instruction stringlengths 225 2.35k | input stringlengths 89 1.5k | response stringclasses 698 values |
|---|---|---|
<Instruct>: Given the context 'In spite of the divergence in sequence of introns, the size and position of the introns are very similar between the murine and human IL-2 genes.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine; human]
<Options>: A: house mouse (aka mus musculus)
B: kingdom
C: this
D: peromyscus
E: human (aka homo sapiens)
F: mus (aka mus <subgenus>) (aka mus <subgenus>)
G: mus norvegicus (aka rattus norvegicus)
H: eastern european house mouse (aka mus musculus musculus)
I: primate (aka primates)
J: macrobiotus sapiens
K: None of the above. | [A; E] |
<Instruct>: Given the context 'In spite of the divergence in sequence of introns, the size and position of the introns are very similar between the murine and human IL-2 genes.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine; human]
<Options>: A: primate (aka primates)
B: human (aka homo sapiens)
C: kingdom
D: mus norvegicus (aka rattus norvegicus)
E: mus (aka mus <subgenus>) (aka mus <subgenus>)
F: macrobiotus sapiens
G: peromyscus
H: eastern european house mouse (aka mus musculus musculus)
I: this
J: None of the above. | [J; B] |
<Instruct>: Given the context 'In spite of the divergence in sequence of introns, the size and position of the introns are very similar between the murine and human IL-2 genes.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine; human]
<Options>: A: mus norvegicus (aka rattus norvegicus)
B: homo sapiens (human) (aka homo sapiens)
C: mus musculus (house mouse) (aka mus musculus)
D: this
E: biota (aka cellular organisms)
F: kingdom
G: mus cricetus (aka cricetus cricetus)
H: western european house mouse (aka mus musculus domesticus)
I: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
J: genus
K: None of the above. | [C; B] |
<Instruct>: Given the context 'Of particular interests is the presence of highly conserved sequences in the 5' -flanking region of the human and mouse IL-2 gene (Fig. 4). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: mouse (aka mus musculus)
B: probles
C: mus cricetus (aka cricetus cricetus)
D: human (aka homo sapiens)
E: kingdom
F: animals (aka metazoa)
G: avian (aka aves)
H: mus molossinus (aka mus musculus molossinus)
I: mice (aka mus sp.) (aka mus sp.)
J: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
K: None of the above. | [D; A] |
<Instruct>: Given the context 'Of particular interests is the presence of highly conserved sequences in the 5' -flanking region of the human and mouse IL-2 gene (Fig. 4). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: peromyscus
B: human (aka homo sapiens)
C: species
D: mus <subgenus> (mus (aka mus <subgenus>))
E: mammals (aka mammalia)
F: probles
G: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
H: genus
I: house mouse (aka mus musculus)
J: mus (aka mus <genus>) (aka mus <genus>)
K: None of the above. | [B; I] |
<Instruct>: Given the context 'Since we have not yet determined the nucleotide sequence further upstream of the mouse gene, we do not know whether or not this similarity extends further. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: peromyscus
C: mus molossinus (aka mus musculus molossinus)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: western european house mouse (aka mus musculus domesticus)
F: None of the above. | [A] |
<Instruct>: Given the context 'Our preliminary results indicate that the 5 '-flanking sequence of the human IL-2 gene mediates mitogen induced expression of the gene in T-lymphocytic cells (Fujita & Taniguchi, unpublished observation).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: birds (aka aves)
B: homo sapiens (human) (aka homo sapiens)
C: macrobiotus sapiens
D: kingdom
E: humans (aka homo)
F: None of the above. | [B] |
<Instruct>: Given the context 'We thank Dr. T. Honjo for mouse gene library. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus domesticus (aka mus musculus domesticus)
D: mus musculus (house mouse) (aka mus musculus)
E: mus molossinus (aka mus musculus molossinus)
F: None of the above. | [D] |
<Instruct>: Given the context 'More than half of human genes are known to have alternative polyadenylation (31).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: humans (aka homo)
B: avian (aka aves)
C: macrobiotus sapiens
D: genus
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'More than half of human genes are known to have alternative polyadenylation (31).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: genus
B: macrobiotus sapiens
C: humans (aka homo)
D: avian (aka aves)
E: None of the above. | [E] |
<Instruct>: Given the context 'Over two-thirds of human genes are thought to undergo alternative splicing (32).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: homo (humans) (aka homo)
C: mammals (aka mammalia)
D: genus
E: species
F: None of the above. | [A] |
<Instruct>: Given the context 'Although, G-quadruplexes have been surveyed in the human genome with such techniques (34,35), there are no known user-friendly computational tools easily accessible to the public.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: humans (aka homo)
B: animals (aka metazoa)
C: kingdom
D: species
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: mouse (aka mus musculus)
B: homo sapiens (human) (aka homo sapiens)
C: mammals (aka mammalia)
D: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
E: biota (aka cellular organisms)
F: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
G: mus cricetus (aka cricetus cricetus)
H: genus
I: birds (aka aves)
J: mus molossinus (aka mus musculus molossinus)
K: None of the above. | [B; A] |
<Instruct>: Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: house mouse (aka mus musculus)
B: homo sapiens (human) (aka homo sapiens)
C: genus
D: probles
E: avian (aka aves)
F: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
G: mouse (aka mus <genus>)
H: biota (aka cellular organisms)
I: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
J: peromyscus
K: None of the above. | [B; A] |
<Instruct>: Given the context 'For example, entering the gene ID 403437 results in downloading the Brca1 gene sequence for Canis familiaris.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [canis familiaris]
<Options>: A: canis lupus familiaris (dogs (aka canis lupus familiaris))
B: canis sp.
C: canis
D: canis lupus (grey wolf) (aka canis lupus)
E: canidae (dog, coyote, wolf, fox) (aka canidae)
F: None of the above. | [A] |
<Instruct>: Given the context 'For example, the mouse version of the gene PTPRU, which is 69822 bases long, contains 94681 QGRS of length up to 45 bases.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus sp. (mice (aka mus sp.))
B: peromyscus
C: mus molossinus (aka mus musculus molossinus)
D: mus musculus (house mouse) (aka mus musculus)
E: mus <subgenus> (mus (aka mus <subgenus>))
F: None of the above. | [D] |
<Instruct>: Given the context 'As an example, the Gene View for the human GREB1 is displayed in Figure 2, showing the table of gene information and product information for the first product (the output for all products may be seen in the supplementary material).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: macrobiotus sapiens
B: humans (aka homo)
C: animals (aka metazoa)
D: mammals (aka mammalia)
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis
Abstract
ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast; saccharomyces cerevisiae]
<Options>: A: saccharomyces lactis (aka kluyveromyces lactis)
B: saccharomyces albicans (aka candida albicans)
C: saccharomyces sp.
D: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
E: saccharomyces cf. cerevisiae
F: baker's yeast (aka saccharomyces cerevisiae)
G: saccharomyces globosus (aka saccharomyces uvarum)
H: saccharomyces cerevisiae x saccharomyces mikatae
I: None of the above. | [F; F] |
<Instruct>: Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis
Abstract
ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast; saccharomyces cerevisiae]
<Options>: A: saccharomyces uvarum (saccharomyces bayanus var. uvarum) (aka saccharomyces uvarum)
B: saccharomyces cerevisiae x saccharomyces paradoxus
C: saccharomyces sp.
D: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
E: saccharomyces cerevisiae synthetic construct
F: saccharomycodes
G: mycoderma cerevisiae (aka saccharomyces cerevisiae)
H: saccharomyces albicans (aka candida albicans)
I: candida/saccharomycetales (aka candida/saccharomycales clade)
J: None of the above. | [G; G] |
<Instruct>: Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast; saccharomyces cerevisiae]
<Options>: A: saccharomyceta
B: saccharomyces hansenii (aka debaryomyces hansenii)
C: mycoderma cerevisiae (aka saccharomyces cerevisiae)
D: saccharomyces cf. cerevisiae
E: saccharomyces cerevisiae x saccharomyces uvarum
F: saccharomyces paradoxus
G: candida/saccharomycetales (aka candida/saccharomycales clade)
H: saccharomyces albicans (aka candida albicans)
I: saccharomyces cerevisiae x saccharomyces mikatae
J: None of the above. | [C; C] |
<Instruct>: Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast; saccharomyces cerevisiae]
<Options>: A: saccharomyces sp.
B: baker's yeast (aka saccharomyces cerevisiae)
C: saccharomyces cf. cerevisiae
D: saccharomyces lactis (aka kluyveromyces lactis)
E: saccharomyces cerevisiae x saccharomyces paradoxus
F: candida/saccharomycetales (aka candida/saccharomycales clade)
G: saccharomyces cerevisiae x saccharomyces mikatae
H: saccharomycodes
I: None of the above. | [B; B] |
<Instruct>: Given the context 'In yeast cells there are more than 100 different snoRNAs playing important roles in rRNA modification and processing.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: candida/saccharomycetales (aka candida/saccharomycales clade)
B: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
C: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
D: saccharomyceta
E: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
F: None of the above. | [E] |
<Instruct>: Given the context 'The yeast protein was localized to the nucleus in a previous study (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: saccharomyces lactis (aka kluyveromyces lactis)
B: baker's yeast (aka saccharomyces cerevisiae)
C: saccharomycodes
D: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
E: true yeasts (aka saccharomycotina)
F: None of the above. | [B] |
<Instruct>: Given the context 'On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: eutherian mammals (aka eutheria)
B: this
C: homo sapiens (human) (aka homo sapiens)
D: probles
E: species
F: None of the above. | [C] |
<Instruct>: Given the context 'On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: probles
B: eutherian mammals (aka eutheria)
C: species
D: this
E: None of the above. | [E] |
<Instruct>: Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: saccharomyces cf. cerevisiae
B: human (aka homo sapiens)
C: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
D: animals (aka metazoa)
E: baker's yeast (aka saccharomyces cerevisiae)
F: avian (aka aves)
G: saccharomyces hansenii (aka debaryomyces hansenii)
H: saccharomyces cerevisiae x saccharomyces mikatae
I: macrobiotus sapiens
J: eutherian mammals (aka eutheria)
K: None of the above. | [B; E] |
<Instruct>: Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: this
B: mycoderma cerevisiae (aka saccharomyces cerevisiae)
C: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
D: species
E: saccharomyces albicans (aka candida albicans)
F: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
G: saccharomycodes
H: human (aka homo sapiens)
I: birds (aka aves)
J: macrobiotus sapiens
K: None of the above. | [H; B] |
<Instruct>: Given the context 'MATERIALS AND METHODS
Yeast strains and media
The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast; s.cerevisiae]
<Options>: A: saccharomyces cerevisiae x saccharomyces paradoxus
B: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
C: saccharomyces sp.
D: saccharomyces cerevisiae synthetic construct
E: saccharomyces cerevisiae x saccharomyces mikatae
F: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
G: saccharomyces lactis (aka kluyveromyces lactis)
H: saccharomyceta
I: mycoderma cerevisiae (aka saccharomyces cerevisiae)
J: None of the above. | [I; I] |
<Instruct>: Given the context 'MATERIALS AND METHODS
Yeast strains and media
The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast; s.cerevisiae]
<Options>: A: candida/saccharomycetales (aka candida/saccharomycales clade)
B: mycoderma cerevisiae (aka saccharomyces cerevisiae)
C: saccharomyces albicans (aka candida albicans)
D: saccharomyces globosus (aka saccharomyces uvarum)
E: saccharomyces cerevisiae x saccharomyces paradoxus
F: saccharomyceta
G: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
H: saccharomyces cf. cerevisiae
I: saccharomyces cerevisiae x saccharomyces mikatae
J: None of the above. | [B; B] |
<Instruct>: Given the context 'Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [schizosaccharomyces pombe]
<Options>: A: fission yeast (aka schizosaccharomyces pombe)
B: zygosaccharomyces sp.
C: schizosaccharomycetes (archiascomycota) (aka schizosaccharomycetes)
D: schizosaccharomyces osmophilus
E: zygosaccharomyces
F: None of the above. | [A] |
<Instruct>: Given the context '[MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: genus
C: eutherian mammals (aka eutheria)
D: primate (aka primates)
E: humans (aka homo)
F: None of the above. | [A] |
<Instruct>: Given the context '[MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: genus
B: humans (aka homo)
C: eutherian mammals (aka eutheria)
D: primate (aka primates)
E: None of the above. | [E] |
<Instruct>: Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: primate (aka primates)
B: saccharomyces albicans (aka candida albicans)
C: kingdom
D: cellular organisms (biota) (aka cellular organisms)
E: baker's yeast (aka saccharomyces cerevisiae)
F: human (aka homo sapiens)
G: saccharomyces hansenii (aka debaryomyces hansenii)
H: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
I: eutherian mammals (aka eutheria)
J: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
K: None of the above. | [F; E] |
<Instruct>: Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: candida/saccharomycetales (aka candida/saccharomycales clade)
B: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
C: homo (humans) (aka homo)
D: saccharomyces sp.
E: avian (aka aves)
F: this
G: saccharomyces lactis (aka kluyveromyces lactis)
H: genus
I: saccharomycodes
J: human (aka homo sapiens)
K: None of the above. | [J; B] |
<Instruct>: Given the context 'The fragment of the human Enp1 homolog (amino acids 152–437) was also cloned into these vectors to generate pCW110, pCW114, pCW116 and pCW118.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: probles
B: homo sapiens (human) (aka homo sapiens)
C: species
D: suborder
E: birds (aka aves)
F: None of the above. | [B] |
<Instruct>: Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; donkey]
<Options>: A: mouse (aka mus musculus)
B: equus africanus (aka equus asinus africanus)
C: mus domesticus (aka mus musculus domesticus)
D: hybrid of male horse and female donkey (aka equus caballus x equus asinus)
E: equus subg. asinus (aka equus)
F: equine (aka equus caballus)
G: mus molossinus (aka mus musculus molossinus)
H: eastern european house mouse (aka mus musculus musculus)
I: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
J: donkey (aka equus asinus)
K: None of the above. | [A; J] |
<Instruct>: Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; donkey]
<Options>: A: house mouse (aka mus musculus)
B: mice (aka mus <genus>) (aka mus <genus>)
C: african ass (aka equus asinus)
D: mus sp. (mice (aka mus sp.))
E: equidae (horses) (aka equidae)
F: equus ferus (equus caballus ferus) (aka equus ferus)
G: equus caballus x equus asinus (hybrid of male horse and female donkey) (aka equus caballus x equus asinus)
H: mus cricetus (aka cricetus cricetus)
I: equine (aka equus caballus)
J: mus (aka mus <subgenus>) (aka mus <subgenus>)
K: None of the above. | [A; C] |
<Instruct>: Given the context 'Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: house mouse (aka mus musculus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus cricetus (aka cricetus cricetus)
D: eastern european house mouse (aka mus musculus musculus)
E: peromyscus
F: None of the above. | [A] |
<Instruct>: Given the context 'Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: eastern european house mouse (aka mus musculus musculus)
B: peromyscus
C: mus cricetus (aka cricetus cricetus)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: None of the above. | [E] |
<Instruct>: Given the context 'RESULTS
Construction and analysis of ENP1 temperature-sensitive alleles
ENP1 is an essential yeast gene conserved among eukaryotes (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: saccharomyces cerevisiae x saccharomyces mikatae
B: mycoderma cerevisiae (aka saccharomyces cerevisiae)
C: candida/saccharomycetales (aka candida/saccharomycales clade)
D: saccharomyces hansenii (aka debaryomyces hansenii)
E: true yeasts (aka saccharomycotina)
F: None of the above. | [B] |
<Instruct>: Given the context 'The TAP tag contains Staphylococcus aureus Protein A as well as calmodulin-binding peptide sequences, so the tagged Enp1 binds IgG beads with high specificity.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [staphylococcus aureus]
<Options>: A: staphylococcus sp. s
B: staphylococcus simulans staphylolyticus (aka staphylococcus simulans bv. staphylolyticus)
C: 'staphylococcus faecalis' (aka staphylococcus faecalis)
D: staphylococcus pyogenes aureus (aka staphylococcus aureus)
E: staphylococcus aureus col (aka staphylococcus aureus subsp. aureus col)
F: None of the above. | [D] |
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; drosophila; caenorhabditis elegans]
<Options>: A: caenorhabditis sp.
B: caenorhabditis
C: mammals (aka mammalia)
D: melanogaster <basidiomycete fungi> (melanogaster) (aka melanogaster <basidiomycete fungi>)
E: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans)
F: fruit fly (aka drosophila melanogaster)
G: enyo elegans (aka zodarion elegans)
H: drosophila elegans
I: melanogaster subgroup
J: cellular organisms (biota) (aka cellular organisms)
K: drosophila (aka drosophila <basidiomycete fungi>)
L: drosophila <flies,subgenus> (drosophila) (aka drosophila <flies,subgenus>)
M: species
N: homo (humans) (aka homo)
O: human (aka homo sapiens)
P: None of the above. | [O; F; E] |
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; drosophila; caenorhabditis elegans]
<Options>: A: elegans subgroup (in: mosquitos)
B: flies (aka diptera)
C: caenorhabditis vulgaris (aka caenorhabditis remanei)
D: rhabditis elegans (aka caenorhabditis elegans)
E: melanogaster <basidiomycete fungi> (melanogaster) (aka melanogaster <basidiomycete fungi>)
F: this
G: homo sapiens (human) (aka homo sapiens)
H: avian (aka aves)
I: drosophila melanogaster (sophophora melanogaster) (aka drosophila melanogaster)
J: kingdom
K: melanogaster group
L: uronema elegans
M: drosophila <basidiomycete fungi> (drosophila) (aka drosophila <basidiomycete fungi>)
N: species
O: uca elegans (aka tubuca elegans)
P: None of the above. | [G; I; D] |
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; drosophila; caenorhabditis elegans]
<Options>: A: human (aka homo sapiens)
B: drosophila (aka drosophila <basidiomycete fungi>)
C: uronema elegans
D: birds (aka aves)
E: cyclostrongylus elegans
F: melanogaster subgroup
G: drosophila <flies,subgenus> (drosophila) (aka drosophila <flies,subgenus>)
H: caenorhabditis drosophilae (rhabditis drosophilae) (aka caenorhabditis drosophilae)
I: macrobiotus sapiens
J: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans)
K: this
L: melanogaster group
M: probles
N: bactris elegans
O: drosophila melanogaster (sophophora melanogaster) (aka drosophila melanogaster)
P: None of the above. | [A; O; J] |
<Instruct>: Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: birds (aka aves)
B: homo sapiens (human) (aka homo sapiens)
C: candida/saccharomycetales (aka candida/saccharomycales clade)
D: saccharomyces cerevisiae x saccharomyces mikatae
E: animals (aka metazoa)
F: genus
G: mycoderma cerevisiae (aka saccharomyces cerevisiae)
H: macrobiotus sapiens
I: saccharomyces cf. cerevisiae
J: saccharomyces sp.
K: None of the above. | [B; G] |
<Instruct>: Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: macrobiotus sapiens
B: saccharomyces hansenii (aka debaryomyces hansenii)
C: saccharomyces cerevisiae x saccharomyces mikatae
D: biota (aka cellular organisms)
E: saccharomyces cf. cerevisiae
F: true yeasts (aka saccharomycotina)
G: eutherian mammals (aka eutheria)
H: species
I: homo sapiens (human) (aka homo sapiens)
J: mycoderma cerevisiae (aka saccharomyces cerevisiae)
K: None of the above. | [I; J] |
<Instruct>: Given the context 'In contrast, we identified a human expressed sequence tag (EST), BC007340 in a Blast search that revealed an ORF of 1311 nucleotides encoding a 437 amino acid polypeptide (39).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: macrobiotus sapiens
C: placental mammals (aka eutheria)
D: animals (aka metazoa)
E: probles
F: None of the above. | [A] |
<Instruct>: Given the context 'Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: mammals (aka mammalia)
B: primate (aka primates)
C: macrobiotus sapiens
D: homo (humans) (aka homo)
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: suborder
B: birds (aka aves)
C: probles
D: macrobiotus sapiens
E: human (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: macrobiotus sapiens
B: animals (aka metazoa)
C: homo sapiens (human) (aka homo sapiens)
D: primate (aka primates)
E: species
F: None of the above. | [C] |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.pombe; arabidopsis thaliana; c.elegans; drosophila melanogaster]
<Options>: A: urocitellus elegans elegans (spermophilus elegans elegans) (aka urocitellus elegans elegans)
B: schizosaccharomyces kambucha x schizosaccharomyces pombe
C: melanogaster <basidiomycete fungi> (melanogaster) (aka melanogaster <basidiomycete fungi>)
D: arabidopsis environmental sample
E: melanogaster <flies> (melanogaster) (aka melanogaster <flies>)
F: schizosaccharomycetoideae (aka schizosaccharomycetaceae)
G: cyclostrongylus elegans
H: hawaiian drosophila
I: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans)
J: fission yeast (aka schizosaccharomyces pombe)
K: arabideae
L: caenorhabditis drosophilae (rhabditis drosophilae) (aka caenorhabditis drosophilae)
M: thale-cress (aka arabidopsis thaliana)
N: schizosaccharomyces
O: fruit fly (aka drosophila melanogaster)
P: unclassified arabidopsis
Q: melanogaster group
R: arabidopsis sp.
S: uronema elegans
T: zygosaccharomyces sp.
U: None of the above. | [J; M; I; O] |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.pombe; arabidopsis thaliana; c.elegans; drosophila melanogaster]
<Options>: A: fission yeast (aka schizosaccharomyces pombe)
B: arabidella
C: arabidopsis suecica (arabis thaliana subsp. suecica) (aka arabidopsis suecica)
D: melanogaster (aka melanogaster <basidiomycete fungi>)
E: arabis thaliana (aka arabidopsis thaliana)
F: rhabditis elegans (aka caenorhabditis elegans)
G: fruit flies (aka drosophila <flies,genus>)
H: theocolax elegans
I: hawaiian drosophila
J: zygosaccharomyces
K: euphyia
L: drosophila elegans
M: schizosaccharomyces
N: arabidopsis thaliana x arabidopsis halleri
O: dikarya
P: sphaerococcus <red algae> (sphaerococcus) (aka sphaerococcus <red algae>)
Q: cyclostrongylus elegans
R: drosophila (aka drosophila <flies,subgenus>)
S: drosophila melanogaster (sophophora melanogaster) (aka drosophila melanogaster)
T: urocitellus elegans elegans (spermophilus elegans elegans) (aka urocitellus elegans elegans)
U: None of the above. | [A; E; F; S] |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.pombe; arabidopsis thaliana; c.elegans; drosophila melanogaster]
<Options>: A: flies (aka diptera)
B: melanogaster <flies> (melanogaster) (aka melanogaster <flies>)
C: schizosaccharomyces japonicus var. japonicus (aka schizosaccharomyces japonicus)
D: thale-cress (aka arabidopsis thaliana)
E: melanogaster subgroup
F: sphaerospermopsis (sphaerospermum) (aka sphaerospermopsis)
G: schizosaccharomyces pombe (schizosaccharomyces malidevorans) (aka schizosaccharomyces pombe)
H: arabidopsis suecica (arabis thaliana subsp. suecica) (aka arabidopsis suecica)
I: arabidella
J: bactris elegans
K: bactrocera (bactrocera) melanogaster (aka bactrocera melanogaster)
L: arabidopsis thaliana x arabidopsis halleri
M: gongylostoma elegans elegans (clausilia elegans elegans) (aka gongylostoma elegans elegans)
N: schizosaccharomyces sp.
O: caenorhabditis vulgaris (aka caenorhabditis remanei)
P: uca elegans (aka tubuca elegans)
Q: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans)
R: fruit fly (aka drosophila melanogaster)
S: apophyllum
T: schizosaccharomyces kambucha x schizosaccharomyces pombe
U: None of the above. | [G; D; Q; R] |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [s.pombe; arabidopsis thaliana; c.elegans; drosophila melanogaster]
<Options>: A: arabidopsis suecica (arabis thaliana subsp. suecica) (aka arabidopsis suecica)
B: schizosaccharomyces japonicus var. japonicus (aka schizosaccharomyces japonicus)
C: elegans subgroup (in: mosquitos)
D: caenorhabditis sp.
E: arabidopsis sp.
F: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans)
G: schizosaccharomyces kambucha x schizosaccharomyces pombe
H: arabidopsis thaliana x arabidopsis lyrata
I: thale-cress (aka arabidopsis thaliana)
J: salinomyces
K: melanogaster subgroup
L: melanogaster group
M: schizosaccharomyces pombe (schizosaccharomyces malidevorans) (aka schizosaccharomyces pombe)
N: caenorhabditis drosophilae (rhabditis drosophilae) (aka caenorhabditis drosophilae)
O: arabidopsis arenosa x arabidopsis thaliana
P: hawaiian drosophila
Q: drosophila <flies,genus> (fruit flies) (aka drosophila <flies,genus>)
R: drosophila melanogaster (sophophora melanogaster) (aka drosophila melanogaster)
S: sphingomorpha
T: caenorhabditis vulgaris (aka caenorhabditis remanei)
U: None of the above. | [M; I; F; R] |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mus molossinus (aka mus musculus molossinus)
C: mus sp. (mice (aka mus sp.))
D: mus cricetus (aka cricetus cricetus)
E: mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: kingdom
B: suborder
C: human (aka homo sapiens)
D: saccharomyces hansenii (aka debaryomyces hansenii)
E: saccharomyces albicans (aka candida albicans)
F: probles
G: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
H: candida/saccharomycetales (aka candida/saccharomycales clade)
I: eutherian mammals (aka eutheria)
J: saccharomyces cerevisiae x saccharomyces mikatae
K: None of the above. | [C; G] |
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: budding yeasts & others (aka saccharomycotina)
B: homo sapiens (human) (aka homo sapiens)
C: avian (aka aves)
D: mammals (aka mammalia)
E: genus
F: saccharomyces lactis (aka kluyveromyces lactis)
G: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
H: candida/saccharomycetales (aka candida/saccharomycales clade)
I: baker's yeast (aka saccharomyces cerevisiae)
J: biota (aka cellular organisms)
K: None of the above. | [B; I] |
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: saccharomyces lactis (aka kluyveromyces lactis)
B: budding yeasts & others (aka saccharomycotina)
C: avian (aka aves)
D: genus
E: biota (aka cellular organisms)
F: baker's yeast (aka saccharomyces cerevisiae)
G: mammals (aka mammalia)
H: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
I: candida/saccharomycetales (aka candida/saccharomycales clade)
J: None of the above. | [J; F] |
<Instruct>: Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: saccharomyces sp.
B: saccharomyces lactis (aka kluyveromyces lactis)
C: humans (aka homo)
D: true yeasts (aka saccharomycotina)
E: homo sapiens (human) (aka homo sapiens)
F: saccharomyces cerevisiae x saccharomyces mikatae
G: baker's yeast (aka saccharomyces cerevisiae)
H: macrobiotus sapiens
I: mammals (aka mammalia)
J: primate (aka primates)
K: None of the above. | [E; G] |
<Instruct>: Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: candida/saccharomycetales (aka candida/saccharomycales clade)
C: cellular organisms (biota) (aka cellular organisms)
D: placental mammals (aka eutheria)
E: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
F: suborder
G: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
H: kingdom
I: saccharomyces lactis (aka kluyveromyces lactis)
J: saccharomyces hansenii (aka debaryomyces hansenii)
K: None of the above. | [A; G] |
<Instruct>: Given the context 'However, a GFP fusion to the N-terminus of human Enp1 homolog localized to the nucleus and was enriched in the nucleolus (data not shown).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: animals (aka metazoa)
B: kingdom
C: macrobiotus sapiens
D: human (aka homo sapiens)
E: biota (aka cellular organisms)
F: None of the above. | [D] |
<Instruct>: Given the context 'DISCUSSION
ENP1 is a yeast gene first identified in a genetic screen for complementation of mutations in ost4, which encodes a subunit of oligosaccharide transferase (17), although subsequent work showed that it is unlikely that Enp1 has any connection to oligosaccharide transferase (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: saccharomyces lactis (aka kluyveromyces lactis)
B: saccharomyces albicans (aka candida albicans)
C: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
D: brewer's yeast (aka saccharomyces cerevisiae)
E: saccharomyces hansenii (aka debaryomyces hansenii)
F: None of the above. | [D] |
<Instruct>: Given the context 'Among the more than 100 snoRNAs in yeast cells, U3, U14, snR10, snR30 and MRP RNA are the only ones required for rRNA processing.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
B: saccharomyces sp.
C: saccharomyces cerevisiae x saccharomyces mikatae
D: saccharomycotina (budding yeasts & others) (aka saccharomycotina)
E: saccharomyces hansenii (aka debaryomyces hansenii)
F: None of the above. | [A] |
<Instruct>: Given the context 'Recently, a genome-wide study of yeast protein complexes, using a TAP tag method similar to ours, reported a number of proteins that co-immunoprecipitated with Enp1 (43).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [yeast]
<Options>: A: saccharomyces cf. cerevisiae
B: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
C: saccharomyces hansenii (aka debaryomyces hansenii)
D: saccharomyces cerevisiae x saccharomyces mikatae
E: saccharomycotina (budding yeasts & others) (aka saccharomycotina)
F: None of the above. | [B] |
<Instruct>: Given the context 'A previous study on the Enp1 human homolog, bystin, reported that the protein was localized in the cytoplasm of mammalian cells and might be involved in cell adhesion (19).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: animals (aka metazoa)
B: human (aka homo sapiens)
C: kingdom
D: cellular organisms (biota) (aka cellular organisms)
E: birds (aka aves)
F: None of the above. | [B] |
<Instruct>: Given the context 'Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: animals (aka metazoa)
C: suborder
D: mammals (aka mammalia)
E: homo (humans) (aka homo)
F: None of the above. | [A] |
<Instruct>: Given the context 'Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: homo (humans) (aka homo)
B: suborder
C: mammals (aka mammalia)
D: animals (aka metazoa)
E: None of the above. | [E] |
<Instruct>: Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: probles
B: saccharomyces cf. cerevisiae
C: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
D: humans (aka homo)
E: saccharomyces sp.
F: animals (aka metazoa)
G: saccharomyceta
H: saccharomyces cerevisiae x saccharomyces mikatae
I: human (aka homo sapiens)
J: placental mammals (aka eutheria)
K: None of the above. | [I; C] |
<Instruct>: Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: saccharomyces cerevisiae x saccharomyces mikatae
B: genus
C: baker's yeast (aka saccharomyces cerevisiae)
D: homo sapiens (human) (aka homo sapiens)
E: saccharomycodes
F: saccharomyces sp.
G: species
H: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
I: this
J: birds (aka aves)
K: None of the above. | [D; C] |
<Instruct>: Given the context 'The cytoplasmic localization of bystin and its proposed function in cell adhesion are unlikely to reflect the actual function of the human Enp1 homolog.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: primate (aka primates)
B: placental mammals (aka eutheria)
C: macrobiotus sapiens
D: humans (aka homo)
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'Epigenetic inactivation and aberrant transcription of CSMD1 in squamous cell carcinoma cell lines
Abstract
Background
The p23.2 region of human chromosome 8 is frequently deleted in several types of epithelial cancer and those deletions appear to be associated with poor prognosis.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: species
B: suborder
C: homo sapiens (human) (aka homo sapiens)
D: animals (aka metazoa)
E: placental mammals (aka eutheria)
F: None of the above. | [C] |
<Instruct>: Given the context 'Background
CUB and Sushi Multiple Domains 1 (CSMD1) was cloned as a candidate tumor suppressor or progression gene from a region of human chromosome 8 deleted in tumors of the upper aerodigestive tract, prostate, ovary and bladder', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: birds (aka aves)
B: animals (aka metazoa)
C: humans (aka homo)
D: genus
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'RT-PCR of human fetal brain cDNA reveals very low levels of an RT-PCR product corresponding in size to that expected from the internally deleted transcript.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: suborder
B: macrobiotus sapiens
C: probles
D: cellular organisms (biota) (aka cellular organisms)
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'Normal oropharyngeal epithelium was isolated from discarded tissue from uvulopalatopharyngoplasties (UPPP) collected anonymously with the approval of the Washington University Human Studies Committee.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: macrobiotus sapiens
B: species
C: mammals (aka mammalia)
D: human (aka homo sapiens)
E: animals (aka metazoa)
F: None of the above. | [D] |
<Instruct>: Given the context 'Cell Culture and Tissue Preparation
Squamous cell carcinoma cell lines were grown in DMEM or DMEM:F-12, 1:1 Mixture (BioWhittaker) containing 10% fetal bovine serum (Sigma).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos bovis (aka bos taurus)
B: bovidae
C: bos sp.
D: bos taurus indicus (aka bos indicus)
E: bos bubalis (aka bubalus bubalis)
F: None of the above. | [A] |
<Instruct>: Given the context 'Cell Culture and Tissue Preparation
Squamous cell carcinoma cell lines were grown in DMEM or DMEM:F-12, 1:1 Mixture (BioWhittaker) containing 10% fetal bovine serum (Sigma).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos taurus indicus (aka bos indicus)
B: bovidae
C: bos bubalis (aka bubalus bubalis)
D: bos sp.
E: None of the above. | [E] |
<Instruct>: Given the context 'An amplicon from human 18S RNA was used as a basis for comparisons across cell lines (primers prm2396, ttcggaactgaggccatgat and prm2397, tttcgctctggtccgtcttg).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: primate (aka primates)
B: species
C: suborder
D: kingdom
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'Cells were grown for 72 hours in media containing DMEM:F-12, 1:1 Mixture (BioWhittaker) with 1X MEM Nonessential Amino Acids (BioWhittaker) and 10% fetal bovine serum and then switched to media containing 5aza-dC at concentrations of 0 μm, 5 μM, 25 μM, or 100 μM. Cells were fed daily for 4–5 days and then both plates were harvested in 3 ml of Trizol (Invitrogen) for isolation of RNA and DNA according to the manufacturer's instructions.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bovidae
B: domestic cattle (aka bos taurus)
C: bos taurus indicus (aka bos indicus)
D: boveria
E: bos (cattle) (aka bos)
F: None of the above. | [B] |
<Instruct>: Given the context 'Human growth hormone (GH1) gene polymorphism map in a normal-statured adult population
Abstract
Objective
GH1 gene presents a complex map of single nucleotide polymorphisms (SNPs) in the entire promoter, coding and noncoding regions.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: human (aka homo sapiens)
B: avian (aka aves)
C: genus
D: animals (aka metazoa)
E: species
F: None of the above. | [A] |
<Instruct>: Given the context 'Systematic GH1 gene analysis in patients with growth delay and suspected GH deficiency/insufficiency will clarify whether different SNP frequencies and/or the presence of different sequence changes may be associated with phenotypes in them.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: theraps
B: genus
C: homo sapiens (human) (aka homo sapiens)
D: this
E: subsection
F: None of the above. | [C] |
<Instruct>: Given the context 'Introduction
Human skeletal growth and final height attainment are a result of a multifactorial regulation involving systemic and local hormones, growth and nutritional factors, lifestyle and genetic factors.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: placental mammals (aka eutheria)
B: this
C: animals (aka metazoa)
D: human (aka homo sapiens)
E: probles
F: None of the above. | [D] |
<Instruct>: Given the context 'Large deletions within the GH1 gene cluster were described first followed by point mutations, the majority of which affect introns 3 or 4, provoke skipping of exon 3 product and exert a dominant effect.3,7,8 More recently, the presence of single nucleotide polymorphic points (SNPs) in the promoter region or in intron 4 of the GH1 gene have been described9–12 and associations with promoter allele activities or with GH secretion efficacy and circulating IGF-I levels in growth-retarded patients have also been described.11,12 Other studies have analysed several GH1 gene SNP genotypes as related to the incidence of neoplasia, with a positive association with colorectal neoplasia for intron 4 SNP,13 a negative result for breast carcinoma14,15 or a positive one for breast cancer risk.16,17 In addition, a recent study in a cohort of adults over ages 60 years detected a significant association between genotypes at one SNP in the GH1 gene promoter region and at the intron 4 SNP described by Hasegawa et al.11 with baseline bone density and accelerated bone loss together with an interaction with weight at 1 year.18 Intron 4 SNP described by Hasegawa et al.11 has also been associated, in women, with shorter body height and reduced mortality,19 whereas another intron 4 SNP (T1169A) has been associated in both sexes with a favourable metabolic profile.20', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients; women]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: mammals (aka mammalia)
C: infraclass
D: this
E: suborder
F: goes
G: latina
H: mouse (aka mus musculus)
I: None of the above. | [A; A] |
<Instruct>: Given the context 'Large deletions within the GH1 gene cluster were described first followed by point mutations, the majority of which affect introns 3 or 4, provoke skipping of exon 3 product and exert a dominant effect.3,7,8 More recently, the presence of single nucleotide polymorphic points (SNPs) in the promoter region or in intron 4 of the GH1 gene have been described9–12 and associations with promoter allele activities or with GH secretion efficacy and circulating IGF-I levels in growth-retarded patients have also been described.11,12 Other studies have analysed several GH1 gene SNP genotypes as related to the incidence of neoplasia, with a positive association with colorectal neoplasia for intron 4 SNP,13 a negative result for breast carcinoma14,15 or a positive one for breast cancer risk.16,17 In addition, a recent study in a cohort of adults over ages 60 years detected a significant association between genotypes at one SNP in the GH1 gene promoter region and at the intron 4 SNP described by Hasegawa et al.11 with baseline bone density and accelerated bone loss together with an interaction with weight at 1 year.18 Intron 4 SNP described by Hasegawa et al.11 has also been associated, in women, with shorter body height and reduced mortality,19 whereas another intron 4 SNP (T1169A) has been associated in both sexes with a favourable metabolic profile.20', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients; women]
<Options>: A: human (aka homo sapiens)
B: avian (aka aves)
C: kingdom
D: subsection
E: species
F: infraclass
G: gallus
H: suborder
I: None of the above. | [A; A] |
<Instruct>: Given the context 'To obtain normative data for subsequent analysis of GH1 gene contribution to IIGHD in children, a systematic GH1 gene structural analysis was designed in a normal adult control population to establish the GH1 gene SNP map in adults from our population with heights within the normal range, determine the genotype frequencies and analyse possible associations between individual and combined SNPs with height.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [children]
<Options>: A: genus
B: suborder
C: human (aka homo sapiens)
D: circe
E: kingdom
F: None of the above. | [C] |
<Instruct>: Given the context 'To obtain normative data for subsequent analysis of GH1 gene contribution to IIGHD in children, a systematic GH1 gene structural analysis was designed in a normal adult control population to establish the GH1 gene SNP map in adults from our population with heights within the normal range, determine the genotype frequencies and analyse possible associations between individual and combined SNPs with height.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [children]
<Options>: A: genus
B: circe
C: suborder
D: kingdom
E: None of the above. | [E] |
<Instruct>: Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men; patients]
<Options>: A: menetus
B: infraclass
C: menura
D: cancer
E: meneristes
F: probles
G: menetes
H: eutherian mammals (aka eutheria)
I: menaethius
J: aides
K: genus
L: menesia
M: human (aka homo sapiens)
N: None of the above. | [M; M; M] |
<Instruct>: Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men; patients]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: menetus
C: goes
D: gallus
E: mene
F: china
G: menecleonus
H: mammals (aka mammalia)
I: menophra
J: menura
K: this
L: other (aka unidentified)
M: aides
N: probles
O: None of the above. | [A; A; A] |
<Instruct>: Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men; patients]
<Options>: A: menoidium
B: china
C: menetes
D: kingdom
E: genus
F: humans (aka homo)
G: human (aka homo sapiens)
H: menophra
I: this
J: menevia
K: theraps
L: circe
M: menkeleon
N: None of the above. | [G; G; G] |
<Instruct>: Given the context 'The protocol was approved by the Hospital Vall d’Hebron Ethics Committee and written informed consent was obtained from each participant.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [participant]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: suborder
C: subsection
D: primate (aka primates)
E: other (aka unidentified)
F: None of the above. | [A] |
<Instruct>: Given the context 'The protocol was approved by the Hospital Vall d’Hebron Ethics Committee and written informed consent was obtained from each participant.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [participant]
<Options>: A: subsection
B: suborder
C: other (aka unidentified)
D: primate (aka primates)
E: None of the above. | [E] |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men]
<Options>: A: menevia
B: gallus
C: eutherian mammals (aka eutheria)
D: menetes
E: menesia
F: infraclass
G: homo sapiens (human) (aka homo sapiens)
H: menoidium
I: meneristes
J: menetus
K: None of the above. | [G; G] |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men]
<Options>: A: suborder
B: menetes
C: menkeleon
D: mene
E: china
F: probles
G: menneus
H: human (aka homo sapiens)
I: menura
J: species
K: None of the above. | [H; H] |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: mene
C: infraclass
D: menetus
E: humans (aka homo)
F: chicken (aka gallus gallus)
G: kingdom
H: menosira
I: menecles
J: menenotus
K: None of the above. | [A; A] |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [women; men]
<Options>: A: menetes
B: menneus
C: probles
D: menkeleon
E: species
F: mammals (aka mammalia)
G: mene
H: latina
I: menesia
J: homo sapiens (human) (aka homo sapiens)
K: None of the above. | [J; J] |
<Instruct>: Given the context 'Several sequence changes have been reported in patients with familial or idiopathic short stature,11,26,27 whereas P8, P19, P20 and P25 (at positions 5165, 5681, 5686 and 6358, respectively, in the Genebank accession GI 183148) located in the promoter, intron 2 and intron 4 regions, respectively, had not been previously described.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: other (aka unidentified)
B: kingdom
C: this
D: homo sapiens (human) (aka homo sapiens)
E: probles
F: None of the above. | [D] |
<Instruct>: Given the context 'Discussion
Genetic variations within human GH1 gene have been described by several authors.9–12,21', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: human (aka homo sapiens)
B: macrobiotus sapiens
C: eutherian mammals (aka eutheria)
D: birds (aka aves)
E: genus
F: None of the above. | [A] |
<Instruct>: Given the context 'Discussion
Genetic variations within human GH1 gene have been described by several authors.9–12,21', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: eutherian mammals (aka eutheria)
B: birds (aka aves)
C: genus
D: macrobiotus sapiens
E: None of the above. | [E] |
<Instruct>: Given the context 'The populations described to date comprised small numbers of normal-stature individuals,9 male adults with narrow height range12 or growth-retarded patients with/without GHD before achievement of adult height.9,11,12 Our study was designed to characterize the GH1 gene sequence variation in individuals within the whole range of normal adult height (between −2 and +2 SDS) according to the standards for our population.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: mus <genus> (mice (aka mus <genus>))
B: this
C: goes
D: human (aka homo sapiens)
E: theraps
F: None of the above. | [D] |
<Instruct>: Given the context 'Five single nucleotide changes are located in exon 5; of these five, three predict an amino acid change, and one of the three (Ile179Met) has been described by Lewis et al.27 in a paediatric patient with familial short stature and the other two, as yet undescribed, are contiguous in a single individual (Pro133Hys and Arg134Leu).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: probles
C: proxys
D: subsection
E: isolate
F: None of the above. | [A] |
<Instruct>: Given the context 'Analysis of SNP association with adult height was subsequently performed to establish a body of knowledge useful for comparing patient genotypes and phenotypes.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: theraps
C: probles
D: data
E: cancer
F: None of the above. | [A] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.