text stringlengths 105 4.57k | label int64 0 1 | label_text stringclasses 2 values |
|---|---|---|
The silyl-Hilbert-Johnson reaction is the most commonly used method for the synthesis of nucleosides from heterocyclic and sugar-based starting materials. However, the reaction suffers from some issues that are not associated with other methods, such as unpredictable site selectivity in some cases (see below). This section describes both derivatives of and alternatives to the SHJ reaction that are used for the synthesis of nucleosides. | 0 | Theoretical and Fundamental Chemistry |
As algal blooms grow, they deplete the oxygen in the water and block sunlight from reaching fish and plants. Such blooms can last from a few days to many months. With less light, plants beneath the bloom can die and fish can starve. Furthermore, the dense population of a bloom reduces oxygen saturation during the night by respiration. And when the algae eventually die off, the microbes which decompose the dead algae use up even more oxygen, which in turn causes more fish to die or leave the area. When oxygen continues to be depleted by blooms it can lead to hypoxic dead zones, where neither fish nor plants are able to survive. These dead zones in the case of the Chesapeake Bay, where they are a normal occurrence, are also suspected of being a major source of methane.
Scientists have found that HABs were a prominent feature of previous mass extinction events, including the End-Permian Extinction. | 0 | Theoretical and Fundamental Chemistry |
UIT enables life extension of steel bridges. This technique has been employed in numerous US states as well as other nations. The result is a greatly reduced cost of infrastructure. UIT has been certified for this use by AASHTO.
The use of UIT on draglines and other heavy equipment in the mining industry has resulted in increased production and has decreased downtime and maintenance costs.
UIT is employed on drive shafts and crank shafts in a number of industries. Results show that UIT increases shaft life by over a factor of 3.
The US Navy uses UIT to address cracked areas in certain aluminum decks. Without UIT, crack repairs resulted in almost immediate re-cracking. With UIT, repairs have shown to last over eight months without cracks. | 1 | Applied and Interdisciplinary Chemistry |
The first "pure" Bose–Einstein condensate was created by Eric Cornell, Carl Wieman, and co-workers at JILA on 5 June 1995. They cooled a dilute vapor of approximately two thousand rubidium-87 atoms to below 170 nK using a combination of laser cooling (a technique that won its inventors Steven Chu, Claude Cohen-Tannoudji, and William D. Phillips the 1997 Nobel Prize in Physics) and magnetic evaporative cooling. About four months later, an independent effort led by Wolfgang Ketterle at MIT condensed sodium-23. Ketterle's condensate had a hundred times more atoms, allowing important results such as the observation of quantum mechanical interference between two different condensates. Cornell, Wieman and Ketterle won the 2001 Nobel Prize in Physics for their achievements.
A group led by Randall Hulet at Rice University announced a condensate of lithium atoms only one month following the JILA work. Lithium has attractive interactions, causing the condensate to be unstable and collapse for all but a few atoms. Hulet's team subsequently showed the condensate could be stabilized by confinement quantum pressure for up to about 1000 atoms. Various isotopes have since been condensed. | 0 | Theoretical and Fundamental Chemistry |
Azines characteristically undergo hydrolysis to hydrazines. The reaction proceeds by the intermediacy of a hydrazone:
:RC=N-N=CR + HO → RC=N-NH + RC=O
:RC=N-NH + HO → NH + RC=O
Azines have been used as precursors to hydrazones:
:RC=N-N=CR + NH → 2 RC=N-NH
They are also precursors to diazo compounds.
The coordination chemistry of azines (as ligands) has also been studied.
Acetone is used to derivatize hydrazine into acetone azine for analysis by gas chromatography. This method is used to determine trace levels of hydrazine in drinking water and pharmaceuticals. | 0 | Theoretical and Fundamental Chemistry |
Silicon carbide is an important material in TRISO-coated fuel particles, the type of nuclear fuel found in high temperature gas cooled reactors such as the Pebble Bed Reactor. A layer of silicon carbide gives coated fuel particles structural support and is the main diffusion barrier to the release of fission products.
Silicon carbide composite material has been investigated for use as a replacement for Zircaloy cladding in light water reactors. One of the reasons for this investigation is that, Zircaloy experiences hydrogen embrittlement as a consequence of the corrosion reaction with water. This produces a reduction in fracture toughness with increasing volumetric fraction of radial hydrides. This phenomenon increases drastically with increasing temperature to the detriment of the material. Silicon carbide cladding does not experience this same mechanical degradation, but instead retains strength properties with increasing temperature. The composite consists of SiC fibers wrapped around a SiC inner layer and surrounded by an SiC outer layer. Problems have been reported with the ability to join the pieces of the SiC composite. | 1 | Applied and Interdisciplinary Chemistry |
Modern lacUV5 is seen in the BL21(DE3) strain, which carries both a lac operon with the standard promoter and a lacUV5 operon split by the DE3 prophage (and as a result driving the T7 RNA polymerase instead). The two important mutations are underlined.
lacUV5 TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT
LacZ TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATTGTGTGAAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT
position ^-35 ^-10 ^+1 | 1 | Applied and Interdisciplinary Chemistry |
Suppose the original dataset D contains the n spectra in rows. The signals of the original dataset are generally preprocessed. The original spectra are compared to a reference spectrum. By subtracting a reference spectrum, often the average spectrum of the dataset, so called dynamic spectra are calculated which form the corresponding dynamic dataset E. The presence and interpretation may be dependent on the choice of reference spectrum. The equations below are valid for equally spaced measurements of the perturbation. | 0 | Theoretical and Fundamental Chemistry |
Similar to generation of Cancer Stem Cells, EMT was demonstrated to generate endocrine progenitor cells from human pancreatic islets. Initially, the human islet-derived progenitor cells (hIPCs) were proposed to be better precursors since β-cell progeny in these hIPCs inherit epigenetic marks that define an active insulin promoter region. However, later, another set of experiments suggested that labelled β-cells de-differentiate to a mesenchymal-like phenotype in vitro, but fail to proliferate; thus initiating a debate in 2007.
Since these studies in human islets lacked lineage-tracing analysis, these findings from irreversibly tagged beta cells in mice were extrapolated to human islets. Thus, using a dual lentiviral and genetic lineage tracing system to label β-cells, it was convincingly demonstrated that adult human islet β-cells undergo EMT and proliferate in vitro. Also, these findings were confirmed in human fetal pancreatic insulin-producing cells, and the mesenchymal cells derived from pancreatic islets can undergo the reverse of EMT – MET – to generate islet-like cell aggregates. Thus, the concept of generating progenitors from insulin-producing cells by EMT or generation of Cancer Stem Cells during EMT in cancer may have potential for replacement therapy in diabetes, and call for drugs targeting inhibition of EMT in cancer. | 1 | Applied and Interdisciplinary Chemistry |
In 1982, Koiti Titanis lab identified an "N-terminal blocking group" on the catalytic subunit of cyclic AMP-dependent protein kinase in cows as n-tetradecanoyl. Almost simultaneously in Claude B. Klees lab, this same N-terminal blocking group was further characterized as myristic acid. Both labs made this discovery utilizing similar techniques: mass spectrometry and gas chromatography. | 1 | Applied and Interdisciplinary Chemistry |
Treatment with mTOR inhibitors can be complicated by adverse events. The most frequently occurring adverse events are stomatitis, rash, anemia, fatigue, hyperglycemia/hypertriglyceridemia, decreased appetite, nausea, and diarrhea. Additionally, interstitial lung disease is an adverse event of particular importance. mTORi-induced ILD often is asymptomatic (with ground glass abnormalities on chest CT) or mild symptomatic (with a non-productive cough), but can be very severe as well. Even fatalities have been described. Careful diagnosis and treatment, therefore, is essential. Recently, a new diagnostic and therapeutic management approach has been proposed. | 1 | Applied and Interdisciplinary Chemistry |
Availability of modular metal centers and organic building blocks generate wide diversity in synthetic versatility. Their applications range from industrial use to chemiresistive sensors. The ordered structure of the frame is largely determined by the coordination geometry of the metal and directionality of functional groups upon the organic linker. Consequently, MOFs contain highly defined pore dimensions when compared with conventional amorphous nanoporous materials and polymers. Reticular Synthesis of MOFs is a term that has been recently coined to describe the bottom-up method of assembling cautiously designed rigid molecular building blocks into prearranged structures held together by strong chemical bonds. The synthesis of two-dimensional MOFs begins with the knowledge of a target "blueprint" or a network, followed by identification of the required building blocks for its assembly.
By interchanging metal centers and organic ligands, one can fine-tune electronic and magnetic properties observed in MOFs. There have been recent efforts synthesize conductive MOFs using triyphenylene linkers. Additionally, MOFs have been utilized as reversible chemiresistive sensors. | 0 | Theoretical and Fundamental Chemistry |
Dextrose equivalent (DE) is a measure of the amount of reducing sugars present in a sugar product, expressed as a percentage on a dry basis relative to dextrose. The dextrose equivalent gives an indication of the average degree of polymerisation (DP) for starch sugars. As a rule of thumb, DE × DP = 120.
In all glucose polymers, from the native starch to glucose syrup, the molecular chain begins with a reducing sugar, containing a free aldehyde. As the starch is hydrolysed, the molecules become shorter and more reducing sugars are present. Therefore, the dextrose equivalent describes the degree of conversion of starch to dextrose. The standard method of determining the dextrose equivalent is the Lane-Eynon titration, based on the reduction of copper(II) sulfate in an alkaline tartrate solution, an application of Fehling's test.
Examples:
*A maltodextrin with a DE of 10 would have 10% of the reducing power of dextrose which has a DE of 100.
*Maltose, a disaccharide made of two glucose (dextrose) molecules, has a DE of 52, correcting for the water loss in molecular weight when the two molecules are combined. Glucose (dextrose) has a molecular mass of 180, while water has a molecular mass of 18. For each 2 glucose monomers binding, a water molecule is removed.
Therefore, the molecular mass of a glucose polymer can be calculated by using the formula (180*n - 18*(n-1)) with n the DP (degree of polymerisation) of the glucose polymer. The DE can be calculated as 100*(180 / Molecular mass( glucose polymer)). In this example the DE is calculated as 100*(180/(180*2-18*1)) = 52.
*Sucrose actually has a DE of zero even though it is a disaccharide, because both reducing groups of the monosaccharides that make it are connected, so there are no remaining reducing groups.
Because different reducing sugars (e.g. fructose and glucose) have different sweetness, it is incorrect to assume that there is any direct relationship between dextrose equivalent and sweetness. | 0 | Theoretical and Fundamental Chemistry |
Olefin polymers (such as polypropylene and polyethylene) have seen widespread use in the plastics industry in the past 50 years. A way to enhance the properties of these olefin polymers was first discovered by the scientists Karl Ziegler and Giulio Natta. Ziegler discovered the original Titanium based catalyst essential for olefin polymerization, while Natta used the catalyst to alter and control the stereochemistry (tacticity) of the olefin polymers (hence Ziegler–Natta catalyst). By controlling the tacticity of the polymer, a chain can, for example, either be semi crystalline or amorphous, rigid or elastic, heat resistant or have a low glass transition temperature. Much research since has been dedicated to predicting and creating polymers based on this work. Living polymerization is the term coined to describe the use of specially made catalysts (often involving transition metal centers) in olefin polymerization, since the polymer chains self-propagate in the presence of the catalyst until intentionally terminated.
Living polymerization, however, produces only one type of tacticity per catalyst. While the specific tacticity can be controlled by altering the type of catalyst used, creating a block copolymer requires that the polymerization be terminated, the catalyst destroyed, and that the chain re-propagate using another catalyst that produces the desired stereochemistry. Such manipulations are usually difficult, however. | 0 | Theoretical and Fundamental Chemistry |
Transposase (Tnp) Tn5 is a member of the RNase superfamily of proteins which includes retroviral integrases. Tn5 can be found in Shewanella and Escherichia bacteria. The transposon codes for antibiotic resistance to kanamycin and other aminoglycoside antibiotics.
Tn5 and other transposases are notably inactive. Because DNA transposition events are inherently mutagenic, the low activity of transposases is necessary to reduce the risk of causing a fatal mutation in the host, and thus eliminating the transposable element. One of the reasons Tn5 is so unreactive is because the N- and C-termini are located in relatively close proximity to one another and tend to inhibit each other. This was elucidated by the characterization of several mutations which resulted in hyperactive forms of transposases. One such mutation, L372P, is a mutation of amino acid 372 in the Tn5 transposase. This amino acid is generally a leucine residue in the middle of an alpha helix. When this leucine is replaced with a proline residue the alpha helix is broken, introducing a conformational change to the C-terminal domain, separating it from the N-terminal domain enough to promote higher activity of the protein. The transposition of a transposon often needs only three pieces: the transposon, the transposase enzyme, and the target DNA for the insertion of the transposon. This is the case with Tn5, which uses a cut-and-paste mechanism for moving around transposons.
Tn5 and most other transposases contain a DDE motif, which is the active site that catalyzes the movement of the transposon. Aspartate-97, aspartate-188, and glutamate-326 make up the active site, which is a triad of acidic residues. The DDE motif is said to coordinate divalent metal ions, most often magnesium and manganese, which are important in the catalytic reaction. Because transposase is incredibly inactive, the DDE region is mutated so that the transposase becomes hyperactive and catalyzes the movement of the transposon. The glutamate is transformed into an aspartate and the two aspartates into glutamates. Through this mutation, the study of Tn5 becomes possible, but some steps in the catalytic process are lost as a result.
There are several steps which catalyze the movement of the transposon, including Tnp binding, synapsis (the creation of a synaptic complex), cleavage, target capture, and strand transfer. Transposase then binds to the DNA strand and creates a clamp over the transposon end of the DNA and inserts into the active site. Once the transposase binds to the transposon, it produces a synaptic complex in which two transposases are bound in a cis/trans relationship with the transposon.
In cleavage, the magnesium ions activate oxygen from water molecules and expose them to nucleophilic attack. This allows the water molecules to nick the 3' strands on both ends and create a hairpin formation, which separates the transposon from the donor DNA. Next, the transposase moves the transposon to a suitable location. Not much is known about the target capture, although there is a sequence bias which has not yet been determined. After target capture, the transposase attacks the target DNA nine base pairs apart, resulting in the integration of the transposon into the target DNA.
As mentioned before, due to the mutations of the DDE, some steps of the process are lost—for example, when this experiment is performed in vitro, and SDS heat treatment denatures the transposase. However, it is still uncertain what happens to the transposase in vivo.
The study of transposase Tn5 is of general importance because of its similarities to HIV-1 and other retroviral diseases. By studying Tn5, much can also be discovered about other transposases and their activities.
Tn5 is utilized in genome sequencing by using the Tn5 to append sequencing adaptors and fragment the DNA in a single enzymatic reaction in 2010, reducing the time and input requirements over traditional next-generation sequencing library preparation. The Tn5-based strategy can simplify the library preparation protocol significantly and can even can be incorporated into the direct colony-PCR for large numbers of bacterial isolates with no obvious coverage bias. The main disadvantages are less control of fragmented size compared to enzymatic fragmentation and mechanical fragmentation, and a bias toward high G-C content. This means of library preparation is also used in the ATAC-seq technique. | 1 | Applied and Interdisciplinary Chemistry |
Joule heating can also be calculated at a particular location in space. The differential form of the Joule heating equation gives the power per unit volume.
Here, is the current density, and is the electric field. For a material with a conductivity , and therefore
where is the resistivity. This directly resembles the "" term of the macroscopic form.
In the harmonic case, where all field quantities vary with the angular frequency as , complex valued phasors and are usually introduced for the current density and the electric field intensity, respectively. The Joule heating then reads
where denotes the complex conjugate. | 0 | Theoretical and Fundamental Chemistry |
Through the Safe Drinking Water Act, the United States Environmental Protection Agency has set a maximum contaminant level of 10 mg/L or 10 ppm of nitrate in drinking water.
An acceptable daily intake (ADI) for nitrate ions was established in the range of 0–3.7 mg (kg body weight) day by the Joint FAO/WHO Expert Committee on Food Additives (JEFCA). | 0 | Theoretical and Fundamental Chemistry |
The ionic strength of a solution is a measure of the concentration of ions in that solution. Ionic compounds, when dissolved in water, dissociate into ions. The total electrolyte concentration in solution will affect important properties such as the dissociation constant or the solubility of different salts. One of the main characteristics of a solution with dissolved ions is the ionic strength. Ionic strength can be molar (mol/L solution) or molal (mol/kg solvent) and to avoid confusion the units should be stated explicitly. The concept of ionic strength was first introduced by Lewis and Randall in 1921 while describing the activity coefficients of strong electrolytes. | 0 | Theoretical and Fundamental Chemistry |
Carbon tetrachloride was originally synthesized in 1820 by Michael Faraday, who named it "protochloride of carbon", by decomposition of hexachloroethane ("perchloride of carbon") which he synthesized by chlorination of ethylene. The protochloride of carbon has been previously misidentified as tetrachloroethylene because it was made with the same reaction of hexachloroethane. Later in the 19th century, the name protochloride of carbon was used for tetrachloroethylene, and carbon tetrachloride was called "bichloride of carbon" or "perchloride of carbon". Henri Victor Regnault developed another method to synthesise carbon tetrachloride from chloroform, chloroethane or methanol with excess chlorine in 1839.
Kolbe made carbon tetrachloride in 1845 by passing chlorine over carbon disulfide through a porcelain tube. Prior to the 1950s, carbon tetrachloride was manufactured by the chlorination of carbon disulfide at 105 to 130 °C:
:CS + 3 Cl → CCl + SCl
But now it is mainly produced from methane:
:CH + 4 Cl → CCl + 4 HCl
The production often utilizes by-products of other chlorination reactions, such as from the syntheses of dichloromethane and chloroform. Higher chlorocarbons are also subjected to this process named "chlorinolysis":
:CCl + Cl → 2 CCl
The production of carbon tetrachloride has steeply declined since the 1980s because of environmental concerns and the decreased demand for CFCs, which were derived from carbon tetrachloride. In 1992, production in the U.S./Europe/Japan was estimated at 720,000 tonnes. | 1 | Applied and Interdisciplinary Chemistry |
Cancer can result from the loss of cell-cell interaction. In normal cells, growth is controlled by contact inhibition in which contact with neighboring cells causes a stunt in cell growth. Contact inhibition is thought to be mediated by cadherins, proteins that play an important role in cell adhesion. This inhibition prevents cells from piling up on top of one another and forming mounds. However, in cancerous cells where expression of E-cadherin is lost, contact inhibition is lost and results in uncontrolled growth or proliferation, tumor formation, and metastasis. | 1 | Applied and Interdisciplinary Chemistry |
Depending on the type of constructed wetlands, the wastewater passes through a gravel and more rarely sand medium on which plants are rooted. A gravel medium (generally limestone or volcanic rock lavastone) can be used as well (the use of lavastone will allow for a surface reduction of about 20% over limestone) is mainly deployed in horizontal flow systems though it does not work as efficiently as sand (but sand will clog more readily).
Constructed subsurface flow wetlands are meant as secondary treatment systems which means that the effluent needs to first pass a primary treatment which effectively removes solids. Such a primary treatment can consist of sand and grit removal, grease trap, compost filter, septic tank, Imhoff tank, anaerobic baffled reactor or upflow anaerobic sludge blanket (UASB) reactor. The following treatment is based on different biological and physical processes like filtration, adsorption or nitrification. Most important is the biological filtration through a biofilm of aerobic or facultative bacteria. Coarse sand in the filter bed provides a surfaces for microbial growth and supports the adsorption and filtration processes. For those microorganisms the oxygen supply needs to be sufficient.
Especially in warm and dry climates the effects of evapotranspiration and precipitation are significant. In cases of water loss, a vertical flow constructed wetland is preferable to a horizontal because of an unsaturated upper layer and a shorter retention time, although vertical flow systems are more dependent on an external energy source. Evapotranspiration (as is rainfall) is taken into account in designing a horizontal flow system.
The effluent can have a yellowish or brownish colour if domestic wastewater or blackwater is treated. Treated greywater usually does not tend to have a colour. Concerning pathogen levels, treated greywater meets the standards of pathogen levels for safe discharge to surface water. Treated domestic wastewater might need a tertiary treatment, depending on the intended reuse application.
Plantings of reedbeds are popular in European constructed subsurface flow wetlands, although at least twenty other plant species are usable. Many fast growing timer plants can be used, as well for example as Musa spp., Juncus spp., cattails (Typha spp.) and sedges. | 1 | Applied and Interdisciplinary Chemistry |
For purposes of law enforcement, blood alcohol content is used to define intoxication and provides a rough measure of impairment. Although the degree of impairment may vary among individuals with the same blood alcohol content, it can be measured objectively and is therefore legally useful and difficult to contest in court. Most countries forbid operation of motor vehicles and heavy machinery above prescribed levels of blood alcohol content. Operation of boats and aircraft is also regulated. Some jurisdictions also regulate bicycling under the influence. The alcohol level at which a person is considered legally impaired to drive varies by country. | 1 | Applied and Interdisciplinary Chemistry |
’ position was essential to the potency of ACE inhibitor so it can be reasoned that this has postponed the discovery of N-domain selective ACE inhibitors. When RXP 407 was discovered researchers looked into phosphinic peptides with 3 different general formula, each containing 2 unidentified amino acids, only 1 of these general formula showed potent inhibition (Ac-Yaa-Pheψ(PO-CH)Ala-Yaa’-NH). Peptide mixtures were made, substituting Yaa and Yaa’ with different amino acids, trying to establish if there would be a potent inhibitor that could inhibit either the N-domain or the C-domain of the enzyme. The result was that the compound Ac-Asp-Pheψ(PO-CH)Ala-Ala-NH actively inhibited the N-domain and was given the name RXP 407. Structure-function relationship showed that the C-terminus carboxamide group played a crucial role in the selectivity for the N-domain of ACE. Additionally, the N-acetyl group and the aspartic side chain in the P position aides in the N-domain selectivity of the inhibitor. These features make the inhibitor inaccessible to the C-domain but give good potency for the N-domain, this leads to a difference in inhibitory potency of the active sites of three orders of magnitude. These results also indicate that the N-domain possess a broader selectivity than the C-domain. Another difference between the older ACE inhibitors and RXP 407 is the molecular size of the compound. The older ACE inhibitors had mostly been interacting with S’, S’ and S subsites but RXP 407 interacts in addition with the S subsite. This also is important for the selectivity of the inhibitor since the aspartic side chain and N-acetyl group are located in the P position. | 1 | Applied and Interdisciplinary Chemistry |
Plasmid DNA may appear in one of five conformations, which (for a given size) run at different speeds in a gel during electrophoresis. The conformations are listed below in order of electrophoretic mobility (speed for a given applied voltage) from slowest to fastest:
* Nicked open-circular DNA has one strand cut.
* Relaxed circular DNA is fully intact with both strands uncut but has been enzymatically relaxed (supercoils removed). This can be modeled by letting a twisted extension cord unwind and relax and then plugging it into itself.
* Linear DNA has free ends, either because both strands have been cut or because the DNA was linear in vivo. This can be modeled with an electrical extension cord that is not plugged into itself.
* Supercoiled (or covalently closed-circular) DNA is fully intact with both strands uncut, and with an integral twist, resulting in a compact form. This can be modeled by twisting an extension cord and then plugging it into itself.
* Supercoiled denatured DNA is like supercoiled DNA, but has unpaired regions that make it slightly less compact; this can result from excessive alkalinity during plasmid preparation.
The rate of migration for small linear fragments is directly proportional to the voltage applied at low voltages. At higher voltages, larger fragments migrate at continuously increasing yet different rates. Thus, the resolution of a gel decreases with increased voltage.
At a specified, low voltage, the migration rate of small linear DNA fragments is a function of their length. Large linear fragments (over 20 kb or so) migrate at a certain fixed rate regardless of length. This is because the molecules respirate, with the bulk of the molecule following the leading end through the gel matrix. Restriction digests are frequently used to analyse purified plasmids. These enzymes specifically break the DNA at certain short sequences. The resulting linear fragments form bands after gel electrophoresis. It is possible to purify certain fragments by cutting the bands out of the gel and dissolving the gel to release the DNA fragments.
Because of its tight conformation, supercoiled DNA migrates faster through a gel than linear or open-circular DNA. | 1 | Applied and Interdisciplinary Chemistry |
Sinter plants agglomerate iron ore fines (dust) with other fine materials at high temperature, to create a product that can be used in a blast furnace. The final product, a sinter, is a small, irregular nodule of iron mixed with small amounts of other minerals. The process, called sintering, causes the constituent materials to fuse to make a single porous mass with little change in the chemical properties of the ingredients. The purpose of sinter are to be used converting iron into steel.
Sinter plants, in combination with blast furnaces, are also used in non-ferrous smelting. About 70% of the world's primary lead production is still produced using the sinter plant–blast furnace combination, and this combination was formerly often used in copper smelting (at the Electrolytic Refining and Smelting smelter in Wollongong, New South Wales, for example). | 1 | Applied and Interdisciplinary Chemistry |
Both up and downregulation of miR-324-5p is shown to contribute to various types of cancer.
miR-324-5p plays a role in inflammation and tumorigenesis in colorectal cancer through regulation of CUEDC2, which regulates inflammation via interaction with NF-kB signaling. miR-324-5p can inhibit glioma proliferation, suppress hepatocellular carcinoma and nasopharyngeal carcinoma cell invasion, and regulate growth and pathology in multiple myeloma. Additionally, chromosome 17 deletions, which include deletion of miR-324-5p, are present in 10% of multiple myeloma patients and are associated with poorer prognosis.
In contrast, overexpression of miR-324-5p in gastric cancer cells reduces cell death and promotes growth and proliferation. miR-324-5p has also been shown to reduce the viability of gastric cancer cells via downregulation of TSPAN8, and miR-324-5p expression increased apoptosis in these same gastric cancer cells. | 1 | Applied and Interdisciplinary Chemistry |
Born in Keresley on the outskirts of Coventry, Warwickshire, England, on 10 September 1936, Hartshorn was the son of Bernard Hartshorn and Christine Evelyn Hartshorn (née Bennett). He studied at Imperial College London, from where he graduated BSc and ARCS, and at University College, Oxford, where he obtained a DPhil in 1960. His doctoral thesis was titled Steroid hormone analogues.
Hartshorn married Jacqueline Joll in 1963, and the couple went on to have four sons. He became a naturalised New Zealand citizen in 1965. | 0 | Theoretical and Fundamental Chemistry |
It can also be used with highly specific meanings in specialised contexts. In the description of protein structure, in particular in the Protein Data Bank file format, a heteroatom record (HETATM) describes an atom as belonging to a small molecule cofactor rather than being part of a biopolymer chain. | 0 | Theoretical and Fundamental Chemistry |
As nanoparticle interactions take place on a nanoscale, the particle interactions must be scaled similarly. Hamaker interactions take into account the polarization characteristics of a large number of nearby particles and the effects they have on each other. Hamaker interactions sum all of the forces between all particles and the solvent(s) involved in the system. While Hamaker theory generally describes a macroscopic system, the vast number of nanoparticles in a self-assembling system allows the term to be applicable. Hamaker constants for nanoparticles are calculated using Lifshitz theory, and can often be found in literature. | 0 | Theoretical and Fundamental Chemistry |
The École Nationale Supérieure des Industries Chimiques (ENSIC) is an Engineering School dedicated to Chemical Engineering in Nancy, France.
Ensic Nancy is one of the seven schools of the Institut National Polytechnique de Lorraine (INPL), France's largest technological university. | 1 | Applied and Interdisciplinary Chemistry |
HSC Sim is a process simulator based on the HSC Chemistry software and databases. It has been implemented as a module to HSC Chemistry 7.0 in 2007 and can be used primarily for static process simulation. HSC stands for H ([enthalpy]), S ([entropy]) and Cp([heat capacity]). | 1 | Applied and Interdisciplinary Chemistry |
Irrespective of scan rate, the area under the peak (in units of AV) is equal to , where is the number of electrons exchanged in the oxidation/reduction of the center, is the electrode surface and is the electroactive coverage (in units of mol/cm). The latter can therefore be deduced from the area under the peak after subtraction of the capacitive current. | 0 | Theoretical and Fundamental Chemistry |
Non-ionic surfactants have covalently bonded oxygen-containing hydrophilic groups, which are bonded to hydrophobic parent structures. The water-solubility of the oxygen groups is the result of hydrogen bonding. Hydrogen bonding decreases with increasing temperature, and the water solubility of non-ionic surfactants therefore decreases with increasing temperature.
Non-ionic surfactants are less sensitive to water hardness than anionic surfactants, and they foam less strongly. The differences between the individual types of non-ionic surfactants are slight, and the choice is primarily governed having regard to the costs of special properties (e.g., effectiveness and efficiency, toxicity, dermatological compatibility, biodegradability) or permission for use in food. | 0 | Theoretical and Fundamental Chemistry |
Extra-thyroidal iodine exists in several other organs, including the mammary glands, eyes, gastric mucosa, cervix, cerebrospinal fluid, arterial walls, ovary and salivary glands. In the cells of these tissues the iodide ion (I) enters directly by the sodium-iodide symporter (NIS). Different tissue responses for iodine and iodide occur in the mammary glands and the thyroid gland of rats. The role of iodine in mammary tissue is related to fetal and neonatal development, but its role in the other tissues is not well known. It has been shown to act as an antioxidant and antiproliferant in various tissues that can uptake iodine. Molecular iodine (I) has been shown to have a suppressive effect on benign and cancerous neoplasias.
The U.S. Food and Nutrition Board and Institute of Medicine recommended daily allowance of iodine ranges from 150 micrograms per day for adult humans to 290 micrograms per day for lactating mothers. However, the thyroid gland needs no more than 70 micrograms per day to synthesize the requisite daily amounts of T4 and T3. The higher recommended daily allowance levels of iodine seem necessary for optimal function of a number of other body systems, including lactating breasts, gastric mucosa, salivary glands, oral mucosa, arterial walls, thymus, epidermis, choroid plexus and cerebrospinal fluid, among others. | 1 | Applied and Interdisciplinary Chemistry |
Reductive elimination is sensitive to a variety of factors including: 1) metal identity and electron density; 2) sterics; 3) participating ligands; 4) coordination number; 5) geometry; and 6) photolysis/oxidation. Additionally, because reductive elimination and oxidative addition are reverse reactions, any sterics or electronics that enhance the rate of reductive elimination must thermodynamically hinder the rate of oxidative addition. | 0 | Theoretical and Fundamental Chemistry |
Lanthanide probes' ligands must meet several chemical requirements for the probes to work properly. These qualities are: water solubility, large thermodynamic stability at physiological pHs, kinetic inertness and absorption above 330 nm to minimize destruction of live biological materials.
The chelates which have been studied and utilized to date can be classified into the following groups:
# Tris chelates (three ligands)
# Tetrakis chelates (four ligands)
# Mixed ligand complexes
# Complexes with neutral donors
# Others such as: phthalate, picrate, and salicylate complexes.
The efficiency of the energy transfer from the ligand to the ion is determined ligand-metal bond. The energy transfer is more efficient when bonded covalently than through ionic bonding. Substituents in the ligand which are of electron-donating such as hydroxy, methoxy and methyl groups increase the fluorescence. The opposite effect is seen when an electron-withdrawing group (such as nitro) is attached. Furthermore, the fluorescence intensity is increased by fluorine substitution to the ligand. The energy transfer to the metal ion increases as the electronegativity of the fluorinated group makes the europium-oxygen bond of a more covalent nature. Increased conjugation by aromatic substituents by replacing phenyl by naphtyl groups is shown to enhance fluorescence. | 1 | Applied and Interdisciplinary Chemistry |
The Pople notation is named after the Nobel laureate John Pople and is a simple method of presenting second-order spin coupling systems in NMR.
The notation labels each (NMR active) nucleus with a letter of the alphabet. The difference in chemical shift, δ, relative to the J-coupling between nuclei mirrors the separation of the letter labels in the Latin alphabet. The letters used tend to be limited to A,B,M,N,X,Y.
For example, AB indicates two nuclei which have similar chemical shifts (Δδ similar to or smaller than J), whereas AX indicates two which lie further apart on the spectrum (Δδ significantly larger than J). AB would similarly indicate a spin system containing two equivalent nuclei (A) and a third, inequivalent one (B). Nuclei which are in equivalent chemical environments (that is, symmetry-related), but inequivalent magnetic environments are distinguished with a prime; e.g. AA'. This key aspect of the notation, i.e., using a prime to differentiate between chemical equivalence only compared to full magnetic equivalence, was introduced by Richards and Schaefer in 1958.
The notation can be used to represent systems of more than two nuclei, for example AMX represents three nuclei, each moderately separated from the others, and ABX represents two nuclei whose peaks are closely spaced and one other nucleus which is more distant.
Examples:
PHCl is an AX system whereas
CHCHF is an AMX system, | 0 | Theoretical and Fundamental Chemistry |
*2007 - Recipient of the puRkwa Prize. This is an "international prize for the scientific literacy of the children of the planet" awarded annually by the École nationale supérieure des mines de Saint-Étienne and the French Academy of Sciences.
*2005 - Member of the Academy of Exact, Physical and Natural Sciences of Argentina
*2002 - Medal of the Grand Cross of the Scientific Merit awarded by the President Brazil.
*2001 - Foreign Member of the National Academy of Sciences of the United States of America.
*1993 - Honorary Doctorate from the University of Buenos Aires, Argentina.
*1992 - National "Natural Sciences Award of Chile".
*1990 - Foreign Member of the Institute of Medicine of the National Academy of Sciences of the United States of America.
*1986 to 1988 - "Scholar in Residence" of the Fogarty International Center in the United States.
*1986 - Founding member of the Academy of Sciences of the Third World.
*1983 - Member of the Chilean Academy of Sciences.
*1982 - Founding member of the Academy of Sciences of Latin America.
*1966 - Guggenheim Fellowship | 1 | Applied and Interdisciplinary Chemistry |
Mathematically, PCLake is composed of a set of coupled differential equations. With a large number of state variables (>100) and parameters (>300), the model may be characterized as relatively complex. The main biotic variables are phytoplankton and submerged aquatic vegetation, describing primary production. A simplified food web is made up of zooplankton, zoobenthos, young and adult whitefish and piscivorous fish. The main abiotic factors are transparency and the nutrients phosphorus (P), nitrogen (N) and silica (Si). At the base of the model are the water and nutrient budgets (in- and outflow). The model describes a completely mixed water body and comprises both the water column and the upper sediment layer. The overall nutrient cycles for N, P and Si are described as completely closed (except for in- and outflow and denitrification). Inputs to the model are: lake hydrology, nutrient loading, dimensions and sediment characteristics. The model calculates chlorophyll-a, transparency, cyanobacteria, vegetation cover and fish biomass, as well as the concentrations and fluxes of nutrients N, P and Si, and oxygen. Optionally, a wetland zone with marsh vegetation and water exchange with the lake can be included.
PCLake is calibrated against nutrient, transparency, chlorophyll and vegetation data on more than 40 European (but mainly Dutch) lakes, and systematic sensitivity and uncertainty analysis have been performed.
Although PCLake is primarily used for Dutch lakes, it is likely that the model is also applicable to comparable non-stratifying lakes in other regions, if parameters are adjusted or some small changes to the model are made. | 1 | Applied and Interdisciplinary Chemistry |
One of the critical needs for NMR structural ensemble validation is to distinguish well-determined regions (those that have experimental data) from regions that are highly mobile and/or have no observed data. There are several current or proposed methods for making this distinction such as Random Coil Index, but so far the NMR community has not standardized on one. | 1 | Applied and Interdisciplinary Chemistry |
* Europium tetrakis (dibenzoylmethide)triethylammonium emits particularly bright red flashes upon the destruction of its crystals.
* Triphenylphosphinebis(pyridine)thiocyanatocopper(I) emits a reasonably strong blue light when crystals of it are fractured. This luminescence is not as extreme as the red luminescence; however, it is still very clearly visible to the naked eye in standard settings.
* N-acetylanthranilic acid emits a deep blue light when its crystals are fractured. | 0 | Theoretical and Fundamental Chemistry |
In molecular biology, STRING (Search Tool for the Retrieval of Interacting Genes/Proteins) is a biological database and web resource of known and predicted protein–protein interactions.
The STRING database contains information from numerous sources, including experimental data, computational prediction methods and public text collections. It is freely accessible and it is regularly updated. The resource also serves to highlight functional enrichments in user-provided lists of proteins, using a number of functional classification systems such as GO, Pfam and KEGG. The latest version 11b contains information on about 24,5 million proteins from more than 5000 organisms. STRING has been developed by a consortium of academic institutions including CPR, EMBL, KU, SIB, TUD and UZH. | 1 | Applied and Interdisciplinary Chemistry |
The speed of sound is the distance travelled per unit of time by a sound wave as it propagates through an elastic medium. At , the speed of sound in air is about , or one km in or one mile in . It depends strongly on temperature as well as the medium through which a sound wave is propagating. At , the speed of sound in air is about . More simply, the speed of sound is how fast vibrations travel.
The speed of sound in an ideal gas depends only on its temperature and composition. The speed has a weak dependence on frequency and pressure in ordinary air, deviating slightly from ideal behavior.
In colloquial speech, speed of sound refers to the speed of sound waves in air. However, the speed of sound varies from substance to substance: typically, sound travels most slowly in gases, faster in liquids, and fastest in solids. For example, while sound travels at in air, it travels at in water (almost 4.3 times as fast) and at in iron (almost 15 times as fast). In an exceptionally stiff material such as diamond, sound travels at , about 35 times its speed in air and about the fastest it can travel under normal conditions.
In theory, the speed of sound is actually the speed of vibrations.
Sound waves in solids are composed of compression waves (just as in gases and liquids) and a different type of sound wave called a shear wave, which occurs only in solids. Shear waves in solids usually travel at different speeds than compression waves, as exhibited in seismology. The speed of compression waves in solids is determined by the mediums compressibility, shear modulus, and density. The speed of shear waves is determined only by the solid materials shear modulus and density.
In fluid dynamics, the speed of sound in a fluid medium (gas or liquid) is used as a relative measure for the speed of an object moving through the medium. The ratio of the speed of an object to the speed of sound (in the same medium) is called the objects Mach number. Objects moving at speeds greater than the speed of sound (') are said to be traveling at supersonic speeds. | 1 | Applied and Interdisciplinary Chemistry |
In 1908, AWWA began developing industry standards for products, processes and best practices. The AWWA Standards Program is recognized internationally as a source for scientific and management reference resources for the water community. Currently, there are over 150 AWWA Standards covering filtration materials, treatment chemicals, disinfection practices, meters, valves, utility management practices, storage tanks, pumps, and ductile iron, steel, concrete, asbestos-cement, and plastic pipe and fittings. Standing committees periodically review and update the standards as required.
In May 1985, the United States Environmental Protection Agency entered into a cooperative agreement with a consortium led by NSF International to develop voluntary third-party consensus standards and a certification program for all direct and indirect drinking water additives. Other members of the consortium include AWWA. The consortium is responsible for the cooperative effort of manufacturers, regulators, product users and other interested parties that develop and maintain the NSF standards. | 1 | Applied and Interdisciplinary Chemistry |
The reactions in this category behave like a clock reaction, however they are irreproducible, unpredictable and hard to control. Examples are chlorite/thiosulfate and iodide/chlorite reactions. | 0 | Theoretical and Fundamental Chemistry |
Basic research on supercritical water oxidation was undertaken in the 1990s at Sandia National Laboratory's Combustion Research Facility (CRF), in Livermore, CA. Originally proposed as a hazardous waste destruction technology in response to the Kyoto protocol, multiple waste streams were studied by Steven F. Rice and Russ Hanush, and hydrothermal (supercritical water) flames were investigated by Richard R. Steeper and Jason D. Aiken. Among the waste streams studied were military dyes and pyrotechnics, methanol, and isopropyl alcohol. Hydrogen peroxide was used as an oxidizing agent, and Eric Croiset was tasked with detailed measurements of the decomposition of hydrogen peroxide at supercritical water conditions.
In mid-1992, Thomas G. McGuinness, PE invented what is now known as the "transpiring-wall SCWO reactor" (TWR) while seconded to Los Alamos National Laboratory on behalf of Summit Research Corporation. McGuinness subsequently received the first US patent for a TWR in early 1995. The TWR was designed to mitigate problems of salt/solids deposition, corrosion and thermal limitations occurring in other SCWO reactor designs (eg. tubular & vat-type reactors) at the time. The upper part of the vertical reactor incorporates a permeable liner through which a clean fluid permeates to help prevent salts and other solids from accumulating at the inner surface of the liner. The liner also insulates the outer pressure containment vessel from high temperatures within the reaction zone. The liner can be manufactured from a variety of materials resistant to corrosion and high reaction temperatures. The bottom end of the TWR incorporates a "quench cooler" for cooling the reaction byproducts while neutralizing any components that might form acids during transition to subcritical temperature. Proof-of-concept and performance advantages of the TWR for a variety of feedstocks was demonstrated by Eckhard Dinjus and Johannes Abeln at Forschungszentrum Karlsruhe (FZK), via direct comparison between a TWR and an adjacent tubular reactor.
Major engineering challenges were associated with the deposition of salts and chemical corrosion in these supercritical water reactors. Anthony Lajeunesse led the team investigating these issues. To address these issues Lajeunesse designed a transpiring wall reactor which introduced a pressure differential through the walls of an inner sleeve filled with pores to continuously rinse the inner walls of the reactor with fresh water. Russ Hanush was charged with the construction and operation of the supercritical fluids reactor (SFR) used for these studies. Among its design intricacies were the Inconel 625 alloy necessary for operation at such extreme temperatures and pressures, and the design of the high-pressure, high-temperature optical cells used for photometric access to the reacting flows which incorporated 24 carat gold pressure seals and sapphire windows. | 0 | Theoretical and Fundamental Chemistry |
In environmental chemistry, the chemical oxygen demand (COD) is an indicative measure of the amount of oxygen that can be consumed by reactions in a measured solution. It is commonly expressed in mass of oxygen consumed over volume of solution which in SI units is milligrams per litre (mg/L). A COD test can be used to easily quantify the amount of organics in water. The most common application of COD is in quantifying the amount of oxidizable pollutants found in surface water (e.g. lakes and rivers) or wastewater. COD is useful in terms of water quality by providing a metric to determine the effect an effluent will have on the receiving body, much like biochemical oxygen demand (BOD). | 0 | Theoretical and Fundamental Chemistry |
To relate the orientation of a crystal, much like in X-ray diffraction (XRD), the geometry of the system must be known. In particular, the pattern centre describes the distance of the interaction volume to the detector and the location of the nearest point between the phosphor and the sample, on the phosphor screen. Early work used a single crystal of known orientation being inserted into the SEM chamber, and a particular feature of the EBSP was known to correspond to the pattern centre. Later developments involved exploiting various geometric relationships between the generation of an EBSP and the chamber geometry (shadow casting and phosphor movement).
Unfortunately, each of these methods is cumbersome and can be prone to some systematic errors for a general operator. Typically they cannot be easily used in modern SEMs with multiple designated uses. Thus, most commercial EBSD systems use the indexing algorithm combined with an iterative movement of crystal orientation and suggested pattern centre location. Minimising the fit between bands located within experimental patterns and those in look-up tables tends to converge on the pattern centre location to an accuracy of ~0.5–1% of the pattern width.
The recent development of AstroEBSD and PCGlobal, open-source MATLAB codes, increased the precision of determining the pattern centre (PC) and – consequently – elastic strains by using a pattern matching approach which simulates the pattern using EMSoft. | 0 | Theoretical and Fundamental Chemistry |
In placebo-controlled studies, the most commonly observed side effects were headache, xerostomia (dry mouth), nausea, dizziness, and insomnia. Possible side effects also include depression, anxiety, hallucinations, euphoria, extreme increase in activity and talking, anorexia, tremor, thirst, rash, suicidal thoughts, and aggression. Symptoms of an overdose on armodafinil include trouble sleeping, restlessness, confusion, disorientation, feeling excited, mania, hallucinations, nausea, diarrhea, severely increased or decreased heart beat, chest pain, and increased blood pressure. Serious rashes can develop in rare cases, and require immediate medical attention due to the possibility of Steven's-Johnson Syndrome, or other hypersensitivities to armodafinil. | 0 | Theoretical and Fundamental Chemistry |
In Hamiltonian mechanics, the Boltzmann equation is often written more generally as
where is the Liouville operator (there is an inconsistent definition between the Liouville operator as defined here and the one in the article linked) describing the evolution of a phase space volume and is the collision operator. The non-relativistic form of is | 1 | Applied and Interdisciplinary Chemistry |
These are exclusively coal-fired processes, with the reducing gases generated inside the reduction vessel. The ore is charged with coal into a closed container. This is then heated until the oxygen present in the ore combines with the carbon before being discharged, mainly in the form of CO or CO2. This production of gas by heating a solid material means that the reactor belongs to the retort category.
The principle is an ancient one: in northern China, the shortage of charcoal led to the development of processes using hard coal before the 4th century. To avoid any contact between iron and sulfur, the brittle element provided by coal, China developed a process that involved placing iron ore in batteries of elongated tubular crucibles and covering them with a mass of coal, which was then burned. This process survived into the 20th century.
More recently, other historic processes have come to the fore, such as that of Adrien Chenot, operational in the 1850s in a number of plants in France and Spain. Successive improvements by Blair, Yutes, Renton, and Verdié are not significant. Among the processes developed is the HOGANAS process, perfected in 1908. Three small units are still operational (as of 2010). Not very productive, it is limited to the production of powdered iron, but as it is slow and operates in closed retorts, it easily achieves the purities required by powder metallurgy.
Other retort processes were developed, such as KINGLOR-METOR, perfected in 1973. Two small units were built in 1978 (closed) and 1981 (probably closed). | 1 | Applied and Interdisciplinary Chemistry |
A sample is introduced, either manually or with an autosampler, into a sample loop of known volume. A buffered aqueous solution known as the mobile phase carries the sample from the loop onto a column that contains some form of stationary phase material. This is typically a resin or gel matrix consisting of agarose or cellulose beads with covalently bonded charged functional groups. Equilibration of the stationary phase is needed in order to obtain the desired charge of the column. If the column is not properly equilibrated the desired molecule may not bind strongly to the column. The target analytes (anions or cations) are retained on the stationary phase but can be eluted by increasing the concentration of a similarly charged species that displaces the analyte ions from the stationary phase. For example, in cation exchange chromatography, the positively charged analyte can be displaced by adding positively charged sodium ions. The analytes of interest must then be detected by some means, typically by conductivity or UV/visible light absorbance.
Control an IC system usually requires a chromatography data system (CDS). In addition to IC systems, some of these CDSs can also control gas chromatography (GC) and HPLC. | 0 | Theoretical and Fundamental Chemistry |
Filtrate is the waste that has been discharge in vacuum ceramic filters through the waste stream. During cake washing, a wash liquid is sprayed on the cake solids to remove impurities or additional filtrate. The filtrate goes into filtrate tank and is drained through a discharge system. However, the filtrate is recyclable and has low suspended solid content. Thus, it can be recycled through the system without further treatment. Filtrate is used to flush the disc during back flow washing to clean the micro-porous structure and remove any residual cake. | 0 | Theoretical and Fundamental Chemistry |
Anim-Mensah was born in Takoradi Ghana to two Kwahu parents. His late father, Kwame Anim-Mensah, was both a businessman and cocoa farmer while his late mother Kate Animah was a homemaker. He is one of thirteen children. He had his primary education at the Young Christian Preparatory School in Sekondi-Takoradi Ghana; and his secondary education at the GSTS where he obtained his Ordinary Level ("O") and Advanced Level ("A") certificates in Science and Technical education.
He obtained his PhD, MSc., and BSc. in Chemical Engineering from the University of Cincinnati-Ohio, and also studied at North Carolina A&T State University, and the KNUST, respectively. Some of his numerous specializations include Technology, Operations and Value Chain Management Capability from the Massachusetts Institute of Technology Sloan School of Management. Intellectual Property Law & Policy from the University of Pennsylvania, Business Strategy from the University of Virginia Darden Business School, Global Energy Business from the University of Colardo, Marketing Mix Implementation from the IE Business School Madrid - Spain and Executive Certificates in both Advanced Project Management & Project Leadership from the University of Dayton - Ohio.
Anim-Mensah started his career with an internship in 1995 at the West African Mills Co LLC (WAMCO) and in 1997 at the Ghana Cement Works all in Takoradi Ghana. He obtained his chemical engineering bachelors degree around 1998 at the KNUST and then taught Science & Math at the Takoradi Secondary School in Takoradi Ghana early in 1999 as part of a required one year National service. At the end of his National Service he joined Ghanas Tema Oil Refinery as a Process & Environmental Engineer in early 2000, processing crude oil and managing its waste products. He then left Ghana after a year to North Carolina to pursue his masters degree in Chemical Engineering specializing in liquid carbon dioxide (liq-) separation and recovery from process solutions without phase change enhanced by micelles in a crossflow microfiltration. In 2003 he enrolled at the University of Cincinnati-Ohios PhD chemical engineering program specializing in membrane science & technology specifically assessing solvent resistant polymeric nanofiltration membranes for small molecule purification and solvent recovery for re-use and other specialties.
He has worked at Procter & Gamble Cincinnati-Ohio, Siemens Water Technologies-Colorado, Veolia Water Technologies-Ohio, and currently works as the Engineer Manager with ITWs Food Equipment Group in the Dayton, Ohio area. He obtained his PhD, MSc and BSc in Chemical Engineering from the University of Cincinnati-Ohio and studied at North Carolina A&T State University, Executive Certificate Construction Project Management from Columbia University, NY and then KNUST. He is a recipient of the Illinois Tool Works Distinguished Patent Fellow Award.
Recipient of 2023 Black History & Lifestyle award, 2022 Award for Contribution Towards the Membrane Science & Technology Field. | 1 | Applied and Interdisciplinary Chemistry |
Giesel isolated from pitchblende a lanthanum-containing fraction which showed unique properties. He produced several compounds of the new element, and after studying for two years he was confident enough to give the new element the name emanium. He was aware of the discovery of actinium by André-Louis Debierne. In publications from 1899 and 1900 Debierne does not give the exact procedures to obtain actinium, but from the description of chemical properties which he described as similar to titanium (1899) or similar to thorium (1900) it was clear for Giesel that the two elements must be different. A later comparison of the two elements by Otto Hahn, Otto Sackur and others showed that the two elements were identical. Debierne's name was retained because it had seniority.
Giesel stated in one of his publications that the sample Debierne provided for the comparison was a lanthanum fraction obtained by the same process he used and not the titanium or thorium fractions from earlier publications. This fact never led to an open controversy but the history of the discovery stayed questionable, and publications from 1971 argue that the claims of André-Louis Debierne in 1904 conflict with the publications in 1899 and 1900, making Giesel the real discoverer of actinium.
A less confrontational vision of scientific discovery is proposed by Adloff. He suggests that hindsight criticism of the early publications should be mitigated by the nascent state of radiochemistry, highlights the prudence of Debiernes claims in the original papers, and notes that nobody can contend that Debiernes substance did not contain actinium. Debierne, who is now considered by the vast majority of historians as the discoverer, lost interest in the element and left the topic. Giesel, on the other hand, can rightfully be credited with the first preparation of radiochemically pure actinium and with the identification of its atomic number 89. | 1 | Applied and Interdisciplinary Chemistry |
A catalyst is a substance that alters the rate of a chemical reaction but it remains chemically unchanged afterwards. The catalyst increases the rate of the reaction by providing a new reaction mechanism to occur with in a lower activation energy. In autocatalysis a reaction product is itself a catalyst for that reaction leading to positive feedback. Proteins that act as catalysts in biochemical reactions are called enzymes. Michaelis–Menten kinetics describe the rate of enzyme mediated reactions. A catalyst does not affect the position of the equilibrium, as the catalyst speeds up the backward and forward reactions equally.
In certain organic molecules, specific substituents can have an influence on reaction rate in neighbouring group participation. | 0 | Theoretical and Fundamental Chemistry |
Because Grignard reagents are so sensitive to moisture and oxygen, many methods have been developed to test the quality of a batch. Typical tests involve titrations with weighable, anhydrous protic reagents, e.g. menthol in the presence of a color-indicator. The interaction of the Grignard reagent with phenanthroline or 2,2'-biquinoline causes a color change. | 0 | Theoretical and Fundamental Chemistry |
The first pathogenic mutation in mitochondrial DNA was identified in 1988; from that time to 2016, around 275 other disease-causing mutations were identified. | 1 | Applied and Interdisciplinary Chemistry |
The electrochemical reduction of carbon dioxide, also known as CO2RR, is the conversion of carbon dioxide () to more reduced chemical species using electrical energy. It represents one potential step in the broad scheme of carbon capture and utilization.
CO2RR can produce diverse compounds including formate (HCOO), carbon monoxide (CO), methane (CH), ethylene (CH), and ethanol (CHOH). The main challenges are the relatively high cost of electricity (vs petroleum) and that CO is often contaminated with O and must be purified before reduction.
The first examples of CO2RR are from the 19th century, when carbon dioxide was reduced to carbon monoxide using a zinc cathode. Research in this field intensified in the 1980s following the oil embargoes of the 1970s. As of 2021, pilot-scale carbon dioxide electrochemical reduction is being developed by several companies, including Siemens, Dioxide Materials, Twelve and [https://www.gigkarasek.com/en/renewable-carbon-solutions GIGKarasek]. The techno-economic analysis was recently conducted to assess the key technical gaps and commercial potentials of the carbon dioxide electrolysis technology at near ambient conditions. | 1 | Applied and Interdisciplinary Chemistry |
* 2015 (forthcoming) Providence, RI, September 27-October 2, 2015
* 2014 (forthcoming) Reno, NV, September 28-October 3, 2014
* 2013 (forthcoming) Milwaukee, WI, September 29-October 3, 2013, which will be the 40th annual meeting of the FACSS organization
* 2012 - Kansas City, MO
* 2011 - Reno, NV
*2010 - Raleigh, NC
*2009 - Louisville, KY
*2008 - Reno, NV
*2007 - Memphis, TN
*2006 - Lake Buena Vista, FL
*2005 - Quebec City, Canada
*2004 - Portland, OR
*2003 - Ft. Lauderdale, FL
*2002 - Providence, RI
*2001 - Detroit, Michigan
*2000 - Nashville, Tennessee
*1999 - Vancouver, BC
*1998 - Austin, TX
Accompanying each conference, attendees receive a final program book of abstracts which includes the schedule of talks, profiles of award winners, a list of exhibitors, and much more. Copies of these final programs for all forty of the conferences held by FACSS are available for download as .pdf files from the FACSS website, under [https://web.archive.org/web/20130827101831/http://facss.org/facss-presents/past-events Past Events]. | 0 | Theoretical and Fundamental Chemistry |
In the binuclear ion each bridging water molecule donates one pair of electrons to one cobalt ion and another pair to the other cobalt ion. The Co-O (bridging) bond lengths are 213 picometers, and the Co-O (terminal) bond lengths are 10 pm shorter.
The complexes and contain metal-metal bonds. | 0 | Theoretical and Fundamental Chemistry |
Internal conversion is favored whenever the energy available for a gamma transition is small, and it is also the primary mode of de-excitation for 0→0 (i.e. E0) transitions. The 0→0 transitions occur where an excited nucleus has zero-spin and positive parity, and decays to a ground state which also has zero-spin and positive parity (such as all nuclides with even number of protons and neutrons). In such cases, de-excitation cannot take place by emission of a gamma ray, since this would violate conservation of angular momentum, hence other mechanisms like IC predominate. This also shows that internal conversion (contrary to its name) is not a two-step process where a gamma ray would be first emitted and then converted.
The competition between IC and gamma decay is quantified in the form of the internal conversion coefficient which is defined as where is the rate of conversion electrons and is the rate of gamma-ray emission observed from a decaying nucleus. For example, in the decay of the excited state at 35 keV of Te (which is produced by the decay of I), 7% of decays emit energy as a gamma ray, while 93% release energy as conversion electrons. Therefore, this excited state of has an IC coefficient of .
For increasing atomic number (Z) and decreasing gamma-ray energy, IC coefficients increase. For example, calculated IC coefficients for electric dipole (E1) transitions, for Z = 40, 60, and 80, are shown in the figure.
The energy of the emitted gamma ray is a precise measure of the difference in energy between the excited states of the decaying nucleus. In the case of conversion electrons, the binding energy must also be taken into account: The energy of a conversion electron is given as , where and are the energies of the nucleus in its initial and final states, respectively, while is the binding energy of the electron. | 0 | Theoretical and Fundamental Chemistry |
In metalworking and jewelry making, casting is a process in which a liquid metal is delivered into a mold (usually by a crucible) that contains a negative impression (i.e., a three-dimensional negative image) of the intended shape. The metal is poured into the mold through a hollow channel called a sprue. The metal and mold are then cooled, and the metal part (the casting) is extracted. Casting is most often used for making complex shapes that would be difficult or uneconomical to make by other methods.
Casting processes have been known for thousands of years, and have been widely used for sculpture (especially in bronze), jewelry in precious metals, and weapons and tools. Highly engineered castings are found in 90 percent of durable goods, including cars, trucks, aerospace, trains, mining and construction equipment, oil wells, appliances, pipes, hydrants, wind turbines, nuclear plants, medical devices, defense products, toys, and more.
Traditional techniques include lost-wax casting (which may be further divided into centrifugal casting, and vacuum assist direct pour casting), plaster mold casting and sand casting.
The modern casting process is subdivided into two main categories: expendable and non-expendable casting. It is further broken down by the mold material, such as sand or metal, and pouring method, such as gravity, vacuum, or low pressure. | 1 | Applied and Interdisciplinary Chemistry |
Johann Heinrich Pott, a student of one of Stahl's students, expanded the theory and attempted to make it much more understandable to a general audience. He compared phlogiston to light or fire, saying that all three were substances whose natures were widely understood but not easily defined. He thought that phlogiston should not be considered as a particle but as an essence that permeates substances, arguing that in a pound of any substance, one could not simply pick out the particles of phlogiston. Pott also observed the fact that when certain substances are burned they increase in mass instead of losing the mass of the phlogiston as it escapes; according to him, phlogiston was the basic fire principle and could not be obtained by itself. Flames were considered to be a mix of phlogiston and water, while a phlogiston-and-earthy mixture could not burn properly. Phlogiston permeates everything in the universe, it could be released as heat when combined with an acid. Pott proposed the following properties:
# The form of phlogiston consists of a circular movement around its axis.
# When homogeneous it cannot be consumed or dissipated in a fire.
# The reason it causes expansion in most bodies is unknown, but not accidental. It is proportional to the compactness of the texture of the bodies or to the intimacy of their constitution.
# The increase of weight during calcination is evident only after a long time, and is due either to the fact that the particles of the body become more compact, decrease the volume and hence increase the density as in the case of lead, or those little heavy particles of air become lodged in the substance as in the case of powdered zinc oxide.
# Air attracts the phlogiston of bodies.
# When set in motion, phlogiston is the chief active principle in nature of all inanimate bodies.
# It is the basis of colours.
# It is the principal agent in fermentation.
Pott's formulations proposed little new theory; he merely supplied further details and rendered existing theory more approachable to the common man. | 1 | Applied and Interdisciplinary Chemistry |
The three most-cited papers published by the journal are:
# Research Article: Development of a novel autothermal reforming process and its economics for clean hydrogen production, Volume 1, Issue 1–2, Nov-Dec 2006, Pages: 5–12, Chen ZX, Elnashaie SSEH
# Research Article: Review: examining the use of different feedstock for the production of biodiesel, Volume 2, Issue 5, Sep-Oct 2007, Pages: 480–486, Behzadi S, Farid MM
# Research Article: The forces at work in colloidal self-assembly: a review on fundamental interactions between colloidal particles, Volume 3, Issue 3, May-Jun 2008, Pages: 255–268, Li Q, Jonas U, Zhao XS, et al. | 1 | Applied and Interdisciplinary Chemistry |
The 4n+2 chain of uranium-238 is called the "uranium series" or "radium series". Beginning with naturally occurring uranium-238, this series includes the following elements: astatine, bismuth, lead, mercury, polonium, protactinium, radium, radon, thallium, and thorium. All are present, at least transiently, in any natural uranium-containing sample, whether metal, compound, or mineral. The series terminates with lead-206.
The total energy released from uranium-238 to lead-206, including the energy lost to neutrinos, is 51.7 MeV. | 0 | Theoretical and Fundamental Chemistry |
Pipe is made out of many types of material including ceramic, glass, fiberglass, many metals, concrete and plastic. In the past, wood and lead (Latin plumbum, from which comes the word plumbing) were commonly used.
Typically metallic piping is made of steel or iron, such as unfinished, black (lacquer) steel, carbon steel, stainless steel, galvanized steel, brass, and ductile iron. Iron based piping is subject to corrosion if used within a highly oxygenated water stream. Aluminum pipe or tubing may be utilized where iron is incompatible with the service fluid or where weight is a concern; aluminum is also used for heat transfer tubing such as in refrigerant systems. Copper tubing is popular for domestic water (potable) plumbing systems; copper may be used where heat transfer is desirable (i.e. radiators or heat exchangers). Inconel, chrome moly, and titanium steel alloys are used in high temperature and pressure piping in process and power facilities. When specifying alloys for new processes, the known issues of creep and sensitization effect must be taken into account.
Lead piping is still found in old domestic and other water distribution systems, but is no longer permitted for new potable water piping installations due to its toxicity. Many building codes now require that lead piping in residential or institutional installations be replaced with non-toxic piping or that the tubes' interiors be treated with phosphoric acid. According to a senior researcher and lead expert with the Canadian Environmental Law Association, "...there is no safe level of lead [for human exposure]". In 1991 the US EPA issued the Lead and Copper Rule, a federal regulation which limits the concentration of lead and copper allowed in public drinking water, as well as the permissible amount of pipe corrosion occurring due to the water itself. In the US it is estimated that 6.5 million lead service lines (pipes that connect water mains to home plumbing) installed before the 1930s are still in use.
Plastic tubing is widely used for its light weight, chemical resistance, non-corrosive properties, and ease of making connections. Plastic materials include polyvinyl chloride (PVC), chlorinated polyvinyl chloride (CPVC), fibre reinforced plastic (FRP), reinforced polymer mortar (RPMP), polypropylene (PP), polyethylene (PE), cross-linked high-density polyethylene (PEX), polybutylene (PB), and acrylonitrile butadiene styrene (ABS), for example. In many countries, PVC pipes account for most pipe materials used in buried municipal applications for drinking water distribution and wastewater mains.
Pipe may be made from concrete or ceramic, usually for low-pressure applications such as gravity flow or drainage. Pipes for sewage are still predominantly made from concrete or vitrified clay. Reinforced concrete can be used for large-diameter concrete pipes. This pipe material can be used in many types of construction, and is often used in the gravity-flow transport of storm water. Usually such pipe will have a receiving bell or a stepped fitting, with various sealing methods applied at installation. | 1 | Applied and Interdisciplinary Chemistry |
* [https://www.youtube.com/watch?v=7aRKAXD4dAg introduction to NMR and MRI]
* [http://www.vega.org.uk/video/programme/21 Richard Ernst, NL – Developer of multidimensional NMR techniques] Freeview video provided by the Vega Science Trust.
* [http://www.vega.org.uk/video/programme/115 An Interview with Kurt Wuthrich] Freeview video by the Vega Science Trust (Wüthrich was awarded a Nobel Prize in Chemistry in 2002 "for his development of nuclear magnetic resonance spectroscopy for determining the three-dimensional structure of biological macromolecules in solution").
; Other
* [https://www.spectroscopyeurope.com/article/spotlight-nuclear-magnetic-resonance-timeless-technique Spotlight on nuclear magnetic resonance: a timeless technique] | 0 | Theoretical and Fundamental Chemistry |
Addiction to indoor tanning has been recognized as a psychiatric disorder. The disorder is characterized as excessive indoor tanning that causes the subject personal distress; it has been associated with anxiety, eating disorders and smoking. The media has described the addiction as tanorexia. According to the Canadian Pediatric Society, "repeated UVR exposures, and the use of indoor tanning beds specifically, may have important systemic and behavioural consequences, including mood changes, compulsive disorders, pain and physical dependency." | 0 | Theoretical and Fundamental Chemistry |
POCIS can be deployed in a wide range of aquatic environments including stagnant pools, rivers, springs, estuarine systems, and wastewater streams. However, there has been little research into the use of POCIS in strictly marine environments. Prior to deployment of a POCIS device, it is essential to select a study site that will maximize the effectiveness of the sampler. Selecting an area that is shaded will help prevent light sensitive chemicals from being degrading. The site should also allow the sampler to be submerged in the water without being buried in the sediment. It is ideal to place the sampler in moving water in order to increase sampling rates, however, areas with an extremely turbulent water flow should be avoided as to prevent damage to the POCIS device. Passive samplers are very vulnerable to vandalism and it is therefore important to secure the sampler in areas that are not easily visible and that are away from areas frequently used by people.
POCIS samplers can be deployed for a period of time ranging from weeks to months. The shortest deployment lengths are typically 7 days but average 2–3 months. It is important to have a long enough deployment period to allow for adequate detection of contaminants at ambient environmental concentrations. Often, the two different types of POCIS devices will be deployed together in order to provide the greatest understanding of contamination. It is also important to deploy enough POCIS devices to ensure a large enough sample of contaminant is recovered for chemical analysis. An estimate or the number of samplers needed at a given site can be determined by the following equation.
::::R x t x n x C x P x E > MQL x V
::where
::*C is the predicted environmental concentration of the contaminant
::*t is the deployment time in days
::*R is sampling rate in liters of water extracted by the passive sampler per day(L/day)
::*P is the overall method recovery for the analyte (expressed as a factor of one; ::therefore 0.9 is used for 90 percent recovery),
::*n is the number of passive samplers combined into a single sample,
::*E is the fraction of the total sample extract which is injected into the ::instrument for quantification
::*MQL is the method quantification limit
::*V is the volume of standard injection (commonly 1 μL). | 0 | Theoretical and Fundamental Chemistry |
*[http://www.nature.com/nature/journal/v446/n7134/full/446391a.html Bergman FAQ in Nature on C-H activation (2007)]
*[https://web.archive.org/web/20160303224214/http://stoltz.caltech.edu/seminars/2004_Ramtohul.pdf Literature Presentation by Ramtohul in Stoltz group on applications of C-H activation]
*[http://www.chem.tamu.edu/rgroup/marcetta/chem636/Presentations/C-H%20Activation=Sam.pdf Powerpoint on John Bercaw's work]
*[http://www.nsf-cchf.com/index.html Center for Selective C-H Functionalization] | 0 | Theoretical and Fundamental Chemistry |
*The World's 500 Most influential Arabs in 2013 in the “scientist inventor” category for his outstanding contributions in the areas of innovation, research and community service.
*The World's 500 Most influential Arabs in 2012.
*Arabian Business Achievement Awards 2011 – Science and Innovation Award 2011
*First prize in Tomohat Shabab TV program(Young Innovation Award), Sharjah TV 2011
*First place in the “Voting for the Best Project” category, 4th UAE Software Development Trade Show, Wollongong University, Dubai 2010
*Third place in the “Business Judging” category, 4th UAE Software Development Trade Show, Wollongong University, Dubai 2010
*Best Research Paper in Faculty of Engineering, The Fifth Approach Student Scientific Conference 2009
*Best Project on Biomedical Day 2008. | 0 | Theoretical and Fundamental Chemistry |
Finally, biology is not the sole domain of MAs. The fields of supramolecular chemistry and nanotechnology each have areas that have developed to elaborate and extend the principles first demonstrated in biologic MAs. Of particular interest in these areas has been elaborating the fundamental processes of molecular machines, and extending known machine designs to new types and processes. | 1 | Applied and Interdisciplinary Chemistry |
The cold blob in the North Atlantic (also called the North Atlantic warming hole) describes a cold temperature anomaly of ocean surface waters, affecting the Atlantic Meridional Overturning Circulation (AMOC) which is part of the thermohaline circulation, possibly related to global warming-induced melting of the Greenland ice sheet. | 0 | Theoretical and Fundamental Chemistry |
In chapter 7, Umaswati presents the Jaina vows and explains their value in stopping karmic particle inflow to the soul. The vows, with their respective translations by Nathmal Tatia, are
:*ahimsa (abstinence from violence)
:* anirta (abstinence from falsehood)
:* asteya (abstinence from stealing)
:* brahmacharya (abstinence from carnality), and
:* aparigraha (abstinence from possessiveness). | 1 | Applied and Interdisciplinary Chemistry |
Examples of trap crops include:
* Alfalfa planted in strips among cotton, to draw away lygus bugs, while castor beans surround the field, or tobacco planted in strips among it, to protect from the budworm Heliothis.
* Rose enthusiasts often plant Pelargonium geraniums among their rosebushes because Japanese beetles are drawn to the geraniums, which are toxic to them.
* Chervil is used by gardeners to protect vegetable plants from slugs.
* Rye, sesbania, and sicklepod are used to protect soybeans from corn seeding maggots, stink bugs, and velvet green caterpillars, respectively.
* Mustard and alfalfa planted near strawberries to attract lygus bugs, a method pioneered by Jim Cochran.
* Blue Hubbard squash is planted near cucurbit crops to attract squash vine borer, squash bugs, and both spotted and striped Cucumber beetle.
* In push-pull agricultural pest management, napier grass or signal grass (Brachiaria brizantha) are used as trap crops to attract stemboring moths such as Chilo partellus.
Trap crops can be planted around the circumference of the field to be protected, which is assumed to act as a barrier for entry by pests, or they can be interspersed among the main crop, for example being planted every ninth row. Planting crops in rows helps facilitate supplemental management practices that prevent insect pest dispersal back into the main field, such as driving a vehicle above the trap crop which then removes insect pests by vacuuming them off of the trap crop row or targeted insecticides, which are only deployed on the trap crop. Even if pesticides are used to control insects on the trap crop, total pesticides are greatly reduced in this scenario over conventional agricultural pesticide applications because they are only deployed on a small portion of the farm (the trap crop). Other strategies that prevent dispersal of insect pests back into the main crop include cutting the trap plants, applying predators or parasitoids to the trap plant that eat the pest, and planting a high ratio of trap plants to other plants.
Trap crops, when used on an industrial scale, are generally planted at a key time in the pest's life-cycle, and then destroyed before that life-cycle finishes and the pest might have transferred from the trap plants to the main crop. | 1 | Applied and Interdisciplinary Chemistry |
Since the method requires no binder, balsam or glue, the physical properties of the bound object are the same as the objects joined. Typically, glues and binders are more heat sensitive or have undesirable properties compared to the actual bodies being joined. The use of optical contact bonding allows the production of a final product with properties as good as the bulk solid. This can include temperature and chemical resistances, spectral absorption properties and reduced contamination from bonding materials. | 0 | Theoretical and Fundamental Chemistry |
In the United States, 49% of the 250,000 valve replacement procedures performed annually involve a mechanical valve implant. The most widely used valve is a bileaflet disc heart valve or St. Jude valve. The mechanics involve two semicircular discs moving back and forth, with both allowing the flow of blood as well as the ability to form a seal against backflow. The valve is coated with pyrolytic carbon and secured to the surrounding tissue with a mesh of woven fabric called Dacron (du Ponts trade name for polyethylene terephthalate). The mesh allows for the bodys tissue to grow, while incorporating the valve. | 1 | Applied and Interdisciplinary Chemistry |
The drinking bird is an exhibition of several physical laws and is therefore a staple of basic chemistry and physics education. These include:
* The dichloromethane with a low boiling point ( under standard pressure p Pa – as the drinking bird is first evacuated, partially filled and sealed, the pressure and thus the boiling point in the drinking bird will be different), gives the heat engine the ability to extract motion from low temperatures. The drinking bird is a heat engine that works at room temperature.
* The combined gas law, which establishes a proportional relationship between temperature and pressure exerted by a gas in a constant volume.
* The ideal gas law, which establishes a proportional relationship between number of gas particles and pressure in a constant volume.
* The Maxwell–Boltzmann distribution, which establishes that molecules in a given space at a given temperature vary in energy level, and therefore can exist in multiple phases (solid/liquid/gas) at a single temperature.
* Heat of vaporization (or condensation), which establishes that substances absorb (or give off) heat when changing state at a constant temperature.
* Torque and center of mass.
* Capillary action of the wicking felt.
* Wet-bulb temperature: The temperature difference between the head and body depends on the relative humidity of the air.
The operation of the bird is also affected by relative humidity.
By using a water-ethanol mixture instead of water, the effect of different rates of evaporation can be demonstrated.
By considering the difference between the wet and dry bulb temperatures, it is possible to develop a mathematical expression to calculate the maximum work that can be produced from a given amount of water "drunk". Such analysis is based on the definition of the Carnot heat engine efficiency and the psychrometric concepts. | 0 | Theoretical and Fundamental Chemistry |
A structural feature common to all IAP family proteins is that they all contain at least one baculoviral IAP repeat (BIR) domain characterized by a conserved zinc-coordinating Cys/His motif at the N-terminal half of the protein.
Survivin is distinguished from other IAP family members in that it has only one BIR domain. The mice and human BIR domain of survivin are very similar structurally except for two differences that may affect function variability. The human survivin also contains an elongated C-terminal helix comprising 42 amino acids. Survivin is 16.5 kDa large and is the smallest member of the IAP family.
X-ray crystallography has shown two molecules of human survivin coming together to form a bowtie-shape dimer through a hydrophobic interface. This interface includes N-terminal residues 6-10 just before the BIR domain region and the 10 residue region connecting the BIR domain to the C-terminal helix. The structural integrity of the determined crystal structure of survivin is quite reliable, as physiological conditions were used to obtain the images. | 1 | Applied and Interdisciplinary Chemistry |
The multiple objective optimization problems involve computing the tradeoff between the costs and benefits resulting in a set of solutions that can be used for sensitivity analysis and tested in different scenarios. But there is no single optimal solution that will satisfy the global optimality of both objectives. As both objectives are to some extent contradictory, it is not possible to improve one objective without sacrificing the other. It is necessary in some cases use a different approach. (e.g. Pareto Analysis), and choose the best combination. | 1 | Applied and Interdisciplinary Chemistry |
Since glyceroneogenesis is related to lipid regulation, it can be found in adipose tissue and the liver. In adipose tissue, glyceroneogenesis restrains the release of free fatty acids (FFA) by re-esterifying them. In the liver, triglycerides are synthesized for lipid distribution. | 1 | Applied and Interdisciplinary Chemistry |
cAMP was discovered by Earl Sutherland and Ted Rall in the mid 1950s. cAMP is considered a secondary messenger along with Ca. Sutherland won the Nobel Prize in 1971 for his discovery of the mechanism of action of epinephrine in glycogenolysis, that requires cAMP as secondary messenger. | 1 | Applied and Interdisciplinary Chemistry |
Similar to the ring-formation behavior in the carbene addition reaction of C=C double bonds, diphosphene can form a P-C-P three-membered ring with dihalocarbene or . Diphosphiranes can further rearrange to 1,3-diphospha-allene via ring opening reactions by using MeLi or n-BuLi. | 0 | Theoretical and Fundamental Chemistry |
The active zone or synaptic active zone is a term first used by Couteaux and Pecot-Dechavassinein in 1970 to define the site of neurotransmitter release. Two neurons make near contact through structures called synapses allowing them to communicate with each other. As shown in the adjacent diagram, a synapse consists of the presynaptic bouton of one neuron which stores vesicles containing neurotransmitter (uppermost in the picture), and a second, postsynaptic neuron which bears receptors for the neurotransmitter (at the bottom), together with a gap between the two called the synaptic cleft (with synaptic adhesion molecules, SAMs, holding the two together). When an action potential reaches the presynaptic bouton, the contents of the vesicles are released into the synaptic cleft and the released neurotransmitter travels across the cleft to the postsynaptic neuron (the lower structure in the picture) and activates the receptors on the postsynaptic membrane.
The active zone is the region in the presynaptic bouton that mediates neurotransmitter release and is composed of the presynaptic membrane and a dense collection of proteins called the cytomatrix at the active zone (CAZ). The CAZ is seen under the electron microscope to be a dark (electron dense) area close to the membrane. Proteins within the CAZ tether synaptic vesicles to the presynaptic membrane and mediate synaptic vesicle fusion, thereby allowing neurotransmitter to be released reliably and rapidly when an action potential arrives. | 1 | Applied and Interdisciplinary Chemistry |
PyAOP ((7-Azabenzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate) is a coupling reagent used in solid phase peptide synthesis. It is a derivative of the HOAt family of coupling reagents. It is preferred over HATU, because it does not side react at the N-terminus of the peptide. Compared to the HOBt derivates, PyAOP (and HOAt in general) are more reactive due to the additional nitrogen. | 1 | Applied and Interdisciplinary Chemistry |
The distinction between prokaryotes and eukaryotes was firmly established by the microbiologists Roger Stanier and C. B. van Niel in their 1962 paper The concept of a bacterium (though spelled procaryote and eucaryote there). That paper cites Édouard Chattons 1937 book Titres et Travaux Scientifiques' for using those terms and recognizing the distinction. One reason for this classification was so that what was then often called blue-green algae (now called cyanobacteria) would not be classified as plants but grouped with bacteria. | 1 | Applied and Interdisciplinary Chemistry |
Streptavidin is a tetrameric protein expressed in Streptomyces avidinii. Because of Streptavidin's high affinity for vitamin H (biotin), Streptavidin is commonly used in the fields of molecular biology and biotechnology. The Strep-tag was originally selected from a genetic library to specifically bind to a proteolytically truncated "core" version of streptavidin. Over the years, the Strep-tag was systemically optimized, to permit a greater flexibility in the choice of attachment site. Further, its interaction partner, Streptavidin, was also optimized to increase peptide-binding capacity, which resulted in the development of Strep-Tactin. The binding affinity of Strep-tag to Strep-Tactin is nearly 100 times higher than from Strep-tag to Streptavidin. The so-called Strep-tag system, consisting of Strep-tag and Strep-Tactin, has proven particularly useful for the functional isolation and analysis of protein complexes in proteome research. | 1 | Applied and Interdisciplinary Chemistry |
Both p90 and p70 Rsk phosphorylate ribosomal protein s6, part of the translational machinery, but several other substrates have been identified, including other ribosomal proteins. Cytosolic substrates of p90 include protein phosphatase 1; glycogen synthase kinase 3 (GSK3); L1 CAM, a neural cell adhesion molecule; Son of Sevenless, the Ras exchange factor; and Myt1, an inhibitor of cdc2.
RSK phosphorylation of SOS1 (Son of Sevenless) at Serines 1134 and 1161 creates 14-3-3 docking site. This interaction of phospho SOS1 and 14-3-3 negatively regulates Ras-MAPK pathway.
p90 also regulates transcription factors including cAMP response element-binding protein (CREB); estrogen receptor-α (ERα); IκBα/NF-κB; and c-Fos. | 1 | Applied and Interdisciplinary Chemistry |
Geological samples, such as drill cores, can be rapidly mapped for nearly all minerals of commercial interest with hyperspectral imaging. Fusion of SWIR and LWIR spectral imaging is standard for the detection of minerals in the feldspar, silica, calcite, garnet, and olivine groups, as these minerals have their most distinctive and strongest spectral signature in the LWIR regions.
Hyperspectral remote sensing of minerals is well developed. Many minerals can be identified from airborne images, and their relation to the presence of valuable minerals, such as gold and diamonds, is well understood. Currently, progress is towards understanding the relationship between oil and gas leakages from pipelines and natural wells, and their effects on the vegetation and the spectral signatures. Recent work includes the PhD dissertations of Werff and Noomen. | 0 | Theoretical and Fundamental Chemistry |
Scintillation detectors uses a photo luminescent source (such as ZnS) which interacts with radiation. When a radioactive particle decays and strikes the photo luminescent material a photon is released. This photon is multiplied in a photomultiplier tube which converts light into an electrical signal. This signal is then processed and converted into a channel. By comparing the number of counts to the energy level (typically in keV or MeV) the type of decay can be determined. | 0 | Theoretical and Fundamental Chemistry |
The nanocar is a molecule designed in 2005 at Rice University by a group headed by Professor James Tour. Despite the name, the original nanocar does not contain a molecular motor, hence, it is not really a car. Rather, it was designed to answer the question of how fullerenes move about on metal surfaces; specifically, whether they roll or slide (they roll).
The molecule consists of an H-shaped chassis with fullerene groups attached at the four corners to act as wheels.
When dispersed on a gold surface, the molecules attach themselves to the surface via their fullerene groups and are detected via scanning tunneling microscopy. One can deduce their orientation as the frame length is a little shorter than its width.
Upon heating the surface to 200 °C the molecules move forward and back as they roll on their fullerene "wheels". The nanocar is able to roll about because the fullerene wheel is fitted to the alkyne "axle" through a carbon-carbon single bond. The hydrogen on the neighboring carbon is no great obstacle to free rotation. When the temperature is high enough, the four carbon-carbon bonds rotate and the car rolls about. Occasionally the direction of movement changes as the molecule pivots. The rolling action was confirmed by Professor Kevin Kelly, also at Rice, by pulling the molecule with the tip of the STM. | 0 | Theoretical and Fundamental Chemistry |
Protein folding in a cell is a highly complex process that involves transport of the newly synthesized proteins to appropriate cellular compartments through targeting, permanent misfolding, temporarily unfolded states, post-translational modifications, quality control, and formation of protein complexes facilitated by chaperones.
Some proteins need the assistance of chaperone proteins to fold properly. It has been suggested that this disproves Anfinsen's dogma. However, the chaperones do not appear to affect the final state of the protein; they seem to work primarily by preventing aggregation of several protein molecules prior to the final folded state of the protein. However, at least some chaperones are required for the proper folding of their subject proteins.
Many proteins can also undergo aggregation and misfolding. For example, prions are stable conformations of proteins which differ from the native folding state. In bovine spongiform encephalopathy, native proteins re-fold into a different stable conformation, which causes fatal amyloid buildup. Other amyloid diseases, including Alzheimers disease and Parkinsons disease, are also exceptions to Anfinsen's dogma.
Some proteins have multiple native structures, and change their fold based on some external factors. For example, the KaiB protein complex switches fold throughout the day, acting as a clock for cyanobacteria. It has been estimated that around 0.5–4% of PDB proteins switch folds. The switching between alternative structures is driven by interactions of the protein with small ligands or other proteins, by chemical modifications (such as phosphorylation) or by changed environmental conditions, such as temperature, pH or membrane potential. Each alternative structure may either correspond to the global minimum of free energy of the protein at the given conditions or be kinetically trapped in a higher local minimum of free energy. | 1 | Applied and Interdisciplinary Chemistry |
For example, hydrogen fluoride—which has three lone pairs on the F atom but only one H atom—can form only two bonds; (ammonia has the opposite problem: three hydrogen atoms but only one lone pair). | 0 | Theoretical and Fundamental Chemistry |
The red chromophore, which is generated by cleavage of the peptide backbone, has an absorption maxima at 571 nm and an emission maxima at 581 nm, in its anionic form. The break in the peptide backbone that leads to this chromophore is between His-62 Nα and Cα. The observed red fluorescence occurs due to an extension of the chromophore's π-conjugation where the His-62 imidazole ring connects to the imidazolinone. The hydrogen bond patterns of the red and green chromophores are almost identical. | 1 | Applied and Interdisciplinary Chemistry |
The Sharpless epoxidation, developed by K. Barry Sharpless in 1980, has been utilized for the kinetic resolution of a racemic mixture of allylic alcohols. While extremely effective at resolving a number of allylic alcohols, this method has a number of drawbacks. Reaction times can run as long as 6 days, and the catalyst is not recyclable. However, the Sharpless asymmetric epoxidation kinetic resolution remains one of the most effective synthetic kinetic resolutions to date. A number of different tartrates can be used for the catalyst; a representative scheme is shown below utilizing diisopropyl tartrate. This method has seen general use on a number of secondary allylic alcohols.
Sharpless asymmetric dihydroxylation has also seen use as a method for kinetic resolution. This method is not widely used, however, since the same resolution can be accomplished in different manners that are more economical. Additionally, the Shi epoxidation has been shown to affect kinetic resolution of a limited selection of olefins. This method is also not widely used, but is of mechanistic interest. | 0 | Theoretical and Fundamental Chemistry |
During the Eastern Front (World War II) or the Great Patriotic War, the plant was almost completely destroyed (immediately before the start of the battles for the liberation of the city, on September 6–7, 1943. The underground workers operating at the plant, led by I.I. Kholoshin, including prisoners of war and assistants from the factory guards, disarmed the factory guards, occupied and saved warehouses, a garage, a telephone exchange and a special factory workshop from destruction).. Already in the fall of 1943, the restoration of the plant began. After the end of the war the plant was reconstructed and expanded. | 1 | Applied and Interdisciplinary Chemistry |
Interfacial and surface tension can be characterized by classical methods such as the
-pendant or spinning drop method.
Dynamic surface tensions, i.e. surface tension as a function of time, can be obtained by the maximum bubble pressure apparatus
The structure of surfactant layers can be studied by ellipsometry or X-ray reflectivity.
Surface rheology can be characterized by the oscillating drop method or shear surface rheometers such as double-cone, double-ring or magnetic rod shear surface rheometer. | 0 | Theoretical and Fundamental Chemistry |
Traumatic brain injury is a major neurological disorder when the brain is injured by traumatic force such as a bluent trauma or blast over-pressure wave.
For the disorders of central nervous system, the neuronal cell body-located Ubiquitin carboxy-terminal hydrolase L1 (UCH-L1) and Glial fibrillary acidic protein (GFAP) are the first-in-class FDA cleared blood-based biomarker test for mild traumatic brain injury (TBI) with potential brain lesions. These tandem biomarkers were first discovered by Dr. Kevin K. Wang and Dr. Ronald. L. Hayes’ neuroscience laboratories at the McKnight Brain Institute of University of Florida from 2003-2007). Here, traumatic brain injury (TBI) blood-based biomarker test consisted of measuring the levels of neuronal (UCH-L1) and astroglial GFAP to aid in the diagnosis of the presence of cranial lesion(s) among moderate to mild TBI patients that is(are) otherwise only diagnosable with the use of a CT scan of the head.
Banyan Biomarkers, Inc., a company co-founded by Drs. Wang, Hayes and Nancy Denslow developed an optimized sandwich chemiluminescent ELISA for UCH-L1/GFAP, termed Brain Trauma Indicator™ (BTI); it contains two kits - one for each of the two biomarkers as chemiluminescence assays on the Synergy 2 Multi-mode Reader (BioTek). These assays were the basis of a pivotal TBI clinical trial called ALERT-TBI (ClinicalTrials.gov #NCT01426919). Over 1,900 adult TBI subjects with a Glasgow Coma Scale of (GCS) 9-15 (mind TBI) were recruited with blood samples drawn within 12 hours of injury to determine if the UCH-L1/GFAP tandem test can aid in the diagnosis of ta presence a cranial lesion that is otherwise only diagnosable with the use of a CT scan of the head. The results of the study show BTI has high sensitivity (97.6%) and negative predictive value (NPV) (99.6%). In February, 2018, FDA cleared the use the BTI for this mild TBI indication. | 1 | Applied and Interdisciplinary Chemistry |
The diameter of the microcapsules is an important factor that influences both the immune response towards the cell microcapsules as well as the mass transport across the capsule membrane. Studies show that the cellular response to smaller capsules is much lesser as compared to larger capsules and in general the diameter of the cell loaded microcapsules should be between 350-450 µm so as to enable effective diffusion across the semi-permeable membrane. | 1 | Applied and Interdisciplinary Chemistry |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.