instruction
stringlengths
225
2.35k
input
stringlengths
89
1.5k
response
stringclasses
698 values
<Instruct>: Given the context 'The mouse IL-2 cDNA sequence was aligned with the genomic sequence and both sequences matched completely each other.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [mouse] <Options>: A: mus molossinus (aka mus musculus molossinus) B: mus sp. (mice (aka mus sp.)) C: mus musculus (house mouse) (aka mus musculus) D: mus cricetus (aka cricetus cricetus) E: mus <subgenus> (mus (aka mus <subgenus>)) F: None of the above.
[C]
<Instruct>: Given the context 'Although we can not rule out the possibility for the deletion of this sequence in the human IL-2 gene, it is more likely that the CAG repeat has been generated in the mouse genome rather recently. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; mouse] <Options>: A: house mouse (aka mus musculus) B: mus <genus> (mice (aka mus <genus>)) C: species D: kingdom E: eutherian mammals (aka eutheria) F: human (aka homo sapiens) G: mice (aka mus sp.) (aka mus sp.) H: eastern european house mouse (aka mus musculus musculus) I: this J: mus musculoides (mus musculoides enclavae) (aka mus musculoides) K: None of the above.
[F; A]
<Instruct>: Given the context 'Although we can not rule out the possibility for the deletion of this sequence in the human IL-2 gene, it is more likely that the CAG repeat has been generated in the mouse genome rather recently. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; mouse] <Options>: A: mus <genus> (mice (aka mus <genus>)) B: primate (aka primates) C: mammals (aka mammalia) D: human (aka homo sapiens) E: peromyscus F: mus <subgenus> (mus (aka mus <subgenus>)) G: mouse (aka mus musculus) H: mus cricetus (aka cricetus cricetus) I: genus J: placental mammals (aka eutheria) K: None of the above.
[D; G]
<Instruct>: Given the context 'Although we can not rule out the possibility for the deletion of this sequence in the human IL-2 gene, it is more likely that the CAG repeat has been generated in the mouse genome rather recently. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; mouse] <Options>: A: mouse (aka mus musculus) B: genus C: peromyscus D: mus cricetus (aka cricetus cricetus) E: mus <subgenus> (mus (aka mus <subgenus>)) F: mus <genus> (mice (aka mus <genus>)) G: primate (aka primates) H: mammals (aka mammalia) I: placental mammals (aka eutheria) J: None of the above.
[J; A]
<Instruct>: Given the context '9329 Nucleic Acids Research Organization of the mouse IL-2 gene resembles to that of the human gene (Fig.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [mouse; human] <Options>: A: homo sapiens (human) (aka homo sapiens) B: biota (aka cellular organisms) C: macrobiotus sapiens D: house mouse (aka mus musculus) E: mus sp. (mice (aka mus sp.)) F: humans (aka homo) G: peromyscus H: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus) I: mus <subgenus> (mus (aka mus <subgenus>)) J: this K: None of the above.
[D; A]
<Instruct>: Given the context '9329 Nucleic Acids Research Organization of the mouse IL-2 gene resembles to that of the human gene (Fig.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [mouse; human] <Options>: A: homo (humans) (aka homo) B: mus molossinus (aka mus musculus molossinus) C: mouse (aka mus musculus) D: eastern european house mouse (aka mus musculus musculus) E: biota (aka cellular organisms) F: peromyscus G: macrobiotus sapiens H: eutherian mammals (aka eutheria) I: homo sapiens (human) (aka homo sapiens) J: mus sp. (mice (aka mus sp.)) K: None of the above.
[C; I]
<Instruct>: Given the context 'There seems to be little sequence homology between corresponding introns of mouse and human IL-2 genes, except for the intron-exon junctions part of which is thought to be necessary for the RNA splicing (17, 18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [mouse; human] <Options>: A: mus musculus (house mouse) (aka mus musculus) B: human (aka homo sapiens) C: primate (aka primates) D: peromyscus E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus) F: mus musculoides (mus musculoides enclavae) (aka mus musculoides) G: macrobiotus sapiens H: homo (humans) (aka homo) I: mice (aka mus sp.) (aka mus sp.) J: kingdom K: None of the above.
[A; B]
<Instruct>: Given the context 'There seems to be little sequence homology between corresponding introns of mouse and human IL-2 genes, except for the intron-exon junctions part of which is thought to be necessary for the RNA splicing (17, 18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [mouse; human] <Options>: A: mouse (aka mus musculus) B: human (aka homo sapiens) C: peromyscus D: mus (aka mus <subgenus>) (aka mus <subgenus>) E: suborder F: eastern european house mouse (aka mus musculus musculus) G: mouse (aka mus <genus>) H: birds (aka aves) I: animals (aka metazoa) J: this K: None of the above.
[A; B]
<Instruct>: Given the context 'In spite of the divergence in sequence of introns, the size and position of the introns are very similar between the murine and human IL-2 genes. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [murine; human] <Options>: A: peromyscus B: mouse (aka mus musculus) C: mus (aka mus <subgenus>) (aka mus <subgenus>) D: biota (aka cellular organisms) E: suborder F: eastern european house mouse (aka mus musculus musculus) G: primate (aka primates) H: genus I: mus (aka mus <genus>) (aka mus <genus>) J: human (aka homo sapiens) K: None of the above.
[B; J]
<Instruct>: Given the context 'In spite of the divergence in sequence of introns, the size and position of the introns are very similar between the murine and human IL-2 genes. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [murine; human] <Options>: A: primate (aka primates) B: peromyscus C: human (aka homo sapiens) D: suborder E: eastern european house mouse (aka mus musculus musculus) F: biota (aka cellular organisms) G: mus (aka mus <subgenus>) (aka mus <subgenus>) H: mus (aka mus <genus>) (aka mus <genus>) I: genus J: None of the above.
[J; C]
<Instruct>: Given the context 'In spite of the divergence in sequence of introns, the size and position of the introns are very similar between the murine and human IL-2 genes. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [murine; human] <Options>: A: mus norvegicus (aka rattus norvegicus) B: species C: mus musculoides (mus musculoides enclavae) (aka mus musculoides) D: mus musculus (house mouse) (aka mus musculus) E: mus cricetus (aka cricetus cricetus) F: homo sapiens (human) (aka homo sapiens) G: humans (aka homo) H: peromyscus I: cellular organisms (biota) (aka cellular organisms) J: probles K: None of the above.
[D; F]
<Instruct>: Given the context 'Of particular interests is the presence of highly conserved sequences in the 5' -flanking region of the human and mouse IL-2 gene (Fig. 4). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; mouse] <Options>: A: primate (aka primates) B: kingdom C: homo sapiens (human) (aka homo sapiens) D: mice (aka mus <genus>) (aka mus <genus>) E: mus domesticus (aka mus musculus domesticus) F: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus) G: probles H: mammals (aka mammalia) I: mouse (aka mus musculus) J: mus musculoides (mus musculoides enclavae) (aka mus musculoides) K: None of the above.
[C; I]
<Instruct>: Given the context 'Of particular interests is the presence of highly conserved sequences in the 5' -flanking region of the human and mouse IL-2 gene (Fig. 4). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; mouse] <Options>: A: eastern european house mouse (aka mus musculus musculus) B: mice (aka mus sp.) (aka mus sp.) C: species D: kingdom E: suborder F: house mouse (aka mus musculus) G: homo sapiens (human) (aka homo sapiens) H: peromyscus I: mus domesticus (aka mus musculus domesticus) J: biota (aka cellular organisms) K: None of the above.
[G; F]
<Instruct>: Given the context 'Since we have not yet determined the nucleotide sequence further upstream of the mouse gene, we do not know whether or not this similarity extends further. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [mouse] <Options>: A: peromyscus B: mouse (aka mus musculus) C: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus) D: mus <subgenus> (mus (aka mus <subgenus>)) E: mice (aka mus sp.) (aka mus sp.) F: None of the above.
[B]
<Instruct>: Given the context 'Our preliminary results indicate that the 5 '-flanking sequence of the human IL-2 gene mediates mitogen induced expression of the gene in T-lymphocytic cells (Fujita & Taniguchi, unpublished observation). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: this B: kingdom C: birds (aka aves) D: humans (aka homo) E: human (aka homo sapiens) F: None of the above.
[E]
<Instruct>: Given the context 'We thank Dr. T. Honjo for mouse gene library. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [mouse] <Options>: A: mus cricetus (aka cricetus cricetus) B: mus molossinus (aka mus musculus molossinus) C: mus (aka mus <genus>) (aka mus <genus>) D: mus sp. (mice (aka mus sp.)) E: mouse (aka mus musculus) F: None of the above.
[E]
<Instruct>: Given the context 'More than half of human genes are known to have alternative polyadenylation (31).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: kingdom B: mammals (aka mammalia) C: homo sapiens (human) (aka homo sapiens) D: probles E: birds (aka aves) F: None of the above.
[C]
<Instruct>: Given the context 'More than half of human genes are known to have alternative polyadenylation (31).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: probles B: birds (aka aves) C: kingdom D: mammals (aka mammalia) E: None of the above.
[E]
<Instruct>: Given the context 'Over two-thirds of human genes are thought to undergo alternative splicing (32).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: mammals (aka mammalia) B: suborder C: primate (aka primates) D: homo sapiens (human) (aka homo sapiens) E: macrobiotus sapiens F: None of the above.
[D]
<Instruct>: Given the context 'Although, G-quadruplexes have been surveyed in the human genome with such techniques (34,35), there are no known user-friendly computational tools easily accessible to the public.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: macrobiotus sapiens B: avian (aka aves) C: humans (aka homo) D: probles E: homo sapiens (human) (aka homo sapiens) F: None of the above.
[E]
<Instruct>: Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; mouse] <Options>: A: animals (aka metazoa) B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus) C: mus <subgenus> (mus (aka mus <subgenus>)) D: homo sapiens (human) (aka homo sapiens) E: mus musculoides (mus musculoides enclavae) (aka mus musculoides) F: mus cricetus (aka cricetus cricetus) G: mus musculus (house mouse) (aka mus musculus) H: eutherian mammals (aka eutheria) I: probles J: biota (aka cellular organisms) K: None of the above.
[D; G]
<Instruct>: Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; mouse] <Options>: A: animals (aka metazoa) B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus) C: mouse (aka mus musculus) D: mus cricetus (aka cricetus cricetus) E: western european house mouse (aka mus musculus domesticus) F: mammals (aka mammalia) G: homo sapiens (human) (aka homo sapiens) H: mice (aka mus sp.) (aka mus sp.) I: avian (aka aves) J: genus K: None of the above.
[G; C]
<Instruct>: Given the context 'For example, entering the gene ID 403437 results in downloading the Brca1 gene sequence for Canis familiaris.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [canis familiaris] <Options>: A: canis B: canis sp. C: canis lupus familiaris (dogs (aka canis lupus familiaris)) D: canis lupus (grey wolf) (aka canis lupus) E: canis lupus variabilis (canis variabilis) (aka canis lupus variabilis) F: None of the above.
[C]
<Instruct>: Given the context 'For example, the mouse version of the gene PTPRU, which is 69822 bases long, contains 94681 QGRS of length up to 45 bases.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [mouse] <Options>: A: peromyscus B: mus molossinus (aka mus musculus molossinus) C: mus domesticus (aka mus musculus domesticus) D: mouse (aka mus musculus) E: mus musculoides (mus musculoides enclavae) (aka mus musculoides) F: None of the above.
[D]
<Instruct>: Given the context 'As an example, the Gene View for the human GREB1 is displayed in Figure 2, showing the table of gene information and product information for the first product (the output for all products may be seen in the supplementary material). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: suborder B: biota (aka cellular organisms) C: probles D: human (aka homo sapiens) E: this F: None of the above.
[D]
<Instruct>: Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis Abstract ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [yeast; saccharomyces cerevisiae] <Options>: A: saccharomyces cerevisiae x saccharomyces paradoxus B: candida/saccharomycetales (aka candida/saccharomycales clade) C: budding yeasts & others (aka saccharomycotina) D: saccharomyces cerevisiae x saccharomyces uvarum E: saccharomyces lactis (aka kluyveromyces lactis) F: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae) G: saccharomyces cerevisiae synthetic construct H: saccharomyces albicans (aka candida albicans) I: saccharomyces cerevisiae x saccharomyces mikatae J: None of the above.
[F; F]
<Instruct>: Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis Abstract ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [yeast; saccharomyces cerevisiae] <Options>: A: mycoderma cerevisiae (aka saccharomyces cerevisiae) B: saccharomyces cerevisiae x saccharomyces uvarum C: saccharomyces lactis (aka kluyveromyces lactis) D: saccharomyces albicans (aka candida albicans) E: saccharomyces cf. cerevisiae F: saccharomyces cerevisiae synthetic construct G: budding yeasts & others (aka saccharomycotina) H: None of the above.
[A; A]
<Instruct>: Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [yeast; saccharomyces cerevisiae] <Options>: A: saccharomyces sp. B: saccharomyces cf. cerevisiae C: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae) D: saccharomyces globosus (aka saccharomyces uvarum) E: saccharomyces cerevisiae x saccharomyces mikatae F: saccharomyces lactis (aka kluyveromyces lactis) G: candida/saccharomycetales (aka candida/saccharomycales clade) H: saccharomyces hansenii (aka debaryomyces hansenii) I: saccharomyces albicans (aka candida albicans) J: None of the above.
[C; C]
<Instruct>: Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [yeast; saccharomyces cerevisiae] <Options>: A: saccharomyces cf. cerevisiae B: saccharomycotina (budding yeasts & others) (aka saccharomycotina) C: candida/saccharomycetales (aka candida/saccharomycales clade) D: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae) E: saccharomyces lactis (aka kluyveromyces lactis) F: saccharomyces paradoxus G: saccharomyces sp. H: saccharomyces cerevisiae x saccharomyces uvarum I: saccharomycetes (hemiascomycetes) (aka saccharomycetes) J: None of the above.
[D; D]
<Instruct>: Given the context 'In yeast cells there are more than 100 different snoRNAs playing important roles in rRNA modification and processing.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [yeast] <Options>: A: saccharomyces sp. B: saccharomycodes C: saccharomyceta D: saccharomyces albicans (aka candida albicans) E: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae) F: None of the above.
[E]
<Instruct>: Given the context 'The yeast protein was localized to the nucleus in a previous study (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [yeast] <Options>: A: saccharomycodes B: saccharomyces lactis (aka kluyveromyces lactis) C: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae) D: saccharomyces sp. E: saccharomyceta F: None of the above.
[C]
<Instruct>: Given the context 'On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: homo (humans) (aka homo) B: homo sapiens (human) (aka homo sapiens) C: macrobiotus sapiens D: suborder E: species F: None of the above.
[B]
<Instruct>: Given the context 'On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: species B: homo (humans) (aka homo) C: suborder D: macrobiotus sapiens E: None of the above.
[E]
<Instruct>: Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; yeast] <Options>: A: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae) B: saccharomyces hansenii (aka debaryomyces hansenii) C: animals (aka metazoa) D: saccharomyceta E: saccharomyces albicans (aka candida albicans) F: suborder G: saccharomyces lactis (aka kluyveromyces lactis) H: human (aka homo sapiens) I: species J: kingdom K: None of the above.
[H; A]
<Instruct>: Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; yeast] <Options>: A: human (aka homo sapiens) B: saccharomyces hansenii (aka debaryomyces hansenii) C: this D: saccharomyces sp. E: kingdom F: biota (aka cellular organisms) G: genus H: saccharomyces cerevisiae x saccharomyces mikatae I: saccharomycodes J: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae) K: None of the above.
[A; J]
<Instruct>: Given the context 'MATERIALS AND METHODS Yeast strains and media The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [yeast; s.cerevisiae] <Options>: A: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus) B: saccharomyces albicans (aka candida albicans) C: saccharomycodes D: saccharomycetes (hemiascomycetes) (aka saccharomycetes) E: brewer's yeast (aka saccharomyces cerevisiae) F: saccharomyces hansenii (aka debaryomyces hansenii) G: saccharomyces globosus (aka saccharomyces uvarum) H: budding yeasts & others (aka saccharomycotina) I: None of the above.
[E; E]
<Instruct>: Given the context 'MATERIALS AND METHODS Yeast strains and media The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [yeast; s.cerevisiae] <Options>: A: saccharomyces sp. B: saccharomycodes C: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus) D: brewer's yeast (aka saccharomyces cerevisiae) E: saccharomyces hansenii (aka debaryomyces hansenii) F: saccharomyces cerevisiae synthetic construct G: saccharomyces albicans (aka candida albicans) H: saccharomyces cerevisiae x saccharomyces mikatae I: None of the above.
[D; D]
<Instruct>: Given the context 'Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [schizosaccharomyces pombe] <Options>: A: schizosaccharomycetes (archiascomycota) (aka schizosaccharomycetes) B: schizosaccharomycetales C: schizosaccharomyces pombe (schizosaccharomyces malidevorans) (aka schizosaccharomyces pombe) D: zygosaccharomyces E: zygosaccharomyces sp. F: None of the above.
[C]
<Instruct>: Given the context '[MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: birds (aka aves) B: kingdom C: animals (aka metazoa) D: human (aka homo sapiens) E: this F: None of the above.
[D]
<Instruct>: Given the context '[MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: kingdom B: birds (aka aves) C: this D: animals (aka metazoa) E: None of the above.
[E]
<Instruct>: Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; yeast] <Options>: A: macrobiotus sapiens B: avian (aka aves) C: saccharomyces lactis (aka kluyveromyces lactis) D: homo (humans) (aka homo) E: placental mammals (aka eutheria) F: saccharomycetes (hemiascomycetes) (aka saccharomycetes) G: mycoderma cerevisiae (aka saccharomyces cerevisiae) H: saccharomyceta I: human (aka homo sapiens) J: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus) K: None of the above.
[I; G]
<Instruct>: Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; yeast] <Options>: A: human (aka homo sapiens) B: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus) C: kingdom D: homo (humans) (aka homo) E: baker's yeast (aka saccharomyces cerevisiae) F: macrobiotus sapiens G: saccharomyces cerevisiae x saccharomyces mikatae H: candida/saccharomycetales (aka candida/saccharomycales clade) I: true yeasts (aka saccharomycotina) J: species K: None of the above.
[A; E]
<Instruct>: Given the context 'The fragment of the human Enp1 homolog (amino acids 152–437) was also cloned into these vectors to generate pCW110, pCW114, pCW116 and pCW118. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: human (aka homo sapiens) B: animals (aka metazoa) C: species D: suborder E: this F: None of the above.
[A]
<Instruct>: Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [mouse; donkey] <Options>: A: equus asinus asinus B: horses (aka equidae) C: donkey (aka equus asinus) D: mus (aka mus <genus>) (aka mus <genus>) E: mouse (aka mus musculus) F: mus molossinus (aka mus musculus molossinus) G: mus cricetus (aka cricetus cricetus) H: equus africanus (aka equus asinus africanus) I: equus ferus (equus caballus ferus) (aka equus ferus) J: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus) K: None of the above.
[E; C]
<Instruct>: Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [mouse; donkey] <Options>: A: mus sp. (mice (aka mus sp.)) B: mus musculus (house mouse) (aka mus musculus) C: mouse (aka mus <genus>) D: equus africanus asinus (aka equus asinus africanus) E: equus asinus (ass (aka equus asinus)) F: equine (aka equus caballus) G: equus subg. asinus (aka equus) H: horses (aka equidae) I: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus) J: mus musculoides (mus musculoides enclavae) (aka mus musculoides) K: None of the above.
[B; E]
<Instruct>: Given the context 'Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [mouse] <Options>: A: mouse (aka mus musculus) B: mouse (aka mus <genus>) C: mus musculoides (mus musculoides enclavae) (aka mus musculoides) D: peromyscus E: mus sp. (mice (aka mus sp.)) F: None of the above.
[A]
<Instruct>: Given the context 'Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [mouse] <Options>: A: mus sp. (mice (aka mus sp.)) B: peromyscus C: mouse (aka mus <genus>) D: mus musculoides (mus musculoides enclavae) (aka mus musculoides) E: None of the above.
[E]
<Instruct>: Given the context 'RESULTS Construction and analysis of ENP1 temperature-sensitive alleles ENP1 is an essential yeast gene conserved among eukaryotes (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [yeast] <Options>: A: saccharomyces sp. B: saccharomyces albicans (aka candida albicans) C: candida/saccharomycetales (aka candida/saccharomycales clade) D: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus) E: baker's yeast (aka saccharomyces cerevisiae) F: None of the above.
[E]
<Instruct>: Given the context 'The TAP tag contains Staphylococcus aureus Protein A as well as calmodulin-binding peptide sequences, so the tagged Enp1 binds IgG beads with high specificity.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [staphylococcus aureus] <Options>: A: staphylococcus aureus str. pa (aka staphylococcus aureus pa) B: staphylococcus sp. C: staphylococcus aureus (staphylococcus aureus subsp. anaerobius) (aka staphylococcus aureus) D: staphylococcus epidermidis (staphylococcus epidermidis albus) (aka staphylococcus epidermidis) E: staphylococcus aureus subsp. aureus col (staphylococcus aureus col) (aka staphylococcus aureus subsp. aureus col) F: None of the above.
[C]
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; drosophila; caenorhabditis elegans] <Options>: A: flies (aka diptera) B: drosophila (aka drosophila <flies,genus>) C: species D: melanogaster <flies> (melanogaster) (aka melanogaster <flies>) E: fruit fly (aka drosophila melanogaster) F: zodarion elegans (enyo elegans) (aka zodarion elegans) G: human (aka homo sapiens) H: rhabditis elegans (aka caenorhabditis elegans) I: melanogaster group J: polyzonia elegans K: animals (aka metazoa) L: cyclostrongylus elegans M: mammals (aka mammalia) N: drosophila elegans O: primate (aka primates) P: None of the above.
[G; E; H]
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; drosophila; caenorhabditis elegans] <Options>: A: animals (aka metazoa) B: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans) C: drosophila melanogaster (sophophora melanogaster) (aka drosophila melanogaster) D: cyclostrongylus elegans E: gongylostoma elegans elegans (clausilia elegans elegans) (aka gongylostoma elegans elegans) F: uronema elegans G: genus H: eutherian mammals (aka eutheria) I: caenorhabditis vulgaris (aka caenorhabditis remanei) J: biota (aka cellular organisms) K: melanogaster <basidiomycete fungi> (melanogaster) (aka melanogaster <basidiomycete fungi>) L: human (aka homo sapiens) M: drosophila (aka drosophila <basidiomycete fungi>) N: melanogaster subgroup O: drosophila <flies,subgenus> (drosophila) (aka drosophila <flies,subgenus>) P: None of the above.
[L; C; B]
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; drosophila; caenorhabditis elegans] <Options>: A: this B: bactrocera (bactrocera) melanogaster (aka bactrocera melanogaster) C: fruit fly (aka drosophila melanogaster) D: flies (aka diptera) E: drosophila (aka drosophila <basidiomycete fungi>) F: cyclostrongylus elegans G: macrobiotus sapiens H: humans (aka homo) I: theocolax elegans J: myzomyia elegans (aka anopheles elegans) K: caenorhabditis sp. L: biota (aka cellular organisms) M: melanogaster <basidiomycete fungi> (melanogaster) (aka melanogaster <basidiomycete fungi>) N: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans) O: human (aka homo sapiens) P: None of the above.
[O; C; N]
<Instruct>: Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; yeast] <Options>: A: saccharomyces cerevisiae x saccharomyces mikatae B: birds (aka aves) C: species D: human (aka homo sapiens) E: suborder F: saccharomycodes G: genus H: saccharomyces lactis (aka kluyveromyces lactis) I: budding yeasts & others (aka saccharomycotina) J: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae) K: None of the above.
[D; J]
<Instruct>: Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; yeast] <Options>: A: cellular organisms (biota) (aka cellular organisms) B: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae) C: saccharomyces lactis (aka kluyveromyces lactis) D: this E: mammals (aka mammalia) F: birds (aka aves) G: human (aka homo sapiens) H: true yeasts (aka saccharomycotina) I: saccharomyces cf. cerevisiae J: saccharomycodes K: None of the above.
[G; B]
<Instruct>: Given the context 'In contrast, we identified a human expressed sequence tag (EST), BC007340 in a Blast search that revealed an ORF of 1311 nucleotides encoding a 437 amino acid polypeptide (39).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: primate (aka primates) B: probles C: homo (humans) (aka homo) D: eutherian mammals (aka eutheria) E: homo sapiens (human) (aka homo sapiens) F: None of the above.
[E]
<Instruct>: Given the context 'Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: primate (aka primates) B: probles C: avian (aka aves) D: cellular organisms (biota) (aka cellular organisms) E: human (aka homo sapiens) F: None of the above.
[E]
<Instruct>: Given the context 'The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: animals (aka metazoa) B: human (aka homo sapiens) C: eutherian mammals (aka eutheria) D: suborder E: probles F: None of the above.
[B]
<Instruct>: Given the context 'Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: homo sapiens (human) (aka homo sapiens) B: mammals (aka mammalia) C: this D: suborder E: kingdom F: None of the above.
[A]
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [s.pombe; arabidopsis thaliana; c.elegans; drosophila melanogaster] <Options>: A: uronema elegans B: schizosaccharomyces pombe (schizosaccharomyces malidevorans) (aka schizosaccharomyces pombe) C: arabidopsis thaliana x arabidopsis halleri D: fruit fly (aka drosophila melanogaster) E: melanogaster (aka melanogaster <basidiomycete fungi>) F: arabis thaliana (aka arabidopsis thaliana) G: caromyxa elegans (aka mutinus elegans) H: flies (aka diptera) I: arabidopsis environmental sample J: arabidopsis sp. K: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans) L: arabidopsis thaliana x arabidopsis arenosa M: sphaerospermum (aka sphaerospermopsis) N: schizosaccharomyces kambucha x schizosaccharomyces pombe O: melanogaster group P: bactrocera (bactrocera) melanogaster (aka bactrocera melanogaster) Q: caenorhabditis sp. R: caenorhabditis drosophilae (rhabditis drosophilae) (aka caenorhabditis drosophilae) S: schizosaccharomycetes (archiascomycota) (aka schizosaccharomycetes) T: schizosaccharomyces japonicus (schizosaccharomyces japonicus var. versatilis) (aka schizosaccharomyces japonicus) U: None of the above.
[B; F; K; D]
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [s.pombe; arabidopsis thaliana; c.elegans; drosophila melanogaster] <Options>: A: fabiana B: drosophila melanogaster (sophophora melanogaster) (aka drosophila melanogaster) C: uronema elegans D: melanogaster <flies> (melanogaster) (aka melanogaster <flies>) E: fission yeasts (aka schizosaccharomycetaceae) F: flies (aka diptera) G: schizosaccharomyces pombe (schizosaccharomyces malidevorans) (aka schizosaccharomyces pombe) H: sphaerospermopsis (sphaerospermum) (aka sphaerospermopsis) I: schizosaccharomyces J: fruit flies (aka drosophila <flies,genus>) K: arabidopsis suecica (arabis thaliana subsp. suecica) (aka arabidopsis suecica) L: schizosaccharomyces sp. M: theocolax elegans N: rhabditis elegans (aka caenorhabditis elegans) O: gongylostoma elegans elegans (clausilia elegans elegans) (aka gongylostoma elegans elegans) P: drosophila elegans Q: arabidopsis sp. R: arabidopsis thaliana (mouse-ear cress) (aka arabidopsis thaliana) S: arabideae T: melanogaster subgroup U: None of the above.
[G; R; N; B]
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [s.pombe; arabidopsis thaliana; c.elegans; drosophila melanogaster] <Options>: A: schizosaccharomyces pombe oy26 B: drosophila <basidiomycete fungi> (drosophila) (aka drosophila <basidiomycete fungi>) C: schizosaccharomyces pombe (schizosaccharomyces malidevorans) (aka schizosaccharomyces pombe) D: arabidella E: arabidopsis environmental sample F: schizosaccharomyces kambucha x schizosaccharomyces pombe G: bactrocera (bactrocera) melanogaster (aka bactrocera melanogaster) H: elegans subgroup (in: flies) I: mouse-ear cress (aka arabidopsis thaliana) J: caromyxa elegans (aka mutinus elegans) K: zygosaccharomyces L: apophylia M: sphingomorpha N: hawaiian drosophila O: drosophila elegans P: unclassified arabidopsis Q: melanogaster (aka melanogaster <basidiomycete fungi>) R: gongylostoma elegans elegans (clausilia elegans elegans) (aka gongylostoma elegans elegans) S: fruit fly (aka drosophila melanogaster) T: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans) U: None of the above.
[C; I; T; S]
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [s.pombe; arabidopsis thaliana; c.elegans; drosophila melanogaster] <Options>: A: schizosaccharomyces sp. B: caenorhabditis drosophilae (rhabditis drosophilae) (aka caenorhabditis drosophilae) C: sphaerosoma <ascomycete fungi> (sphaerosoma) (aka sphaerosoma <ascomycete fungi>) D: melanogaster <basidiomycete fungi> (melanogaster) (aka melanogaster <basidiomycete fungi>) E: hawaiian drosophila F: drosophila melanogaster (sophophora melanogaster) (aka drosophila melanogaster) G: melanogaster (aka melanogaster <flies>) H: fission yeast (aka schizosaccharomyces pombe) I: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans) J: schizosaccharomyces kambucha x schizosaccharomyces pombe K: (arabidopsis thaliana x arabidopsis arenosa) x arabidopsis suecica L: arabis thaliana (aka arabidopsis thaliana) M: theocolax elegans N: euphyia O: schizosaccharomyces japonicus var. japonicus (aka schizosaccharomyces japonicus) P: drosophila <flies,subgenus> (drosophila) (aka drosophila <flies,subgenus>) Q: apophylia R: drosophila elegans S: caenorhabditis T: fabiana U: None of the above.
[H; L; I; F]
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [mouse] <Options>: A: peromyscus B: mus molossinus (aka mus musculus molossinus) C: mus musculoides (mus musculoides enclavae) (aka mus musculoides) D: mouse (aka mus musculus) E: mus <subgenus> (mus (aka mus <subgenus>)) F: None of the above.
[D]
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; yeast] <Options>: A: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae) B: animals (aka metazoa) C: saccharomyces lactis (aka kluyveromyces lactis) D: human (aka homo sapiens) E: saccharomyces albicans (aka candida albicans) F: mammals (aka mammalia) G: budding yeasts & others (aka saccharomycotina) H: saccharomyces hansenii (aka debaryomyces hansenii) I: kingdom J: eutherian mammals (aka eutheria) K: None of the above.
[D; A]
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; yeast] <Options>: A: cellular organisms (biota) (aka cellular organisms) B: saccharomycetes (hemiascomycetes) (aka saccharomycetes) C: this D: saccharomyces hansenii (aka debaryomyces hansenii) E: homo sapiens (human) (aka homo sapiens) F: placental mammals (aka eutheria) G: mycoderma cerevisiae (aka saccharomyces cerevisiae) H: saccharomycotina (budding yeasts & others) (aka saccharomycotina) I: macrobiotus sapiens J: saccharomyceta K: None of the above.
[E; G]
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; yeast] <Options>: A: saccharomycotina (budding yeasts & others) (aka saccharomycotina) B: saccharomyceta C: homo sapiens (human) (aka homo sapiens) D: cellular organisms (biota) (aka cellular organisms) E: placental mammals (aka eutheria) F: saccharomycetes (hemiascomycetes) (aka saccharomycetes) G: this H: saccharomyces hansenii (aka debaryomyces hansenii) I: macrobiotus sapiens J: None of the above.
[C; J]
<Instruct>: Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; yeast] <Options>: A: avian (aka aves) B: saccharomycetes (hemiascomycetes) (aka saccharomycetes) C: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus) D: saccharomyces sp. E: this F: kingdom G: saccharomycotina (budding yeasts & others) (aka saccharomycotina) H: baker's yeast (aka saccharomyces cerevisiae) I: homo sapiens (human) (aka homo sapiens) J: cellular organisms (biota) (aka cellular organisms) K: None of the above.
[I; H]
<Instruct>: Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; yeast] <Options>: A: birds (aka aves) B: human (aka homo sapiens) C: saccharomyces cerevisiae x saccharomyces mikatae D: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus) E: candida/saccharomycetales (aka candida/saccharomycales clade) F: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae) G: genus H: saccharomycetes (hemiascomycetes) (aka saccharomycetes) I: biota (aka cellular organisms) J: kingdom K: None of the above.
[B; F]
<Instruct>: Given the context 'However, a GFP fusion to the N-terminus of human Enp1 homolog localized to the nucleus and was enriched in the nucleolus (data not shown). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: homo (humans) (aka homo) B: placental mammals (aka eutheria) C: mammals (aka mammalia) D: human (aka homo sapiens) E: kingdom F: None of the above.
[D]
<Instruct>: Given the context 'DISCUSSION ENP1 is a yeast gene first identified in a genetic screen for complementation of mutations in ost4, which encodes a subunit of oligosaccharide transferase (17), although subsequent work showed that it is unlikely that Enp1 has any connection to oligosaccharide transferase (18).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [yeast] <Options>: A: saccharomyceta B: saccharomyces sp. C: brewer's yeast (aka saccharomyces cerevisiae) D: budding yeasts & others (aka saccharomycotina) E: saccharomyces cf. cerevisiae F: None of the above.
[C]
<Instruct>: Given the context 'Among the more than 100 snoRNAs in yeast cells, U3, U14, snR10, snR30 and MRP RNA are the only ones required for rRNA processing.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [yeast] <Options>: A: saccharomyces lactis (aka kluyveromyces lactis) B: saccharomycetes (hemiascomycetes) (aka saccharomycetes) C: saccharomyces hansenii (aka debaryomyces hansenii) D: saccharomyceta E: mycoderma cerevisiae (aka saccharomyces cerevisiae) F: None of the above.
[E]
<Instruct>: Given the context 'Recently, a genome-wide study of yeast protein complexes, using a TAP tag method similar to ours, reported a number of proteins that co-immunoprecipitated with Enp1 (43).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [yeast] <Options>: A: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae) B: saccharomyces hansenii (aka debaryomyces hansenii) C: saccharomyces cf. cerevisiae D: candida/saccharomycetales (aka candida/saccharomycales clade) E: saccharomycetes (hemiascomycetes) (aka saccharomycetes) F: None of the above.
[A]
<Instruct>: Given the context 'A previous study on the Enp1 human homolog, bystin, reported that the protein was localized in the cytoplasm of mammalian cells and might be involved in cell adhesion (19).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: human (aka homo sapiens) B: cellular organisms (biota) (aka cellular organisms) C: this D: animals (aka metazoa) E: species F: None of the above.
[A]
<Instruct>: Given the context 'Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: human (aka homo sapiens) B: humans (aka homo) C: suborder D: mammals (aka mammalia) E: cellular organisms (biota) (aka cellular organisms) F: None of the above.
[A]
<Instruct>: Given the context 'Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: suborder B: cellular organisms (biota) (aka cellular organisms) C: mammals (aka mammalia) D: humans (aka homo) E: None of the above.
[E]
<Instruct>: Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; yeast] <Options>: A: human (aka homo sapiens) B: candida/saccharomycetales (aka candida/saccharomycales clade) C: macrobiotus sapiens D: humans (aka homo) E: saccharomyces cerevisiae x saccharomyces mikatae F: suborder G: primate (aka primates) H: saccharomyces albicans (aka candida albicans) I: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus) J: baker's yeast (aka saccharomyces cerevisiae) K: None of the above.
[A; J]
<Instruct>: Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human; yeast] <Options>: A: animals (aka metazoa) B: probles C: genus D: brewer's yeast (aka saccharomyces cerevisiae) E: saccharomycetes (hemiascomycetes) (aka saccharomycetes) F: human (aka homo sapiens) G: saccharomyces cf. cerevisiae H: saccharomyceta I: mammals (aka mammalia) J: saccharomyces sp. K: None of the above.
[F; D]
<Instruct>: Given the context 'The cytoplasmic localization of bystin and its proposed function in cell adhesion are unlikely to reflect the actual function of the human Enp1 homolog. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: species B: birds (aka aves) C: eutherian mammals (aka eutheria) D: homo sapiens (human) (aka homo sapiens) E: homo (humans) (aka homo) F: None of the above.
[D]
<Instruct>: Given the context 'Epigenetic inactivation and aberrant transcription of CSMD1 in squamous cell carcinoma cell lines Abstract Background The p23.2 region of human chromosome 8 is frequently deleted in several types of epithelial cancer and those deletions appear to be associated with poor prognosis.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: animals (aka metazoa) B: homo sapiens (human) (aka homo sapiens) C: birds (aka aves) D: mammals (aka mammalia) E: species F: None of the above.
[B]
<Instruct>: Given the context 'Background CUB and Sushi Multiple Domains 1 (CSMD1) was cloned as a candidate tumor suppressor or progression gene from a region of human chromosome 8 deleted in tumors of the upper aerodigestive tract, prostate, ovary and bladder', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: probles B: macrobiotus sapiens C: homo sapiens (human) (aka homo sapiens) D: homo (humans) (aka homo) E: primate (aka primates) F: None of the above.
[C]
<Instruct>: Given the context 'RT-PCR of human fetal brain cDNA reveals very low levels of an RT-PCR product corresponding in size to that expected from the internally deleted transcript.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: animals (aka metazoa) B: humans (aka homo) C: genus D: human (aka homo sapiens) E: biota (aka cellular organisms) F: None of the above.
[D]
<Instruct>: Given the context 'Normal oropharyngeal epithelium was isolated from discarded tissue from uvulopalatopharyngoplasties (UPPP) collected anonymously with the approval of the Washington University Human Studies Committee. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: species B: suborder C: mammals (aka mammalia) D: human (aka homo sapiens) E: kingdom F: None of the above.
[D]
<Instruct>: Given the context 'Cell Culture and Tissue Preparation Squamous cell carcinoma cell lines were grown in DMEM or DMEM:F-12, 1:1 Mixture (BioWhittaker) containing 10% fetal bovine serum (Sigma).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [bovine] <Options>: A: cattle (aka bos) B: cow (aka bos taurus) (aka bos taurus) C: bos indicus (bos primigenius indicus) (aka bos indicus) D: bovinae E: bos sp. F: None of the above.
[B]
<Instruct>: Given the context 'Cell Culture and Tissue Preparation Squamous cell carcinoma cell lines were grown in DMEM or DMEM:F-12, 1:1 Mixture (BioWhittaker) containing 10% fetal bovine serum (Sigma).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [bovine] <Options>: A: cattle (aka bos) B: bovinae C: bos sp. D: bos indicus (bos primigenius indicus) (aka bos indicus) E: None of the above.
[E]
<Instruct>: Given the context 'An amplicon from human 18S RNA was used as a basis for comparisons across cell lines (primers prm2396, ttcggaactgaggccatgat and prm2397, tttcgctctggtccgtcttg).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: homo sapiens (human) (aka homo sapiens) B: animals (aka metazoa) C: cellular organisms (biota) (aka cellular organisms) D: kingdom E: homo (humans) (aka homo) F: None of the above.
[A]
<Instruct>: Given the context 'Cells were grown for 72 hours in media containing DMEM:F-12, 1:1 Mixture (BioWhittaker) with 1X MEM Nonessential Amino Acids (BioWhittaker) and 10% fetal bovine serum and then switched to media containing 5aza-dC at concentrations of 0 μm, 5 μM, 25 μM, or 100 μM. Cells were fed daily for 4–5 days and then both plates were harvested in 3 ml of Trizol (Invitrogen) for isolation of RNA and DNA according to the manufacturer's instructions.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [bovine] <Options>: A: bos bubalis (aka bubalus bubalis) B: bos (cattle) (aka bos) C: bovine (aka bos taurus) D: bos taurus indicus (aka bos indicus) E: bos sp. F: None of the above.
[C]
<Instruct>: Given the context 'Human growth hormone (GH1) gene polymorphism map in a normal-statured adult population Abstract Objective GH1 gene presents a complex map of single nucleotide polymorphisms (SNPs) in the entire promoter, coding and noncoding regions.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: probles B: homo sapiens (human) (aka homo sapiens) C: biota (aka cellular organisms) D: species E: birds (aka aves) F: None of the above.
[B]
<Instruct>: Given the context 'Systematic GH1 gene analysis in patients with growth delay and suspected GH deficiency/insufficiency will clarify whether different SNP frequencies and/or the presence of different sequence changes may be associated with phenotypes in them. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [patients] <Options>: A: cancer B: aides C: this D: other (aka unidentified) E: human (aka homo sapiens) F: None of the above.
[E]
<Instruct>: Given the context 'Introduction Human skeletal growth and final height attainment are a result of a multifactorial regulation involving systemic and local hormones, growth and nutritional factors, lifestyle and genetic factors.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [human] <Options>: A: this B: suborder C: probles D: mammals (aka mammalia) E: human (aka homo sapiens) F: None of the above.
[E]
<Instruct>: Given the context 'Large deletions within the GH1 gene cluster were described first followed by point mutations, the majority of which affect introns 3 or 4, provoke skipping of exon 3 product and exert a dominant effect.3,7,8 More recently, the presence of single nucleotide polymorphic points (SNPs) in the promoter region or in intron 4 of the GH1 gene have been described9–12 and associations with promoter allele activities or with GH secretion efficacy and circulating IGF-I levels in growth-retarded patients have also been described.11,12 Other studies have analysed several GH1 gene SNP genotypes as related to the incidence of neoplasia, with a positive association with colorectal neoplasia for intron 4 SNP,13 a negative result for breast carcinoma14,15 or a positive one for breast cancer risk.16,17 In addition, a recent study in a cohort of adults over ages 60 years detected a significant association between genotypes at one SNP in the GH1 gene promoter region and at the intron 4 SNP described by Hasegawa et al.11 with baseline bone density and accelerated bone loss together with an interaction with weight at 1 year.18 Intron 4 SNP described by Hasegawa et al.11 has also been associated, in women, with shorter body height and reduced mortality,19 whereas another intron 4 SNP (T1169A) has been associated in both sexes with a favourable metabolic profile.20', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [patients; women] <Options>: A: mus <genus> (mice (aka mus <genus>)) B: circe C: species D: chicken (aka gallus gallus) E: probles F: homo sapiens (human) (aka homo sapiens) G: other (aka unidentified) H: genus I: None of the above.
[F; F]
<Instruct>: Given the context 'Large deletions within the GH1 gene cluster were described first followed by point mutations, the majority of which affect introns 3 or 4, provoke skipping of exon 3 product and exert a dominant effect.3,7,8 More recently, the presence of single nucleotide polymorphic points (SNPs) in the promoter region or in intron 4 of the GH1 gene have been described9–12 and associations with promoter allele activities or with GH secretion efficacy and circulating IGF-I levels in growth-retarded patients have also been described.11,12 Other studies have analysed several GH1 gene SNP genotypes as related to the incidence of neoplasia, with a positive association with colorectal neoplasia for intron 4 SNP,13 a negative result for breast carcinoma14,15 or a positive one for breast cancer risk.16,17 In addition, a recent study in a cohort of adults over ages 60 years detected a significant association between genotypes at one SNP in the GH1 gene promoter region and at the intron 4 SNP described by Hasegawa et al.11 with baseline bone density and accelerated bone loss together with an interaction with weight at 1 year.18 Intron 4 SNP described by Hasegawa et al.11 has also been associated, in women, with shorter body height and reduced mortality,19 whereas another intron 4 SNP (T1169A) has been associated in both sexes with a favourable metabolic profile.20', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [patients; women] <Options>: A: probles B: genus C: homo (humans) (aka homo) D: avian (aka aves) E: human (aka homo sapiens) F: suborder G: other (aka unidentified) H: chicken (aka gallus gallus) I: theraps J: None of the above.
[E; E]
<Instruct>: Given the context 'To obtain normative data for subsequent analysis of GH1 gene contribution to IIGHD in children, a systematic GH1 gene structural analysis was designed in a normal adult control population to establish the GH1 gene SNP map in adults from our population with heights within the normal range, determine the genotype frequencies and analyse possible associations between individual and combined SNPs with height. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [children] <Options>: A: genus B: homo sapiens (human) (aka homo sapiens) C: neonetus D: probles E: infraclass F: None of the above.
[B]
<Instruct>: Given the context 'To obtain normative data for subsequent analysis of GH1 gene contribution to IIGHD in children, a systematic GH1 gene structural analysis was designed in a normal adult control population to establish the GH1 gene SNP map in adults from our population with heights within the normal range, determine the genotype frequencies and analyse possible associations between individual and combined SNPs with height. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [children] <Options>: A: infraclass B: probles C: neonetus D: genus E: None of the above.
[E]
<Instruct>: Given the context 'Subjects and methods Subjects A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [women; men; patients] <Options>: A: menoidium B: gallus C: infraclass D: menella E: menenotus F: kingdom G: human (aka homo sapiens) H: suborder I: menetes J: genus K: homo (humans) (aka homo) L: menecles M: species N: None of the above.
[G; G; G]
<Instruct>: Given the context 'Subjects and methods Subjects A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [women; men; patients] <Options>: A: homo sapiens (human) (aka homo sapiens) B: mus <genus> (mice (aka mus <genus>)) C: menkeleon D: theraps E: kingdom F: latina G: humans (aka homo) H: mammals (aka mammalia) I: menaethius J: menella K: menneus L: menevia M: mouse (aka mus musculus) N: species O: None of the above.
[A; A; A]
<Instruct>: Given the context 'Subjects and methods Subjects A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [women; men; patients] <Options>: A: latina B: subsection C: probles D: homo (humans) (aka homo) E: genus F: mus <genus> (mice (aka mus <genus>)) G: menigrates H: human (aka homo sapiens) I: menaethius J: mammals (aka mammalia) K: menneus L: menecles M: menesia N: chicken (aka gallus gallus) O: None of the above.
[H; H; H]
<Instruct>: Given the context 'The protocol was approved by the Hospital Vall d’Hebron Ethics Committee and written informed consent was obtained from each participant.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [participant] <Options>: A: cohort B: athletes C: humans (aka homo) D: homo sapiens (human) (aka homo sapiens) E: assessor F: None of the above.
[D]
<Instruct>: Given the context 'The protocol was approved by the Hospital Vall d’Hebron Ethics Committee and written informed consent was obtained from each participant.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [participant] <Options>: A: cohort B: assessor C: humans (aka homo) D: athletes E: None of the above.
[E]
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [women; men] <Options>: A: genus B: species C: avian (aka aves) D: menevia E: menetes F: menella G: menoidium H: mene I: infraclass J: homo sapiens (human) (aka homo sapiens) K: None of the above.
[J; J]
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon.
<Mentions>: [women; men] <Options>: A: infraclass B: menosoma C: china D: menoidium E: homo sapiens (human) (aka homo sapiens) F: menesia G: menevia H: menura I: species J: mouse (aka mus musculus) K: None of the above.
[E; E]