image
listlengths
1
1
messages
listlengths
2
2
task_name
stringclasses
5 values
dataset_name
stringclasses
17 values
rvl_cdip_class
stringclasses
12 values
[ "./val_imgs/PubTabNet/val/PMC1526634_002_00.png" ]
[ { "role": "user", "content": "<|image|>What are the following figure content in markdown style: <md> | mRNA | Sequence of primer | Product (bp) | Accession numbers | \n | --- | --- | --- | --- | \n | EP-1 | 5' -GCT GTA CGC CTC GCA TCG TGG-3'5' -GTG TTT CGA GCA TCC CAT GTA TCT-3' | 404 | NCBI:D16338 | \n | EP-2 | 5' -GAA CGC TAC CTC TCC ATC GG-3'5' -TGA TGG TCA TAA TGG-3' | 415 | NCBI:D50589 | \n |" }, { "role": "assistant", "content": "COX-1EP-3 | 5' -GTTTGGTCTG GCGTCTTAGA AC-3'5' -CTTGGAACAG GACCTTCTGA GT-3'5' -TTTGCCTCCGCCTTCGCCTG-3'5' -AGCAGCAGATAAACC-3' | 399,359 | U03388 NCBI:D14869 | \n | COX-2EP-4 | 5' -AATGAGTACC GCAAA-3'5' -ATCTAGTCTG GAGCGGGAGG-3'5' -TGCTCATCTGCTCCATTCCGC-3'5' -ATGCGAACCTGGAAG-5' | 420,407 | NM011198NCBI:D28860 | \n | Col ICOX-1 | 5' -TGGTGACAAG GGTGAGACAG-3'5' -TGAGGCAGGA AGCTGAAGTC-3'5' -GTTTGGTCTG GCGTCTTAGA AC-3'5' -CTTGGAACAG GACCTTCTGA GT-3' | 329,399 | Z78279NCBI:U03388 | \n | Col IICOX-2 | 5' -CTCCAGGTGT GAAGGGTGAG-3'5' -GAACCTTGAG CACCTTCAGG-3'5' -AATGAGTACC GCAAA-3'5' -ATCTAGTCTG GAGCGGGAGG-3' | 261,420 | NM012929NCBI:NM011198 | \n | Col XI | 5' -TGCCTCTTGT CAGTGCTAAC C-3'5' -GCGTGCCGTT CTTATACAGG-3'5' -TGGTGACAAG GGTGAGACAG-3'5' -TGAGGCAGGA AGCTGAAGTC-3' | 248329 | AJ131848NCBI:Z78279 | \n | β-actinCol II | 5' -CATCACCATT GGCAATGAGC G-3'5' -CTAGAAGCAT TTGCGGTCGG AC-3'5' -CTCCAGGTGT GAAGGGTGAG-3'5' -GAACCTTGAG CACCTTCAGG-3' | 403,261 | NM031144NCBI:NM012929 | \n | Col X | 5' -TGCCTCTTGT CAGTGCTAAC C-3'5' -GCGTGCCGTT CTTATACAGG-3' | 248 | NCBI:AJ131848 | \n | β-actin | 5' -CATCACCATT GGCAATGAGC G-3'5' -CTAGAAGCAT TTGCGGTCGG AC-3' | 403 | NCBI:NM031144 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3902424_002_00.png" ]
[ { "role": "user", "content": "<|image|>Encode the table in Markdown syntax." }, { "role": "assistant", "content": "<md> | | Small NHs* N = 15 | Large NHs** N = 17 | P value | \n | --- | --- | --- | --- | \n | Specialized medical manager (%) | 6 (40.0%) | 7 (41.2%) | .615 | \n | Physician availability per day | | | | \n | Up to 8 hours | 10 (66.7%) | 5 (29.4%) | <ROWSPAN=3> .102 | \n | 9-12 hours | 2 (13.3%) | 6 (35.3%) | \n | 13 and more hours | 3 (20.0%) | 6 (35.3%) | \n | Registered nurse availability per shift (%) | | | | \n | Morning | 4 (26.7%) | 2 (11.8%) | <ROWSPAN=3> .550 | \n | Morning and afternoon | 4 (26.7%) | 6 (35.3%) | \n | Morning, afternoon and night | 7 (46.7%) | 9 (52.9%) | \n | Referral form (%) | | | | \n | Direct | 10 (66.7%) | 15 (88.2%) | <ROWSPAN=2> .149 | \n | Indirect | 5 (33.3%) | 2 (11.8%) | \n | Average referral rate per 100 financed beds (SD)*** | 69.1 (SD = 54.0) | 63.7 (SD = 28.1) | .722 | \n | Average annual mortality rate per 100 financed beds (SD) | 35.3 (SD = 19.2) | 31.3 (SD = 15.8) | .525 | \n | Average length of stay in days in general hospitals (SD) | 7.2 (SD = 3.3) | 6.4 (SD = 1.5) | .400 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2715569_005_00.png" ]
[ { "role": "user", "content": "<|image|>Express the illustration as Markdown code." }, { "role": "assistant", "content": "<md> | | BEM | FEM | iFDM | aFDM | \n | --- | --- | --- | --- | --- | \n | Position of computational points | Surface | Volume | Volume | Volume | \n | Free choice of computational points | Yes | Yes | No | No | \n | System matrix | Full | Sparse | Sparse | Sparse | \n | Solvers | Direct/iterative | Iterative | Iterative | Iterative | \n | Number of compartments | Small | Large | Large | Large | \n | Requires tessellation | Yes | Yes | No | No | \n | Handles anisotropy | No | Yes | No | Yes | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3710648_003_00.png" ]
[ { "role": "user", "content": "<|image|>Render the figure in Markdown format." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> Variables used | <COLSPAN=3> Coded levels | \n | −1 | 0 | +1 | \n | --- | --- | --- | --- | \n | Xanthan gum (mg) | 40 | 50 | 60 | \n | Locust bean gum (mg) | 60 | 70 | 80 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5595115_004_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the figure with markdown style: <md> | Groups | SHi | SHf | % Hardness Loss | \n | --- | --- | --- | --- | \n | GP5 – 5% palm oil | 329.92 (±35.81) | 253.90 (±45.15) | 23.24 (±8.436)a" }, { "role": "assistant", "content": "| \n | GP100 – pure palm oil | 337.58 (±28.41) | 310.80 (±34.58) | 7.89 (±7.5)b | \n | GC5 – 5% coconut oil | 334.16 (±26.88) | 250.92 (±37.49) | 24.65 (±11.50)a | \n | GC100 – pure coconut oil | 336.24 (±30.50) | 240.26 (±48.45) | 28.47 (±13.37)a | \n | GSa5 – 5% safflower oil | 341.19 (±31.87) | 241.90 (±37.23) | 28.74 (±11.53)a | \n | GSa100 – pure safflower oil | 337.85 (±29.91) | 248.89 (±43.01) | 26.56 (±9.51)a | \n | GSu5 – 5% sunflower oil | 335.76 (±26.05) | 259.23 (±50.07) | 22.92 (±12.94)a | \n | GSu100 – pure sunflower oil | 338.51 (±27.63) | 265.02 (±55.67) | 21.78 (±14.83)ab | \n | GO5 – 5% olive oil | 337.27(±32.29) | 252.81 (±57.71) | 25.35 (±12.76)a | \n | GO100 – pure olive oil | 337.36 (±29.49) | 249.86 (±46.95) | 25.91(±12.51)a | \n | CON− – deionized water (negative control) | 335.45 (±29.71) | 240.90 (±38.02) | 28.09 (±9.95)a | \n | CON+ – fluoride mouthrinse (positive control) | 337.19 (±28.92) | 256.44 (±22.04) | 23.74 (±6.15)a | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5308255_009_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the table with markdown style: <md> | miRNAs | Accession Number | Primers [5′→3′] | \n | --- | --- | --- | \n | hsa-miR-1180-3p | MIMAT0005825 | GCTCGCGTGGGTGTGTAAAAA | \n | hsa-miR-1180-5p | MIMAT0026735 | CTGCTGGACCCACCCGAAAA | \n | hsa-miR-1247-3p | MIMAT0022721 | ACCCCGGGAACGTCGAGAAA | \n | hsa-miR-149-3p | MIMAT0004609 | AGGAGGGAGGGAGGGACAAA | \n | hsa-miR-192-5p | MIMAT0000222 | GGGCTCTGACCTATGAATTGAA | \n | hsa-miR-194-5p | MIMAT0000460 | CGCGTAACAGCAACTCCAAAAA | \n" }, { "role": "assistant", "content": "| hsa-miR-21-3p | MIMAT0004494 | GGCAACACCAGTCGATGAAAAA | \n | hsa-miR-27a-5p | MIMAT0004501 | CAGGGCTTAGCTGCTTGTGAA | \n | hsa-miR-29a-5p | MIMAT0004503 | GACTGATTTCTTTTGGTGTTCAG | \n | hsa-miR-324-5p | MIMAT0000761 | CCCCTAGGGCATTGGTGTAAA | \n | hsa-miR-4286 | MI0015894 | ACCCCACTCCTGGTACCAAAA | \n | hsa-miR-449c-5p | MIMAT0010251 | CAGTGTATTGCTAGCGGCTGT | \n | hsa-miR-454-3p | MIMAT0003885 | GGTGCAATATTGCTTATAGGGA | \n | hsa-miR-4710 | MI0017344 | GTGGGGTGAGGGCAGGTAAA | \n | hsa-miR-499a-5p | MIMAT0002870 | CGGCTGTTAAGACTTGCAGAAA | \n | hsa-miR-500a-3p | MIMAT0002871 | GCAATGCACCTGGGCAAGAAA | \n | hsa-miR-500a-5p | MIMAT0004773 | ATCCTTGCTACCTGGGTGAGA | \n | hsa-miR-500b-5p | MIMAT0016925 | AATCCTTGCTACCTGGGTAAAA | \n | hsa-miR-548v | MIMAT0015020 | CAGTTACTTTTGCACCAGCCTA | \n | hsa-miR-660-3p | MIMAT0022711 | CTGTGTGCATGGATTACAGGAA | \n | hsa-miR-9-5p | MIMAT0000441 | GGCTCTTTGGTTATCTAGCTGA | \n | <ROWSPAN=2> U6 | | GCTTCGGCAGCACATATACTAA | \n | | GCTTCACGAATTTGCGTGTCAT | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4379543_006_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the image into Markdown format." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> Date | <COLSPAN=2> Working time | <ROWSPAN=2> TWA-S [ppbv] | \n | Beginning | End | \n | --- | --- | --- | --- | \n | October 27th 2009 | 02:00 pm | 10:00 pm | 45.1 | \n | October 27th 2009 | 10:00 pm | 06:00 am | 22.1 | \n | October 28th 2009 | 06:00 am | 02:00 pm | 8.3 | \n | October 28th 2009 | 02:00 pm | 10:00 pm | 23.9 | \n | October 28th 2009 | 10:00 pm | 06:00 am | 18.7 | \n | October 29th 2009 | 06:00 am | 02:00 pm | 17.1 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4410519_004_00.png" ]
[ { "role": "user", "content": "<|image|>Transcribe the picture into Markdown format." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> | Irritable group | Stable group | <ROWSPAN=2> P | \n | n = 32 | n = 32 | \n | --- | --- | --- | --- | \n | Histrionic personality trait, mean ± SD | 9.5 ± 3.1 | 6.9 ± 2.9 | 0.001 | \n | Extravert, n (%) | 17 (53.1) | 12 (37.5) | 0.209 | \n | SCL-90-R, mean ± SD | | | | \n | Somatization | 48.6 ± 9.9 | 47.2 ± 8.7 | 0.549 | \n | Obsession-compulsion | 46.0 ± 10.2 | 46.1 ± 11.1 | 0.879 | \n | Interpersonal sensitivity | 47.1 ± 8.6 | 46.5 ± 10.2 | 0.822 | \n | Depression | 46.5 ± 7.9 | 46.7 ± 9.2 | 0.954 | \n | Anxiety | 52.8 ± 8.6 | 46.1 ± 9.6 | 0.004 | \n | Hostility | 45.1 ± 6.9 | 45.8 ± 8.1 | 0.727 | \n | Phobic anxiety | 48.4 ± 9.8 | 46.9 ± 8.3 | 0.513 | \n | Paranoid ideation | 46.0 ± 8.3 | 43.7 ± 7.1 | 0.232 | \n | Psychoticism | 47.7 ± 7.0 | 47.4 ± 7.5 | 0.877 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC1829164_005_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the figure content behind with markdown code: <md> | Case No | Pathology | CK | EMA | NSE | Syn | CgA | CD56 | S-100 | TTF-1 | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | 1 | SCC | ++ | +++ | +++ | +++ | ++ | +++ | - | +++ | \n | 2 | SCC | +++ | ++ | + | ++ | - | + | - | - | \n | 3 | SCC | ++ | +++ | ++ | +++ | + | +++ | - | ++ | \n | 4 | SCC | +++ | ++ | ++ | ++ | ++ | ++ | ++ | +++ | \n | 5 | SCC | ++ | +++ | - | + | - | +++ | | - | \n | 6 | SCC | ++ | ++ | + | +++ | ++ | ++ | - | +++ | \n | 7 | SCC | +++ | ++ | + | ++ | + | +++ | + | ++ | \n | 8 | SCC | +++ | ++ | +++ | ++ | - | +++ | - | ++ | \n | 9 | SCC | - | - | +++ | +++ | ++ | +++ | ++ | +++ | \n | | SqCC | +++ | ++ | - | - | - | - | - | - | \n | 10 | SCC | - | + | + | +++ | +++ | - | - | ++ | \n | 11 | SCC | - | - | - | ++ | - | ++ | - | - | \n | 12 | SCC | - | - | - | ++ | - | - | - | + | \n | 13 | SCC | - | - | ++ | +++ | ++ | +++ | - | - | \n | 14 | SCC | ++ | - | + | +++ | ++ | ++ | - | +++ | \n | 15 | SCC | + | ++ | - | ++ | ++ | +++ | - | ++ | \n | 16 | SCC | - | - | - | ++ | - | - | - | ++ | \n | 17 | SCC | ++ | +++ | ++ | +++ | + | +++ | + | - | \n | 18 | SCC | - | ++ | - | - | ++ | - | - | +++ | \n | 19 | SCC | ++ | ++ | - | ++ | - |" }, { "role": "assistant", "content": "+++ | - | - | \n | 20 | SCC | - | - | + | +++ | - | ++ | - | ++ | \n | 21 | SCC | - | - | - | +++ | +++ | - | - | ++ | \n | | SqCC | +++ | - | - | - | - | - | - | - | \n | <COLSPAN=2> Total positive cases (%) | 12(57.1) | 13(61.9) | 13(61.9) | 20(95.2) | 13(61.9) | 16(76.2) | 4(19.0) | 15(71.4) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5512921_002_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the figure content behind with markdown code: <md> | Elements | Fe | Si | Cu | Mn | Mg | Zn | Al | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | Composition (wt.%) | 0.15 | 0.10 | 0.05" }, { "role": "assistant", "content": "| 0.02 | 0.001 | 0.01 | Bal. | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3827547_004_00.png" ]
[ { "role": "user", "content": "<|image|>Encode the diagram in Markdown syntax." }, { "role": "assistant", "content": "<md> | Study name (reference) | No patients | BB used | Description | Main findings | Additional findings and comments | \n | --- | --- | --- | --- | --- | --- | \n | MDC (Waagstein et al., 1993) | 383 | Metoprolol | HF secondary to Dilated Cardiomyopathy (EF <40%) | 34% decrease in mortality or need for transplantation | No significant difference in mortality alone | \n | MERIT-HF (Hjalmarson et al., 2000) | 3991 | Metoprolol succinate | Mild-moderate HF (EF <40%) NYHA II-IV | <34% decrease in all cause mortality | <39% decrease in cardiac death and non-fatal MI | \n | CIBIS (CIBIS Investigators and Committees, 1994) | 641 | Bisoprolol | Moderate HF (EF <40%) NYHA III-IV | No significant difference in mortality | Significant improvement of functional status of the patients | \n | CIBIS II (CIBIS-II Investigators, 1999) | 2647 | Bisoprolol | Moderate HF (EF <35%) NYHA III-IV | 32% decrease risk of mortality and hospitalization for HF | Greatest effects in patients with ischaemic HF and NYHA III at baseline | \n | CIBIS III (Willenheimer et al., 2005) | 1010 | Bisoprolol (vs. enalapril) | Mild moderate HF (EF <35%) NYHA II-III | Non-inferiority of bisoprolol vs enalapril in reducing mortality as first treatment in ITT | Non-inferiority of bisoprolol was not proven in per-protocol analysis | \n | US Carvedilol study (Packer et al., 1996) | 1094 | Carvedilol | Mild moderate HF NYHA II-IV | 65% mortality reduction | 38% reduction in death or hospitalization for cardiovascular reasons | \n | COPERNICUS (Packer et al., 2002) | 2289 | Carvedilol | Severe HF (EF <25%) NYHA III-IV | 35% in risk of death | 27% decrease death or hospitalization for a cardiovascular reason | \n | CAPRICORN (The CAPRICORN Investigators, 2001) | 1959 | Carvedilol | Patients with recent MI and left ventricular dysfunction (EF <40%) | 23% reduction in mortality | No significant difference in primary endpoint (all-cause mortality or hospitalization for cardiovascular problems) | \n | COMET (Poole-Wilson et al., 2003) | 3029 | Carvedilol vs. Metoprolol tartrate | Mild moderate HF (EF <35%) NYHA II-IV | 17% decrease in carvedilol- vs. metoprolol- arm | Concerns about metoprolol formulation | \n | BEST (BEST Investigators, 2001) | 2708 | Bucindolol | Mild moderate HF (EF <35%) NYHA III-IV | No significant overall survival benefit | Reduction in mortality in patients homozygous for Arg389 (subsequent pharmacogenetic analysis) | \n | SENIORS (Flather et al., 2005) | 2128 | Nebivolol | Mild moderate HF (EF <35% in last 6-months) Age >70yrs | 14% reduction mortality and hospitalizations | Significant increase of LVEF and decrease in end-systolic volume | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3851528_006_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the illustration in markdown code: <md> | Author group | Year of publication | Dental status | Rehabilitation procedures | Remarks | \n | --- | --- | --- | --- | --- | \n | Frydrych et al. (n = 82) [9] | 2011 | No information | No information | Average (median) date of last dental visit: 66.76 months (18 months) before radiotherapy | \n | <ROWSPAN=4> Guggenheimer et al. (n = 947) [10] | <ROWSPAN=4> 1994 | Edentulous: 59% | <ROWSPAN=4> No information | <ROWSPAN=4> | \n | Partially edentulous: 9% | \n | Poor" }, { "role": "assistant", "content": "dentition with no replacement: 14% | \n | Intact dentition: 18% | \n | <ROWSPAN=3> Maier et al. (n = 100) [11] | <ROWSPAN=3> 1993 | <ROWSPAN=2> Tumour vs. control patients: Tartar > 3 mm: 40.91 vs. 21.98% | <ROWSPAN=3> No information | Tumour vs. control patients | \n | Never tooth brushing 44.9 vs. 23.5% | \n | Decayed teeth >50% : 27.2 vs. 3.9% | Dental visit more than once a year: 6% vs. 43.5% | \n | <ROWSPAN=3> Lockhart et al. (n = 131) [12] | <ROWSPAN=3> 1994 | Alveolar bone loss: 66% | Needing dental care: 97% | Noncompliant with routine dental care: 76% | \n | Clinical caries: 71% | <ROWSPAN=2> Did not seek the indicated treatment: 81% | <ROWSPAN=2> Noncompliant with routine oral hygiene: 65% | \n | Failing restorations: 91% | \n | <ROWSPAN=3> Jham et al. (n = 207) [7] | <ROWSPAN=3> 2008 | Periodontal disease: 41% | <ROWSPAN=3> No information | <ROWSPAN=3> | \n | Residual root: 21.2% | \n | Caries 12% | \n | | | Unerupted tooth: 5.8% | | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3570396_005_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the picture into Markdown format." }, { "role": "assistant", "content": "<md> | Factors | | Median survival | P-value | \n | | | (months) | | \n | --- | --- | --- | --- | \n | Age (yrs) | ≤60 | 9.8 ± 4.9 | 0.585 | \n | | >60 | 13.6 ± 2.1 | | \n | Gender | Male | 12.9 ± 1.9 | 0.293 | \n | | Female | 11.6 ± 1.0 | | \n | ECOG | 1 | 15.9 ± 4.0 | 0.070 | \n | | 2 | 9.8 ± 3.1 | | \n | Etiology | Viral | 11.3 ± 1.4 | 0.344 | \n | | Non-viral | 13.6 ± 2.2 | | \n | Child-Pugh | A | 13.0 ± 1.5 | 0.309 | \n | Classification | B | 6.4 ± 0.8 | | \n | JIS score | 2 | 13.0 ± 1.4 | 0.235 | \n | | 3 | 5.8 ± 0.3 | | \n | Pretreatment | ≤ 20 | 15.9 ± 1.6 | 0.161 | \n | AFP (ng/ml) | > 20 | 10.9 ± 1.0 | | \n | Type of HCC | Nodular | 11.3 ± 0.7 | 0.853 | \n | | Diffuse infiltrative | 13.6 ± 4.4 | | \n | Multiplicity | Solitary | 11.3 ± 1.3 | 0.534 | \n | | Multiple | 13.9 ± 2.1 | | \n | Location of thrombi | PV branch | 16.6 ± 5.9 | 0.036 | \n | | Main portal trunk | 9.8 ± 4.2 | | \n | BED (Gy10) | < 75 | 13.0 ± 1.4 | 0.901 | \n | | ≥ 75 | 9.8 ± 4.7 | | \n | PVTT response | CR + PR | 13.9 ± 1.1 | 0.142 | \n | | SD + PD | 6.9 ± 5.1 | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2575199_001_00.png" ]
[ { "role": "user", "content": "<|image|>Render the diagram in Markdown format." }, { "role": "assistant", "content": "<md> | Type | Level of Care | Services offered | \n | --- | --- | --- | \n | Specialist | Multi-disciplinary care | Type A hospital with specialized patient population | \n | Type A | Multi-disciplinary care | Tertiary referral hospital with access to sub-speciality care and advanced investigational facilities | \n | Type B | Large Urban hospital | Secondary care in basic specialties: general surgery, paediatrics, internal medicine, obstetrics and gynaecology. | \n | Type C | Basic district hospital | Inpatient and outpatient care with basic radiographic and laboratory services | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3050698_004_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the picture with markdown style: <md> | ACIC Component | Correlationcoefficient | p-value | Correlationcoefficientadjusted forclustering effect | p-value | \n | --- | --- | --- | --- | --- | \n | Total ACIC score | .44 | <.0001 | .38 | <.0001 | \n | Community linkages | .28 | <.0001 | .26 | <.0001 | \n | Self-management support | .40 | <.0001 | .35 | <.0001 | \n" }, { "role": "assistant", "content": "| Decision support | .39 | <.0001 | .33 | <.0001 | \n | Delivery system design | .45 | <.0001 | .39 | <.0001 | \n | Clinical information system | .38 | <.0001 | .25 | <.001 | \n | Health system support | .43 | <.0001 | .38 | <.001 | \n | Integration of elements | .45 | <.0001 | .42 | <.0001 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC6024308_004_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the photo in markdown code: <md> | Item | Yes | No | \n | --- | --- | --- | \n | Family members | 6 | 94 | \n | Close friends | 0 | 100 | \n | Acquaintances | 72 | 28 | \n | Strangers |" }, { "role": "assistant", "content": "73 | 27 | \n | Authority figures (e.g., professors) | 63 | 37 | \n | Classmates | 50 | 50 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4486390_008_00.png" ]
[ { "role": "user", "content": "<|image|>Render the figure in Markdown format." }, { "role": "assistant", "content": "<md> | Number of LNM | Under the ICBN | Above the ICBN | Patients | \n | --- | --- | --- | --- | \n | 1 | + | - | 16 | \n | 2 | + | - | 31 | \n | <ROWSPAN=2> 3 | + | - | 9 | \n | + | + | 2 | \n | 4 | + | + | 1 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3078843_004_01.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the picture in markdown code: <md> | | Asthman(%) | Diabetesn(%) | Rheumatoid Arthritisn(%) | p-value* | \n | --- | --- | --- | --- |" }, { "role": "assistant", "content": "--- | \n | <20,000 | 12 (13) | 2 (6) | 0 (0) | 0.03** | \n | 20,000-50,000 | 52 (63) | 37 (49) | 56 (58) | 0.23 | \n | >50,000 | 77(60) | 89 (72) | 53 (64) | 0.12 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4385278_005_01.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the figure with markdown style: <md> | Order of rank | Kernel edge length (cm) | No of iterations (updates) | Cutoff frequency (cm−1) | pvalue | \n | --- | --- | --- | --- | --- | \n | 1 | 2.3 | 6 (96) | 0.7 | 2.8 × 10−14 | \n | 2 | 1.7 | 8 (128) | 0.7 | 3.1 × 10−14 | \n | 3 | 2.3 | 8 (128) | 0.6 | 3.1 × 10−14 | \n | 4 | 3.0 | 8 (128) | 0.7 | 3.1 × 10−14 | \n | 5 | 3.0 | 6 (96) | 0.7 | 3.3 × 10−14 | \n | 6 | 3.0 | 6 (96) | Unfiltered | 3.3 × 10−14" }, { "role": "assistant", "content": "| \n | 7 | 3.0 | 4 (64) | 0.7 | 3.5 × 10−14 | \n | 8 | 1.7 | 10 (160) | 0.7 | 3.8 × 10−14 | \n | 9 | 2.3 | 8 (128) | 0.7 | 4.4 × 10−14 | \n | 10 | 1.7 | 6 (96) | 0.7 | 4.7 × 10−14 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4289403_002_00.png" ]
[ { "role": "user", "content": "<|image|>What are the following illustration content in markdown style: <md> | mVSD size | Number of patients | Rate of follow up recommendation (%) | \n | --- | --- | --- | \n | Isolated small | 509 (85%) | 32 | \n | Isolated small-to-moderate | 12 (2%) | 42 | \n | Isolated moderate | 19 (3%) | 84" }, { "role": "assistant", "content": "| \n | Multiple small | 60 (10%) | 58 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3297493_004_00.png" ]
[ { "role": "user", "content": "<|image|>Transcribe the illustration into Markdown format." }, { "role": "assistant", "content": "<md> | | univariate | | | | <COLSPAN=2> multivariate | \n | --- | --- | --- | --- | --- | --- | --- | \n | | | | <COLSPAN=2> initial model | <COLSPAN=2> final model | \n | | HR | p | HR | p | HR | p | \n | age>65 years | 2.99 | <0.0001 | 3.53 | <0.0001 | 3.43 | <0.0001 | \n | male sex | 1.86 | 0.0018 | 1.84 | 0.0030 | 1.80 | 0.0038 | \n | ALC>14 × 109/L | 1.67 | 0.0062 | 1.34 | 0.17 | - | | \n | β2M>1 × ULN | 1.43 | <0.0001 | 1.51 | 0.06 | 1.59 | 0.029 | \n | LNR ≥3 | 3.06 | <0.0001 | 1.20 | 0.59 | - | | \n | Binet stage | | <0.0001 | | | | | \n | A | ref | | ref | | ref | | \n | B | 3.20 | | 2.19 | 0.0352 | 2.77 | <0.0001 | \n | C | 4.95 | | 2.86 | 0.0028 | 3.68 | <0.0001 | \n | Rai stage | | <0.0001 | | | | | \n | 0 | ref | | ND | | | | \n | I-II | 1.66 | | ND | | | | \n | III-IV | 5.08 | | ND | | | | \n | CD38>30% | 1.73 | 0.0038 | 1.03 | 0.88 | - | | \n | ZAP-70>20% | 1.53 | 0.0204 | 1.04 | 0.83 | - | | \n | Unmutated IGHV | 2.46 | <0.0001 | 2.04 | 0.0008 | 2.04 | 0.0003 | \n | del17p | 3.44 | <0.0001 | 2.14 | 0.0015 | 2.06 | 0.0022 | \n | del11q | 1.39 | 0.248 | ND | | | | \n | Year of diagnosis | | 0.0130 | <COLSPAN=2> (in model as strata)* | <COLSPAN=2> (in model as strata)* | \n | <2001 | ref | | | | | | \n | 2001-2005 | 1.46 | | | | | | \n | >2005 | 2.34 | | | | | | \n | Therapy | | 0.106 | ND | | | | \n | Chemotherapy | ref | | | | | | \n | Immunochemotherapy | 0.6 | | | | | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3599285_003_00.png" ]
[ { "role": "user", "content": "<|image|>Translate the picture into Markdown format." }, { "role": "assistant", "content": "<md> | Analytes | Regression Equation | r2 | Test range(μg/mL) | LOQ (μg/mL) | LOD (μg/mL) | \n | --- | --- | --- | --- | --- | --- | \n | Hypohorine | y = 0.0102 x + 0.0107 | 0.9994 | 1.0-100.0 | 1.0 | 0.4 | \n | THSG | y = 0.0061 x + 0.1012 | 0.9988 | 10.9-1090.0 | 5.4 | 2.0 | \n | Epicatechin | y = 0.0241 x + 0.0327 | 0.9996 | 1.0-100.0 | 1.0 | 0.3 | \n | Proanthocyanidin B2 | y = 0.0279 x + 0.0389 | 0.9988 | 1.0-100.0 | 1.0 | 0.4 | \n | Proanthocyanidin B1 | y = 0.0403 x + 0.0540 | 0.9988 | 1.0-103.0 | 1.0 | 0.3 | \n | Catechin | y = 0.0365 x + 0.0592 | 0.9978 | 1.0-100.0 | 1.0 | 0.4 | \n | Gallic acid | y = 0.0662 x + 0.0929 | 0.9982 | 1.3-130.0 | 1.3 | 0.5 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5852769_002_00.png" ]
[ { "role": "user", "content": "<|image|>Transcribe the image into Markdown format." }, { "role": "assistant", "content": "<md> | | N (%) | \n | --- | --- | \n | Age (years) | | \n | 7 | 16 (31.4) | \n | 8 | 5 (9.8) | \n | 9 | 9 (17.6) | \n | 10 | 6 (11.8) | \n | 11 | 8 (15.7) | \n | 12 | 6 (11.8) | \n | 13 | 1 (2.0) | \n | Sex | | \n | Male | 26 (51.0) | \n | Female | 25 (49.0) | \n | Race | | \n | White (Non-Hispanic) | 39 (76.5) | \n | Hispanic | 1 (2.0) | \n | >1 Race Listed | 11 (21.6) | \n | Parent Highest Education | | \n | High School or less | 3 (5.9) | \n | College Degree (AS, BS, BA) | 18 (35.3) | \n | Graduate Degree | 28 (54.9) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4589125_005_00.png" ]
[ { "role": "user", "content": "<|image|>What are the following figure content in markdown style: <md> | Pathogen species detected | Positive cattle (%) | \n | --- | --- | \n | One pathogen | | \n | B. bovis | 6 (15.8) | \n | T." }, { "role": "assistant", "content": "velifera | 1 (2.6) | \n | A. marginale | 3 (7.9) | \n | Two pathogens | | \n | B.bigemina + T. parva | 1 (2.6) | \n | B.bigemina + T. taurotragi | 1 (2.6) | \n | B.bovis + B. bigemina | 1 (2.6) | \n | T. parva + T. velifera | 2 (5.3) | \n | T. taurotragi + T.velifera | 1 (2.6) | \n | T. parva + T. taurotragi | 1 (2.6) | \n | Three pathogens | | \n | B. bovis + T. parva + T. mutans | 2 (5.3) | \n | B. bigemina + T. parva + T. velifera | 2 (5.3) | \n | A. marginale + T. parva + T. velifera | 2 (5.3) | \n | A. marginale + T. parva + T. mutans | 1 (2.6) | \n | T. parva + T. taurotragi + T. velifera | 1 (2.6) | \n | Total | 25 (65.8) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4880870_004_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the diagram content behind with markdown code: <md> | <ROWSPAN=2> Factors | <COLSPAN=2> Univariable analysis | <COLSPAN=2> Multivariable analysisa | \n | OR (95 % CI) | p-value | OR (95 % CI) | p-value | \n | --- | --- | --- | --- | --- | \n | Male gender | 4.57 (0.82–25.41) | 0.083 | <ROWSPAN=7> | <ROWSPAN=7> | \n | Age (years) | 1.00 (0.94–1.07) | 0.904 | \n | Loss to follow-up period (months) | 1.03 (0.97–1.08) | 0.371 | \n | Glaucoma family history (n) | 3.31 (0.54–20.41) | 0.196 | \n | Past medical history (n) | | | \n | Diabetes mellitus | 3.44 (0.31–38.48) | 0.315 | \n | Hypertension | 1.64 (0.17–15.98) | 0.671 | \n | Baseline IOP (mm Hg) | 1.74 (1.19–2.56)b | 0.005 | <ROWSPAN=3> 1.63 (1.03–2.57)b | <ROWSPAN=3> 0.037 | \n | MD (dB) | 0.90 (0.46–1.76) | 0.750 | \n | PSD (dB) | 3.08 (0.40–23.53) | 0.279 | \n | Average RNFL thickness (μm) | 0.83 (0.75–0.92) | 0.001b | <ROWSPAN=4> 0.84 (0.75–0.95)b |" }, { "role": "assistant", "content": "<ROWSPAN=4> 0.004 | \n | VCDR | 3.14 (0.00–47.13) | 0.851 | \n | Central corneal thickness (μm) | 1.00 (0.97–1.02)b | 0.766 | \n | Refractive error (SE, diopter) | 0.70 (0.49–1.00)b | 0.053 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3141440_004_00.png" ]
[ { "role": "user", "content": "<|image|>Express the table as Markdown code." }, { "role": "assistant", "content": "<md> | Species | Breeding colony | Geographical coordinates | # nestlings | # pairs | # nests | \n | --- | --- | --- | --- | --- | --- | \n | Wood Stork, Mycteria americana | Fazenda Ipiranga (PAN) | 16 ̊25' S, 56 ̊ 36' W | 13 | 5 | 6 | \n | Wood Stork, Mycteria americana | Porto da Fazenda (PAN) | 16 ̊27' S, 56 ̊ 07' W | 25 | 15 | 12 | \n | Wood Stork, Mycteria americana | Tucum (PAN) | 16 ̊26' S, 56 ̊ 03' W | 28 | 14 | 14 | \n | Wood Stork, Mycteria americana | Presidente (PAN) | 16°43' S, 57° 50' W | 18 | 9 | 9 | \n | Wood Stork, Mycteria americana | Macacoari (AP) | 00°27' N, 50° 40' W | 109 | 94 | 42 | \n | Wood Stork, Mycteria americana | Fazenda Zelândia (AP) | 01°09' N, 50° 23' W | 12 | 6 | 6 | \n | Wood Stork, Mycteria americana | Fazenda Alegria (AP) | 01°02' N, 50° 32' W | 7 | 5 | 3 | \n | Wood Stork, Mycteria americana | Se Cria (AP) | 01°56' N, 50° 35' W | 68 | 46 | 30 | \n | Roseate Spoonbill, Platalea ajaja | Porto da Fazenda (PAN) | 16 ̊27' S, 56 ̊07' W | 15 | 9 | 7 | \n | Roseate Spoonbill, Platalea ajaja | Praialzinho (PAN) | 16°76' S; 56°58' W | 22 | 14 | 10 | \n | Roseate Spoonbill, Platalea ajaja | Fazenda Zelândia (AP) | 01°09' N, 50°24' W | 23 | 16 | 10 | \n | Roseate Spoonbill, Platalea ajaja | Se Cria (AP) | 01°56' N, 50° 35' W | 50 | 40 | 20 | \n | Roseate Spoonbill, Platalea ajaja | Banhado do Taim (RS) | 32°29' S, 52°35' W | 83 | 68 | 35 | \n | Great Egret, Ardea alba egretta | Porto da Fazenda (PAN) | 16 ̊28' S, 56 ̊ 07' W | 25 | 14 | 12 | \n | Great Egret, Ardea alba egretta | Praialzinho (PAN) | 16°46' S, 56°35' W | 30 | 15 | 15 | \n | Great Egret, Ardea alba egretta | Tucum (PAN) | 16°26' S, 56°03' W | 10 | 5 | 5 | \n | Great Egret, Ardea alba egretta | Barra do Ribeiro (RS) | 30°16' S, 51°23' W | 46 | 35 | 21 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5992776_004_00.png" ]
[ { "role": "user", "content": "<|image|>Express the picture as Markdown code." }, { "role": "assistant", "content": "<md> | School ID | Total N Year 8 girls | N (%) Opted-out | N (%) Did not participate (other reason) | N (%) consenting Year 8 girls | N (%b) invited to be peer-supporter | N (%a) consenting peer-supporters | \n | --- | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=7> Intervention arm | \n | 2 | 58 | 0 (0.00) | 3 (5.17) | 55 (94.83) | 13 (22.41) | 13 (22.41) | \n | 3 | 96 | 3 (3.13) | 5 (5.21) | 88 (91.67) | 18 (18.75) | 17 (17.70) b | \n | 4 | 66 | 0 (0.00) | 2 (3.03) | 64 (96.97) | 12 (18.18) | 11 (16.67) | \n | 6 | 69 | 0 (0.00) | 7 (10.15) | 62 (89.86) | 14 (20.29) | 14 (20.29) | \n | Total | 289 | 3 (1.04) | 17 (5.88) | 269 (93.07) | 57 (19.72) | 55 (19.03) | \n | <COLSPAN=7> Control arm | \n | 1 | 73 | 1 (1.37) | 0 (0.00) | 72 (98.63) | - | - | \n | 5 | 89 | 0 (0.00) | 3 (3.37) | 86 (96.63) | - | - | \n | Total | 162 | 1 (0.62) | 3 (1.85) | 158 (97.53) | - | - | \n | School mean | 75.16 | 0.67 (0.75) | 3.33 (4.48) | 71.16 (94.68) | 14.25 (19.91) | 13.75 (18.29) | \n | Total | 451 | 4 (0.89) | 20 (4.43) | 427 (94.68) | 57 (19.72) | 55 (19.03) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5579714_004_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the table to Markdown syntax." }, { "role": "assistant", "content": "<md> | Acquisition Date (DD-MM-YYYY) | Test Site | Pixel Size | No. of Bands | \n | --- | --- | --- | --- | \n | 18-05-1999 | Dresden | 7.7 m | 128 | \n | 18-05-1999 | Potsdam | 4.0 m | 128 | \n | 01-08-2000 | Dresden | 3.3 m | 126 | \n | 20-07-2003 | Dresden | 3.5 m | 126 | \n | 17-06-2007 | Munich | 4.0 m | 125 | \n | 25-06-2007 | Munich | 4.0 m | 125 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3462120_006_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the photo into Markdown language." }, { "role": "assistant", "content": "<md> | Characteristic | Experiment | Controln = 200 | Test statistic | Pvalue | \n | | n = 200 [%] | [%] | value (X2) | | \n | --- | --- | --- | --- | --- | \n | <COLSPAN=5> Sex | \n | Male | 96 (48.0) | 98 (49.0) | 0.04 | 0.84 | \n | Female | 104 (52.0) | 102 (51.0) | | | \n | <COLSPAN=5> Age group (months) | \n | < 6 | 31 (15.5) | 36 (18.0) | 6.20 | 0.10 | \n | 6-11 | 37 (18.5) | 28 (14.0) | | | \n | 12-23 | 57 (28.5) | 76 (38.0) | | | \n | 24-35 | 44 (22.0) | 32 (16.0) | | | \n | 36+ | 31 (15.5) | 28 (14.0) | | | \n | <COLSPAN=5> Person child shares bed with | \n | Mother | 145 (72.5) | 144 (72.0) | 0.49 | 0.78 | \n | Parents | 49 (24.5) | 52 (26.0) | | | \n | Other sibling | 6 (3.0) | 4 (2.0) | | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC1635416_005_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the figure in markdown code: <md> | N | D | E | SMR | z | 95% CI | \n | --- | --- | --- | --- | --- | --- | \n | Total, n = 1400 | 38 | 16.11 | 236 | 5.45 | 167–324 | \n | Males, n = 667 | 24 | 10.61 | 226 | 4.11 | 145–337 | \n | Females," }, { "role": "assistant", "content": "n = 733 | 14 | 5.50 | 255 | 3.62 | 139–427 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5930827_002_00.png" ]
[ { "role": "user", "content": "<|image|>Express the table as Markdown code." }, { "role": "assistant", "content": "<md> | Income grade | UEBMI | URBMI | NCMS | \n | --- | --- | --- | --- | \n | I | ≤2500 | ≤1200 | ≤350 | \n | II | 2501–3520 | 1201–2000 | 351–800 | \n | III | 3521–4500 | 2001–2800 | 801–1370 | \n | IV | 4501–5600 | 2801–4000 | 1371–2500 | \n | V | >5600 | >4000 | >2500 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5011633_006_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the illustration to Markdown syntax." }, { "role": "assistant", "content": "<md> | | | | Neutralization | \n | Epitope cluster | Clone name | Epitope determinantsa | (ND50; pM)b | \n | --- | --- | --- | --- | \n | A | GZ4 | A | 3500 | \n | A | 1-D1K | A | 390 | \n | A | MT126L | A | >13000 | \n | A | 45F | a,F | 1400 | \n | A | 30S | a,c,D | — | \n | E | 111W | E | 40 | \n | E | 42H | E | 53 | \n | E | 40K | b,d,E | 390 | \n | E | 7-B6-1 | E | 120 | \n | E | 124i | b,d,E | 9100 | \n | Other | G23 | B,C,f,CT | — | \n | Other | 11i | a,D | — | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3334650_003_00.png" ]
[ { "role": "user", "content": "<|image|>Express the table as Markdown code." }, { "role": "assistant", "content": "<md> | | | <COLSPAN=2> Focal segmental glomerulosclerosis | <COLSPAN=2> Proliferative LN(class III or IV) | <COLSPAN=2> Pure membranous LN (class V) | \n | | | n of 10 (%) | Median (Range) | n of 7 (%) | Median (Range) | n of 7 (%) | Median (Range) | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | Females | | 3 (33%) | | 4/7 (57%) | | 5/7 (71%) | | \n | Race | Black | 2/10 (20%) | | 3/7 (42%) | | 3/7 (42%) | | \n | | White | 5/10 (50%) | | 2/7 (29%) | | 2/7 (29%) | | \n | | Other | 3/10 (30%)* | | 2/7 (29%)† | | 3/7 (43%)** | | \n | Medications | Oral prednisone | 4/10 (40%) | | 7/7 (100%) | | 4/7 (57%) | | \n | | Mycophenolate mofetil | 5/10 (50%) | | 3/7 (43%) | | 5/7 (71%) | | \n | | Cyclophosphamide | - | | 2/7 (29%) | | 1/7 (14%) | | \n | | Angiotensin blocking agent | 9/10 (90%) | | 2/7 (29%) | | 6/7 (86%) | | \n | Kidney Status | GFR < 60 ml/min/m2 | 4/10 (40%) | | 1/7 (14%) | | 1/7 (14%) | | \n | | Protein: creatinine ratio > 0.5 | 5/5 (100%) | | 7/7 (100%) | | 7/7 (100%) | | \n | | Renal SDI score > 0¥ | - | | 0/3 | | 1/4 (25%) | | \n | | Renal SLEDAI score‡ | - | | | 4 (0-16) | | 8 (4-12) | \n | | Presence of anti double-stranded-dsDNA | - | | 7/7 (100%) | | 4/7 (67%) | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3443052_002_01.png" ]
[ { "role": "user", "content": "<|image|>Interpret the diagram as Markdown format." }, { "role": "assistant", "content": "<md> | Herds | No. of positive sera | No. of sera examined | \n | --- | --- | --- | \n | 1 | 10 | 10 | \n | 2 | 10 | 10 | \n | 3 | 14 | 16 | \n | 4 | 17 | 24 | \n | 5 | 62 | 92 | \n | Total | 113 | 152 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4423123_006_01.png" ]
[ { "role": "user", "content": "<|image|>Convert the photo into Markdown language." }, { "role": "assistant", "content": "<md> | Study EFPIA partner | Results current process | Results EHR4CR PF system | Gold Standard-Mean [LB – HB] | Patients per clinic | \n | --- | --- | --- | --- | --- | \n | NCT00439725 Bayer | 20 | 205 | 494 [288 – 816] | 4116 | \n | NCT00638690 Janssen | 25 | 5 | 86 [15 – 470] | 8626 | \n | NCT00626548 AstraZeneca | 250 | 695 | 1035 [603 – 1709] | 8626 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3075050_002_00.png" ]
[ { "role": "user", "content": "<|image|>What are the following diagram content in markdown style: <md> | <ROWSPAN=2> Diagnosis | <COLSPAN=2> Cases | \n | No. | % | \n | --- | --- | --- | \n | Tuberculosis—all | 25 | 23 | \n | Pulmonary | 16 | | \n | Disseminated | 5 | | \n | TB meningitis | 2 | | \n | Lymph node | 1 | | \n | Joint | 1 | | \n | Pulmonary infection | 12 | 11 | \n | Candidiasis—all | 11 | 10 | \n | Oral | 3 | | \n | Oesophageal | 5 | | \n | Vulvovaginal | 3 | | \n | Pregnancy-related admission | 8 | 7.3 | \n | Skin—all | 8 | 7.3 | \n | Fungal | 4 | | \n | Drug rash | 3 | | \n | Infestation (scabies) | 1 | | \n | Abscess/cellulitis | 6 | 5.5 | \n | CMV disease—all | 4 | 3.7 | \n | CMV retinitis | 3 | | \n | CMV colitis | 1 | | \n | Sepsis | 5 | 4.6 | \n | Herpes Zoster | 3 | 2.8 | \n | Malignancy—all | 3 | 2.8 | \n | Kaposi sarcoma | 1 | | \n | Poorly-differentiated carcinoma of tongue | 1 | | \n | Infantile fibrosarcoma | 1 | | \n | Peripheral" }, { "role": "assistant", "content": "neuropathy | 3 | 2.8 | \n | Disseminated histoplasmosis | 2 | 1.8 | \n | Cryptosporidiosis | 1 | 0.9 | \n | Shigellosis | 1 | 0.9 | \n | Bacterial meningitis | 1 | 0.9 | \n | Recurrent otitis media | 1 | 0.9 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5356705_001_00.png" ]
[ { "role": "user", "content": "<|image|>Transform the table into Markdown format." }, { "role": "assistant", "content": "<md> | Gene | rs # | Chromosome | Allele (major/minor) | Position | HWE in controls | \n | --- | --- | --- | --- | --- | --- | \n | XPA | rs1800975 | 9:97697296 | G/A | 5' non-coding region (-4A/G) | 0.118/2.445 | \n | ERCC1 | rs11615 | 19:45420395 | C/T | Exon 4 (Asn118Asn) | 0.509/0.436 | \n | XPC | rs2228000 | 3:14158387 | C/T | Exon 9 (Ala499Val) | 0.498/0.460 | \n | XPC | rs2228001 | 3:14145949 | A/C | Exon 16 (Gln939Lys) | 0.267/1.231 | \n | ERCC2/XPD | rs238406 | 19:45365051 | G/T | Exon 6 (Arg156Arg) | 0.766/0.088 | \n | ERCC2/XPD | rs1799793 | 19:45364001 | G/A | Exon 10 (Asp 312 Asn) | 0.101/2.687 | \n | ERCC2/XPD | rs50872 | 19:45359191 | C/T | Intron 12 | 0.945/0.005 | \n | ERCC2/XPD | rs13181 | 19:45351661 | T/A | Exon 23 ( Lys751 Gln) | 0.716/0.132 | \n | ERCC2/XPD | rs3810366 | 19:45370684 | C/G | Promoter (-114) | 0.099/2.728 | \n | ERCC4/XPF | rs1799801 | 16:13948101 | T/C | Exon 11 (Ser835Ser) | 0.619/0.247 | \n | ERCC5/XPG | rs17655 | 13:102875652 | C/G | Exon 15 (His1104Asp) | 0.077/3.137 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5735913_002_01.png" ]
[ { "role": "user", "content": "<|image|>Transform the picture into Markdown format." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> Characteristics | <COLSPAN=2> S. aureus colonization | <ROWSPAN=2> Total | \n | Yes | No | \n | --- | --- | --- | --- | \n | <COLSPAN=4> Age | \n | Median | 6 | 5 | 5 | \n | Range | 3 | 3 | 3 | \n | <COLSPAN=4> Age (years) | \n | > 4 | 48 (12%) | 248 (62%) | 296 (74%) | \n | ≤ 4 | 4 (1%) | 100 (25%) | 104 (26%) | \n | Total | 52 (13%) | 348 (87%) | 400 (100%) | \n | <COLSPAN=4> Sex | \n | Male | 20 (5%) | 140 (35%) | 160 (40%) | \n | Female | 32 (8%) | 208 (52%) | 240 (60%) | \n | Total | 52 (13%) | 348 (87%) | 400 (100%) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3709725_010_00.png" ]
[ { "role": "user", "content": "<|image|>What are the following illustration content in markdown style: <md> | Gene | Sequence | \n | ---" }, { "role": "assistant", "content": "| --- | \n | Cytokeratin14 | 5′-GTCCTTCTGCAGATTGACAATGA-3′ (forward)5′-TTCACCAAGACAGAGGAGCTGAA-3′ (reverse) | \n | E-cadherin | 5′-GAAGATTGCACCGGTCGACAAA-3′ (forward)5′-CCACCAAAGTCACGCTGAATAC-3′ (reverse) | \n | ΔNp63 | 5′-CAGACTCAATTTAGTGAG-3′ (forward)5′-AGCTCATGGTTGGGGCAC-3′ (reverse) | \n | Amelogenin | 5′-GGAGCAGCTTTTGCCATGCCT-3′ (forward)5′-GTGGCCTTATGCTCTGGTAC-3′ (reverse) | \n | GAPDH | 5′-GAGTCAACGGATTTGGTCGT-3′ (forward)5′-GACAAGCTTCCCGTTCTCAG-3′ (reverse) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4279814_006_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the table in markdown code: <md> | Software | Type | Input data and format | discordant reads detection | transposition calling | Every potential mapping considered | Detection of unknow TEs insertion | Precision | Donor/Acceptor output | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | TE-Tracker | | BAM file | ✓ | ✓ | ✓ | ✓ | 100 bp-1 Kbp | ✓ | \n | RetroSeq | TE-dedicated | BAM file, TE annotation or sequence | ✓ | ✓ | ✗ | ✗ | 100 bp-1 Kbp | ✓ | \n | Tea | TE-dedicated | BAM file, TE annotation or sequence | ✗ | ✓ | ✗ | ✗ | 1 bp | ✓ | \n | T-lex |" }, { "role": "assistant", "content": "TE-dedicated | FASTQ file, TE annotation | ✗ | ✓ | ✗ | ✗ | 1 bp | ✓ | \n | Popoolation-TE | TE-dedicated | FASTQ file, TE sequence and TSD annotation | ✗ | ✓ | ✗ | ✗ | 1 bp | ✓ | \n | TE-locate | TE-dedicated | FASTQ file, TE sequence | ✗ | ✓ | ✗ | ✗ | 1 bp | ✓ | \n | ngs_te_mapper | TE-dedicated | FASTQ file, TE annotation | ✗ | ✓ | ✓ | ✗ | 1 bp | ✓ | \n | RelocatTE | TE-dedicated | FASTQ file, TE sequence | ✗ | ✓ | ✓ | ✗ | 1 bp | ✓ | \n | TIF | TE-dedicated | FASTQ file, TE sequence and TSD annotation | ✗ | ✓ | ✗ | ✗ | 1 bp | ✓ | \n | VariationHunter | SV | DIVET alignment file (mrFAST output) | ✗ | ✗ | ✓ | ✓ | 100 bp-1 Kbp | ✓ | \n | PRISM | SV | BAM file | ✓ | ✗ | ✗ | ✓ | 1 bp | ✗ | \n | Delly | SV | BAM file | ✓ | ✗ | ✗ | ✓ | 1 bp | ✗ | \n | GASVpro | SV | Alignment file and coverage data file | ✓ | ✗ | ✓ | ✓ | 100-1 kp | ✗ | \n | Hydra | SV | Discordant reads coordinates and mapping features | ✗ | ✗ | ✓ | ✓ | 1 bp | ✗ | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4180053_003_01.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the figure in markdown code: <md> | Clinical pharmacology classification | N | Price change (%) | \n | --- | --- | --- | \n | Antiallergics | 121 | −60.3 | \n | Blood-related medicine | 317 | −52.6 | \n | Water-Electrolyte-Acid–base-Balance Medicine | 842 | −49.2 | \n | Antiparasitics | 218 | −48.9 | \n | Urinary system medicine | 152 | −48.8 | \n | Antimicrobial medicine | 1643 | −46.9 | \n | Gynecological medicine | 94 | −46.7 | \n | Vitamin & mineral supplements | 519 | −43.6 | \n | Antipsychotics | 70 | −42.3 | \n | Ophthalmic medicine | 177 | −40.0 | \n | Dermatologic medicine | 291 | −39.5 | \n | Nervous system medicine | 298 | −39.1 | \n | Digestive system medicine | 842 | −38.9 | \n | Respiratory system medicine | 333 | −37.5 | \n | Hormone | 489 | −34.8 | \n | Ear, nose, and throat medicine | 38 | −29.6 | \n | Antipyretic-analgesic" }, { "role": "assistant", "content": "and anti-inflammatory medicine | 426 | −29.4 | \n | Cardiovascular system medicine | 805 | −28.3 | \n | Biological medicine | 72 | 72.2 | \n | Others | 151 | −50.0 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5722546_005_06.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the picture in markdown code: <md> | Group | N | Excellence | Effective | Invalid | P | \n | --- | --- | --- | --- | --- | --- | \n | Male | 118 | 37 | 61 | 20 | 0.4569 | \n | Female |" }, { "role": "assistant", "content": "82 | 25 | 42 | 15 | 0.4491 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3826568_007_00.png" ]
[ { "role": "user", "content": "<|image|>What are the following table content in markdown style: <md> | <ROWSPAN=2> Sample | <COLSPAN=5> Percentage of contribution of standard spectra (%) | \n | Pyrite | Elemental sulfur | Sulfate | Jarosite | DBT | \n | --- | --- | --- | --- | --- | --- | \n | Raw coal | 45.64 | 0 | 23.57 | 0 | 14.34 | \n | Residual coal (16 days) | 35.67 | 28.32 | 10.16 | 18.99" }, { "role": "assistant", "content": "| 13.86 | \n | Raw pyrite | 100 | 0 | 0 | 0 | 0 | \n | Residual pyrite (24 days) | 49.34 | 50.72 | 0 | 0 | 0 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4891821_006_00.png" ]
[ { "role": "user", "content": "<|image|>Transform the picture into Markdown format." }, { "role": "assistant", "content": "<md> | Expert | Sensitivity % | Specificity % | PPV % | NPV % | \n | --- | --- | --- | --- | --- | \n | 1 | 100 (50/50) | 95.6 (43/45) | 96.2 (50/52) | 100 (43/43) | \n | 2 | 86.0 (43/50) | 97.8 (44/45) | 97.7 (43/44) | 86.3 (44/51) | \n | 3 | 100 (50/50) | 73.3 (33/45) | 80.6 (50/62) | 100 (33/33) | \n | Averaged | 95.3 (143/150) | 88.9 (120/135) | 90.5 (143/158) | 94.5 (120/127) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5100336_002_00.png" ]
[ { "role": "user", "content": "<|image|>Express the table as Markdown code." }, { "role": "assistant", "content": "<md> | Date | T-score | Treatment | \n | --- | --- | --- | \n | November 2002 | Greater than −2.5 | ERT | \n | December 2003 | −1/-2.5 | ERT | \n | July 2005 | −1/−2.5 | ERT | \n | May 2006 | −1/−2.5 | ERT | \n | May 2008 | −1/−2.5 | SRT | \n | March 2011 | −1.5 | SRT | \n | April 2012 | −1.5 | SRT | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5964685_002_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the image content behind with markdown code: <md> | | Number | Percent | | Number | Percent | | \n | --- | --- | --- | --- | --- | --- | --- | \n | AGE | | | AWAREP | | | | \n | 16–25 | 109 | 12.1 | Yes | 271 | 29.88 | | \n | 26–35 | 196 | 21.7 | No | 13 | 1.43 | " }, { "role": "assistant", "content": "| \n | 36–45 | 237 | 26.2 | Don’t Know | 623 | 68.69 | | \n | 46–55 | 200 | 22.1 | AWAREPC | | | | \n | 56–65 | 101 | 11.2 | Yes | 68 | 7.71 | | \n | 66+ | 61 | 6.7 | No | 112 | 12.7 | | \n | GENDER | | | Don’t Know | 702 | 79.59 | | \n | Male | 312 | 33.8 | VIRALHEP | | | | \n | Female | 612 | 66.2 | Yes | 647 | 70.94 | | \n | OCCUPATION | | | No | 213 | 23.36 | | \n | Labourer | 192 | 21.4 | Don’t Know | 52 | 5.7 | | \n | Unemployed | 247 | 27.5 | PATIENT | | | | \n | Retired | 131 | 14.6 | I hear | 397 | 43.44 | | \n | Self-employed /B.O/P.S.Worker | 327 | 36.5 | I don’t hear | 404 | 44.2 | | \n | INTERNET | | | Don’t Know | 113 | 12.36 | | \n | Yes | 559 | 63 | HISTofHBV | | | | \n | No | 329 | 37.1 | Yes | 102 | 11.26 | | \n | CELLPHONE | | | No | 654 | 72.19 | | \n | Yes | 878 | 97 | Don’t Know | 150 | 16.56 | | \n | No | 27 | 2.98 | | Obs | Mean | Std. Dev. | \n | MIGRANT | | | ROOM | 905 | 3.3 | 0.75 | \n | Yes | 382 | 57.5 | PEOPLE | 898 | 3.53 | 1.22 | \n | No | 517 | 42.5 | | | | | \n | MIG_EAST | | | | | | | \n | Yes | 118 | 87.2 | | | | | \n | No | 806 | 12.8 | | | | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5136403_003_01.png" ]
[ { "role": "user", "content": "<|image|>Express the illustration as Markdown code." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> Kappa[95% CI] | <ROWSPAN=2> N | <COLSPAN=3> Agree | <ROWSPAN=2> Disagreen (%) | \n | Overalln (%) | Narrown | Openn | \n | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=6> Visit 1 | \n | 0.66[0.50, 0.83] | 86 | 73 (85%) | 22 | 51 | 13 (15%) | \n | <COLSPAN=6> Visit 2 | \n | 0.69[0.50, 0.89] | 71 | 63 (89%) | 13 | 50 | 8 (11%) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2678145_004_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the photo content behind with markdown code: <md> | | AS-SMP3 days(N = 476) | AS-SMP24 hours(N = 458) | AL3 days(N = 450) | \n | --- | --- | --- | --- | \n" }, { "role": "assistant", "content": "| Age (Years) | | | | \n | Median | 8.0 | 9.0 | 8.0 | \n | Min, Max | 0.4, 63.5 | 0.6, 79.0 | 0.6, 60.0 | \n | Age Group (Years) | | | | \n | < 5 – n (%) | 153 (32.1) | 123 (26.9) | 137 (30.4) | \n | Gender | | | | \n | Male – n (%) | 239 (50.3) | 226 (49.3) | 223 (49.6) | \n | P. falciparum (/μl) | | | | \n | Median (IQR) | 8400 (3180–24160) | 8000 (3200–19520) | 7600 (3120–28140) | \n | Gametocyte carriage – n (%) | 6 (1.3) | 16 (3.5) | 8(1.8) | \n | Fever prevalence* – n (%) | 332(69.7) | 324(70.7) | 316(70.2) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3280756_006_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the illustration into Markdown language." }, { "role": "assistant", "content": "<md> | State or Message | Description a | \n | --- | --- | \n | Candidate | The node is a candidate node | \n | Head | The node is selected as cluster head | \n | Plain | The node is a member node | \n | Compete_Msg | Composed by the ID of sender | \n | Join_Msg | Composed by the ID of sender and the ID of head | \n | Weight_Msg | Composed by the ID of sender, weight, Ea, Eresidual | \n | Schedule_Msg | Head assign slot time for its member nodes | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5744119_010_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the photo content behind with markdown code: <md> | ID | NDBp Family | Length of the Mature Peptide | Hydrophobicity | Hydrophobic Moment | Charge | \n | --- | --- | --- | --- | --- | --- | \n | TatHDPND202 | NDBP-2 | 47 | 0.263 | 0.065 | +6 | \n | TatHDPND201 | NDBP-2 | 43 | 0.212 | 0.089 | +6 | \n | TatHDPND301 | NDBP-3 | 19 | 0.903 | 0.377 | +2 | \n | TatHDPND302 | NDBP-3 | 25 | 0.495 | 0.327" }, { "role": "assistant", "content": "| +4 | \n | TatHDPND405 | NDBP-4 | 13 | 0.819 | 0.606 | +1 | \n | TatHDPND406 | NDBP-4 | 13 | 0.742 | 0.458 | +1 | \n | TatHDPND407 | NDBP-4 | 13 | 0.746 | 0.456 | +1 | \n | TatHDPND402 | NDBP-4 | 13 | 0.778 | 0.779 | 0 | \n | TatHDPND403 | NDBP-4 | 13 | 0.752 | 0.792 | +1 | \n | TatHDPND401 | NDBP-4 | 13 | 0.793 | 0.595 | +1 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4545935_002_01.png" ]
[ { "role": "user", "content": "<|image|>Convert the illustration to Markdown syntax." }, { "role": "assistant", "content": "<md> | | | Group A (≤10 deg.; n = 22) | Group B (≥11 deg.; n = 30) | p value | \n | --- | --- | --- | --- | --- | \n | Age | (years) | 67.9 ± 8.3 | 67.5 ± 11.8 | NS | \n | Sex | (M/F) | 14/8 | 11/19 | NS | \n | Body mass index | (kg/m2) | 23.7 ± 2.6 | 25.4 ± 3.9 | NS | \n | Degenerative scoliosis | (≥10 deg) | 22.7 % (5/22) | 40.0 % (12/30) | NS | \n | Diabetes mellitus | | 0.0 % (0/22) | 10.0 % (3/30) | NS | \n | Depression | | 4.5 % (1/22) | 6.7 % (2/30) | NS | \n | Pelvic incidence (PI)a | (Degree) | 44.9 ± 7.0 | 52.1 ± 11.7 | p = 0.013 | \n | Lumbar lordosis (LL)a | (Degree) | 44.0 ± 8.3 | 29.4 ± 10.7 | p < 0.001 | \n | PI minus LL (PI-LL)a | (Degree) | 1.0 ± 5.8 | 22.7 ± 8.9 | p < 0.001 | \n | Follow-up | (months) | 16.9 ± 6.6 | 15.9 ± 5.3 | NS | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2975846_003_01.png" ]
[ { "role": "user", "content": "<|image|>What are the following image content in markdown style: <md> | <ROWSPAN=2> Characteristics | <COLSPAN=2> Frequency (%) and median (IQR) | \n | County hospital (n=234) | Township hospital (n=480) | Total (n=714) | \n | --- | --- | --- | \n | Access to blood culture | 150 (64.1) | 257 (53.5) | 407 (57.0) | \n | Medical expense for illness† (median, IQR) | 263.9 (190.8, 389) | 264 (176.7," }, { "role": "assistant", "content": "460.5) | 264 (180.1, 424.2) | \n | Percentage of reimbursement for all types of payment (%) | | | | \n | 0–10 | 193 (82.5) | 196 (40.8) | 389 (54.5) | \n | 11–50 | 21 (9) | 240 (50) | 261 (36.6) | \n | 51–100 | 20 (8.5) | 44 (9.2) | 64 (9) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5872502_007_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the image in markdown code: <md> | Language | Method | # exp. | # correct | Precision | Recall | F1 | \n | --- | --- | --- | --- | --- | --- | --- | \n | <ROWSPAN=5> Chinese | GUTime | 512 | 429 | 0.838 | 0.241 | 0.375 | \n | HeidelTime | 954 | 824 | 0.864 | 0.463 | 0.603 | \n | CMedTEX | 2293 | 1645 | 0.717 | 0.925 | 0.808 | \n | TEER_C | 1761 | 1613 | 0.916 | 0.907 | 0.912 | \n | TEER | 1761 | 1657 | 0.941 | 0.932 | 0.936 | \n | <ROWSPAN=6> English | NLTK Timex | 106 | 61 | 0.575 | 0.153 | 0.242 | \n | GUTime | 101" }, { "role": "assistant", "content": "| 88 | 0.871 | 0.221 | 0.353 | \n | IllinoisTExtractor | 352 | 287 | 0.815 | 0.721 | 0.765 | \n | Heideltime | 395 | 327 | 0.828 | 0.822 | 0.825 | \n | TEXer | 360 | 340 | 0.944 | 0.854 | 0.897 | \n | TEER | 368 | 349 | 0.948 | 0.877 | 0.911 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5191859_005_00.png" ]
[ { "role": "user", "content": "<|image|>Render the illustration in Markdown format." }, { "role": "assistant", "content": "<md> | Groups | Standard Lab Chow (LC) | Safflower oil (SO) | \n | Research diets | D10012M (AIN-93M) | D11102001 | \n | | g % | g % | \n | --- | --- | --- | \n | Protein | 14 | 15 | \n | Carbohydrate | 73 | 66 | \n | Fat | 4 | 10 | \n | Omega-3 fatty acids | 0.011 | 0.015 | \n | Omega-6 fatty acids | 3.1 | 6.63 | \n | Omega-9 fatty acids | 0.9 | 1.34 | \n | Kcal/g | 3.8 | 4.2 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5522112_002_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the figure content behind with markdown code: <md> | | Early Surveys(2000-2004)N=108 | Late Surveys(2006-2013)N=116 | p value | \n | --- | --- | --- | --- | \n | Gender (female) | 28.7% | 31% | 0.7 | \n | Median Age | 70.52±13.67 | 68.95±13.22 | 0.35 | \n | Age above >75 years | 47.22% | 38.79% | 0.2 | \n | <COLSPAN=4> Cardiovascular risk factor and cardiovascular history | \n | History of Diabetes | 28% | 41.7% | 0.03 | \n | History of HTN | 50.5% | 64.9% | 0.029 | \n | History of dyslipidemia | 31.8% | 63.6% | 0.001 | \n | Family history of CAD | 10.3% | 18.1% | 0.11 | \n | Mean BMI | 26.43±4.49 | 27.68±5.29 | 0.23 | \n | History of MI | 33.6% | 30.1% | 0.57 | \n | Past PCI | 29.9% | 7.8% | 0.1 | \n | Past" }, { "role": "assistant", "content": "CABG | 4.7% | 21.2% | 0.33 | \n | Past CAV/TIA | 19.4% | 8.8% | 0.02 | \n | History of CHF | 13.1% | 16.8% | 0.58 | \n | History of CRF | 13.9% | 14.9% | 0.82 | \n | History of PVD | 13.1% | 10.6% | 0.57 | \n | <COLSPAN=4> Chronic Medication | \n | ASA | 52.5% | 44.9% | 0.34 | \n | Clopidogrel | 1.6% | 5.7% | 0/19 | \n | BB | 38.1% | 39.8 | 0.82 | \n | ACEi | 28.6% | 38.1% | 0.2 | \n | CCB | 19.4% | 18.9% | 0.92 | \n | Nitrate | 28.6% | 9.4% | 0.001 | \n | Lipid lowering agents | 15.7% | 37.1% | 0.0003 | \n | Insulin | 3.2% | 4.5% | 0.65 | \n | Anti-Hyperglycemic | 15.9 | 29.5 | 0.04 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5485536_003_01.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the diagram in markdown code: <md> | <ROWSPAN=2> Subject | <COLSPAN=2> Body weighta | <COLSPAN=2> Body weight versus dayb | \n | CV (%) | SD (kg) | Slope | Intercept (R2) | \n | --- | --- | --- | --- | --- | \n | A | 0.25 | 0.16 | −20.0 | 66.2 (0.14) | \n | B | 0.53 | 0.36 | 6.2 | 63.4 (0.32)* | \n | C | 0.31 | 0.16 | 21.8 | 52.6 (0.16) | \n | D | 0.44 | 0.33 | 41.2 | 76.2 (0.14)" }, { "role": "assistant", "content": "| \n | E | 0.34 | 0.31 | 1.8 | 89.7 (0.001) | \n | F | 0.39 | 0.42 | −103.0 | 108.1 (0.55)** | \n | Mean ± SD | 0.38 ± 0.10 | 0.29 ± 0.10 | 1.0 | 76.0 (0.0002) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3863868_005_00.png" ]
[ { "role": "user", "content": "<|image|>Translate the picture into Markdown format." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> Toothpaste | <COLSPAN=3> Dose (mg F/day/Kg bw) | \n | Based on declared TF | Based on measured TF | Based on measured TSF | \n | --- | --- | --- | --- | \n | Family * (n = 80) | 0.074 ± 0.007 A,a | 0.074 ± 0.007 A,a | 0.039 ± 0.005 A,b | \n | Children’s ** (n = 78) | 0.040 ± 0.007 B,a | 0.039 ± 0.003 B,a | 0.039 ± 0.005 A,a | \n | All (n = 158) | 0.057 ± 0.004 a | 0.057 ± 0.004a | 0.039 ± 0.003 b | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5415592_012_07.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the photo in markdown code: <md> | | 5 | 4S | 4F | 3 | 2 | 1 | 6 | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | 5 | −1.7679 | 0.0000 | 0.0000 | 0.3896 | 0.0740 | 0.0000 | 1.3043 | \n | 4S | 0.0000 | −1.1958 | 0.0000 | 0.3629 | 0.4395 | 0.2703 | 0.1232 | \n | 4F | 0.0000 | 0.3316 | −1.5274 | 0.3629 | 0.4395 | 0.2703 | 0.1232 | \n | 3 | 0.0000 | 0.0000 | 1.4000 | −2.3300 | 0.0000 | 0.0000 | 0.9300 |" }, { "role": "assistant", "content": "\n | 2 | 0.0000 | 0.0000 | 2.4000 | 0.0000 | −2.5500 | 0.0000 | 0.1500 | \n | 1 | 0.0000 | 0.0000 | 1.3300 | 0.0000 | 0.0000 | −1.4400 | 0.1100 | \n | 6 | 0.0000 | 0.0000 | 0.0000 | 0.0000 | 0.0000 | 0.0000 | 1.0000 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC1936417_003_00.png" ]
[ { "role": "user", "content": "<|image|>Express the photo as Markdown code." }, { "role": "assistant", "content": "<md> | Characteristic | Support(n = 105) | Control(n = 107) | \n | --- | --- | --- | \n | Age [mean in years (range)] | 20.6 (13–42) | 20.1 (14–36) | \n | In a stable union (n) | 80 (76.2%) | 92 (85.9%) | \n | Secondary education (n) | 103 (98.1%) | 106 (99.1%) | \n | Religious (n) | 96 (91.4%) | 100 (93.4%) | \n | Non-white skin color (n) | 79 (75.2%) | 75 (70.1%) | \n | Housewife (n) | 63 (60.0%) | 67 (62.6%) | \n | Start of prenatal care (GA < 28 weeks) (n) | 101 (96.2%) | 103 (96.3%) | \n | Number of prenatal visits ≥ 6 (n) | 84 (85.0%) | 84 (78.5%) | \n | Accompanied during prenatal care (n) | 44 (41.9%) | 54 (50.5%) | \n | Participated in classes for pregnant women (n) | 16 (15.2%) | 16 (14.9%) | \n | Gestational age at delivery [mean in weeks (range)] | 39.2 (37–42) | 39.0 (37–42) | \n | Cervical dilation at admission [mean in cm (range)] | 3.9 (3–6) | 3.9 (3–6) | \n | Cervical effacement ≥ 80% (n) | 75 (71.4%) | 68 (63.6%) | \n | Intact amniotic membrane (n) | 82 (78.1%) | 83 (77.6%) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3087711_002_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the figure into Markdown format." }, { "role": "assistant", "content": "<md> | Description | Version 2.3 | Version 2.5p1 | Version 2.5.2 | \n | --- | --- | --- | --- | \n | No. of reads used for assembly | 304,619 | 303,601 | 303,601 | \n | No. of reads assembled in to contigs | 248,857 | 247,757 | 247,757 | \n | No. of contigs assembled | 17, 613 | 17,457 | 17,457 | \n | No. of singletons | 54,669 | 54,002 | 54,002 | \n | Average contig length (bases) | 909 | 916 | 916 | \n | Largest contig length (bases) | 7,170 | 7,173 | 7,173 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5337286_005_00.png" ]
[ { "role": "user", "content": "<|image|>Translate the figure into Markdown format." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> Variables | <COLSPAN=2> Frequency n (%) | \n | Yes n (%) | No n (%) | \n | --- | --- | --- | \n | HIV can be sexually transmitted | 500 (99.6) | 2(0.4) | \n | HIV can be transmitted through Blood transfusion | 499(99.4) | 3(0.6) | \n | HIV can be transmitted from mother to child | 477(95.0) | 25(5.0) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5796392_003_00.png" ]
[ { "role": "user", "content": "<|image|>Encode the diagram in Markdown syntax." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> Mature miRNA | Control | Infected | \n | % | % | \n | --- | --- | --- | \n | miR-21-5p | 17.1 | 24.5 | \n | miR-143-3p | 11.4 | 7.8 | \n | miR-126-3p | 8.3 | 5.7 | \n | miR-26a-5p | 6.2 | 6.5 | \n | miR-148a-3p | 6.1 | 2.9 | \n | let-7f-5p | 4.1 | 4.2 | \n | let-7g-5p | 3.7 | 5.3 | \n | let-7a-5p | 2.8 | 2.6 | \n | let-7i-5p | 2.8 | 4.2 | \n | miR-99a-5p | 2.6 | 2.7 | \n | miR-10a-5p | 2.1 | 1.1 | \n | miR-100-5p | 2.1 | 1.3 | \n | miR-199a-3p | 1.5 | 1.3 | \n | miR-146b-5p | 1.3 | 1.3 | \n | miR-191-5p | 1.2 | 1.4 | \n | miR-24-3p | 1.1 | 1.1 | \n | miR-181a-5p | 1 | 1.3 | \n | miR-27b-3p | 1 | 1 | \n | miR-30d-5p | 1 | – | \n | miR-142-5p | 0.9 | – | \n | miR-150-5p | – | 1.4 | \n | miR-92a-3p | – | 1.1 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3958303_005_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the table in markdown code: <md> | Input Signals | Explanation | \n | --- | --- | \n | grfL | vertical ground reaction force of the left foot (N) | \n | grfR | vertical ground reaction force of the right foot (N) | \n | grfDiff | average absolute difference between grfL and" }, { "role": "assistant", "content": "grfR in the past 50 samples (N) | \n | COPyL | longitudinal coordinate of the center of pressure for the left foot (starting from the toes to the heel) (mm) | \n | COPyR | longitudinal coordinate of the center of pressure for the right foot (starting from the toes to the heel) (mm) | \n | sumAng | the sum of all knee and hip angles (°) | \n | gyroL | angular velocity of the left foot in the sagittal plane (rad/s) | \n | gyroR | angular velocity of the right foot in the sagittal plane (rad/s) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4297373_004_00.png" ]
[ { "role": "user", "content": "<|image|>Encode the figure in Markdown syntax." }, { "role": "assistant", "content": "<md> | GenBank No. | Submission No. | Species | \n | --- | --- | --- | \n | KJ440515 | 1698905 | Dog - Canis lupus familiaris | \n | KJ440516 | 1698976 | Dog - Canis lupus familiaris | \n | KJ440517 | 1698981 | Louse - Linognathus setosus | \n | KJ440518 | 1698985 | Louse - Linognathus setosus | \n | KJ440519 | 1698989 | Mosquito - Anopheles sinensis | \n | KJ440520 | 1699024 | Mosquito - Culex pipiens pallens | \n | KJ440521 | 1699027 | Tick - Rhipicephalus sanguineus | \n | KJ440522 | 1699029 | Louse - Linognathus setosus | \n | KJ440523 | 1699030 | Mosquito - Anopheles sinensis | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3614570_002_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the diagram with markdown style: <md> | Exon | Primers | \n | --- | --- | \n | 24 | Ex24-1F: 5’-GGGGCTCTCTGTGCTTCTGGAAACT-3’ | \n | |" }, { "role": "assistant", "content": "Ex24-1R: 5’-ACAAAGGGGGCCTGGGTTCGGAATC-3’ | \n | 24 | Ex24-2F: 5’-TGAGACGTTCCAGGCCAGCACAGT-3’ | \n | | Ex24-2R: 5’-GACCTCAGGTCTCACCCTCTAAGG-3’ | \n | 27 | Ex27-1F: 5’-CTGAAGCTGATAGAGGTGGGCCATC-3’ | \n | | Ex27-1R: 5’-TTGAAGGACACGCCCTGCACAGCCA-3’ | \n | 27 | Ex27-2F: 5’-GGGACTTTGGGCTAAGATACCGACC-3’ | \n | | Ex27-2R: 5’CCTGGAGTCCTTTGGCCTAAACTCC-3’ | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5595708_004_00.png" ]
[ { "role": "user", "content": "<|image|>Transcribe the figure into Markdown format." }, { "role": "assistant", "content": "<md> | | TTH with insomnia, N = 75 | TTH without insomnia, N = 495 | P | \n | --- | --- | --- | --- | \n | <COLSPAN=4> Demographics | \n | Age, Mean ± SD (years) | 44.5 ± 13.7 | 42.5 ± 13.7 | 0.236 | \n | Women, N (%) | 43 (57.3) | 259 (52.3) | 0.418 | \n | <COLSPAN=4> Headache characteristics | \n | Bilateral pain, N (%) | 45 (60.0) | 329 (66.5) | 0.272 | \n | Non-pulsating quality, N (%) | 29 (38.7) | 198 (40.0) | 0.824 | \n | Mild-to-moderate severity, N (%) | 73 (97.3) | 490 (99.0) | 0.225 | \n | Non-aggravation by movement, N(%) | 58 (77.3) | 393 (79.4) | 0.682 | \n | <COLSPAN=4> Associated symptoms | \n | Photophobia, N (%) | 6 (8.0) | 40 (8.1) | 0.981 | \n | Phonophobia, N (%) | 31 (41.3) | 150 (30.3) | 0.056 | \n | Headache frequency, Median (IQR) | 1.0 (0.3–3.0) | 0.4 (0.2–1.0) | 0.002a | \n | VAS score, Median (IQR) | 5.0 (4.0–7.0) | 4.0 (3.0–6.0) | < 0.001a | \n | HIT-6 score, Median (IQR) | 46.0 (40.0–52.0) | 42.0 (38.0–46.0) | < 0.001a | \n | Anxiety, N (%) | 21 (28.0) | 33 (6.7) | < 0.001 | \n | Depression, N (%) | 16 (21.3) | 8 (1.6) | < 0.001 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5451972_003_01.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the image with markdown style: <md> | Species | Fat [g/100 g] | \n | --- | --- | \n | Giant mealworm larva | 35 ± 0.1 a | \n | Common mealworm" }, { "role": "assistant", "content": "pupa | 32 ± 0.5 a | \n | Common mealworm larvae | 31 ± 1.1 a | \n | Field cricket nymph | 32 ± 0.2 a | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3699365_008_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the figure content behind with markdown code: <md> | <ROWSPAN=2> Concept | <ROWSPAN=2> Measurement | <ROWSPAN=2> Items | <COLSPAN=4> Moment in time | \n | 3-monthly diabetes consultations during follow-up | T0 | T-4 | T-12 | \n | --- | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=2> Primary outcome | | | | | | \n | Daily functioning | DFT | 1 | | *" }, { "role": "assistant", "content": "| * | * | \n | <COLSPAN=2> Secondary outcomes | | | | | | \n | Diabetes-related emotional distress | PAID | 20 | | * | * | * | \n | <ROWSPAN=2> Mental health problems | PSYCHLOPS | 9 | *2 | *1 | * | * | \n | 4DSQ | 50 | | | * | * | \n | Quality of life | SF-12 | 12 | | * | * | * | \n | Participation and autonomy | IPA | 32 + 9 | | * | * | * | \n | Job performance | SF-HLQ | 5 | | * | * | * | \n | Self-management knowledge and behaviour | PIH-NL | 12 | | * | * | * | \n | General self-efficacy | GSES-12 | 12 | | * | * | * | \n | Control over the disease | Average blood glucose level (HbA1c) | 1 | * | | | | \n | Health care use | | 5 | | * | * | * | \n | <COLSPAN=2> Covariates | | | | | | \n | <ROWSPAN=6> Patient demographics | Sex | 1 | | * | | | \n | Age | 1 | | * | | | \n | Year of diagnosis | 1 | | * | | | \n | Treatment of diabetes | 1 | | * | | | \n | Marital status | 1 | | * | | | \n | Education | 1 | | * | | | \n | <ROWSPAN=3> Practice nurse demographics | Age | 1 | | * | | | \n | Training | 1 | | * | | | \n | Type of general practice(s) (one GP, two GPs, group, health centre) | 1 | | * | | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC6021853_011_01.png" ]
[ { "role": "user", "content": "<|image|>Convert the illustration into Markdown language." }, { "role": "assistant", "content": "<md> | | Torso | LU arm | LW arm | L Hand | RU arm | RW arm | R hand | Average | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | Hernández-Vela et al. [4] | 98.44 | 78.93 | 84.38 | 88.32 | 82.57 | 88.85 | 93.86 | 87.91 | \n | Liang et al. [10] | 94.10 | 93.57 | 90.43 | 87.31 | 93.13 | 87.84 | 85.79 | 90.31 | \n | RW | 92.29 | 85.06 | 95.71 | 96.69 | 85.65 | 95.46 | 95.75 | 92.37 | \n | Our method, no line | 96.13 | 87.46 | 95.66 | 96.02 | 88.59 | 95.45 | 95.53 | 93.55 | \n | Our method, with line | 98.65 | 87.67 | 92.84 | 95.92 | 91.40 | 91.47 | 95.48 | 93.35 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4292811_005_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the diagram to Markdown syntax." }, { "role": "assistant", "content": "<md> | Subject | Chedoke | Sex | Age | Months Post Stroke | Affected Arm | \n | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=6> Keypad | \n | E1 | 6 | F | 53 | 36.2 | R | \n | E2 | 5 | M | 57 | 96.3 | R | \n | E3 | 5 | F | 51 | 6.6 | L | \n | E4 | 5 | M | 46 | 61.2 | L | \n | E5 | 5 | M | 56 | 12.6 | R | \n | E6 | 5 | M | 49 | 39.4 | L | \n | E7 | 5 | F | 69 | 74 | R | \n | Mean (SD) | 5.1 (0.4) | 57.1% Male | 54 (7) | 46.6 (32.5) | 42.9% left affected | \n | <COLSPAN=6> OT | \n | C1 | 5 | F | 58 | 89 | R | \n | C2 | 5 | M | 58 | 10.2 | L | \n | C3 | 5 | M | 70 | 14.2 | L | \n | C4 | 5 | F | 53 | 136.4 | L | \n | C5 | 5 | M | 56 | 15.4 | R | \n | C6 | 5 | M | 66 | 35.3 | L | \n | C7 | 5 | M | 55 | 35 | L | \n | Mean (SD) | 5.0 (0) | 71.4% Male | 59 (6) | 47.9 (47.4) | 71.4% left affected | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4351849_005_00.png" ]
[ { "role": "user", "content": "<|image|>Express the illustration as Markdown code." }, { "role": "assistant", "content": "<md> | | <COLSPAN=5> Month(s) | \n | --- | --- | --- | --- | --- | --- | \n | | 0 | 3 | 6 | 9 | 12 | \n | Primary outcome | | | | | | \n | Average overall knee pain severity over the previous week (0 to 10 NRS) | ✓ | ✓ | ✓ | ✓ | ✓ | \n | Secondary outcomes | | | | | | \n | Imaging assessments: | | | | | | \n | MRI of signal knee | ✓ | | ✓ | | | \n | Clinical assessments: | | | | | | \n | Knee examination | ✓ | | | | | \n | Self-reported questionnaires: | | | | | | \n | WOMAC 3.1 (pain, stiffness and function) - five-point Likert scale | ✓ | ✓ | ✓ | ✓ | ✓ | \n | ICOAP | ✓ | ✓ | ✓ | ✓ | ✓ | \n | 11-point NRS for: | ✓ | ✓ | ✓ | ✓ | ✓ | \n | Worst knee pain severity,/ global disease activity and pain in other joints over the past week | | | | | | \n | Satisfaction with knee function over the past 2 days | | | | | | \n | Knee pain, aching or stiffness over the past month (no days to all days) | | | | | | \n | Globala improvement in knee problem, pain and function | | ✓ | ✓ | ✓ | ✓ | \n | Pain elsewhere (pain manikin) | ✓ | ✓ | ✓ | ✓ | ✓ | \n | Duration of knee pain over the past 12 months (<7 days, 1 to 4 weeks, >1 month, <3 months or >3 months) | ✓ | | | | | \n | Onset of knee pain (last 12 months, 1 to 5 years, 5 to 10 years or 10 years or more) | ✓ | | | | | \n | Quality of life: SF-12 v2 and OAQoL [40] | ✓ | | ✓ | | ✓ | \n | EuroQol EQ-5D [41,42] | ✓ | | ✓ | | ✓ | \n | Depression and anxiety: HADS | ✓ | | ✓ | | ✓ | \n | Resource use: | ✓ | | ✓ | | ✓ | \n | Demographics and medical history | ✓ | | | | | \n | Brief medication questionnaire | | ✓ | ✓ | ✓ | ✓ | \n | Concomitant medicationb | ✓ | ✓ | ✓ | ✓ | ✓ | \n | Adverse eventsb | | ✓ | ✓ | ✓ | ✓ | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4419449_002_00.png" ]
[ { "role": "user", "content": "<|image|>Interpret the illustration as Markdown format." }, { "role": "assistant", "content": "<md> | Clinical trial | Patient population | Restrictive strategy (Hb trigger – target) (g/dl) | Liberal strategy (Hb trigger – target) (g/dl) | Reduction in blood utilization | <COLSPAN=4> Primary outcome | \n | | | | | | Event | Restrictive strategy incidence (%) | Liberal strategy incidence (%) | Pvalue | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | Hébert and colleagues [3] (n = 838) | Critically ill (adults) | 7 to 8.5 | 10 to 10.7 | 54% less RBC units transfused | 30-day mortality | 18.7 | 23.3% | 0.11 | \n | Hajjar and colleagues [5] (n = 502) | Cardiac surgery (adults) | 8 to 9.1 | 10 to 10.5 | 58% less RBC units transfused | Composite endpoint | 11 | 105 | 0.85 | \n | | | | | | • 30-day mortality | 6 | 6 | 0.93 | \n | | | | | | • Cardiogenic shock | 9 | 1 | 0.42 | \n | | | | | | • ARDS | 2 | 5 | 0.99 | \n | | | | | | • Acute renal injury requiring dialysis | 4 | | 0.99 | \n | Carson and colleagues [7] (n = 2,016) | Femur fracture (older adults) | 8.0 to 9.5 | 10.0 to 11.0 | 65% less RBC units transfused | Composite endpoint | 34.7 | 35.2 | NS | \n | | | | | | • 60-day mortality | 28.1 | 27.6 | NS | \n | | | | | | • 60-day inability to walk | 6.6 | 7.6 | NS | \n | Villanueva and colleagues [9] (n = 921) | Gastrointestinal bleeding (adults) | 7 to 9.2 | 9 to 10.1 | 59% less RBC units transfused | 45-day all-cause mortality | 5 | 9 | 0.02 | \n | Holst and colleagues (n = 998) [8] | Sepsis in the ICU (adults) | <7.0 | 7.0 to 9.0 | 50% less RBC units transfused | 90-day all-cause mortality | 43 | 45 | 0.44 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2989864_001_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the image into Markdown format." }, { "role": "assistant", "content": "<md> | High Risk BCC | \n | --- | \n | Aggressive histological subtype; morphoeic, micronodular | \n | Large size >2 cm | \n | Perineural, perivascular invasion | \n | Central facial site; periocular, nasal, perioral | \n | Recurrent BCC | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3855753_003_00.png" ]
[ { "role": "user", "content": "<|image|>Transcribe the image into Markdown format." }, { "role": "assistant", "content": "<md> | Species | LONG | MTR | ST | FT | ED | MD | VP | MVP | HA | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | Pinus koraiensis | 300 | 40 | 4 | 4 | 50 | 100 | 0 | 0 | 120 | \n | Picea koraiensis | 300 | 30 | 4 | 4 | 50 | 150 | 0 | 0 | 120 | \n | Tilia amurensis | 300 | 30 | 4 | 2 | 100 | 100 | 0.1 | 60 | 80 | \n | Acer mono | 200 | 30 | 4 | 3 | 100 | 200 | 0.3 | 60 | 80 | \n | Populus davidiana | 150 | 30 | 2 | 1 | -1 | -1 | 1 | 0 | 40 | \n | Betula platyphylla | 150 | 20 | 1 | 1 | 20 | 4000 | 0.8 | 50 | 60 | \n | Ulmus pumila | 250 | 30 | 3 | 3 | 300 | 1000 | 0.7 | 60 | 60 | \n | Juglans mandshurica | 250 | 30 | 2 | 4 | 50 | 100 | 0.9 | 60 | 80 | \n | Fraxinus mandshurica | 300 | 30 | 4 | 2 | 50 | 150 | 0.1 | 80 | 80 | \n | Quercus mongolica | 300 | 30 | 4 | 3 | 40 | 100 | 0.5 | 60 | 80 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5854949_003_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the picture with markdown style: <md> | | <COLSPAN=3> EEG abnormality scores | \n | Score | 0 | 1 | <COLSPAN=2> 2 | \n | --- | --- | --- | --- | \n | Delta | Absent" }, { "role": "assistant", "content": "| Present | | \n | Theta | Absent | Present | Higher, sharp or saw-tooth | \n | IED | Absent | Brief Spikes | Spike and wave | \n | | | EEG laterality score | \n | Left = 1 | Left > Right = 2 | Left ≈ Right = 3 | Left < Right = 4 | Right = 5 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4491429_003_01.png" ]
[ { "role": "user", "content": "<|image|>Parse the illustration content behind with markdown code: <md> | Question | \n | --- | \n | The formative OSCE helped me to prepare for the summative OSCE | \n |" }, { "role": "assistant", "content": "I felt confident going into the summative OSCE | \n | I was less anxious going into the summative OSCE because of my experience of the formative OSCE | \n | I think I have done better in the summative OSCE compared to the formative OSCE | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4326187_007_00.png" ]
[ { "role": "user", "content": "<|image|>Express the illustration as Markdown code." }, { "role": "assistant", "content": "<md> | Gene model | Absolute expression value in primary root at V1 | \n | --- | --- | \n | GRMZM2G153722 | 7456.31 | \n | GRMZM2G053511 | 66.76 | \n | GRMZM2G002879 | 1216.56 | \n | GRMZM2G154864 | 4826.04 | \n | GRMZM2G070837 | 53.19 | \n | GRMZM2G095969 | 70.27 | \n | GRMZM2G322186 | 4784.54 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5946204_006_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the photo content behind with markdown code: <md> | | <COLSPAN=2> BrAC Pre-Drive 2 (%) | <COLSPAN=2> BrAC Post-Drive 2" }, { "role": "assistant", "content": "(%) | \n | | AS | CHO | AS | CHO | \n | --- | --- | --- | --- | --- | \n | Males | 0.036 ± 0.010 | 0.025 ± 0.007 | 0.028 ± 0.008 | 0.022 ± 0.006 | \n | Females | 0.024 ± 0.009 | 0.017 ± 0.008 | 0.018 ± 0.006 | 0.010 ± 0.008 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5915141_006_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the image into Markdown format." }, { "role": "assistant", "content": "<md> | Best model* | Training balanced accuracy | Testing balanced accuracy | Cross-validationconsistency | Sign test (P) | \n | --- | --- | --- | --- | --- | \n | 1 | 0.397 | 0.612 | 6/10 | 8 (0.423) | \n | 1, 2 | 0.525 | 0.605 | 9/10 | 8 (0.342) | \n | 1, 2, 3 | 0.687 | 0.672 | 10/10 | 9 (0.015) | \n | 1, 2, 3, 4 | 0.585 | 0.612 | 7/10 | 7 (0.325) | \n | 1, 2, 3, 4, 5 | 0.575 | 0.512 | 8/10 | 6 (0.642) | \n | 1, 2, 3, 4, 5, 6 | 0.622 | 0.479 | 7/10 | 8 (0.576) | \n | 1, 2, 3, 4, 5, 6, 7 | 0.499 | 0.526 | 8/10 | 5 (0.734) | \n | 1, 2, 3, 4, 5, 6, 7, 8 | 0.613 | 0.611 | 7/10 | 6 (0.412) | \n | 1, 2, 3, 4, 5, 6, 7, 8, 9 | 0.598 | 0.572 | 6/10 | 7 (0.665) | \n | 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 | 0.613 | 0.476 | 8/10 | 5 (0.684) | \n | 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 | 0.504 | 0.644 | 9/10 | 6 (0.337) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4396834_004_00.png" ]
[ { "role": "user", "content": "<|image|>Translate the illustration into Markdown format." }, { "role": "assistant", "content": "<md> | | <COLSPAN=5> Total phenolic content [mg/L] | \n | | o/n | 1 h | 2 h | 4 h | 6 h | \n | --- | --- | --- | --- | --- | --- | \n | Average | 1,559 ± 167 | 1,575 ± 165 | 1,621 ± 139 | 1,676 ± 168 | 1,706 ± 167 | \n | Min | 1.025 | 1.121 | 979 | 1.188 | 1.145 | \n | Max | 1.749 | 1.66 | 1.698 | 1.853 | 1.779 | \n | | <COLSPAN=5> Reversed phase chromatography [mg/L] | \n | | o/n | 1 h | 2 h | 4 h | 6 h | \n | Average | 6 ± 5 | 4 ± 3 | 4 ± 3 | 4 ± 4 | 7 ± 5 | \n | Min | 0 | 0 | 0 | 0 | 0 | \n | Max | 21 | 12 | 12 | 14 | 15 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5816392_006_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the diagram in markdown code: <md> | <COLSPAN=2> | Beliefs in effectiveness | Beliefs in safety production | Perceived norms | Self-efficacy | Limitations of the double-check | \n | --- | --- | --- | --- | --- | --- | --- | \n | <ROWSPAN=2> Primary place of work | On ward | 5.7 [0.8] | 5.3 [0.7] | 5.0 [1.0]** | 5.9 [0.6] | 3.3 [0.9] | \n | Ambulatory infusion unit | 5.8 [0.7] | 5.2 [0.9] | 5.5 [1.1]** | 5.9 [0.7] | 3.1 [1.2] | \n | <ROWSPAN=2> Years of practice in oncology | ≤ 5 years | 5.7 [0.8] | 5.3 [0.8] | 5.0 [1.0] | 5.8 [0.7] | 3.2 [1.0] | \n | >5 years | 5.7 [0.8] | 5.3 [0.8] | 5.2 [1.0] | 5.9 [0.6] | 3.3 [1.0] | \n | <ROWSPAN=2> Weekly hours in direct patient care | ≤ 40 h | 5.7 [0.8] | 5.3 [0.8] | 5.1 [1.0] | 5.8 [0.6]* | 3.3 [1.0] | \n | >40 h | 5.7 [0.8] | 5.3 [0.8] | 5.1 [1.0] | 6.0 [0.5]* | 3.3 [1.1] | \n | <ROWSPAN=2> Qualification |" }, { "role": "assistant", "content": "Nurse | 5.8 [0.7] | 5.3 [0.8] | 5.1 [1.0] | 5.9 [0.6] | 3.4 [1.0] | \n | Nursing expert/head nurse | 5.6 [1.0] | 5.2 [0.8] | 5.1 [1.1] | 5.9 [0.6] | 3.2 [1.0] | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5344660_002_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the picture with markdown style: <md> | <ROWSPAN=2> Variable | <COLSPAN=3> Univariate analysis | | <COLSPAN=3> Multivariate analysis | \n | OR | p | 95%CI | | OR | p | 95%CI | \n | --- | --- | --- | --- | --- |" }, { "role": "assistant", "content": "--- | --- | --- | \n | Triglycerides (TG) | (TG) | 0.006 | 1.001-1.008 | | 1.004 | 0.018 | 1.001-1.008 | \n | Mean platelet volume (MPV) | 1.271 | 0.003 | 1.084-1.490 | | 1.215 | 0.021 | 1.030-1.434 | \n | Neutrophil count | 1.159 | 0.007 | 1.040-1.292 | | | | | \n | White cell (WBC) count | 1.142 | 0.022 | 1.020-1.278 | | 1.142 | 0.020 | 1.021-1.278 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5975502_006_00.png" ]
[ { "role": "user", "content": "<|image|>Transform the photo into Markdown format." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> Psychiatric Comorbidities | <COLSPAN=2> Diagnostic codes (N = 196) | <COLSPAN=2> NLP (N = 486) | <COLSPAN=2> Reference group (N = 17,183) | \n | n | % | n | % | n | % | \n | --- | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=7> Psychiatric Comorbidities | \n | Depression | 171 | 87.24 | 353 | 72.63 | 5150 | 29.97 | \n | Schizophrenia | 10 | 5.10 | 10 | 2.06 | 95 | 0.55 | \n | Bipolar | 45 | 22.96 | 40 | 8.23 | 489 | 2.85 | \n | PTSD | 58 | 29.59 | 76 | 15.64 | 590 | 3.43 | \n | Substance abuse | 102 | 52.04 | 173 | 35.60 | 2332 | 13.57 | \n | Anxiety | 100 | 51.02 | 259 | 53.29 | 5184 | 30.17 | \n | <COLSPAN=7> Psychiatric comorbidities at encounters to Department Psychiatry/Mental Health/Behavioral Health (ever) | \n | Depression | 93 | 47.45 | 180 | 37.04 | 1536 | 8.94 | \n | Schizophrenia | 7 | 3.57 | 4 | 0.82 | 43 | 0.25 | \n | Bipolar | 18 | 9.18 | 26 | 5.35 | 234 | 1.36 | \n | PTSD | 29 | 14.80 | 44 | 9.05 | 312 | 1.82 | \n | Substance abuse | 43 | 21.94 | 36 | 7.41 | 177 | 1.03 | \n | Anxiety | 30 | 15.31 | 113 | 23.25 | 1058 | 6.16 | \n | <COLSPAN=7> Psychiatric comorbidities at encounters to Emergency Department (Ever) | \n | Depression | 128 | 65.31 | 80 | 16.46 | 608 | 3.54 | \n | Schizophrenia | 6 | 3.06 | 2 | 0.41 | 22 | 0.13 | \n | Bipolar | 25 | 12.76 | 8 | 1.65 | 76 | 0.44 | \n | PTSD | 28 | 14.29 | 9 | 1.85 | 54 | 0.31 | \n | Substance abuse | 74 | 37.76 | 57 | 11.73 | 652 | 3.79 | \n | Anxiety | 51 | 26.02 | 42 | 8.64 | 660 | 3.84 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4507316_003_01.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the table in markdown code: <md> | | <COLSPAN=2> Body image perception, n (%) | <ROWSPAN=2> Adjusteda OR (95 % CI) | <ROWSPAN=2> P-value | \n | | Correct | Underestimated | \n | --- | --- | --- | --- | --- | \n | Exercise | | | | | \n | Daily | 343 (60.0) | 63 (65.6) | 1.28 (0.76–2.16) | 0.346 | \n | Sometimes | 68 (11.9) | 10 (10.4) | 1.05 (0.47–2.35) | 0.903 | \n | Never | 161 (28.1) | 23 (24.0) | 1.00 | | \n | Snacking after dinner | | | | | \n | Yes | 276 (47.8) | 56 (57.1) | 1.44 (0.93–2.23) | 0.100 | \n | No | 302 (52.2) | 42 (42.9) | 1.00 | | \n | Skipping breakfast | | | | | \n | No | 548 (93.4) | 91 (91.9) | 1.00 | | \n | Yes | 39 (6.6) | 8 (8.1) | 1.33 (0.60–2.98) | 0.485 | \n | Wakeup time | | | | | \n | Before 6:30 | 318 (55.8) | 45 (46.4) | 1.00 | | \n | 6:30–6:59 | 90 (15.8) | 17 (17.5) | 1.36 (0.74–2.51) | 0.329 | \n | After 7:00 | 162 (28.4) | 35 (36.1) | 1.62 (1.00–2.64) |" }, { "role": "assistant", "content": "0.052 | \n | Bedtime | | | | | \n | Before 22:00 | 36 (6.7) | 9 (9.5) | 1.00 | | \n | 22:00–22:59 | 262 (48.4) | 46 (48.4) | 0.73 (0.33–1.63) | 0.445 | \n | After 23:00 | 243 (44.9) | 40 (42.1) | 0.72 (0.32–1.63) | 0.435 | \n | Hours of sleep | | | | | \n | < 8 | 176 (32.8) | 22 (23.4) | 1.00 | | \n | 8–9 | 288 (53.7) | 54 (57.4) | 1.44 (0.85–2.46) | 0.179 | \n | 9+ | 72 (13.4) | 18 (19.1) | 1.85 (0.93–3.67) | 0.081 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3113947_009_01.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the table with markdown style: <md> | | <COLSPAN=4> CONTROL | <COLSPAN=4> STROKE | \n | | <COLSPAN=2> Thumb | <COLSPAN=2> Long Fingers | <COLSPAN=2> Thumb | <COLSPAN=2> Long Fingers | \n | | MCPJ | IPJ | MCPJ | IPJ | MCPJ | IPJ | MCPJ | IPJ | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | ROM [deg] | 61.1(23.8) | 64.0(24.4) | 90.3(12.7) | 109.1(12.5) | 25.8***(18.4) | 40.5**(20.0) | 50.4***(20.4) | 64.5***(27.7) | \n | | | | <COLSPAN=2> §§§ | <COLSPAN=2> §§ | <COLSPAN=2> § | \n | Max. ext. angle [deg] | 143.0(14.6) | 188.8(16.8) | 186.7(8.1) | 189.5(8.7) | 116.6***(22.6) | 180.4(18.2) | 166.7***(17.0) | 159.5***(26.8) | \n | | <COLSPAN=2> §§§ | | | <COLSPAN=2> §§§ | | | \n | Max. Flex. Angle [deg] | 81.7(16.4) | 125.2(20.5) | 96.6(11.2) | 80.4(7.7) | 90.7(17.5) | 139.6*(18.8) | 116.3***(13.1) | 95.0***(12.8) | \n | | <COLSPAN=2> §§§ | <COLSPAN=2> §§§ |" }, { "role": "assistant", "content": "<COLSPAN=2> §§§ | <COLSPAN=2> §§ | \n | Vpk - Hand Opening [deg/s] | 191.5(98.8) | 272.8(146.5) | 354.2(181.1) | 490.4(228.4) | 22.7***(23.6) | 16.5***(23.5) | 34.6***(20.8) | 40.7***(30.9) | \n | | <COLSPAN=2> §§ | <COLSPAN=2> §§§ | | | | | \n | Vpk - Hand Closing [deg/s] | 184.1(109.4) | 189.3(103.4) | 279.2(146.7) | 437.7(172.5) | 50.4***(48.9) | 41.5***(35.4) | 51.7***(31.8) | 83.5***(55.1) | \n | | | | <COLSPAN=2> §§§ | | | <COLSPAN=2> §§ | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC6091154_002_01.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the diagram with markdown style: <md> | Variable | Subject with fallsn = 178 | Subject without fallsn = 850 | Crude OR(95%CI) | Adjusted OR(95%CI) | \n | --- | --- | --- | --- | --- | \n | <COLSPAN=5> Gender n(%) | \n | Men | 82 (14.3) | 491 (85.7) | 1 | 1.15(0.74–1.79) | \n | Women | 96 (21.1) | 359 (78.9) | 1.6(1.16–2.22) | 1 | \n | <COLSPAN=5> aBMI(kg/m2) | \n | > 30 | 62 (18.7) | 270 (81.3) | 1 | 1 | \n | 25–30 | 74 (17.2) | 357 (82.8) | 1.11(076–1.6) | 1.09(0.68–1.7)" }, { "role": "assistant", "content": "| \n | < 30 | 42 (15.8) | 223 (82.4) | 0.82(053–1.26) | 1.1(0.71–0.69) | \n | <COLSPAN=5> bOsteoporosis n(%) | \n | Absent | 95 (14.2) | 574 (85.8) | 1 | 1 | \n | Present | 83 (23.1) | 276 (76.9) | 1.88(1.34–3.52) | 1.38(0.78–1.9) | \n | <COLSPAN=5> cQMS (kg) | \n | > 30 | 23 (9.3) | 225 (90.7) | 1 | 1 | \n | 15–30 | 97 (18.2) | 430 (81.8) | 2.18(1.34–3.52) | 1.72(1.01–2.9) | \n | < 15 | 58 (23.5) | 189 (76.5) | 3.01(1.78–5) | 2.02(1.06–3.85) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4929097_009_01.png" ]
[ { "role": "user", "content": "<|image|>Interpret the figure as Markdown format." }, { "role": "assistant", "content": "<md> | <ROWSPAN=3> Predicted malarial status | <COLSPAN=8> True clinical diagnosis of malaria | \n | <COLSPAN=2> 5–9 Years | <COLSPAN=2> 10–17 Years | <COLSPAN=2> 18 Years and above | <COLSPAN=2> Total | \n | Positive | Negative | Positive | Negative | Positive | Negative | Positive | Negative | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | <COLSPAN=9> (a) Predictive dataset: Kalisizo Hospital | \n | Positive | 6 | 4 | 10 | 3 | 65 | 8 | 81 | 15 | \n | Negative | 5 | 4 | 4 | 3 | 25 | 14 | 34 | 21 | \n | Total | 11 | 8 | 14 | 6 | 90 | 22 | 115 | 36 | \n | <COLSPAN=9> (b) Training dataset: Kisubi Hospital | \n | Positive | 56 | 22 | 20 | 19 | 11 | 15 | 90 | 16 | \n | Negative | 5 | 270 | 5 | 105 | 4 | 290 | 11 | 705 | \n | Total | 61 | 292 | 25 | 124 | 15 | 305 | 101 | 721 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2359745_007_00.png" ]
[ { "role": "user", "content": "<|image|>What are the following photo content in markdown style: <md> | | White Mean (SD) N | Non-White Mean (SD) N | Significance | Effect size | \n | --- | --- | --- | --- | --- | \n | Total number of points achieved at A level | 17.71 (9.17) N = 2376 | 16.42 (9.15) N = 355 | t = 2.474 p = .013 | -.141 | \n | | White N (%) | Non-White N(%) | | Odds Ratio (95% CI) | \n | Taking one or more A-levels (excluding General Studies) | 4666/11273 = 41.4% | 738/1777 = 41.5% | χ2 = .012 (1) p = .911 | OR = 1.01 (.91–1.11) d = .005 | \n" }, { "role": "assistant", "content": "| Taking one or more science A-levels | 2701/11273 = 24.0% | 515/1777 = 29.0% | χ2 = 20.84 (1) p < .001 | 1.30 (1.16–1.45) d = .145 | \n | Taking A-level Chemistry | 744/11273 = 6.6% | 202/1776 = 11.4% | χ2 = 51.98 (1) p < .001 | 1.82 (1.54–2.14) d = .331 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4692095_004_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the figure content behind with markdown code: <md> | | <COLSPAN=2> High glucoraphanin broccoli | <COLSPAN=2> Standard broccoli | \n | | Male (n = “28) | Female (n = 19) | Male (n = 27) | Female (n = 21) | \n | --- | --- | --- | --- | --- | \n | Age (y) | 60.2" }, { "role": "assistant", "content": "± 6.38a) | 63.0 ± 5.72 | 59.8 ± 5.49 | 63.5 ± 7.09 | \n | BMI (kg/m2) | 26.7 ± 3.43 | 26.0 ± 4.70 | 27.5 ± 3.67 | 26.3 ± 4.20 | \n | Systolic BP (mmHg) | 128.1 ± 14.80 | 128.4 ± 12.9 | 126.3 ± 11.24 | 134.1 ± 10.84 | \n | Diastolic BP (mmHg) | 83.1 ± 9.87 | 76.9 ± 10.20 | 81.6 ± 7.51 | 78.9 ± 6.10 | \n | Weight (kg) | 83.4 ± 13.06 | 68.9 ± 10.14 | 86.5 ± 12.35 | 68.0± 12.25 | \n | Waist circumference (cm) | 98.7 ± 11.20 | 87.6 ± 11.73 | 100.5 ± 8.66 | 87.2 ± 11.50 | \n | Hip circumference (cm) | 105.5 ± 6.25 | 107.0± 8.66 | 106.8 ± 6.95 | 105.3 ± 10.17 | \n | Total cholesterol (mmol/L) | 5.9 ± 0.86 | 6.7 ± 0.71 | 5.8 ± 0.96 | 6.7 ± 0.90 | \n | LDL cholesterol (mmol/L) | 4.2 ± 0.71 | 4.6 ± 0.77 | 4.1 ± 0.79 | 4.7 ± 0.80 | \n | HDL cholesterol (mmol/L) | 1.4 ± 0.28 | 1.8 ± 0.32 | 1.4 ± 0.31 | 1.7 ± 0.29 | \n | Triglycerides (mmol/L) | 1.6 ± 0.69 | 1.1 ± 0.32 | 1.5±0.57 | 1.2 ± 0.30 | \n | Glucose (mmol/L) | 5.7 ± 0.47 | 5.7 ± 0.46 | 5.7 ± 0.43 | 5.7 ± 0.48 | \n | JBS2 CVD risk score (%) | 17.5 ± 5.85 | 14.4 ± 4.89 | 17.1 ± 5.54 | 12.5 ± 2.52 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5886474_001_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the image content behind with markdown code: <md> | IRD patient numbers | Patient origin (predominant) | NGS technology | Pathogenic/likely pathogenic mutations (%) | Reference | \n | --- | --- | --- | --- | --- | \n | 100 | Dutch | Target capture 111 genes | ∼ 50% | Neveling et al. 2012 (10) | \n | 20 | France | Target capture 254 genes | 57% | Audo et al. 2012 (11) | \n | 50 | UK | Target capture 105 genes | 50-50% | O’Sullivan et al. 2012 (12) | \n | 50 | UK | Target capture 73 genes | 53% (early onset IRD;25% overall) | Shanks et al. 2013 (13)" }, { "role": "assistant", "content": "| \n | 192 | US | Target capture (GEDi) 214 genes | 51% | Consugar et al. 2015 (14) | \n | 105 | eyeGENE® database | Target capture 195 genes | 49.5% | Ge et al. 2015 (15) | \n | 82 | N Ireland | Target capture 186 genes | 60% | Zhao et al. 2015 (16) | \n | 88 | Italy | Target capture 72 genes | 59.1% | Bernardis et al. 2016 (17) | \n | 309 | Ireland | Target capture 216 genes | 57% | Carrigan et al. 2016 (18) | \n | 537 | Worldwide | Target capture 105 genes | 51% | Ellingford et al. 2016 (19) | \n | 47 | Spain | Target capture 75 genes | 57.4% | Perez-Carro et al. 2016 (20) | \n | 88 | European | Target capture & WES | 61% | Weisschuh et al. 2016 (21) | \n | 58 | Swiss | WES | 64% | Tiwari et al. 2016 (22) | \n | 33 | Mixed | WES | 55% | de Castro-Miró et al. 2016 (23) | \n | 59 | Spain | WES | 71.8% | Riera et al. 2017 (24) | \n | 266 | Dutch | Target panel & WES | 52% | Haer-Wigman et al. 2017 (25) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC1660568_006_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the illustration into Markdown language." }, { "role": "assistant", "content": "<md> | Model | p | l | Parameters estimates | Positively selected sites | \n | --- | --- | --- | --- | --- | \n | M0: one-ratio | 1 | -5974.07 | ω = 0.0621 | None | \n | <underline>Branch-site model</underline>: | | | | | \n | Model A | 3 | -5925.68 | p0 = 0.503, p1 = 0.102(p2 + p3) = 0.393ω2 = 14.201 | Sites for foreground lineage: 17M 19T 22Q 29C 51W 63T 70G 71D 74L 75Q 76L 103G 126A 163S 209G 226V 248T 257A (at P > 0.95) | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5301428_003_00.png" ]
[ { "role": "user", "content": "<|image|>Express the illustration as Markdown code." }, { "role": "assistant", "content": "<md> | <ROWSPAN=2> | <COLSPAN=2> Quadriceps | <COLSPAN=2> Hamstrings | <COLSPAN=2> Adductor | <COLSPAN=2> Whole thigh | \n | Young | Old | Young | Old | Young | Old | Young | Old | \n | --- | --- | --- | --- | --- | --- | --- | --- | --- | \n | IMF | 64.4 (32.1) | 66.5 (15.0) | 41.1 (24.4) | 51.7 (13.4) | 55.8 (39.2) | 46.7 (16.3) | 161.3 (93.1) | 164.9 (39.4) | \n | Skeletal muscle | 1304.2 (373.2) | 824.3 (247.2)* | 438.5 (132.3) | 316.7 (80.5)* | 655.2 (226.4) | 475.8 (161.1)* | 2397.9 (712.1) | 1616.8 (469.0)* | \n | Normalized IMF | 1.0 (0.4) | 1.2 (0.2) | 0.6 (0.3) | 0.9 (0.2)* | 0.9 (0.5) | 0.8 (0.3) | 2.5 (1.1) | 2.9 (0.6) | \n | Normalized skeletal muscle | 20.7 (3.8) | 14.4 (2.8)* | 7.0 (1.5) | 5.6 (1.1)* | 10.4 (2.7) | 8.2 (1.9)* | 38.1 (7.6) | 28.2 (5.2)* | \n | Volume-based IMF content | 4.8 (2.2) | 7.8 (2.4)* | 8.6 (4.7) | 14.4 (3.7)* | 8.3 (5.4) | 9.5 (3.7) | 6.5 (3.3) | 9.7 (2.9)* | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4483518_002_00.png" ]
[ { "role": "user", "content": "<|image|>Transcribe the illustration into Markdown format." }, { "role": "assistant", "content": "<md> | Study | Mutation(s) | Aβ42 | Tau | pTau | Comments | \n | --- | --- | --- | --- | --- | --- | \n | Moonis et al. (69)6 MC6 Unrelated controls | PSEN-1 C410Y, PSEN-1 P242H, and R352H | ↓ | N.S. | Not tested | MC EYO −8 ± 3 | \n | Ringman et al. (74)20 MC9 NC | PSEN-1 A431E, PSEN-1 L235V, PSEN-1 G206A, APP V717I | ↓ (trend) | ↑ | ↑ | MC EYO ~−12NC EYO −9 ± 12 | \n | Fortea et al. (70)8 MC5 NC | PSEN-1 L286P, PSEN-1 M139T | ↓ (trend) | N.S. | N.S. | MC EYO −6 ± 10NC EYO −7 ± 9 | \n | Scholl et al. (71)4 MC7 Unrelated controls | APP KM670/671 NL, APP E693G, PSEN-1 H163Y | ↓ | ↑ | ↑ | | \n | Reiman et al. (72)10 MC10 NC | PSEN-1 E280A (API) | ↑ | N.S. | N.S. | MC EYO ~−25NC EYO ~−26 | \n | Ringman et al. (75)13 MC5 NC | PSEN-1 A431E, PSEN-1 L235V, PSEN-1 S212Y, APP V717I | ↓ | ↑ | ↑ | MC EYO −12 ± 10NC EYO −6 ± 14 | \n | Bateman et al. (11)88 MC40 NC | Many (DIAN) | ↓ at EYO −10 and closer to EAO | ↑ at EYO −15 and closer to EAO | Not shown | | \n | Thordardottir et al. (76)10 MC12 NC | APP KM670/671 NL, APP E693G, PSEN-1 H163Y, PSEN-1 I143T | ↓ | ↑ | ↑ | MC EYO −7 ± 9NC EYO −7 ± 12 | \n | Fleisher et al. (12)32 MC22 NC | PSEN-1 E280A (API) | ↓ at EYO −25 and closer to EAO | ↑ at EYO −20 and closer to EAO | ↑ at EYO −18 and closer to EAO | | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4029907_008_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the photo in markdown code: <md> | <ROWSPAN=2> Cross | <ROWSPAN=2> Chr. | <ROWSPAN=2> LOD | <ROWSPAN=2> PVE | <ROWSPAN=2> Peak marker | <COLSPAN=3> Phenotype mean +/- standard error | \n | MM | MF | FF | \n | --- | --- | --- | --- | --- | --- | --- | --- | \n | PAXB | 4 | 8.9 | 12.5 | Chr4_152 | 11.54 +/-" }, { "role": "assistant", "content": "0.08 | 11.2 +/- 0.05 | 10.97 +/- 0.06 | \n | FTC | 4 | 20.7 | 20.7 | Chr4_152 | 11.21 +/- 0.07 | 10.83 +/- 0.04 | 10.4 +/- 0.06 | \n | BEPA | 4 | 11.2 | 9.5 | Chr4_131 | 11.58 +/- 0.07 | 11.26 +/- 0.04 | 11.08 +/- 0.06 | \n | PAXB | 20 | 7.9 | 11.5 | Stn216 | 11.54 +/- 0.07 | 11.25 +/- 0.05 | 10.99 +/- 0.07 | \n | FTC | 20 | 10.2 | 9.7 | Stn212 | 11.04 +/- 0.06 | 10.85 +/- 0.04 | 10.54 +/- 0.06 | \n | BEPA | 20 | 24.8 | 22.4 | Stn216 | 11.65 +/- 0.06 | 11.31 +/- 0.04 | 10.8 +/- 0.05 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC2891694_003_00.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the table with markdown style: <md> | | <COLSPAN=3> Males (n = 403) | <COLSPAN=3> Females (n = 225) | <COLSPAN=2> Both genders (n = 628) | \n | | SDICH(n = 177) | Controls(n = 226) | P-Value | SDICH(n = 83) | Controls(n = 142) | P-Value | SDICH(n = 260) | P-Value | \n | ---" }, { "role": "assistant", "content": "| --- | --- | --- | --- | --- | --- | --- | --- | \n | Age (years) | 58.3 ± 1.0 | 58.7 ± 0.9 | 0.82 | 65.1 ± 1.3 | 62.6 ± 0.9 | 0.05 | | 0.61 | \n | Hypertension (%) | 91.5 | 32.3 | <0.0001 | 95.2 | 38.7 | <0.0001 | | <0.0001 | \n | Diabetes mellitus (%) | 12.4 | 15.9 | 0.35 | 30.1 | 13.4 | 0.004 | | 0.32 | \n | Alcohol use (%) | 46.9 | 19.5 | <0.0001 | 4.8 | 0 | 0.018 | | <0.0001 | \n | Body mass index (kg/m2) | 25.2 ± 0.3 | 25.8 ± 0.3 | 0.13 | 24.4 ± 0.4 | 25.1 ± 0.4 | 0.31 | | 0.08 | \n | Total cholesterol (mg/dL) | 176.9 ± 2.7 | 191.7 ± 3.0 | 0.0003 | 188.3 ± 4.1 | 204.6 ± 3.7 | 0.003 | | <0.0001 | \n | Triglyceride (mg/dL) | 137.9 ± 6.1 | 143.7 ± 6.9 | 0.90 | 143.8 ± 8.3 | 147.3 ± 8.0 | 0.80 | | 0.77 | \n | SDICH at supratentorium | 149 (84.2%) | | | 80 (96.4%) | | | 229 (88.1%) | 0.005a | \n | Hemorrhage size (cm3)b | 18.0 ± 1.6 | | | 13.1 ±1.6 | | | 16.3 ±1.2 | 0.03a | \n | modified Rankin scale > 3 | 49.1% | | | 52.5% | | | 50.2% | 0.62a | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3476998_005_01.png" ]
[ { "role": "user", "content": "<|image|>Continue parse the image with markdown style: <md> | INH Induced method | Control (Mean ± SEM) (Min) | Standard (Mean ± SEM) (Min) | Test (Mean ± SEM) (Min) | Significance | \n | --- | --- | --- | --- | --- | \n | Time" }, { "role": "assistant", "content": "for onset of convulsions | 28 ± 1.195 | 58.17 ± 6.676 | 135.0 ± 25.10 | (P<0.05) significant | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3651306_004_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the figure into Markdown language." }, { "role": "assistant", "content": "<md> | | <COLSPAN=2> N (%)* | <COLSPAN=2> Crude results (n = 61,129) | <COLSPAN=2> Adjusted results** (n = 47,817) | \n | LAN exposure | Cases | Referents | Odds ratios | 95% CI | Odds ratios | 95% CI | \n | --- | --- | --- | --- | --- | --- | --- | \n | Low | 27,121 (63) | 10,970 (60) | <COLSPAN=2> Ref. | <COLSPAN=2> Ref. | \n | Medium | 5,974 (14) | 2,623 (14) | 1.13 | (1.07-1.19) | 1.06 | (0.97-1.16) | \n | High | 9,659 (23) | 4,782 (26) | 1.22 | (1.18-1.28) | 1.12 | (1.04-1.20)† | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC3167762_005_00.png" ]
[ { "role": "user", "content": "<|image|>Convert the diagram to Markdown syntax." }, { "role": "assistant", "content": "<md> | <COLSPAN=5> pg/mL | μM | \n | | IL-4 | IL-10 | IL-12 | IFN-γ | NO | \n | --- | --- | --- | --- | --- | --- | \n | Con A | 226.84 ± 9.53 | 338.10 ± 11.49 | 26.85 ± 11.94 | 939.48 ± 0.00 | ND | \n | PLA | 33.67 ± 4.82 | 68.57 ± 6,88 | ND | 87.06 ± 12,23 | 1.39 ± 0.96 | \n | P2 | ND | ND | 18.37 ± 11.58 | ND | ND | \n | P3 | ND | ND | 16.44 ± 3.25 | ND | ND | \n | P8 | ND | 27.46 ± 0.74 | ND | ND | ND | \n | P9 | ND | 21.03 ± 0.16 | 8.02 ± 3.85 | ND | ND | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC4915277_003_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the following content of the photo in markdown code: <md> | <ROWSPAN=2> Study | <COLSPAN=3> Gene variant | \n | UCP3‐55C>T | UCP2‐866G>A |" }, { "role": "assistant", "content": "UCP2 D/I | \n | --- | --- | --- | --- | \n | <ROWSPAN=2> HMAR | 128/71/13 | 82/108/22 | 104/92/16 | \n | 0.229 (0.189–0.269) | 0.358 (0.313–0.404) | 0.292 (0.249–0.336) | \n | <ROWSPAN=2> T1DM | 116/78/16 | 84/98/28 | 116/76/18 | \n | 0.262 (0.220–0.304) | 0.367 (0.321–0.413) | 0.267 (0.224–0.309) | \n | P HMAR vs. T1DM | 0.53 | 0.97 | 0.74 | </md>" } ]
mp_sft
PubTabNet
null
[ "./val_imgs/PubTabNet/val/PMC5815051_002_00.png" ]
[ { "role": "user", "content": "<|image|>Parse the figure content behind with markdown code: <md> | Time (min) | Flow rate (mL/min) | \n | --- | --- | \n |" }, { "role": "assistant", "content": "0.00-7.20 | 1.0 | \n | 7.20-8.20 | 1.0-1.5 | \n | 8.21-11.00 | 1.5 | \n | 11.00-12.00 | 1.5-2.0 | \n | 12.01-20.00 | 2.0 | \n | 20.00-21.00 | 2.0-1.0 | </md>" } ]
mp_sft
PubTabNet
null