instruction stringlengths 225 2.35k | input stringlengths 89 1.5k | response stringclasses 698 values |
|---|---|---|
<Instruct>: Given the context 'Viral Hemorrhagic Septicemia Virus (VHSV) induced protein and neighbor of COX-4 are the only annotated genes without known molecular functions.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [viral hemorrhagic septicemia virus; vhsv]
<Options>: A: his1v (aka his 1 virus)
B: vibrio harveyi bacteriophage vhml (aka vibrio phage vhml)
C: vector vhb
D: viral hemorrhagic septicemia virus strain makah (viral hemorrhagic septicemia virus (strain makah)) (aka viral hemorrhagic septicemia virus strain makah)
E: crimean-congo hemorrhagic virus (aka orthonairovirus haemorrhagiae)
F: harvey murine sarcoma virus
G: shfv (aka simian hemorrhagic fever virus) (aka simian hemorrhagic fever virus)
H: haemorrhagic kidney syndrome virus
I: None of the above. | [I; I] |
<Instruct>: Given the context 'The interferon system is one of the first lines of host defense against invading pathogens for vertebrates (for review see [26]), including teleost fish (for review see [27]).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [teleost fish]
<Options>: A: fishes (aka actinopterygii)
B: teleostean fish (aka teleost fish)
C: pisciforma
D: chondrichthyes (fish (aka chondrichthyes))
E: teleostei (teleost fishes) (aka teleostei)
F: None of the above. | [B] |
<Instruct>: Given the context 'Other economically important salmonid pathogens, such as infectious pancreatic necrosis virus and infectious salmon anaemia virus have been found to activate both type I and type II interferon (IFN) responses in the Atlantic salmon host following infection [28].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infectious pancreatic necrosis virus; infectious salmon anaemia virus; atlantic salmon]
<Options>: A: infectious pancreatic necrosis virus - n1 (infectious pancreatic necrosis virus (strain n1)) (aka infectious pancreatic necrosis virus - n1)
B: sala virus
C: salmon isavirus (aka isavirus salaris)
D: infectious pancreatic necrosis virus serotype a5 (infectious pancreatic necrosis virus (serotype a5)) (aka infectious pancreatic necrosis virus serotype a5)
E: salmonid alphavirus
F: salmo salar (atlantic salmon) (aka salmo salar)
G: salmondvirus
H: salmonids (aka salmonidae)
I: salmons and trouts (aka salmoniformes)
J: infectious pancreatic necrosis virus - he
K: pink salmon (aka oncorhynchus gorbuscha)
L: ipnv (aka infectious pancreatic necrosis virus) (aka infectious pancreatic necrosis virus)
M: aquabirnavirus salmonidae
N: salmoneus
O: infectious hematopoietic necrosis virus (ihnv (aka infectious hematopoietic necrosis virus))
P: None of the above. | [L; C; F] |
<Instruct>: Given the context 'Other economically important salmonid pathogens, such as infectious pancreatic necrosis virus and infectious salmon anaemia virus have been found to activate both type I and type II interferon (IFN) responses in the Atlantic salmon host following infection [28].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infectious pancreatic necrosis virus; infectious salmon anaemia virus; atlantic salmon]
<Options>: A: atlantic salmon paramyxovirus (aka salmon aquaparamyxovirus)
B: infectious pancreatic necrosis virus (serotype a6) (aka infectious pancreatic necrosis virus serotype a6)
C: infectious pancreatic necrosis virus (strain n1) (aka infectious pancreatic necrosis virus - n1)
D: infectious pancreatic necrosis virus (ipnv (aka infectious pancreatic necrosis virus))
E: infectious spleen and kidney necrosis virus (isolate nanhai)
F: oncorhynchus gilae (salmo gilae) (aka oncorhynchus gilae)
G: novirhabdovirus salmonid (salmonid novirhabdovirus) (aka novirhabdovirus salmonid)
H: salmoneus
I: atlantic salmon respirovirus
J: salmonids (aka salmonidae)
K: infectious hematopoietic necrosis virus (ihnv (aka infectious hematopoietic necrosis virus))
L: sala virus
M: salmon isavirus (aka isavirus salaris)
N: salmo salar (atlantic salmon) (aka salmo salar)
O: salmonid fish
P: None of the above. | [D; M; N] |
<Instruct>: Given the context 'Other economically important salmonid pathogens, such as infectious pancreatic necrosis virus and infectious salmon anaemia virus have been found to activate both type I and type II interferon (IFN) responses in the Atlantic salmon host following infection [28].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infectious pancreatic necrosis virus; infectious salmon anaemia virus; atlantic salmon]
<Options>: A: salmo salar (atlantic salmon) (aka salmo salar)
B: infectious pancreatic necrosis virus (serotype jasper) (aka infectious pancreatic necrosis virus - jasper)
C: black sea salmon (aka salmo labrax)
D: infectious pancreatic necrosis virus ipnv (aka infectious pancreatic necrosis virus)
E: infectious hematopoietic necrosis virus (ihnv (aka infectious hematopoietic necrosis virus))
F: salmon isavirus (aka isavirus salaris)
G: aquareovirus a (aka aquareovirus salmonis)
H: pink salmon (aka oncorhynchus gorbuscha)
I: nienokoue virus
J: infectious pancreatic necrosis virus (serotype a5) (aka infectious pancreatic necrosis virus serotype a5)
K: japanese salmon (aka oncorhynchus masou)
L: coho salmon (aka oncorhynchus kisutch)
M: aquabirnavirus salmonidae
N: salmonid novirhabdovirus (aka novirhabdovirus salmonid)
O: salmon river virus
P: None of the above. | [D; F; A] |
<Instruct>: Given the context 'Other economically important salmonid pathogens, such as infectious pancreatic necrosis virus and infectious salmon anaemia virus have been found to activate both type I and type II interferon (IFN) responses in the Atlantic salmon host following infection [28].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infectious pancreatic necrosis virus; infectious salmon anaemia virus; atlantic salmon]
<Options>: A: salmonid novirhabdovirus (aka novirhabdovirus salmonid)
B: coho salmon (aka oncorhynchus kisutch)
C: salmon isavirus (aka isavirus salaris)
D: infectious hematopoietic necrosis virus (ihnv (aka infectious hematopoietic necrosis virus))
E: aquareovirus a (aka aquareovirus salmonis)
F: aquabirnavirus salmonidae
G: pink salmon (aka oncorhynchus gorbuscha)
H: infectious pancreatic necrosis virus (serotype jasper) (aka infectious pancreatic necrosis virus - jasper)
I: infectious pancreatic necrosis virus (serotype a5) (aka infectious pancreatic necrosis virus serotype a5)
J: infectious pancreatic necrosis virus ipnv (aka infectious pancreatic necrosis virus)
K: nienokoue virus
L: black sea salmon (aka salmo labrax)
M: salmon river virus
N: japanese salmon (aka oncorhynchus masou)
O: None of the above. | [J; C; O] |
<Instruct>: Given the context 'The PPAR-α-interacting complex protein 285 is a transcriptional co-activator with helicase activity [48] and has sequence similarity to a rainbow trout VHSV-induced protein.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout; vhsv]
<Options>: A: vhsv (aka viral hemorrhagic septicemia virus) (aka viral hemorrhagic septicemia virus)
B: salmo trutta trutta (sea trout) (aka salmo trutta trutta)
C: rainbow trout (aka oncorhynchus mykiss)
D: salmo gilae gilae (aka oncorhynchus gilae gilae)
E: salmo trutta (river trout) (aka salmo trutta)
F: harvey murine sarcoma virus
G: vibrio phage vhml (vibrio harveyi bacteriophage vhml) (aka vibrio phage vhml)
H: black sea salmon (aka salmo labrax)
I: vibrio phage vb_vhas-vhb1
J: vhmlvirus (vhml-like phages) (aka vhmlvirus)
K: None of the above. | [C; A] |
<Instruct>: Given the context 'The PPAR-α-interacting complex protein 285 is a transcriptional co-activator with helicase activity [48] and has sequence similarity to a rainbow trout VHSV-induced protein.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout; vhsv]
<Options>: A: rainbow trout (aka oncorhynchus mykiss)
B: vhulanivirus
C: golden trout (aka oncorhynchus mykiss aguabonita)
D: river trout (aka salmo trutta fario)
E: japanese salmon (aka oncorhynchus masou)
F: vhsv (aka viral hemorrhagic septicemia virus) (aka viral hemorrhagic septicemia virus)
G: vhev (aka vilyuisk human encephalomyelitis virus) (aka vilyuisk human encephalomyelitis virus)
H: black sea salmon (aka salmo labrax)
I: vibrio phage vb_vhas-vhb1
J: harvey murine sarcoma virus
K: None of the above. | [A; F] |
<Instruct>: Given the context 'A critical phase in the early stages of M. cerebralis infection in trout is invasion and intracellular replication, processes that begin as early as one hour post exposure to triactinomyxons [16].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [m. cerebralis]
<Options>: A: somniosus
B: mesopeplum
C: paregle
D: glomus cerebriforme
E: distremocephalus
F: None of the above. | [F] |
<Instruct>: Given the context 'A role for accumulated ubiquinated proteins in the lysosome in the killing of Mycobacterium tuberculosis has recently been described that has implications for a range of intracellular infections [58] and some similar responses to infection may be occurring for both resistant and susceptible strains.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mycobacterium tuberculosis]
<Options>: A: mycobacterium tuberculosis avium (aka mycobacterium avium)
B: bacterium tuberculosis (aka mycobacterium tuberculosis)
C: mycobacterium tuberculosis h37rv (mycobacterium tuberculosis strain h37rv) (aka mycobacterium tuberculosis h37rv)
D: mycobacterium bovis (aka mycobacterium tuberculosis variant bovis)
E: mycobacterium tuberculosis complex bacterium (aka mycobacterium tuberculosis complex sp.)
F: None of the above. | [B] |
<Instruct>: Given the context 'Evaluations by light microscopy and qPCR for M. cerebralis genomic DNA of Hofer and Trout Lodge rainbow trout exposed to triactinomyxons demonstrates Hofer more efficiently eliminates invading parasites in the skin (M. Adkison, pers.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [m. cerebralis; rainbow trout]
<Options>: A: japanese salmon (aka oncorhynchus masou)
B: glomus cerebriforme
C: salmo gilae gilae (aka oncorhynchus gilae gilae)
D: sea trout (aka salmo trutta trutta)
E: black sea salmon (aka salmo labrax)
F: mesopsocus
G: paraglomus
H: encephalus
I: paregle
J: rainbow trout (aka oncorhynchus mykiss)
K: None of the above. | [K; J] |
<Instruct>: Given the context 'Evaluations by light microscopy and qPCR for M. cerebralis genomic DNA of Hofer and Trout Lodge rainbow trout exposed to triactinomyxons demonstrates Hofer more efficiently eliminates invading parasites in the skin (M. Adkison, pers.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [m. cerebralis; rainbow trout]
<Options>: A: river trout (aka salmo trutta fario)
B: distremocephalus
C: striatula
D: salmo gilae (aka oncorhynchus gilae)
E: somniosus
F: neurocallis
G: golden trout (aka oncorhynchus mykiss aguabonita)
H: micronisus
I: salmon trout (aka oncorhynchus masou)
J: salmo mykiss (aka oncorhynchus mykiss)
K: None of the above. | [K; J] |
<Instruct>: Given the context 'Evaluations by light microscopy and qPCR for M. cerebralis genomic DNA of Hofer and Trout Lodge rainbow trout exposed to triactinomyxons demonstrates Hofer more efficiently eliminates invading parasites in the skin (M. Adkison, pers.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [m. cerebralis; rainbow trout]
<Options>: A: micronisus
B: golden trout (aka oncorhynchus mykiss aguabonita)
C: river trout (aka salmo trutta fario)
D: somniosus
E: distremocephalus
F: salmo gilae (aka oncorhynchus gilae)
G: neurocallis
H: salmon trout (aka oncorhynchus masou)
I: striatula
J: None of the above. | [J; J] |
<Instruct>: Given the context 'A role for host immune factors in the elimination of invading parasites, even in susceptible rainbow trout strains, is suggested by several prior light and electron microscopy studies that demonstrate an increase in degenerative stages in the skin beginning as early as 12 h and then their elimination by 24 h post-exposure to triactinomyxons [12,16,63].
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: rainbow trout (aka oncorhynchus mykiss)
B: golden trout (aka oncorhynchus mykiss aguabonita)
C: sea trout (aka salmo trutta trutta)
D: black sea salmon (aka salmo labrax)
E: salmo gilae gilae (aka oncorhynchus gilae gilae)
F: None of the above. | [A] |
<Instruct>: Given the context 'For instance, metallothionein's role as a zinc-finger transcriptional regulator [64] may dramatically alter the expression profiles between resistant and susceptible rainbow trout.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: black sea salmon (aka salmo labrax)
B: trouts, salmons & chars (aka salmoninae)
C: rainbow trout (aka oncorhynchus mykiss)
D: golden trout (aka oncorhynchus mykiss aguabonita)
E: salmons and trouts (aka salmoniformes)
F: None of the above. | [C] |
<Instruct>: Given the context 'Given the high degree of statistical support and biological relevance of the candidate genes, we believe this study provides initial insight into rainbow trout genes and pathways responding to whirling disease infection and identifies the first candidate genes for whirling disease resistance.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: salmons and trouts (aka salmoniformes)
B: trouts, salmons & chars (aka salmoninae)
C: salmo mykiss (aka oncorhynchus mykiss)
D: brook trout (aka salvelinus fontinalis)
E: salmo keta (aka oncorhynchus keta)
F: None of the above. | [C] |
<Instruct>: Given the context 'For instance, metallothionein's role as a zinc-finger transcriptional regulator [64] may dramatically alter the expression profiles between resistant and susceptible rainbow trout.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: salmo gilae gilae (aka oncorhynchus gilae gilae)
B: river trout (aka salmo trutta)
C: golden trout (aka oncorhynchus mykiss aguabonita)
D: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
E: river trout (aka salmo trutta fario)
F: None of the above. | [D] |
<Instruct>: Given the context 'Conclusion
The present study has provided the first examination into the genetic basis underlying rainbow trout's immune response and resistance to the whirling disease pathogen.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: sea trout (aka salmo trutta trutta)
B: rainbow trout (aka oncorhynchus mykiss)
C: brook trout (aka salvelinus fontinalis)
D: salmons and trouts (aka salmoniformes)
E: japanese salmon (aka oncorhynchus masou)
F: None of the above. | [B] |
<Instruct>: Given the context 'Several genes were significantly up-regulated in skin following pathogen exposure for both the resistant Hofer and susceptible Trout Lodge rainbow trout strains.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: salmo trutta (river trout) (aka salmo trutta)
B: golden trout (aka oncorhynchus mykiss aguabonita)
C: salmo gilae (aka oncorhynchus gilae)
D: salmo mykiss (aka oncorhynchus mykiss)
E: brook trout (aka salvelinus fontinalis)
F: None of the above. | [D] |
<Instruct>: Given the context 'Methods
Animal care, pathogen exposure, and RNA preparation
Hofer and Trout Lodge rainbow trout strains were reared in 35 gallon aquaria with 15°C flow-through well water for nine weeks post-hatch, with each fish weighing approximately 6.5 grams prior to pathogen exposure.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: salmo mykiss (aka oncorhynchus mykiss)
B: salmo trutta (river trout) (aka salmo trutta)
C: trouts, salmons & chars (aka salmoninae)
D: salmo gilae gilae (aka oncorhynchus gilae gilae)
E: river trout (aka salmo trutta fario)
F: None of the above. | [A] |
<Instruct>: Given the context 'These arrays contain 13,421 Atlantic salmon and 2,576 rainbow trout cDNA features and have been successfully used for several previous rainbow trout gene expression studies [70-73].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [atlantic salmon; rainbow trout]
<Options>: A: salmo salar (atlantic salmon) (aka salmo salar)
B: salmo mykiss (aka oncorhynchus mykiss)
C: trouts, salmons & chars (aka salmoninae)
D: sockeye salmon (aka oncorhynchus nerka)
E: black sea salmon (aka salmo labrax)
F: golden trout (aka oncorhynchus mykiss aguabonita)
G: pink salmon (aka oncorhynchus gorbuscha)
H: salmo trutta trutta (sea trout) (aka salmo trutta trutta)
I: salmo gilae gilae (aka oncorhynchus gilae gilae)
J: None of the above. | [A; B] |
<Instruct>: Given the context 'These arrays contain 13,421 Atlantic salmon and 2,576 rainbow trout cDNA features and have been successfully used for several previous rainbow trout gene expression studies [70-73].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [atlantic salmon; rainbow trout]
<Options>: A: salmo trutta trutta (sea trout) (aka salmo trutta trutta)
B: king salmon (aka oncorhynchus tshawytscha)
C: river trout (aka salmo trutta fario)
D: salmoneus
E: salmons and trouts (aka salmoniformes)
F: oncorhynchus mykiss (oncorhynchus nerka mykiss) (aka oncorhynchus mykiss)
G: salmo salar (atlantic salmon) (aka salmo salar)
H: brook trout (aka salvelinus fontinalis)
I: salmonid fish
J: None of the above. | [G; F] |
<Instruct>: Given the context 'For each rainbow trout strain, competitive hybridization was conducted on every array using equal amounts (8 μg) of differentially labeled aRNA from one control fish and one exposed fish.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: salmo mykiss (aka oncorhynchus mykiss)
B: japanese salmon (aka oncorhynchus masou)
C: brook trout (aka salvelinus fontinalis)
D: salmons and trouts (aka salmoniformes)
E: trouts, salmons & chars (aka salmoninae)
F: None of the above. | [A] |
<Instruct>: Given the context 'The Significance Analysis of Microarrays (SAM) software package [75] was used to identify differentially expressed genes between exposed and unexposed control fish for each rainbow trout strain.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rainbow trout]
<Options>: A: sea trout (aka salmo trutta trutta)
B: salmo gilae gilae (aka oncorhynchus gilae gilae)
C: salmo keta (aka oncorhynchus keta)
D: salmons and trouts (aka salmoniformes)
E: salmo mykiss (aka oncorhynchus mykiss)
F: None of the above. | [E] |
<Instruct>: Given the context 'In situ hybridization indicates the photoreceptor layer has the highest level of P2Y2 receptor of any region in the rabbit retina, although staining was not pronounced in monkey', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit]
<Options>: A: swamp rabbit (aka sylvilagus aquaticus)
B: bovidae
C: lepus cuniculus cuniculus (aka oryctolagus cuniculus cuniculus)
D: european rabbit (aka oryctolagus cuniculus)
E: marsh rabbit (aka sylvilagus palustris)
F: None of the above. | [D] |
<Instruct>: Given the context 'A2 receptors have been recognized on cultured and fresh RPE cells for some time [26, 27], with in situ hybridization confirming the presence of A2A receptors in rat RPE', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus (rats (aka rattus))
B: roof rat (aka rattus rattus)
C: rattus norvegicus albus
D: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
E: mus norvegicus (aka rattus norvegicus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Although adenosine alone does not increase intracellular Ca2+ levels [31], adenosine acts synergistically with ATP to elevate Ca2+ levels in human RPE cells by stimulating both A1 and A2A receptors', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: animals (aka metazoa)
B: homo sapiens (human) (aka homo sapiens)
C: probles
D: this
E: kingdom
F: None of the above. | [B] |
<Instruct>: Given the context 'The P2Y2 receptor was initially characterized in cultured human RPE', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: probles
B: primate (aka primates)
C: homo sapiens (human) (aka homo sapiens)
D: kingdom
E: animals (aka metazoa)
F: None of the above. | [C] |
<Instruct>: Given the context '[31], with subsequent reports localizing transcript for P2Y1, P2Y2, P2Y4, and P2Y6 in the rat RPE/choroid', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rats (aka rattus) (aka rattus)
B: rattus rattoides (aka rattus rattus)
C: brown rat (aka rattus norvegicus)
D: rattus rattoides (aka rattus pyctoris)
E: rattus sp. (rats (aka rattus sp.))
F: None of the above. | [C] |
<Instruct>: Given the context '[40], and functionally identifying a P2X receptor in rat RPE cells [41].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus sp. (rats (aka rattus sp.))
B: rattus norvegicus albus
C: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
D: brown rat (aka rattus norvegicus)
E: rats (aka rattus) (aka rattus)
F: None of the above. | [D] |
<Instruct>: Given the context 'The P2Y2 receptor has been specifically localized to the apical membrane of fresh bovine RPE cells, and addition of ATP to this membrane transiently elevates Ca2+, activates a basolateral Cl- conductance, inhibits an apical K+ conductance, and increases the apical to basolateral flow of fluid [43].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos taurus x bos indicus (aka bos indicus x bos taurus)
B: bos sp.
C: cow (aka bos taurus) (aka bos taurus)
D: bos bubalis bubalis (aka bubalus bubalis bubalis)
E: bovidae
F: None of the above. | [C] |
<Instruct>: Given the context 'The P2Y2 receptor has been specifically localized to the apical membrane of fresh bovine RPE cells, and addition of ATP to this membrane transiently elevates Ca2+, activates a basolateral Cl- conductance, inhibits an apical K+ conductance, and increases the apical to basolateral flow of fluid [43].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos bubalis bubalis (aka bubalus bubalis bubalis)
B: bovidae
C: bos taurus x bos indicus (aka bos indicus x bos taurus)
D: bos sp.
E: None of the above. | [E] |
<Instruct>: Given the context 'ATP, UTP, and the P2Y2 receptor agonist INS37217 decrease the size of subretinal fluid blebs when injected into subretinal space of rats [44].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rats]
<Options>: A: black rat (aka rattus rattus)
B: rattus rattoides (aka rattus pyctoris)
C: rattus norvegicus albus
D: mus norvegicus (aka rattus norvegicus)
E: rats (aka rattus) (aka rattus)
F: None of the above. | [D] |
<Instruct>: Given the context 'In both normal and rds +/- mice with experimentally induced detachment, INS31217 improves the ERG recovery and decreased cell death [45].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: peromyscus
B: house mouse (aka mus musculus)
C: mus (aka mus <genus>) (aka mus <genus>)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
F: None of the above. | [B] |
<Instruct>: Given the context 'INS37217 also reduces subretinal blebs in rabbits [46].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbits]
<Options>: A: lepus europaeus europaeus
B: european rabbit (aka oryctolagus cuniculus)
C: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
D: marsh rabbit (aka sylvilagus palustris)
E: rabbits and hares (aka leporidae)
F: None of the above. | [B] |
<Instruct>: Given the context 'NMDA also triggers a release of ATP when applied to the intact bovine RPE eyecup [51].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos bubalis (aka bubalus bubalis)
B: bos taurus x bos indicus (aka bos indicus x bos taurus)
C: domestic cattle (aka bos taurus)
D: bovidae
E: bovinae
F: None of the above. | [C] |
<Instruct>: Given the context 'The NMDA receptors and the ATP release sites have been functionally identified to the apical membrane of the bovine RPE, suggesting the neurotransmitter interactions could amplify the signal from any glutamate reaching subretinal space.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos indicus (bos primigenius indicus) (aka bos indicus)
B: boveria
C: bos sp.
D: bos bovis (aka bos taurus)
E: bovinae
F: None of the above. | [D] |
<Instruct>: Given the context 'While the precise mechanisms by which CFTR contributes to this release are not yet known, a role for CFTR in ATP release into subretinal space is consistent with the reduction of certain ERG components in cftr -/- mice [58] and with the ability of apical ATP to activate conductances associated with these ERG components [43].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mice (aka mus sp.) (aka mus sp.)
B: mus cricetus (aka cricetus cricetus)
C: house mouse (aka mus musculus)
D: mus castaneus (aka mus musculus castaneus)
E: peromyscus
F: None of the above. | [C] |
<Instruct>: Given the context 'Degradation of ATP by the apical membrane of the fresh bovine eyecup and by ARPE-19 cells is inhibited by ARL67156 or βγmATP.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos bubalis (aka bubalus bubalis)
B: bos sp.
C: bos taurus indicus (aka bos indicus)
D: bos bovis (aka bos taurus)
E: bovinae
F: None of the above. | [D] |
<Instruct>: Given the context 'The production of adenosine from ATP at the apical membrane of the bovine RPE eyecup is inhibited by the ecto-5′-nucleotidase inhibitor αβmADP, confirming a role for this enzyme [63].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos (cattle) (aka bos)
B: bos sp.
C: bos taurus (bos primigenius taurus) (aka bos taurus)
D: bovinae
E: bos bubalis bubalis (aka bubalus bubalis bubalis)
F: None of the above. | [C] |
<Instruct>: Given the context 'The enzyme is localized to rat RPE and ARPE-19 cells immunohistochemically.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus norvegicus albus
B: rats (aka rattus sp.) (aka rattus sp.)
C: rattus rattus (rattus wroughtoni) (aka rattus rattus)
D: norway rat (aka rattus norvegicus)
E: rattus (rats (aka rattus))
F: None of the above. | [D] |
<Instruct>: Given the context 'Degradation of 5′AMP is highest near the subretinal space of rat retina', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rats (aka rattus sp.) (aka rattus sp.)
B: rattus norvegicus (rats (aka rattus norvegicus))
C: rattus norvegicus albus
D: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
E: roof rat (aka rattus rattus)
F: None of the above. | [B] |
<Instruct>: Given the context 'Degradation of 5′AMP is highest near the subretinal space of rat retina', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
B: rattus norvegicus albus
C: rats (aka rattus sp.) (aka rattus sp.)
D: roof rat (aka rattus rattus)
E: None of the above. | [E] |
<Instruct>: Given the context '[63], although localization in mouse indicated larger amounts of ecto-5′-nucleotidase at the tips of adjacent Müller cells', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mouse (aka mus musculus)
B: mus <subgenus> (mus (aka mus <subgenus>))
C: mus cricetus (aka cricetus cricetus)
D: mus (aka mus <genus>) (aka mus <genus>)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: None of the above. | [A] |
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; potato; wheat]
<Options>: A: solanum arboreum
B: sweet potato (aka ipomoea batatas)
C: wheat (aka triticum aestivum)
D: solanum crispum (chilean potato-tree) (aka solanum crispum)
E: triticum strictum (aka secale strictum)
F: potato (aka solanum tuberosum)
G: tuberaria
H: triticum
I: solanum giganteum
J: solanum annuum
K: one-grained wheat (aka triticum monococcum)
L: triticum x secale (aka x triticosecale)
M: solanum
N: solanum acuminatum
O: None of the above. | [F; F; C] |
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; potato; wheat]
<Options>: A: tuberaria
B: solanum giganteum
C: wild emmer wheat (aka triticum dicoccoides)
D: solanum acuminatum
E: solanum ipomoeoides
F: english wheat (aka triticum turgidum)
G: sweet potato (aka ipomoea batatas)
H: bread wheat (aka triticum aestivum)
I: one-grained wheat (aka triticum monococcum)
J: solanum hirtum
K: triticum tauschii (aka aegilops tauschii)
L: solanum crispum (chilean potato-tree) (aka solanum crispum)
M: solanum trifidum
N: potatoes (aka solanum tuberosum)
O: None of the above. | [N; N; H] |
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; potato; wheat]
<Options>: A: solanum arboreum
B: triticum strictum (aka secale strictum)
C: common wheat (aka triticum aestivum)
D: triticum tauschii (aka aegilops tauschii)
E: solanum barbisetum
F: chinese-potato (aka dioscorea polystachya)
G: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
H: solanum giganteum
I: tuberaria
J: solanum annuum
K: potatoes (aka solanum tuberosum)
L: solanum hirtum
M: triticum durum (aka triticum turgidum subsp. durum)
N: rivet wheat (aka triticum turgidum)
O: None of the above. | [K; K; C] |
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; potato; wheat]
<Options>: A: triticum strictum (aka secale strictum)
B: solanum arboreum
C: solanum giganteum
D: solanum annuum
E: solanum hirtum
F: potatoes (aka solanum tuberosum)
G: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
H: tuberaria
I: triticum durum (aka triticum turgidum subsp. durum)
J: chinese-potato (aka dioscorea polystachya)
K: triticum tauschii (aka aegilops tauschii)
L: solanum barbisetum
M: rivet wheat (aka triticum turgidum)
N: None of the above. | [F; F; N] |
<Instruct>: Given the context 'Our aim was to compare processing and editing of potato small ribosomal protein 10 gene (rps10) transcripts in heterologous (wheat mitochondria) and homologous (potato mitochondria) contexts.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: durum wheat (aka triticum turgidum subsp. durum)
B: triticum
C: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
D: solanum annuum
E: english wheat (aka triticum turgidum)
F: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
G: bread wheat (aka triticum aestivum)
H: triticum x secale (aka x triticosecale)
I: sweet potato (aka ipomoea batatas)
J: solanum rugosum
K: None of the above. | [C; G] |
<Instruct>: Given the context 'Our aim was to compare processing and editing of potato small ribosomal protein 10 gene (rps10) transcripts in heterologous (wheat mitochondria) and homologous (potato mitochondria) contexts.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: solanum glutinosum
B: triticum strictum (aka secale strictum)
C: wild emmer wheat (aka triticum dicoccoides)
D: solanum crispum (chilean potato-tree) (aka solanum crispum)
E: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
F: solanum giganteum
G: bread wheat (aka triticum aestivum)
H: triticum aethiopicum (aka triticum turgidum)
I: triticum durum (aka triticum turgidum subsp. durum)
J: potatoes (aka solanum tuberosum)
K: None of the above. | [J; G] |
<Instruct>: Given the context 'rps10 is a suitable model because it contains a group II intron, is absent in wheat mitochondria but is actively expressed in potato mitochondria, where transcripts are spliced and undergo five C-to-U editing events.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: solanum glutinosum
B: triticum aestivum subsp. aestivum (aka triticum aestivum)
C: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
D: one-grained wheat (aka triticum monococcum)
E: triticum x secale (aka x triticosecale)
F: triticum tauschii (aka aegilops tauschii)
G: solanum nutans
H: triticum
I: chinese-potato (aka dioscorea polystachya)
J: potato yam (aka dioscorea bulbifera)
K: None of the above. | [B; C] |
<Instruct>: Given the context 'rps10 is a suitable model because it contains a group II intron, is absent in wheat mitochondria but is actively expressed in potato mitochondria, where transcripts are spliced and undergo five C-to-U editing events.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: triticum x secale (aka x triticosecale)
B: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
C: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
D: one-grained wheat (aka triticum monococcum)
E: chinese-potato (aka dioscorea polystachya)
F: solanum glutinosum
G: tuberaria
H: triticum strictum (aka secale strictum)
I: triticum
J: dioscorea bulbifera (potato yam) (aka dioscorea bulbifera)
K: None of the above. | [C; B] |
<Instruct>: Given the context 'For this purpose, conditions for electroporating isolated potato mitochondria were established.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
B: solanum rugosum
C: potatoes (aka solanum tuberosum)
D: solanum glutinosum
E: solanum ipomoeoides
F: None of the above. | [C] |
<Instruct>: Given the context 'rps10 was placed under the control of either potato or wheat cox2 promoters.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: solanum
B: rivet wheat (aka triticum turgidum)
C: wild emmer wheat (aka triticum dicoccoides)
D: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
E: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
F: solanum rugosum
G: solanum ipomoeoides
H: triticum
I: triticum strictum (aka secale strictum)
J: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
K: None of the above. | [D; E] |
<Instruct>: Given the context 'rps10 was placed under the control of either potato or wheat cox2 promoters.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: wild emmer wheat (aka triticum dicoccoides)
B: sweet potato (aka ipomoea batatas)
C: chinese-potato (aka dioscorea polystachya)
D: triticum x secale (aka x triticosecale)
E: air-potato (aka dioscorea bulbifera)
F: wheat (aka triticum aestivum)
G: triticum
H: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
I: solanum giganteum
J: triticum tauschii (aka aegilops tauschii)
K: None of the above. | [H; F] |
<Instruct>: Given the context 'In wheat mitochondria, rps10 transcripts were neither spliced nor edited while they are correctly processed in potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: triticum strictum (aka secale strictum)
B: solanum ipomoeoides
C: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
D: triticum x secale (aka x triticosecale)
E: triticum durum (aka triticum turgidum subsp. durum)
F: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
G: wild emmer wheat (aka triticum dicoccoides)
H: air-potato (aka dioscorea bulbifera)
I: chilean potato-tree (aka solanum crispum)
J: solanum nutans
K: None of the above. | [F; C] |
<Instruct>: Given the context 'In wheat mitochondria, rps10 transcripts were neither spliced nor edited while they are correctly processed in potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: solanum
B: durum wheat (aka triticum turgidum subsp. durum)
C: chinese-potato (aka dioscorea polystachya)
D: common wheat (aka triticum aestivum)
E: triticum x secale (aka x triticosecale)
F: potato (aka solanum tuberosum)
G: tuberaria
H: wild emmer wheat (aka triticum dicoccoides)
I: solanum giganteum
J: one-grained wheat (aka triticum monococcum)
K: None of the above. | [D; F] |
<Instruct>: Given the context 'Interestingly, a wheat editing site grafted into rps10 was not recognized by wheat mitochondria but was correctly edited in potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: sweet potato (aka ipomoea batatas)
B: durum wheat (aka triticum turgidum subsp. durum)
C: solanum glutinosum
D: potatoes (aka solanum tuberosum)
E: bread wheat (aka triticum aestivum)
F: triticum
G: rivet wheat (aka triticum turgidum)
H: chaco potato (aka solanum chacoense)
I: triticum x secale (aka x triticosecale)
J: solanum crispum (chilean potato-tree) (aka solanum crispum)
K: None of the above. | [E; D] |
<Instruct>: Given the context 'Interestingly, a wheat editing site grafted into rps10 was not recognized by wheat mitochondria but was correctly edited in potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: potato (aka solanum tuberosum)
B: one-grained wheat (aka triticum monococcum)
C: wild emmer wheat (aka triticum dicoccoides)
D: triticum aethiopicum (aka triticum turgidum)
E: solanum nutans
F: chinese-potato (aka dioscorea polystachya)
G: triticum strictum (aka secale strictum)
H: air-potato (aka dioscorea bulbifera)
I: triticum sativum (aka triticum aestivum)
J: solanum giganteum
K: None of the above. | [I; A] |
<Instruct>: Given the context 'In Arabidopsis thaliana 456 C-to-U editing events have been described (6).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [arabidopsis thaliana]
<Options>: A: apophylia
B: arabidopsis arenosa x arabidopsis thaliana
C: apophyllum
D: thale-cress (aka arabidopsis thaliana)
E: arabidella
F: None of the above. | [D] |
<Instruct>: Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [a.thaliana; sorghum bicolor; maize]
<Options>: A: brassica
B: archeria
C: saccharum x sorghum
D: zea mays subsp. mays x zea mays subsp. parviglumis
E: maize (aka zea mays subsp. mays)
F: sorghum vulgare var. sudanense (aka sorghum bicolor subsp. drummondii)
G: arabidopsis thaliana x arabidopsis arenosa
H: zea mays subsp. mays x zea mays subsp. mexicana
I: sorghum australiense
J: sorghum (aka sorghum bicolor)
K: australytta
L: zea mexicana (aka zea mays subsp. mexicana)
M: maize (aka zea mays)
N: sorghum bicolor x saccharum hybrid cultivar
O: thale-cress (aka arabidopsis thaliana)
P: None of the above. | [O; J; M] |
<Instruct>: Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [a.thaliana; sorghum bicolor; maize]
<Options>: A: sorghum sudanense (aka sorghum bicolor subsp. drummondii)
B: sorghum bicolor var. virgatum (aka sorghum virgatum)
C: sorghum bicolor x saccharum hybrid cultivar
D: maize (aka zea mays)
E: sorghum vulgare (aka sorghum bicolor)
F: sorghum brachypodum
G: annea
H: brassica
I: zea mays subsp. mays x zea mays subsp. parviglumis
J: zea mays subsp. mays x zea perennis
K: arabidopsis thaliana x arabidopsis lyrata
L: zea mexicana (aka zea mays subsp. mexicana)
M: vascular plants (aka tracheophyta)
N: zea mays subsp. mays x zea mays subsp. mexicana
O: arabis thaliana (aka arabidopsis thaliana)
P: None of the above. | [O; E; D] |
<Instruct>: Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [a.thaliana; sorghum bicolor; maize]
<Options>: A: beana
B: archeria
C: arabis thaliana (aka arabidopsis thaliana)
D: sorghum australiense
E: sorghum bicolor x saccharum hybrid cultivar
F: australytta
G: sorghum hybrid cultivar
H: ansola
I: sorghum grande
J: sorghum (aka sorghum bicolor)
K: zea mays (zea mays var. japonica) (aka zea mays)
L: zea ramosa (aka zea mays subsp. mays)
M: zea mexicana (aka zea mays subsp. mexicana)
N: zea mays subsp. mays x zea mays subsp. mexicana
O: zea mays subsp. mays x zea perennis
P: None of the above. | [C; J; K] |
<Instruct>: Given the context 'Of particular interest is the situation of the small ribosomal protein 10 gene (rps10), a group II intron-bearing gene which is encoded in Solanum tuberosum mitochondrial DNA but is absent from the wheat mitochondrial genome (20).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; wheat]
<Options>: A: solanum giganteum
B: one-grained wheat (aka triticum monococcum)
C: durum wheat (aka triticum turgidum subsp. durum)
D: potatoes (aka solanum tuberosum)
E: triticum sativum (aka triticum aestivum)
F: solanum hirtum
G: solanum arboreum
H: english wheat (aka triticum turgidum)
I: solanum mammosum
J: triticum
K: None of the above. | [D; E] |
<Instruct>: Given the context 'Of particular interest is the situation of the small ribosomal protein 10 gene (rps10), a group II intron-bearing gene which is encoded in Solanum tuberosum mitochondrial DNA but is absent from the wheat mitochondrial genome (20).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [solanum tuberosum; wheat]
<Options>: A: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
B: solanum
C: triticum strictum (aka secale strictum)
D: wild emmer wheat (aka triticum dicoccoides)
E: solanum mammosum
F: triticum aegilops (aka aegilops tauschii)
G: solanum hirtum
H: solanum vicinum
I: triticum
J: potatoes (aka solanum tuberosum)
K: None of the above. | [J; A] |
<Instruct>: Given the context 'Using this model, we found that editing and splicing of cox2 transcripts were not linked in wheat mitochondria (15).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: triticum aegilops (aka aegilops tauschii)
B: triticum vulgare (aka triticum aestivum)
C: rivet wheat (aka triticum turgidum)
D: triticum durum (aka triticum turgidum subsp. durum)
E: wild emmer wheat (aka triticum dicoccoides)
F: None of the above. | [B] |
<Instruct>: Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: durum wheat (aka triticum turgidum subsp. durum)
B: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
C: tuberosum group
D: triticum
E: solanum paludosum
F: common wheat (aka triticum aestivum)
G: triticum aegilops (aka aegilops tauschii)
H: solanum trifolium
I: potato (aka solanum tuberosum)
J: triticum aethiopicum (aka triticum turgidum)
K: None of the above. | [I; F] |
<Instruct>: Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: solanum barbisetum
B: solanum glutinosum
C: triticum strictum (aka secale strictum)
D: wild emmer wheat (aka triticum dicoccoides)
E: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
F: potato (aka solanum tuberosum)
G: triticum aegilops (aka aegilops tauschii)
H: solanum luteum (aka solanum villosum)
I: solanum paludosum
J: one-grained wheat (aka triticum monococcum)
K: None of the above. | [F; E] |
<Instruct>: Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: one-grained wheat (aka triticum monococcum)
B: triticum aegilops (aka aegilops tauschii)
C: solanum glutinosum
D: solanum luteum (aka solanum villosum)
E: solanum barbisetum
F: triticum strictum (aka secale strictum)
G: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
H: solanum paludosum
I: wild emmer wheat (aka triticum dicoccoides)
J: None of the above. | [J; G] |
<Instruct>: Given the context 'Five C residues are changed to U in potato mitochondria rps10 transcripts by editing.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum glutinosum
B: solanum
C: potato (aka solanum tuberosum)
D: tuberaria
E: potato yam (aka dioscorea bulbifera)
F: None of the above. | [C] |
<Instruct>: Given the context 'To test this hypothesis, it was necessary to set up the conditions for electroporation of foreign DNA into S.tuberosum mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum mammosum
B: potatoes (aka solanum tuberosum)
C: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
D: solanum lanceaefolium (aka solanum lanceifolium)
E: solanum trifolium
F: None of the above. | [B] |
<Instruct>: Given the context 'Here, we show that a potato rps10 construct is transcribed when introduced into wheat mitochondria, but transcripts are not recognized by the post-transcriptional processing machinery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: solanum annuum
B: solanum nutans
C: triticum x secale (aka x triticosecale)
D: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
E: common wheat (aka triticum aestivum)
F: potatoes (aka solanum tuberosum)
G: wild emmer wheat (aka triticum dicoccoides)
H: triticum strictum (aka secale strictum)
I: solanum
J: triticum
K: None of the above. | [F; E] |
<Instruct>: Given the context 'Here, we show that a potato rps10 construct is transcribed when introduced into wheat mitochondria, but transcripts are not recognized by the post-transcriptional processing machinery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato; wheat]
<Options>: A: wheat (aka triticum aestivum)
B: poulard wheat (aka triticum turgidum)
C: sweet potato (aka ipomoea batatas)
D: durum wheat (aka triticum turgidum subsp. durum)
E: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
F: chaco potato (aka solanum chacoense)
G: triticum tauschii (aka aegilops tauschii)
H: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
I: triticum strictum (aka secale strictum)
J: solanum annuum
K: None of the above. | [E; A] |
<Instruct>: Given the context 'In contrast, a rps10 construct is correctly expressed and processed in cognate potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: potato (aka solanum tuberosum)
B: chaco potato (aka solanum chacoense)
C: solanum giganteum
D: tuberaria
E: solanum annuum
F: None of the above. | [A] |
<Instruct>: Given the context 'This is the first report on DNA electroporation into potato mitochondria.
MATERIALS AND METHODS
Plasmids
All plasmids used in this study are based on the previously described pCOXII vector (14).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum
B: tuberaria
C: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
D: solanum nutans
E: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
F: None of the above. | [C] |
<Instruct>: Given the context 'An NsiI restriction site was introduced at the initiation codon of the wheat cox2 open reading frame (ORF).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: wild emmer wheat (aka triticum dicoccoides)
B: one-grained wheat (aka triticum monococcum)
C: triticum aestivum subsp. aestivum (aka triticum aestivum)
D: triticum
E: triticum x secale (aka x triticosecale)
F: None of the above. | [C] |
<Instruct>: Given the context 'Then, NsiI was used in combination with a SpeI restriction site present in the original vector after the stop codon, to produce the chimeric vectors.
S.tuberosum cox2 gene, including a 727 bp non-coding upstream region, was isolated by PCR from total DNA using the primer A designed from partial sequences reported by Löessl et al. (22),', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: potatoes (aka solanum tuberosum)
B: solanum luteum (aka solanum villosum)
C: solanum esculentum (aka solanum lycopersicum)
D: solanum florulentum
E: solanum mammosum
F: None of the above. | [A] |
<Instruct>: Given the context 'Then, NsiI was used in combination with a SpeI restriction site present in the original vector after the stop codon, to produce the chimeric vectors.
S.tuberosum cox2 gene, including a 727 bp non-coding upstream region, was isolated by PCR from total DNA using the primer A designed from partial sequences reported by Löessl et al. (22),', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum esculentum (aka solanum lycopersicum)
B: solanum luteum (aka solanum villosum)
C: solanum florulentum
D: solanum mammosum
E: None of the above. | [E] |
<Instruct>: Given the context 'accession no. AF096321, containing the KpnI restriction sequence, and primer B derived from Triticum timopheevi cox2 (AF336134).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [triticum timopheevi]
<Options>: A: triticum urartu var. urartu
B: triticum aethiopicum (aka triticum turgidum)
C: triticum x dimococcum
D: triticum timonovum (aka triticum timopheevii)
E: triticum x timococcum
F: None of the above. | [D] |
<Instruct>: Given the context 'The complete sequence of the S.tuberosum cox2 was determined (accession no. DQ18064).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum tuberosum var. boreale (aka solanum stoloniferum)
B: solanum pallidum
C: solanum esculentum (aka solanum lycopersicum)
D: potato (aka solanum tuberosum)
E: solanum glabratum
F: None of the above. | [D] |
<Instruct>: Given the context 'To generate the plasmid pCOXIISt containing the S.tuberosum cox2 gene, a KpnI/SpeI fragment containing the 727 bp upstream region and the complete coding region was used to replace the wheat gene from pCOXII.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: solanum hirtum
B: wild emmer wheat (aka triticum dicoccoides)
C: triticum sativum (aka triticum aestivum)
D: potato (aka solanum tuberosum)
E: triticum tauschii (aka aegilops tauschii)
F: solanum mammosum
G: solanum luteum (aka solanum villosum)
H: triticum aethiopicum (aka triticum turgidum)
I: triticum strictum (aka secale strictum)
J: solanum pallidum
K: None of the above. | [D; C] |
<Instruct>: Given the context 'To generate the plasmid pCOXIISt containing the S.tuberosum cox2 gene, a KpnI/SpeI fragment containing the 727 bp upstream region and the complete coding region was used to replace the wheat gene from pCOXII.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: rivet wheat (aka triticum turgidum)
B: solanum glabratum
C: potatoes (aka solanum tuberosum)
D: triticum
E: solanum tuberosum var. boreale (aka solanum stoloniferum)
F: triticum strictum (aka secale strictum)
G: solanum glutinosum
H: solanum succosum
I: triticum vulgare (aka triticum aestivum)
J: wild emmer wheat (aka triticum dicoccoides)
K: None of the above. | [C; I] |
<Instruct>: Given the context 'This 23 bp insertion provides a specific sequence allowing isolation of potato cox2 transcripts originating from the introduced DNA by RT–PCR.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: chinese-potato (aka dioscorea polystachya)
B: solanum ipomoeoides
C: potato (aka solanum tuberosum)
D: sweet potato (aka ipomoea batatas)
E: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
F: None of the above. | [C] |
<Instruct>: Given the context 'The chimeric wheat/potato cox2 gene was constructed by replacing 727 bp KpnI/NsiI promoter sequence from pCOXIISt with the 880 bp wheat upstream region from pCOXII.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
B: triticum strictum (aka secale strictum)
C: common wheat (aka triticum aestivum)
D: triticum aegilops (aka aegilops tauschii)
E: chilean potato-tree (aka solanum crispum)
F: solanum nutans
G: solanum ipomoeoides
H: triticum
I: durum wheat (aka triticum turgidum subsp. durum)
J: solanum
K: None of the above. | [C; A] |
<Instruct>: Given the context 'The chimeric wheat/potato cox2 gene was constructed by replacing 727 bp KpnI/NsiI promoter sequence from pCOXIISt with the 880 bp wheat upstream region from pCOXII.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: sweet potato (aka ipomoea batatas)
B: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
C: one-grained wheat (aka triticum monococcum)
D: solanum rugosum
E: durum wheat (aka triticum turgidum subsp. durum)
F: triticum strictum (aka secale strictum)
G: solanum giganteum
H: triticum aestivum subsp. aestivum (aka triticum aestivum)
I: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
J: triticum
K: None of the above. | [H; B] |
<Instruct>: Given the context 'The vectors pRPS10W and the pRPS10St derivative, containing wheat and potato cox2 promoters, respectively, were constructed by inserting the 1178 bp rps10 sequence containing two exons separated by a 777 bp intronic sequence [(23), accession no.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: triticum strictum (aka secale strictum)
B: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
C: solanum giganteum
D: one-grained wheat (aka triticum monococcum)
E: sweet potato (aka ipomoea batatas)
F: triticum aestivum subsp. aestivum (aka triticum aestivum)
G: wild emmer wheat (aka triticum dicoccoides)
H: solanum annuum
I: solanum glutinosum
J: triticum tauschii (aka aegilops tauschii)
K: None of the above. | [F; B] |
<Instruct>: Given the context 'The vectors pRPS10W and the pRPS10St derivative, containing wheat and potato cox2 promoters, respectively, were constructed by inserting the 1178 bp rps10 sequence containing two exons separated by a 777 bp intronic sequence [(23), accession no.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: chaco potato (aka solanum chacoense)
B: solanum giganteum
C: durum wheat (aka triticum turgidum subsp. durum)
D: solanum glutinosum
E: triticum aegilops (aka aegilops tauschii)
F: one-grained wheat (aka triticum monococcum)
G: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
H: chinese-potato (aka dioscorea polystachya)
I: triticum
J: triticum sativum (aka triticum aestivum)
K: None of the above. | [J; G] |
<Instruct>: Given the context 'The coding region was isolated from total S.tuberosum DNA by PCR using primers D1 and D2 containing the restriction sites NsiI and SpeI, respectively.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum ruvu
B: solanum luteum (aka solanum villosum)
C: solanum pallidum
D: potato (aka solanum tuberosum)
E: solanum paludosum
F: None of the above. | [D] |
<Instruct>: Given the context 'Since all vectors used here were based on pCOXII, they contain the downstream region from the wheat cob gene (Ir-cob) (accession no. AF337547) (14).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: triticum aegilops (aka aegilops tauschii)
B: triticum strictum (aka secale strictum)
C: triticum vulgare (aka triticum aestivum)
D: poulard wheat (aka triticum turgidum)
E: wild emmer wheat (aka triticum dicoccoides)
F: None of the above. | [C] |
<Instruct>: Given the context 'For constructs MA and MAB containing the wheat cox2 C259 editing site, two consecutive insertions were carried out using primers: GGAAGATTGGATTACTATCGAAATTGCCCTGAATCA and TACTATCGAAATTATTCGGACCATGCCCTGAATCA.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
B: triticum strictum (aka secale strictum)
C: triticum
D: triticum x secale (aka x triticosecale)
E: one-grained wheat (aka triticum monococcum)
F: None of the above. | [A] |
<Instruct>: Given the context 'Mitochondria purification
S.tuberosum cv.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum]
<Options>: A: solanum esculentum (aka solanum lycopersicum)
B: solanum lanceaefolium (aka solanum lanceifolium)
C: potatoes (aka solanum tuberosum)
D: tuberosum group
E: solanum barbisetum
F: None of the above. | [C] |
<Instruct>: Given the context 'Potato mitochondria were prepared from 2 kg of tubers in batches of 200 g with 200 ml of a homogenization buffer containing 0.4 M mannitol, 25 mM MOPS (pH 7.8), 1 mM EGTA, 8 mM cysteine and 1 mg/ml fatty acid-free BSA.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
B: solanum rugosum
C: tuberaria
D: sweet potato (aka ipomoea batatas)
E: potato (aka solanum tuberosum)
F: None of the above. | [E] |
<Instruct>: Given the context 'Potato mitochondria were prepared from 2 kg of tubers in batches of 200 g with 200 ml of a homogenization buffer containing 0.4 M mannitol, 25 mM MOPS (pH 7.8), 1 mM EGTA, 8 mM cysteine and 1 mg/ml fatty acid-free BSA.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum rugosum
B: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
C: sweet potato (aka ipomoea batatas)
D: tuberaria
E: None of the above. | [E] |
<Instruct>: Given the context 'The supernatant was centrifuged in a Sorvall SS-34 rotor at 15 000 g for 10 min, the pellet was resuspended in 12 ml of homogenization buffer and mitochondria were purified by centrifugation on a sucrose gradient essentially as described for wheat embryo mitochondria (14).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: triticum vulgare (aka triticum aestivum)
B: english wheat (aka triticum turgidum)
C: triticum tauschii (aka aegilops tauschii)
D: triticum
E: triticum durum (aka triticum turgidum subsp. durum)
F: None of the above. | [A] |
<Instruct>: Given the context 'Electroporation
Electrotransfer experiments were carried out with 1 mg of purified wheat embryo or potato tuber mitochondria in 50 µl of 0.33 M sucrose and 1 µg of recombinant plasmid as described (14).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: durum wheat (aka triticum turgidum subsp. durum)
B: tuberaria
C: triticum x secale (aka x triticosecale)
D: potato yam (aka dioscorea bulbifera)
E: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
F: triticum strictum (aka secale strictum)
G: solanum giganteum
H: triticum
I: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
J: solanum crispum (chilean potato-tree) (aka solanum crispum)
K: None of the above. | [I; E] |
<Instruct>: Given the context 'Electroporation
Electrotransfer experiments were carried out with 1 mg of purified wheat embryo or potato tuber mitochondria in 50 µl of 0.33 M sucrose and 1 µg of recombinant plasmid as described (14).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: sweet potato (aka ipomoea batatas)
B: triticum
C: solanum giganteum
D: potatoes (aka solanum tuberosum)
E: triticum x secale (aka x triticosecale)
F: triticum tauschii (aka aegilops tauschii)
G: solanum
H: solanum ipomoeoides
I: wild emmer wheat (aka triticum dicoccoides)
J: triticum aestivum subsp. aestivum (aka triticum aestivum)
K: None of the above. | [J; D] |
<Instruct>: Given the context 'In the case of potato mitochondria the incubation mixture was supplemented with 1 mg/ml of fatty acid-free BSA.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: potatoes (aka solanum tuberosum)
B: sweet potato (aka ipomoea batatas)
C: solanum
D: tuberaria
E: chilean potato-tree (aka solanum crispum)
F: None of the above. | [A] |
<Instruct>: Given the context 'One microliter of 20% SDS was added to achieve mitochondrial lysis and the DNA was extracted with phenol/chloroform, precipitated with 0.1 vol of 3 M Sodium Acetate (pH 5.2), 3 vol of 100% ethanol and 100 ng of carrier yeast tRNA and left overnight at −20°C.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: saccharomyces cerevisiae x saccharomyces mikatae
B: saccharomyces sp.
C: true yeasts (aka saccharomycotina)
D: saccharomyces cf. cerevisiae
E: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
F: None of the above. | [E] |
<Instruct>: Given the context 'DNA sequencing
Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem).
RESULTS
S.tuberosum rps10 transcripts are not processed in wheat mitochondria
The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: english wheat (aka triticum turgidum)
B: durum wheat (aka triticum turgidum subsp. durum)
C: solanum paludosum
D: triticum x secale (aka x triticosecale)
E: solanum florulentum
F: potatoes (aka solanum tuberosum)
G: wild emmer wheat (aka triticum dicoccoides)
H: solanum lanceaefolium (aka solanum lanceifolium)
I: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
J: solanum hirtum
K: None of the above. | [F; I] |
<Instruct>: Given the context 'DNA sequencing
Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem).
RESULTS
S.tuberosum rps10 transcripts are not processed in wheat mitochondria
The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.tuberosum; wheat]
<Options>: A: wild emmer wheat (aka triticum dicoccoides)
B: triticum x secale (aka x triticosecale)
C: potato (aka solanum tuberosum)
D: solanum succosum
E: triticum durum (aka triticum turgidum subsp. durum)
F: solanum esculentum (aka solanum lycopersicum)
G: poulard wheat (aka triticum turgidum)
H: wheat (aka triticum aestivum)
I: solanum barbisetum
J: solanum vicinum
K: None of the above. | [C; H] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.