instruction stringlengths 225 2.35k | input stringlengths 89 1.5k | response stringclasses 698 values |
|---|---|---|
<Instruct>: Given the context 'This possibility can be discarded since potato rps10 precursor mRNA was found to be edited in vivo (23).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: sweet potato (aka ipomoea batatas)
B: solanum annuum
C: solanum
D: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
E: tuberaria
F: None of the above. | [D] |
<Instruct>: Given the context 'This led us to postulate that the inability of wheat mitochondria to recognize rps10 editing sites is likely due to the fact that wheat mitochondria have lost the editing trans-recognition elements which become dispensable after transfer of rps10 to the nucleus.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: triticum
B: common wheat (aka triticum aestivum)
C: triticum strictum (aka secale strictum)
D: triticum aethiopicum (aka triticum turgidum)
E: one-grained wheat (aka triticum monococcum)
F: None of the above. | [B] |
<Instruct>: Given the context 'To test this possibility, rps10 chimeric plasmids containing editing site C259 from wheat cox2 inserted either in exon1 or the intron were constructed.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: one-grained wheat (aka triticum monococcum)
B: triticum
C: triticum aestivum subsp. aestivum (aka triticum aestivum)
D: english wheat (aka triticum turgidum)
E: durum wheat (aka triticum turgidum subsp. durum)
F: None of the above. | [C] |
<Instruct>: Given the context 'The wheat C259 editing site in the chimeric construct was correctly edited by potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: one-grained wheat (aka triticum monococcum)
B: solanum giganteum
C: triticum strictum (aka secale strictum)
D: solanum nutans
E: potatoes (aka solanum tuberosum)
F: triticum
G: solanum rugosum
H: triticum sativum (aka triticum aestivum)
I: sweet potato (aka ipomoea batatas)
J: poulard wheat (aka triticum turgidum)
K: None of the above. | [H; E] |
<Instruct>: Given the context 'The wheat C259 editing site in the chimeric construct was correctly edited by potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: triticum aegilops (aka aegilops tauschii)
B: triticum strictum (aka secale strictum)
C: sweet potato (aka ipomoea batatas)
D: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum)
E: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
F: rivet wheat (aka triticum turgidum)
G: chaco potato (aka solanum chacoense)
H: one-grained wheat (aka triticum monococcum)
I: solanum ipomoeoides
J: solanum crispum (chilean potato-tree) (aka solanum crispum)
K: None of the above. | [E; D] |
<Instruct>: Given the context 'The wheat C259 editing site in the chimeric construct was correctly edited by potato mitochondria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat; potato]
<Options>: A: one-grained wheat (aka triticum monococcum)
B: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum)
C: solanum ipomoeoides
D: triticum aegilops (aka aegilops tauschii)
E: solanum crispum (chilean potato-tree) (aka solanum crispum)
F: chaco potato (aka solanum chacoense)
G: sweet potato (aka ipomoea batatas)
H: triticum strictum (aka secale strictum)
I: rivet wheat (aka triticum turgidum)
J: None of the above. | [B; J] |
<Instruct>: Given the context 'This result is not unexpected since the corresponding region in endogenous potato cox2 mRNA, which presents two differences at positions −3 (C instead of A) and −7 (G instead of A), is edited.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [potato]
<Options>: A: solanum glutinosum
B: potatoes (aka solanum tuberosum)
C: air-potato (aka dioscorea bulbifera)
D: sweet potato (aka ipomoea batatas)
E: solanum insanum (solanum melongena var. insanum) (aka solanum insanum)
F: None of the above. | [B] |
<Instruct>: Given the context 'Surprisingly, the C259 editing site grafted in rps10 was not recognized by the wheat editing machinery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: triticum
B: triticum x secale (aka x triticosecale)
C: triticum tauschii (aka aegilops tauschii)
D: durum wheat (aka triticum turgidum subsp. durum)
E: triticum vulgare (aka triticum aestivum)
F: None of the above. | [E] |
<Instruct>: Given the context 'The fact that the wheat editing site C259 inserted in chimeric rps10 transcripts was not recognized by wheat mitochondria is a strong argument for this hypothesis.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [wheat]
<Options>: A: one-grained wheat (aka triticum monococcum)
B: triticum
C: triticum sativum (aka triticum aestivum)
D: triticum aegilops (aka aegilops tauschii)
E: triticum x secale (aka x triticosecale)
F: None of the above. | [C] |
<Instruct>: Given the context 'The power function Tf=f(Pc) theoretically derived was experimentally confirmed by concomitant Pp and Pc measurements on intact leaflets of the liana Tetrastigma voinierianum under greenhouse conditions.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [tetrastigma voinierianum]
<Options>: A: anapochrysa voeltzkowi
B: diplotaxis vogelii (sinapidendron vogelii) (aka diplotaxis vogelii)
C: herpetodiplostomum vogti
D: poecilimon vodnensis
E: vitis voinieriana (aka tetrastigma voinierianum)
F: None of the above. | [E] |
<Instruct>: Given the context 'This could be verified by combined turgor pressure probe and leaf patch clamp pressure probe measurements on leaflets of the liana Tetrastigma voinierianum.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [tetrastigma voinierianum]
<Options>: A: vitis voinieriana (aka tetrastigma voinierianum)
B: sphaeria vogesiaca (aka hypoxylon vogesiacum)
C: myriophyllum votschii
D: phacelia vossii
E: milesina vogesiaca
F: None of the above. | [A] |
<Instruct>: Given the context 'Materials and methods
Plant material
Experiments were performed on two specimens of the liana Tetrastigma voinierianum, growing in the c. 12 m tall tropical greenhouse of the University of Salzburg, Austria.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [tetrastigma voinierianum]
<Options>: A: haplotrema voyanum (ancotrema voyanum) (aka haplotrema voyanum)
B: elaphoglossum fournierianum
C: magnolia vovidesii
D: tetrastigma voinierianum (vitis voinieriana) (aka tetrastigma voinierianum)
E: myriophyllum votschii
F: None of the above. | [D] |
<Instruct>: Given the context 'Turgor pressure measurements on leaf cells of T. voinierianum were difficult to perform because of the presence of mucilage.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [t. voinierianum]
<Options>: A: paratrigonidium vittatum (aka trigonidium venustulum)
B: vitis voinieriana (aka tetrastigma voinierianum)
C: byttneria voulily
D: votum
E: vogesella mureinivorans
F: None of the above. | [B] |
<Instruct>: Given the context 'Experience collected with patch clamp pressure measurements on T. voinierianum and on preliminary results of other plants (e.g. grapevines, bananas, Eucalyptus, and Arabidopsis) showed that a smooth intercostal leaf area for clamping can readily be found.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [t. voinierianum; bananas]
<Options>: A: vogesella mureinivorans
B: vitis voinieriana (aka tetrastigma voinierianum)
C: musaceae (banana family) (aka musaceae)
D: musa ornata (flowering banana) (aka musa ornata)
E: tetramorium voasary
F: herpetodiplostomum vogti
G: banana (aka musa acuminata)
H: banchus
I: bantia
J: byttneria voulily
K: None of the above. | [B; G] |
<Instruct>: Given the context 'Experience collected with patch clamp pressure measurements on T. voinierianum and on preliminary results of other plants (e.g. grapevines, bananas, Eucalyptus, and Arabidopsis) showed that a smooth intercostal leaf area for clamping can readily be found.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [t. voinierianum; bananas]
<Options>: A: banana (aka musa acuminata)
B: banjos
C: trichinium beckerianum (aka ptilotus beckerianus)
D: hypobathrum boivinianum (aka tricalysia boiviniana)
E: baniana
F: musa balbisiana (starchy banana) (aka musa balbisiana)
G: tetrastigma voinierianum (vitis voinieriana) (aka tetrastigma voinierianum)
H: bantia
I: didymium radiaticolumellum
J: herpetodiplostomum vogti
K: None of the above. | [G; A] |
<Instruct>: Given the context 'Analogous recordings of turgor pressure and patch clamp pressure on grapevines, bananas, and Eucalyptus trees also yielded results (D Zimmermann, unpublished results) which were consistent with the predictions of equation 8.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bananas; eucalyptus]
<Options>: A: eucalyptus pulverulenta (powdered gum) (aka eucalyptus pulverulenta)
B: starchy banana (aka musa balbisiana)
C: eucalyptus verrucata (eucalyptus verrucosa) (aka eucalyptus verrucata)
D: cooking banana (aka musa abb group)
E: banana family (aka musaceae)
F: eucalyptus grisea
G: baniana
H: dwarf banana (aka musa acuminata)
I: eucalyptus luculenta
J: eucalyptus
K: None of the above. | [H; J] |
<Instruct>: Given the context 'Analogous recordings of turgor pressure and patch clamp pressure on grapevines, bananas, and Eucalyptus trees also yielded results (D Zimmermann, unpublished results) which were consistent with the predictions of equation 8.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bananas; eucalyptus]
<Options>: A: sweet banana (aka musa acuminata)
B: eucalyptus grisea
C: bannoa
D: eucalyptus pulverulenta (powdered gum) (aka eucalyptus pulverulenta)
E: balbis banana (aka musa balbisiana)
F: eucalyptus oleosa
G: banta
H: banjos
I: eucalyptus luculenta
J: eucalyptus
K: None of the above. | [A; J] |
<Instruct>: Given the context 'The process seemed to be very similar to the refilling of the cells of the resurrection plant Myrothamnus flabellifolia with water after desiccation (Wagner et al., 2000).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [myrothamnus flabellifolia]
<Options>: A: grammitis flabelliformis (aka melpomene flabelliformis)
B: myrtea flabelliformis (aka notomyrtea flabelliformis)
C: mimosa flabellifolia
D: myrothamnus flabellifolia (myrothamnus flabellifolius) (aka myrothamnus flabellifolia)
E: pannaria flabellosa (aka placynthium flabellosum)
F: None of the above. | [D] |
<Instruct>: Given the context '4A and B, restoration of full turgescence in T. voinierianum was faster than the preceding turgor pressure loss if the lianas were well-watered.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [t. voinierianum]
<Options>: A: unclassified votadinium
B: geminibasidium donsium (geminobasidium donsium) (aka geminibasidium donsium)
C: byttneria voulily
D: vitis voinieriana (aka tetrastigma voinierianum)
E: ancotrema voyanum (aka haplotrema voyanum)
F: None of the above. | [D] |
<Instruct>: Given the context 'Even though more work is required, the present study shows that the leaf patch clamp pressure probe is a promising tool to elucidate short- and long-distance water transport in T. voinierianum and other plants.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [t. voinierianum]
<Options>: A: tetrastigma voinierianum (vitis voinieriana) (aka tetrastigma voinierianum)
B: tetramorium voasary
C: unclassified votadinium
D: trichinium beckerianum (aka ptilotus beckerianus)
E: ancotrema voyanum (aka haplotrema voyanum)
F: None of the above. | [A] |
<Instruct>: Given the context 'These considerations led Blalock to recommend the use of the former except in infants under two years of age in whom this artery may be too small and in adults or children over twelve years old or five feet tall with a left aortic arch in whom it is often too short to permit a satisfactory anastomosis.7'
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infants; children]
<Options>: A: neonetus
B: genus
C: this
D: species
E: birds (aka aves)
F: suborder
G: human (aka homo sapiens)
H: neon
I: None of the above. | [G; G] |
<Instruct>: Given the context 'These considerations led Blalock to recommend the use of the former except in infants under two years of age in whom this artery may be too small and in adults or children over twelve years old or five feet tall with a left aortic arch in whom it is often too short to permit a satisfactory anastomosis.7'
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infants; children]
<Options>: A: genus
B: this
C: suborder
D: birds (aka aves)
E: neonetus
F: neon
G: species
H: None of the above. | [H; H] |
<Instruct>: Given the context 'These considerations led Blalock to recommend the use of the former except in infants under two years of age in whom this artery may be too small and in adults or children over twelve years old or five feet tall with a left aortic arch in whom it is often too short to permit a satisfactory anastomosis.7'
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [infants; children]
<Options>: A: avian (aka aves)
B: species
C: menetus
D: probles
E: homo sapiens (human) (aka homo sapiens)
F: neoneides
G: birds (aka aves)
H: this
I: miletus
J: None of the above. | [E; E] |
<Instruct>: Given the context 'Nevertheless, the choice of the systemic artery in each individual patient is important since in certain cases one or another is unsuitable.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: isolate
C: kingdom
D: genus
E: theraps
F: None of the above. | [A] |
<Instruct>: Given the context 'The subclavian branch of the innominate has generally been preferred in patients ranging between two and twelve years of age and in older individuals in whom there is a right aortic arch.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: human (aka homo sapiens)
B: theraps
C: suborder
D: probles
E: genus
F: None of the above. | [A] |
<Instruct>: Given the context 'One eighteen-month-old child died the day after operation and was found at post-mortem examination to have an occluded anastomosis.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [child]
<Options>: A: genus
B: pedum
C: family
D: menetus
E: human (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'In one three-year-old child and one twenty-year-old woman a poor result was obtained and a second operation upon the other side was necessary.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [child; woman]
<Options>: A: species
B: avian (aka aves)
C: kingdom
D: menetus
E: human (aka homo sapiens)
F: somaticus
G: neonetus
H: mus <subgenus> (mus (aka mus <subgenus>))
I: None of the above. | [E; E] |
<Instruct>: Given the context 'In one three-year-old child and one twenty-year-old woman a poor result was obtained and a second operation upon the other side was necessary.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [child; woman]
<Options>: A: kingdom
B: probles
C: this
D: homo sapiens (human) (aka homo sapiens)
E: mammals (aka mammalia)
F: suborder
G: humans (aka homo)
H: None of the above. | [D; D] |
<Instruct>: Given the context 'Excluding the patients mentioned in the present report, only in two was an unquestionably good result obtained.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: mus <genus> (mice (aka mus <genus>))
B: suborder
C: homo sapiens (human) (aka homo sapiens)
D: cancer
E: genus
F: None of the above. | [C] |
<Instruct>: Given the context 'Excluding the patients mentioned in the present report, only in two was an unquestionably good result obtained.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: suborder
B: cancer
C: mus <genus> (mice (aka mus <genus>))
D: genus
E: None of the above. | [E] |
<Instruct>: Given the context 'Case report
The patient was a 19-year-old girl who had been cyanotic since the age of six months.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; girl]
<Options>: A: probles
B: latina
C: other (aka unidentified)
D: humans (aka homo)
E: kingdom
F: genus
G: human (aka homo sapiens)
H: infraclass
I: isolate
J: None of the above. | [G; G] |
<Instruct>: Given the context 'Case report
The patient was a 19-year-old girl who had been cyanotic since the age of six months.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; girl]
<Options>: A: latina
B: suborder
C: subsection
D: kingdom
E: aides
F: homo sapiens (human) (aka homo sapiens)
G: probles
H: isolate
I: cancer
J: None of the above. | [F; F] |
<Instruct>: Given the context 'The patient had an uneventful but disappointing convalescence.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: mouse (aka mus musculus)
B: goes
C: human (aka homo sapiens)
D: suborder
E: aides
F: None of the above. | [C] |
<Instruct>: Given the context 'Though the patient has been markedly improved, it is recognized that the result is not as good as is commonly obtained when patients with more adequate pulmonary arteries are treated by the conventional anastomosis of a systemic artery to the side of the pulmonary artery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; patients]
<Options>: A: subsection
B: genus
C: circe
D: species
E: theraps
F: kingdom
G: cancer
H: human (aka homo sapiens)
I: None of the above. | [H; H] |
<Instruct>: Given the context 'Though the patient has been markedly improved, it is recognized that the result is not as good as is commonly obtained when patients with more adequate pulmonary arteries are treated by the conventional anastomosis of a systemic artery to the side of the pulmonary artery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; patients]
<Options>: A: goes
B: circe
C: cancer
D: human (aka homo sapiens)
E: theraps
F: mouse (aka mus musculus)
G: species
H: humans (aka homo)
I: None of the above. | [D; D] |
<Instruct>: Given the context 'Nevertheless, the patient has thus far been given such good health and relatively normal capacity for ordinary activity that further operation has seemed unwarranted, though the possibility of some future attempt at creation of an additional shunt is being kept in mind.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: aides
B: suborder
C: human (aka homo sapiens)
D: mouse (aka mus musculus)
E: other (aka unidentified)
F: None of the above. | [C] |
<Instruct>: Given the context 'Nevertheless, the patient has thus far been given such good health and relatively normal capacity for ordinary activity that further operation has seemed unwarranted, though the possibility of some future attempt at creation of an additional shunt is being kept in mind.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: other (aka unidentified)
B: aides
C: mouse (aka mus musculus)
D: suborder
E: None of the above. | [E] |
<Instruct>: Given the context 'TREATMENT OF TETRALOGY OF FALLOT
Case reports
The first patient was a fully grown young man of 17 with tetralogy of Fallot which caused considerable incapacity.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; man]
<Options>: A: mammals (aka mammalia)
B: species
C: kingdom
D: this
E: isolate
F: macrobiotus sapiens
G: probles
H: mus <subgenus> (mus (aka mus <subgenus>))
I: human (aka homo sapiens)
J: None of the above. | [I; I] |
<Instruct>: Given the context 'TREATMENT OF TETRALOGY OF FALLOT
Case reports
The first patient was a fully grown young man of 17 with tetralogy of Fallot which caused considerable incapacity.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; man]
<Options>: A: mammals (aka mammalia)
B: mus <subgenus> (mus (aka mus <subgenus>))
C: homo sapiens (human) (aka homo sapiens)
D: mouse (aka mus musculus)
E: genus
F: aides
G: probles
H: humans (aka homo)
I: circe
J: None of the above. | [C; C] |
<Instruct>: Given the context 'The patient had an uneventful convalescence.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: suborder
B: genus
C: human (aka homo sapiens)
D: aides
E: species
F: None of the above. | [C] |
<Instruct>: Given the context 'The second patient was a 16-year-old boy who had been cyanotic since birth.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; boy]
<Options>: A: theraps
B: species
C: boyliae ('boyliae') (aka boyliae)
D: this
E: circe
F: genus
G: proxys
H: birds (aka aves)
I: human (aka homo sapiens)
J: None of the above. | [I; I] |
<Instruct>: Given the context 'The second patient was a 16-year-old boy who had been cyanotic since birth.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient; boy]
<Options>: A: this
B: homo sapiens (human) (aka homo sapiens)
C: species
D: homo (humans) (aka homo)
E: isolate
F: proeces
G: goes
H: probles
I: None of the above. | [B; B] |
<Instruct>: Given the context 'The operation performed in my first patient constitutes in reality the use of the subclavian artery as an autogenous graft between the aorta and pulmonary artery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: human (aka homo sapiens)
B: genus
C: humans (aka homo)
D: subsection
E: mouse (aka mus musculus)
F: None of the above. | [A] |
<Instruct>: Given the context 'The operation performed in my first patient constitutes in reality the use of the subclavian artery as an autogenous graft between the aorta and pulmonary artery.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patient]
<Options>: A: genus
B: humans (aka homo)
C: subsection
D: mouse (aka mus musculus)
E: None of the above. | [E] |
<Instruct>: Given the context 'Observation on arterial grafts in dogs.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [dogs]
<Options>: A: carnidae
B: domestic cat (aka felis catus)
C: felis
D: cat family (aka felidae)
E: dog (aka canis lupus familiaris) (aka canis lupus familiaris)
F: None of the above. | [E] |
<Instruct>: Given the context 'Report of transplantation of preserved arterial grafts in nine human cases.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: primate (aka primates)
B: this
C: probles
D: homo sapiens (human) (aka homo sapiens)
E: animals (aka metazoa)
F: None of the above. | [D] |
<Instruct>: Given the context 'Organization and structure of the mouse interleukin-2 gene.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus (aka mus <genus>) (aka mus <genus>)
B: eastern european house mouse (aka mus musculus musculus)
C: mus cricetus (aka cricetus cricetus)
D: mus musculus (house mouse) (aka mus musculus)
E: mus molossinus (aka mus musculus molossinus)
F: None of the above. | [D] |
<Instruct>: Given the context 'Abstract
We have cloned a chromosomal DNA segment which covers the entire sequence for the murine interleukin-2 gene and analysed the structure of the gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine]
<Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: western european house mouse (aka mus musculus domesticus)
C: mouse (aka mus musculus)
D: mus <subgenus> (mus (aka mus <subgenus>))
E: mus cricetus (aka cricetus cricetus)
F: None of the above. | [C] |
<Instruct>: Given the context 'The coding regions are separated into four blocks by three introns each of which is located similarly to the corresponding human gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: eutherian mammals (aka eutheria)
C: this
D: suborder
E: probles
F: None of the above. | [A] |
<Instruct>: Given the context 'Of particular interests is the presence of sequences within the 5'-flanking region which are highly conserved between mouse and man.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; man]
<Options>: A: birds (aka aves)
B: genus
C: human (aka homo sapiens)
D: mice (aka mus sp.) (aka mus sp.)
E: probles
F: mus cricetus (aka cricetus cricetus)
G: eastern european house mouse (aka mus musculus musculus)
H: this
I: house mouse (aka mus musculus)
J: peromyscus
K: None of the above. | [I; C] |
<Instruct>: Given the context 'Of particular interests is the presence of sequences within the 5'-flanking region which are highly conserved between mouse and man.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; man]
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: mus (aka mus <subgenus>) (aka mus <subgenus>)
C: mus <genus> (mice (aka mus <genus>))
D: mus molossinus (aka mus musculus molossinus)
E: mus musculus (house mouse) (aka mus musculus)
F: humans (aka homo)
G: homo sapiens (human) (aka homo sapiens)
H: macrobiotus sapiens
I: western european house mouse (aka mus musculus domesticus)
J: this
K: None of the above. | [E; G] |
<Instruct>: Given the context 'Images
Volume 12 Number 24 1984 Nucleic Acids Research
Organization and structure of the mouse interleukin-2 gene
Akira Fuse*, Takashi Fujita, Hidetaro Yasumitsu, Nobukazu Kashima+, Katsushige Hasegawa and Tadatsugu Taniguchi?
Department of Biochemistry, Cancer Institute, Japanese Foundation for Cancer Research, Toshimaku, Tokyo 170 and Institute for Molecular and Cellular Biology, Osaka University, Suita-shi, Osaka 565, Japan
Received 10 October 1984; Revised and Accepted 20 November 1984
ABSTRACT
We have cloned a chromosomal DNA segment which covers the entire sequence for the murine interleukin-2 gene and analysed the structure of the gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; murine]
<Options>: A: mice (aka mus <genus>) (aka mus <genus>)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: mus <subgenus> (mus (aka mus <subgenus>))
F: mus musculus (house mouse) (aka mus musculus)
G: mus cricetus (aka cricetus cricetus)
H: None of the above. | [F; F] |
<Instruct>: Given the context 'Images
Volume 12 Number 24 1984 Nucleic Acids Research
Organization and structure of the mouse interleukin-2 gene
Akira Fuse*, Takashi Fujita, Hidetaro Yasumitsu, Nobukazu Kashima+, Katsushige Hasegawa and Tadatsugu Taniguchi?
Department of Biochemistry, Cancer Institute, Japanese Foundation for Cancer Research, Toshimaku, Tokyo 170 and Institute for Molecular and Cellular Biology, Osaka University, Suita-shi, Osaka 565, Japan
Received 10 October 1984; Revised and Accepted 20 November 1984
ABSTRACT
We have cloned a chromosomal DNA segment which covers the entire sequence for the murine interleukin-2 gene and analysed the structure of the gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; murine]
<Options>: A: mouse (aka mus musculus)
B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
C: mus (aka mus <subgenus>) (aka mus <subgenus>)
D: mice (aka mus sp.) (aka mus sp.)
E: mus cricetus (aka cricetus cricetus)
F: eastern european house mouse (aka mus musculus musculus)
G: peromyscus
H: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
I: None of the above. | [A; A] |
<Instruct>: Given the context 'The coding regions are separated into four blocks by three introns each of which is located similarly to the corresponding human gene. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: macrobiotus sapiens
B: biota (aka cellular organisms)
C: human (aka homo sapiens)
D: primate (aka primates)
E: genus
F: None of the above. | [C] |
<Instruct>: Given the context 'Of particular interests is the presence of sequences within the 5'flanking region which are highly conserved between mouse and man.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; man]
<Options>: A: mus sp. (mice (aka mus sp.))
B: human (aka homo sapiens)
C: mus musculus (house mouse) (aka mus musculus)
D: mouse (aka mus <genus>)
E: mus molossinus (aka mus musculus molossinus)
F: genus
G: kingdom
H: mus (aka mus <subgenus>) (aka mus <subgenus>)
I: birds (aka aves)
J: neanderthal man (aka homo sapiens neanderthalensis)
K: None of the above. | [C; B] |
<Instruct>: Given the context 'Of particular interests is the presence of sequences within the 5'flanking region which are highly conserved between mouse and man.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; man]
<Options>: A: human (aka homo sapiens)
B: mus (aka mus <subgenus>) (aka mus <subgenus>)
C: eastern european house mouse (aka mus musculus musculus)
D: probles
E: mus musculus (house mouse) (aka mus musculus)
F: neandertal man (aka homo sapiens neanderthalensis)
G: mus <genus> (mice (aka mus <genus>))
H: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
I: mus cricetus (aka cricetus cricetus)
J: None of the above. | [E; A] |
<Instruct>: Given the context 'We previously reported isolation and sequence analysis of the cDNA for human IL-2 (8), as well as the chromosomal gene (9).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: placental mammals (aka eutheria)
B: homo sapiens (human) (aka homo sapiens)
C: animals (aka metazoa)
D: kingdom
E: homo (humans) (aka homo)
F: None of the above. | [B] |
<Instruct>: Given the context 'More recently, we have isolated a cDNA which encodes murine IL-2 (Kashima et al., submitted for publication). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine]
<Options>: A: mus norvegicus (aka rattus norvegicus)
B: mus musculus (house mouse) (aka mus musculus)
C: mus sp. (mice (aka mus sp.))
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: peromyscus
F: None of the above. | [B] |
<Instruct>: Given the context 'More recently, we have isolated a cDNA which encodes murine IL-2 (Kashima et al., submitted for publication). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine]
<Options>: A: mus norvegicus (aka rattus norvegicus)
B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
C: peromyscus
D: mus sp. (mice (aka mus sp.))
E: None of the above. | [E] |
<Instruct>: Given the context 'In order to study the structure of the murine IL-2 chromosomal gene and its controlling region, we isolated and analysed a A phage clone containing the gene and its flanking sequences.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine]
<Options>: A: mus cricetus (aka cricetus cricetus)
B: house mouse (aka mus musculus)
C: mus (aka mus <subgenus>) (aka mus <subgenus>)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mus domesticus (aka mus musculus domesticus)
F: None of the above. | [B] |
<Instruct>: Given the context 'MATERIALS AND METHODS
Southern blotting of total mouse DNA
Mouse chromosomal DNA was extracted from liver of BALB/c6
?', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus molossinus (aka mus musculus molossinus)
B: mice (aka mus <genus>) (aka mus <genus>)
C: peromyscus
D: eastern european house mouse (aka mus musculus musculus)
E: house mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Nucleic Acids Research
Volume 12 Number 24 1984
9323
Nucleic Acids Research
mouse as described before (10).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mus (aka mus <subgenus>) (aka mus <subgenus>)
C: western european house mouse (aka mus musculus domesticus)
D: mus musculus (house mouse) (aka mus musculus)
E: mice (aka mus sp.) (aka mus sp.)
F: None of the above. | [D] |
<Instruct>: Given the context 'Screening of genomic DNA library
A bacteriophage XCharon 4A/mouse genomic DNA library prepared with partial EcoRI digests of mouse DNA from MPC 11 plasmacytoma cells was kindly provided by Dr. T. Honjo.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: eastern european house mouse (aka mus musculus musculus)
B: mice (aka mus sp.) (aka mus sp.)
C: mouse (aka mus musculus)
D: western european house mouse (aka mus musculus domesticus)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: None of the above. | [C] |
<Instruct>: Given the context 'Mouse IL-2-specific clones were screened by the method of Benton and Davis (12), using 700 bp PstI-AccI fragment of a cDNA clone, pMIL2-45 as the probe (Kashima et al., submitted for publication). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: peromyscus
B: mus <subgenus> (mus (aka mus <subgenus>))
C: mus musculus (house mouse) (aka mus musculus)
D: mice (aka mus sp.) (aka mus sp.)
E: mus molossinus (aka mus musculus molossinus)
F: None of the above. | [C] |
<Instruct>: Given the context 'Subcloninq and sequencing of the mouse IL-2 gene
Two EcoRI fragments of 3.3 Kbp and 2.8 Kbp from the positive recombinant X phage were subcloned into EcoRI site of plasmid pBR322. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: eastern european house mouse (aka mus musculus musculus)
C: western european house mouse (aka mus musculus domesticus)
D: mus cricetus (aka cricetus cricetus)
E: mice (aka mus sp.) (aka mus sp.)
F: None of the above. | [A] |
<Instruct>: Given the context 'RESULTS
Total DNA blotting analysis
In order to study structural organization of the mouse IL-2 gene, we first subjected total mouse DNA to the blotting analysis by using various probes specific for IL-2 gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: mus molossinus (aka mus musculus molossinus)
C: mice (aka mus <genus>) (aka mus <genus>)
D: mouse (aka mus musculus)
E: mus sp. (mice (aka mus sp.))
F: None of the above. | [D] |
<Instruct>: Given the context 'When mouse DNA was digested with various restriction endonucleases and then probed with a 7 kb human chromosomal DNA segment which contains the human IL-2 gene and its flanking region (Fig. 1 lane 1-8, ref.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus molossinus (aka mus musculus molossinus)
B: mouse (aka mus musculus)
C: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
D: mus cricetus (aka cricetus cricetus)
E: mus <genus> (mice (aka mus <genus>))
F: suborder
G: human (aka homo sapiens)
H: cellular organisms (biota) (aka cellular organisms)
I: genus
J: birds (aka aves)
K: None of the above. | [B; G] |
<Instruct>: Given the context 'When mouse DNA was digested with various restriction endonucleases and then probed with a 7 kb human chromosomal DNA segment which contains the human IL-2 gene and its flanking region (Fig. 1 lane 1-8, ref.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: homo (humans) (aka homo)
C: birds (aka aves)
D: genus
E: eutherian mammals (aka eutheria)
F: mus domesticus (aka mus musculus domesticus)
G: peromyscus
H: human (aka homo sapiens)
I: mus musculus (house mouse) (aka mus musculus)
J: eastern european house mouse (aka mus musculus musculus)
K: None of the above. | [I; H] |
<Instruct>: Given the context 'Additional bands corresponding to those observed by using mouse IL-2 cDNA probes (lane 13-17) also appeared by longer
9324
Nucleic Acids Research
M 1 2 3 4 M 5 6 7 8 M 9 101112 M 13 141516 17
a~ ~ 3 ..
I pMIL2-45 SacI Acc I
CZI~~1 1t L2- 20
Acc I
1 00', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: peromyscus
C: mice (aka mus <genus>) (aka mus <genus>)
D: mus <subgenus> (mus (aka mus <subgenus>))
E: eastern european house mouse (aka mus musculus musculus)
F: None of the above. | [A] |
<Instruct>: Given the context '1. Blot hybridization analysis of mouse chromosomal DNA.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: western european house mouse (aka mus musculus domesticus)
B: mus musculus (house mouse) (aka mus musculus)
C: mus cricetus (aka cricetus cricetus)
D: mice (aka mus sp.) (aka mus sp.)
E: mus (aka mus <subgenus>) (aka mus <subgenus>)
F: None of the above. | [B] |
<Instruct>: Given the context 'High molecular DNA prepared from Liver BALB/C6 mouse was digested with various restriction endonucleases (BamHI for lanes 1, 5, 9, 13 ; EcoRI for lanes 2, 6, 10, 14, 17 ; HindIII for lanes 3, 7, 11, 15 ; XbaI for lanes 4, 8, 12, 16 ).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: mus molossinus (aka mus musculus molossinus)
C: mus musculus (house mouse) (aka mus musculus)
D: mus cricetus (aka cricetus cricetus)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: None of the above. | [C] |
<Instruct>: Given the context 'Filters were hybridized by the published procedure (13) either with the nick-translated chromosomal DNA containing human IL-2 gene and its flanking region (total length, 7.0 kb, ref. 9) (lane 1-8) or with the nick-translated cDNA for mouse IL-2 (see figure).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: species
C: suborder
D: mus <subgenus> (mus (aka mus <subgenus>))
E: mus musculus (house mouse) (aka mus musculus)
F: eutherian mammals (aka eutheria)
G: primate (aka primates)
H: homo sapiens (human) (aka homo sapiens)
I: mus domesticus (aka mus musculus domesticus)
J: mus (aka mus <genus>) (aka mus <genus>)
K: None of the above. | [H; E] |
<Instruct>: Given the context 'Filters were hybridized by the published procedure (13) either with the nick-translated chromosomal DNA containing human IL-2 gene and its flanking region (total length, 7.0 kb, ref. 9) (lane 1-8) or with the nick-translated cDNA for mouse IL-2 (see figure).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: mus cricetus (aka cricetus cricetus)
C: biota (aka cellular organisms)
D: mus musculus (house mouse) (aka mus musculus)
E: eastern european house mouse (aka mus musculus musculus)
F: mus molossinus (aka mus musculus molossinus)
G: placental mammals (aka eutheria)
H: genus
I: suborder
J: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
K: None of the above. | [A; D] |
<Instruct>: Given the context 'Brief restriction endonuclease cleavage map for the mouse IL-2 cDNAs is presented in the lower part of the figure.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mice (aka mus <genus>) (aka mus <genus>)
D: mus musculus (house mouse) (aka mus musculus)
E: mice (aka mus sp.) (aka mus sp.)
F: None of the above. | [D] |
<Instruct>: Given the context 'Those results suggest the presence of highly conserved sequences between human and mouse DNA either in the flanking regions or in the introns of the IL-2 gene, since the coding regions apparently show lower degree of sequence homology as evidenced in this series of blotting analysis (see below). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: mouse (aka mus musculus)
B: biota (aka cellular organisms)
C: kingdom
D: genus
E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
F: homo sapiens (human) (aka homo sapiens)
G: mus <subgenus> (mus (aka mus <subgenus>))
H: probles
I: mouse (aka mus <genus>)
J: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
K: None of the above. | [F; A] |
<Instruct>: Given the context 'Those results suggest the presence of highly conserved sequences between human and mouse DNA either in the flanking regions or in the introns of the IL-2 gene, since the coding regions apparently show lower degree of sequence homology as evidenced in this series of blotting analysis (see below). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: kingdom
B: mus cricetus (aka cricetus cricetus)
C: suborder
D: eastern european house mouse (aka mus musculus musculus)
E: homo (humans) (aka homo)
F: mus <genus> (mice (aka mus <genus>))
G: mus musculus (house mouse) (aka mus musculus)
H: mus <subgenus> (mus (aka mus <subgenus>))
I: human (aka homo sapiens)
J: cellular organisms (biota) (aka cellular organisms)
K: None of the above. | [I; G] |
<Instruct>: Given the context 'When the PstI insert of a mouse IL-2 cDNA clone, pMIL2-20, was used as the probe, a simple pattern was
9325
Nucleic Acids Research
obtained at higher stringent condition (lane 13-17). ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: mice (aka mus sp.) (aka mus sp.)
C: mouse (aka mus musculus)
D: mouse (aka mus <genus>)
E: eastern european house mouse (aka mus musculus musculus)
F: None of the above. | [C] |
<Instruct>: Given the context 'The 3.3 kb band was similar in its size with the positive band which became detectable by probing the same DNA with the 7.0 kb human DNA probe (Fig. 1, lane 2).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: primate (aka primates)
B: human (aka homo sapiens)
C: humans (aka homo)
D: suborder
E: mammals (aka mammalia)
F: None of the above. | [B] |
<Instruct>: Given the context 'BamHI digest of the mouse DNA (Fig. 1, lane 1, 13) constantly gave a very faint signal which would correspond to a DNA larger than 15 kb. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mus musculus (house mouse) (aka mus musculus)
C: mus (aka mus <subgenus>) (aka mus <subgenus>)
D: western european house mouse (aka mus musculus domesticus)
E: mus molossinus (aka mus musculus molossinus)
F: None of the above. | [B] |
<Instruct>: Given the context 'Taken together, the results suggested the presence of a single copy gene for murine IL-2. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine]
<Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: house mouse (aka mus musculus)
C: mus <genus> (mice (aka mus <genus>))
D: mus (aka mus <subgenus>) (aka mus <subgenus>)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: None of the above. | [B] |
<Instruct>: Given the context 'On the other hand appearance of the multiple positive bands at lower stringent washing condition (lane 9-12) indicates the presence of IL-2 related sequences within the mouse genome.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus molossinus (aka mus musculus molossinus)
B: mus sp. (mice (aka mus sp.))
C: mouse (aka mus <genus>)
D: peromyscus
E: mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Screening of recombinant phaqe libraries
We next screened a gene library from partial EcoRIdigested DNA from MPC 11 cells and by using 0.8 Kbp SacI-AccI cDNA fragment as the probe and isolated 14 positive clones containing sequences specific to the mouse IL-2 gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mice (aka mus sp.) (aka mus sp.)
B: peromyscus
C: mus cricetus (aka cricetus cricetus)
D: mus molossinus (aka mus musculus molossinus)
E: mus musculus (house mouse) (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context '2. Comparison of the mouse genomic IL-2 sequence with mouse IL-2 cDNA sequence revealed that, like the human gene, the gene is divided into four exons. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: genus
B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
C: mouse (aka mus <genus>)
D: human (aka homo sapiens)
E: probles
F: macrobiotus sapiens
G: mus (aka mus <subgenus>) (aka mus <subgenus>)
H: homo (humans) (aka homo)
I: mus cricetus (aka cricetus cricetus)
J: house mouse (aka mus musculus)
K: None of the above. | [J; D] |
<Instruct>: Given the context '2. Comparison of the mouse genomic IL-2 sequence with mouse IL-2 cDNA sequence revealed that, like the human gene, the gene is divided into four exons. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus molossinus (aka mus musculus molossinus)
B: mouse (aka mus <genus>)
C: kingdom
D: human (aka homo sapiens)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: mus domesticus (aka mus musculus domesticus)
G: house mouse (aka mus musculus)
H: suborder
I: humans (aka homo)
J: this
K: None of the above. | [G; D] |
<Instruct>: Given the context 'Restriction map and sequencing strategy of mouse IL-2 gene.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: eastern european house mouse (aka mus musculus musculus)
B: peromyscus
C: mouse (aka mus musculus)
D: mus cricetus (aka cricetus cricetus)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: None of the above. | [C] |
<Instruct>: Given the context 'Horizontal lines indicate the length of mouse DNA inserted into the X phage Charon 4A or plasmid subclones. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: peromyscus
B: house mouse (aka mus musculus)
C: western european house mouse (aka mus musculus domesticus)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mice (aka mus <genus>) (aka mus <genus>)
F: None of the above. | [B] |
<Instruct>: Given the context 'As seen also in the murine IL-2 cDNA, there is an unusual repeat of CAG triplet coding for 12 glutamine residues in a row in the first exon.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [murine]
<Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: mus sp. (mice (aka mus sp.))
C: mouse (aka mus musculus)
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: mus cricetus (aka cricetus cricetus)
F: None of the above. | [C] |
<Instruct>: Given the context 'As far as the available sequence data are concerned, it seems that, despite their identical location, intron sequences are distinctly dissimilar except for the junction regions between the human and mouse IL-2 genes. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: eutherian mammals (aka eutheria)
B: mice (aka mus sp.) (aka mus sp.)
C: western european house mouse (aka mus musculus domesticus)
D: mus <subgenus> (mus (aka mus <subgenus>))
E: this
F: human (aka homo sapiens)
G: eastern european house mouse (aka mus musculus musculus)
H: mammals (aka mammalia)
I: mouse (aka mus musculus)
J: birds (aka aves)
K: None of the above. | [F; I] |
<Instruct>: Given the context 'As far as the available sequence data are concerned, it seems that, despite their identical location, intron sequences are distinctly dissimilar except for the junction regions between the human and mouse IL-2 genes. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: probles
B: mus domesticus (aka mus musculus domesticus)
C: cellular organisms (biota) (aka cellular organisms)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: homo sapiens (human) (aka homo sapiens)
F: mus <genus> (mice (aka mus <genus>))
G: homo (humans) (aka homo)
H: mus molossinus (aka mus musculus molossinus)
I: mus musculus (house mouse) (aka mus musculus)
J: animals (aka metazoa)
K: None of the above. | [E; I] |
<Instruct>: Given the context 'As far as the available sequence data are concerned, it seems that, despite their identical location, intron sequences are distinctly dissimilar except for the junction regions between the human and mouse IL-2 genes. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; mouse]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mus <genus> (mice (aka mus <genus>))
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: probles
E: animals (aka metazoa)
F: mus molossinus (aka mus musculus molossinus)
G: cellular organisms (biota) (aka cellular organisms)
H: homo (humans) (aka homo)
I: mus domesticus (aka mus musculus domesticus)
J: None of the above. | [J; A] |
<Instruct>: Given the context 'There are two potential poly (A) addition signals within the mouse gene (nucleotide positions 793 - 798 and 924 - 929 in Fig. 3 ) and, based on our sequence data for various cDNA clones, both signals seem to function and give rise to heterogeneous termini of the mRNA in the LBRM-33 cells (16).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: peromyscus
B: mouse (aka mus musculus)
C: mus cricetus (aka cricetus cricetus)
D: eastern european house mouse (aka mus musculus musculus)
E: mice (aka mus sp.) (aka mus sp.)
F: None of the above. | [B] |
<Instruct>: Given the context 'We have also determined the sequence of about 500 bp of 5'-flanking region of mouse IL-2 gene, since (i) promoter/regulatory sequences are located in this region in many other genes of eukaryotes and (ii) this region appeared to contain sequences which show strongest cross-hybridization between human and mouse DNA around the IL-2 gene (Fig. 1).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: western european house mouse (aka mus musculus domesticus)
B: probles
C: mouse (aka mus musculus)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: placental mammals (aka eutheria)
F: kingdom
G: mus cricetus (aka cricetus cricetus)
H: mus <genus> (mice (aka mus <genus>))
I: human (aka homo sapiens)
J: suborder
K: None of the above. | [C; I] |
<Instruct>: Given the context 'We have also determined the sequence of about 500 bp of 5'-flanking region of mouse IL-2 gene, since (i) promoter/regulatory sequences are located in this region in many other genes of eukaryotes and (ii) this region appeared to contain sequences which show strongest cross-hybridization between human and mouse DNA around the IL-2 gene (Fig. 1).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
B: house mouse (aka mus musculus)
C: animals (aka metazoa)
D: peromyscus
E: eastern european house mouse (aka mus musculus musculus)
F: human (aka homo sapiens)
G: birds (aka aves)
H: kingdom
I: mus molossinus (aka mus musculus molossinus)
J: macrobiotus sapiens
K: None of the above. | [B; F] |
<Instruct>: Given the context 'Nucleotide sequence of mouse IL-2 gene. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: mouse (aka mus <genus>)
C: mouse (aka mus musculus)
D: peromyscus
E: eastern european house mouse (aka mus musculus musculus)
F: None of the above. | [C] |
<Instruct>: Given the context 'CACCCCCTTAAAGAAAGGAGGAAAAACTGTTTCATACAGAAGGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAA
-200 -150
CCAAGAGGGATTTCACCTAAATCCATTCAGTCAGTATAT GGGGTTTAAACAAATTCCAGAGAGTCATCAGAAGAGGAAAAACAAAGGTAA CAAAGAGGGATTTCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAA AAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAA
-100 -50
TACTTTCTGCCACACAGGTAGACTCTTTTGAAAATATGTGTXATATTAAAACATCGTGACACCCCCATATiXrTCCAGCATTAACAG TGTTTTTT CAGACAGGTAAAGTC TTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAG ATAAGCCTCCCATGCTGAAGAGCTGCCTATCACCCTTGCTAATCACTCCTCACAGTGACCTCAAGTCCTGCAGGCATG Mouse rTATGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACACACAGTAACCTCAACTCCTGCCACTATG Human
Fig. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: house mouse (aka mus musculus)
B: homo sapiens (human) (aka homo sapiens)
C: suborder
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: mice (aka mus <genus>) (aka mus <genus>)
F: kingdom
G: macrobiotus sapiens
H: mus (aka mus <subgenus>) (aka mus <subgenus>)
I: animals (aka metazoa)
J: mus molossinus (aka mus musculus molossinus)
K: None of the above. | [A; B] |
<Instruct>: Given the context 'CACCCCCTTAAAGAAAGGAGGAAAAACTGTTTCATACAGAAGGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAA
-200 -150
CCAAGAGGGATTTCACCTAAATCCATTCAGTCAGTATAT GGGGTTTAAACAAATTCCAGAGAGTCATCAGAAGAGGAAAAACAAAGGTAA CAAAGAGGGATTTCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAA AAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAA
-100 -50
TACTTTCTGCCACACAGGTAGACTCTTTTGAAAATATGTGTXATATTAAAACATCGTGACACCCCCATATiXrTCCAGCATTAACAG TGTTTTTT CAGACAGGTAAAGTC TTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAG ATAAGCCTCCCATGCTGAAGAGCTGCCTATCACCCTTGCTAATCACTCCTCACAGTGACCTCAAGTCCTGCAGGCATG Mouse rTATGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACACACAGTAACCTCAACTCCTGCCACTATG Human
Fig. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: animals (aka metazoa)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: biota (aka cellular organisms)
D: primate (aka primates)
E: mice (aka mus sp.) (aka mus sp.)
F: mus (aka mus <genus>) (aka mus <genus>)
G: human (aka homo sapiens)
H: suborder
I: mus molossinus (aka mus musculus molossinus)
J: mouse (aka mus musculus)
K: None of the above. | [J; G] |
<Instruct>: Given the context 'CACCCCCTTAAAGAAAGGAGGAAAAACTGTTTCATACAGAAGGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAA
-200 -150
CCAAGAGGGATTTCACCTAAATCCATTCAGTCAGTATAT GGGGTTTAAACAAATTCCAGAGAGTCATCAGAAGAGGAAAAACAAAGGTAA CAAAGAGGGATTTCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAA AAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAA
-100 -50
TACTTTCTGCCACACAGGTAGACTCTTTTGAAAATATGTGTXATATTAAAACATCGTGACACCCCCATATiXrTCCAGCATTAACAG TGTTTTTT CAGACAGGTAAAGTC TTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAG ATAAGCCTCCCATGCTGAAGAGCTGCCTATCACCCTTGCTAATCACTCCTCACAGTGACCTCAAGTCCTGCAGGCATG Mouse rTATGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACACACAGTAACCTCAACTCCTGCCACTATG Human
Fig. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mouse (aka mus musculus)
C: suborder
D: primate (aka primates)
E: biota (aka cellular organisms)
F: mus (aka mus <genus>) (aka mus <genus>)
G: mus molossinus (aka mus musculus molossinus)
H: mice (aka mus sp.) (aka mus sp.)
I: animals (aka metazoa)
J: None of the above. | [B; J] |
<Instruct>: Given the context 'Comparison of 5'-flanking regions of mouse and human IL-2 genes. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: this
B: mouse (aka mus musculus)
C: kingdom
D: mus molossinus (aka mus musculus molossinus)
E: primate (aka primates)
F: mus sp. (mice (aka mus sp.))
G: mouse (aka mus <genus>)
H: human (aka homo sapiens)
I: placental mammals (aka eutheria)
J: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
K: None of the above. | [B; H] |
<Instruct>: Given the context 'Comparison of 5'-flanking regions of mouse and human IL-2 genes. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; human]
<Options>: A: species
B: house mouse (aka mus musculus)
C: mus sp. (mice (aka mus sp.))
D: mus (aka mus <genus>) (aka mus <genus>)
E: this
F: humans (aka homo)
G: birds (aka aves)
H: homo sapiens (human) (aka homo sapiens)
I: western european house mouse (aka mus musculus domesticus)
J: peromyscus
K: None of the above. | [B; H] |
<Instruct>: Given the context 'We have isolated recombinant clones for mouse IL-2 gene from a phage Charon 4A/mouse genomic DNA library and determined the entire sequence of the gene except for the sequence of the internal portion of the second and third introns. ', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mus <subgenus> (mus (aka mus <subgenus>))
C: mus cricetus (aka cricetus cricetus)
D: mice (aka mus <genus>) (aka mus <genus>)
E: mus domesticus (aka mus musculus domesticus)
F: None of the above. | [A] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.