAI | State-Trait Anger Expression Inventory | \n | BDI | Beck Depression Inventory | \n | IPQ | Illness Perceptions Questionnaire | \n | CSQ | Coping Strategies Questionnaire | \n | MHLC | Multidimensional Health Locus of Control scale | \n | SES | Self-Efficacy Scale | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5372828_004_00.png" ]
[ { "role": "user", "content": "<|image|>Transcribe the image into Markdown format." }, { "role": "assistant", "content": "<md> | | | FR | HR | WR | RR | \n | --- | --- | --- | --- | --- | --- | \n | <ROWSPAN=2> MK | rs | 0.35 | −0.54 | −0.28 | 0.21 | \n | SD | 0.05 | 0.04 | 0.06 | 0.05 | \n | <ROWSPAN=2> AK | rs | 0.08 | −0.24 | −0.12 | 0.43 | \n | SD | 0.05 | 0.06 | 0.05 | 0.04 | \n | <ROWSPAN=2> RK | rs | 0.44 | −0.32 | −0.28 | 0.09 | \n | SD | 0.05 | 0.04 | 0.05 | 0.05 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3666055_004_01.png" ]
[ { "role": "user", "content": "<|image|>Convert the picture into Markdown language." }, { "role": "assistant", "content": "<md> | Study ahead of time? | <COLSPAN=2> Take medication? | \n | | Yes (n) | No (n) | \n | --- | --- | --- | \n | Yes | 3.15 (19) | 3.19 (3) | \n | No | 2.88 (47) | 2.84 (15) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4665858_005_00.png" ]
[ { "role": "user", "content": "<|image|>Express the image as Markdown code." }, { "role": "assistant", "content": "<md> | Independent variables | <COLSPAN=2> All independent variables (n = 149) | <COLSPAN=2> The five variables with highest β in the initial multivariate analyses (n = 168) | \n | | β | p | β | p | \n | --- | --- | --- | --- | --- | \n | Age | -0.008 | 0.918 | | | \n | Gender | -0.033 | 0.601 | | | \n | Employment | -0.431 | 0.000* | -0.448 | 0.000* | \n | Children at home | 0.078 | 0.250 | | | \n | Education | 0.149 | 0.016* | 0.136 | 0.016* | \n | Symptoms | 0.063 | 0.471 | | | \n | Daily activities | -0.155 | 0.173 | -0.146 | 0.032* | \n | Psychosocial sequeale | -0.004 | 0.970 | | | \n | Fatigue | 0.003 | 0.968 | | | \n | Physical activity self-efficacy | 0.139 | 0.120 | 0.226 | 0.001* | \n | Fall-related self-efficacy | 0.036 | 0.665 | | | \n | Fear of falling | 0.057 | 0.480 | | | \n | Social support (from family) | 0.104 | 0.104 | | | \n | Enjoyment of physical activity | 0.107 | 0.124 | 0.096 | 0.113 | \n | | <COLSPAN=2> Adj R2 = 0.494, (F 14, 134) = 11.303, p = 0.000 | <COLSPAN=2> Adj R2 = 0.509, F(5, 162) = 35.611, p = 0.000 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC6027546_006_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the picture in markdown code: <md> | Parameter | Subgroup | N | M ± SD | CI | F | df | p | d | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | <ROWSPAN=2> Stand headers | O | 25 | 5.9 ± 1.0 | 5.53–6.36 | <ROWSPAN=2> 1.77 | <ROWSPAN=2> 63 | <ROWSPAN=2> 0.189 | <ROWSPAN=2> 0.4 | \n | D | 39 | 6.3 ± 1.0 | 5.96–6.62 | \n | <ROWSPAN=2> Jump headers | O | 25 | 5.6 ± 1.1 | 5.17–6.11 | <ROWSPAN=2> 0.04 | <ROWSPAN=2> 62 | <ROWSPAN=2> 0.848 | <ROWSPAN=2> 0.1 | \n | D | 38 | 5.7 ± 1.1 | 5.35–6.04 | \n | <ROWSPAN=2> Run headers 1 | O | 24 | 7.4 ± 1.0 | 6.98–7.81 | <ROWSPAN=2> 0.00 |" }, { "role": "assistant", "content": "<ROWSPAN=2> 35.2 | <ROWSPAN=2> 0.991 | <ROWSPAN=2> 0.0 | \n | D | 33 | 7.4 ± 0.6 | 7.18–7.61 | \n | <ROWSPAN=2> Stand headers | SP | 39 | 6.3 ± 1.0 | 5.99–6.62 | <ROWSPAN=2> 2.83 | <ROWSPAN=2> 51 | <ROWSPAN=2> 0.099 | <ROWSPAN=2> −0.4 | \n | R | 13 | 5.8 ± 1.2 | 5.06–6.45 | \n | <ROWSPAN=2> Jump headers | SP | 38 | 5.8 ± 1.1 | 5.44–6.16 | <ROWSPAN=2> 1.62 | <ROWSPAN=2> 50 | <ROWSPAN=2> 0.209 | <ROWSPAN=2> −0.4 | \n | R | 13 | 5.4 ± 1.1 | 4.71–5.99 | \n | <ROWSPAN=2> Run headers | SP | 37 | 7.6 ± 0.9 | 7.27–7.84 | <ROWSPAN=2> 1.21 | <ROWSPAN=2> 48 | <ROWSPAN=2> 0.277 | <ROWSPAN=2> −0.4 | \n | R | 12 | 7.2 ± 1.1 | 6.49–7.94 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3363155_002_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the image content behind with markdown code: <md> | Method | <COLSPAN=2> Chr. 1 | <COLSPAN=2> Chr. 2 | <COLSPAN=2> Chr. 3 | <COLSPAN=2> Chr. 4 | \n | | Pos. | Effect | Pos. | Effect | Pos. | Effect | Pos. | Effect | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | BayesA | 59 | 5.19±0.37 | 3660 | 1.01±0.90 | 4094 | 2.25±0.40 | | | \n | | | | 3914 | 0.35±0.73 | | | | | \n | BayesB | 59 | 1.96±2.13 | 3660 | 0.73±0.82 | 4092 | 0.91±1.17 | | | \n | | | | 3873 | 0.56±0.65 | | | | | \n | BayesCπ | 58 | 5.15±0.42 | 3660 | 0.93±0.96 | 4092 | 2.50±0.76 | 7234 | 0.53±1.51 | \n | | | | 3873 | 0.76±0.75 | 4331 | 0.41±0.67 | | | \n | Simulated QTL" }, { "role": "assistant", "content": "| 57 | | 3638 | | 4100 | | 6644 | | \n | | | | 3875 | | 4300 | | | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5872316_003_01.png" ]
[ { "role": "user", "content": "<|image|>Encode the table in Markdown syntax." }, { "role": "assistant", "content": "<md> | | <COLSPAN=3> C. immitis | <COLSPAN=3> C. posadasii | \n | | Total | Pol Domain | None | Total | Pol Domain | None | \n | --- | --- | --- | --- | --- | --- | --- | \n | Number of TEs | 1204 | 338 (28%) | 866 (72%) | 1199 | 260 (22%) | 938 (78%) | \n | Associated loci | 571 | 60 (11%) | 511 (89%) | 341 | 24 (7%) | 317 (91%) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5537608_002_00.png" ]
[ { "role": "user", "content": "<|image|>Transcribe the photo into Markdown format." }, { "role": "assistant", "content": "<md> | Characteristics | <COLSPAN=2> GATA3 score | P value | \n | | Low | High | | \n | --- | --- | --- | --- | \n | Age ⩽ 60 | 67 | 29 | 0.75 | \n | Age>60 | 37 | 18 | | \n | | | | | \n | Male | 99 | 44 | 0.69 | \n | Female | 5 | 3 | | \n | | | | | \n | Oral cavity | 73 | 29 | 0.25 | \n | Oropharynx | 10 | 2 | | \n | Hypopharynx | 15 | 11 | | \n | Larynx | 6 | 5 | | \n | | | | | \n | T1–2 | 57 | 20 | 0.16 | \n | T3–4 | 47 | 27 | | \n | | | | | \n | N0–1 | 85 | 27 | 0.002* | \n | N2–3 | 19 | 20 | | \n | | | | | \n | M0 | 96 | 34 | 0.001* | \n | M1 | 8 | 13 | | \n | | | | | \n | Low grade | 56 | 11 | < 0.001* | \n | High gradea | 48 | 36 | | \n | | | | | \n | LVI − | 84 | 29 | 0.01* | \n | LVI + | 20 | 18 | | \n | | | | | \n | PNI − | 69 | 22 | 0.02* | \n | PNI + | 35 | 25 | | \n | | | | | \n | ECS − | 22 | 6 | 0.004* | \n | ECS+b | 13 | 18 | | \n | | | | | \n | LR − | 81 | 24 | 0.001* | \n | LR+c | 19 | 20 | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3852741_003_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the table with markdown style: <md> | | control | | geolocator | | GLM | \n | --- | --- | ---" }, { "role": "assistant", "content": "| --- | --- | --- | \n | | mean±SE | n | mean±SE | n | median (CI) | \n | body mass (g) | 22.44±0.11 | 105 | 23.45±0.15 | 37 | 1.06 (0.61/1.51) | \n | arrival date | 0.85±0.72 | 78 | 0.34±0.71 | 34 | -0.13 (-2.57/2.32) | \n | egg laying date | 1.09±0.65 | 87 | -2.21±0.73 | 33 | -3.00 (-5.43/-0.58) | \n | nest success (%) | 91.9 | 87 | 87.5 | 24 | -0.67 (-2.32/1.14) | \n | no. fledglings | 5.0±0.2 | 57 | 5.1±0.2 | 16 | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5048408_002_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the photo in markdown code: <md> | Characteristics | All (n = 578) | Male (n = 247) | Female (n = 331) | Pa | \n | --- | --- | --- | --- | --- | \n | Age at onset (mean ± SD) | 36.8 ± 12.4 | 35.2 ± 12.1 | 37.8 ± 12.0 | 0.013b | \n | Observation period (mean ± SD) | 9.2 ± 9.2 | 8.2 ± 7.6 | 9.6 ± 8.4 | 0.036b | \n | HLA-B51, n (%) | 177/352 (50.3) | 88/170 (51.8) | 89/182" }, { "role": "assistant", "content": "(48.9) | 0.59 | \n | Oral ulcer, n (%) | 572 (99.0) | 246 (99.6) | 326 (98.5) | 0.11 | \n | Genital ulcer, n (%) | 417 (72.3) | 141 (57.3) | 276 (83.4) | <0.0001 | \n | Eye involvement, n (%) | 356 (61.6) | 181 (73.3) | 175 (52.9) | <0.0001 | \n | Skin involvement, n (%) | 513 (88.8) | 212 (85.8) | 301 (90.9) | 0.055 | \n | Arthritis, n (%) | 301 (52.1) | 104 (42.1) | 197 (59.5) | <0.0001 | \n | Epididymitis, n (%) | 14 (2.4) | 14 (5.7) | | | \n | Gastrointestinal involvement, n (%) | 71(12.3) | 26 (10.5) | 45 (13.6) | 0.069 | \n | CNS involvement, n (%) | 59 (10.2) | 34 (13.8) | 25 (7.6) | 0.015 | \n | Vascular involvement, n (%) | 46 (8.0) | 25 (10.1) | 21 (6.3) | 0.097 | \n | Fulfilling ISG, n (%) | 517 (89.4) | 213 (86.2) | 304 (91.8) | 0.030 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4118376_004_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the diagram to Markdown syntax." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> sdAb | <COLSPAN=6> Refold | \n | Tm(CD), °C | Tm(TFA), °C | (%, approx.) | Ka(1/Ms) | Kd(1/s) | KD(M) | \n | --- | --- | --- | --- | --- | --- | --- | \n | B12 | 65.3 | 64 | 100 | 1.39 × 106 | 3.21 × 10−4 | 2.32 × 10−10 | \n | F1 | 70.9 | 68 | 100 | 6.46 × 105 | 4.20 × 10−4 | 6.50 × 10−10 | \n | A10 | 65.5 | 63 | 100 | 1.76 × 106 | 2.77 × 10−4 | 1.58 × 10−10 | \n | D9 | 64.6 | 55 | 60 | 2.49 × 106 | 2.77 × 10−4 | 1.11 × 10−10 | \n | B1 | 73 | 71 | 100 | 1.95 × 106 | 3.90 × 10−4 | 2.0 × 10−10 | \n | H9 | 70.9 | 70 | 100 | 3.53 × 106 | 3.18 × 10−4 | 9.0 × 10−11 | \n | H12 | 60 | 55 | 40 | 2.23 × 106 | 6.07 × 10−4 | 2.72 × 10−10 | \n | E9 | 65.1 | 62 | 70 | 1.11 × 106 | 5.89 × 10−4 | 5.33 × 10−10 | \n | E2 | 72 | 71 | 60 | 1.28 × 107 | 3.51 × 10−3 | 2.73 × 10−10 | \n | H9-A1 | 66.9 | * | 60 | 1.8 × 106 | 2.27 × 10−3 | 1.25 × 10−9 | \n | H9-H11 | 60.4 | 59 | 0 | 4.85 × 105 | 7.55 × 10−4 | 1.56 × 10−9 | \n | S222-A2 | 56.2 | 55 | 100 | 1.22 × 106 | 5.06 × 10−3 | 4.16 × 10−9 | \n | H9-B11 | 58.5 | 60 | 80 | 1.54 × 105 | 5.12 × 10−4 | 3.32 × 10−9 | \n | H9-D7 | 62.1 | 61 | 80 | 1.74 × 105 | 1.92 × 10−4 | 1.1 × 10−9 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC1764757_007_01.png" ]
[ { "role": "user", "content": "<|image|>What are the following diagram content in markdown style: <md> | Event | Grade | <COLSPAN=2> Cilengitide + Gemcitabine n = 44 | <COLSPAN=2> Gemcitabine n = 42 | \n | | | No. | Pts (%) | No. | Pts (%) | \n | --- | --- | --- | --- | --- | --- | \n | AE | All | 923 | 100% | 755 | 100% | \n | | Grade 1/2 | 812" }, { "role": "assistant", "content": "| 27% | 617 | 17% | \n | | Grade 3/4 | 111 | 73% | 138 | 83% | \n | SAE | All | 50 | 55% | 64 | 71% | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3117751_007_00.png" ]
[ { "role": "user", "content": "<|image|>Interpret the image as Markdown format." }, { "role": "assistant", "content": "<md> | Comparator drug | Country, Reference | Patients | Patients receiving ASAQ Winthrop | \n | --- | --- | --- | --- | \n | Non-fixed combination of aretsunate + amodiaquine | Burkina Faso [5] | Children < 5 years | 375 | \n | Amodiaquine | India [SP] | Children and adults | 201 | \n | Artemether-lumefantrine | Senegal, Mali, Cameroon, Madagascar [8] | Children and adults | 629 | \n | | Benin [13] | Children < 10 years | 90 | \n | | Liberia [14] | Children < 5 years | 150 | \n | | Liberia [15] | Children and adults | 496 | \n | | Senegal [16] | Children and adults | 184 | \n | | Colombia [SP] | Adults | 105 | \n | | Uganda [SP] | Children < 5 years | 200 | \n | Artemether-lumefantrine and DHA-piperaquine | Burkina Faso, Gabon, Mozambique, Nigeria, Rwanda, Uganda, Zambia [17] | | 1002 | \n | Total | | | 3432 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3799505_007_00.png" ]
[ { "role": "user", "content": "<|image|>Translate the table into Markdown format." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> Source of irrigation water | <COLSPAN=2> October 2011 | <COLSPAN=2> November 2011 | <COLSPAN=2> December 2011 | \n | MPN/100 mL | 95% confidence interval lower/upper limit * | MPN/100 mL | 95% confidence interval lower/upper limit | MPN/100 mL | 95% confidence intervallower/upper limit | \n | --- | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=7> Total coliforms | \n | Nungwane Dam | 7.90 | 2.4/25 | 7.90 | 2.4/25 | 7.90 | 2.4/25 | \n | Spring water | 110.00 | 39/300 | 79.00 | 25/247 | 110.00 | 39/300 | \n | IsiJodi River | 110.00 | 39/300 | 25.00 | 11/62 | 33.00 | 11/99 | \n | Tap water source | n.d | - | n.d | - | n.d | - | \n | <COLSPAN=7> Fecal coliforms | \n | Nungwane Dam | 2.00 | 0.28/14 | 4.50 | 1.1/18 | 4.50 | 1.1/18 | \n | Spring water | 14.00 | 5.5/34 | 4.50 | 1.1/18 | 4.50 | 1.1/18 | \n | IsiJodi River | 27.00 | 11/64 | 4.50 | 1.1/18 | 7.90 | 2.4/25 | \n | Tap water source | n.d | - | n.d | - | n.d | - | \n | <COLSPAN=7> E. coli | \n | Nungwane Dam | n.d | - | n.d | - | n.d | - | \n | Spring water | n.d | - | n.d | - | n.d | - | \n | IsiJodi River | n.d | - | n.d | - | n.d | | \n | Tap water source | n.d | - | n.d | - | n.d | - | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3143092_005_00.png" ]
[ { "role": "user", "content": "<|image|>Translate the picture into Markdown format." }, { "role": "assistant", "content": "<md> | Bacteria (all natively sensitive to antibiotics) | Relevant Characteristics | Resistant or Sensitive | \n | --- | --- | --- | \n | Salmonella typhimurium;Salmonella paratyphi;Salmonella pullorum/pFimH;Salmonella javiana | Express a FimH protein with Thr at amino acid 78 | Resistant | \n | Salmonella typhimurium/dFimH;Salmonella pullorum;Salmonella gallinarum | Express a FimH protein with Ile at amino acid 78 | Sensitive | \n | Shigella flexneri;E. coli | Invade and attach via alternative processes | Sensitive | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3018388_004_00.png" ]
[ { "role": "user", "content": "<|image|>Interpret the illustration as Markdown format." }, { "role": "assistant", "content": "<md> | Target | Primer sequences (designed using Primer 3 [26]) | \n | --- | --- | \n | 18S:U43011 | Fw: 5'-GACTACGTCCCTGCCCTTTG (nt 1571-1590)Rev: 5'- AACACTTCACCGGACCATTCA (nt 1618-1638) | \n | PsSym19:AF491997 | Fw: 5'- GATTGGTTGTGGCGTGTGTTC (nt 317-337)Rev: 5'- GCTCTCAAACCCTTCAGTTGC (nt 373-393) | \n | PsPT4:GU721059 | Fw:5'-CAATATTGTCACCGGTGTGGCACTTGTC (nt 197-224)Rev: 5' GGAAGAACCGAATGAAAGGCCGGAGCA (nt 327-353) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3706420_004_01.png" ]
[ { "role": "user", "content": "<|image|>Express the figure as Markdown code." }, { "role": "assistant", "content": "<md> | Trial Property (A) | P(A) (%) | Conditional probabilities | \n | --- | --- | --- | \n | Has linked result article | 27.8% (2477/8907) | P(has linked result article | has required results) = 34.7% (822/2367) | \n | | | P(has linked result article | has extended results) = 41.5% (402/969) | \n | Has no linked result article | 72.2% (6430/8907) | P(no linked result article | has required results) = 65.3% (1545/2367) | \n | | | P(no linked result article | has extended results) = 58.5% (567/969) | \n | Has required results | 26.6% (2367/8907) | P(has required results | has linked result article) = 33.2% (822/2477) | \n | | | P(has required results | no linked result article) = 24.0% (1545/6430) | \n | Has extended results | 10.9% (969/8907) | P(has extended results | has linked result article) = 16.2% (402/2477) | \n | | | P(has extended results | no linked result article) = 8.8% (567/6430 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4718041_001_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the figure with markdown style: <md> | Grade | Property | \n | --- | --- | \n | 1 | Superficial lesions, fissures and cracks, soft indentation | \n | 2 | Defects that extend to less" }, { "role": "assistant", "content": "than 50 % in depth | \n | 3 | Defects that extend to more than 50 % in depth | \n | 4 | Complete loss of cartilage thickness, bone only | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5341191_013_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the table into Markdown language." }, { "role": "assistant", "content": "<md> | | Number of transcripts | Number of genes | \n | --- | --- | --- | \n | Total | 201 | 102 | \n | 100 ≥ the supported reads >0 | 18 | 17 | \n | 1000 ≥ the supported reads >100 | 98 | 52 | \n | 2000 ≥ the supported reads >1000 | 42 | 17 | \n | the supported reads >2000 | 43 | 16 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3905716_006_01.png" ]
[ { "role": "user", "content": "<|image|>Translate the diagram into Markdown format." }, { "role": "assistant", "content": "<md> | Neoplasia | Frequency (%) | References | \n | --- | --- | --- | \n | Non-Hodgkin lymphoma | 38.6 | [224] | \n | Chronic lymphocytic leukemia | 18.4 | [224] | \n | Castleman disease | 18.4 | [224] | \n | | 77 | [225]1 | \n | Hodgkin lymphoma | 0.6 | [224, 226, 227] | \n | Thymoma | 6-30 | [50, 228, 229] | \n | Waldenstrom's macroglobulinemia | 6 | [224] | \n | Carcinomas | 8.6 | [224] | \n | Sarcomas | 6.2 | [224] | \n | Malignant melanoma | 0.6 | [224] | \n | Systemic mastocytosis | ? | [230] | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4581441_003_01.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the table in markdown code: <md> | <ROWSPAN=2> Independent variable | <ROWSPAN=2> Regression coefficient (B) | <ROWSPAN=2> Wald statistic | <ROWSPAN=2> Significance | <ROWSPAN=2> Odds ratio | <COLSPAN=2> 95 % CI for odds ratio | \n | Lower | Upper | \n | --- | --- | --- | --- |" }, { "role": "assistant", "content": "--- | --- | --- | \n | Female gender | −0.848a | 4.896 | 0.027† | 0.428 | 0.202 | 0.908 | \n | ISS | 0.084 | 43.957 | <0.0005† | 1.087 | 1.061 | 1.115 | \n | Time to resuscitation | 0.031 | 4.180 | 0.041† | 1.032 | 1.001 | 1.063 | \n | Presence of femur fracture | −0.806b | 6.150 | 0.013† | 0.447 | 0.236 | 0.845 | \n | Constant | −2.696 | 19.090 | <0.0005 | 0.067 | | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4110786_005_01.png" ]
[ { "role": "user", "content": "<|image|>Parse the table content behind with markdown code: <md> | Group | Dose | Oedema diameter(mm) 1h | 2h | 3h | 4h | Inhibition (%) 1h | 2h | 3h | 4h | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | Control | Vehicle | 4.6±0.907 | 4.35±0.71 | 4.25±0.56 | 3.78±0.44 | | | | | \n | Ibuprofen | 10 mg/kg | 2.48±0.454* | 1.9±0.46* | 1.4±0.38* | 0.98±0.31* | 47.06 | 56.32 | 67.06 | 74.17 |" }, { "role": "assistant", "content": "\n | MELI | 100 mg/kg | 4.28±0.486* | 2.45±0.56* | 2.2±0.44* | 1.7±0.6* | 8.566 | 43.68 | 48.24 | 54.97 | \n | MELI | 200 mg/kg | 3.88±0.816* | 2.5±0.82* | 2.3±0.77* | 1.43±0.72* | 17.11 | 42.52 | 45.29 | 62.25 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4694943_002_00.png" ]
[ { "role": "user", "content": "<|image|>Interpret the diagram as Markdown format." }, { "role": "assistant", "content": "<md> | <COLSPAN=2> | MRI (N = 168) | FDG-PET (N = 328) | CSF (N = 274) | \n | --- | --- | --- | --- | --- | \n | <COLSPAN=2> APOE4 N (%) | 50 (29.76%) | 87 (26.5%) | 71 (25.9%) | \n | <COLSPAN=2> AGE | 73.4 (6.02) | 74.5 (5.57) | 74.4 (5.97) | \n | <COLSPAN=2> SEX (% Females) | 53.6% | 49.4% | 50.4% | \n | <COLSPAN=2> MMSE | 29.1 (1.07) | 29.0 (1.24) | 29.1 (1.15) | \n | <COLSPAN=2> YEARS OF EDUCATION | 16.6 (2.55) | 16.3 (2.77) | 16.3 (2.69) | \n | Aβ1–42*** | TOTAL | 200.7 (49.92) | 201.4 (52.46) | 200.6 (52.51) | \n | | APOE4− | 211.3* (46.32) | 213.5* (46.87) | 212.1* (47.81) | \n | | APOE4+ | 175.4* (49.58) | 165.2* (51.85) | 167.9* (51.87) | \n | p-taup181*** | TOTAL | 32.4 (16.41) | 30.78 (18.14) | 30.48 (17.97) | \n | | APOE4− | 31.3 (16.68) | 28.3* (15.31) | 28.2* (15.23) | \n | | APOE4+ | 35.0 (15.62) | 38.1* (23.38) | 36.9*(23.10) | \n | t-tau*** | TOTAL | 66.0 (31.88) | 68.9 (34.57) | 68.4 (32.12) | \n | | APOE4− | 65.1 (32.60) | 67.0 (34.84) | 66.0** (30.29) | \n | | APOE4+ | 68.2 (30.34) | 74.5 (33.41) | 75.1** (36.22) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4094632_009_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the diagram to Markdown syntax." }, { "role": "assistant", "content": "<md> | | Adjusted HR‡ | 95% CI | \n | --- | --- | --- | \n | Age | | | \n | 20-34 | 1 | | \n | 35-49 | 1.38 | 0.48-3.98 | \n | ≥50 | 3.11* | 1.17-8.26 | \n | Gender | | | \n | Female | 1 | | \n | Male | 1.14 | 0.44-2.95 | \n | Body Mass Index | | | \n | <18.5 | 1 | | \n | ≥18.5 | 0.49* | 0.25-0.95 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4029144_002_00.png" ]
[ { "role": "user", "content": "<|image|>Transcribe the picture into Markdown format." }, { "role": "assistant", "content": "<md> | | Male | Female | \n | --- | --- | --- | \n | Body Weight (g) | 36.6 ± 0.7 | 32.0 ± 0.6* | \n | Water Intake (ul/gBW) | 101.8 ± 6.3 | 112.2 ±14.4 | \n | Urine Volume (ul/gBW) | 37.2 ±3.1 | 35.3 ± 6.5 | \n | Food Intake (mg/gBW) | 86.6 ± 4.1 | 79.9 ±7.1 | \n | Na+ Excretion (umol/g BW) | 2.52 ± 0.26 | 2.46 ± 0.40 | \n | Urea Excretion (umol/g BW) | 53.2 ± 3.2 | 45.4 ± 7.1 | \n | Osmolality (mOsmol/kg H2O) | 2546 ± 419 | 2247 ±286 | \n | Osmolar Excretion (uosmol/g BW) | 90.4 ± 13.2 | 70.6 ± 11.6 | \n | n | 16 | 15 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3446394_004_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the picture content behind with markdown code: <md> | Feature group | Totalfeatures | Preselected featuresa | Selected featureswithin feature groupb | Featuresfinally selectedc | \n | --- | --- | --- | --- | --- | \n | Moment-based features | 76 | 71 | 8 | 1 | \n | Form-based features | 86 | 74 | 16 | 4 | \n | Statistical features | 130 | 86 | 46 | 29 | \n |" }, { "role": "assistant", "content": "Structural features | 108 | 90 | 23 | 10 | \n | Spectral features | 70 | 21 | 6 | 2 | \n | Total | 470 | 342 | 99 | 46 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3083371_003_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the table content behind with markdown code: <md> | <COLSPAN=2> Study areas | <COLSPAN=2> Animal level* | <COLSPAN=2> Herd level | <COLSPAN=2> Village level | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | Production system | Zones | No of animals |" }, { "role": "assistant", "content": "Prevalence(95% CI) | No of herds | Prevalence(95% CI) | No of Villages | Prevalence(95% CI) | \n | Mixed farming | Dawro | 104 | 0 (-) | 13 | 0 (0) | 7 | 0 (0) | \n | | Gedeo | 161 | 0.5 (0.05, 1.5) | 17 | 5.9 (0.3, 30.8) | 10 | 10 (0.5, 45.9) | \n | | Hadiya | 245 | 3.5 (1.1, 5.8) | 20 | 30.0 (12.8, 54.3) | 17 | 35.3 (15.3, 61.4) | \n | | Sidama | 390 | 1.8 (0.4, 3.0) | 37 | 13.5 (5.1, 29.6) | 26 | 19.2 (7.3, 40.0) | \n | Pastoral system | Borana | 271 | 4.7 (2.1, 7.3) | 16 | 68.8 (41.5, 87.9) | 6 | 100.0 | \n | | Jijiga | 62 | 3.0 (1.1, 7.1) | 4 | 50.0 (9.2, 90.8) | 4 | 50.0 (9.2, 90.8) | \n | | Shinle | 210 | 6.6 (3.1, 10.1) | 15 | 40.0 (17.1, 67.1) | 14 | 42.9 (18.8, 70.4) | \n | | South Omo | 180 | 3.4 (0.9, 6.1) | 12 | 33.3 (11.3, 64.6) | 12 | 33.3 (11.3, 64.6) | \n | Total | | 1623 | 3.5 (2.4, 4.5) | 134 | 26.1 (19.1, 34.5) | 96 | 31.3 (22.4, 41.6) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5981929_007_00.png" ]
[ { "role": "user", "content": "<|image|>Interpret the image as Markdown format." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> Variable | <ROWSPAN=2> Construct | <COLSPAN=3> Self-Injury Group Means | <COLSPAN=2> | Effect Size | \n | Current | Previous | None | F | p | D | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | Expressed Emotion | Overall | 39.58 | 37.53 | 36.01 | 7.36 | 0.001 | 0.06 | \n | | Perceived Criticism | 20.06 | 14.67 | 13.02 | 15.48 | 0.000 | 0.17 | \n | | Emotional Involvement | 19.52 | 22.98 | 22.99 | 13.42 | 0.000 | 0.09 | \n | Shame | Overall | 80.73 | 61.08 | 54.84 | 61.99 | 0.000 | 0.33 | \n | | Characterological | 36.72 | 26.89 | 23.82 | 54.61 | 0.000 | 0.24 | \n | | Behavioural | 30.35 | 23.81 | 21.62 | 43.00 | 0.000 | 0.25 | \n | | Bodily | 13.69 | 11.40 | 9.39 | 49.08 | 0.000 | 0.24 | \n | Psychological Distress | Overall | 117.14 | 83.50 | 70.38 | 68.30 | 0.000 | 0.26 | \n | | Depression | 40.86 | 26.91 | 23.19 | 56.92 | 0.000 | 0.27 | \n | | Anxiety | 34.67 | 25.19 | 20.80 | 48.72 | 0.000 | 0.18 | \n | | Stress | 41.76 | 31.28 | 25.86 | 64.45 | 0.000 | 0.34 | \n | Emotion Dysregulation | | 116.50 | 101.75 | 91.24 | 55.02 | 0.000 | 0.11 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC1866240_004_01.png" ]
[ { "role": "user", "content": "<|image|>Parse the image content behind with markdown code: <md> | | <COLSPAN=3> No. of days between onset of symptom and seeking first treatment | Total | \n | | ≤1 day, n (%) | 2 days, n (%) | ≥3 days, n (%) | | \n | --- | --- | --- | --- | --- | \n | Care providera | | | | | \n | Public health" }, { "role": "assistant", "content": "facilityb | 36 (9) | 148 (37) | 219 (54) | 403 | \n | Private clinic | 35 (12) | 109 (37) | 150 (51) | 294 | \n | CHWc | 82 (14) | 254 (44) | 245 (42) | 581 | \n | Home treatment | 17 (36) | 17 (36) | 13 (28) | 47 | \n | Age groupa | | | | | \n | <5 years | 29 (13) | 93 (41) | 103 (46) | 225 | \n | 5–14 years | 54 ((12) | 172 (39) | 220 (49) | 446 | \n | ≥15 years | 87 (13) | 263 (40) | 304 (47) | 654 | \n | All | 170 (13) | 528 (40) | 627 (47) | 1325 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3903555_003_00.png" ]
[ { "role": "user", "content": "<|image|>What are the following image content in markdown style: <md> | <ROWSPAN=2> Reporter plasmid | <COLSPAN=6> Inhibition efficiency of each miRNA (%) | \n | pmiR153 | pmiR220 | pmiR242 | pmiR276 | Bi-miRNA | Dual-miRNA | \n | --- | --- | --- | --- | --- | --- | --- | \n |" }, { "role": "assistant", "content": "pHN/IRES-EGFP | 72.2% | 56.7% | 44.3% | 81.4% | 84.7% | 95.0% | \n | pFC/IRES-EGFP | 38.7% | 47.9% | 71.4% | 60.5% | 88.3% | 96.6% | \n | pJS/IRES-EGFP | 64.6% | 37.5% | 68.8% | 62.5% | 78.4% | 83.6% | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5344559_018_00.png" ]
[ { "role": "user", "content": "<|image|>Transcribe the table into Markdown format." }, { "role": "assistant", "content": "<md> | Component | Test Method | Percentage (%) | \n | --- | --- | --- | \n | α-cellulose | ASTM D 1103-55T | 93.6 | \n | Hemicellulose | ASTM D 1104-56 | 0.8 | \n | Lignin | ASTM D 1106-56 | <0.3 | \n | Ash | ASTM D 5360 | 10.4 | \n | Moisture content | ASTM D 2495 | 2.3 | \n | Extractive | TAPPI T257 cm-02 | n/d | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3104375_004_01.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the diagram with markdown style: <md> | N = 278 | BehT2 | IntT1 | Att | PBC | SN | DN | MN | Hab | Barr | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | Behavior Time 2 | BehT2 |" }, { "role": "assistant", "content": " | | | | | | | | \n | Intention Time 1 | .44*** | IntT1 | | | | | | | | \n | Attitude | .27*** | .59*** | Att | | | | | | | \n | Perceived behavioral control | .28*** | .41*** | .43*** | PBC | | | | | | \n | Subjective norms | .25*** | .45*** | .43*** | .43*** | SN | | | | | \n | Descriptive norms | .29*** | .25*** | .25*** | .34*** | .50*** | DN | | | | \n | Moral norms | ns | .14* | ns | ns | ns | ns | MN | | | \n | Habit | .30*** | .27*** | .16** | .40*** | .19** | .21** | ns | Hab | | \n | Barriers | -.40*** | -.38*** | -.39*** | -.42*** | -.40*** | -.33*** | ns | -.37*** | Barr | \n | Mean | 5.77 | 6.20 | 6.18 | 5.04 | 5.63 | 4.86 | 5.57 | 5.29 | 2.64 | \n | SD | 0.91 | 0.94 | 0.60 | 0.60 | 0.77 | 0.72 | 1.13 | 1.26 | 1.00 | \n | Range | 1-7 | 1-7 | 1-7 | 1-7 | 1-7 | 1-7 | 1-7 | 1-7 | 1-7 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4024989_007_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the diagram into Markdown language." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> Adipocytokines and Inflammatory Markers | <COLSPAN=2> BMI | <COLSPAN=2> Waist | <COLSPAN=2> Fat Mass | \n | r | p | r | p | r | p | \n | --- | --- | --- | --- | --- | --- | --- | \n | Adiponectin | −0.53 | ˂0.01 | −0.60 | ˂0.01 | −0.40 | ˂0.01 | \n | Leptin | 0.58 | ˂0.01 | 0.35 | ˂0.01 | 0.65 | ˂0.01 | \n | Resistin | 0.45 | ˂0.01 | 0.43 | ˂0.01 | 0.41 | ˂0.01 | \n | TNF-α | 0.57 | ˂0.01 | 0.55 | ˂0.01 | 0.48 | ˂0.01 | \n | IL-6 | 0.57 | ˂0.01 | 0.50 | ˂0.01 | 0.51 | ˂0.01 | \n | hsCRP | 0.29 | ˂0.01 | 0.20 | ˂0.05 | 0.32 | ˂0.01 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4415310_005_01.png" ]
[ { "role": "user", "content": "<|image|>Transform the illustration into Markdown format." }, { "role": "assistant", "content": "<md> | Gender | Grade of PC | Specialty | Predicted probability | \n | --- | --- | --- | --- | \n | Men | Senior specialist | Feminized | 0.722 203 5 | \n | Women | Senior specialist | Feminized | 0.675 362 8 | \n | Men | Consultant | Feminized | 0.256 266 7 | \n | Women | Consultant | Feminized | 0.216 133 9 | \n | Men | Senior consultant | Feminized | 0.586 477 8 | \n | Women | Senior consultant | Feminized | 0.531 594 7 | \n | Men | Senior specialist | Parity | 0.635 839 5 | \n | Women | Senior specialist | Parity | 0.582 847 9 | \n | Men | Consultant | Parity | 0.503 629 7 | \n | Women | Consultant | Parity | 0.448 098 4 | \n | Men | Senior consultant | Parity | 0.513 531 5 | \n | Women | Senior consultant | Parity | 0.457 915 6 | \n | Men | Senior specialist | Masculinised | 0.638 706 9 | \n | Women | Senior specialist | Masculinised | 0.585 860 8 | \n | Men | Consultant | Masculinised | 0.505 287 4 | \n | Women | Consultant | Masculinised | 0.449 738 9 | \n | Men | Senior consultant | Masculinised | 0.570 206 8 | \n | Women | Senior consultant | Masculinised | 0.514 950 3 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC1586224_008_00.png" ]
[ { "role": "user", "content": "<|image|>What are the following illustration content in markdown style: <md> | PFMT studies | Treatment time | N (subjects) | N (% lost to follow-up) | % cure | % cure/improved | N (%) positive & statistically significant outcomes | \n | --- | --- | --- | --- | --- | --- | --- | \n | Bo (1999) | 6 months | 29 | 4" }, { "role": "assistant", "content": "(14) | 44 (1), 56 (4) | 48 (4) | 8/9 (89) | \n | Morkved (2002) | 6 months | 50 | 4 (17) | 46 (1), 30 (4) 57 (2) | 93 (4) | 6 (100) | \n | Bo (2000) | 6 months | 24 | 4 (8) | 6–44 (5) | NR | 1 (100) | \n | Berghmans (1996) | 4 weeks | 20 | 0 (0) | 15 (2) | 85 (2) | 1 (100) | \n | Miller (1998b) | 1 week | 27 | 0 (0) | 23 (3) | NR | 2 (100) | \n | Hay-Smith (2002)a | 20 weeks | 64 | 2 (3) | 7 (4) | 47 (4) | NR | \n | Hay-Smith (2002)b | 20 weeks | 64 | 3 (5) | 2 (4) | 41 (4) | NR | \n | Arvonen (2001) | 4 months | 20 | 1 (5) | 26 (1) | 58 (4) | 3 (100) | \n | Glavind (1996) | NR (2–3 sessions) | 20 | 5 (25) | 20 (1) | NR | NR | \n | Pages (2001) | 3 months | 27 | 0 (0) | 69 (4) | 100 (4) | 3 (100) | \n | Bidmead (2002) | 14 weeks | 40 | NR | NR | NR | 3 (100) | \n | Sung (2000) | 6 weeks | 30 | NR | NR | NR | 3 (100) | \n | Aksac (2003) | 8 weeks | 20 | NR | 75 (3) | 100 (3) | 10 (100) | \n | Finkenhagen (1998) | 6 months | 38 | 2 (5) | 35 (4) | 71 (4) | NR | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4704730_009_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the diagram content behind with markdown code: <md> | <ROWSPAN=2> Component | <COLSPAN=2> Energy Consume × 10−17a2 (J) | <COLSPAN=2> Ratio (%) | \n | Earlier Structure | This Work | Earlier Structure | This work | \n | --- | --- | --- | --- | --- | \n | DETF | 7.96 × 10−4 | 24.56 | 6.58 × 10−4 | 59.6 | \n | Flexure | 41.93 | 6.51 | 34.64 | 15.8 | \n | Input beam | 51.69 | 2.19" }, { "role": "assistant", "content": "| 42.71 | 5.3 | \n | Output beam | 23.35 | 1.09 | 19.3 | 2.6 | \n | Pivot beam | 3.825 | 1.04 | 3.16 | 2.5 | \n | Lever arm(in) | 0.24 | 2.55 | 0.198 | 6.2 | \n | Lever arm(out) | 9.47 × 10−5 | 0.07 | 7.82 × 10−7 | 0.2 | \n | Connecting mass | 8.8 × 10−4 | 3.27 | 7.27 × 10−6 | 7.9 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5302971_008_01.png" ]
[ { "role": "user", "content": "<|image|>What are the following illustration content in markdown style: <md> | No. Case | Diagnosis | Sex | Age | CALR mutation | CALR allele burden (%) | JAK2 allele burden (%) | Reference | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | 1 | ET | U | U | U | U | U | [4] | \n | 2 | RARS-T | F | 73 | c.1129_1138del | U | 4 | [5] | \n | 3 | PMF | U | U | c.1092_1143del (type 1) | U | U | [6] | \n | 4 | ET | F | 79 | c.1094_1139del (type 6) | 10.5 | <1 | [7] | \n | 5–8 | PMF | U | U | U | U | U | [8] | \n | 9 | ET | U | U | c.1092_1143del (type 1) | U | 0.03 | [9] | \n | 10" }, { "role": "assistant", "content": "| ET | F | 62 | c.1095_1140del (type 3) | 24.22 | 0.16 | this study | \n | 11 | ET | M | 29 | c.1144del | 50.37 | 0.27 | this study | \n | 12 | ET | F | 71 | c.1092_1143del (type 1) | 61.08 | 0.12 | this study | \n | 13 | ET | F | 61 | U* | 4.47 | 0.10 | this study | \n | 14 | ET | F | 74 | c.1092_1143del (type 1) | 89.48 | 0.38 | this study | \n | 15 | ET | M | 37 | c.1092_1143del (type 1) | 40.65 | 0.14 | this study | \n | 16 | ET | M | 57 | c.1154_1155insTTGTC (type 2) | 36.92 | 0.26 | this study | \n | 17 | ET | F | 77 | c.1092_1143del (type 1) | 47.54 | 0.28 | this study | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4782332_004_01.png" ]
[ { "role": "user", "content": "<|image|>Convert the picture into Markdown format." }, { "role": "assistant", "content": "<md> | CMMa,b | <COLSPAN=6> BMI (kg/m2) | <COLSPAN=6> WC(cm) | \n | | <COLSPAN=3> 25 | <COLSPAN=3> 30 | <COLSPAN=3> WCF | <COLSPAN=3> WCM | \n | | Se | Sp | J | Se | Sp | J | Se | Sp | J | Se | Sp | J | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | WC | 99 | 75 | 74 | 97 | 71 | 68 | | | | | | | \n | HTA | 82 | 58 | 40 | 49 | 80 | 29 | 71 | 69 | 40 | 57 | 78 | 35 | \n | HDL-C (↓) | 62 | 65 | 27 | 33 | 83 | 16 | 43 | 81 | 24 | 52 | 82 | 34 | \n | LDL-C | 62 | 58 | 20 | 34 | 82 | 16 | 45 | 69 | 14 | 45 | 78 | 23 | \n | TC | 78 | 53 | 31 | 56 | 77 | 33 | 58 | 67 | 25 | 67 | 71 | 38 | \n | TAG | 85 | 55 | 40 | 62 | 79 | 41 | 90 | 68 | 58 | 69 | 76 | 45 | \n | TAG/HDL-C | 74 | 59 | 33 | 50 | 83 | 33 | 53 | 71 | 24 | 64 | 80 | 44 | \n | FG | 75 | 51 | 26 | 50 | 75 | 25 | 75 | 64 | 39 | 75 | 68 | 43 | \n | FI (↑) | 79 | 69 | 48 | 53 | 91 | 44 | 64 | 80 | 44 | 58 | 88 | 46 | \n | HOMA-IR | 79 | 65 | 44 | 55 | 90 | 45 | 69 | 79 | 48 | 58 | 85 | 43 | \n | QUICKI (↓) | 82 | 65 | 47 | 59 | 90 | 49 | 67 | 79 | 46 | 65 | 85 | 50 | \n | HTGW | 100 | 55 | 55 | 79 | 80 | 59 | 100 | 69 | 69 | 100 | 78 | 78 | \n | UA | 95 | 53 | 48 | 79 | 78 | 57 | 100 | 68 | 68 | 77 | 73 | 50 | \n | MetS | 100 | 58 | 58 | 74 | 82 | 56 | 100 | 74 | 74 | 93 | 82 | 75 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4731843_004_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the image to Markdown syntax." }, { "role": "assistant", "content": "<md> | Study | QA score | Quality rating | Adherence definition | Adherence is primary outcome? | Data on predictors of adherence? | Data on adherence and outcomes? | N | MTX adherence rate | 95% CI/SD | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=10> MEMS | \n | de Klerk et al22 | 12 | Low | Per cent of adherence (ratio) | Yes | Yes | No | 23 | 107% | 98 to 117 | \n | Waimann et al30 | 15 | High | Per cent of adherence (ratio) | Yes | Yes | Yes | 76 | 63% | 20% | \n | <COLSPAN=10> Pharmacy refill | \n | Harley et al21 | 8 | High | Per cent of adherent (MPR ≥80%) | Yes | No | No | 1668 | 64% | 24 to 102 | \n | Grijalva et al23 | 15 | High | Per cent of adherence (MPR) | Yes | Yes | No | 2933 | 80% | NP | \n | Grijalva et al25 | 9 | High | Per cent of adherence (MPR) | No | No | No | NP | 59% | 31 to 82 | \n | de Thurah et al26 | 14 | High | Per cent of non-adherence (CMG) | Yes | Yes | No | 941 | 12% | 1113 | \n | Cannon et al28 | 15 | High | Per cent of adherent (MPR ≥80%) | Yes | No | Yes | 384 | 84% | NP | \n | <COLSPAN=10> Self-report | \n | Contreras-Yanez et al24 | 11 | Low | Per cent of adherent (7-day DRR ≥80%) | Yes | Yes | Yes | 10 | 78% | NP | \n | de Thurah et al27 | 14 | High | Per cent of non-adherent (CQ-R ≤25th centile) | Yes | Yes | No | 8565 | BL 23%9 mo 23% | NPNP | \n | Salt and Frazier29 | 9 | Low | Per cent of adherent (MARS ≥39) | Yes | Yes | No | 77 | 92% | NP | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3362929_005_01.png" ]
[ { "role": "user", "content": "<|image|>Convert the table into Markdown format." }, { "role": "assistant", "content": "<md> | | <COLSPAN=3> All participants | <COLSPAN=3> Smokers | <COLSPAN=3> Non-Smokers | \n | | Baseline | Follow-up | P value | Baseline | Follow-up | P value | Baseline | Follow-up | P value | \n | | N = 40 | N = 36 | | N = 20 | N = 19 | | N = 20 | N = 17 | | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | Smoking ban inside home | | | | | | | | | | \n | Total ban | — | 33% | | — | 32% | | — | 35% | | \n | Partial ban | 70% | 58% | .0001 | 75% | 58% | .04 | 65% | 59% | .004 | \n | No ban | 30% | 8% | | 25% | 11% | | 35% | 6% | | \n | Improvement in SFH status | N/A | 43% | | N/A | 40% | | N/A | 45% | | \n | SFH attempts | N/A | 78% | | N/A | 63% | | N/A | 94% | | \n | Smoking inside the home | | | | | | | | | | \n | Daily | 83% | 53% | | 75% | 53% | | 90% | 53% | | \n | Weekly | 13% | 14% | | 20% | 11% | | 5% | 18% | | \n | Monthly | 3% | 6% | .0015 | — | 11% | .06 | 5% | — | .02 | \n | Less than monthly | 3% | 11% | | 5% | 11% | | — | 12% | | \n | Never | — | 17% | | — | 16% | | — | 18% | | \n | | Mean (SD) | Mean (SD) | | Mean (SD) | Mean (SD) | | Mean (SD) | Mean (SD) | | \n | Days smoking occurred in the home last week | 5.3 (2.4) | 2.6 (2.7) | <.0001 | 5.4 (2.5) | 1.8 (2.6) | <.0001 | 5.2 (2.4) | 2.7 (2.8) | .002 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5444716_007_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the table in markdown code: <md> | <COLSPAN=3> | <COLSPAN=4> recombinant human cytochrome P450 enzymes | <COLSPAN=2> | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | | CYP1A2 | CYP2B6 | CYP2C8 | CYP2C9 | CYP2C19 | CYP2D6 | CYP2E1 | CYP3A4 | \n | Metabolites | M1 | M1 | M1 | ND | M1 | ND | ND | M7 | \n | <COLSPAN=3> | <COLSPAN=4> recombinant human UDP-glucuronosyltransferase enzymes |" }, { "role": "assistant", "content": "<COLSPAN=2> | \n | | UGT1A1 | UGT1A3 | UGT1A6 | UGT1A7 | UGT1A9 | UGT2B7 | UGT2B15 | | \n | Metabolites | ND | ND | ND | ND | M9 | ND | ND | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5440990_003_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the table content behind with markdown code: <md> | Year | 2010 | 2011 | 2012 | 2013 | 2014 | Average | SD | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | Population | 267,456 | 276,468 | 285,716 | 295,189 | 304,873 | 285,940 | 14,794 | \n | Malaria cases | 41,925 | 47,107 | 52,463 | 60,381 | 84,707 | 57,317 | 16,765 | \n | All cause death | 3676 | 3893 | 3509 |" }, { "role": "assistant", "content": "3706 | 3724 | 3702 | 137 | \n | Malaria death | 111 | 111 | 201 | 147 | 159 | 146 | 38 | \n | Mortality rate (per 100,000) | 1374 | 1408 | 1228 | 1255 | 1221 | 1298 | 78.1 | \n | Incidence (%) | 15.7 | 17 | 18.4 | 20.5 | 27.8 | 20 | 5 | \n | MCMR | 41.5 | 40.1 | 70.3 | 49.7 | 52.1 | 51.0 | 12.1 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC1913059_002_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the image into Markdown language." }, { "role": "assistant", "content": "<md> | Exclusion stage | Reason for exclusion | n | % within stage | \n | --- | --- | --- | --- | \n | Prior to contacting patients (of n = 174) | No telephone number recorded | 6 | 3.5 | \n | | Dementia documented | 2 | 1.1 | \n | | No record that the patient had received a study information sheet1 | 55 | 31.6 | \n | | Subtotal | 63 | 36.2 | \n | On patient contact (of n = 111) | No reply to telephone call | 29 | 26.1 | \n | | Patient declined to participate | 1 | 0.9 | \n | | Subtotal | 30 | 27.0 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5459066_001_00.png" ]
[ { "role": "user", "content": "<|image|>Transform the figure into Markdown format." }, { "role": "assistant", "content": "<md> | Composites | Carbon Source | Pre-Milled | Mixed Powders | \n | --- | --- | --- | --- | \n | Composite 1 | raw CNTs | – | raw CNTs + Cu + Ti | \n | Composite 2 | ground CNTs | – | ground CNTs + Cu + Ti | \n | Composite 3 | ground CNTs | ground CNTs + Cu | Pre-milled + Ti | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5356304_004_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the figure with markdown style: <md> | Factors | Odds ratio | 95% Confidence interval | P value | \n | --- | --- | --- | --- | \n | <COLSPAN=4> IAC and SCC patients | \n | Gender (male vs. female) | 1.333 | 0.475–3.741 |" }, { "role": "assistant", "content": "0.580 | \n | Preoperative CEA level (<5.0 vs. ≥5.0 IU/mL) | 3.647 | 1.908–6.971 | <0.0001 | \n | Histology (IAC vs. SCC) | 4.286 | 2.015–9.116 | <0.0001 | \n | Tumor size, cm (≤1.0 vs. >1.0–≤2.0 vs.>2.0–≤3.0) | 1.744 | 1.006–3.024 | 0.048 | \n | <COLSPAN=4> IAC patients | \n | Preoperative CEA level (<5.0 vs. ≥5.0 IU/mL) | 6.132 | 2.787–13.490 | <0.0001 | \n | Tumor size, cm (≤1.0 vs. >1.0–≤2.0 vs. >2.0–≤3.0) | 2.227 | 1.119–4.432 | 0.023 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC1865378_005_00.png" ]
[ { "role": "user", "content": "<|image|>Transcribe the illustration into Markdown format." }, { "role": "assistant", "content": "<md> | Score | Pass | Fail | | \n | --- | --- | --- | --- | \n | | 17 | <17 | | \n | Count | 300 | 133 | | \n | Percent | 69.30% | 30.70% | | \n | <COLSPAN=4> Age (yrs) | \n | Mean | 39.7 | 45.7 | | \n | Median | 40 | 46 | | \n | S. Deviation | 8.3 | 8.3 | | \n | Min | 23 | 24 | | \n | Max | 60 | 61 | Z = -6.37, p < 0.001 | \n | <COLSPAN=4> Score | \n | Mean | 18.4 | 14.7 | | \n | Median | 18 | 15 | | \n | S. Deviation | 1.1 | 1.6 | | \n | Min | 17 | 7 | | \n | Max | 21 | 16 | Z = -16.81, p < 0.001 | \n | Injured: | | | | \n | Yes | 75 (25%) | 43(32%) | | \n | No | 225 (75%) | 90(68%) | Chi2 = 2.5, p < 0.114 | \n | # Injuries: | | | | \n | Mean | 0.37 | 0.52 | | \n | Median | 0 | 0 | | \n | S. Deviation | 0.75 | 0.99 | | \n | Min | 0 | 0 | | \n | Max | 4 | 7 | Z = -1.6, p < 0.11 | \n | <COLSPAN=4> Injured & Lost Work Time | \n | Yes | 32 (11%) | 22 (17%) | Chi2 = 2.9, p < 0.09 | \n | No | 268 (89%) | 111 (83%) | | \n | <COLSPAN=4> Rank (yrs): | \n | Mean | 7.6 | 11.4 | | \n | Median | 5 | 10 | | \n | S. Deviation | 6.6 | 7.8 | | \n | Min | 0 | 0 | | \n | Max | 32 | 31 | Z = -4.7, p < 0.001 | \n | <COLSPAN=4> Tenure (yrs) | \n | Mean | 12.9 | 18.2 | | \n | Median | 11 | 19 | | \n | S. Deviation | 8.3 | 9.4 | | \n | Min | 1 | 1 | | \n | Max | 35 | 40 | Z = -5.5, p < 0.001 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5138016_010_00.png" ]
[ { "role": "user", "content": "<|image|>Interpret the diagram as Markdown format." }, { "role": "assistant", "content": "<md> | Nanoagents | Activity | Ref. | \n | --- | --- | --- | \n | Liposomes | Anticlotting inhibitors (PPACK) against acute thrombosis | [44] | \n | Perfluorocarbon nanoparticles | Inhibitors (PPACK) of clot-bound thrombin | [46] | \n | Polymeric nanocarriers | Enoxaparin for antithrombotic activity | [42] | \n | Dendrimers | Enoxaparin for attenuation of thrombi formation | [47] | \n | Magnetic nanoparticles | Conjugation agents along with urokinase for thrombolytic activity | [48] | \n | Iron oxide nanoparticles | Conjugation agents along with tissue plasminogen activator for thrombolysis | [49] | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5361642_003_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the diagram content behind with markdown code: <md> | <ROWSPAN=2> Parameters | <COLSPAN=2> Subgroups by PSADT | <ROWSPAN=2> P* | \n | Slow | Fast | \n | --- | --- | --- | --- | \n | Local prostate cancer (n = 360) | | | | \n | Number of patients | 219 | 141 | | \n | Median PSADT (IQR), months | 53.1 (29.1 - 119.7) | 5.2 (2.8 -" }, { "role": "assistant", "content": "9.3) | < 0.01 | \n | Median survival, months | 151.2 | 77.8 | Log-rank, p < 0.01 | \n | Local-advanced prostate cancer (n = 276) | | | | \n | Number of patients | 177 | 99 | | \n | Median PSADT (IQR), months | 26.6 (13.2 – 58.5) | 3.0 (1.4-4.9) | < 0.01 | \n | Median survival, months | Not estimated | 69.3 | Log-rank, p < 0.01 | \n | Metastatic prostate cancer (n = 276) | | | | \n | Number of patients | 111 | 165 | | \n | Median PSADT (IQR), months | 9.8 (5.2-18.7) | 1.3 (0.8 – 2.0) | < 0.01 | \n | Median survival, months | 49.1 | 23.4 | Log-rank, p < 0.01 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2770530_003_01.png" ]
[ { "role": "user", "content": "<|image|>Parse the illustration content behind with markdown code: <md> | Genes | <COLSPAN=2> Expression levels (arbitrary units) | \n | --- | --- | --- | \n | | C/C (n = 7) | HF/C (n = 7) | \n | let-7c | 118.10 ± 9.71 | 60.31 ± 6.80** | \n | let-7a | 278.62 ± 15.64 | 107.64 ± 11.82* | \n | let-7b | 107.10 ± 5.45 | 45.82 ±" }, { "role": "assistant", "content": "4.28** | \n | let-7d | 164.68 ± 15.50 | 80.29 ± 8.10** | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2897783_008_00.png" ]
[ { "role": "user", "content": "<|image|>Render the figure in Markdown format." }, { "role": "assistant", "content": "<md> | | Social interaction (SI) | Awareness of self (AS) | Response to surroundings (RS) | Enjoyment of activities (EA) | Feelings/mood (FM) | \n | --- | --- | --- | --- | --- | --- | \n | BL1 | 0.2 (-1.5;2.0) | 3.5 (1.5;5.5) | -0.1 (-1.7;1.4) | 1.9 (-1.2;4.9) | -1.8 (-3.2;-0.3) | \n | BL2 | 0.7 (-1.0;2,5) | -0.4 (-2.5;1.6) | 0.9 (-0.7;2.5) | 0.5 (-2.6;3.5) | -0.0 (-1.4;1.4) | \n | BL3 | Reference | Reference | Reference | Reference | Reference | \n | T6 | 0.7 (-1.7;3.2) | -0.1 (-3.0;2.7) | -0.3 (-2.5;1.9) | -0.7 (-5.0;3.6) | -0.6 (-2.7;1.4) | \n | T12 | -0.6 (-3.1;1.8) | -3.5 (-6.4;-0.6) | -0.1 (-2.4;2.1) | -3.1 (-7.5;1.3) | -2.6 (-4.6;-0.5) | \n | iv | -1.0 (-4.2;2.2) | 0.1 (-3.6;3.8) | -2.7 (-5.5;0.0) | -2.9 (-7.8;2.0) | -1.6 (-4.4;1.3) | \n | T6*iv | -0.7 (-3.8;2.4) | 0.2 (-3.5;3.9) | 3.4 (0.6;6.2) | -1.0 (-6.5;4.6) | 1.2 (-1.4;3.8) | \n | T12*iv | -1.5 (-4.8;1.8) | 1.3 (-2.6;5.1) | 0.5 (-2.4;3.5) | 2.8 (-3.0;8.5) | 1.1 (-1.6;3.8) | \n | MMSE > 23 | 10.7 (7.1;14.4) | 18.2 (14.0;22.4) | 8.7 (5.5;11.8) | 20.6 (15.1;26.1) | 8.1 (4.8;11.4) | \n | Constant | 76.8 (74.2;79.5) | 68.3 (65.2;71.4) | 88.5 (86.2;90.8) | 64.5 (60.4;68.4) | 86.2 (83.9;88.5) | \n | n(obs/residents) | 1476/344 | 1476/344 | 1473/344 | 1474/344 | 1476/344 | \n | Log-restricted likelihood | -5979.0 | -6211.2 | -5798.2 | -6749.01 | -5732.4 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5581137_002_00.png" ]
[ { "role": "user", "content": "<|image|>Encode the image in Markdown syntax." }, { "role": "assistant", "content": "<md> | | <COLSPAN=3> EMT up-regulated | <COLSPAN=3> EMT down-regulated | \n | --- | --- | --- | --- | --- | --- | --- | \n | Phenotypes1 | NES | NOM p-val | FWER p-val2 | NES | NOM p-val | FWER p-val | \n | Gender(Male vs Female) | −1.223 | 0.17 | 0.209 | −1.133 | 0.247 | 0.348 | \n | Age(≥ 60 ys vs < 60 ys) | 1.059 | 0.35 | 0.432 | −1.128 | 0.258 | 0.331 | \n | Smoking(≥ 20 pys vs < 20 pys) | −1.196 | 0.198 | 0.231 | −0.949 | 0.549 | 0.609 | \n | T(T3&T4 vs T1&T2) | 1.054 | 0.394 | 0.448 | 0.729 | 0.94 | 0.949 | \n | N(N1&N2 vs N0) | 1.705 | <0.001 | <0.001*** | 0.95 | 0.552 | 0.612 | \n | TNM Stage(I&II vs III) | 1.386 | 0.068 | 0.08* | 0.664 | 0.975 | 0.976 | \n | Differ.(P vs M&W) | 0.928 | 0.539 | 0.648 | −1.246 | 0.142 | 0.2 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4732486_004_00.png" ]
[ { "role": "user", "content": "<|image|>Transform the diagram into Markdown format." }, { "role": "assistant", "content": "<md> | Measurement | <COLSPAN=2> No mortality (n = 28) | <COLSPAN=2> Mortality (n = 4) | \n | | Mean (SD) | Range | Mean (SD) | Range | \n | --- | --- | --- | --- | --- | \n | Total length (mm) | 670 (74) | 530–875 | 727 (116) | 610–870 | \n | Fight time (s) | 194 (105) | 43–476 | 186 (84) | 107–295 | \n | Length-corrected hooking depth (proportion) | 0.14 (0.05) | 0.07–0.24 | 0.165 (0.002) | 0.164–0.167 | \n | Glucose (mmol/l) | 5.59 (1.33) | 3.67–8.96 | 5.95 (1.96) | 4.86–8.88 | \n | Lactate (mmol/l) | 3.72 (1.37) | 0.32–6.31 | 3.23 (0.84) | 2.31–4.35 | \n | Packed cell volume (fraction) | 0.21 (0.05) | 0.09–0.33 | 0.19 (0.29) | 0.18–0.24 | \n | Chloride (mmol/l) | 271.8 (11.8) | 240–290 | 282 (10.5) | 269–293 | \n | Calcium (mequiv/l) | 5.14 (0.6) | 3.89–6.31 | 5.21 (0.61) | 4.46–5.73 | \n | Magnesium (mmol/l) | 3.46 (1.26) | 2.68–9.39 | 3.56 (1.10) | 2.84–5.21 | \n | Sodium (mmol/l) | 277.2 (30.8) | 149–327 | 280.7 (24.5) | 253–301 | \n | Potassium (mmol/l) | 7.67 (0.91) | 6.02–9.81 | 7.41 (1.66) | 6.02–9.81 | \n | Blood urea nitrogen (mmol/l) | 48.9 (2.5) | 42.6–53.5 | 50.1 (1.6) | 48.4–51.9 | \n | Creatinine (mg/dl) | 0.37 (0.15) | 0–0.67 | 0.35 (0.06) | 0.31–0.44 | \n | Blood urea nitrogen:creatinine (mmol/l) | 136.3 (58.5) | 72.3–368.0 | 144.6 (19.4) | 115.9–157.3 | \n | Water temperature (°C) | 31.3 (1.6) | 28.7–35.2 | 33.2 (2.0) | 31.4–35.1 | \n | RAMP score (proportion) | 0.09 (0.2) | 0–0.5 | 0.44 (0.3) | 0–0.75 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4465721_007_00.png" ]
[ { "role": "user", "content": "<|image|>What are the following table content in markdown style: <md> | <ROWSPAN=2> Gene | <ROWSPAN=2> | <COLSPAN=2> Neutrality test | <COLSPAN=2> Mismatch distribution | \n | Fu’s FS | Tajima’s D | τ | t (ka) | \n | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=6> Siphonaria japonica | \n | COI | northern group | −25.029*** | −2.199* | 5.750 (4.094-8.898) | 440.9 (313.9-682.4) | \n | | southern group | −26.964*** | −2.781*** | 2.486 (1.361-3.381) | 190.6 (104.4-259.3) | \n | <COLSPAN=6> Cellana toreuma | \n | COI | | −30.175*** | −2.497*** | 3.000 (0.422-3.213) | 502.5 (70.7-538.2.) | \n | <COLSPAN=6> Sargassum horneri | \n | COIII | | −18.353*** | −1.531* | 1.875 (0.75-3.072) |" }, { "role": "assistant", "content": "119.3 (47.7-195.5) | \n | <COLSPAN=6> Atrina pectinata | \n | COI | | −26.277*** | −2.527*** | 1.648 (1.295-4.086) | 170.1 (133.7-421.7) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5307490_005_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the photo content behind with markdown code: <md> | Response type | Number | \n | --- | --- | \n | 0 | 1,178 | \n | 1 | 1,503 |" }, { "role": "assistant", "content": "\n | 2 | 7,769 | \n | 3 | 7,558 | \n | 4 | 3,976 | \n | Total | 21,984 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3543823_003_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the diagram in markdown code: <md> | Parameter | Tumor (−), Hochuekkito (−)(n = 5) | Tumor (−), Hochuekkito (+)(n = 5) | Tumor (+), Hochuekkito (−)(n = 4) | Tumor (+), Hochuekkito (+)(n = 4) | \n | --- | --- | --- | --- | --- | \n | Carcass weight (g) | 27.1 ± 0.7 | 26.2 ± 0.29 | 20.2 ± 2.3* | 24.2 ± 2.9†† | \n | Gastrocnemius muscle (mg) | 141.1 ± 10.3 | 128 ± 8.7 | 115.7 ± 6.9** | 148.8 ± 8.9† | \n | Fat tissue around testis (mg) | 209.5 ± 14.4 | 226.5 ± 7.3 | 32.2 ± 55.7* | 155.4 ± 77.9†† | \n | Hb (g/dL) | 16.3 ± 1.2 | 15.4 ± 1 | 13.5 ± 0.9** | 15.3 ± 1.6 | \n | Hct (%) | 51.6 ± 3.2 | 48.2 ± 2.7 | 41.7 ± 2.1* | 47.2 ± 5.1 | \n | Plt (×104/μL) | 103.5 ± 9.7 | 115.6 ± 20.1 | 38.3 ± 8.7* | 37.7 ± 13.6 | \n | Triglyceride (mg/dL) | 117.2" }, { "role": "assistant", "content": "± 21.1 | 115 ± 14 | 16.8 ± 5.7* | 63.8 ± 9.5†† | \n | Glucose (mg/dL) | 176.9 ± 20.4 | 181.5 ± 22.3 | 61.7 ± 13.3* | 126.6 ± 56.5 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3120796_002_00.png" ]
[ { "role": "user", "content": "<|image|>Encode the photo in Markdown syntax." }, { "role": "assistant", "content": "<md> | | <COLSPAN=4> Cell lines | \n | CV distribution | NTERA-2-R/NTERA-2 | NCCIT-R/NCCIT | 2102EP-R/2102EP | together | \n | --- | --- | --- | --- | --- | \n | mean | 30.5 | 25.3 | 37.4 | 28.9 | \n | median | 27.3 | 21.7 | 32.7 | 24.1 | \n | 25-75 percentile | 18.5-36.3 | 15.7-29.0 | 18.6-40.4 | 16.5-33.8 | \n | n | 43 | 53 | 15 | 111 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3263667_005_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the picture content behind with markdown code: <md> | | VAST (median (range)) | MASS (median (range)) | \n | N = | 105" }, { "role": "assistant", "content": "patients | 76 patients | \n | --- | --- | --- | \n | mMOT | 4.6 hours (2.6–6.5 hours) | 3.7 hours (2.2–7 hours) | \n | mLOS | 7 days (6.5–7.5 days) | 5 days (4–6.25 days) | \n | mNI: | 100% (92%–100%) | 95% (62.5%–100%) | \n | mPA: | 100% (94%–100%) | 100% (62.5%–100%) | \n | mCR: | 0% (0%–54%) | 9% (0%–24%) | \n | mMBL | 1113 mL (350–1677 mL) | 905 mL (227–1200 mL) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3055267_007_00.png" ]
[ { "role": "user", "content": "<|image|>What are the following photo content in markdown style: <md> | | | Females | | | | Males | | | \n | Source of variation | df | Var Comp% | F | P | df | Var Comp% | F | P | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | Band4.1 inhibitor LRP interactor (2) | | | | | | | | | \n | Family* | 5 | 36.9 | 14.5 | < 0.0001 | 5 | 53.6 | 31.7 | < 0.0001 | \n | Genotype* | 4 | 2.0 | 1.7 | 0.16 | 4 | 1.1 | 1.6 | 0.17 | \n | Error | 177 | | | | 202 | | | | \n | CG33692 (1) | | | | | | | | | \n | Family* | 5 | 37.3 | 13.2 | < 0.0001 | 5 | 38.6 | 18.2 | < 0.0001 | \n | Genotype* | 7 | 5.6 | 2.7 | 0.011 | 7 | 6.8 | 3.5 | 0.0013 | \n | Error | 168 | | | | 200 | | | | \n | Corto (2) | | | | | | | | | \n | Family* | 5 | 33.7 | 10.5 | < 0.0001 | 5 | 46.1 | 18.4 | < 0.0001 | \n | Genotype* | 9 | 4.9 | 2.1 | 0.035 | 9 | 1.1 | 1.3 | 0.23 | \n | Error | 175 | | | | 200 | | | | \n | Ecdysone-induced protein 75B (1) |" }, { "role": "assistant", "content": " | | | | | | | | \n | Family* | 4 | 32.9 | 14.3 | < 0.0001 | 4 | 43.3 | 19.2 | < 0.0001 | \n | Genotype* | 2 | 5.4 | 4.6 | 0.012 | 2 | 1.2 | 1.8 | 0.18 | \n | Error | 134 | | | | 119 | | | | \n | 3531953:1 (X) | | | | | | | | | \n | Family* | 4 | 47.7 | 16.2 | < 0.0001 | 4 | 50.6 | 22.6 | < 0.0001 | \n | Genotype* | 5 | -1.0 | 0.7 | 0.59 | 5 | 6.5 | 4.5 | 0.0049 | \n | Error | 143 | | | | 144 | | | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3896704_006_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the picture content behind with markdown code: <md> | Gene | Family | Position (Hg19) | dbSNP | Nucleotide | Amino acid | HIHG control chromosomes | Disorder | References | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | ABHD14A | 17351 | chr3:52011912 | rs17849626 | G > A | Arg32Gln | 25/614 | ASD | Casey et al., [53] | \n | | | chr3:52014897 | rs61729088 | C > G | Arg227Gly | 2/616 | ASD | Casey et al., [53] | \n | FAT1 | 17545 | chr4:187549364 | rs111886222 | G > A | Thr1584Met | 5/614 | ASD, BD | Blair et al., [43], Neale et al., [15] | \n | | | chr4:187557908 | rs113970444 | C > T | Arg1268Gln | 5/608 | ASD, BD | Blair et al., [43], Neale et al., [15] | \n | OFCC1 | 7606 | chr6:9809860 | - | C > T | Arg538Gln | 0/602 | TS | Sundaram et al., [51] | \n | | | chr6:9900660 | rs148761621 | C > A | Glu204Stop | 0/614 | TS | Sundaram et al., [51] | \n | PRICKLE1 | 37232 | chr12:42862463 | rs61924369 | C > T |" }, { "role": "assistant", "content": "Glu185Lys | 0/614 | E | Bassuk et al., [47], Tao et al., [49] | \n | | | chr12:42864125 | - | C > G | Val57Leu | 0/614 | E | Bassuk et al., [47], Tao et al., [49] | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4205886_002_00.png" ]
[ { "role": "user", "content": "<|image|>What are the following picture content in markdown style: <md> | Tumour samples | <COLSPAN=2> Samples with decreased ABRO1 expression | \n | | Ratio of decreased samples | Average tumour/adjacent in decreased samples* |" }, { "role": "assistant", "content": "\n | --- | --- | --- | \n | Hepatic cellular cancer | 256/310 (83%) | 0.39±0.21 | \n | Thyroid cellular cancer | 21/31 (68%) | 0.22±0.13 | \n | Breast cellular cancer | 43/61 (70%) | 0.61±0.17 | \n | Renal cellular cancer | 97/136 (71%) | 0.53±0.19 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4096092_003_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the illustration content behind with markdown code: <md> | Movement | r value | \n | --- | --- | \n | Racket-side ankle range of motion in the sagittal plane during phase I and II (°) | −0.275 | \n | Racket-side ankle peak plantar flexion velocity in the sagittal plane during phase II (°/s) | −0.232 | \n | Racket-side rear knee range of motion in the sagittal plane during phase II and III (°) | 0.705* | \n | Racket-side rear knee peak extension velocity during phase II (°/s) | 0.751** | \n | Racket-side rear hip range of motion in the sagittal plane during phase I and II (°) | 0.505 | \n |" }, { "role": "assistant", "content": "Racket-side rear hip peak extension velocity in the sagittal plane during phase II (°/s) | 0.657* | \n | Racket-side pelvic rotation range of motion in the coronal plane during phase I to III (°) | −0.128 | \n | Pelvic peak axial rotation velocity during phase II (°/s) | −0.210 | \n | Trunk range of motion in the coronal plane during phase I to III (°) | −0.095 | \n | Racket-side trunk peak rotation velocity during phase II (°/s) | 0.201 | \n | Racket-side shoulder range of motion in the coronal plane during phase III (°) | 0.616* | \n | Racket-side shoulder peak internal rotation velocity in the horizontal plane during phase III (°/s) | 0.212 | \n | Racket-side elbow range of motion in the sagittal plane during phase II and III (°) | 0.435 | \n | Racket-side elbow peak extension velocity during phase III (°/s) | 0.708** | \n | Racket-side wrist range of motion in the coronal plane during phase III (°) | −0.005 | \n | Racket-side wrist peak pronation velocity during phase III (°/s) | 0.260 | \n | Racket-side wrist range of motion in the sagittal plane during phase III (°) | −0.154 | \n | Racket-side wrist peak flexion velocity during phase III (°/s) | 0.432 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC1190187_005_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the picture content behind with markdown code: <md> | | | <COLSPAN=5> Response (percent) to effects dimension | \n | | | <COLSPAN=3> Never Visited Dentist n = 79 | Last visit >1 year ago n = 185 | Last visit within 1 year n = 92 | \n | Domain | Attribute (effect on) | Very bad/Bad | None | Very good/Good | Very good/Good | Very good/Good | \n | --- | --- | --- | --- | --- | --- | --- | \n | Physical | Eating | 6.2 | 15.0 | 78.8 | 73.7 | 60.9 b | \n | | Appearance | 3.8 | 15.0 | 81.2 | 71.0 | 69.6 c | \n | | Speech | 2.5 | 17.5 | 80.0 | 68.3 | 65.2 b | \n | | General Health | 3.8 | 20.0 | 76.2 | 75.8 | 67.4 | \n | | Breath | 7.5 | 23.8 | 68.7 | 66.1 | 53.3 | \n | | Comfort/Relaxation | 2.5 | 35.0 | 62.5 | 62.4 | 51.1 c | \n | Psychological | Sleep | 5.0 | 27.5 | 67.5 | 53.2 | 56.5 | \n | | Confidence | 10.0 | 15.0 | 75.0 | 55.4 | 69.6 | \n | | Worry | 5.0 | 33.8 | 61.2 | 53.2 | 46.7 b | \n | | Mood | 8.8 | 33.7 | 57.5 | 48.4 | 42.4 b | \n | | Personality | 7.5 | 23.8 | 68.7 | 61.3 | 57.6 | \n | Social | Social life | 7.5 | 25.0 | 67.5 | 67.2 | 62.0 | \n | | Romantic Relationship | 7.5" }, { "role": "assistant", "content": "| 33.8 | 58.7 | 64.0 | 58.7 | \n | | Smiling | 7.5 | 21.2 | 71.2 | 69.4 | 70.7 | \n | | Work | 5.0 | 38.8 | 56.2 | 46.2 | 43.5 c | \n | | Finance | 0.0 | 53.8 | 46.2 | 34.4 | 32.6 b | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3150310_001_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the figure with markdown style: <md> | | total(n = 112) | M(n = 41) | F (n = 71) | \n | --- | --- | --- | --- | \n | SBP( mmHg ) | 104.03 ± 1.27 | 114.05 ± 2.17 | 98.24 ± 1.12* | \n | DBP(mmHg) | 66.98 ± 0.86 | 70.49 ± 1.48 | 64.96 ± 0.99* | \n | HR(bpm) | 76.51 ± 0.91 | 72.93 ± 1.36 | 78.69 ± 1.15* |" }, { "role": "assistant", "content": "\n | BMI | 21.21 ± 0.35 | 22.67 ± 0.70 | 20.374 ± 0.35 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2678147_006_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the illustration content behind with markdown code: <md> | Preferred term | <COLSPAN=4> Number of patients | <COLSPAN=2> Number (%) patients | \n | --- | --- | --- | --- | --- | --- | --- | \n | | <COLSPAN=2> LD 5-FU(n = 7) | <COLSPAN=2> HD 5-FU(n = 45) | <COLSPAN=2> Total(n = 52) | \n | | Grade 3 | Grade 4 | Grade 3 | Grade 4 | Grade 3 | Grade 4 | \n" }, { "role": "assistant", "content": "| Leucopenia | 2 [2] | 0 | 8 [8] | [1] | 10 (19) | 1 (2) | \n | Diarrhoea | 0 | 0 | 6 [5] | 0 | 6 (12) | 0 (0) | \n | Vomiting | 1 [1] | 0 | 5 [3] | 0 | 6 (12) | 0 (0) | \n | Rash | 2 [2] | 0 | 4 [4] | 0 | 6 (12) | 0 (0) | \n | Acne | 2 [2] | 0 | 3 [3] | 0 | 5 (10) | 0 (0) | \n | Asthenia | 2 [2] | 0 | 3 [1] | 1 | 5 (10) | 1 (2) | \n | Intestinal obstruction | 0 | 0 | 4 | 1 | 4 (8) | 1 (2) | \n | Abdominal pain | 0 | 0 | 3 | 0 | 3 (6) | 0 (0) | \n | Mucous membrane disorder | 0 | 0 | 3 [3] | 0 | 3 (6) | 0 (0) | \n | Dyspnoea | 0 | 0 | 3 [3] | 1 | 3 (6) | 1 (2) | \n | Atrial fibrillation | 0 | 0 | 2 | 0 | 2 (4) | 0 (0) | \n | Deep thrombophlebitis | 0 | 0 | 2 [1] | 0 | 2 (4) | 0 (0) | \n | Gamma glutamyl transpeptidase increased | 0 | 0 | 2 [1] | 0 | 2 (4) | 0 (0) | \n | Hypokalaemia | 0 | 0 | 2 | 0 | 2 (4) | 0 (0) | \n | Liver function test abnormal | 0 | 0 | 2 [1] | 0 | 2 (4) | 0 (0) | \n | Skin disorder | 0 | 0 | 2 [2] | 0 | 2 (4) | 0 (0) | \n | Thrombosis | 0 | 0 | 2 | 0 | 2 (4) | 0 (0) | \n | Urinary tract infection | 0 | 0 | 2 | 0 | 2 (4) | 0 (0) | \n | Weight loss | 0 | 0 | 2 [1] | 0 | 2 (4) | 0 (0) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5907294_004_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the table with markdown style: <md> | <ROWSPAN=2> | <COLSPAN=4> Hemoglobin concentration | \n | Hb(g/dl) ± SD | Minimum Hb(g/dl) | Maximum Hb(g/dl) | P – value | \n | --- | --- | --- | --- | --- | \n | Total | 11.6 ± 1.5 | 5.5 | 15.1 | | \n | <COLSPAN=5> District | \n | Ga West | 11.5 ± 1.4 | 5.5 | 14.5 | 0.146 | \n | Ga South | 11.7 ± 1.5 | 7 | 15.1 | | \n | <COLSPAN=5> Age | \n | 9–11 | 11.3 ± 1.5 | 5.5 | 14.2 | 0.001** | \n | 12–14 | 11.8 ± 1.4 | 7 | 15.1 | | \n | <COLSPAN=5> Sex | \n | Male | 11.6 ± 1.3 | 7.7 | 15.1 | 0.431 | \n | Female | 11.5 ± 1.6 | 5.5 | 15.1 | | \n | <COLSPAN=5> Socioeconomic status | \n | Low | 11.4 ± 1.7 | 5.5 | 14.1 | 0.103 | \n | Moderate | 11.7 ± 1.4 | 6.2 | 15.1 | | \n | High | 11.4 ± 1.5 | 7 | 14.7 | | \n | <COLSPAN=5> Hematuria | \n | Present | 12.3 ± 1.4 | 10.2 | 15.1 | 0.016** | \n | Absent |" }, { "role": "assistant", "content": "11.6 ± 1.4 | 5.5 | 15.1 | | \n | <COLSPAN=5> Infection status | \n | Schistosomiasis Positive | 12.3 ± 1.7 | 8.5 | 15.1 | <ROWSPAN=2> 0.0332** | \n | Schistosomiasis Negative | 11.6 ± 1.4 | 5.5 | 15.1 | \n | Malaria Positive | 11.4 ± 1.2 | 8.6 | 13.5 | <ROWSPAN=2> 0.3139 | \n | Malaria Negative | 11.6 ± 1.5 | 5.5 | 15.1 | \n | <COLSPAN=5> Intensity of S. haematobium infection | \n | light infection | 12.9 ± 1.5 | 10.7 | 15.1 | <ROWSPAN=2> 0.003** | \n | heavy infection | 11.2 ± 1.5 | 8.5 | 13.3 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5648957_003_00.png" ]
[ { "role": "user", "content": "<|image|>Render the figure in Markdown format." }, { "role": "assistant", "content": "<md> | <ROWSPAN=3> Vitamin D level at | <COLSPAN=2> Group | <ROWSPAN=3> p-value | \n | Metformin | Metformin + Vitamin D | \n | --- | --- | --- | --- | \n | Baseline | 17.09±1.73 | 16.49±1.56 | 0.053 | \n | 1st visit | 0 | 23.53±3.16 | NA | \n | 2nd visit | 0 | 29.04±3.96 | NA | \n | p-value | NA | 0.000 | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3462690_003_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the image content behind with markdown code: <md> | Extracts | <COLSPAN=3> Extract content | \n | --- | --- | --- | --- | \n | | Polyphenols (gallic acid equivalents) | Flavonoids (Quercitin equivalents) | Tannins (Tannic acid equivalents) | \n | Chloroform extract |" }, { "role": "assistant", "content": "104.41 | - | - | \n | Ethyl acetate extract | 227.75 | 264.57 | 136.64 | \n | Methanol extract | 157.47 | 114.57 | 116 | \n | TOF extract | 372 .47 | 494.57 | 163.73 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC6055700_005_00.png" ]
[ { "role": "user", "content": "<|image|>Render the diagram in Markdown format." }, { "role": "assistant", "content": "<md> | <COLSPAN=2> Internalizing Model | <COLSPAN=2> Externalizing Model | \n | Stem | Leaf | Stem | Leaf | \n | --- | --- | --- | --- | \n | −.5 | | −.5 | 4 | \n | −.4 | | −.4 | 7 | \n | −.3 | | −.3 | | \n | −.2 | | −.2 | | \n | −.1 | 2, 4, 9 | −.1 | 2 | \n | −.0 | 2, 6, 7, 9 | −.0 | 6, 8, 8, 8 | \n | .0 | 0, 1, 1, 2, 2, 4, 5, 5, 5, 7, 8, 9, 9 | .0 | 0, 0, 1, 3, 4, 4, 5, 6, 7, 9, 9, 9 | \n | .1 | 0, 1, 1, 1, 2, 2, 3, 3, 4, 4, 4, 4, 5, 5, 5, 6, 6, 6, 7, 7, 7, 7, 7, 8, 9, 9, 9 | .1 | 1, 1, 2, 4, 5, 5, 5, 6, 8, 9 | \n | .2 | 0, 0, 2, 2, 2, 2, 4, 6 | .2 | | \n | .3 | 0, 0, 0, 0, 1, 4, 5, 7, 8 | .3 | | \n | .4 | 0, 1, 3, 6 | .4 | | \n | .5 | | .5 | | \n | .6 | 7 | .6 | | \n | .7 | | .7 | 0 | \n | .8 | 9 | .8 | 1 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3566916_004_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the photo with markdown style: <md> | No | Procedure time (min) | Symptom score | <COLSPAN=2> LESP(mmHg) | <COLSPAN=2> Eckardt score | Myotomy length | Complications | \n | | | | Before | After | Before | After | | | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | 1 | 98 | 0 | 70.0 | 16.4 | 3 | 0 | 14 | none | \n | 2 | 160 | 1 | 87.0 | 35.0 | 8 | 1 | 15 | none | \n | 3 | 140 | 1 | 50.4 | 28.2 | 3 | 0 | 15 | bleedind(day 10) | \n | 4 | 120 | 0 | 48.0 | 37.4 | 8 | 0 | 13 | none | \n | 5 | 80 | 3 | 98.0 | 33.5 | 7 | 1 | 12 | none | \n | 6 | 100 | 0 | 109.5 | 25.1 | 9 | 0 | 15 | none | \n | 7 | 88 | 3 | 56.5 | 23.6 | 7 | 3 | 18 | none | \n | 8 | 90 | 0 | 104.1 | 15.2 | 9 | 0 | 14 | none | \n | 9 | 85 | 0 | 119.0 | 28.0 | 5 | 0 | 15 | none | \n | 10 | 75 | 3 | 256.0 | 26.7 | 6 | 1 | 10 | none | \n | 11 | 80 | 0 | 65.8 | 14.7 | 9 | 1 | 18 | none | \n | 12 | 140 | 1 | 73.0 | 29.6 | 8 | 1 | 18 | bleedind(day 1) | \n | 13 | 90 | 2 | 29.8 | 19.5 | 4 | 1 |" }, { "role": "assistant", "content": "15 | none | \n | 14 | 75 | 0 | 46.7 | 6.7 | 6 | 0 | 17 | none | \n | 15 | 95 | 0 | - | 14.7 | 12 | 0 | 14 | none | \n | mean | 101.1 | 0.7 | 82.7 | 22.9 | 7.4 | 0.5 | 14.9 | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2967503_008_02.png" ]
[ { "role": "user", "content": "<|image|>What are the following picture content in markdown style: <md> | Parameter | β estimate | SE | p-value | \n | --- | --- | --- | --- | \n | Intercept | -1.512 | 0.439 | 0.001 | \n | Copper level (mg/L) | -0.299 | 1.172 | 0.799 | \n | Sulfate level (mg/L) | -0.0002 | 0.001 | 0.851 | \n | Age (years) | 0.013 | 0.048 | 0.814 | \n | Race (White) | -0.858 | 1.608 | 0.601 | \n | Nitrate from water (mg/Kg/day) | 0.046 | 2.564 | 0.986 | \n | Bacteria in water (yes) | 0.361 | 0.526 | 0.493 | \n | Vegetable 24 hrs (yes) | -0.621 | 0.345 | 0.074 | \n | Water source (private well) | 0.109 | 0.333 | 0.742 | \n | Carboxyhemoglobin | 0.245 |" }, { "role": "assistant", "content": "0.113 | 0.032 | \n | Cured meats (yes) | 0.226 | 0.295 | 0.445 | \n | Vitamins (no) | -0.083 | 0.418 | 0.844 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4226882_007_00.png" ]
[ { "role": "user", "content": "<|image|>Express the table as Markdown code." }, { "role": "assistant", "content": "<md> | GPs | | \n | --- | --- | \n | Independent variables | Gender, Age category, Practice organization, Pall. Care education, RIPLS score | \n | Model statistics | Adj R2 = 0.07, p = 0.004 | \n | PHCT nurses | | \n | Independent variables | Gender, Age category, Years in practice, RIPLS score | \n | Model statistics | Adj R2 = 0.01, p = 0.386 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC1629008_006_00.png" ]
[ { "role": "user", "content": "<|image|>Transform the picture into Markdown format." }, { "role": "assistant", "content": "<md> | | OR | 95%CI | \n | --- | --- | --- | \n | Busulfan® | 2.1 | 1.3–3.0 | \n | Germinal tumors | 1.4 | 1.2–1.7 | \n | Bacterial infections | 1.8 | 1.1–2.5 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4347913_003_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the diagram content behind with markdown code: <md> | | Residents (n = 396) | \n | --- | --- | \n | Age in years; mean (SD) | 78.4 (11.1) | \n | Women in % (n) | 69.4 (275) | \n | Time being in the SHA in years; mean (SD) | 2.7 (2.3) | \n | Medical diagnosis of dementia in % (n) | 71.0 (281) | \n | Severity of dementia (GDS) in" }, { "role": "assistant", "content": "% (n) | | \n | ≤ 5 (moderately severe cognitive decline) | 15.9 (63) | \n | 6 (severe cognitive decline) | 42.2 (167) | \n | 7 (very severe cognitive decline) | 38.4 (152) | \n | Challenging behavior (CMAI) in % (n) | | \n | Physically nonaggressive behavior | 34.3 (136) | \n | Verbally agitated behavior | 37.9 (150) | \n | Aggressive behavior | 15.9 (63) | \n | At least one need-driven behavior | 57.8 (229) | \n | With family members in % (n) | 65.4 (259) | \n | Weekly family visits in % (n)* | 44.8 (116) | \n | Living situation before admission into SHA in % (n) | | \n | Alone | 65.7 (260) | \n | With family member/partner | 27.0 (107) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5854978_017_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the picture content behind with markdown code: <md> | <ROWSPAN=2> Algorithm | <COLSPAN=2> Localization Error | <COLSPAN=3> Execution Time | \n | 1 Robot | 4 Robots | 1 Robot |" }, { "role": "assistant", "content": "4 Robots | Reduction | \n | --- | --- | --- | --- | --- | --- | \n | Centroid [15] | 2.30 m | 2.60 m | 226 min | 56 min | 75% | \n | Weighted Centroid [16] | 1.70 m | 1.40 m | 226 min | 56 min | 75% | \n | PSO [14] | 0.63 m | 0.63 m | 226 min | 56 min | 75% | \n | WiMAP [17] | 0.22 m | 0.20 m | 226 min | 56 min | 75% | \n | DWiMAP [18] | 0.19 m | 0.19 m | 59 min | 18 min | 70% | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3509631_004_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the figure to Markdown syntax." }, { "role": "assistant", "content": "<md> | Steviol Glycoside Type | Sensory Evaluation of Original Compound | Sensory Evaluation of Reduced Compound | \n | --- | --- | --- | \n | Rebaudioside B (1) | Slow onset of sweetness, sweet lingering aftertaste, about 5%–6% sucrose equivalence | Weak sweetness, about 1% sucrose equivalence | \n | Rebaudioside C (2) | Slow onset of sweetness, less sweet overall than sucrose, about 2%–3% sucrose equivalence | No sweetness, moderate astringency | \n | Rebaudioside D (3) | Slow onset of sweetness, very clean, sweeter overall than sucrose, less sweet lingering aftertaste compared to sucrose, about 6%–7% sucrose equivalence | Slow onset of sweetness, no sweet lingering taste, about 5%–5.5% sucrose equivalence | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4208224_017_00.png" ]
[ { "role": "user", "content": "<|image|>Transcribe the illustration into Markdown format." }, { "role": "assistant", "content": "<md> | Sample | Laser, Power, Detection Time | SERS Substrate | LOD (M) | Ref. | \n | --- | --- | --- | --- | --- | \n | B. subtilis | 750,50 mW, CCD 1 min | AgFON: 600 nm diameter | 2.1 × 10−14 | [75] | \n | Chromate | 785, 80.2 mW, CCD TE Cooled 20 s | Au/mercaptoethyl pyridinium | 5 × 10−7 | [76] | \n | E. coli | 514.5, 100 mW, CCD 1–2 min | Ag nanoparticle suspension | ∼103 cfu/mL | [77] | \n | Uranium | 785, 60 mW | Au/aminomethyl phosphonic acid 50–60 nm | 8 × 10−7 | [78] | \n | RDX in water | 785 nm, 1 mW, CCD 10 s | Au nanoparticles 90–100 nm | 1 × 10−6 | [79] | \n | Mercaptobenzoic Acid | 785 nm, 5 mW, 2 s | Ag nanostructure on polyaniline membrane | 1 × 10−12 | [80] | \n | Crystal violet | 785 nm, 2 mW, CCD 10 s | Fractal-like Au nanostructure 30–50 nm | 4.3 × 10−9 | [81] | \n | Thrombin | 632.8 nm, 0.5 mW | Au nanoparticles 56 nm | 2 × 10−11 | [82] | \n | Arsenic | 532 nm, 20 mW | Ag, Cu nanoparticles coated with poly(vinyl pyrrolidone) | 1.3 × 10−8 | [83] | \n | Cyanide | 514 nm, 20 mW, CCD 30 s | Ag colloids 35–40 nm | 1.5–2 × 10−8 | [73] | \n | Malachite green | 514 nm, 20 mW, CCD 30 s | Hydroxylamine hydrochloride- reduced Ag colloid 40 nm | 2.6–5.2 × 10−9 | [74] | \n | Cyanide | 532 nm, 10 mW, CCD 100 s | Ag nanoparticles immobilized on oxidized silicon substrates | 2.7 ×10−7 | [84] | \n | Perchlorate | 785 nm, 1.5 mW, CCD 10 s | Ag nanoparticles on functionalized silica sol-gel films | 1 × 10−6 | [85] | \n | Polychlorinated biphenyls | 532 nm, 3.09 mW, 30 s | AgFON | 5 × 10−11 | [86] | \n | Perchlorate | 785 nm, 1.5 mW, CCD 10 s | Cystamine-modified Au nanoparticles | 5 × 10−16 | [87] | \n | Uranyl Ion | 632.8 nm, 2 mW, CCD 1 s | Ag modified polypropylene filter (PPF) substrates | 4 × 10−8 | [88] | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5014943_005_01.png" ]
[ { "role": "user", "content": "<|image|>Convert the table into Markdown format." }, { "role": "assistant", "content": "<md> | Instrument | May | Jun | Jul | Aug | \n | --- | --- | --- | --- | --- | \n | Apathy AES | 60 | 57 | 52 | 42 | \n | NPI-Q total | 18 | 13 | 9 | 6 | \n | NPI-Q apathy subscale | 9 | 6 | 2 | 2 | \n | NPI-Q depression subscale | 3 | 2 | 2 | 2 | \n | Caregiver burden ZBI | 38 | 36 | 30 | 32 | \n | Caregiver self-efficacy RSCSE | 16 | 16 | 18 | 22 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3499149_004_00.png" ]
[ { "role": "user", "content": "<|image|>What are the following illustration content in markdown style: <md> | Methods: | fPH | NN | WNN | SVM | NeuN | MC | BL | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | hd-0.5% | .9151 |" }, { "role": "assistant", "content": ".8701 | .8748 | .8538 | .6518 | .8012 | .5449 | \n | hd-1% | .9209 | .8695 | .8707 | .8563 | .6495 | .7991 | .5432 | \n | hd-2% | .9174 | .8624 | .8599 | .8484 | .6437 | .7933 | .5412 | \n | hd-5% | .9123 | .8482 | .8436 | .8362 | .6336 | .7817 | .5379 | \n | hd-10% | .8968 | .8232 | .8344 | .8057 | .6204 | .7771 | .5378 | \n | hd-20% | .8831 | .7951 | .8032 | .7782 | .6072 | .7548 | .5352 | \n | ld-0.5% | .9643 | .8618 | .8705 | .8765 | .6817 | .7269 | .6563 | \n | ld-1% | .9627 | .8601 | .8674 | .8732 | .6799 | .7270 | .6527 | \n | ld-2% | .9616 | .8571 | .8636 | .8704 | .6796 | .7265 | .6552 | \n | ld-5% | .9598 | .8480 | .8468 | .8577 | .6765 | .7230 | .6532 | \n | ld-10% | .9566 | .8328 | .8209 | .8395 | .6740 | .7169 | .6542 | \n | ld-20% | .9492 | .7951 | .7686 | .8029 | .6680 | .7110 | .6528 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3447340_020_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the diagram content behind with markdown code: <md> | Species | Toxin | UniProt/GenBank Accession Number | LD50 (μg/kg) | Features | Reference | \n | --- | --- | --- | --- | --- | --- | \n | Actinia equina | Acrorhagin 1 | Q3C258/AB212066 | 520/Crabs | Produced by acrorhagi | [134] | \n | Actinia equina | Acrorhagin 1a | Q3C257/AB212067 | - | Produced by acrorhagi | [134] | \n | Actinia equina | Acrorhagin 2a | Q3C256/AB212068 | 80/Crabs | Produced by acrorhagi | [134] | \n" }, { "role": "assistant", "content": "| Actinia equina | Acrorhagin 2a | Q3C255/AB212069 | - | Produced by acrorhagi | [134] | \n | Actineria villosa | Avt120 | E9RGH6/AB576860 | 0.085/Mice | Possible similar function as PsTX-115/may inhibit nerve cells | [135] | \n | Anemonia erythraea | AETX-II | P69944/- | 0.53/Crabs | Toxin Type Not Known. Possible Neurtoxin | [47] | \n | Anemonia erythraea | AETX-III | P69945/- | 0.28/Crabs | Toxin Type Not Known. Possible Neurtoxin | [47] | \n | Antheopsis maculata | Peptide toxin Am-1 | P69929/AB180685 | 830/Crabs | Inhibits ion channels | [51] | \n | Bunodosoma granulifera | Granulitoxin | P58305/- | 400/Mice | Neurotoxin | [136] | \n | Phyllodiscus semoni | Nephrotoxin PsTX-115 | P84851/- | -/Rats | Nephrotoxin | [137] | \n | Stichodactyla haddoni | EGF-like peptide SHTX-5 | B1B5J0/AB362571 | - | Has both toxic and EGF activity | [80] | \n | Stichodactyla gigantea | Gigantoxin-1 | Q76CA1/AB110014 | >1000/Crabs | Has both toxic and EGF activity | [79] | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5333437_004_00.png" ]
[ { "role": "user", "content": "<|image|>Interpret the diagram as Markdown format." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> | <ROWSPAN=2> Number of women screened | <ROWSPAN=2> Cancers detected | <ROWSPAN=2> Rate of detection | <COLSPAN=4> Sensitivities of different screening modalities | \n | Mammography | Ultrasound | M and US | MRI | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | Family history positive | 458 | 2 | 0.4% | 50% | 50% | 100% | 100% | \n | CHEK2 mutation | 353 | 5 | 1.4% | 60% | 80% | 100% | 100% | \n | No risk factors | 2269 | 16 | 0.7% | 53% | 56% | 75% | 81% | \n | 40–49 | 1022 | 5 | 0.5% | 60% | 80% | 100% | 100% | \n | 50–59 | 1537 | 11 | 0.7% | 64% | 45% | 71% | 82% | \n | 60–65 | 436 | 6 | 1.4% | 40% | 67% | 83% | 830% | \n | All | 2995 | 22 | 0.7% | 57% | 59% | 82% | 86% | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4895966_003_00.png" ]
[ { "role": "user", "content": "<|image|>Render the table in Markdown format." }, { "role": "assistant", "content": "<md> | SNP | Position | Minor allele | Nearest gene | P imputeda | Rep case MAFb | Rep Cont. MAFc | P replicationd | P metae | OR (95 % CI) combinedf | P adjustedg | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | rs614549 | 31948604 | C | SLC44A4 | 5.74 × 10−05 | 0.32 | 0.38 | 5.87 ×10−05 | 2.09 × 10−08 | 0.80 (0.73, 0.87) | 0.26 | \n | rs7887 | 31972526 | A | EHMT2 | 1.18 × 10−05 | 0.31 | 0.37 | 5.84 ×10−05 | 3.70 × 10−09 | 0.78 (0.71, 0.86) | NA | \n | rs2844452 | 31990003 | C | C2 | 1.69 × 10−05 | 0.42 | 0.47 | 0.00071 | 4.55 × 10−08 | 0.81 (0.74, 0.88) | 0.26 | \n | rs3020644 | 32002605 | G | C2 | 1.13 × 10−05 | 0.36 | 0.41 | 0.00062 | 2.68 × 10−08 | 0.80 (0.73, 0.87) | 0.28 | \n | rs2280774 | 32036670 | T | NELFE | 1.11 × 10−05 | 0.29 | 0.34 | 0.00096 | 3.89 × 10−08 | 0.81 (0.74, 0.89) | 0.83 | \n | rs3117116 | 32474995 | C | BTNL2 | 9.15 × 10−08 | 0.15 | 0.13 | 0.038 | 2.65 × 10−08 | 1.25 (1.10, 1.41) | 0.02 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5518214_006_00.png" ]
[ { "role": "user", "content": "<|image|>Translate the illustration into Markdown format." }, { "role": "assistant", "content": "<md> | <COLSPAN=3> AB | <COLSPAN=3> NAB | \n | ID | SRCglu | SRCglu + pyr | ID | SRCglu | SRCglu + pyr | \n | --- | --- | --- | --- | --- | --- | \n | 110.ROH | 42% | 45% | 110.ROH | 59% | 64% | \n | 156.ROH | 66% | 75% | 156.ROH | 32% | 30% | \n | 178.ROH | 5% | 6% | 178.ROH | 34% | 24% | \n | 179.ROH | 21% | 31% | 179.ROH | 52% | 57% | \n | 206.ROH | 51% | 55% | 229.ROH | 28% | 24% | \n | 207.ROH | 37% | 41% | 231.ROH | 4% | 3% | \n | 208.ROH | 33% | 30% | 248.ROH | −4% | −31% | \n | 218.ROH | −12% | −11% | 250.ROH | −87% | −110% | \n | 219.ROH | 20% | 16% | 251.ROH | 21% | 19% | \n | 229.ROH | −21% | −10% | SS206 | 10% | 64% | \n | 231.ROH | −92% | −113% | SS208 | 34% | 56% | \n | 240.ROH | 34% | 32% | SS212 | 60% | 65% | \n | 245.ROH | −52% | −73% | SS213 | −72% | −50% | \n | 248.ROH | −8% | −22% | SS220 | 27% | 45% | \n | 250.ROH | −72% | −75% | SS229 | 24% | 18% | \n | 251.ROH | 22% | 37% | SS234 | 28% | 37% | \n | n | 16 | 16 | n | 16 | 16 | \n | Mean | 5% | 4% | Mean | 16% | 20% | \n | SD | 45% | 52% | SD | 41% | 48% | \n | SE | 11% | 13% | SE | 10% | 12% | \n | p‐value | 0.816 | | p‐value | 0.410 | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC545962_006_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the illustration in markdown code: <md> | | <COLSPAN=2> Unstandardised coefficients | Standardised coefficients | | | \n | | B | SE | Beta | t | Sig. | \n | --- | --- | --- | --- | --- | --- | \n | Constant | -2.404 | 4.302 | | -0.559 | | \n | Diagnosis (1 = right, 0 = wrong) | 12.345 | 2.644 | 0.200 |" }, { "role": "assistant", "content": "4.668 | < 0.001 | \n | Patient's age | 0.077 | 0.036 | 0.076 | 2.128 | 0.034 | \n | Accessibility by phone a | 0.155 | 0.054 | 0.112 | 2.859 | 0.005 | \n | Doctor's assistant's attitude a | 0.401 | 0.067 | 0.355 | 5.960 | < 0.001 | \n | Doctor's assistant's advice a | 0.267 | 0.055 | 0.282 | 4.840 | < 0.001 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5677772_010_01.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the diagram in markdown code: <md> | Changes planned | Broilers | Cattle | Pigs | Sheep | Total | \n | --- | --- | --- | --- | --- | --- | \n | Increase production | 9 (43) | 8 (31) | 4 (15) | 20 (74) | 51 | \n | Decrease production | 0 | 1 (4) | 1 (4) | 0 | 2 | \n | New or improved buildings or equipment | 4 (19) | 7 (27) | 4 (15) | 6 (22) | 21 | \n | On‐farm slaughter of" }, { "role": "assistant", "content": "livestock | 2 (9) | 0 | 0 | 2 (7) | 4 | \n | Change breed | 0 | 0 | 0 | 1 | 1 | \n | Total n farmers questioned | 21 | 26 | 26 | 27 | 100 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3849882_012_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the image into Markdown language." }, { "role": "assistant", "content": "<md> | <COLSPAN=8> Probability of using medical care | \n | | <COLSPAN=3> Probit with controls | <COLSPAN=4> Need-standardized | \n | | | | | <COLSPAN=2> With controls | <COLSPAN=2> Without controls | \n | Quintile | Actual | Need Predicted | Difference= predicted-actual | Probit | OLS | Probit | OLS | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | Poorest 20% | 0.256 | 0.330 | −0.073 | 0.229 | 0.230 | 0.232 | 0.232 | \n | 2nd poorest 20% | 0.276 | 0.313 | 0.037 | 0.265 | 0.266 | 0.267 | 0.267 | \n | Middle | 0.271 | 0.297 | 0.026 | 0.277 | 0.276 | 0.276 | 0.276 | \n | 2nd richest 20% | 0.332 | 0.293 | 0.040 | .342 | 0.342 | 0.342 | 0.342 | \n | Richest 20% | 0.389 | 0.281 | 0.108 | 0.411 | 0.410 | 0.408 | 0.408 | \n | Mean | 0.305 | 0.303 | 0.002 | 0.305 | 0.305 | 0.305 | 0.305 | \n | Concentration | 0.089 | 0.033 | | 0.121 | 0.120 | 0.118 | 0.117 | \n | Index/HIwv | | | | | | | | \n | Standard error | 0.013 | 0.004 | | 0.013 | 0.013 | 0.013 | 0.013 | \n | t-ratio | 6.644 | −8.028 | | 9.469 | 9.404 | 9.234 | 9.219 | </md>" } ]
mp_sft
PubTabNet
null