image listlengths 1 1 | messages listlengths 2 2 | task_name stringclasses 5 values | dataset_name stringclasses 17 values | rvl_cdip_class stringclasses 12 values |
|---|---|---|---|---|
[
"./val_imgs/PubTabNet/val/PMC5553993_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Interpret the picture as Markdown format."
},
{
"role": "assistant",
"content": "<md> | S/no. | Variable | Frequency (n) | Percentage (%) | \n | --- | --- | --- | --- | \n | 1. | <COLSPAN=3> Age | \n | | 14–19 | 104 | 26.8 | \n | | 20–24 | 214 | 55.2 | \n | | 25+ | 70 | 18.0 | \n | 2. | <COLSPAN=3> Marital status | \n | | Never married | 360 | 92.8 | \n | | Ever married/cohabiting | 28 | 7.2 | \n | 3. | <COLSPAN=3> Religion | \n | | Christianity | 283 | 72.9 | \n | | Islam | 105 | 27.1 | \n | 4. | <COLSPAN=3> Ethnicity | \n | | Yoruba | 332 | 85.6 | \n | | Others | 56 | 14.4 | \n | 5. | <COLSPAN=3> Type of institution | \n | | Polytechnic student | 159 | 41.0 | \n | | University student | 138 | 35.6 | \n | | College of education student | 91 | 23.5 | \n | 6. | <COLSPAN=3> Level of education | \n | | 1st year | 80 | 20.6 | \n | | 2nd year | 143 | 36.9 | \n | | 3rd year | 99 | 25.5 | \n | | 4th year and above | 66 | 17.0 | \n | 7. | <COLSPAN=3> Family setting | \n | | Monogamous | 280 | 72.2 | \n | | Polygamous | 108 | 27.8 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2082030_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following table content in markdown style: <md> | | HBV DNA+ | HBV DNA- | | Sensitivity(%) | Specificity(%) | PPV(%) | NPV (%) | Overall (%) | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | HBpreSAg+ | 48 | 34 | | 68 | 56 | 59 | 66 | 62 | \n | HBpreSAg- | 23 | 44 | CI,95% | 55–78 | 45–67 | | | | \n | <COLSPAN=2> n = 149 | <COLSPAN=7> | \n | | HBV DNA+ | HBV DNA- | | Sensitivity(%) | Specificity(%) | PPV(%) | NPV (%) | Overall (%) |"
},
{
"role": "assistant",
"content": "\n | HBeAg+ | 43 | 7 | | 61 | 91 | 86 | 72 | 77 | \n | HBeAg- | 28 | 71 | CI,95% | 48–72 | 82-96 | | | | \n | <COLSPAN=2> n=149 | <COLSPAN=7> | \n | | HBeAg+ | HBeAg- | | Sensitivity(%) | Specificity(%) | PPV(%) | NPV (%) | Overall (%) | \n | HBpreSAg+ | 35 | 49 | | 70 | 53 | 42 | 79 | 58 | \n | HBpreSAg- | 15 | 55 | CI,95% | 55-82 | 43-63 | | | | \n | <COLSPAN=2> n=154 | <COLSPAN=7> | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5872568_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Encode the image in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | <ROWSPAN=2> Access and adherence to ART | Total (n = 328) | Male (n = 169) | Female (n = 159) | <ROWSPAN=2> p-value* | \n | n (%) | n (%) | n (%) | \n | --- | --- | --- | --- | --- | \n | Mean number of days the drug supply is usually given | 58.4 ± 53.9 | 61.4 ± 73.7 | 55.1 ± 14.9 | 0.3 | \n | <COLSPAN=4> Ever shared your drugs to other persons | – | \n | No | 328 (100) | 169 (100) | 159 (100) | | \n | Yes | 0 (0.0) | 0 (0.0) | 0 (0.0) | | \n | <COLSPAN=4> Having been asked to come back earlier than appointment | 0.56 | \n | No | 283 (86.3) | 144 (85.2) | 139 (87.4) | | \n | Yes | 45 (13.7) | 25 (14.8) | 20 (12.6) | | \n | <COLSPAN=4> Reasons for coming back earlier than appointment | 0.35 | \n | Lack of medicines | 10 (22.2) | 5 (20.0) | 5 (25.0) | | \n | Additional check up | 21 (46.7) | 10 (40.0) | 11 (55.0) | | \n | Other | 14 (31.1) | 10 (40.0) | 4 (20.0) | | \n | <COLSPAN=4> Having been asked to buy any other medicines | 0.81 | \n | No | 319 (97.3) | 164 (97.0) | 155 (97.5) | | \n | Yes | 9 (2.7) | 5 (3.0) | 4 (2.5) | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC1413544_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following photo content in markdown style: <md> | | <COLSPAN=2> Average sample (design effect ratio = 1.19) | <COLSPAN=2> High psychological distress (design effect ratio = 1.32) | \n | | LA-RDD n = 2,000 | EWP n = 2,380 | LA-RDD n = 1,960 | EWP n = 2,600 | \n | Number of dialling | 29,800 | 23,562 | 29,204 | 25,740 | \n | Costed dialling * | 16,600 | 15,708 | 16,268 | 17,160 | \n | Calling time (in hours) | 1,180 | 1,249.5 | 1,156.4 | 1,365 | \n | --- | ---"
},
{
"role": "assistant",
"content": "| --- | --- | --- | \n | Cost† | $26,920 | $28,132 | $26,382 | $30,732 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4524012_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the image with markdown style: <md> | <ROWSPAN=3> Year | <COLSPAN=5> No. of samples (%) | \n | <ROWSPAN=2> Recombinant | Belem"
},
{
"role": "assistant",
"content": "| <COLSPAN=2> Sal-1 | <ROWSPAN=2> Total | \n | B-1 | S-a | S-b | \n | --- | --- | --- | --- | --- | --- | \n | 2011 | 24 (28.2) | 16 (18.9) | 24 (28.2) | 21 (24.7) | 85 | \n | 2012 | 92 (37.1) | 50 (20.2) | 60 (24.2) | 46 (18.5) | 248 | \n | 2013 | 48 (36.4) | 32 (24.2) | 32 (24.2) | 20 (15.2) | 132 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2770543_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the photo content behind with markdown code: <md> | Haplotypea | <COLSPAN=2> Estimated frequency | \n | --- | --- | --- | \n | | Severe malaria | Mild malaria | \n"
},
{
"role": "assistant",
"content": "| 1: CCTGGGCATCAACTCT | 0.095 | 0.163 | \n | 2: TATACCAGATGATCAC | 0.723 | 0.637 | \n | 3: CAGACCAGATGATCAC | 0.03 | 0.018 | \n | 4: TATACCAGATGATCCC | 0.025 | 0.04 | \n | 5: CATACCAGATGATCAC | 0.057 | 0.045 | \n | 6: CAGACCAGATGCTCAC | 0.038 | 0.048 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5404212_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the illustration into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Country and program stage | Sample size, n | Message coverage2 | Contact coverage3 | Effective coverage4 | \n | --- | --- | --- | --- | --- | \n | Bangladesh5 | | | | | \n | Survey 1.1A | 1927 | 44.7 (41.3, 48.4) | 23.5 (20.8, 26.7) | 2.1 (1.4, 3.2) | \n | Survey 1.2A | 1924 | 63.7 (60.0, 67.1) | 36.8 (33.4, 40.9) | 3.9 (2.7, 5.5) | \n | Survey 2 | 2887 | 46.3 (43.3, 49.4) | 26.3 (23.6, 28.6) | 0.8 (0.4, 1.2) | \n | Côte d’Ivoire | | | | | \n | End-line | 776 | 85.0 (82.3, 87.3) | 37.5 (32.8, 42.5) | 4.6 (2.9, 7.2) | \n | Ghana6 | | | | | \n | Survey 1.1B | 306 | 97.7 (92.9, 100.0) | 94.4 (89.7, 98.1) | 88.3 (81.1, 94.6) | \n | Survey 1.2B | 306 | 99.0 (91.8, 100.0) | 92.0 (82.7, 98.7) | 83.1 (73.4, 93.1) | \n | Survey 1.3 | 307 | 99.7 (98.4, 100.0) | 84.4 (77.6, 89.9) | 61.9 (53.2, 69.9) | \n | Survey 2.1 | 620 | 63.8 (57.2, 71.1) | 23.5 (19.0, 28.5) | 15.3 (11.3, 19.8) | \n | Survey 2.2 | 663 | 89.8 (86.6, 92.4) | 52.8 (47.7, 58.9) | 9.4 (6.7, 12.4) | \n | India | | | | | \n | End-line | 905 | 93.7 (82.4, 97.9) | 86.8 (73.1, 94.1) | 57.2 (48.2, 65.8) | \n | Vietnam | | | | | \n | End-line | 962 | 29.0 (21.9, 35.9) | 22.6 (17.4, 28.2) | 12.5 (8.3, 16.8) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4820835_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the figure with markdown style: <md> | Database | Sample count | Gene count | Database url | Reference | \n | --- | --- | --- | --- | --- | \n | ProteomicsDB | 577 | 17,153 | https://www.proteomicsdb.org/ | (5)"
},
{
"role": "assistant",
"content": "| \n | MOPED | 172 | 17,164 | http://moped.proteinspire.org | (8) | \n | PaxDB | 11 | 19,851 | http://pax-db.org/#!home | (9) | \n | MaxQB | 11 | 10,059 | http://maxqb.biochem.mpg.de/mxdb/ | (10) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4640978_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the diagram content behind with markdown code: <md> | | n | Age (years) | Weight (kg) | Height (cm) | \n | --- | --- | --- | --- | --- | \n | Males | 308 | 73.5 ± 5.7 (65–91) | 84.3 ± 14.0 (56–125) | 174.3 ± 7.2"
},
{
"role": "assistant",
"content": "(147–198) | \n | Females | 125 | 76.8 ± 7.4 (53–98) | 66.4 ± 11.1 (40–96) | 158.1 ± 6.7 (141–175) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5097118_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the picture into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | Site | Sex | Implant observed | Bone resorption (mm) (mean ± SD) | t test P value | \n | --- | --- | --- | --- | --- | --- | \n | <ROWSPAN=4> Sur-6 months | <ROWSPAN=2> Mesial | Male | 20 | 0.56 ± 0.86 | <ROWSPAN=2> .809 | \n | Female | 12 | 0.63 ± 0.65 | \n | <ROWSPAN=2> Distal | Male | 20 | 0.23 ± 0.21 | <ROWSPAN=2> .002 | \n | Female | 12 | 0.84 ± 0.53 | \n | <ROWSPAN=4> Prosthesis | <ROWSPAN=2> Mesial | Male | 20 | 0.77 ± 1.33 | <ROWSPAN=2> .021 | \n | Female | 12 | 1.90 ± 1.19 | \n | <ROWSPAN=2> Distal | Male | 20 | 0.48 ± 0.49 | <ROWSPAN=2> .003 | \n | Female | 12 | 1.67 ± 1.06 | \n | <ROWSPAN=4> Total | <ROWSPAN=2> Mesial | Male | 20 | 1.33 ± 1.81 | <ROWSPAN=2> .064 | \n | Female | 12 | 2.54 ± 1.55 | \n | <ROWSPAN=2> Distal | Male | 20 | 0.71 ± 0.52 | <ROWSPAN=2> .001 | \n | Female | 12 | 2.51 ± 1.41 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5753013_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the photo with markdown style: <md> | Event | Time | Minutes | EtCO2 | RR | BP | Pulse | O2 saturation | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | <ROWSPAN=2> Initial patient presentation to ED | 11/29/16 16:59:00 | 0 | <ROWSPAN=2> NA | 24 | 119/73 | 144 | 97% (room air) | \n | 11/29/201619:15 | 16 | 21 | 128/50 | 133 | 99% (room air) | \n | C-section procedure start | 11/29/16 19:55:00 | 56 | 32 | ETT | 128/75 | 120 | 96% (on ETT) | \n | Delivery of baby | 11/29/16 19:56:00 | 57 | 0 | ETT | 72/48 | 140 | 72% (on ETT) | \n | A-OK therapy initiated"
},
{
"role": "assistant",
"content": "| 11/29/16 19:57:00 | 58 | | ETT | 80/50 | 130 | 94% (on ETT) | \n | (Effect of) A-OK therapy | 11/29/16 20:00:00 | 61 | 35 | ETT | 138/68 | 140 | 97% (on ETT) | \n | Operating room timeout | 11/29/16 21:20:00 | 81 | 37 | 21 | 140/94 | 140 | 94% (on ventilator) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4976483_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the photo into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | AICA sensitivity (%) | PICA sensitivity (%) | \n | --- | --- | --- | \n | Direction-changing nystagmus | 60 | 56.3 | \n | Skew | 60 | 53.1 | \n | HIT | 30 | 100 | \n | Grade ataxia 1 | 0 | 9.4 | \n | Ataxia 2 | 20 | 28.1 | \n | Ataxia 3 | 80 | 62.5 | \n | Ataxia 2–3 | 100 | 90.6 | \n | Asynergy | 100 | 90.6 | \n | HINTS | 100 | 100 | \n | Ataxia 2–3 + nystagmus | 100 | 100 | \n | Ataxia 2–3 + skew | 100 | 100 | \n | Ataxia 2–3 + HIT | 100 | 100 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4683726_002_01.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the photo into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Items | Basal diet (B) | Chicory forage (C) | Ribwort forage (R) | \n | --- | --- | --- | --- | \n | Ash | 67.0 | 255.6 | 133.6 | \n | Crude protein | 211.4 | 195.2 | 169.4 | \n | Crude fat | 26.9 | 15.6 | 11.1 | \n | Starch | 463.0 | 24.5 | 9.5 | \n | WSC | 60.5 | 11.5 | 42.0 | \n | NDF | 107.6 | 268.0 | 352.0 | \n | NSP | | | | \n | Total | 187.2 | 311.0 | 308.5 | \n | Insoluble | 142.6 | 194.9 | 229.5 | \n | Glucose | | | | \n | Total | 89.4 | 133.7 | 134.9 | \n | Insoluble | 56.9 | 118.3 | 134.9 | \n | Arabinose | | | | \n | Total | 25.0 | 13.4 | 17.8 | \n | Insoluble | 22.4 | 5.6 | 10.4 | \n | Xylose | | | | \n | Total | 56.7 | 31.1 | 32.1 | \n | Insoluble | 56.2 | 27.2 | 26.8 | \n | Uronic acid | | | | \n | Total | 7.4 | 97.0 | 88.3 | \n | Insoluble | 4.0 | 21.2 | 19.9 | \n | Klason Lignin | 34.9 | 107.2 | 77.7 | \n | Dietary fibre | 222.0 | 418.4 | 386.2 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3098182_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the picture into Markdown format."
},
{
"role": "assistant",
"content": "<md> | KEGG name | Modules | \n | --- | --- | \n | ABC transporters | 5 | \n | Flagellar assembly | 1 | \n | Porphyrin and chlorophyll metabolism | 1 | \n | Oxidative phosphorylation | 1 | \n | Bacterial secretion system | 2 | \n | Two-component system | 2 | \n | Phenylalanine, tyrosine and tryptophan biosynthesis | 1 | \n | Phenylalanine metabolism | 1 | \n | Starch and sucrose metabolism | 1 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3457899_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the illustration in markdown code: <md> | Populations compareda | Snnb | HSTc | \n | --- | --- | --- | \n | <COLSPAN=3> By geographic region | \n | Region A (36) vs. region B (14) vs. region C (10) vs. region D (6) | 0.5468* | 0.0469** | \n | <COLSPAN=3> By host origin | \n | triticale (33) vs. wheat (33) | 0.8654** | 0.0397** | \n | <COLSPAN=3> By year of collection within host origin wheat | \n | Region D 1980’s (6) vs. Region A-B-C 2009–2010 | 0.7283ns | −0.0025ns | \n | <COLSPAN=3> By geographic region within host origin triticale | \n | region A (16) vs. region B (8) vs. region C (9) | 0.5899** | 0.1008** | \n | region A (16) vs. region B (8) | 0.6597ns | 0.0019ns | \n | region A (16) vs. region C (9) | 0.7667* | 0.1116* | \n | region"
},
{
"role": "assistant",
"content": "B (8) vs. region C (9) | 0.8677* | 0.1428* | \n | <COLSPAN=3> By pathogenicity | \n | Pathogenic (37) vs. non-pathogenic (29) on triticale | 0.9811** | 0.0565** | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3716901_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the photo into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | I. ricinus | I. persulcatus | TOTAL | \n | | No. of ticks positive/total positive (prevalence, %) | No. of ticks positive/total positive (prevalence, %) | No. of ticks positive/total positive (prevalence, %) | \n | --- | --- | --- | --- | \n | B. afzelii VS461 | 60/187 (32.1%) | 32/88 (36.4%) | 92/275 (33.5%) | \n | B. afzelii NT28 | 37/187 (18.8%) | 5/88 (5.7%) | 42/275 (15.3%) | \n | VS461+ NT28 | 8/187 (4.3%) | 5/88 (5.7%) | 13/275 (4.7%) | \n | Total B. afzelii | 105/ 187 (56.1%) | 42/ 88 (47.7%) | 147/ 275 (53.5%) | \n | B. garinii 20047 | 38/187 (20.3%) | 9/88 (10.2%) | 47/275 (17.1%) | \n | B. garinii NT29 | 0/187 | 25/88 (28.4%) | 25/275 (9.1%) | \n | Total B. garinii | 38/ 187(20.3%) | 34/ 88 (38.6%) | 72/ 275 (26.2%) | \n | B. valaisiana | 13/ 187 (6.9%) | 2/ 88 (2.3%) | 15/ 275 (5.5%) | \n | B. burgdorferi s.s. | 3/ 187 (1.6%) | 0/ 88 | 3/ 275 (1.1%) | \n | B. bavariensis | 1/ 187 (0.5%) | 0/ 88 | 1/275 (0.4%) | \n | Mix of several genotypes | 27/ 187 (14.4%) | 10/ 88 (11.4%) | 37/275 (13.5%) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4955131_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the photo into Markdown format."
},
{
"role": "assistant",
"content": "<md> | <COLSPAN=2> Multivariate analysis | \n | Variable | P-value (overall survival) | \n | --- | --- | \n | AJCC staging | <0.0001* | \n | age (20 < vs ≥20) | 0.2819 | \n | Sex | 0.5497 | \n | FOXM1 | 0.0302* | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3180366_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following diagram content in markdown style: <md> | | No. of hypertensives | Mean blood pressure mmHg (SD) | %ACE/ARB | %CCB | %Thiazides | %Beta-blockers | %Alpha blockers | Mean no.of drugs | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | eGFR > 60 ml/min/1.73 m2 | | | | | | | | | \n | White | 10 546 | 136.5 (15.5) | 54.3 | 48.1 | 41.9 | 27.1 | 9.8 | 1.81 | \n | South Asian | 4 557 | 132.4 (16.1) | 51.5 | 47.1 | 32.5 | 25.5 | 7.6 | 1.64 | \n | Black | 5 508 | 138.2 (16.1) | 43.2 | 71.4 | 53.0 | 22.0 | 14.7 | 2.04 | \n | ANOVA p value | | < 0.01 | < 0.01 | < 0.01 | < 0.01 | < 0.01 | < 0.01 | < 0.01 | \n | eGFR < 60 ml/min/1.73 m2 | | | | | | | | | \n | White | 3 407 | 136.1 (17.4) | 64.2 | 56.3 | 35.7 | 16.2 | 43.5 | 2.16 | \n | South Asian | 767 | 134.3 (18.8) | 60.3 | 56.7 | 32.7 | 12.4 | 37.4 | 2.00 | \n | Black"
},
{
"role": "assistant",
"content": "| 1 223 | 138.9 (18.4) | 58.5 | 72.9 | 30.3 | 22.7 | 53.7 | 2.38 | \n | ANOVA p value | | < 0.01 | < 0.01 | < 0.01 | < 0.01 | < 0.01 | < 0.01 | < 0.01 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4115483_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the picture into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | <COLSPAN=2> Subject | \n | | Male | Female | \n | --- | --- | --- | \n | Age | 27 | 25 | \n | Height | 167 cm | 151 cm | \n | Weight | 64 Kg | 52 Kg | \n | Head circumference | 56.5 cm | 55.5 cm | \n | Neck circumference | 32 cm | 30 cm | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3045988_019_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the figure in markdown code: <md> | Noise duration | trial 1 | trial 2 | trial 3 | average | \n | --- | --- | ---"
},
{
"role": "assistant",
"content": "| --- | --- | \n | 0.1 s | 0.92 | 0.92 | 0.90 | 0.91 | \n | 0.2 s | 0.90 | 0.89 | 0.92 | 0.90 | \n | 0.3 s | 0.91 | 0.90 | 0.89 | 0.90 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2246125_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Encode the picture in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | Flies bearing transgene h14-3-3γ * | Heat-shock induction of transgene | Numbers of cells in \"S\" phase | Numbers of eye imaginal discs observed | \n | --- | --- | --- | --- | \n | None (Control) | | | | \n | - HS | NO | 4.14 (± 1.03) | 8 | \n | + HS | NO | 8.29 (± 3.11) | 8 | \n | h14-3-3γ | | | | \n | - HS | NO | 9.90 (± 1.92) | 11 | \n | + HS | YES | 11.0 (± 5.69) | 3 | \n | Both HS1433GA & HS1433GC | | | | \n | - HS | NO | 8.0 (± 1.91) | 10 | \n | + HS | YES | 20.5 (± 2.32)a | 11 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4280744_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the figure with markdown style: <md> | Characteristics | p-value* | \n | --- | --- | \n | <COLSPAN=2> Anatomical success at 6 months vs | \n | CD4 counts at RD | 0.915 | \n | CMVR activity at surgery | 0.570 | \n | CMV size </> 50% | 0.197 | \n | Macula on/off RD | > 0.999 | \n | Presence of PVR | 0.272 | \n | Presence of IRU | 0.603 | \n | Concurrent scleral buckling | 0.628 | \n | 23G/20G vitrectomy | 0.201 | \n | <COLSPAN=2> Functional success at 6 months vs | \n | CD4 counts at RD | 0.847 | \n | CMV size </> 50% | 0.103 |"
},
{
"role": "assistant",
"content": "\n | CMVR activity at surgery | 0.314 | \n | CMV macula involvement | 0.088 | \n | RD size </> 50% | 0.321 | \n | Macula on/off RD | > 0.999 | \n | Presence of PVR | > 0.999 | \n | Presence of IRU | 0.367 | \n | 23G/20G vitrectomy | 0.090 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5404332_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the figure into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Canonical Pathways | p-value | \n | --- | --- | \n | <COLSPAN=2> Green Module | \n | IL-10 Signaling | 4.47E-08 | \n | TREM1 Signaling | 1.14E-06 | \n | PPAR/RXR Activation | 3.96E-06 | \n | Fc Receptor-mediated Phagocytosis in Macrophages and Monocytes | 9.75E-06 | \n | PPAR Signaling | 9.75E-06 | \n | <COLSPAN=2> Yellow Module | \n | IL-8 Signaling | 5.90E-09 | \n | Production of Nitric Oxide and Reactive Oxygen Species in Macrophages | 8.84E-07 | \n | Caveolar-mediated Endocytosis Signaling | 2.29E-05 | \n | Role of Tissue Factor in Cancer | 2.95E-05 | \n | Relaxin Signaling | 3.26E-05 | \n | <COLSPAN=2> Brown Module | \n | tRNA Charging | 2.06E-10 | \n | Purine Nucleotides De Novo Biosynthesis II | 5.12E-04 | \n | Cleavage and Polyadenylation of Pre-mRNA | 8.27E-04 | \n | Nur77 Signaling in T Lymphocytes | 1.61E-03 | \n | Leucine Degradation I | 2.17E-03 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4405018_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the photo content behind with markdown code: <md> | | Standard 2D FLASH | CAIPIRINHA 3D FLASH | T1w TSE triggered | T2w TIRM | T2w HASTE FS | \n | --- | --- | --- | --- | --- | --- | \n | TR, ms | 86.0 | 6.1 | 2000 | 8290 | 1000 | \n | TE, ms | 3.8 | 3.0 | 2.5 | 84 | 102 | \n | Flip angle, ° | 90"
},
{
"role": "assistant",
"content": "| 10 | 15 | 180 | 160 | \n | Scan orientation | Transverse | Transverse | Transverse | Coronal | Coronal | \n | In-plane resolution, mm | 1.3 × 1.3 | 1.0 × 1.0 | 0.7 × 0.7 | 0.8 × 0.8 | 1.0 × 1.0 | \n | Slice thickness, mm | 5 | 3–5 | 4 | 4 | 4 | \n | FOV, mm | 250 | 250 | 350 | 350 | 350 | \n | iPAT | None | Acceleration factor = 4 | None | Acceleration factor = 2 | Acceleration factor = 2 | \n | Breath-hold | 22 s | 15 s | Respiratory-triggered | 20 s | 21 s | \n | Scan time | 4 min 3 s | 15 s | 6 min 10 s | 3 min 5 s | 42 s | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5650382_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Interpret the table as Markdown format."
},
{
"role": "assistant",
"content": "<md> | | | <COLSPAN=2> Nuclear c-Myc expression | | \n | | N | Positive | Negative | P value | \n | --- | --- | --- | --- | --- | \n | Ovarian cancer | 138 | 40 | 98 | | \n | Ovarian tissues | 47 | 6 | 41 | 0.031 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3398323_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the table into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Allergen | <COLSPAN=2> Concentration of the allergen | \n | --- | --- | --- | \n | | SPT | BAT | \n | Cat pelt | 10,000 BAU/ml | 100 BAU/ml | \n | Dog epithelium | 1:20 | 1:2000 | \n | Dermatophagoides pteronyssius (DP) | 1000 AU/ml | 100 AU/ml | \n | Dermatophagoides farinae (DF) | 1000 AU/ml | 100 AU/ml | \n | Alternaria | 1:10 | 1:1000 | \n | Hormodendrum/Cladosporium | 1:10 | 1:1000 | \n | Timothy grass pollen | 100,000 AU/ml | 1000 AU/ml [BAT] | \n | Short ragweed pollen | 1:20 | 1:2000 | \n | Birch tree (Betula verrucosa) pollen | 1:20 | 1:2000 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2956722_007_01.png"
] | [
{
"role": "user",
"content": "<|image|>Express the table as Markdown code."
},
{
"role": "assistant",
"content": "<md> | Hybrid Capture-II (HC-II) | <COLSPAN=2> HPV-16 E6 PCR | Total | \n | | HPV-16 E6 Positive | HPV-16 E6 Negative | | \n | --- | --- | --- | --- | \n | HC-II Positive | 42 (77.78%) | 15 (9.74%) | 57 (100) | \n | HC-II Negative | 12 (22.22%) | 139 (90.26%) | 151 (100) | \n | Total | 54 | 154 | 208 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4019897_006_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the image content behind with markdown code: <md> | Characteristic | Refugee n | Refugee mean (95% CI) | Cameroonian n | Cameroonian mean (95% CI) | \n | --- | --- | --- | --- | --- | \n | Average daily income, CFA | 188 | 842.38 (593.58 – 1091.18) | 394 | 1172.53 (1001.66 – 1343.39) | \n | Average size of land owned, hectares | 187 | 1.54 (0.38 – 2.69) | 397 | 1.26 (0.68 – 1.83) | \n | Cows owned by household | 191 | 6.6 (0.2 – 12.9) | 396 | 6.2 (3.9 –"
},
{
"role": "assistant",
"content": "8.5) | \n | Chickens owned by household | 191 | 2.3 (1.5 - 3.2) | 396 | 2.3 (1.6 – 3.0) | \n | Day without food in the past month | 191 | 1.7 (1.6 – 1.8) | 395 | 1.7 (1.7 – 1.8) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4847216_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the picture in markdown code: <md> | | Prenotification (n = 727) | No prenotification (n = 201) | p-value | \n | --- | ---"
},
{
"role": "assistant",
"content": "| --- | --- | \n | Total prehospital time, median | 22.5 (18.5–26.0) | 22 (17.5–26.5) | 0.433 | \n | Door to CT time, median | 13 (10.0–18.0) | 19 (13.0–34.0) | <0.001 | \n | Door to CT time ≤ 25 min | 660 (90.8 %) | 125 (62.2 %) | <0.001 | \n | Door to needle time, median | 63 (49.0–79.0) | 68 (54.0–86.0) | 0.138 | \n | Door to needle time ≤ 60 min | 65 (45.1 %) | 7 (28.0 %) | 0.110 | \n | Administering thrombolytic therapy | 144 (19.8 %) | 25 (12.4 %) | 0.017 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5155644_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Express the diagram as Markdown code."
},
{
"role": "assistant",
"content": "<md> | Characteristics | Outpatient(n=55) | Hospitalized(n=344) | P value | \n | --- | --- | --- | --- | \n | RSV A | 42 (76.4%) | 242 (70.3%) | 0.36 | \n | RSV B | 12 (21.8%) | 98 (28.5%) | 0.31 | \n | RSV A and B coinfection | 1 (1.8%) | 4 (1.2%) | >0.99 | \n | Other respiratory pathogen | 23 (41.8%) | 74 (21.5%) | 0.001 | \n | Age (years) (mean, SD) | 2.4 (3.2) | 1.3 (2.1) | 0.018 | \n | <COLSPAN=4> Gender | \n | Male | 29 (52.7%) | 204 (59.3%) | 0.36 | \n | Female | 26 (47.3%) | 140 (40.7%) | | \n | <COLSPAN=4> Smoking history | \n | Never smoked | 45 (81.8%) | 277 (80.5%) | 0.82 | \n | Former/current/passive smoker | 10 (18.2%) | 67 (19.5%) | | \n | <COLSPAN=4> Underlying conditions | \n | Any underlying condition | 14 (25.4%) | 142 (41.3%) | 0.026 | \n | Cardiovascular disorder | 0 | 8 (2.3%) | 0.61 | \n | Activities of daily living impaired | 0 | 2 (0.6%) | 1 | \n | Hematological malignancy | 0 | 3 (0.9%) | 1 | \n | Chronic lung disease | 2 (3.6%) | 12 (3.5%) | 1 | \n | Solid organ malignancy | 0 | 1 (0.3%) | 1 | \n | Neuromyopathy | 0 | 1 (0.3%) | 1 | \n | Immunodeficiencies | 1 (1.8%) | 4 (1.2%) | 0.53 | \n | Congenital malformations/congenital syndromes | 4 (7.3%) | 68 (19.8%) | 0.023 | \n | Renal disorder | 0 | 1 (0.3%) | 1 | \n | Asthma | 2 (3.6%) | 14 (4.1%) | 1 | \n | Cognitive dysfunction | 2 (3.6%) | 9 (2.6%) | 0.65 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3434939_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the picture with markdown style: <md> | | Site 1 | Site 2 | Site 3 | Site 4 | All sites | \n | --- | --- | --- | --- | --- | --- | \n | Latitude | 17.284 | 17.283 | 17.282 | 17.278 | - | \n | Longitude | −87.808 | −87.814 | −87.815 | −87.815 | - | \n | N | 8 | 57 | 18 | 35 | 118 | \n | <COLSPAN=6> Genetic diversity | \n | Ar | 3.84 | 4.73 | 4.23 | 4.31 | 4.28 | \n | FIS | 0.83 | 0.55 | 0.76 | 0.60 | 0.63 | \n | HL | 0.86 | 0.68 | 0.87 |"
},
{
"role": "assistant",
"content": "0.73 | 0.77 | \n | SR | 0.72 | 0.62 | 0.51 | 0.66 | 0.63 | \n | SI | 0.76 | 0.62 | 0.68 | 0.69 | 0.69 | \n | J′ | 0.33 | 0.46 | 0.25 | 0.42 | 0.41 | \n | R | 0.018 | −0.001 | 0.013 | 0.007 | 0.000 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3602667_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the image into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Under-sampling | <COLSPAN=2> SVM | <COLSPAN=2> MyC | <COLSPAN=2> RIPPER | <COLSPAN=2> C4.5 | Imbalance | \n | (%) | Sens. | Spec. | Sens. | Spec. | Sens. | Spec. | Sens. | Spec. | ratio | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | 0 | 0.89 | 0.77 | 0.92 | 0.68 | 0.91 | 0.71 | 0.90 | 0.79 | 42 | \n | 10 | 0.89 | 0.76 | 0.93 | 0.65 | 0.91 | 0.75 | 0.90 | 0.80 | 38 | \n | 20 | 0.89 | 0.75 | 0.93 | 0.63 | 0.91 | 0.73 | 0.91 | 0.79 | 34 | \n | 30 | 0.89 | 0.76 | 0.94 | 0.61 | 0.93 | 0.72 | 0.90 | 0.78 | 30 | \n | 40 | 0.89 | 0.73 | 0.93 | 0.60 | 0.92 | 0.69 | 0.91 | 0.77 | 25 | \n | 50 | 0.90 | 0.70 | 0.93 | 0.58 | 0.92 | 0.71 | 0.91 | 0.76 | 21 | \n | 60 | 0.90 | 0.71 | 0.94 | 0.56 | 0.92 | 0.72 | 0.92 | 0.73 | 17 | \n | 70 | 0.91 | 0.67 | 0.95 | 0.55 | 0.91 | 0.72 | 0.92 | 0.70 | 13 | \n | 80 | 0.92 | 0.64 | 0.94 | 0.49 | 0.92 | 0.73 | 0.92 | 0.68 | 9 | \n | 90 | 0.94 | 0.52 | 0.91 | 0.60 | 0.93 | 0.67 | 0.93 | 0.59 | 5 | \n | 100 | 0.99 | 0.12 | 0.99 | 0.07 | 0.99 | 0.03 | 0.99 | 0.14 | 0.5 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3443074_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the photo content behind with markdown code: <md> | | Patient 1 | Patient 2 | Patient 3 | Patient 4 | Patient 5 | \n | --- | --- | --- | --- | --- | --- | \n | Number of NGS runs | 1 | 1 | 1 | 2 | 2 | \n | 454 experiment | Standard 1/3 run | Standard 1/3 run | Standard 1/3 run | Standard 1/5 Titanium 1/12 | Standard 1/5 Titanium 1/12 | \n | Mapped reads | 127980 | 96538 | 111492 | 24940* (Std) 24192* (Tit) | 16767* (Std) 40169* (Tit) | \n | Total average coverage | 221 | 168 | 194 | 73* | 88* | \n | % sequenced amplicons with coverage > 38 | 94.4 | 93.2 | 96.3 | 80.3 | 85.3 | \n | % sequenced amplicons with coverage > 30 | 95.3 | 94.6 | 97.2 | 86.8 | 91.5 | \n | % sequenced amplicons with coverage > 5 | 97.2 | 97.2 | 99.0 | 94.6 | 96.3 |"
},
{
"role": "assistant",
"content": "\n | Mutations | New mutation found in CDH23 | New mutation found in CDH23 | No mutation could be clearly identified | New mutation found in OTOF | Known mutation in TMC1 confirmed | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3648407_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the image content behind with markdown code: <md> | <ROWSPAN=2> Secondary structures | <ROWSPAN=2> Wavenumber (cm-1) | <COLSPAN=4> L-cysteine (g/l) | \n | 0.0 | 0.5 | 1.0 | 1.5"
},
{
"role": "assistant",
"content": "| \n | --- | --- | --- | --- | --- | --- | \n | Aggregated strands (%) | 1625-1610 | 1.55 | 1.21 | 2.51 | 2.01 | \n | β-Sheet (%) | 1640-1630 | 11.33 | 14.73 | 21.09 | 25.31 | \n | Random coil (%) | 1645-1640 | 37.50 | 27.30 | 3.28 | 5.52 | \n | α-Helix (%) | 1657-1648 | 16.96 | 25.52 | 49.40 | 31.03 | \n | 3-Turn helix (%) | 1666-1659 | 20.13 | 27.63 | 21.35 | 34.54 | \n | Antiparallel β-sheet/ aggregated strands (%) | 1680-1695 | 12.53 | 3.62 | 2.38 | 1.59 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5982247_013_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the table content behind with markdown code: <md> | Rank | R | G | B | FOV | Contrast | Fmeasure | Positional Error"
},
{
"role": "assistant",
"content": "(mm) | Angular Error (°) | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | 1 | 195 | 120 | 75 | narrow | 4 | 1.00 | 0.60 | 3.1 | \n | 2 | 240 | 45 | 75 | narrow | 3 | 1.00 | 0.92 | 3.0 | \n | 3 | 105 | 30 | 150 | narrow | 4 | 1.00 | 1.15 | 2.9 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5613338_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the table into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Variable | % of TIP cases(N = 45) | % of controlsa(N = 137) | ORcrude(95% CI) | ORadj(95% CI) | \n | --- | --- | --- | --- | --- | \n | <COLSPAN=5> Days before seeking treatment | \n | 0–3 | 29 | 63 | ref | | \n | 4–9 | 42 | 32 | 3.0(1.8–5.7) | 2.2(0.83–5.8) | \n | 10+ | 29 | 5.1 | 13(3.8–43) | 11(1.9–61) | \n | <COLSPAN=5> Heard of typhoid fever before | \n | Yes | 64 | 82 | ref | | \n | No | 36 | 18 | 2.5(1.0–5.9) | NS | \n | <COLSPAN=5> Heard of typhoid outbreak in Kampala | \n | Yes | 41 | 75 | ref | | \n | No | 59 | 25 | 4.4(1.9–10) | 5.2(1.8–15) | \n | <COLSPAN=5> Got treatment beforeb | \n | No | 45 | 77 | ref | | \n | Yes | 96 | 23 | 7.0(1.5–31) | 9.0(1.1–78) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5732420_002_01.png"
] | [
{
"role": "user",
"content": "<|image|>Express the table as Markdown code."
},
{
"role": "assistant",
"content": "<md> | Name | Sequence | Use | \n | --- | --- | --- | \n | hepP-For1 | GGACTGGCAAGCTGATAGGA | Analysis of hepP transcriptionAnalysis of operon | \n | hepP-Rev1 | CGATACGCAAGGAAAGAGGA | Analysis of hepP transcriptionAnalysis of operon | \n | zbdP-For1 | CGGGTGTTGGCTATTGATTT | Analysis of zbdP transcription | \n | zbdP-Rev1 | AACAATCCGTCCACGCTTAC | Analysis of zbdP transcription | \n | zbdP-For2 | CTTCTGAGGACAAGGCTTCG | Analysis of operon | \n | hepP-Rev2 | GATAAGGCTCCCAACCTTC | Analysis of operon | \n | zbdP-For3 | AGCCGACTATCGCTTGTGAA | Confirmation of hepP mutation | \n | hepP-Rev3 | GTGCTTTTCGAGCAATGGAG | Confirmation of hepP mutation | \n | hepP-ATG | ATGGCACTTCAAAAACTCGTCCG | Cloning hepP | \n | hepP-[-TGA] | ACTCGTATTTGCTGGGGTGGAATT | Cloning hepP | \n | Trx Forward | TTCCTCGACGCTAACCTG | Confirmation of cloning | \n | pBAD Reverse | GATTTAATCTGTATCAGG | Confirmation of cloning | \n | hepP-For2 | CGCTGGTGCAACAAGTAGAA | Analysis of hepP transcription | \n | hepP-Rev4 | GCGTGATACATCGGAGACAA | Analysis of hepP transcription | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC1774573_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Render the table in Markdown format."
},
{
"role": "assistant",
"content": "<md> | Protein | Case A | Case B | Case C | Case D | Case E | \n | --- | --- | --- | --- | --- | --- | \n | CA I | -6.5 | -1.6 | -3.3 | -4.3 | -2.6 | \n | CA II | -2.6 | -1.3 | -26 | -4.3 | -13 | \n | FOV | -13 | -13 | -26 | * | -26 | \n | MnSOD | +1.7 | -2.6 | +6.5 | +1.4 | +1.1 | \n | HMG-1 | +13 | * | +3.7 | +13 | * | \n | PGK1 | +1.6 | +1.1 | -1.2 | +2.6 | -1.4 | \n | AST | -13 | -1.6 | -6.5 | -3.7 | -2.6 | \n | GST | * | -26 | * | -13 | -13 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2836282_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the table into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | Athlete | N | Mean | Std Deviation | Std Error Mean | \n | --- | --- | --- | --- | --- | --- | \n | Total Deviation(right hand) | yes | 83 | 80.0 | 14.9 | 3.3 | \n | | no | 217 | 73.3 | 14.4 | 1.6 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5601157_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following figure content in markdown style: <md> | | <COLSPAN=2> LRFS | <COLSPAN=2> PFS | <COLSPAN=2> OS | \n | | HR(95%CI) | P | HR(95%CI) | P | HR(95%CI) | P | \n | --- | --- | --- | --- | --- | --- | --- | \n | Age >60 | 1.858(0.942-3.667) | 0.074 | 1.845(0.986-3.450) | 0.055 | 2.595(1.233-5.461) | 0.012 | \n | ELTI | 1.467(0.810-2.655) | 0.206 | 1.715(0.987-2.978) | 0.056 | 2.426(1.102-5.342) | 0.028 | \n | 3DCRT | 2.230(1.027-4.845) | 0.043 |"
},
{
"role": "assistant",
"content": "1.544(0.800-2.981) | 0.195 | 2.104(0.832-5.323) | 0.116 | \n | CR after chemotherapy | 0.430(0.214-0.866) | 0.018 | 0.475(0.255-0.885) | 0.019 | 0.486(0.210-1.036) | 0.091 | \n | Asparaginase-based chemotherapy | 0.448(0.172-1.169) | 0.101 | 0.424(0.184-0.981) | 0.045 | 0.440(0.136-1.424) | 0.171 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC6073152_005_01.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the illustration into Markdown format."
},
{
"role": "assistant",
"content": "<md> | <ROWSPAN=2> Property | <COLSPAN=6> A Type of Polymer Concrete | \n | CG-0 | CG-10 | CG-30 | CG-50 | CG-70 | CG-100 | \n | --- | --- | --- | --- | --- | --- | --- | \n | Bulk density [g/cm3] | 1.86 | 1.89 | 1.93 | 1.93 | 1.94 | 2.04 | \n | Water adsorption [%] | 1.55 | 1.53 | 1.49 | 1.46 | 1.37 | 1.22 | \n | Water resistance | <COLSPAN=6> above W6 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5134529_013_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the illustration in markdown code: <md> | <ROWSPAN=2> | <ROWSPAN=2> Objects | <COLSPAN=2> Horizontal Rectification | <COLSPAN=2> Commonly Used Methods | \n | Integrity (%) | Precision (RMSE) | Integrity (%)"
},
{
"role": "assistant",
"content": "| Precision (RMSE) | \n | --- | --- | --- | --- | --- | --- | \n | <ROWSPAN=2> Horizontal Objects | Roof 1 | 99.15% | 10.1 cm | 98.89% | 15.2 cm | \n | Roof 2 | 98.86% | 18.1 cm | 98.55% | 21.5 cm | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4168068_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the photo content behind with markdown code: <md> | Phage name | Place isolated | Capsid height (nm) | Capsid width (nm) | Tail length (nm) | Tail width (nm) | Contracted sheath length (nm) | Contracted sheath width (nm) | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | Myoviridae | | | | | | | | \n | Abouo | Utah, USA | 68.3 ± 5.6 | 65.1 ± 3.6 | 113.6 ± 2.6 | 12.7 ± 3.8 | 45.7 ± 5.0 | 24.0 ± 2.3 | \n | Davies | Utah, USA | 68.1 ± 4.5 | 61.7 ± 3.2 | 125.4 ± 0.2 | 9.8 ± 0.7 | 83.0 ± 0 | 19.2 ± 0 | \n | Emery | Utah, USA | 73.5 ± 3.2 | 66.0 ± 3.3 | 162.2 ± 5.2 | 11.0 ± 1.4 | 82.9 ± 0 | 25.5 ± 0 | \n | Jimmer1 | Utah, USA | 68.2 ± 3.6 | 61.3 ± 3.9 | 98.9 ± 14.7 | 11.9 ± 1.4 | 43.1 ± 1.5 | 23.3 ± 2.5 | \n | Jimmer2 | Utah, USA | 62.9 ± 2.5 | 66.3 ± 2.2 | 75.6 ± 8.7 | 7.7 ± 0.3 | 42.9 ± 2.4 | 20.6 ± 0.4 | \n | PBL0.5c* (and PBL2 *) | Georgia (Minnesota) | 66.3 ± 3 | 66.3 ± 3 | 142.0 ± 1 | 9.2 ± 0.9 | 92.0 ± 1 | 22.5 ± 1.2 | \n | BL2* | Unknown | 64.1 ± 1.1** | 60.1 ± 3.9** | 116 | 7 | 76 | 19 | \n |"
},
{
"role": "assistant",
"content": "Siphoviridae | | | | | | | | \n | phiIBB_Pl23* | Portugal | <COLSPAN=4> Not published | | | \n | Round capsid | | | | | | | | \n | PBL3* | USA | 62.2 ± 2.2** | 70 ± 2.1 | 140 ± 2.8 | 10.1 ± 0.9 | — | — | \n | Elongated capsid | | | | | | | | \n | BLA* | Czechoslovakia | 150 | 68 | 280 | 13 | — | — | \n | PBL1* (and PPL1c *) | USA | 95.9 ± 2.6 | 52.5 ± 1.9 | 131.8 ± 1.5 | 9.4 ± 0.6 | — | — | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC6090832_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the picture content behind with markdown code: <md> | | Grade 1 | Grade 2 | Grade 3 | Grade 4 | \n | --- | --- | --- | --- | --- | \n | WBC (X 1000) | 3.0 to < 4.0 | 2.0 to < 3.0 | 1.0 to < 2.0 | < 1.0 | \n | Platelets (X 1000) | 75 to 100 | 50 to <75 | 25 to < 50 | <25 or spontaneous | \n | Neutrophils (X 1000)"
},
{
"role": "assistant",
"content": "| 1.5 to 1.9 | 1.0 to < 1.5 | 0.5 to < 1.0 | <0.5 or sepsis | \n | Hemoglobin (GM %) | 11 to 9.5 | <9.5 to 7.5 | <7.5 to 5.0 | < 5.0 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5307813_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the table in markdown code: <md> | Socioeconomic factors | ORa (95% CI)Model 1b | AOR (95% CI)Model 2c | AOR (95% CI)Model 3d | \n | --- | --- | --- | --- | \n | <COLSPAN=4> Education | \n | Illiteracy and primary | 2.9 (1.1–7.6) | 2.0 (0.5–7.8) | 1.6 (0.4–6.2) | \n | Secondary and higher | 1.00 | 1.00 | 1.00 | \n | <COLSPAN=4> Family income | \n | Low | 3.4 (1.3–9.0) | 1.1 (0.2–4.9) | 1.4 (0.3–5.7) | \n | Medium and high | 1.00 | 1.00 | 1.00 | \n | Nationality | | | – | \n | Afghan | 6.3 (1.7–23.9) | 4.4 (1.1–18.2) | | \n | Iranian | 1.00 | 1.00"
},
{
"role": "assistant",
"content": "| | \n | Insurance | 0.2 (0.1–0.6) | – | – | \n | Insurance-nationality | | – | | \n | Uninsured Afghan | 7.3 (1.9–28.3) | | 5.1 (1.2–22.6) | \n | Uninsured Iranian | 2.0 (0.5–7.9) | | 1.7 (0.4–7.1) | \n | Insured Iranian | 1.00 | | 1.00 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3772336_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the figure into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | <COLSPAN=2> RLG (N = 11) | <COLSPAN=2> NRG (N = 12) | <COLSPAN=2> NCG (N = 5) | <COLSPAN=2> CG (N = 30) | \n | | M | SD | M | SD | M | SD | M | SD | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=9> T1 | \n | Age | 25.09 | 6.47 | 25.25 | 4.09 | 29.6 | 4.88 | 26.17 | 5.69 | \n | Education | 14.27 | 1.62 | 14.25 | 1.96 | 13 | 1.41 | 14.03 | 1.65 | \n | Males/Females | 3/8 | | 10/2 | | 1/4 | | 14/14 | | \n | IQ | 115.46 | 6.53 | 119.08 | 9.65 | 123.4 | 7.57 | 120.97 | 8.23 | \n | Months depressed | 1.64 | 1.57 | 2.08 | 2.07 | 2 | 0.71 | * | | \n | MADRS score | 25 | 4.36 | 23 | 2.49 | 28 | 3.16 | * | | \n | Treatment | <COLSPAN=8> Frequency/percent | \n | Psychological treatment. | 2 | 18.2% | 5 | 41.7% | 1 | 20% | * | | \n | Medical treat. | 1 | 9.1% | 1 | 8.3% | 2 | 40% | * | | \n | Both psych/med. | 6 | 54.5% | 4 | 33.3% | 0 | | * | | \n | No treatment | 2 | 18.2% | 2 | 16.7% | 2 | 40% | * | | \n | <COLSPAN=9> T2 | \n | MADRS score | 9.09 | 5.19 | 7.42 | 3.53 | 18 | 6.33 | * | | \n | Treatment | <COLSPAN=8> Frequency/percent | \n | Psychological treatment. | 3 | 27.3% | 1 | 8.3% | 1 | 20% | * | | \n | Medical treatment | 1 | 9.1% | 0 | | 1 | 20% | * | | \n | Both psych/med.treat. | 4 | 36.4% | 6 | 50% | 1 | 20% | * | | \n | No treatment | 3 | 27.3% | 5 | 41.7% | 2 | 40% | * | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2915972_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Render the table in Markdown format."
},
{
"role": "assistant",
"content": "<md> | | No of patients | \n | --- | --- | \n | Gender: | | \n | Men | 24 | \n | Women | 26 | \n | Age (years): | | \n | 30-39 | 2 | \n | 40-49 | 8 | \n | 50-59 | 15 | \n | 60-69 | 16 | \n | 70-79 | 6 | \n | ≥ 80 | 3 | \n | Tumor site: | | \n | Bladder | 4 | \n | Breast | 10 | \n | Colorectal | 4 | \n | Esophageal | 9 | \n | Gynecological | 7 | \n | Lung | 6 | \n | Prostate | 10 | \n | <COLSPAN=2> Length of interval between baseline and follow-up interview | \n | (median) | | \n | < 50 days | 22 | \n | ≥ 50 days | 28 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3607964_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Interpret the figure as Markdown format."
},
{
"role": "assistant",
"content": "<md> | | Alfentanil group (n=129) | Fentanyl group (n=131) | P value | \n | --- | --- | --- | --- | \n | Cardiopulmonary complications | 14 (10.9) | 14 (10.7) | 0.966 | \n | Systolic hypotension (<90mmHg) | 12 (9.3) | 11 (8.4) | 0.797 | \n | MAP decreased >25% | 4 (3.1) | 2 (1.5) | 0.445 | \n | Use of vasopressors | 1 (0.8) | 2 (1.5) | 0.445 | \n | Bradycardia (<50 beats/min) | 0 | 0 | 0.445 | \n | Hypoxemia (SpO2 < 90%) | 4 (3.1) | 3 (2.3) | 0.721 | \n | Chin lift | 4 (3.1) | 1 (0.8) | 0.212 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4110242_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the photo in markdown code: <md> | Population | Disability | Intervention | Study type/outcome measures (economic evidence searches only) | \n | --- | --- | --- | --- | \n | Child* | Disab* | Wheelchair | Cost benefit | \n | Adolescen* | Physically impair* | Buggy | Cost utility | \n | Young* | Physical impair* | Mobility technolog* | Cost effective* | \n | Teen* | Handicap* | Mobility aid | Qaly | \n | Disab* child* | Dystroph* | Powered wheelchair | Quality-adjusted life year | \n | Disab* | Cerebral palsy | Mobility equipment | Quality adjusted life year | \n | Adolescen* | Spina bifida | Motorised | Health economic* | \n | Disab* young* | Wheelchair* | Mobility training | Economic analys* |"
},
{
"role": "assistant",
"content": "\n | Disab* teen* | Special needs | Wheelchair service | Cost minimisation | \n | | Amputee | Electric scooter | Health care cost* | \n | | Complex needs | Pushchair | Healthcare cost* | \n | | Brain injury | Mobility | Social economic* | \n | | Brain damage* | | Social care economic* | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3856526_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the diagram in markdown code: <md> | | DMFT | D | M | F | \n | --- | --- | --- | --- | --- | \n | Our study | | | | | \n | 35–44 | 14.5 | 5.0 | 3.0 | 6.4 | \n | 65-74"
},
{
"role": "assistant",
"content": "| 22.6 | 4.2 | 15.4 | 3.0 | \n | French population (1995) | | | | | \n | 35–44 means | 14.6 | 1.2 | 3.0 | 10.4 | \n | High occupational group (OG) | 13.7 | 0.9 | 2.0 | 10.8 | \n | Low OG | 14.8 | 1.3 | 3.6 | 9.9 | \n | 65-74 means | 23.3 | 1.1 | 16.9 | 5.2 | \n | High OG | 19.4 | 0.9 | 10.2 | 8.4 | \n | Low OG | 24.5 | 1.2 | 19.4 | 4.0 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5296661_008_00.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the figure into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Locus tag | Gene symbol | Description | Relative fold change in 4-APP-treated to vehicle-treated C57BL/6 mice (mean (s.e.)) | Relative fold change in MyD88-deficient to wild type C57BL/6 mice (mean (s.e.)) | \n | --- | --- | --- | --- | --- | \n | SAOUHSC_02265 | agrA | Accessory gene regulator protein A | −1.60 (0.22) | −1.62 (0.5) | \n | SAOUHSC_02566 | sarR | Accessory regulator R | −1.83 (0.22) | −1.23 (0.09) | \n | SAOUHSC_01121 | hla | Alpha-hemolysin | −3.32 (1.56) | −18.06 (0.16) | \n | SAOUHSC_02971 | aur | Zinc metalloproteinase aureolysin | −2.31 (0.96) | −2.59 (0.75) | \n | SAOUHSC_00988 | sspA | Glutamyl endopeptidase | −2.19 (0.01) | −2.32 (0.46) | \n | SAOUHSC_00561 | vraX | Protein VraX | −3.91 (2.76) | 1.11 (0.04) | \n | SAOUHSC_00436 | gltD | Glutamate synthase subunit beta | −2.41 (1.11) | −6.03 (1.66) | \n | SAOUHSC_01803 | aapA | D-serine/D-alanine/glycine transporter | 1.21 (2.32) | 1.69 (0.29) | \n | | RNAIII | Regulatory RNA | −1.80 (0.53) | −2.52 (0.08) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5930791_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Render the table in Markdown format."
},
{
"role": "assistant",
"content": "<md> | | <COLSPAN=2> Univariate Analysis | <COLSPAN=2> Multivariate Analysis | \n | Variable | HR (95% CI) | p-value | HR (95% CI) | p-value | \n | --- | --- | --- | --- | --- | \n | Age > 65 | 1.44 (0.64–2.43) | 0.58 | NA | NA | \n | Male sex | 2.23 (1.42–3.05) | 0.01 | 3.66 (1.56–8.60) | 0.002 | \n | G3 vs G1G2 vs G1 | 1.36 (0.58–3.21)0.33 (0.03–2.92) | 0.290.32 | NA | NA | \n | T3-T4 vs T1-T2 | 1.94 (0.88–4.25) | 0.12 | NA | NA. | \n | N + ve vs N -ve | 2.11 (1.31–2.90) | 0.02 | 2.25 (1.00–5.17) | 0.049 | \n | RT total dose | 1.42 (0.87–2.33) | 0.16 | NA | NA | \n | Boost: yes vs no | 1.72 (0.40–7.35) | 0.47 | NA | NA | \n | OTT > 42 days | 1.75 (0.86–2.65) | 0.19 | NA | NA | \n | Hb | 0.5 (0.30–0.83) | 0.006 | 0.53 (0.33–0.87) | 0.001 | \n | Response | 6.26 (2.73–14.40) | < 0.0001 | 6.96 (2.96–16.50) | < 0.0001 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3146404_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the photo into Markdown language."
},
{
"role": "assistant",
"content": "<md> | Databases(update search to mid Oct 2010) | Search Terms | Hand Search of Journals (update search to mid Oct 2010) | \n | --- | --- | --- | \n | Web of Knowledge all databases(Web of Science with conferenceProceedings (1899-2010), BIOSISPreviews (1969-2010), Inspec(1969-2010), MEDLINE (1950-2010),Journal Citation Reports (2000-2010));OVID (AMED (1985-2010); MEDLINE(1950 to 2010); PsycINFO (1806 to 2010);and EMBASE (1980 to 2010)); Cancerlit(1975-2010); ASSIA (1987-2010);CINAHL (1982 to 2010); and Cochranereviews (1996-2010). | (\"United Kingdom\" OR UK OR Britain OREngland OR Wales OR Scotland OR \"NorthernIreland\")AND(palliative OR terminal OR \"end of life\"OR end-of-life OR death OR dying OR\"continu* care\" OR \"advance directive*\"OR hospice* OR \"supportive care\")AND(cultur* OR intercultural OR cross-culturalOR transcultural OR ethnic* OR migrant* ORminorit* OR diversity OR Muslim* OR Jew* ORChristian* OR Sikh* OR Buddh* OR Hindu* ORIndia* OR Pakistan* OR black OR white ORCaribbean* OR Africa* OR Bangladesh* ORIrish OR British OR Chinese OR Asian*)a | European Journal of Palliative Care 1994-2010International Journal of Palliative Nursing 1996-2010Palliative Medicine 1987-2010Journal of Palliative Care 1985-2010Diversity in Health and Social Care 2004-2008(Diversity in Health and Care 2008-2010)Omega 1970-2010Mortality 1996-2010Medical Anthropology Volume 21 2002-2010 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3405643_002_02.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the image into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Variables | N | HOMA-IR | P | \n | --- | --- | --- | --- | \n | Genotype | 92 | | | \n | Non-3 | 74 (80.4%) | 1.94 (1.51–3.61) | <ROWSPAN=2> 0.890 | \n | 3 | 18 (19.6%) | 1.93 (1.46–3.56) | \n | Fibrosis stage∗ | 89 | | | \n | F0/F1 | 63 (70.8%) | 1.93 (1.51–2.93) | <ROWSPAN=2> 0.207 | \n | F2/F3 | 26 (29.2%) | 2.75 (1.55–3.95) | \n | Viral load | 73 | | | \n | >400.000 UI/mL | 55 (75.3%) | 1.53 (1.17–2.35) | <ROWSPAN=2> 0.027 | \n | <400.000 UI/mL | 18 (24.7%) | 2.21 (1.29–3.76) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3882720_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the diagram into Markdown language."
},
{
"role": "assistant",
"content": "<md> | | <COLSPAN=3> Dependent variables and model summaries | \n | | <COLSPAN=2> Visuo-spatial WM (late) | <COLSPAN=2> Verbal WM (late) | <COLSPAN=2> Reasoning (late) | \n | Independent variables | β | P | β | P | β | P | \n | --- | --- | --- | --- | \n | Constant | – | 0.002 | – | 0.032 | – | 0.171 | \n | Sex | -0.568 | 0.242 | 0.300 | 0.422 | -0.025 | 0.612 | \n | Age (Inverse) | -150.70 | 0.241 | 57.692 | 0.517 | -20.47 | 0.145 | \n | Mother Edu (years) | 0.048 | 0.680 | -0.107 | 0.242 | 0.018 | 0.139 | \n | Father Edu (years) | 0.185 | 0.138 | 0.043 | 0.653 | -0.010 | 0.423 | \n | Outcome (Early) | 0.715 | <0.001 | 0.773 | <0.001 | 0.668 | <0.001 | \n | Online/gaming/TV(h/w) | -0.002 | 0.907 | 0.043 | 0.004 | 0.001 | 0.436 | \n | Exercise (h/w) | -0.229 | 0.078 | 0.157 | 0.110 | -0.005 | 0.712 | \n | Music (h/w) | 0.351 | 0.003 | 0.261 | 0.006 | 0.021 | 0.090 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4301494_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following image content in markdown style: <md> | | Male, n (%) | Female, n (%) | Total, n (%) | \n | --- | --- | --- | --- | \n | <COLSPAN=4> Pathological stage | \n | I | 8 (13.6) | 51 (84.4) | 59 (61.5) | \n | II | 2 (40.0) | 3 (60.0) | 5 (5.2) | \n | III | 2 (11.0) | 16 (88.9) | 18 (18.8) | \n | IV | 2 (14.3) | 12 (85.7) | 14 (14.6) | \n | Total | 14 (14.6) | 82 (85.4) | 96 (100) | \n | <COLSPAN=4> Histology | \n | Adenocarcinoma | 11 (12.2) | 79 (87.8) | 90 (93.8) | \n | Squamous cell carcinoma | 3 (75.0) | 1 (25.0) | 4 (4.2) | \n | Small cell carcinoma | 0 (0.0) | 0 (0.0) | 0 (0.0) | \n | Others | 0 (0.0) | 2 (100) | 2 (2.1) | \n | <COLSPAN=4> EGFR mutation status | \n | Positive | 5 (8.8) | 52 (91.2) | 57 (59.4) | \n | Exon 19 | 1 (4.3) | 22 (95.7) | 23 (24.0) | \n | L858R | 3 (12.0) | 22 (88.0) | 25 (26.0) | \n | Others | 1 (11.1) | 8 (88.9) | 9 (9.4) | \n |"
},
{
"role": "assistant",
"content": "Negative | 9 (23.1) | 30 (76.9) | 39 (40.6) | \n | <COLSPAN=4> HPV genotyping status | \n | Positive | 0 (0.0) | 1 (100.0) | 1 (1.0) | \n | Negative | 14 (14.7) | 81 (85.3) | 95 (99.0) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4932734_005_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the table content behind with markdown code: <md> | Calcium channel blockers | Limited to women currently using an antihypertensive drug for 5 years or more (N = 8057) | Limited to women currently using an antihypertensive drug for 10 years or more (N = 3879) | \n | --- | --- | --- | \n | Never used"
},
{
"role": "assistant",
"content": "| Reference | Reference | \n | Former user | 0.87 (0.36–2.11) | 0.80 (0.20–3.24) | \n | Current user (<5 years) | 1.06 (0.71–1.58) | 1.09 (0.60–1.99) | \n | (5–10 years) | 1.14 (0.81–1.61) | 1.15 (0.58–2.29) | \n | (10+ years) | 0.89 (0.58–1.36) | 0.89 (0.57–1.40) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2206387_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Encode the figure in Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | Age (years) and sex | Spinal level | Score | Reason excised/cause of death | \n | --- | --- | --- | --- | \n | Normal tissue: live patients | | | | \n | 18 M | L4/5 | 0 | Spinal trauma | \n | | L5/S1 | 1 | | \n | 24 M | L3/4 | 1 | Spinal trauma | \n | 48 F | L3/4 | 1 | Spinal reconstruction for metastatic breast cancer | \n | Normal tissue: cadaveric | | | | \n | 59 F | L3/4 | 1 | Massive pulmonary embolism | \n | 52 M | L4/5 | 1 | Myocardial infarction | \n | 47 M | L3/4 | 1 | Road traffic accident | \n | 72 M | L3/4 | 1 | Myocardial infarction | \n | 64 M | L5/S1 | 2 | Myocardial infarction | \n | 75 F | L4/5 | 2 | CVA | \n | 47 F | L4/5 | 3 | Ovarian cancer | \n | 58 M | L4/5 | 3 | Myocardial infarct | \n | Degenerate tissue: live patients | | | | \n | 51 M | L4/5 | 7 | Disc degeneration | \n | 60 M | L4/5 | 7 | Disc degeneration | \n | 25 M | L4/5 | 8 | Disc degeneration | \n | 45 M | L4/5 | 8 | Disc degeneration | \n | 48 M | L4/5 | 8 | Disc degeneration | \n | 73 F | L3/4 | 9 | Disc degeneration | \n | 61 M | L5/S1 | 9 | Disc degeneration | \n | 45 F | L5/S1 | 9 | Disc degeneration | \n | 53 M | L4/5 | 10 | Disc degeneration | \n | 46 F | L4/5 | 11 | Data not available | \n | Degenerate tissue: cadaveric | | | | \n | 49 F | L4/5 | 5 | Data not available | \n | 57 F | L4/5 | 6 | Myocardial infarction | \n | 64 M | L4/5 | 7 | Myocardial infarction | \n | 69 M | L4/5 | 8 | CVA | \n | 47 F | L3/4 | 8 | Breast cancer | \n | 76 M | L4/5 | 9 | CVA | \n | 50 M | L3/4 | 9 | Myocardial infarction | \n | 61 F | L5/S1 | 10 | Data not available | \n | 28 M | L4/5 | 11 | Road traffic accident | \n | 59 M | L4/5 | 11 | Myocardial infarction | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2674415_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Express the table as Markdown code."
},
{
"role": "assistant",
"content": "<md> | clinic phenotype | number of samples | HCMV PCR positive samples | \n | --- | --- | --- | \n | poorly differentiated adenocarcinomas | 7 | 0 | \n | moderately differentiated adenocarcinomas | 24 | 5 | \n | well differentiated adenocarcinomas | 5 | 0 | \n | adenomas | 20 | 1 | \n | total | 56 | 6 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5713197_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Interpret the diagram as Markdown format."
},
{
"role": "assistant",
"content": "<md> | b-DNACp-MBs-Mixture Solution Incubation Time, min | [Anti DNA–RNA Hybrid Antibody], μg·mL−1 | [ProtA–HRP40], μg·mL−1 | Slope, nA·nM−1 | Sensitivity, % | \n | --- | --- | --- | --- | --- | \n | 30 | 2.0 | 2.0 | 55,214 ± 921 | 100 | \n | <ROWSPAN=4> 15 | 2.0 | 2.0 | 34,843 ± 2542 | 63.1 | \n | 4.0 | 2.0 | 30,844 ± 4494 | 55.9 | \n | 2.0 | 4.0 | 53,899 ± 659 | 97.6 | \n | 4.0 | 4.0 | 48,862 ± 4269 | 88.5 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3840315_008_00.png"
] | [
{
"role": "user",
"content": "<|image|>Express the photo as Markdown code."
},
{
"role": "assistant",
"content": "<md> | miRNA_name | Rank sum rank | \n | --- | --- | \n | rno-miR-92a | 1 | \n | rno-miR-25 | 2 | \n | rno-miR-27a | 3 | \n | rno-miR-92b | 4 | \n | rno-let-7b* | 5 | \n | rno-miR-93 | 6 | \n | rno-miR-130b | 7 | \n | rno-miR-320 | 8 | \n | rno-miR-874 | 9 | \n | rno-miR-24 | 10 | \n | rno-miR-127* | 211 | \n | rno-miR-22 | 212 | \n | rno-miR-101a | 213 | \n | rno-miR-138 | 214 | \n | rno-miR-98 | 215 | \n | rno-miR-532-3p | 216 | \n | rno-miR-331 | 217 | \n | rno-miR-434* | 218 | \n | rno-miR-329* | 219 | \n | rno-miR-7a | 220 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4105797_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following table content in markdown style: <md> | <COLSPAN=3> Residues | Most favored (%) | Allowed regions (%) | Generously allowed (%) | Disallowed (%) | \n | --- | --- | --- | --- | --- | --- | ---"
},
{
"role": "assistant",
"content": "| \n | <ROWSPAN=4> m35kDa | <ROWSPAN=2> Pre-MD | Procheck | 61.6 | 29.8 | 6.2 | 2.5 | \n | MolProbity | 69.9 | 20.4 | - | 9.7 | \n | <ROWSPAN=2> Post-MD | Procheck | 74.0 | 22.3 | 2.9 | 0.8 | \n | MolProbity | 86.0 | 12.7 | - | 1.3 | \n | <ROWSPAN=4> m78kDa | <ROWSPAN=2> Pre-MD | Procheck | 76.6 | 16.9 | 3.8 | 2.7 | \n | MolProbity | 80.7 | 11.7 | - | 7.6 | \n | <ROWSPAN=2> Post-MD | Procheck | 73.3 | 20.3 | 4.5 | 2.0 | \n | MolProbity | 84.1 | 12.7 | - | 3.2 | \n | <ROWSPAN=4> m87kDa | <ROWSPAN=2> Pre-MD | Procheck | 72.1 | 20.5 | 5.0 | 2.4 | \n | MolProbity | 78.5 | 12.8 | - | 8.7 | \n | <ROWSPAN=2> Post-MD | Procheck | 74.3 | 21.3 | 2.8 | 1.6 | \n | MolProbity | 83.5 | 12.7 | - | 3.8 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3356719_003_01.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the image into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Characteristics | Nonprogressors (n = 21) | Progressors (n = 46) | \n | --- | --- | --- | \n | Gender, male (%) | 14 (67) | 30 (65) | \n | Age, years | 40.1 (1.1) | 39.9 (1.1) | \n | BMI, kg/m2 | 22.9 (0.2) | 23.1 (0.2) | \n | Systolic blood pressure, mm Hg | 119.9 (2.7) | 115.9 (1.9) | \n | Diastolic blood pressure, mm Hg | 79.6 (1.4) | 77.3 (1.3) | \n | Smoking, n (%) | 13 (62) | 30 (65) | \n | TDF-FTC-based therapy, n (%) | 7 (33) | 28 (61)* | \n | CD4+ T cell count, cells/μL | 463.2 (46.1) | 469.9 (19.3) | \n | Total cholesterol, mmol/L | 4.79 (0.3) | 5.02 (0.4) | \n | HDL cholesterol, mmol/L | 1.18 (0.2) | 1.17 (0.1) | \n | LDL cholesterol, mmol/L | 2.66 (0.3) | 2.79 (0.4) | \n | Triglycerides, mmol/L | 2.48 (0.3) | 2.51 (0.3) | \n | Glucose, mmol/L | 5.40 (0.4) | 5.41 (0.4) | \n | Delta IMT, mm | −0.05 (0.01) | 0.22 (0.01)* | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC1215485_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the diagram with markdown style: <md> | principle tasks | learning objectives | \n | --- | --- | \n | - Pre-marital & health-care services. | - Take proper family, medical history, educate couples about the essentials, order for CXR, blood group, R.H & other investigations for STD.- Take proper obstetric history, conduct properly clinical examination searching for signs of anemia hypertension, edema, urinary tract disorders, pelvic size and shape, and any fetal abnormality, do a schedule for antenatal visit and weight checking giving antitetanus toxoid at the proper time & calculate the expected date for delivery. | \n | - Management of common gestational health problems. | - Diagnose and prescribe treatment for anemia, hypertension, urinary tract infections, toxoplasmosis and diabetes, and follow up patients through out gestational period. | \n | Risky pregnancies – diagnosis and follow up. | - Detect and manage risky pregnancies and follow them up. | \n | Delivery-health-care services. | - Facilitate process of delivery to be normal uncomplicated vaginal labor and promote uterine contractions for expulsion of a head presented fetus under sterile conditions. | \n | Essential postnatal health care services. | - Examine for unevoluted uterus, bleeding & promote healthy purperium, lactation and look for breast complications including over encouragement or crackled nipples. | \n | - Health educational advice for pregnant and lactating women. | - Use proper methods of communication to explain essential nutrient materials needed and the value of attending MCH clinics periodically, taking tonic drugs, vaccination and care of breasts. | \n | - Immunization of women during the age of child bearing. | - Protect women through proper implementing of vaccination program against German measles and tetanus. | \n | - Referral services. | - Put criteria for risky patient's referral and direction, identify proper time and essential measures for referral, and follow up referred patients. | \n | - Screening for the risk of developing breast carcinoma. | - Perform a proper clinical examination of breasts and detect any lump and manage accordingly specially for those with positive family history of breast cancer. | \n | - Follow up hydatiform-mole | - Monitor women with history of hydatidiform mole, prescribe essential contraceptive, give methotrexate, and follow them up. | \n | - Management of common health problems of lactating breast. | -"
},
{
"role": "assistant",
"content": "Diagnose and manage common breast problems e.g. crackled nipples, retracted malformed nipples, and breast abscess. | \n | - Infertility and menstrual cycle regulation measures. | - Take proper menstrual history, detect any abnormality, relate findings to failure of conception, and suggest proper treatment method. | \n | - Family planning services. | - Display a proper action for a better child spacing time, and communicate properly to justify a routine attendance of family planning clinics. | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4629414_021_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the picture to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | | <COLSPAN=2> Incidents of violent reoffending | <COLSPAN=3> Adjusted hazard ratio* | \n | | Without substance use disorder | With substance use disorder | Without substance use disorder | With substance use disorder | p value for interaction† | \n | --- | --- | --- | --- | --- | --- | \n | Any psychiatric disorder‡ | 764/3426 (22%) | 1912/5504 (35%) | 1·39 (1·29–1·50) | 2·43 (2·30–2·57) | 0·85 | \n | Schizophrenia spectrum disorder | 66/303 (22%) | 390/934 (42%) | 1·29 (1·00–1·67) | 2·68 (2·41–2·98) | 0·44 | \n | Bipolar disorder | 11/72 (15%) | 41/144 (28%) | 1·45 (0·75–2·79) | 3·22 (2·35–4·39) | 0·67 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3049126_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following picture content in markdown style: <md> | | <COLSPAN=2> Univariate | <COLSPAN=2> Multivariate | \n | Characteristic | ORa (95% CI) | p-valueb | AORc (95% CI) | p-value | \n | --- | --- | --- | --- | --- | \n | Older Age | | | | | \n | Per year older | 1.01 (0.98 - 1.04) | 0.446 | | | \n | Gender | | | | | \n | Female vs. Male | 2.25 (1.38 - 3.68) | 0.001 | 2.11 (1.26 - 3.55) | 0.005 | \n | Aboriginal Ancestry | | | | | \n | Yes vs. No | 1.87 (1.15 - 3.05) | 0.011 | 1.61 (0.96 - 2.72) | 0.072 | \n | Limited Access to Private Space d | | | | | \n | Yes vs. No | 1.63 (0.94 - 2.84) | 0.083 | | | \n | Drug Scene Exposure d | | | | | \n | Yes vs. No | 1.74 (1.12 - 2.72) | 0.014 | 1.40 (0.86 - 2.28) | 0.181 | \n | Most Drug Use in Public Areas d | | | | | \n | Yes vs. No | 1.69 (1.08 - 2.65) | 0.022 | 1.39 (0.85 - 2.28) | 0.187 | \n | Daily Crack Cocaine Smoking d | | | | | \n | Yes vs. No | 1.51 (0.96 - 2.35) | 0.071"
},
{
"role": "assistant",
"content": "| | | \n | Binge Drug Use d | | | | | \n | Yes | | | | | \n | Risky Pipe Sharing* d | | | | | \n | Yes vs. No | 5.87 (1.79 - 30.29) | <0.001 | 5.50 (1.63 - 18.56) | 0.006 | \n | Encounters with Police e | | | | | \n | Yes vs. No | 2.08 (1.22 - 3.53) | 0.006 | 2.09 (1.20 - 3.65) | 0.010 | \n | Victim of Violence d | | | | | \n | Yes vs. No | 0.88 (0.51 - 1.52) | 0.648 | | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5104688_002_02.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the picture to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | <ROWSPAN=2> Increase factor | <COLSPAN=2> 2-year-olds (n = 144) | <COLSPAN=2> 5-year-olds (n = 146) | \n | Freq | Percent (95% CI) | Freq | Percent (95% CI) | \n | --- | --- | --- | --- | --- | \n | <2.00 | 42 | 29.2% (21.9, 37.3) | 63 | 43.2% (35.0, 51.6) | \n | 2.00–2.99 | 12 | 8.3% (4.4%, 14.1) | 15 | 10.3% (5.9%, 16.4%) | \n | 3.00–3.99 | 14 | 9.7% (5.4, 15.8) | 9 | 6.2% (2.9, 11.4) | \n | ⩾4.00 | 76 | 52.8% (44.3, 61.2) | 59 | 40.4% (32.4, 48.8) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3546733_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the picture into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Group | Dose(μg mL−1) | NO(μmol/L) | NOS(U/mL) | iNOS(U/mL) | \n | --- | --- | --- | --- | --- | \n | Normal control | - | 56.94 ± 5.73 ** | 1.92 ± 0.30 ** | 0.64 ± 0.20 * | \n | STZ model | - | 89.34 ± 5.12 | 3.01 ± 0.35 | 1.00 ± 0.23 | \n | <ROWSPAN=3> SES | 100 | 76.79 ± 4.42 ** | 2.50 ± 0.25 * | 0.86 ± 0.28 | \n | 200 | 63.83 ± 5.26 ** | 2.21 ± 0.35 * | 0.75 ± 0.30 | \n | 400 | 58.43 ± 3.31 ** | 2.10 ± 0.18 ** | 0.61 ± 0.20 * | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5035779_002_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the illustration content behind with markdown code: <md> | Region | Population | Number of health districts | Number of health facilities (public and private) | Number of public health facilities | Rate health facilities/ population | Coverage rate DTP3 (2011), % | \n | --- | --- | --- | --- | --- | --- | --- | \n | Centre* | 3,525,664 | 29 | 571 | 370 | 1/6174 | 82 | \n | Far North | 3,480,414 | 28 | 308 | 260 | 1/11,300 | 84 | \n"
},
{
"role": "assistant",
"content": "| Total Cameroon | 19,406,110 | 2648 | 2648 | 1 888 | 1/7328 | 86 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5312588_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the photo into Markdown format."
},
{
"role": "assistant",
"content": "<md> | <COLSPAN=2> Exclusion criteria for both HEPATICUS-1 and HEPATICUS-2 | \n | --- | --- | \n | <COLSPAN=2> Patients, whose mortality approaches 100%, or who are not likely to benefit from treatment(intervention with ADVOS is likely to be futile) | \n | <COLSPAN=2> Patients, whose current medical condition does not allow treatment with any extracorporeal procedure | \n | <COLSPAN=2> Potential conflict with good clinical practice (GCP) or with the declaration of Helsinki | \n | <COLSPAN=2> PaO2/FiO2 ≤ 100 mmHg (respiratory SOFA score of 4) | \n | <COLSPAN=2> Patient testament excludes the use of life-prolonging measures | \n | <COLSPAN=2> Post-operative patients whose liver failure is related to liver surgery | \n | <COLSPAN=2> Participation in another clinical study | \n | <COLSPAN=2> Patients diagnosed with Creutzfeldt-Jakob disease | \n | <COLSPAN=2> Pregnancy | \n | <COLSPAN=2> Weight ≥120 kg | \n | <COLSPAN=2> Uncontrolled seizures | \n | <COLSPAN=2> Mean arterial pressure ≤50 mmHg despite conventional medical treatment | \n | <COLSPAN=2> Active or uncontrolled bleeding | \n | <COLSPAN=2> Untreatable extrahepatic cholestasis | \n | <COLSPAN=2> Patients with MELD-score of 40 | \n | Exclusion criteria specific for HEPATICUS-1 | Exclusion criteria specific for HEPATICUS-2 | \n | Patients with creatinine >5 mg/dl or urine output <200 ml/day(renal SOFA-score of 4) | Patient with known history of chronic liver disease | \n | Patients who receive a vasopressor support of Dopamine >15 μg/kg/min or epinephrine >0.1 μg/kg/min or norepinephrine >0.1 μg/kg/min (cardiovascular SOFA-score of 4) | | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4149194_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the picture content behind with markdown code: <md> | | Db/+, fed | Db/db, fed | Db/+, fasted | Db/db, fasted | \n | --- | --- | --- | --- | --- | \n | RR, ms | 124 ± 4 | 131 ± 3 | 137 ± 4 † | 154 ± 4*† | \n | HR, bpm | 483 ± 17 | 458 ± 12 | 438 ± 11 † | 390 ± 10*† | \n | SDRR, ms | 4.4 ± 1.0 | 5.0 ± 0.9 | 5.3 ± 0.8 | 6.0 ± 1.6 | \n | SD∆RR, ms | 2.1 ± 0.3 | 3.2 ± 0.6 | 2.8 ± 0.6 | 4.7 ± 0.7* | \n | pRR6,% | 3 ± 4 | 11 ± 5a | 8 ± 3 | 22 ± 6* | \n | LF Power, μs2 | 0.9 ± 0.2 | 0.9 ± 0.4 | 1.0 ± 0.4 | 2.5 ± 1.0 | \n | HF Power, μs2 | 2.4 ± 0.6 | 7.9 ± 3.8"
},
{
"role": "assistant",
"content": "| 6.1 ± 3.4 | 15.4 ± 4.3a | \n | LF Power, % | 32 ± 4 | 17 ± 4 | 17 ± 4 | 15 ± 5 | \n | HF Power, % | 67 ± 4 | 84 ± 4 | 84 ± 4 | 86 ± 5 | \n | LF/HF | 55 ± 11 | 25 ± 10 | 24 ± 9 | 19 ± 4 | \n | n | 12 | 12 | 10 | 9 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5316437_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following diagram content in markdown style: <md> | Parameters | Mean ± SD | \n | --- | --- | \n | Age (years) | 58.41 ± 12.93 | \n | Time from onset of RRD to vitrectomy (days) | 12.07 ± 15.36 | \n | Range of RD (degrees) | 155.85 ± 86.67 | \n | Area of retinal break (pixels) | 37000 ±"
},
{
"role": "assistant",
"content": "67100 | \n | hsa-miR-148a-3p (relative expression) | 23.68 ± 43.00 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5666787_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the diagram in markdown code: <md> | Compound | A549 | HepG2 | PANC-1 | \n | --- | --- | --- | --- | \n | Curc. | 27.11 | 14.53 | 30.57 | \n | C501 # | 1.26 | 0.66 | 1.44 | \n | C502 | 2.39 | >5 | 2.20 | \n | C503 # | 1.70 | 2.55 | 1.66 | \n | C504 # | 1.58 | 1.24 | 1.40 | \n | C505 # | 1.29 | 1.48 | 1.43 | \n | C509 # | 2.27 | 2.98 | 1.01 | \n | C510 | >5 | 1.07 | >5 | \n | C513 | >5 | 3.11 | >5 | \n | C514 | inactive | inactive | inactive | \n | C515 # | 2.73 | 1.31 | 1.46 | \n | C516 | >5 | 4.19 | >5 | \n | C517 | >5 | >5 | 2.45 | \n | C518 # | 2.42 | 4.77 | 1.25 | \n | C519 | >5 | >5 | >5 | \n | C520 | inactive | inactive | inactive | \n | C521 # | 1.88 | 1.36 | 1.18 | \n | C524 # | 1.70 | 1.69 | 1.14 | \n | C525 | inactive | inactive | inactive | \n | C526 | inactive"
},
{
"role": "assistant",
"content": "| inactive | inactive | \n | C529 | inactive | inactive | inactive | \n | C530 | inactive | inactive | inactive | \n | C532 | >5 | >5 | 1.58 | \n | C533 | >5 | 4.81 | >5 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5219688_007_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the figure content behind with markdown code: <md> | <ROWSPAN=2> | <COLSPAN=2> Ionic silver | <COLSPAN=2> Nanosilver | | \n | Medium A | Medium E | Medium A | Medium E | Units | \n | --- | --- | --- | --- | --- | --- | \n | Chloride | 125 | 0.05 | 125 | 0.05 | mM | \n | Total silver in solution | 0.7–1 | 1–1.4 | 0.6 | 0.8–1.2 | μg/mL | \n"
},
{
"role": "assistant",
"content": "| Dissolved silver | 6–130 | 0.5 | 1–2.5 | 0.5 | ng/mL | \n | Free silver | 1.3–1.8 | 3–9 | – | – | 10−10M | \n | Calc. free silver | 0.4–9 | 19 | 0.06–0.2 | 19–24 | 10−10M | \n | Toxicity floating | – | – | 0 | 0 | % | \n | Toxicity bottom | 30–90 | 10–60 | 40–60 | 10 | % | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5688796_003_01.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following table content in markdown style: <md> | Gene | Sequence (forward 5′- 3′) | Sequence (reverse 5′- 3′) | \n | --- | --- | --- | \n | Eta | AACCTGGCAACCATGAACTC | ATGAGGCTTTTGGACTGGTG | \n | Etb | CAGGATTCTGAAGCTCACCCTTT | TCCAAAACCAGCAAAAAACTCA | \n | Et-1 | TGTGCTCACCAAAAAGACAAGAA | GGTACTTTGGGCTCGGAGTTC | \n | Ece-1 | GCAAGAACATAGCCAGCGAG | CTCCGAGTATCTTCATCCATCC | \n"
},
{
"role": "assistant",
"content": "| eNos | CATACTTGAGGATGTGGCTG | CCACGTTAATTTCCACTGCT | \n | Sma | TGACCCAGATTATGTTTGAGAC | AGAGTCCAGCACAATACCAG | \n | Ptgis | CATCAAACAGTTTGTGGTCCT | CAAAGCCATATCTGCTAAGGT | \n | Ptgir | CACGAGAGGATGAAGTTTACCA | AATCCTCTGATCGTGAGAGGC | \n | Tbxas1 | AGACTCAGGTTCCACTTCAG | TCACACCTGCCTTCTATGTC | \n | Tbxa2r | ACTGTGAGGTGGAGATGATGG | CAGGATGAAGACCAGCAAGG | \n | Actb | AGATGACCCAGATCATGTTTGAG | GTACGACCAGAGGCATACAG | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5424166_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the table with markdown style: <md> | <ROWSPAN=2> Data | <COLSPAN=2> SRNS | <COLSPAN=2> SSNS | <ROWSPAN=2> P value | \n | Number | % | Number | % | \n | --- | --- | --- | --- | --- | --- | \n | Hypertension | <COLSPAN=5> | \n | Hypertensive | 16 | 59.3 | 2 | 7.4 | <ROWSPAN=2> 0.000 | \n | Normotensive | 11 | 40.7 | 25 | 92.6"
},
{
"role": "assistant",
"content": "| \n | <COLSPAN=6> Hematuria | \n | Hematuria | 9 | 33.3 | 1 | 3.7 | <ROWSPAN=2> 0.005 | \n | No hematuria | 18 | 66.7 | 26 | 96.3 | \n | <COLSPAN=6> Renal insufficiency | \n | RI | 8 | 29.6 | 0.00 | 0.00 | <ROWSPAN=2> 0.002 | \n | No RI | 19 | 70.4 | 27 | 100 | \n | <COLSPAN=6> Mean s. albumin, g/L (mean ± SD) | \n | <COLSPAN=3> 2.400 ± 0.889 | <COLSPAN=2> 2.525 ± 0.867 | 0.601 | \n | <COLSPAN=6> Mean blood urea, mmol/L (mean ± SD) | \n | <COLSPAN=3> 6.499 ± 3.491 | <COLSPAN=2> 4.149 ± 1.405 | 0.002 | \n | <COLSPAN=6> Mean s. creatinine, mmol/L (mean ± SD) | \n | <COLSPAN=3> 79.518 ± 73.150 | <COLSPAN=2> 47.696 ± 14.904 | 0.031 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4491724_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the illustration in markdown code: <md> | Cx26 type | <COLSPAN=2> Propidium iodide transfer (%) | | \n | | <2 min | 2~4 min | No transfer (%) | \n | --- | --- | --- | --- | \n | Cx26-WT | 13 (82.3) | 2 (12.5) | 1 (6.3) | \n | Cx26-V37I | 2 (12.5) | 3 (18.8)"
},
{
"role": "assistant",
"content": "| 11 (68.8) | \n | Cx26-R75Q | 0 (0) | 2 (11.8) | 15 (88.2) | \n | Cx26-V37I+R75Q | 0 (0) | 3 (16.7) | 15 (83.3) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3262777_003_01.png"
] | [
{
"role": "user",
"content": "<|image|>Interpret the diagram as Markdown format."
},
{
"role": "assistant",
"content": "<md> | | | <COLSPAN=2> δ-catenin | \n | --- | --- | --- | --- | \n | Sites | Total | Negative | Positive | \n | Supratentorial | | | | \n | Hemisphere | 124 | 87(70.2%) | 37(29.8%) | \n | Diencephalon | 2 | 2(100%) | 0(0%) | \n | Total | 126 | 89(70.7) | 37(29.3%) | \n | Infratentorial | | | | \n | Cerebellum | 17 | 13(76.5%) | 4(23.5%) | \n | Brain stem | 5 | 5(100%) | 0(0%) | \n | Spinal cord | 8 | 8(100%) | 0(0%) | \n | Total | 30 | 26(86.7%) | 4(13.3%)* | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3117319_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Render the figure in Markdown format."
},
{
"role": "assistant",
"content": "<md> | Groups | Control | Let (PCOS) | Let+aloe combined | Aloe group | Metformin group | \n | --- | --- | --- | --- | --- | --- | \n | Serum Glutamate Pyruvate Transaminase (SGPT) mg/dl | 59.33±2.12 | 59.2±1.08 | 46.25±1.23 | 59.4±2.05 | 61±1.28 | \n | Creatinine mg/dl | 0.59±0.25 | 0.57±0.17 | 0.50±0.31 | 0.58±0.11 | 0.62±0.21 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4866011_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Express the image as Markdown code."
},
{
"role": "assistant",
"content": "<md> | S.N. | Genes | Types | Functions | References | \n | --- | --- | --- | --- | --- | \n | 1 | KNOX | Transcription factor | Regulation of meristem identity in plants (monocots and dicot); Activation/repression of GA-synthesis genes | [95, 96] | \n | 2 | CLAVATA1(CLV1) | Receptor-like kinase | Maintenance of an equilibrium between cell enlargement and organ development; Regulation of apical/floral meristem determinacy | [76, 97] | \n | 3 | CLAVATA 3 (CLV3) | Peptide | Binding with the receptor-like kinase CLV1 as its ligand; Restricts WUS expression | [65, 76] | \n | 4 | AUXIN-BINDING PROTEIN 1 (ABP1) | Auxin binding protein | ABP1- TMK1 complex formation for auxin perception; Maintenance of asymmetric growth at floral primordial region | [75, 99] | \n | 5 | RHO OF PLANTS 6 (ROP6) | Plasma membrane associated small GTPase | Regulation of cellular processes; Maintenance of asymmetric growth under the influence of auxin | [75] | \n | 6 | SEPALLATA 3 (SEP3) | MADS-domain transcription factor | Interaction with floral genes AG and AP3; Regulation of floral organ formation | [98] | \n | 7 | ROP-INTERACTIVE CRIB MOTIF-CONTAINING PROTEIN 1 (RIC1) | CRIB-containing ROP effector | Regulator of ROP6 gene; Maintenance of asymmetric growth under the influence of auxin | [99] | \n | 8 | APETALA 1 (AP1) | MADS-domain transcription factor | Chromatin remodelling; Regulation of flower initiation | [74, 98] | \n | 9 | WUSCHEL (WUS) | Homeodomain transcription factor | Stem cell activity in meristematic regions; Regulation offloral meristem determinacy | [65] | \n | 10 | LEAFY (LFY) | Transcription factor | Regulation of floral meristem identity; Activator of AG, AP3 and AP1 genes | [73, 74] | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3575328_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the table into Markdown format."
},
{
"role": "assistant",
"content": "<md> | <ROWSPAN=3> | Control | <ROWSPAN=3> % | Case | <ROWSPAN=3> % | <ROWSPAN=3> P | \n | N = 938 | N = 962 | \n | N | N | \n | --- | --- | --- | --- | --- | --- | \n | Gender | | | | | 0.60 | \n | Women | 343 | 36.6 | 363 | 37.7 | | \n | Men | 595 | 63.4 | 599 | 62.3 | | \n | Hypoglycemic drugs (Yes) | 49 | 5.2 | 130 | 13.5 | <.0001 | \n | Lipid lowering drugs (yes) | 44 | 4.7 | 99 | 10.3 | <.0001 | \n | Current smoker | 132 | 14.1 | 173 | 18.0 | 0.020 | \n | Current drinker | 539 | 57.5 | 545 | 56.7 | 0.72 | \n | Regular sports habit | 669 | 71.3 | 636 | 66.1 | 0.014 | \n | | Mean | SD | Mean | SD | | \n | Age, yrs | 54.5 | 10.6 | 55.1 | 10.6 | 0.22 | \n | Body mass index, kg/m2 | 22.7 | 2.3 | 27.1 | 3.0 | <.0001 | \n | Waist circumference, cm | 79.2 | 6.4 | 94.2 | 7.1 | <.0001 | \n | Systolic blood pressure, mmHg | 122.7 | 14.8 | 133.2 | 14.9 | <.0001 | \n | Diastolic blood pressure, mmHg | 72.9 | 9.8 | 79.2 | 10.3 | <.0001 | \n | Total cholesterol, mg/dL | 203.0 | 36.5 | 206.8 | 36.7 | 0.025 | \n | Triglycerides, mg/dL | 115.0 | 74.3 | 177.6 | 103.8 | <.0001 | \n | HDL cholesterol, mg/dL | 43.2 | 9.8 | 38.5 | 7.0 | <.0001 | \n | LDL cholesterol, mg/dL | 116.4 | 31.6 | 124.7 | 32.7 | <.0001 | \n | Fasting glucose, mg/dL | 93.3 | 22.7 | 105.2 | 28.1 | <.0001 | \n | Postprandial glucose, mg/dL | 120.1 | 52.3 | 129.8 | 59.2 | 0.0002 | \n | Uric acid, mg/dL | 6.1 | 1.5 | 6.6 | 1.6 | <.0001 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3974222_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the table with markdown style: <md> | | Topic selection | Tools development | Pilot testing | \n | --- | --- | --- | --- | \n | Professional society | | | | \n | Dutch Order of Medical Specialists (OMS) | + | + | + | \n | Dutch College of General Practitioners (NHG) | + | + | + | \n | Royal Dutch Society for Physical Therapy (KNGF) | + | + | + | \n | Dutch Association of Nurses and Care Providers (V&VN) | + | + | - | \n | Dutch Association of Youth Health Care Doctors (AJN) | + | + | - | \n | Dutch Urological Association (NVU) | - | - | + | \n | Research institute | | | | \n | Netherlands Organisation for Applied Scientific Research (TNO) | + | + | + | \n | Netherlands institute for health services research (NIVEL) | +"
},
{
"role": "assistant",
"content": "| + | - | \n | institute for Medical Technology Assessment (iMTA) | + | + | - | \n | Quality improvement organization | | | | \n | Dutch Institute for Healthcare Improvement (CBO) | + | + | + | \n | Dutch Council for Quality of Healthcare | + | + | - | \n | Knowledge institute | | | | \n | Trimbos Institute | + | + | + | \n | Dutch Youth Health Centre (NCJ) | + | + | + | \n | Netherlands Youth Institute (NJi) | + | + | + | \n | Medical Centre | | | | \n | Academic Medical Center (AMC) | + | + | - | \n | Onze Lieve Vrouwe Gasthuis (OLVG) | + | + | - | \n | Radboud University Nijmegen Medical Centre (RUNMC) | + | + | + | \n | University Medical Center Groningen (UMCG) | + | + | - | \n | Leiden University Medical Center (LUMC) | + | + | + | \n | University Medical Center Utrecht | + | + | + | \n | Educational organizations | | | | \n | Maastricht University | + | + | + | \n | Utrecht University | + | + | + | \n | Disease specific organization | | | | \n | Comprehensive Cancer Centre The Netherlands (IKNL) | + | + | + | \n | Dutch Lung Alliance (LAN) | - | - | + | \n | Other | | | | \n | PROVA | + | + | + | \n | Federation of Patients and Consumers Organisations in the Netherlands (NPCF) | + | + | - | \n | Dutch Burns Foundation | - | - | + | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3791599_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the illustration with markdown style: <md> | <ROWSPAN=2> Personal barrier | <COLSPAN=2> Survivor | <COLSPAN=2> Comparison | <ROWSPAN=2> P value | \n | % | M (SD) | % | M (SD) | \n | --- | --- | --- | --- | --- | --- | \n | Lack of energy | 19.2 | 1.4 (1.1) | 17.0 | 1.5 (1.2) | NS | \n | Lack of self-discipline | 19.2 | 1.3 (1.2) | 25.5 | 1.5 (1.2) | NS | \n | Lack of time | 17.0 | 1.5 (1.1) | 46.8 | 2.4 (1.1) |"
},
{
"role": "assistant",
"content": "0.007 | \n | Lack of skills | 10.6 | 1.0 (1.1) | 8.5 | 0.9 (1.0) | NS | \n | No one to do physical activity with | 10.4 | 1.1 (1.2) | 12.8 | 1.3 (1.2) | NS | \n | The weather is bad | 8.5 | 1.2 (0.9) | 4.3 | 1.3 (1.0) | NS | \n | Self-conscious about my looks when exercising | 6.4 | 0.8 (0.9) | 8.5 | 0.9 (1.1) | NS | \n | Lack of knowledge about how to be physically active | 4.2 | 0.6 (0.8) | 6.4 | 0.7 (0.8) | NS | \n | I am too overweight | 2.1 | 0.3 (0.8) | 0 | 0.2 (0.5) | NS | \n | Physical activity is boring | 2.1 | 0.8 (0.9) | 2.1 | 0.8 (1.0) | NS | \n | Friends tease me during exercise or sports | 2.1 | 0.3 (0.6) | 0 | 0.4 (0.6) | NS | \n | Someone told me not to exercise | 2.1 | 0.1 (0.3) | 0 | 0.1 (0.4) | NS | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4644035_002_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the figure in markdown code: <md> | Total N=641 | Low | Intermediate | High | \n | --- | ---"
},
{
"role": "assistant",
"content": "| --- | --- | \n | AHA/ACC/ACEP | 57 (9%) | 290 (45%) | 294 (45%) | \n | EP | 257 (40%) | 265 (41%) | 119 (19%) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5073960_001_00.png"
] | [
{
"role": "user",
"content": "<|image|>Express the figure as Markdown code."
},
{
"role": "assistant",
"content": "<md> | Abbreviation | Domain | Range | \n | --- | --- | --- | \n | C | Basic care (support needs) | 0–4 | \n | R | Risk (cognitive or behavioural needs) | 0–4 | \n | N | Skilled nursing needs | 0–4 | \n | M | Medical needs | 0–4 | \n | <COLSPAN=3> Therapy needs | \n | TD | Required number of different therapy disciplines | 0–4 | \n | TI | Therapy intensity | 0–4 | \n | E | Equipment needs | 0–2 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4532705_005_01.png"
] | [
{
"role": "user",
"content": "<|image|>Translate the table into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Strap condition | Vertical breast displacement (cm) | \n | --- | --- | \n | Vertical orientation | | \n | Standard | 3.3 ± 1.0 | \n | Wide | 3.2 ± 1.1 | \n | Gel | 3.3 ± 1.1 | \n | Cross-back orientation | | \n | Standard | 3.1 ± 1.1 | \n | Wide | 3.1 ± 1.0 | \n | Gel | 3.2 ± 1.1 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4060171_005_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the illustration in markdown code: <md> | | Difference, compliance score mean (CI) | P value | \n | --- | --- | --- | \n | The individual therapy, N = 40 | 0.400 (−0.174–0.974) | >0.05 | \n | The system-oriented therapy, N"
},
{
"role": "assistant",
"content": "= 30 | 1.103 (0.434–1.733) | <0.05 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5569751_003_01.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the image into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Groups | Number of brain cysts (means ± SD) | \n | --- | --- | \n | Blank control | 3366.67 ± 115.47 | \n | PBS | 3463.33 ± 109.70 | \n | pVAX I | 3150.00 ± 129.41 | \n | pVAX-GRA16 | 1866.67 ± 152.75∗∗∗ | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5551242_005_01.png"
] | [
{
"role": "user",
"content": "<|image|>Transform the picture into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Outcomes | <COLSPAN=2> Transportation (Compliant, n = 24) | <COLSPAN=2> Dog (n = 35) | \n | | Pre-IV | Post-IV | Pre-IV | Post-IV | \n | --- | --- | --- | --- | --- | \n | Knowledge | 5.79 (1.32) (5.24, 6.35) | 6.33 (1.24) (5.81, 6.86) | 5.97 (1.38) (5.49, 6.45) | 6.50 (1.29) (6.05, 6.95) | \n | Simulated Behavior | 6.65 (3.56) (5.14, 8.15) | 6.87 (3.06) (5.54, 8.19) | 6.80 (2.68) (5.88, 7.72) | 6.50 (2.94) (5.48, 7.52) | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3141466_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>What are the following photo content in markdown style: <md> | | With a friend | Duration | \n | --- | --- | --- | \n | Interest/Enjoyment | .203* | .306** | \n | Social | .191* | .201* | \n | Appearance | .104"
},
{
"role": "assistant",
"content": "| -.241** | \n | Competence | -.005 | .084 | \n | Fitness | -.022 | .036 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4768336_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the table into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Semester | Topic | ECTS | \n | --- | --- | --- | \n | 1 | Introduction to EBP in health care | 15 | \n | 2 | EBP-Implementation I (clinical practice) | 15 | \n | 3 | Philosophy of science, methodologies and methods | 15 | \n | 4 | EBP-Implementation II (organization) | 15 | \n | 5 | Developing a research project and in-depth research methods | 15 | \n | 6–8 | Master’s thesis | 45 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3295667_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the illustration to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | Uptake Index | 0 μg/ml SP-D | 1 μg/ml SP-D | 10 μg/ml SP-D | \n | --- | --- | --- | --- | \n | MDM | 685.4 ± 193.2 | 511.3 ± 212.7 | 815.5 ± 289.9 | \n | EC | 9.9 ± 2.5 | 55.8 ± 32.8 | 64.1 ± 26.4 | \n | MDDC | 1982 ± 1346 | 1018 ± 455.9 | 570.6 ± 232.2 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3843585_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Continue parse the illustration with markdown style: <md> | Class | Gene | Chromosomal location | Protein | Mass (kDa) | Sequence length (AA) | \n | --- | --- | --- | --- | --- | --- | \n | Class I | | | | | | \n | IA | PIK3CA | 3q26.3 | p110-α | 124.28 | 1068 | \n | | PIK3CB | 3q22.3 | p110-β | 122.76 | 1070 | \n | | PIK3CD | 1p36.2 | p110-δ | 119.48 | 1044 | \n | | PIK3R1 | 5q13.1 | p85-α | 83.60 | 724 | \n | | PIK3R2 | 19p13.1 | p85-β | 81.55 | 728 | \n | | PIK3R3 | 1p34.1 | p55-γ | 54.45 | 461 | \n | IB | | | | | "
},
{
"role": "assistant",
"content": "| \n | | PIK3CG | 7q22.3 | π110-γ | 126.45 | 1102 | \n | | PIK3R5 | 17p13.1 | p101 | 97.35 | 880 | \n | | PIK3R6 | 17p13.1 | p84/p87PIKAP | 84.26 | 754 | \n | Class II | | | | | | \n | | PIK3C2A | 11p15.1 | PIK-C2α | 190.68 | 1686 | \n | | PIK3C2B | 1q32.1 | PIK-C2β | 184.77 | 1634 | \n | | PIK3C2G | 12p12.3 | PIK-C2γ | 165.72 | 1445 | \n | Class III | | | | | | \n | | PIK3C3 | 18q12.3 | hVps34 | 101.55 | 887 | \n | | PIK3R4 | 3q22.1 | p150 | 153.10 | 1358 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC5960128_006_00.png"
] | [
{
"role": "user",
"content": "<|image|>Express the figure as Markdown code."
},
{
"role": "assistant",
"content": "<md> | Variables | Unstandardized coefficienta | Standardized coefficient (β)a | t value | P value | \n | --- | --- | --- | --- | --- | \n | <COLSPAN=5> Operation type | \n | Robot assisted | REF | – | – | – | \n | Open | −0.017 | −0.325 | −7.259 | < 0.001 | \n | Laparoscopic | −0.008 | −0.146 | −3.730 | < 0.001 | \n | Blood loss (L) | −0.023 | −0.205 | −5.438 | < 0.001 | \n | <COLSPAN=5> Gleason score | \n | ≤ 6 | REF | – | – | – | \n | 7 | −0.003 | −0.061 | − 1.668 | 0.096 | \n | ≥ 8 | −0.009 | −0.152 | −4.115 | < 0.001 | \n | White blood count (× 109/L) | 0.002 | 0.089 | 2.775 | 0.006 | \n | Preoperative PSA | 8.222E-6 | 0.007 | 0.208 | 0.835 | \n | Dysuresia | −0.002 | −0.027 | −0.826 | 0.409 | \n | Platelet count (× 109/L) | 2.816E-5 | 0.053 | 1.550 | 0.122 | \n | Serum calcium (mmol/L) | −0.012 | − 0.058 | −1.797 | 0.073 | \n | Blood glucose (mmol/L) | 0.001 | 0.043 | 1.352 | 0.177 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3653702_005_01.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the diagram to Markdown syntax."
},
{
"role": "assistant",
"content": "<md> | Pt. no. | Grade 1–2 toxicity | Grade 3-4 | \n | --- | --- | --- | \n | 1 | Mucositis, Fatigue | / | \n | 2 | Fatigue | / | \n | 3 | Loss of appetite, Xerostomia, Diarrhea, Fatigue, Erythema, Conjunctivitis | / | \n | 4 | Nausea | / | \n | 5 | Xerostomie, Parotitis, Headache, Fatigue | / | \n | 6 | Loss of appetite, Fatigue, Nausea, Dysgeusia | / | \n | 7 | Loss of appetite, Nausea, Headache, Neck pain | / | \n | 8 | Loss of appetite, Nausea, Fatigue | / | \n | 9 | Xerostomia | / | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC4765137_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the diagram in markdown code: <md> | | Cases (n = 144) | Controls (n = 280) | p-value | \n | --- | --- | --- | --- | \n | Preoperative characteristics | | | | \n | Gender (male) | 93 (64.6 %) | 181 (64.6 %) | 1.00 | \n | Age (years) | 70 (43–89) | 70 (42–89) | 0.81 | \n | Parsonnet score | 18.3 (0–49.0) | 16.5 (0–52.5) | 0.28 | \n | Renal failurea | 22 (15.3 %) | 29 (10.4 %) | 0.16 | \n | Severe peripheral vascular disease | 13 (9 %) | 17 (6.1 %) | 0.32 | \n | Cardiogenic shockb | 5 (3.5 %) | 1 (0.4 %) | 0.02 | \n | Preoperative intra-aortic balloon pump | 16 (11.1 %) | 10 (3.6 %) | 0.004 | \n | Chronic obstructive pulmonary diseasec | 10 (6.9 %) | 48 (17.1 %) | 0.004 | \n | Diabetesd | 38 (26.4 %) | 103 (36.8 %) | 0.04 | \n | Postoperative characteristics | | | | \n | Peak lactate (mmol/L) | 4.6 (3.0–18.0)"
},
{
"role": "assistant",
"content": "| 2.1 (0.8–2.9) | <0.0001 | \n | Peak serum creatinine level (mmol/L) | 127 (66–840) | 100 (39–1013) | <0.0001 | \n | Intra-aortic balloon pump | 29 (20.1 %) | 14 (5 %) | <0.0001 | \n | Computed tomography chest /abdomen | 4 (2.8 %) | 0 | 0.01 | \n | Return to operating room | 22 (15.3 %) | 5 (1.8 %) | <0.0001 | \n | Cardiogenic shock | 9 (6.3 %) | 2 (0.7 %) | 0.002 | \n | Post-operative cardiac hemorrhage | 9 (6.3 %) | 4 (1.4 %) | 0.01 | \n | Acute kidney injury (AKIN 1) | 68 (50.4 %) | 73 (26.8 %) | <0.0001 | \n | Ischemic bowel | 1 (0.7 %) | 0 | 0.34 | \n | Length of ICU admission (days) | 3 (1–96) | 1 (1–29) | <0.0001 | \n | ICU readmission | 12 (8.3 %) | 13 (4.7 %) | 0.13 | \n | Mechanical ventilation (days) | 0.89 (0.14–75.5) | 0.50 (0.09–11.9) | <0.0001 | \n | Mortality | 15 (10.4 %) | 4 (1.4 %) | <0.0001 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC3790552_004_00.png"
] | [
{
"role": "user",
"content": "<|image|>Transcribe the photo into Markdown format."
},
{
"role": "assistant",
"content": "<md> | | Estimate | SE | z | P | \n | --- | --- | --- | --- | --- | \n | Intercept | −2.829 | 0.447 | −6.333 | <0.0001 | \n | Sex M | 0.954 | 0.598 | 1.594 | 0.111 | \n | Age Juvenile | 0.878 | 0.305 | 2.877 | 0.004 | \n | Age Adult | −0.073 | 0.316 | −0.232 | 0.817 | \n | Band Size | 0.061 | 0.035 | 1.778 | 0.075 | \n | Density | 0.093 | 0.025 | 3.649 | 0.0003 | \n | Sex M × Age Juvenile | −0.226 | 0.430 | −0.526 | 0.599 | \n | Sex M × Age Adult | −1.866 | 0.585 | −3.193 | 0.0014 | \n | Sex M × Band Size | −0.120 | 0.059 | −2.040 | 0.041 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC2903568_002_00.png"
] | [
{
"role": "user",
"content": "<|image|>Convert the image into Markdown format."
},
{
"role": "assistant",
"content": "<md> | Measure | Description | Range | \n | --- | --- | --- | \n | <COLSPAN=3> Similarity scores for term pairs | \n | Resnik [6] | Information content of the most informative common ancestor of two terms | ≥ 0 | \n | Lin [5] | Normalized Resnik similarity score by assessing how close two terms are to their most informative common ancestor | [0, 1) | \n | RS [4] | Weighted Lin similarity score by using the probability of annotations of the most informative common ancestor | [0,1) | \n | Jiang [7] | Based on the difference between two terms and their most informative common ancestor in information content | (0,1] | \n | <COLSPAN=3> Similarity scores for protein pairs based on pairwise similarity scores between term groups | \n | AVG [2] | The average of the similarity scores for all pairs of terms between two groups of protein annotations | Same with those for the corresponding similarity scores for term pairs | \n | BMA [3] | The score of the best-matching pairs between two groups of protein annotations | | \n | <COLSPAN=3> Similarity scores for protein pairs based on groupwise similarity scores between term groups | \n | TO [9] | The number of terms shared by the annotations for two proteins | ≥ 1 | \n | NTO [9] | Dividing TO by the minimum of the annotation lengths of two proteins | (0,1] | \n | Dice [12] | Dividing TO by the average of annotation lengths of two proteins | (0,1] | \n | Kappa [11] | A chance-corrected measure of co-occurrence between two groups of protein annotations | [0, 1] | \n | GIC [8] | Jaccard index weighted by the information content of each GO term | [0, 1] | \n | VSM [10] | Cosine similarity weighted by the information content of each GO term | [0, 1] | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC1635695_004_01.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the table content behind with markdown code: <md> | | <COLSPAN=2> Men (n = 101) | <COLSPAN=2> Women (n = 78) | | \n | | Mean | (SD) | Mean | (SD) | p-value | \n | --- | --- | --- | --- | --- | --- | \n | Age | 44.2 | (13.0) | 46.6 | (13.3) | 0.22 | \n | Physical activity (1–4) | 2.0 | (0.8) | 1.9 | (0.5) | 0.19"
},
{
"role": "assistant",
"content": "| \n | BMI | 26.9 | (3.9) | 26.3 | (6.1) | 0.39 | \n | Chest pain intensity (0–100 mm)a | 61 | (23) | 65 | (25) | 0.27 | \n | Confrontive coping (0–52) | 31.1 | (7.4) | 30.8 | (5.6) | 0.81 | \n | Emotive coping (0–36) | 17.0 | (4.5) | 18.4 | (3.6) | 0.03 | \n | Palliative coping (0–56) | 27.2 | (5.0) | 28.1 | (4,9) | 0.21 | \n | Negative life events (0–30) | 5.8 | (4.2) | 6.3 | (4.5) | 0.45 | \n | Stress at home (0–5) | 1.8 | (1.5) | 1.9 | (1.6) | 0.68 | \n | Sleep problems (0–20) | 7.9 | (5.2) | 8.8 | (5.0) | 0.27 | \n | Mental strain at work (2–10) | 6.1 | (2.3) | 6.0 | (2.1) | 0.82 | </md>"
}
] | mp_sft | PubTabNet | null |
[
"./val_imgs/PubTabNet/val/PMC1751002_003_00.png"
] | [
{
"role": "user",
"content": "<|image|>Parse the following content of the diagram in markdown code: <md> | Patient | Age (years) | Died on day | Resuscitation during surgery | Blood-loss (l) | Complications | Organ failure | Infectious complication | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | 1 | 79 | 2 | - | 7.0 | | Respiratory and renal | - | \n | 2 | 80 | 3 | - | 9.5 | Sigmoid necrosis, ischemic lower legs | Respiratory, cardiovascular and renal | - | \n | 3 | 74 | 4 | - | 2.0 | | Respiratory, cardiovascular and renal | - | \n | 4 | 79 | 12 | - | 2.5 | Sigmoid"
},
{
"role": "assistant",
"content": "necrosis | Respiratory, hepatic, cardiovascular and renal | Enterococci in blood culture | \n | 5 | 79 | 21 | - | 3.0 | Wound infection | Respiratory, cardiovascular and renal | Proteus mirabilis in wound and blood | \n | 6 | 76 | 30 | + | 25.0 | Sigmoid necrosis | Respiratory, cardiovascular and renal | - | </md>"
}
] | mp_sft | PubTabNet | null |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.