instruction stringlengths 225 2.35k | input stringlengths 89 1.5k | response stringclasses 698 values |
|---|---|---|
<Instruct>: Given the context 'More than half of human genes are known to have alternative polyadenylation (31).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: suborder
B: species
C: human (aka homo sapiens)
D: animals (aka metazoa)
E: macrobiotus sapiens
F: None of the above. | [C] |
<Instruct>: Given the context 'More than half of human genes are known to have alternative polyadenylation (31).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: species
B: animals (aka metazoa)
C: macrobiotus sapiens
D: suborder
E: None of the above. | [E] |
<Instruct>: Given the context 'Over two-thirds of human genes are thought to undergo alternative splicing (32).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: kingdom
B: homo sapiens (human) (aka homo sapiens)
C: suborder
D: genus
E: animals (aka metazoa)
F: None of the above. | [B] |
<Instruct>: Given the context 'Although, G-quadruplexes have been surveyed in the human genome with such techniques (34,35), there are no known user-friendly computational tools easily accessible to the public.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: mammals (aka mammalia)
B: human (aka homo sapiens)
C: kingdom
D: animals (aka metazoa)
E: primate (aka primates)
F: None of the above. | [B] |
<Instruct>: Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: peromyscus
B: placental mammals (aka eutheria)
C: homo sapiens (human) (aka homo sapiens)
D: mammals (aka mammalia)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: homo (humans) (aka homo)
G: mouse (aka mus musculus)
H: macrobiotus sapiens
I: mus (aka mus <subgenus>) (aka mus <subgenus>)
J: mice (aka mus sp.) (aka mus sp.)
K: None of the above. | [C; G] |
<Instruct>: Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: human (aka homo sapiens)
B: mus <subgenus> (mus (aka mus <subgenus>))
C: mice (aka mus sp.) (aka mus sp.)
D: cellular organisms (biota) (aka cellular organisms)
E: mouse (aka mus musculus)
F: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
G: this
H: avian (aka aves)
I: mus molossinus (aka mus musculus molossinus)
J: kingdom
K: None of the above. | [A; E] |
<Instruct>: Given the context 'For example, entering the gene ID 403437 results in downloading the Brca1 gene sequence for Canis familiaris.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [canis familiaris]
<Options>: A: canis lupus nubilus
B: canis domesticus (aka canis lupus familiaris)
C: canis variabilis (aka canis lupus variabilis)
D: felidae (cat family) (aka felidae)
E: canis
F: None of the above. | [B] |
<Instruct>: Given the context 'For example, the mouse version of the gene PTPRU, which is 69822 bases long, contains 94681 QGRS of length up to 45 bases.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mice (aka mus sp.) (aka mus sp.)
C: mus molossinus (aka mus musculus molossinus)
D: mus <subgenus> (mus (aka mus <subgenus>))
E: peromyscus
F: None of the above. | [A] |
<Instruct>: Given the context 'As an example, the Gene View for the human GREB1 is displayed in Figure 2, showing the table of gene information and product information for the first product (the output for all products may be seen in the supplementary material).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: human (aka homo sapiens)
B: macrobiotus sapiens
C: suborder
D: animals (aka metazoa)
E: this
F: None of the above. | [A] |
<Instruct>: Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis
Abstract
ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast; saccharomyces cerevisiae]
<Options>: A: saccharomyceta
B: saccharomyces hansenii (aka debaryomyces hansenii)
C: saccharomyces cerevisiae x saccharomyces mikatae
D: saccharomyces paradoxus
E: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
F: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
G: saccharomyces sp.
H: saccharomyces cerevisiae x saccharomyces paradoxus
I: None of the above. | [E; E] |
<Instruct>: Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis
Abstract
ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast; saccharomyces cerevisiae]
<Options>: A: budding yeasts & others (aka saccharomycotina)
B: mycoderma cerevisiae (aka saccharomyces cerevisiae)
C: saccharomyces cerevisiae x saccharomyces mikatae
D: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
E: saccharomyces albicans (aka candida albicans)
F: saccharomyces sp.
G: saccharomyces lactis (aka kluyveromyces lactis)
H: saccharomycodes
I: saccharomyces uvarum (saccharomyces bayanus var. uvarum) (aka saccharomyces uvarum)
J: None of the above. | [B; B] |
<Instruct>: Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast; saccharomyces cerevisiae]
<Options>: A: saccharomyces lactis (aka kluyveromyces lactis)
B: saccharomyces cerevisiae x saccharomyces mikatae
C: saccharomyces albicans (aka candida albicans)
D: saccharomyceta
E: baker's yeast (aka saccharomyces cerevisiae)
F: saccharomyces cerevisiae synthetic construct
G: saccharomyces cerevisiae x saccharomyces paradoxus
H: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
I: None of the above. | [E; E] |
<Instruct>: Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast; saccharomyces cerevisiae]
<Options>: A: saccharomyces hansenii (aka debaryomyces hansenii)
B: saccharomyces cerevisiae x saccharomyces paradoxus
C: saccharomyces cf. cerevisiae
D: saccharomyces cerevisiae x saccharomyces mikatae
E: saccharomyces albicans (aka candida albicans)
F: baker's yeast (aka saccharomyces cerevisiae)
G: saccharomyces lactis (aka kluyveromyces lactis)
H: None of the above. | [F; F] |
<Instruct>: Given the context 'In yeast cells there are more than 100 different snoRNAs playing important roles in rRNA modification and processing.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
B: saccharomyces lactis (aka kluyveromyces lactis)
C: candida/saccharomycetales (aka candida/saccharomycales clade)
D: saccharomycodes
E: saccharomyceta
F: None of the above. | [A] |
<Instruct>: Given the context 'The yeast protein was localized to the nucleus in a previous study (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: baker's yeast (aka saccharomyces cerevisiae)
B: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
C: saccharomyces hansenii (aka debaryomyces hansenii)
D: saccharomyces lactis (aka kluyveromyces lactis)
E: candida/saccharomycetales (aka candida/saccharomycales clade)
F: None of the above. | [A] |
<Instruct>: Given the context 'On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: mammals (aka mammalia)
B: probles
C: homo sapiens (human) (aka homo sapiens)
D: this
E: primate (aka primates)
F: None of the above. | [C] |
<Instruct>: Given the context 'On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: probles
B: this
C: mammals (aka mammalia)
D: primate (aka primates)
E: None of the above. | [E] |
<Instruct>: Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
B: suborder
C: species
D: saccharomyces hansenii (aka debaryomyces hansenii)
E: human (aka homo sapiens)
F: genus
G: humans (aka homo)
H: saccharomyces lactis (aka kluyveromyces lactis)
I: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
J: saccharomyceta
K: None of the above. | [E; A] |
<Instruct>: Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: macrobiotus sapiens
B: brewer's yeast (aka saccharomyces cerevisiae)
C: saccharomyces cf. cerevisiae
D: saccharomyceta
E: genus
F: primate (aka primates)
G: homo sapiens (human) (aka homo sapiens)
H: kingdom
I: saccharomyces lactis (aka kluyveromyces lactis)
J: saccharomyces sp.
K: None of the above. | [G; B] |
<Instruct>: Given the context 'MATERIALS AND METHODS
Yeast strains and media
The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast; s.cerevisiae]
<Options>: A: saccharomyces lactis (aka kluyveromyces lactis)
B: saccharomyces cerevisiae x saccharomyces paradoxus
C: saccharomyces sp.
D: budding yeasts & others (aka saccharomycotina)
E: saccharomyces albicans (aka candida albicans)
F: saccharomyces hansenii (aka debaryomyces hansenii)
G: mycoderma cerevisiae (aka saccharomyces cerevisiae)
H: saccharomycodes
I: true yeasts (aka saccharomycotina)
J: None of the above. | [G; G] |
<Instruct>: Given the context 'MATERIALS AND METHODS
Yeast strains and media
The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast; s.cerevisiae]
<Options>: A: true yeasts (aka saccharomycotina)
B: saccharomyces albicans (aka candida albicans)
C: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
D: mycoderma cerevisiae (aka saccharomyces cerevisiae)
E: saccharomyces hansenii (aka debaryomyces hansenii)
F: saccharomyceta
G: saccharomyces cf. cerevisiae
H: None of the above. | [D; D] |
<Instruct>: Given the context 'Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [schizosaccharomyces pombe]
<Options>: A: zygosaccharomyces sp.
B: fission yeasts (aka schizosaccharomycetaceae)
C: fission yeast (aka schizosaccharomyces pombe)
D: sphaerospermopsis (sphaerospermum) (aka sphaerospermopsis)
E: schizosaccharomyces
F: None of the above. | [C] |
<Instruct>: Given the context '[MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: mammals (aka mammalia)
B: placental mammals (aka eutheria)
C: animals (aka metazoa)
D: human (aka homo sapiens)
E: probles
F: None of the above. | [D] |
<Instruct>: Given the context '[MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: animals (aka metazoa)
B: placental mammals (aka eutheria)
C: mammals (aka mammalia)
D: probles
E: None of the above. | [E] |
<Instruct>: Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: avian (aka aves)
B: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
C: kingdom
D: true yeasts (aka saccharomycotina)
E: probles
F: saccharomyces hansenii (aka debaryomyces hansenii)
G: this
H: saccharomyceta
I: human (aka homo sapiens)
J: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
K: None of the above. | [I; B] |
<Instruct>: Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: saccharomycotina (budding yeasts & others) (aka saccharomycotina)
B: brewer's yeast (aka saccharomyces cerevisiae)
C: placental mammals (aka eutheria)
D: saccharomyces cerevisiae x saccharomyces mikatae
E: mammals (aka mammalia)
F: human (aka homo sapiens)
G: suborder
H: saccharomycodes
I: candida/saccharomycetales (aka candida/saccharomycales clade)
J: birds (aka aves)
K: None of the above. | [F; B] |
<Instruct>: Given the context 'The fragment of the human Enp1 homolog (amino acids 152–437) was also cloned into these vectors to generate pCW110, pCW114, pCW116 and pCW118.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: human (aka homo sapiens)
B: eutherian mammals (aka eutheria)
C: genus
D: humans (aka homo)
E: species
F: None of the above. | [A] |
<Instruct>: Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; donkey]
<Options>: A: mus molossinus (aka mus musculus molossinus)
B: equus ferus (equus caballus ferus) (aka equus ferus)
C: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
D: ass (aka equus asinus) (aka equus asinus)
E: mouse (aka mus musculus)
F: mice (aka mus <genus>) (aka mus <genus>)
G: peromyscus
H: domestic horse (aka equus caballus)
I: equus asinus x equus caballus (hybrid of male donkey and female horse) (aka equus asinus x equus caballus)
J: horses (aka equidae)
K: None of the above. | [E; D] |
<Instruct>: Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; donkey]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: domestic ass (aka equus asinus)
C: horses (aka equidae)
D: equus asinus x equus caballus (hybrid of male donkey and female horse) (aka equus asinus x equus caballus)
E: equus africanus asinus (aka equus asinus africanus)
F: mus cricetus (aka cricetus cricetus)
G: peromyscus
H: eastern european house mouse (aka mus musculus musculus)
I: equus subg. asinus (aka equus)
J: mus molossinus (aka mus musculus molossinus)
K: None of the above. | [A; B] |
<Instruct>: Given the context 'Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mouse (aka mus musculus)
B: mus cricetus (aka cricetus cricetus)
C: mus molossinus (aka mus musculus molossinus)
D: mus (aka mus <genus>) (aka mus <genus>)
E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
F: None of the above. | [A] |
<Instruct>: Given the context 'Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus (aka mus <genus>) (aka mus <genus>)
B: mus molossinus (aka mus musculus molossinus)
C: mus cricetus (aka cricetus cricetus)
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: None of the above. | [E] |
<Instruct>: Given the context 'RESULTS
Construction and analysis of ENP1 temperature-sensitive alleles
ENP1 is an essential yeast gene conserved among eukaryotes (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: saccharomyceta
B: saccharomyces hansenii (aka debaryomyces hansenii)
C: saccharomyces lactis (aka kluyveromyces lactis)
D: candida/saccharomycetales (aka candida/saccharomycales clade)
E: brewer's yeast (aka saccharomyces cerevisiae)
F: None of the above. | [E] |
<Instruct>: Given the context 'The TAP tag contains Staphylococcus aureus Protein A as well as calmodulin-binding peptide sequences, so the tagged Enp1 binds IgG beads with high specificity.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [staphylococcus aureus]
<Options>: A: staphylococcus aureus (staphylococcus aureus subsp. anaerobius) (aka staphylococcus aureus)
B: aurococcus (aka staphylococcus)
C: staphylococcus staphylolyticus (aka staphylococcus simulans bv. staphylolyticus)
D: 'staphylococcus faecalis' (aka staphylococcus faecalis)
E: micrococcus epidermidis (aka staphylococcus epidermidis)
F: None of the above. | [A] |
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; drosophila; caenorhabditis elegans]
<Options>: A: suborder
B: drosophila (aka drosophila <basidiomycete fungi>)
C: flies (aka diptera)
D: animals (aka metazoa)
E: this
F: macrobiotus sapiens
G: elegans subgroup (in: flies)
H: melanogaster group
I: zodarion elegans (enyo elegans) (aka zodarion elegans)
J: caenorhabditis vulgaris (aka caenorhabditis remanei)
K: drosophila <flies,subgenus> (drosophila) (aka drosophila <flies,subgenus>)
L: drosophila melanogaster (sophophora melanogaster) (aka drosophila melanogaster)
M: elegans subgroup (in: mosquitos)
N: homo sapiens (human) (aka homo sapiens)
O: rhabditis elegans (aka caenorhabditis elegans)
P: None of the above. | [N; L; O] |
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; drosophila; caenorhabditis elegans]
<Options>: A: theocolax elegans
B: fruit fly (aka drosophila melanogaster)
C: placental mammals (aka eutheria)
D: birds (aka aves)
E: drosophila <basidiomycete fungi> (drosophila) (aka drosophila <basidiomycete fungi>)
F: homo sapiens (human) (aka homo sapiens)
G: rhabditis elegans (aka caenorhabditis elegans)
H: melanogaster (aka melanogaster <basidiomycete fungi>)
I: flies (aka diptera)
J: macrobiotus sapiens
K: urocitellus elegans elegans (spermophilus elegans elegans) (aka urocitellus elegans elegans)
L: gongylostoma elegans elegans (clausilia elegans elegans) (aka gongylostoma elegans elegans)
M: fruit fly (aka drosophila <flies,genus>)
N: bactris elegans
O: genus
P: None of the above. | [F; B; G] |
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; drosophila; caenorhabditis elegans]
<Options>: A: fruit fly (aka drosophila melanogaster)
B: humans (aka homo)
C: cyclostrongylus elegans
D: homo sapiens (human) (aka homo sapiens)
E: suborder
F: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans)
G: drosophila (aka drosophila <flies,genus>)
H: polyzonia elegans
I: melanogaster subgroup
J: drosophila elegans
K: melanogaster (aka melanogaster <basidiomycete fungi>)
L: cellular organisms (biota) (aka cellular organisms)
M: theocolax elegans
N: kingdom
O: hawaiian drosophila
P: None of the above. | [D; A; F] |
<Instruct>: Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
B: suborder
C: birds (aka aves)
D: genus
E: animals (aka metazoa)
F: saccharomyces cf. cerevisiae
G: saccharomyces cerevisiae x saccharomyces mikatae
H: human (aka homo sapiens)
I: candida/saccharomycetales (aka candida/saccharomycales clade)
J: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
K: None of the above. | [H; J] |
<Instruct>: Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: human (aka homo sapiens)
B: probles
C: macrobiotus sapiens
D: saccharomyces cerevisiae x saccharomyces mikatae
E: budding yeasts & others (aka saccharomycotina)
F: saccharomyceta
G: mycoderma cerevisiae (aka saccharomyces cerevisiae)
H: primate (aka primates)
I: animals (aka metazoa)
J: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
K: None of the above. | [A; G] |
<Instruct>: Given the context 'In contrast, we identified a human expressed sequence tag (EST), BC007340 in a Blast search that revealed an ORF of 1311 nucleotides encoding a 437 amino acid polypeptide (39).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: macrobiotus sapiens
B: kingdom
C: primate (aka primates)
D: human (aka homo sapiens)
E: mammals (aka mammalia)
F: None of the above. | [D] |
<Instruct>: Given the context 'Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: macrobiotus sapiens
B: animals (aka metazoa)
C: species
D: homo sapiens (human) (aka homo sapiens)
E: biota (aka cellular organisms)
F: None of the above. | [D] |
<Instruct>: Given the context 'The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: primate (aka primates)
B: avian (aka aves)
C: eutherian mammals (aka eutheria)
D: animals (aka metazoa)
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: genus
B: mammals (aka mammalia)
C: human (aka homo sapiens)
D: biota (aka cellular organisms)
E: species
F: None of the above. | [C] |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.pombe; arabidopsis thaliana; c.elegans; drosophila melanogaster]
<Options>: A: zygosaccharomyces
B: urocitellus elegans elegans (spermophilus elegans elegans) (aka urocitellus elegans elegans)
C: salinomyces
D: (arabidopsis thaliana x arabidopsis arenosa) x arabidopsis suecica
E: unclassified arabidopsis
F: drosophila (aka drosophila <basidiomycete fungi>)
G: schizosaccharomycetoideae (aka schizosaccharomycetaceae)
H: rhabditis elegans (aka caenorhabditis elegans)
I: melanogaster group
J: melanogaster (aka melanogaster <flies>)
K: caenorhabditis vulgaris (aka caenorhabditis remanei)
L: caenorhabditis sp.
M: euphyia
N: arabidopsis (cardaminopsis) (aka arabidopsis)
O: bactris elegans
P: fruit fly (aka drosophila melanogaster)
Q: fission yeast (aka schizosaccharomyces pombe)
R: flies (aka diptera)
S: schizosaccharomyces japonicus (schizosaccharomyces japonicus var. versatilis) (aka schizosaccharomyces japonicus)
T: arabidopsis thaliana (mouse-ear cress) (aka arabidopsis thaliana)
U: None of the above. | [Q; T; H; P] |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.pombe; arabidopsis thaliana; c.elegans; drosophila melanogaster]
<Options>: A: bactrocera (bactrocera) melanogaster (aka bactrocera melanogaster)
B: bactris elegans
C: fruit flies (aka drosophila <flies,genus>)
D: rhabditis elegans (aka caenorhabditis elegans)
E: fabiana
F: sphaerosoma <ascomycete fungi> (sphaerosoma) (aka sphaerosoma <ascomycete fungi>)
G: sphaerococcus <red algae> (sphaerococcus) (aka sphaerococcus <red algae>)
H: mouse-ear cress (aka arabidopsis thaliana)
I: arabidella
J: uca elegans (aka tubuca elegans)
K: zodarion elegans (enyo elegans) (aka zodarion elegans)
L: arabidopsis thaliana x arabidopsis arenosa
M: schizosaccharomycetes (archiascomycota) (aka schizosaccharomycetes)
N: flies (aka diptera)
O: fission yeast (aka schizosaccharomyces pombe)
P: hawaiian drosophila
Q: euphyia
R: schizosaccharomyces
S: urocitellus elegans elegans (spermophilus elegans elegans) (aka urocitellus elegans elegans)
T: drosophila melanogaster (sophophora melanogaster) (aka drosophila melanogaster)
U: None of the above. | [O; H; D; T] |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.pombe; arabidopsis thaliana; c.elegans; drosophila melanogaster]
<Options>: A: melanogaster (aka melanogaster <basidiomycete fungi>)
B: elegans subgroup (in: flies)
C: schizosaccharomyces pombe oy26
D: unclassified arabidopsis
E: rhabditis elegans (aka caenorhabditis elegans)
F: fission yeasts (aka schizosaccharomycetaceae)
G: sphingomorpha
H: schizosaccharomyces pombe (schizosaccharomyces malidevorans) (aka schizosaccharomyces pombe)
I: apophylia
J: schizosaccharomyces kambucha x schizosaccharomyces pombe
K: flies (aka diptera)
L: arabidopsis (cardaminopsis) (aka arabidopsis)
M: drosophila elegans
N: melanogaster group
O: theocolax elegans
P: thale-cress (aka arabidopsis thaliana)
Q: arabideae
R: urocitellus elegans elegans (spermophilus elegans elegans) (aka urocitellus elegans elegans)
S: drosophila melanogaster (sophophora melanogaster) (aka drosophila melanogaster)
T: bactrocera melanogaster (bactrocera (bactrocera) melanogaster) (aka bactrocera melanogaster)
U: None of the above. | [H; P; E; S] |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.pombe; arabidopsis thaliana; c.elegans; drosophila melanogaster]
<Options>: A: caenorhabditis vulgaris (aka caenorhabditis remanei)
B: fruit fly (aka drosophila melanogaster)
C: elegans subgroup (in: flies)
D: fission yeast (aka schizosaccharomyces pombe)
E: drosophila <basidiomycete fungi> (drosophila) (aka drosophila <basidiomycete fungi>)
F: schizosaccharomyces japonicus var. japonicus (aka schizosaccharomyces japonicus)
G: salinomyces
H: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans)
I: schizosaccharomycetes (archiascomycota) (aka schizosaccharomycetes)
J: melanogaster (aka melanogaster <basidiomycete fungi>)
K: arabidopsis arenosa x arabidopsis thaliana
L: hawaiian drosophila
M: sphingomorpha
N: uca elegans (aka tubuca elegans)
O: thale-cress (aka arabidopsis thaliana)
P: melanogaster group
Q: urocitellus elegans elegans (spermophilus elegans elegans) (aka urocitellus elegans elegans)
R: arabidella
S: arabidopsis thaliana x arabidopsis arenosa
T: apophyllum
U: None of the above. | [D; O; H; B] |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus domesticus (aka mus musculus domesticus)
B: mus <subgenus> (mus (aka mus <subgenus>))
C: peromyscus
D: mice (aka mus <genus>) (aka mus <genus>)
E: house mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: human (aka homo sapiens)
B: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
C: saccharomyces cf. cerevisiae
D: homo (humans) (aka homo)
E: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
F: saccharomyces albicans (aka candida albicans)
G: eutherian mammals (aka eutheria)
H: probles
I: mycoderma cerevisiae (aka saccharomyces cerevisiae)
J: this
K: None of the above. | [A; I] |
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: saccharomyceta
B: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
C: mycoderma cerevisiae (aka saccharomyces cerevisiae)
D: saccharomyces cf. cerevisiae
E: animals (aka metazoa)
F: this
G: kingdom
H: human (aka homo sapiens)
I: saccharomyces hansenii (aka debaryomyces hansenii)
J: cellular organisms (biota) (aka cellular organisms)
K: None of the above. | [H; C] |
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: saccharomyces cf. cerevisiae
B: kingdom
C: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
D: saccharomyces hansenii (aka debaryomyces hansenii)
E: human (aka homo sapiens)
F: cellular organisms (biota) (aka cellular organisms)
G: animals (aka metazoa)
H: this
I: saccharomyceta
J: None of the above. | [E; J] |
<Instruct>: Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: humans (aka homo)
B: primate (aka primates)
C: saccharomyces albicans (aka candida albicans)
D: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
E: homo sapiens (human) (aka homo sapiens)
F: avian (aka aves)
G: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
H: this
I: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
J: saccharomycodes
K: None of the above. | [E; I] |
<Instruct>: Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
B: saccharomyces hansenii (aka debaryomyces hansenii)
C: saccharomyces cerevisiae x saccharomyces mikatae
D: homo (humans) (aka homo)
E: probles
F: baker's yeast (aka saccharomyces cerevisiae)
G: biota (aka cellular organisms)
H: homo sapiens (human) (aka homo sapiens)
I: saccharomyces lactis (aka kluyveromyces lactis)
J: genus
K: None of the above. | [H; F] |
<Instruct>: Given the context 'However, a GFP fusion to the N-terminus of human Enp1 homolog localized to the nucleus and was enriched in the nucleolus (data not shown).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: probles
B: macrobiotus sapiens
C: animals (aka metazoa)
D: kingdom
E: human (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'DISCUSSION
ENP1 is a yeast gene first identified in a genetic screen for complementation of mutations in ost4, which encodes a subunit of oligosaccharide transferase (17), although subsequent work showed that it is unlikely that Enp1 has any connection to oligosaccharide transferase (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: saccharomyces lactis (aka kluyveromyces lactis)
B: saccharomyces cerevisiae x saccharomyces mikatae
C: candida/saccharomycetales (aka candida/saccharomycales clade)
D: saccharomycotina (budding yeasts & others) (aka saccharomycotina)
E: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
F: None of the above. | [E] |
<Instruct>: Given the context 'Among the more than 100 snoRNAs in yeast cells, U3, U14, snR10, snR30 and MRP RNA are the only ones required for rRNA processing.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: mycoderma cerevisiae (aka saccharomyces cerevisiae)
B: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
C: saccharomyces albicans (aka candida albicans)
D: saccharomycodes
E: saccharomycotina (budding yeasts & others) (aka saccharomycotina)
F: None of the above. | [A] |
<Instruct>: Given the context 'Recently, a genome-wide study of yeast protein complexes, using a TAP tag method similar to ours, reported a number of proteins that co-immunoprecipitated with Enp1 (43).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: saccharomyces hansenii (aka debaryomyces hansenii)
B: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
C: true yeasts (aka saccharomycotina)
D: candida/saccharomycetales (aka candida/saccharomycales clade)
E: saccharomyces albicans (aka candida albicans)
F: None of the above. | [B] |
<Instruct>: Given the context 'A previous study on the Enp1 human homolog, bystin, reported that the protein was localized in the cytoplasm of mammalian cells and might be involved in cell adhesion (19).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: species
C: probles
D: animals (aka metazoa)
E: macrobiotus sapiens
F: None of the above. | [A] |
<Instruct>: Given the context 'Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: homo (humans) (aka homo)
B: suborder
C: mammals (aka mammalia)
D: human (aka homo sapiens)
E: species
F: None of the above. | [D] |
<Instruct>: Given the context 'Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: suborder
B: species
C: mammals (aka mammalia)
D: homo (humans) (aka homo)
E: None of the above. | [E] |
<Instruct>: Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: homo (humans) (aka homo)
B: saccharomyces sp.
C: saccharomycodes
D: birds (aka aves)
E: human (aka homo sapiens)
F: probles
G: budding yeasts & others (aka saccharomycotina)
H: primate (aka primates)
I: saccharomyces cerevisiae x saccharomyces mikatae
J: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
K: None of the above. | [E; J] |
<Instruct>: Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: saccharomycodes
B: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
C: species
D: homo sapiens (human) (aka homo sapiens)
E: candida/saccharomycetales (aka candida/saccharomycales clade)
F: saccharomyceta
G: mammals (aka mammalia)
H: saccharomyces lactis (aka kluyveromyces lactis)
I: kingdom
J: avian (aka aves)
K: None of the above. | [D; B] |
<Instruct>: Given the context 'The cytoplasmic localization of bystin and its proposed function in cell adhesion are unlikely to reflect the actual function of the human Enp1 homolog.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: probles
B: suborder
C: kingdom
D: homo sapiens (human) (aka homo sapiens)
E: this
F: None of the above. | [D] |
<Instruct>: Given the context 'Epigenetic inactivation and aberrant transcription of CSMD1 in squamous cell carcinoma cell lines
Abstract
Background
The p23.2 region of human chromosome 8 is frequently deleted in several types of epithelial cancer and those deletions appear to be associated with poor prognosis.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: humans (aka homo)
B: macrobiotus sapiens
C: human (aka homo sapiens)
D: mammals (aka mammalia)
E: suborder
F: None of the above. | [C] |
<Instruct>: Given the context 'Background
CUB and Sushi Multiple Domains 1 (CSMD1) was cloned as a candidate tumor suppressor or progression gene from a region of human chromosome 8 deleted in tumors of the upper aerodigestive tract, prostate, ovary and bladder', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: placental mammals (aka eutheria)
B: avian (aka aves)
C: homo sapiens (human) (aka homo sapiens)
D: cellular organisms (biota) (aka cellular organisms)
E: homo (humans) (aka homo)
F: None of the above. | [C] |
<Instruct>: Given the context 'RT-PCR of human fetal brain cDNA reveals very low levels of an RT-PCR product corresponding in size to that expected from the internally deleted transcript.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: probles
B: eutherian mammals (aka eutheria)
C: human (aka homo sapiens)
D: mammals (aka mammalia)
E: macrobiotus sapiens
F: None of the above. | [C] |
<Instruct>: Given the context 'Normal oropharyngeal epithelium was isolated from discarded tissue from uvulopalatopharyngoplasties (UPPP) collected anonymously with the approval of the Washington University Human Studies Committee.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: probles
B: human (aka homo sapiens)
C: mammals (aka mammalia)
D: humans (aka homo)
E: avian (aka aves)
F: None of the above. | [B] |
<Instruct>: Given the context 'Cell Culture and Tissue Preparation
Squamous cell carcinoma cell lines were grown in DMEM or DMEM:F-12, 1:1 Mixture (BioWhittaker) containing 10% fetal bovine serum (Sigma).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos taurus (bos primigenius taurus) (aka bos taurus)
B: boveria
C: bovinae
D: bovidae
E: bos bubalis bubalis (aka bubalus bubalis bubalis)
F: None of the above. | [A] |
<Instruct>: Given the context 'Cell Culture and Tissue Preparation
Squamous cell carcinoma cell lines were grown in DMEM or DMEM:F-12, 1:1 Mixture (BioWhittaker) containing 10% fetal bovine serum (Sigma).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bovinae
B: boveria
C: bos bubalis bubalis (aka bubalus bubalis bubalis)
D: bovidae
E: None of the above. | [E] |
<Instruct>: Given the context 'An amplicon from human 18S RNA was used as a basis for comparisons across cell lines (primers prm2396, ttcggaactgaggccatgat and prm2397, tttcgctctggtccgtcttg).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: human (aka homo sapiens)
B: animals (aka metazoa)
C: kingdom
D: humans (aka homo)
E: mammals (aka mammalia)
F: None of the above. | [A] |
<Instruct>: Given the context 'Cells were grown for 72 hours in media containing DMEM:F-12, 1:1 Mixture (BioWhittaker) with 1X MEM Nonessential Amino Acids (BioWhittaker) and 10% fetal bovine serum and then switched to media containing 5aza-dC at concentrations of 0 μm, 5 μM, 25 μM, or 100 μM. Cells were fed daily for 4–5 days and then both plates were harvested in 3 ml of Trizol (Invitrogen) for isolation of RNA and DNA according to the manufacturer's instructions.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: cow (aka bos taurus) (aka bos taurus)
B: bos bubalis bubalis (aka bubalus bubalis bubalis)
C: boveria
D: bos taurus x bos indicus (aka bos indicus x bos taurus)
E: bos sp.
F: None of the above. | [A] |
<Instruct>: Given the context 'Human growth hormone (GH1) gene polymorphism map in a normal-statured adult population
Abstract
Objective
GH1 gene presents a complex map of single nucleotide polymorphisms (SNPs) in the entire promoter, coding and noncoding regions.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: animals (aka metazoa)
B: cellular organisms (biota) (aka cellular organisms)
C: probles
D: homo sapiens (human) (aka homo sapiens)
E: genus
F: None of the above. | [D] |
<Instruct>: Given the context 'Systematic GH1 gene analysis in patients with growth delay and suspected GH deficiency/insufficiency will clarify whether different SNP frequencies and/or the presence of different sequence changes may be associated with phenotypes in them.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: mus <genus> (mice (aka mus <genus>))
B: humans (aka homo)
C: kingdom
D: subsection
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'Introduction
Human skeletal growth and final height attainment are a result of a multifactorial regulation involving systemic and local hormones, growth and nutritional factors, lifestyle and genetic factors.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: macrobiotus sapiens
B: human (aka homo sapiens)
C: biota (aka cellular organisms)
D: mammals (aka mammalia)
E: humans (aka homo)
F: None of the above. | [B] |
<Instruct>: Given the context 'Large deletions within the GH1 gene cluster were described first followed by point mutations, the majority of which affect introns 3 or 4, provoke skipping of exon 3 product and exert a dominant effect.3,7,8 More recently, the presence of single nucleotide polymorphic points (SNPs) in the promoter region or in intron 4 of the GH1 gene have been described9–12 and associations with promoter allele activities or with GH secretion efficacy and circulating IGF-I levels in growth-retarded patients have also been described.11,12 Other studies have analysed several GH1 gene SNP genotypes as related to the incidence of neoplasia, with a positive association with colorectal neoplasia for intron 4 SNP,13 a negative result for breast carcinoma14,15 or a positive one for breast cancer risk.16,17 In addition, a recent study in a cohort of adults over ages 60 years detected a significant association between genotypes at one SNP in the GH1 gene promoter region and at the intron 4 SNP described by Hasegawa et al.11 with baseline bone density and accelerated bone loss together with an interaction with weight at 1 year.18 Intron 4 SNP described by Hasegawa et al.11 has also been associated, in women, with shorter body height and reduced mortality,19 whereas another intron 4 SNP (T1169A) has been associated in both sexes with a favourable metabolic profile.20', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients; women]
<Options>: A: chicken (aka gallus gallus)
B: mouse (aka mus musculus)
C: cancer
D: species
E: human (aka homo sapiens)
F: suborder
G: this
H: probles
I: other (aka unidentified)
J: None of the above. | [E; E] |
<Instruct>: Given the context 'Large deletions within the GH1 gene cluster were described first followed by point mutations, the majority of which affect introns 3 or 4, provoke skipping of exon 3 product and exert a dominant effect.3,7,8 More recently, the presence of single nucleotide polymorphic points (SNPs) in the promoter region or in intron 4 of the GH1 gene have been described9–12 and associations with promoter allele activities or with GH secretion efficacy and circulating IGF-I levels in growth-retarded patients have also been described.11,12 Other studies have analysed several GH1 gene SNP genotypes as related to the incidence of neoplasia, with a positive association with colorectal neoplasia for intron 4 SNP,13 a negative result for breast carcinoma14,15 or a positive one for breast cancer risk.16,17 In addition, a recent study in a cohort of adults over ages 60 years detected a significant association between genotypes at one SNP in the GH1 gene promoter region and at the intron 4 SNP described by Hasegawa et al.11 with baseline bone density and accelerated bone loss together with an interaction with weight at 1 year.18 Intron 4 SNP described by Hasegawa et al.11 has also been associated, in women, with shorter body height and reduced mortality,19 whereas another intron 4 SNP (T1169A) has been associated in both sexes with a favourable metabolic profile.20', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients; women]
<Options>: A: cancer
B: species
C: chicken (aka gallus gallus)
D: eutherian mammals (aka eutheria)
E: other (aka unidentified)
F: avian (aka aves)
G: homo sapiens (human) (aka homo sapiens)
H: mus <genus> (mice (aka mus <genus>))
I: None of the above. | [G; G] |
<Instruct>: Given the context 'To obtain normative data for subsequent analysis of GH1 gene contribution to IIGHD in children, a systematic GH1 gene structural analysis was designed in a normal adult control population to establish the GH1 gene SNP map in adults from our population with heights within the normal range, determine the genotype frequencies and analyse possible associations between individual and combined SNPs with height.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [children]
<Options>: A: kingdom
B: suborder
C: human (aka homo sapiens)
D: birds (aka aves)
E: chicken (aka gallus gallus)
F: None of the above. | [C] |
<Instruct>: Given the context 'To obtain normative data for subsequent analysis of GH1 gene contribution to IIGHD in children, a systematic GH1 gene structural analysis was designed in a normal adult control population to establish the GH1 gene SNP map in adults from our population with heights within the normal range, determine the genotype frequencies and analyse possible associations between individual and combined SNPs with height.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [children]
<Options>: A: chicken (aka gallus gallus)
B: kingdom
C: suborder
D: birds (aka aves)
E: None of the above. | [E] |
<Instruct>: Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men; patients]
<Options>: A: china
B: menevia
C: menura
D: homo sapiens (human) (aka homo sapiens)
E: menida
F: mouse (aka mus musculus)
G: species
H: humans (aka homo)
I: mene
J: mus musculus (house mouse) (aka mus musculus)
K: menecles
L: genus
M: None of the above. | [D; D; D] |
<Instruct>: Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men; patients]
<Options>: A: probles
B: kingdom
C: other (aka unidentified)
D: species
E: goes
F: aides
G: menophra
H: humans (aka homo)
I: menecleonus
J: menoidium
K: homo sapiens (human) (aka homo sapiens)
L: mammals (aka mammalia)
M: menevia
N: menesia
O: None of the above. | [K; K; K] |
<Instruct>: Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men; patients]
<Options>: A: chicken (aka gallus gallus)
B: human (aka homo sapiens)
C: menenotus
D: menosoma
E: circe
F: mus <genus> (mice (aka mus <genus>))
G: menura
H: probles
I: menesia
J: kingdom
K: eutherian mammals (aka eutheria)
L: menkeleon
M: mammals (aka mammalia)
N: None of the above. | [B; B; B] |
<Instruct>: Given the context 'The protocol was approved by the Hospital Vall d’Hebron Ethics Committee and written informed consent was obtained from each participant.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [participant]
<Options>: A: primate (aka primates)
B: probles
C: inquisitor
D: species
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'The protocol was approved by the Hospital Vall d’Hebron Ethics Committee and written informed consent was obtained from each participant.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [participant]
<Options>: A: species
B: primate (aka primates)
C: inquisitor
D: probles
E: None of the above. | [E] |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men]
<Options>: A: menosira
B: menaethius
C: gallus
D: menetes
E: menkeleon
F: latina
G: homo sapiens (human) (aka homo sapiens)
H: species
I: menosoma
J: genus
K: None of the above. | [G; G] |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men]
<Options>: A: human (aka homo sapiens)
B: menetus
C: eutherian mammals (aka eutheria)
D: menosoma
E: menigrates
F: suborder
G: menevia
H: menella
I: this
J: None of the above. | [A; A] |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men]
<Options>: A: menecleonus
B: homo sapiens (human) (aka homo sapiens)
C: menophra
D: suborder
E: menevia
F: menaethius
G: avian (aka aves)
H: menetus
I: menecles
J: china
K: None of the above. | [B; B] |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men]
<Options>: A: eutherian mammals (aka eutheria)
B: china
C: menesia
D: kingdom
E: gallus
F: menneus
G: menenotus
H: menura
I: menaethius
J: homo sapiens (human) (aka homo sapiens)
K: None of the above. | [J; J] |
<Instruct>: Given the context 'Several sequence changes have been reported in patients with familial or idiopathic short stature,11,26,27 whereas P8, P19, P20 and P25 (at positions 5165, 5681, 5686 and 6358, respectively, in the Genebank accession GI 183148) located in the promoter, intron 2 and intron 4 regions, respectively, had not been previously described.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: goes
B: kingdom
C: genus
D: homo sapiens (human) (aka homo sapiens)
E: mouse (aka mus musculus)
F: None of the above. | [D] |
<Instruct>: Given the context 'Discussion
Genetic variations within human GH1 gene have been described by several authors.9–12,21', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: animals (aka metazoa)
B: human (aka homo sapiens)
C: suborder
D: macrobiotus sapiens
E: eutherian mammals (aka eutheria)
F: None of the above. | [B] |
<Instruct>: Given the context 'Discussion
Genetic variations within human GH1 gene have been described by several authors.9–12,21', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: suborder
B: animals (aka metazoa)
C: eutherian mammals (aka eutheria)
D: macrobiotus sapiens
E: None of the above. | [E] |
<Instruct>: Given the context 'The populations described to date comprised small numbers of normal-stature individuals,9 male adults with narrow height range12 or growth-retarded patients with/without GHD before achievement of adult height.9,11,12 Our study was designed to characterize the GH1 gene sequence variation in individuals within the whole range of normal adult height (between −2 and +2 SDS) according to the standards for our population.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: kingdom
B: human (aka homo sapiens)
C: this
D: cancer
E: genus
F: None of the above. | [B] |
<Instruct>: Given the context 'Five single nucleotide changes are located in exon 5; of these five, three predict an amino acid change, and one of the three (Ile179Met) has been described by Lewis et al.27 in a paediatric patient with familial short stature and the other two, as yet undescribed, are contiguous in a single individual (Pro133Hys and Arg134Leu).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: proxys
B: goes
C: cancer
D: human (aka homo sapiens)
E: probles
F: None of the above. | [D] |
<Instruct>: Given the context 'Analysis of SNP association with adult height was subsequently performed to establish a body of knowledge useful for comparing patient genotypes and phenotypes.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: cancer
B: species
C: isolate
D: this
E: human (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'A recent study from Giordano et al.34 has shown a twofold reduced luciferase activity for the G nucleotide bearing promoter haplotype in transfected rat pituitary cells.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus rattoides (aka rattus pyctoris)
B: rattus sp. (rats (aka rattus sp.))
C: rattus rattus (rattus wroughtoni) (aka rattus rattus)
D: rat (aka rattus norvegicus) (aka rattus norvegicus)
E: rats (aka rattus) (aka rattus)
F: None of the above. | [D] |
<Instruct>: Given the context 'The high density of SNPs and their proximity hamper other genotyping strategies for rapid determination of the complete GH1 SNP map in large control and patient populations.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: isolate
B: goes
C: probles
D: human (aka homo sapiens)
E: data
F: None of the above. | [D] |
<Instruct>: Given the context 'Systematic GH1 gene analysis in patients with growth delay and suspected GH deficiency/insufficiency will clarify whether different SNP frequencies and/or the presence of different sequence changes may be associated with phenotypes in them.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: humans (aka homo)
B: species
C: homo sapiens (human) (aka homo sapiens)
D: genus
E: probles
F: None of the above. | [C] |
<Instruct>: Given the context 'Down-regulation of the M6P/IGF-II receptor increases cell proliferation and reduces apoptosis in neonatal rat cardiac myocytes
Abstract
Background
The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a multi-functional protein that has been implicated in regulation of cell growth and apoptosis.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus norvegicus (rats (aka rattus norvegicus))
B: rat (aka rattus) (aka rattus)
C: rattus norvegicus albus
D: rats (aka rattus sp.) (aka rattus sp.)
E: black rat (aka rattus rattus)
F: None of the above. | [A] |
<Instruct>: Given the context 'Results
We down-regulated the expression of M6P/IGF2R in neonatal rat cardiac myocytes and examined the effect on cell proliferation and apoptosis.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: mus rattus (aka rattus rattus)
B: rattus norvegicus albus
C: rattus (rats (aka rattus))
D: rattus sp. (rats (aka rattus sp.))
E: norway rat (aka rattus norvegicus)
F: None of the above. | [E] |
<Instruct>: Given the context 'However, alterations in the control of apoptosis have also been shown to contribute to human diseases.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: species
B: human (aka homo sapiens)
C: humans (aka homo)
D: mammals (aka mammalia)
E: placental mammals (aka eutheria)
F: None of the above. | [B] |
<Instruct>: Given the context 'Cardiac myocytes express relatively high levels of M6P/IGF2R and transgenic mice containing a homologous deletion of the M6P/IGF2R gene manifest ventricular hyperplasia due to an increase in cell number [9,10], suggesting that the M6P/IGF2R normally acts to suppress cardiac myocyte cell growth.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mouse (aka mus musculus)
B: mus cricetus (aka cricetus cricetus)
C: mus castaneus (aka mus musculus castaneus)
D: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
E: mice (aka mus sp.) (aka mus sp.)
F: None of the above. | [A] |
<Instruct>: Given the context 'Cardiac myocytes express relatively high levels of M6P/IGF2R and transgenic mice containing a homologous deletion of the M6P/IGF2R gene manifest ventricular hyperplasia due to an increase in cell number [9,10], suggesting that the M6P/IGF2R normally acts to suppress cardiac myocyte cell growth.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
B: mus castaneus (aka mus musculus castaneus)
C: mice (aka mus sp.) (aka mus sp.)
D: mus cricetus (aka cricetus cricetus)
E: None of the above. | [E] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.