article stringlengths 0 826k | abstract stringlengths 174 4.34k |
|---|---|
human dignity has always been considered important and its maintenance has been emphasized ; it is recognized as the basis for human rights .
it is so important that it is a subject long debated in medical professions , particularly nursing , and its maintenance has always been emphasized . because patients are vulnerable , the need for respect to their human dignity is doubled .
preservation and promotion of patient dignity make them feel more satisfied and that they are valued by their healthcare systems .
the word dignity is derived from the latin words dignitus meaning competence and dingus meaning value .
a simple definition of human dignity is the intrinsic value that is given one by virtue of being human and which is formed through one s individual character and relations with others .
illness , disability , need , reduced power and authority , lack of privacy , medical treatments and hospitalization can affect one s intrinsic value . limiting human dignity can affect the body , spirit , morality , and spirituality of clients , and it puts them at risk of stress and discomfort .
human dignity is a major concern of the healthcare system ; yet , it is somewhat unknown .
studies have shown that maintaining patient dignity depends on knowledge of the factors influencing it . in their 2008 qualitative study ,
matiti et al . showed that six factors influence dignity : privacy , confidentiality of information , communication and information , selection , control of and interference in care and respect .
the royal college of nursing states the physical environment , corporate culture and attitude and behavior of staff may affect dignity numerous studies state that maintenance of dignity in a healthcare setting is influenced by a group of factors such as context , social and cultural background and beliefs . in his study ,
turnock at an action research study showed that awareness among the staff and nurses of the factors that promote patient dignity prompts all personnel to better maintain the personal dignity of patients .
manookian at a qualitative content analysis study showed that four themes including persona , communication behaviors , and conduct of the staff are the factors affecting patient dignity .
various studies have mentioned factors affecting patient dignity , but little research has examined the facilitator and threatening dignity in hospitalized patients with heart diseases . in iran , like many other countries , cardiovascular disease is the most common cause of death .
it influences patients , families , and society and causes social isolation , reduced life quality , and dissatisfaction in patients .
van gennip in 2013 at a qualitative study showed illness related conditions do not affect the patients dignity directly but indirectly they affect the way patients perceive themselves .
furthermore , studies have shown that respecting the dignity of patients with heart disease increases the satisfaction and confidence in the care , reduces the length of a hospital stay , and increases the patient s mental health .
considering the fact that recognition of facilitators and threats the dignity of patients is dependent on the context and also this process is the interaction between persons , it seems that the paradigm of qualitative research for this study is necessary .
therefore , this study investigated facilitator and the factors threatening the dignity of the patients with heart disease in qualitative method .
the current study is part of a larger study related to a doctoral dissertation which was done as a qualitative approach using conventional content analysis to identify the facilitators and threats to the dignity of patients with heart disease .
qualitative content analysis is one of the approaches of qualitative research and also qualitative data analysis .
content analysis method contains a package of techniques for systematic text analysis which was suitable for this research because it is an unobtrusive technique of analysis that can simply accommodate a great amount of data .
participants in this study were 20 cardiac patients admitted to hospitals related to kerman university of medical sciences in iran and 5 personnel in 2014 .
sampling was done using purposeful method with an attempt to observe maximum variations in terms of demographic characteristics and the type of heart disease . for the purpose of maximum variation in participants
, the researchers made an attempt to interview with the participants who could deliver wide insights about the study question .
inclusion criteria for patients included the ability to speak in the persian language and admission to the cardiac intensive care unit for more than 48 hours .
exclusion criteria were mental illness confirmed by a physician or the individual patient ; also , inclusion criteria for the staff included working in cardiac care units and desire to participate in the study data were collected in the form of a semi - structured interview .
interviews were done by a researcher familiar with interviewing technique and conducted by a research team member .
data collection was continued until saturation which occurred when a new category did not appear and until the existing categories were enriched .
interviews were done after agreement on the location and time between the interviewer and interviewee . written and verbal consent were obtained by investigators . at first , the researcher clarified the study aims and explained the benefits of the study for participants .
the researchers encouraged the participants to talk about their experiences by starting with an open - ended question : what is your perception of
do you feel dignified and why , or why not? and why do you feel dignified or not dignified? interviews were conducted at hospital or the researcher s workplace ( school of nursing and midwifery , kerman ) .
all interviews were recorded by the researcher , and then the recorded interviews were immediately after completion listened several times and typed verbatim in microsoft word , and then analyzed with an inductive style by the research team , using constant comparative method and software maxqd .
the researchers used a thematic analysis to recognize the themes within the data and find the meaningful categories , and their relation to each other and to the core concept .
data analysis was performed using the constant comparative method with inductive approach in stage : analysis began with first interview .
first , each interview was read several times , important statements were underlined ; then we determined the meaning units from the participants talks and observations , documentations , and field notes .
similar codes were merged and categorized according to similarities and suitability of the categories . review and comparison of categories were done to ensure the rigor of the codes .
finally , identification of themes associated with facilitator and threatening the dignity of the heart patients .
the researchers continued analysis until all categories were saturated ( when there were not new information on the characteristics of the category ) .
finally three themes were obtained . the study s accuracy and reliability of qualitative data , rigor ( dependability , transferability and confirm ability )
were assessed using the criteria proposed by guba and lincoln . to ensure credibility of the data , interaction and adequate collaboration
data dependability was examined using experts views , and revision was done by participants and external observers .
the researchers also tried to avoid presupposition and put their previous beliefs aside to obtain sufficient conformability .
, the ethics committee of shiraz university of medical sciences ( code of ethics k/93/261 ) approved the study .
all participants completed written informed consent forms and were assured that their information would remain confidential .
study purposes , confidentiality of data , and recording of interviews were clarified to the participants before the interviews , and their verbal agreements were obtained .
before beginning the study , the ethics committee of shiraz university of medical sciences ( code of ethics k/93/261 ) approved the study .
all participants completed written informed consent forms and were assured that their information would remain confidential .
study purposes , confidentiality of data , and recording of interviews were clarified to the participants before the interviews , and their verbal agreements were obtained .
the patients were 12 males and 8 females aged between 27 and 82 years.12 patients had suffered heart disease for more than 5 years and they had been admitted for more than 10 times in coronary care unit ( ccu ) .
the findings of this study identified three central themes affecting the dignity of the patients with heart disease : a ) care context with subthemes of human environment , and physical environment .
b ) holistic safe care with two subthemes of meeting the needs of patients in the hospital and after discharge , creating a sense of security .
c ) effective communication with two subthemes of respectful relationship and involvement of the family in health team . characteristics of participants in the study ( patients with heart disease ) mi = myocardial infarction ; acs = acute coronary syndrome characteristics of participants in the study ( staffs ) care context is an environment where heart patients are taken care of and cured .
based on their experiences , participants described the environmental conditions that affected their human dignity , including human and physical environments .
regarding the human environment , participants pointed to the conditions of the nurses personal and professional lives and the patient s individual beliefs .
one participant reported , a few days ago , nurses were speaking in the ward with each other , and i heard them .
i heard that they were not satisfied with their salary and that they had very low income .
how could i ask them to come and help me ? if they become angry .
they are right ; they are tired and living has costs and they live as we do , ( participant 5 ) .
another participant said , if one is respected , he will respect others as well , and nurses will respect them as well . despite the fact that i have diabetes and my foot has to be bandaged every day , i respect nurses , so they respect me and treat me well ,
participants stated that the lack of resources is threatening human dignity of heart patients , such as the shortage of nurses , and the shortage of homogeneous nurses .
individual circumstances of each person are the conditions that promote or threaten the dignity of patients .
a nurse said some nurses are inherently kind and others are generally cranky .
so when i come to the hospital , i ll just do my job and i only want to finish the shift .
i work because it is my duty experience of nurses is one of the facilitators of the dignity of heart patients .
physical environment is the part of the environment that includes purely physical factors ( as soil , climate , and water supply ) .
participants referred to organizational culture and comfort requirements in the physical environment and mentioned characteristics such as hospital conditions , physical and entertainment facilities .
clean environment , comfort equipment , green hospital and silence in the intensive care unit are facilitators of the patient dignity and the failure of these factors is threatening the dignity of patients .
for example , one participant said , the sounds of the air conditioner and the
utility room are not good for those who suffer from heart disease .
the workers come with bad temper , clean the room a bit , and go .
yesterday i spilled tea ; we asked several times until someone came and cleaned it ( participant 9 ) .
a system of broad or total patient care reflects the physical , emotional , social , economic , and spiritual needs patients .
safe holistic nursing is a system of comprehensive care without harm to the patient and without error .
based on their experiences , the participants of this study considered holistic care an important factor affecting the dignity of meeting the patients needs in the hospital and after discharge ; a sense of security was placed on this category .
addressing the physical psychological , social , and spiritual needs of patients facilitates the patients dignity and negligence of needs is threatening the dignity of heart patients .
meeting physical needs includes pain relief , considering the needs of the body system , and self - care training .
they take care of patients . in another hospital , you should search for a doctor . yesterday
, 7 or 8 staff members came to me ; one of them performed an electrocardiogram , one took my blood pressure ; one gave me a pill and lowered my pain .
this demonstrates that they respect human life , and in my opinion they affect dignity , ( participant 1 ) .
another participant said , when i am discharged , i need to know what to eat and where to go when i have pain .
no one will call and ask me if i m alive or dead or how it is going .
participants referred to meeting psychological needs as predicting the needs of patients , emotional support for patients and their families , and respecting the will of the patient .
i m so uncomfortable ; they should comfort me , ( participant 6 ) .
participants referred to being accepted in society as one of their social needs and considered attempting to resolve the problem as a factor affecting the patient s dignity .
for example , one participant said , the community needs to understand what it means to be a heart patient and what it s like for one who has had a heart attack .
for example , once i went to a bus stop , no one offered me a seat .
i was drenched in sweat and got tired , and then a young girl said , you are sick ; come and sit in my place. it is better to place some seats for patients in bus stations .
of course , i know it s too much to expect , but radio and tv should educate the public , ( participant 10 ) .
respect for religious duties , training in religious issues , and spiritual tranquility are factors that participants considered , and they mentioned that fulfilling such needs are among the factors affecting the patient s dignity .
i do nt know the religious orders about saying prayers for a man who lies in bed .
i can not get out of the bed ; one should teach me what the religious orders for me as a patient are ,
security is all actions that nurses and physicians do for heart patients to be safe in the hospital from any risk and medical error .
a sense of security , including physical and mental and spiritual security , is another contributor to patient s dignity , according to the participants .
care must be taken to keep them safe and not to impose mental or physical injury on them .
at least they are careful about my body , though it would be better if they pay attention to my mental status as well .
however , i know that what they do is for my good , ( participant 15 ) .
emotional security includes observing the privacy of the patient , considering his autonomy , and keeping his / her secrets . a participant reported ,
. my wife does not know anything . when i came to the hospital , i was so afraid that they would tell my wife that i m addicted .
i told the nurses that i do nt want my family to know about it ; they accepted my request and did not say anything ,
spiritual security includes meeting the spiritual needs of patients , being admitted to any hospital with any religious beliefs and practices and being allowed to do what helps them spiritually .
for example , a participant said , when i m dying , i want the hospital to bring a priest to give me peace .
i want someone to come so that i can ask him what happens after my death or what i can do to make god accept me better ,
was another reported issue that affects the patients dignity , and many participants consider it important in promoting human dignity .
having a respectful relationship with the patient and his / her family is a factor in this group ; factors such as working conditions , health staff , patient s number , patient s culture , the culture of nurses , and culture and family are also involved .
the suitable relationship between heart patients and staff that is based on mutual respect makes patients feel satisfied about hospitalization .
respectful communication and dialogue is considered important by many participants . for example , one participant said , they talked nicely with me , and they did nt let me feel strange .
they listened to my confabulation . even when they were busy , they treated me well .
nurses are better . at night when they are not busy , they come and speak with us .
some speak more , but younger nurses speak little with me , ( participant 19 )
. involvement of the family in the health team and communication with respect are two important subjects at patient dignity communication with the patient s family and accepting the family as a member of the treatment group was the factor always considered by participants .
many of them complained that their spouse is not allowed to be with them in the hospital ; because of that , after discharge , he could not be helpful .
for example , one participant said , my spouse came from a long way .
the old man heard that i m sick and he came all this way just to visit me .
they told him , visiting is forbidden in the ccu ; go and come during visiting hours. they did nt even tell him about my condition . they do nt allow us to bring cell phones so we can inform our family about us .
if they had let him visit me for a minute , it would have been very good for me , and he would be more comfortable , too ,
based on their experiences , participants described the environmental conditions that affected their human dignity , including human and physical environments .
regarding the human environment , participants pointed to the conditions of the nurses personal and professional lives and the patient s individual beliefs .
one participant reported , a few days ago , nurses were speaking in the ward with each other , and i heard them .
i heard that they were not satisfied with their salary and that they had very low income .
how could i ask them to come and help me ? if they become angry .
they are right ; they are tired and living has costs and they live as we do , ( participant 5 ) .
another participant said , if one is respected , he will respect others as well , and nurses will respect them as well . despite the fact that i have diabetes and
my foot has to be bandaged every day , i respect nurses , so they respect me and treat me well , ( participant 7 ) .
participants stated that the lack of resources is threatening human dignity of heart patients , such as the shortage of nurses , and the shortage of homogeneous nurses .
individual circumstances of each person are the conditions that promote or threaten the dignity of patients .
a nurse said some nurses are inherently kind and others are generally cranky .
so when i come to the hospital , i ll just do my job and i only want to finish the shift .
i work because it is my duty experience of nurses is one of the facilitators of the dignity of heart patients .
physical environment is the part of the environment that includes purely physical factors ( as soil , climate , and water supply ) .
participants referred to organizational culture and comfort requirements in the physical environment and mentioned characteristics such as hospital conditions , physical and entertainment facilities .
clean environment , comfort equipment , green hospital and silence in the intensive care unit are facilitators of the patient dignity and the failure of these factors is threatening the dignity of patients .
for example , one participant said , the sounds of the air conditioner and the
utility room are not good for those who suffer from heart disease .
the workers come with bad temper , clean the room a bit , and go .
yesterday i spilled tea ; we asked several times until someone came and cleaned it ( participant 9 ) .
a system of broad or total patient care reflects the physical , emotional , social , economic , and spiritual needs patients .
safe holistic nursing is a system of comprehensive care without harm to the patient and without error .
based on their experiences , the participants of this study considered holistic care an important factor affecting the dignity of meeting the patients needs in the hospital and after discharge ; a sense of security was placed on this category .
addressing the physical psychological , social , and spiritual needs of patients facilitates the patients dignity and negligence of needs is threatening the dignity of heart patients .
meeting physical needs includes pain relief , considering the needs of the body system , and self - care training .
they take care of patients . in another hospital , you should search for a doctor . yesterday
, 7 or 8 staff members came to me ; one of them performed an electrocardiogram , one took my blood pressure ; one gave me a pill and lowered my pain .
this demonstrates that they respect human life , and in my opinion they affect dignity , ( participant 1 ) .
another participant said , when i am discharged , i need to know what to eat and where to go when i have pain
. they should tell me this or write it and give it to my companion .
no one will call and ask me if i m alive or dead or how it is going .
participants referred to meeting psychological needs as predicting the needs of patients , emotional support for patients and their families , and respecting the will of the patient .
i m so uncomfortable ; they should comfort me , ( participant 6 ) .
participants referred to being accepted in society as one of their social needs and considered attempting to resolve the problem as a factor affecting the patient s dignity .
for example , one participant said , the community needs to understand what it means to be a heart patient and what it s like for one who has had a heart attack .
for example , once i went to a bus stop , no one offered me a seat .
i was drenched in sweat and got tired , and then a young girl said , you are sick ; come and sit in my place. it is better to place some seats for patients in bus stations .
of course , i know it s too much to expect , but radio and tv should educate the public , ( participant 10 ) .
respect for religious duties , training in religious issues , and spiritual tranquility are factors that participants considered , and they mentioned that fulfilling such needs are among the factors affecting the patient s dignity .
i do nt know the religious orders about saying prayers for a man who lies in bed .
i can not get out of the bed ; one should teach me what the religious orders for me as a patient are ,
security is all actions that nurses and physicians do for heart patients to be safe in the hospital from any risk and medical error .
a sense of security , including physical and mental and spiritual security , is another contributor to patient s dignity , according to the participants .
care must be taken to keep them safe and not to impose mental or physical injury on them .
at least they are careful about my body , though it would be better if they pay attention to my mental status as well .
emotional security includes observing the privacy of the patient , considering his autonomy , and keeping his / her secrets . a participant reported ,
when i came to the hospital , i was so afraid that they would tell my wife that i m addicted .
i told the nurses that i do nt want my family to know about it ; they accepted my request and did not say anything ,
spiritual security includes meeting the spiritual needs of patients , being admitted to any hospital with any religious beliefs and practices and being allowed to do what helps them spiritually .
for example , a participant said , when i m dying , i want the hospital to bring a priest to give me peace .
i want someone to come so that i can ask him what happens after my death or what i can do to make god accept me better ,
effective communication between the patient and the nurse was another reported issue that affects the patients dignity , and many participants consider it important in promoting human dignity . having a respectful relationship with the patient and
his / her family is a factor in this group ; factors such as working conditions , health staff , patient s number , patient s culture , the culture of nurses , and culture and family are also involved .
the suitable relationship between heart patients and staff that is based on mutual respect makes patients feel satisfied about hospitalization .
respectful communication and dialogue is considered important by many participants . for example , one participant said , they talked nicely with me , and they did nt let me feel strange .
they listened to my confabulation . even when they were busy , they treated me well .
nurses are better . at night when they are not busy , they come and speak with us .
involvement of the family in the health team and communication with respect are two important subjects at patient dignity communication with the patient s family and accepting the family as a member of the treatment group was the factor always considered by participants .
many of them complained that their spouse is not allowed to be with them in the hospital ; because of that , after discharge , he could not be helpful .
for example , one participant said , my spouse came from a long way .
the old man heard that i m sick and he came all this way just to visit me .
they told him , visiting is forbidden in the ccu ; go and come during visiting hours. they did nt even tell him about my condition . they do nt allow us to bring cell phones so we can inform our family about us .
if they had let him visit me for a minute , it would have been very good for me , and he would be more comfortable , too , ( participant 20 ) .
this exploratory study provides important visions that are extremely relevant to facilitator and threats to the human dignity of heart patients , broadly considered to be one of the essential principles of ethics .
firstly , it provides useful information to clinicians and researchers about what the facilitators and threats to human dignity of the heart patient are .
if the facilitators and threats to the patient dignity are identified , medical staff can better observe the patients dignity .
the results of this study presented a new insight toward facilitators and threats to the patient dignity and human dignity of heart patients .
the researchers have chosen heart patients , because these patients constitute a large group of patients in iran and in the world .
the majority of heart patients suffer from other chronic diseases such as chronic kidney disease , multiple sclerosis , high blood pressure , diabetes , stroke , psychiatric diseases and .
since heart disease is a chronic disease requiring frequent hospitalization , respecting these patients improves their quality of life . in this study , participants considered their experiences and presented the factors that were effective in maintaining the patient s dignity .
they referred to categories such as care context , holistic safe care , and effective communication and considered them to be the major factors in patient dignity . considering this factors
the results of this study showed that care context is a facilitator or threat to human dignity .
in fact , it includes an environment in which dignity is shaped , consisting of human , social , and physical contexts .
studies have shown that since the human environment is comprised of the individual characteristics of nurses and patients , it is a facilitator or threat in this field .
manookian , in a qualitative study done in 2013 in tehran , considered the characteristics of the personnel as an effective factor in human dignity , and he believed that if one respects oneself , he will respect others , as well .
hall in 2014 also considered that the patients character was important for patient s dignity .
of course in the current study , the human environment consisted of the personal situations of patients and nurses and the professional conditions of nurses .
other environments such as physical and social ones that include the patients environment and consider the health and comfort requirements were also considered important by the participants .
feris ( 2014 ) also considered the importance of the physical environment and environmental health in promoting human dignity and stated that a multifaceted approach is required to create a healthy physical environment to maintain the dignity of patients .
webster ( 2009 ) in a qualitative study showed that environment and cleanliness promote dignity in hospitals .
a patient who refers to a hospital expects to receive perfect care , but the care should be in the light of physical , emotional , and psychological security .
meeting the patients needs is the basic demand of them , and this should not be limited to hospitals ; it should also be brought to patients homes to further maintain their independence .
statistics show that heart patients who have had a myocardial infarction will suffer the second infarction within the first month after treatment .
thus , the importance of care and meeting the patients needs after discharge are doubled . indeed , comprehensive care is based on the patient being the central concern .
, in a study conducted in 2012 , found security to be a key point in promoting dignity .
effective and mutual communication and conversation between the nurses and medical staff and the patients and the feedback they receive are other factors considered by participants of the current study .
the education of the patient and the patient s family is formed through effective communication .
communication allows patients to easily express their concerns , and as a result , their anxiety is reduced . in a study by matiti et al . conducted in 2008 , one factor affecting dignity was found to be effective communication .
the relationship does nt always include discussion , but it includes any other communication methods .
communication in which the patient and his family are informed as to what the patient s sickness is , why certain treatments are performed , and any other information that the patient needs maintains the patient s autonomy . hall et al . , in a study to determine the factors affecting the dignity of people living in care homes , considered communication an effective factor in maintaining dignity .
borhani et al . also showed if nurses have moral sensitivity , the relationship between the nurse and the patient will be better .
the findings represent facilitator and threats to human dignity of heart patients . in this study ,
researchers effort was to certify accuracy and reliability of qualitative data , but this study had all qualitative research limitations in generalization of results .
the results of this study highlighted the facilitator and o threats to human dignity of heart patients .
this study showed that care context is important for patients dignity and includes human and physical environments ; also safe holistic care is one of the important aspects affecting the dignity of heart patients . if the staffs pay attention to care context and safe holistic care , but they do nt perform effective communication , the dignity of patients is not well observed .
thus facilitator and threat to patient dignity is under the influence of these three factors .
no doubt , respect for dignity of heart patients enhances the quality of life and quality of care provided to them .
identification of the factors facilitating and threatening the dignity of heart patients helps the staff to better respect their patients . | background : patient s dignity is an important issue which is highlighted in nursing it is an issue that is highly dependent on context and culture . heart disease is the most common disease in iran and the world .
identification of facilitator and threatening patient dignity in heart patients is vital .
this study aimed to explore facilitator and threatening patient dignity in hospitalized patients with heart disease.methods:this qualitative content analysis study was performed in 2014 in kerman , iran .
20 patients admitted to coronary care units and 5 personnel were selected using purposeful sampling in semi - structured and in depth interviews .
researchers also used documentation and field notes until data saturation .
qualitative data analysis was done constantly and simultaneously with data collectionresults : three central themes emerged : a ) care context which includes human environment and physical environment , b ) holistic safe care including meeting the needs of patients both in the hospital and after discharge , c ) creating a sense of security and an effective relationship between patient and nurse , including a respectful relationship and account the family in health team.conclusion:the results of this study showed that care context is important for patient dignity as well as physical environment and safe holistic care . |
immune reconstitution reactions are rare in pulmonary tuberculosis , especially in non - immunocompromised patients .
we present a 21 year old immunocompetent patient that developed bilateral pneumothoraces and respiratory failure as a result of immune reconstitution syndrome during treatment for pulmonary tuberculosis .
a 21-year - old male presented with fever , cough , anorexia and weight loss of 2 months duration .
he was a student , did not smoke and did not report alcohol or substance abuse .
he reported exposure to pulmonary tuberculosis as a caregiver to a sibling 18 months prior to this episode ; his sister recovered completely with 6 months of antituberculosis treatment .
tuberculin testing or isoniazid prophylaxis was not offered to the index patient according to current practice in india .
he did not raise pets and had stayed alone in a hostel for the last 4 months .
chest radiographs showed bilateral infiltrates and computed tomography [ ct , figure 1 ] showed findings suggestive of extensive pulmonary tuberculosis .
tuberculin skin testing was negative ( 6 mm with 5 tu at 72 h ) .
neelsen 's stain and supervised daily four - drug antituberculosis treatment ( isoniazid 200 mg , rifampicin 450 mg , pyrazinamide 1000 mg , ethambutol 600 mg , pyridoxine 20 mg ; weight 40 kg ) was initiated and sputum cultures and drug susceptibility for mycobacterium tuberculosis by multiple growth indicator technique ( mgit ) was requested .
nutrition counseling and four doses of 2-weekly vitamin d 100,000 i.u were administered as per unit 's protocol .
he presented with fever , worsening breathlessness , weight loss and chest pain 4 weeks after starting treatment . on examination
he was afebrile , normotensive with respiratory rate of 40 breaths / min and pulse rate of 130 beats / min .
kg / m , normal 1925 kg / m ) . respiratory examination showed reduced right - sided movements and breath sound intensity with coarse left - sided crackles .
chest radiography [ figure 1 , left ] confirmed the diagnosis of right - sided pneumothorax with increased bilateral infiltrates .
he was admitted to the intensive care unit ( icu ) with appropriate respiratory isolation ; intercostal chest drain was inserted on the right side .
there was evidence of air - leak ( cerfolio e ) from the right lung with minimal subcutaneous emphysema .
noninvasive positive pressure ventilation ( nippv ) was started ; no worsening of air - leak was noted .
repeat sputum smears showed downgrading of smears with scanty acid - fast bacilli by zeihl - neelsen 's stain .
repeat ct - chest [ figure 2 ] showed increase in cavitation , consolidation and ground - glass opacities bilaterally .
fasting blood glucose was 87 mg / dl and human immunodeficiency virus elisa was negative and there was no cd4 lymphocytopenia .
arterial blood gas analysis showed corrected hypoxemia and respiratory alkalosis ( ph 7.42 , po2 78 mm hg on fio20.4 , pco228 mm hg , hco322 meq / l ) .
he was continued on four - drug antituberculosis treatment ; further doses of vitamin d were not administered .
he developed contralateral pneumothorax on the 2 day of admission and worsened hypoxemia needing mechanical ventilation .
urgent left intercostal tube drainage was performed and air - leak ( cerfolio i ) was noticed on the left side also .
high - resolution computed tomography of the chest at diagnosis showing a large right upper lobe cavity ( right ) and extensive random nodules in bilateral lower lobes ( right ) high - resolution computed tomography of the chest after 1-month of treatment showing increase in cavitation and new - onset consolidation and ground glass appearance bilaterally in the upper lobes ; bilateral pneumothoraces and intercostal drains are also seen laboratory values during icu admission of index patient
the differential diagnosis of a new or worsening finding in a patient with tuberculosis on treatment includes wrong diagnosis ( if diagnosis not microbiologically confirmed ) , an improper regimen , noncompliance , drug - resistant m. tuberculosis , nontuberculosis - mycobacterial disease ( hiv - aids ) , super - infection with bacteria or pneumocystis jerovicii , drug hypersensitivity and immune reconstitution .
given the reported rarity of immune reconstitution in hiv - negative pulmonary tuberculosis , we measured cytokines ( bioplex cytokine assay kit ; biorad ) and t cell subsets and activation markers by flow cytometry [ facs cantou ii , beckton dickinson , table 1 ] .
the strong interferon - g responses to rd1 antigens ( quantiferon - gold ) favor the diagnosis of immune reconstitution syndrome ( iris ) .
immune reconstitution is defined as development of new lesions or clinical and/or radiological worsening of preexisting ( tuberculosis ) lesions not attributable to the normal course of disease in a patient ( with tuberculosis ) initially improving on ( antituberculosis ) treatment .
immune reconstitution is associated with a wide spectrum of pathogens , most commonly mycobacteria , herpes , and deep fungal infections .
it has been reported to complicate treatment in 836% of hiv - infected patients with tuberculosis .
while less is known about immune reconstitution in pulmonary tuberculosis in non - hiv settings , it has been reported in up to 2.4% of patients .
immune reconstitution in non - hiv setting occurs more commonly in extra - pulmonary tuberculosis and in patients with anemia , malnutrition , hypoalbuminemia and lymphocytopenia at baseline .
immune reconstitution occurs at varied intervals with a median of 11 - 46 days after initiation of antituberculosis therapy .
radiological findings suggestive of immune reconstitution in pulmonary tuberculosis includes new or worsening infiltrates and endobronchial lesions , new pleural effusions , new / worsening cavitation and acute respiratory syndrome .
findings suggestive of immune reconstitution in extra - pulmonary tuberculosis include new or enlarging neurological lesions , new or enlarging soft tissue masses and pleural effusions .
paradoxical reactions have been attributed to immunological causes such as the strengthening of the host 's delayed hypersensitivity response , a decrease in suppressor mechanisms as a consequence of increased exposure to mycobacterial antigens secondary to mycobactericidal chemotherapy .
recent consensus statements of hiv - related immune reconstitution have stressed that the diagnosis should be made on clinical grounds and that viral load and cd4 assays are not routinely needed .
treatment of immune reconstitution is controversial ; treatment varies from observation , analgesics , nonsteroidal antiinflammatory drugs and steroids depending on the severity of the clinical syndrome .
surgical drainage may be necessary in extra - pulmonary tuberculosis . in scenarios with high - risk for immune reconstitution
, a clinical visit must be scheduled and patients counseled appropriately . in the index patient , in view of isolation of pan - sensitive m. tuberculosis , good compliance , down - graded smears and negative cultures with therapy and strongly suggestive serological responses , a diagnosis of iris was considered and 20 mg prednisolone was administered daily .
he improved symptomatically with resolution of fever and constitutional symptoms , weight gain and resolution of right - sided alveolo - pleural fistula .
he continued to have left - sided alveolo - pleural fistula requiring thoracotomy and stapling at 4 months of treatment [ figure 3 , right ] .
composite mage of chest radiographs with left , at initial pneumothorax and respiratory failure showing bilateral extensive upper lobe infiltrates and right pneumothorax with intercostals drain .
the image on the right at end of treatment shows expanded bilateral lungs with residual fibrosis in the right upper zone | we present a young immunocompetent male with diagnosed sputum culture - positive tuberculosis on intensive phase with observed daily four - drug antituberculosis therapy .
he presented at 1-month of treatment with sequential bilateral pneumothoraces , increase in cavitation and consolidation and respiratory failure .
repeat smears for acid - fast bacilli had downgraded , and cultures were negative .
quantiferon - gold ( initially negative ) was now strongly positive .
a diagnosis of possible immune reconstitution syndrome was considered and 0.25 mg / kg / day oral steroids administered .
we also discuss an approach to differential diagnosis of a patient worsening on treatment for microbiologically confirmed tuberculosis in this manuscript . |
the online version of this article ( doi:10.1007/s13555 - 014 - 0055 - 0 ) contains supplementary material , which is available to authorized users .
hypertrophic scarring is caused by an imbalance between extracellular matrix ( ecm ) protein deposition and degradation .
there are many factors affecting surgical scarring such as healing of the wounds , tension , and the line of the scars .
prolonged redness and post - inflammatory pigmentation of the scar tissues cause patients to be concerned about the noticeability of scars , especially in aesthetic surgery such as lower blepharoplasty , face - lift , or breast augmentation .
apart from the use of advanced wound dressing products to accelerate wound healing , many methods are used to prevent scar formation .
pressure garments , taping , and silicone gel have been prescribed for scar prevention ; however , these methods have not been prescribed for the reduction or prevention of post - inflammatory hyperpigmentation , which is a common problem in patients with fitzpatrick type iv or v skin [ 35 ] .
it has previously been shown that herbal extracts have various effects in scar - remodeling pathways and might have scar - reduction properties [ 6 , 7 ] . the combined herbal extract gel ( chg )
is a composition of allium cepa ( 12% w / w ) , centella asiatica ( 5% w / w ) , aloe vera ( 4% w / w ) , phyllanthus emblica ( 1.5% w / w ) , and tamarindus indica ( 1.5% w / w ) extract .
this formulation was developed as it was believed that their synergistic effects would help in the prevention of scar development [ 8 , 9 ] .
only one randomized control study has been done to evaluate the efficacy of chg in preventing surgical scarring .
thus , the purpose of this study was to evaluate the efficacy of the chg in the prevention of surgical scar formation .
patients aged over 18 years , who were fitzpatrick type iii or iv skin , and had under gone bilaterally symmetrical surgical procedures at siriraj hospital ( bangkok , thailand ) were enrolled in the study .
patients with critical illnesses ( such as systemic infections or hemodynamic instability ) , major - acute illnesses , or chronic medical illnesses that can affect wound healing ( such as bleeding disorders , transplantation , diabetes , obesity , cancer , chronic renal failure , and hematologic diseases ) were excluded from the study .
pregnant patients and patients with allergic reactions to chg were also excluded from the study .
all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( institutional and national ) and with the helsinki declaration of 1975 , as revised in 2000 and 2008 .
the placebo gel was a combination of water , acrylate , c10 - 30 alkyl acrylate crosspolymer , polysorbate 20 , and fragrance , and was similar in color and consistency to that of the chg .
the containers were labeled a or b. the identity of the gels was kept blind to the evaluator ( second investigator ) and the patients .
one week after the sutures were removed , random cards were withdrawn for each site of the scars to indicate which containers ( a or b ) would be applied on the sites , chg on one scar and placebo on another scar .
application of the gels was done twice daily , once in the morning and once in the evening . during each follow - up visit
, the scars were photographed and evaluated using patient and observer scar assessment scale ( posas ) [ 1013 ] .
evaluations were done on the 2nd , 4th , 8th , and 12th week after commencing application of the gels .
the assessment consisted of the two numeric scales : the patient scar assessment scale ( psas ) , which was completed by the patient , and the observer scar assessment scale ( osas ) , which was completed by one observer [ 11 , 14 ] . the median of the total score of the posas was analyzed using the wilcoxon paired signed - rank test method
twenty patients with fitzpatrick type iii or iv skin , classified as beige to beige - with - brown tint skin color , were enrolled in this study ; however , only 17 patients completed the follow - up period .
the average age of the patients was 39.44 years and ranged from 18 to 64 years .
most of the surgical procedures in our study involved excision of nevus at both arms .
the other operations were intercostal drainage of median sternotomy at the subcostal area ( 2 cases ) and mandibular osteotomy at both angles of the chin ( 1 case ) .
the dimensions of the scars included in this study varied from 3 to 10 cm.table 1demographic datademographic data
n ( % ) sex ( n = 17 ) female13 ( 76)operation ( n = 20 ) lower blepharoplasty5 ( 25 ) excision ( excision of mole and excision of lipoma)6 ( 30 ) liposuction4 ( 20 ) breast surgery2 ( 10 ) others ( icd drainage of median sternotomy and mandibular osteotomy)3 ( 15 )
icd intercostal drainage
icd intercostal drainage the chg - treated scars showed lower psas scores compared with the placebo group in color , stiffness , thickness , irregularity , and overall scores with statistical significance at 12 weeks follow - up ( p value 0.03 , 0.04 , 0.03 , 0.04 , and 0.02 , respectively ; figs . 1 , 2 )
. the scores in pain and itching in the chg group did not significantly differ from the placebo group at 12 weeks ( p value 0.72 and 0.33 , respectively ) .
the scars in the chg group showed lower osas scores compared with the placebo group in pigmentation , thickness , and overall scores at 12 weeks ( p value 0.04 , 0.04 , and 0.04 , respectively ) .
the osas scores in vascularity , relief , and pliability in the chg group were significantly less than those in the placebo group at 8 weeks ( p value 0.03 , 0.04 , and 0.04 , respectively ) .
the efficacy of chg compared to placebo gel is demonstrated in figs . 3 and 4.fig . 1patient scar assessment scale score comparison between combined herbal extracts gel ( chg ) and placebo group at 2 , 4 , 8 , and 12 weeks follow - upfig .
2observer scar assessment scale score comparison between combined herbal extracts gel ( chg ) and placebo group at 2 , 4 , 8 , and 12 weeks follow - upfig .
3a 30-year - old female patient underwent excision nevus at both arms . at 8
weeks follow - up , psas for chg and placebo groups were 15 and 21 , respectively , and osas for chg and placebo groups were 14 and 23 , respectively . at 12 weeks follow - up , psas for chg and
placebo groups were 12 and 19 , respectively , and osas for chg and placebo groups were 12 and 21 , respectively .
chg combined herbal extracts gel , osas observer scar assessment scale , psas patient scar assessment scalefig .
4a 40-year - old female patient underwent bilateral breast reduction . at 4 weeks follow - up , psas scores for the chg and placebo groups
were 29 and 32 , respectively , and osas scores for the chg and placebo groups were 21 and 28 , respectively .
at 12 weeks follow - up , psas scores for the chg and placebo groups were 21 and 21 , respectively , and osas scores for the chg and placebo groups were 21 and 22 , respectively .
chg combined herbal extracts gel , osas observer scar assessment scale , psas patient scar assessment scale patient scar assessment scale score comparison between combined herbal extracts gel ( chg ) and placebo group at 2 , 4 , 8 , and 12 weeks follow - up observer scar assessment scale score comparison between combined herbal extracts gel ( chg ) and placebo group at 2 , 4 , 8 , and 12 weeks follow - up a 30-year - old female patient underwent excision nevus at both arms . at 8
weeks follow - up , psas for chg and placebo groups were 15 and 21 , respectively , and osas for chg and placebo groups were 14 and 23 , respectively . at 12 weeks follow - up , psas for chg and
placebo groups were 12 and 19 , respectively , and osas for chg and placebo groups were 12 and 21 , respectively .
chg combined herbal extracts gel , osas observer scar assessment scale , psas patient scar assessment scale a 40-year - old female patient underwent bilateral breast reduction . at 4 weeks follow - up , psas scores for the chg and
placebo groups were 29 and 32 , respectively , and osas scores for the chg and placebo groups were 21 and 28 , respectively . at 12 weeks follow - up , psas scores for the chg and placebo groups were 21 and 21 , respectively , and osas scores for the chg and placebo groups were 21 and 22 , respectively .
chg combined herbal extracts gel , osas observer scar assessment scale , psas patient scar assessment scale
the longest period of wound healing is the maturation phase . in this phase , surgical scars are hypervascularized , raised , and hard for 23 months after the wound has healed
if we can reduce or shorten these signs and symptoms , the patient will benefit .
patients with fitzpatrick type iii skin or above have a greater chance of developing post - inflammatory hyperpigmentation , hypertrophic scarring , and keloids than patients with fitzpatrick type i and ii skin .
many methods have been described for scar prevention , such as pressure garments , taping , and silicone gel sheets / ointment ; however , these methods have not been described for controlling post - inflammatory hyperpigmentation and the other symptoms experienced during the maturation phase .
silicone is believed to improve scarring via wound hydration and increased static charge [ 1618 ] .
these mechanisms effectively decrease the stimulation of keratinocytes , reduce cytokine production , and inhibit excessive collagen synthesis .
silicone also helps to rearrange the collagen fibers during the wound healing process via the polarization between the silicone and skin
. it has previously been demonstrated that silicone has benefits in scar reduction [ 1821 ] .
the silicone in a gel preparation is easy to use when compared with conventional silicone gel sheeting .
combination of the silicone derivative with other active compounds , such as onion extract ( which have various mechanisms ) , may also have synergistic effects in scar prevention [ 6 , 24 ] .
allium cepa ( onion ) extract , the main component of chg , is useful in reducing neoangiogenesis in hypertrophic scars and keloids , resulting in the clinical improvement of skin vascularity [ 7 , 2427 ] .
it shows an anti - inflammatory effect by inhibiting lipopolysaccharide - induced tumor - necrosis factor - alpha ( tnf- ) production .
reported that onion extract could fade scar color and the most effective therapeutic results were produced when it was combined with silicone gel sheet treatment .
several scientific reports have documented that centella asiatica has the ability to enhance wound healing . by treating with centella asiatica extract , the maturation of the scar is stimulated by the production of type i collagen .
the treatment also results in a marked decrease in the inflammatory reaction and myofibroblast production [ 30 , 31 ] .
asiaticoside , the active ingredient of centella asiatica , has an anti - scarring effect by decreasing the transforming growth factor beta-1 expression and enhancing the expression of inhibitory smad-7 [ 30 , 32 ] .
aloe vera is widely used as a traditional herbal medicine in many countries and is effective in the treatment of wounds .
some studies have shown that aloe vera extract increases the rate of healing by enhancing keratinocyte multiplication and migration , the expression of proliferation - related factors , and epidermis formation [ 33 , 34 ] .
the study by vzquez et al . reported that aloe vera could interrupt cyclooxygenase enzyme ( cox ) function and decrease the production of eicosanoid .
therefore , the combined extracts of allium cepa , centella asiatica , and aloe vera may encourage an anti - inflammatory effect .
saponin significantly stimulates angiogenesis by modifying the balance of protease / protease inhibitor secretion in human endothelial vascular cells [ 3638 ] .
phyllanthus emblica extract has antioxidant potentials as well as antimicrobial activity which can be a good therapeutic agent for accelerating the wound healing process [ 39 , 40 ] .
tamarindus indica extract and phyllanthus emblica may , therefore , have an additive effect in reducing hyperpigmentation . in the results of our study , the color , stiffness , irregularity , and overall scores in psas and pigmentation , thickness , and overall scores in osas of the chg study group showed improved scores at 12 weeks .
the scars might have less chance to develop post - inflammatory hyper - pigmentation . in this study
moreover , the sample size is quite small and there are many other variables that may affect the outcomes . further studies with larger sample sizes and longer term follow - ups are needed to confirm the benefit of this product .
combination of herbal extracts gel might be effective in the prevention of surgical scar formation .
all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( institutional and national ) and with the helsinki declaration of 1975 , as revised in 2000 and 2008 .
this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and the source are credited . | introductionthe objective of preventing surgical scar formation is to improve the quality of life for patients .
many medical products have been used in preventing hypertrophic scarring but an optimal treatment method has not been established yet . at the present ,
there are several studies demonstrating the potential of herbs in scar prevention .
the purpose of this study was to evaluate the efficacy of combined herbal extracts gel ( chg ) in the prevention of surgical scar formation.methodsall the patients who underwent bilaterally symmetric surgical procedures were selected using inclusion and exclusion criteria and were then treated with both the chg ( chg group ) and placebo gel .
each gel was applied on separate scars twice daily for 12 weeks .
the scars were photographed and evaluated using patient and observer scar assessment scale ( psas and osas , respectively).resultsthe chg - treated scars showed lower median psas scores than the placebo group in color , stiffness , thickness , irregularity , and overall scores , with statistically significant difference at 12 weeks . for osas , the scars in the chg group showed lower median scores than the placebo group in pigmentation , thickness , and overall scores at 12 weeks . the median osas scores in vascularity , relief , and pliability differed from placebo group and were statistically significant at 8 weeks .
no side effects were observed in either group.conclusionthe chg might be effective in the prevention of surgical scarring.electronic supplementary materialthe online version of this article ( doi:10.1007/s13555 - 014 - 0055 - 0 ) contains supplementary material , which is available to authorized users . |
indicators of operative outcomes could be used to identify underperforming surgeons for support and training .
pancreatic resection is one of the most common major operative procedures performed by hepato - pancreato - biliary ( hpb ) surgeons .
as the procedure is complex with a high associated morbidity and mortality , it may be suitable for comparing the operative performances of hpb surgeons .
the major indication for pancreatic resection is pancreatic cancer , the seventh most common cause of cancer - related mortality in the world , resulting in approximately 330 000 deaths worldwide annually .
pancreatic cancer is a biologically aggressive cancer , which is relatively resistant to chemotherapy and radiotherapy and has a high rate of local and systemic recurrence [ 24 ] . in early pancreatic cancer ( with no invasion of adjacent structures such as the superior mesenteric vein , portal vein , or superior mesenteric artery or distal metastases ) , surgical resection
is generally considered the only treatment with the potential for long - term survival and possibility of cure in people likely to withstand major surgery . the overall five - year survival after radical resection ranges from 7% to 25% [ 49 ] , with a median survival of 11 to 15 months . with adjuvant chemotherapy , median survival after radical resection
however , it should be noted that about half of the patients presenting with pancreatic cancer will have metastatic disease and one - third have locally advanced unresectable disease , leaving about 10% to 20% suitable for resection .
another major indication for pancreatic resection is chronic pancreatitis , a condition associated with long - standing and progressive inflammation of the pancreas resulting in destruction and replacement of pancreatic tissue with fibrous tissue leading to exocrine pancreatic insufficiency and endocrine pancreatic insufficiency ( diabetes ) .
the annual incidence of chronic pancreatitis ranges from 1.5 to 7.9 per population of 100,000 [ 1418 ] .
the prevalence of chronic pancreatitis ranges from 17 to 49 per population of 100,000 [ 15 , 16 , 18 ] .
the annual mortality rate attributable to chronic pancreatitis is around 1 to 4 per million people [ 15 , 17 ] .
there is no consensus among experts for selecting patients for surgical management but pancreatic pain and other local complications are the major indications for surgical treatment .
other indications for pancreatic resection include ampullary cancers , distal common bile duct cancers , duodenal cancers , intraductal papillary mucinous neoplasm , and neuroendocrine tumours [ 2023 ] .
pancreatic resection is in the form of pancreaticoduodenectomy for cancers of the head of the pancreas , ampullary cancers , distal common bile duct cancers , and duodenal cancers and distal pancreatectomy for cancers of the body and tail of the pancreas .
surgical excision for chronic pancreatitis can be performed by pancreaticoduodenectomy ( standard whipple 's operation or pylorus preserving pancreaticoduodenectomy ) or by duodenum preserving pancreatic head resection [ 19 , 26 ] .
duodenum preserving pancreatic head resection involves resection of the pancreatic head without excision of duodenum .
the latter involves a drainage procedure anastomosing the duct in the pancreatic remnant to the jejunum by longitudinal pancreatojejunostomy in addition to pancreatic head excision leaving behind a cuff of pancreas on the duodenal wall . in general ,
after resection of the body and tail of the pancreas , the cut surface of the pancreatic remnant ( pancreatic stump ) is closed using staples or sutures . in england ,
individual surgeon 's results of surgery - related complications are being published as part of the drive by nhs england to improve transparency [ 30 , 31 ] and to allow patients to make informed decisions .
this allows patients to identify outliers ( a consultant whose clinical outcomes data lies outside the expected range given the national average ) and make an informed decision as to whether they would like to be treated by that particular surgeon .
the feasibility of identifying hpb surgeons with poor operative performance based on the results of pancreatic resections is not known but it may be the most suited for comparison as the procedures are common and complex and are generally associated with a high morbidity and mortality .
the main objectives of this research are to conduct a systematic review of the recent results of pancreatic resections so that it is possible to establish a benchmark for surgeon 's performance based on international standards and to assess the feasibility of comparing the results of pancreatic resections between surgeons based on the results of the systematic review .
all studies that reported on pancreatic resections irrespective of whether they were pancreaticoduodenectomies or distal pancreatectomy , the reason for the pancreatic resection ( cancer or benign disease ) , the type of access ( open or laparoscopic ) , the type of anastomosis ( pancreaticogastrostomy or pancreatojejunostomy ) , and the postoperative care provided to the patients were included .
only studies including at least 100 patients , published as full texts or conference abstracts in the previous 10 years from the search date ( february 2014 ) , and reporting one or more of the primary outcomes ( 30-day or in - hospital mortality ) or secondary outcomes ( 12-month mortality , proportion of people with complications , number of complications , the classification system used to report the complications , operating time , and length of hospital stay ) were included in the review to ensure that only the recent results on a reasonable number of patients were included in the analysis .
studies were identified by searching medline , embase , and the cochrane library using the medical subject headings ( mesh ) search terms pancreatectomy ,
equivalent free text search terms were used and equivalent search strategies were used in other databases .
full texts were obtained for references that at least one author identified as potentially meeting the inclusion criteria .
further selection was made independently by two authors ( clare toon and bhavisha virendrakumar ) by reviewing the full texts .
all differences were resolved by discussion and arbitration by another author ( kurinchi gurusamy ) .
data on patient characteristics including the demographic details , case - mix ( risk prognostic models or score to take into account the different anaesthetic and surgical risks in patients ) , and outcomes were extracted by two authors ( clare toon and bhavisha virendrakumar ) independently .
foreign language articles were translated to english before data extraction . when significant overlap of patients between two or more reports was identified based on the authors , centres , and the time period , the report that contained maximum information with regard to the outcomes
all differences in data extraction were resolved by discussion and arbitration by another author ( kurinchi gurusamy ) .
meta - analysis was performed using statsdirect statistical software using a random - effects model .
heterogeneity was assessed by higgin 's i - square and chi - square test for heterogeneity . despite exploration of heterogeneity by various subgroup analyses including the reason for pancreatic resection ( cancer versus other causes ) , type of resection ( pancreaticoduodenectomy versus distal pancreatic resection ) , and method of access ( laparoscopic versus open access ) , the data available from the studies were insufficient to allow meaningful subgroup analyses .
the short - term mortality and complications which would have been attributable to an individual surgeon for a hypothetical cohort of people undergoing pancreatic resection were calculated based on the summary estimate of the meta - analysis , the lower quartile , and the upper quartile of the proportions observed for these outcomes in the systematic review , thus extrapolating the results of the meta - analysis to an average surgeon .
the 95% and 99.8% confidence intervals of these outcomes were calculated using the wilson score method with continuity correction for samples sizes of 50 , 100 , and 200 ( approximately 1 pancreatic resection a week , 2 pancreatic resections a week , and 4 pancreatic resections a week ) .
proportions that lay outside the upper 95% and 99.8% confidence limits were considered as outliers with a one - sided false positive rate of 2.5% and 0.1% , respectively .
the 95% and 99.8% confidence limits are equivalent to the surgeon having results which are different by two standard deviations and three standard deviations from the average results expected based on the data ( the benchmark ) .
one - sided false positive rate was calculated since the upper limit of the confidence interval was the main interest of the study ; that is , if surgeon - specific mortality and complications were lower than the confidence limits , it was not of any interest since these surgeons are better than other surgeons and there are no concerns on their operative performance .
a total of 7193 references were identified by database search . after removing duplicate citations , a total of 6268 unique references
a total of 6 full texts were excluded ( 4 studies had less than 100 patients in total [ 6669 ] ; one reference was a comment on an excluded article ; and one study did not contain any outcomes included in this review ) .
five references were duplicate reports of other studies or contained a significant proportion of patients included in other reports [ 6165 ] .
data from these studies was not included in the analysis to avoid the same patients being counted multiple times . in total ,
30 studies reporting on 10712 patients were eligible for inclusion in this review [ 2023 , 3560 ] .
the number of patients included in each study , the number and proportion of patients with malignancy , the mean age of patients , the number and proportion of female patients , and different groups within the cohort as reported by the study authors have been tabulated in table 1 . the number of patients included in each study varied from 100 to 2610 patients .
three studies included only patients with chronic pancreatitis [ 36 , 38 , 53 ] .
the mean age of patients reported in the studies ranged from 42 years to 68 years .
case - mix was assessed using surgical apgar score ( sas ) in one study .
the surgical details of patients in terms of the surgeries and the surgical access included in the studies have been tabulated in table 2 .
only three studies included patients undergoing laparoscopic pancreatic resection [ 20 , 22 , 41 ] .
it is likely that most of the patients or all the patients in the other studies underwent open pancreatic resection .
short - term mortality ( 30-day or in - hospital mortality ) was reported in 21 studies including 6727 patients [ 21 , 23 , 35 , 36 , 38 , 39 , 41 , 42 , 4448 , 5055 , 58 ] .
the 30-day or in - hospital mortality ranged between 0.6% and 10.6% ( lower quartile = 1.6% ; upper quartile = 4.7% ) .
the average mortality was 3.1% ( 95% ci 2.4% to 3.9% ; i
= 59.6% ) .
there was no evidence of publication bias by egger 's regression test ( p = 0.1866 ) .
depending upon the proportion of short - term mortality used ( the meta - analysis summary estimate , lower quartile , or upper quartile ) , sample size ( 50 , 100 , or 200 ) , and the false positive rate ( 2.5% versus 0.1% for a surgeon to be wrongly identified as an outlier ) , a surgeon will be called an outlier only when the surgeon - specific mortality is several times the average mortality ( table 3 ) .
for example , the surgeon - specific mortality should be more than 5 times the average mortality before he or she can be identified as an outlier with 0.1% false positivity rate ( i.e. , results lie outside three standard deviations of the average results expected from a surgeon ) if he or she performs 50 surgeries a year .
twelve - month mortality was reported in 7 studies including 1549 patients [ 22 , 36 , 40 , 49 , 56 , 57 , 59 ] .
the 12-month mortality ranged between 0.0% and 8.2% ( lower quartile = 0.9% ; upper quartile = 3.3% ) .
the average mortality was 2.2% ( 95% ci 0.7% to 4.5% ; i
= 83.7% ) .
there was no evidence of publication bias by egger 's regression test ( p = 0.1174 ) .
five studies reported complications using the clavien - dindo method [ 72 , 73 ] of classification of complications [ 20 , 37 , 39 , 48 , 60 ] .
two studies used common terminology criteria for adverse events system of classification of complications [ 50 , 57 ] .
the proportion of people with complications was reported in 23 studies including 6712 patients [ 20 , 21 , 23 , 3541 , 43 , 4550 , 52 , 5457 , 60 ] . the proportion of people with complications ranged between 3.3% and 100.0% ( lower quartile = 38.3% ; upper quartile = 53.4% ) .
the average proportion of people with complications was 47.0% ( 95% ci 36.0% to 59.0% ; i
= 98.9% ) .
there was significant publication bias as denoted by egger 's regression test ( p = 0.0037 ) with the funnel plot suggesting that studies with lower complication proportions were more likely to be published .
with regard to comparing the performance of surgeons , a surgeon will be identified as an outlier with 0.1% false positive rate when the proportion of patients who develop complications following surgery by him or her is 1.4 times that of the average even if he or she performs 50 surgeries a year as shown in table 3 .
the number of complications ( as opposed to the proportion of people with complications ) was reported in 18 studies including 4763 patients [ 22 , 35 , 37 , 38 , 40 , 42 , 4449 , 52 , 54 , 55 , 5759 ] .
the number of complications per 100 patients ranged between 40 and 132 ( lower quartile = 61 per 100 patients ; upper quartile = 95 per 100 patients ) .
the numbers of complications per 100 patients in individual studies are shown in figure 5 .
the average number of complications per 100 patients was 80 ( 95% ci 70 to 90 ; i
= 94.3% ) .
there was no evidence of publication bias by egger 's regression test ( p = 0.4189 ) .
the average operating time was reported as mean or median in 22 studies including 5475 patients [ 2022 , 36 , 3941 , 4449 , 5260 ] .
a meta - analysis was not performed because of insufficient data ( i.e. , mean and standard deviation were not reported adequately in many studies ) . the mean or median operating time in the studies ranged between 230 minutes and 492 minutes ( median = 337 minutes ; lower quartile = 279 minutes ; upper quartile = 419 minutes ) .
the average hospital stay was reported as mean or median in 24 studies including 7385 patients [ 2023 , 35 , 36 , 38 , 4043 , 4548 , 5052 , 54 , 55 , 5760 ] . as for operating time
the mean or median hospital stay in the studies ranged between 6 days and 31 days ( median = 15 days ; lower quartile = 11 days ; upper quartile = 17 days ) .
in this systematic review and meta - analysis , the recent results of pancreatic resections have been reviewed . despite significant advances in anaesthetic and surgical techniques in the recent years
the average 30-day or in - hospital mortality after pancreatic resection was approximately 3% ( figure 2 ) and approximately 47% of patients undergoing pancreatic resection develop one or more complications ( figure 4 ) .
however , there was significant variation in the mortality and the complications as evidenced by the i
values which demonstrated substantial statistical heterogeneity .
the average 12-month mortality was 2.2% ( figure 3 ) which was less than the average 30-day mortality of 3.1% .
this is not clinically possible but was observed in this systematic review because of different studies being included for the different time points .
one possible reason for this observed heterogeneity in the results is the inclusion of different types of surgeries in different studies .
another possible reason is that the patients included in the different studies had different comorbidities and there was variation in the technical difficulty of surgery ( case - mix ) .
use of prognostic models is one of the commonly used methods to adjust for case - mix .
a number of prognostic models are available for risk adjustment in pancreatic resections , although the accuracy of these models has not been assessed systematically .
only one of the studies included in this review considered a risk prognostic model to adjust for case - mix . while the authors used surgical apgar score as the risk prognostic model , it was not reliable in this study .
prognostic models to adjust for case - mix are essential for comparative audit between specialists to ensure that surgeons are not penalised for accepting to operate on high - risk patients where there is evidence of potential patient benefit .
in addition , adequate adjustment for the case - mix is necessary to allow indirect comparison of results obtained in different studies .
thus , a reliable method of adjustment for case - mix ( risk prognostic model ) is necessary for pancreatic resections . with regard to complications , in addition to the types of pancreatic resections and case - mix contributing to the heterogeneity in the estimates obtained in the different studies ,
while the mortality rate of 3% is a high perioperative mortality rate , it does not allow comparison of the surgical performance as the surgeon - specific mortality has to be more than 5 times the average mortality before the surgeon is identified as an outlier with 0.1% false positive rate if he or she performs 50 pancreatic resections a year ( table 3 ) .
fifty pancreatic resections per year equates to an average of one resection a week and few surgeons are likely to perform more than this .
thus , using short - term mortality does not appear to be a sensitive way of comparing the performance of hpb or pancreatic surgeons .
if , on the other hand , complication rates were used to compare surgeons , an outlier will be identified if the proportion of patients who develop complications following surgery by him or her is only 1.4 times the average complication rates ( with 0.1% false positive rate if he or she performs 50 pancreatic resections a year ) .
an evaluation of complication rates following pancreatic resection would therefore allow the comparison of operative performance of surgeons with a reasonable sensitivity . however , the major problem with using complications as the benchmark for assessing surgeons is that they will also depend on the case - mix of the patient cohort .
in addition , none of the current classification systems for complications adequately distinguish between complications that result in permanent disability as opposed to those that do not result in permanent disability .
while some of these systems include reinterventions and requirement for organ support while classifying complications [ 7274 ] , the cost implications of these individual complications to the healthcare funder are not clear .
thus , the existing systems of classification of complications which have been applied to major pancreatic surgery do not appear to be patient outcome oriented or funder oriented and can not therefore be used as benchmark for assessing surgical performance .
health - related quality of life ( hrqol ) using a validated quality of life scale may be a suitable way of comparing the long - term outcomes of surgeons but is not sensitive enough to capture the severity of the early postoperative complications .
this is because the hrqol is usually impaired immediately after major surgery and hence those developing major complications shortly after surgery may not have a significant change from the baseline ( observed in people without complications ) because of the low baseline values .
in addition , measurement of long - term hrqol may necessitate additional follow - up for patients resulting in additional resource utilisation and costs .
the likelihood of missing data will increase if long - term follow - up is necessary to assess the outcomes .
current methods which have been suggested for identifying surgeons with poor operative performance are likely to miss a significant proportion of underperforming pancreatic surgeons .
the results of this review are applicable to other surgeries that have similar or lower mortality such as liver resections and colorectal surgeries .
valid risk prognostic model and classification system of surgical complications ( which captures long - term disability to patients and the cost implications to funder ) are necessary before meaningful comparisons of the operative performance between pancreatic surgeons can be made . | background . indicators of operative outcomes could be used to identify underperforming surgeons for support and training .
the feasibility of identifying hpb surgeons with poor operative performance ( outliers ) based on the results of pancreatic resections is not known .
methods .
a systematic review of medline , embase , and the cochrane library was performed to identify studies on pancreatic resection including at least 100 patients and published between 2004 and 2014 .
proportions that lay outside the upper 95% and 99.8% confidence intervals based on results of the systematic reviews were considered as outliers . results . in total ,
30 studies reporting on 10712 patients were eligible for inclusion in this review .
the average short - term mortality after pancreatic resections was 3.1% and proportion of patients with procedure - related complications was 47.0% .
none of the classification systems assessed the long - term impact of the complications on patients .
the surgeon - specific mortality should be 5 times the average mortality before he or she can be identified as an outlier with 0.1% false positive rate if he or she performs 50 surgeries a year . conclusions .
a valid risk prognostic model and a classification system of surgical complications are necessary before meaningful comparisons of the operative performance between pancreatic surgeons can be made . |
adolescents psycho - social response to dancehall genre has become a national and public health concern , and has raised policy debate in terms of adolescent 's sexual and violent behavior ( with respect to pregnancy , sexually transmitted infections ( sti ) and human immunodeficiency virus ( hiv ) ) .
issues relating to sex and violence among adolescents have , in recent times , raised much public health and policy concerns , especially in an era where first sexual debut is at the mean age of 11.4 years for boys and 12.8 years for girls in jamaica .
studies have shown that graphical lyrical contents in some music can impact adolescent sexual and violent behavior .
this research has explored the literature and noted that there is a correlation between dancehall genre and adolescent sexual and violent behavior .
unlike the literature which shows that such genre is likely to impact the behavior of male than female ( because of its delivery from a masculine perspective ) , the findings of this research show that females are more likely to be impacted psycho - socially , hence would act upon the lyrical contents that they hear .
this research has posited the various policy and health implications governing adolescent behavior and the playing of dancehall music on public buses and taxis .
recommendations are also made regarding policy and legislative directions that may be taken by the health sector of jamaica .
the former was captured through field research , which was collected in jamaica , during the period february - may , 2008 .
the instrument used in the collection of data was a 20-item close - ended questionnaire .
the respondents were instructed to opt - out , should they become uncomfortable with any aspect of the questionnaire .
the findings reveal ( table 1 ) that unlike females ( 40% ) who gravitated to sexually explicit lyrical content than their male counterpart ( 26% ) , males were more inclined to lyrical contents that were conscious ( 34% ) and violent ( 20% ) rather than their female counterpart ( 24% and 16% respectively ) .
both males ( 20% ) and females ( 20% ) responded similarly to lyrical content of expletive language .
adolescent 's response to dancehall genre from a psychological perspective , table 2 shows that there is no significant difference between the respondents who claimed that dancehall genre inspired their dreams ( males 64% , females 62% ) . to be more specific
, these respondents postulated that they dream of the sexual and violent graphics of the genre and that this resulted in waking up with an orgasm and/or a feeling of rage or fright .
males ( 62% ) were , however , less likely to be emotionally stimulated by the dancehall genre than their female counterpart ( 82% ) .
males were also less likely to act on lyrical content ( 46% ) or feel controlled by the lyrics ( 42% ) than the females ( 74% and 64% respectively ) .
more males ( 54% ) than females ( 26% ) claimed that the dancehall lyrics did not influence them . during the questionnaire administration
, there were respondents who claimed that the graphical overture of sex and violence in the dancehall music , helped to stimulate and empower them to behave according to the impression conveyed , whether or not they had prior exposure to sex and/or violence .
of the 100 respondents , 52% males and 58% females claimed to be sexually active , while 19% male and 13% females demonstrated violence in schools , in their communities , and/or in their homes - 7% females and 9% males were taken to the principal 's office ; 3% females and 5% males suspended ; and 5% females and 8% male were warned by police ( without arrest ) ; 3% male and 6% female contracted sti ( including hiv ) .
there was no significant difference between those who would sing the lyrics of the dancehall genre without hearing it ( 100% male , 98% female ) .
30% male and 58% female said that they sometimes heard the music in their heads while focusing on other things .
in support of the findings of this study , the literature reveals that music ( especially in the dancehall genre ) has influence on adolescent sexual behavior . in a 2007 study in jamaica ( table 3 ) , out of 238 cases of 9 - 17 year olds ,
42% respondents ( 18.5% male , 23.5% female ) contracted stis / hiv . unlike the findings of this study , males were more likely influenced ( than their female counterpart ) by dancehall genre .
influences of sexual activities the literature also shows that music is highly influential and can create negative impact on youths , who imitate these negative acts .
schubert contends that music tend to evoke intense pleasure ; while mcfarlane holds the view that a link does exist between exposure to sexual content via the media and the sexual behavior of our children . unlike the findings of this study
, the literature also points out that males were more likely to be impacted by the sexual messages from the dancehall genre , because such message is usually delivered from a masculine perspective .
one author noted that the lyrical contents of dancehall genre have the potential to impact the brain , and affect emotional behavior in humans , especially for the young people .
this is probably because there is a direct correlation between the playing of hard - core
music on public transportation and the proliferation of sexual display on these said transportations . in a 2009 jamaican study ,
this study explains that female students would often sit in the laps of the male students and engage in sexual activities while gyrating their bodies to the sound of the music .
the said study further pointed out that such kind of sexual behavior , demonstrated by adolescents , was also prevalently practiced in taxis .
the gyration of the body brings to mind one 's scholar 's perspective that owing to the rhythmic pattern , timbre and amplitudes of the music , in general , this can affect emotional behavior .
it is noted that the lyrical contents in the majority of the dancehall genre are messages which relate to male - female sexual relationships , and are not messages of respect , care , consideration and values . in these musicals ,
the artistes sing about what men should do and how they should treat women ( in a derogatory manner ) .
one deejay artist charged that parents become more responsible and censor what their children see or hear . as a result
effective controls over crime in jamaica need to start with the music industries , the artistes and the music lyrics which explicitly describe and depict murder so callously to a level where it is difficult to fathom .
dancehall music with these violent lyrics helps to build the thought process of our youths .
the encouragement of sexual activities of minors by bus and taxi operators ( adults ) is a breach of ( 1 ) article 34 of the united nations convention of the rights of the child ( 1989 ) , which addresses sexual exploitation , abuse , unlawful sexual activity / practices , pornographic performance or materials ; and ( 2 ) the child care and protection act , which refers to exposing the child to moral danger .
in addition , such practice suggests conflict with the jamaican government 's efforts ( under its national development 2030 plan ) to achieve ( i ) a healthy and stable population ; ( ii ) a society which is safe , cohesive and just ; ( iii ) the goal of being able to combat hiv / aids .
it is therefore recommend that the state should make it a responsibility to educate public bus and taxi operators on the psycho - social , legal and health implications ( abuse , pregnancy , sti / hiv ) of playing loud inappropriate music while transporting passengers . at the same time it is imperative that there be political support for this cause .
policies should be enforced ( if already implemented ) regarding the matter of public bus and taxi operators facilitating sexual activities by adolescents while on their public transportations .
close attention should be paid to the legislation ( child care and protection act , 2004 ) , which protects the interest and rights of the child .
loud and inappropriate music on public buses and taxis should be forbidden ( especially while located in public domain ) whether or not such transportations contain passengers .
there is a correlation between hard - core dancehall genre and the sexual and violent behavior of adolescents . based on the responses obtained from the respondents ,
the findings reveal that females more than males are more likely to respond psychologically to the lyrical contents of dancehall genre . | background : research has shown that there is a direct correlation between the loud hard - core music played on public transportation and the proliferation of sexual activities on these said transportations.aim:to determine the extent to which dancehall music / genre impacts adolescent behavior.materials and method : the study is informed by quantitative and qualitative data , which were collected during the period february may 2008 .
convenience and judgmental sampling were used to target 100 subjects.results:of the 100 adolescent cases ( 50 male , 50 female ) , females ( 40% ) were more likely to gravitate to sexually explicit lyrical content than their male counterparts ( 26% ) .
females ( 74% ) were also more likely to act upon lyrical contents than males ( 46% ) .
there was no significant difference where males ( 100% ) and females ( 98% ) subconsciously sings the dancehall lyrics even without hearing it ; as well as inspire their dreams 64% and 62% respectively .
however , more females ( 74% ) than males ( 46% ) acted on lyrical contents of the dancehall genre.conclusion:there is a correlation between hard - core dancehall genre and the sexual and violent behavior of adolescents . |
the global incidence of diabetes mellitus ( dm ) has increased alarmingly in the past ten years , becoming one of the most common chronic diseases .
it is estimated that this disorder will affect 552 million people by 2030 ( http://www.idf.org/media-events/press-releases/2011/diabetes-atlas-5th-edition ) .
changing lifestyle leading to reduced physical activity and increased obesity has been pointed as the major culprit for this increase .
dm is a group of metabolic diseases characterized by hyperglycemia due to defects in insulin secretion by pancreatic -cells , insulin action on target tissues , or both .
based on its etiology , dm has been classified into four main groups ; ( 1 ) type 1 dm ( t1 dm ) that results from lack of insulin production due to selective autoimmune destruction of pancreatic -cells ; ( 2 ) type 2 dm ( t2 dm ) caused by a combination of insulin resistance in the main target tissues ( liver , muscle , and fat ) and inadequate compensatory insulin secretion response by -cells ; ( 3 ) other specific type of diabetes which includes the genetic defects of the -cell ; ( 4 ) gestational diabetes mellitus ( gdm ) , characterized by glucose intolerance with onset or first recognition during pregnancy .
existing treatments for t1 dm and long - term t2 dm patients are primarily focused on insulin supplementation . however , despite the beneficial effects of insulin therapy on glucose homeostasis , poor patient implementation often leads to diabetic complications such as retinopathy and nephropathy as well as cardiovascular and cerebrovascular diseases .
the life - threatening side effects of poor insulin management expose the need for new therapeutic strategies to preserve or replenish the functional -cell mass and consequently maintain glucose homeostasis . in this
scope , phase ii clinical trials performed in patients with recent - onset t1 dm using anti - cd3 monoclonal antibodies that suppress the immune system showed significant preservation of -cell function for at least 24 months and to decrease insulin requirements . despite these beneficial effects , this intervention alone does not restore normal glucose control highlighting the need for the development of alternative therapies aimed at preserving or replacing destroyed -cells . in the past 10 years
, islet transplantation has gained much attention as a cell replacement therapy for restoring the functional -cell mass .
unfortunately , the limited supply of islets from donors can not meet the demand imposed by the ever - growing number of t1 dm patients .
furthermore , a major hurdle has been the lack of durability of islet function resulting in only less than 50% of recipients with insulin independence two years after transplantation .
in addition to side effects produced by immunosuppression , several posttransplant events , such as instant blood mediated inflammatory reaction ( ibmir ) and cytokine cascade , seriously affect the functionality of transplanted islets [ 58 ] .
nonetheless , the promising outcome of islet transplantation has prompted the search for alternative sources of -cells .
one such alternative has been differentiation of insulin - producing cells from embryonic and adult stem / progenitor cells .
however , despite the high number of differentiation protocols described in the literature , none published to date have generated by exclusive in vitro differentiation sufficient numbers of insulin - producing cells meeting all essential criteria that define a functional -cell .
a more recent and provocative alternative to cell replacement therapy for the treatment of dm has been the concept of in vivo regeneration to replenish the loss of -cell mass . basically , the ultimate goal of this strategy is to enhance the regenerative capacity of the pancreas .
studies in animal models and in humans have demonstrated that obesity - associated insulin resistance as well as increased insulin requirements during pregnancy is matched by a corresponding stimulation in insulin output through -cell hyperplasia and hypertrophy .
studies in the non - obese diabetic ( nod ) mouse , an important animal model of experimental autoimmune diabetes , have confirmed the importance of -cell replication and improved survival under pathophysiological conditions .
it was shown that -cell replication increases with the occurrence of islet inflammation during progression of dm .
nonetheless , by three months mice develop hyperglycemia as the autoimmune attack counteracts the attempt of -cells regeneration by the organism .
of note , in condition in which autoimmunity and islet inflammation are blunted using an anti - cd3 immune therapy , newly formed -cells derived from preexisting ones are sufficient to normalized blood glucose levels .
a combinatorial approach in which both regeneration and resistance to destruction are enhanced will need to be targeted in order to successfully regain a functional -cell mass and maintain normoglycemia .
a regenerative approach to dm is a matter of life and death . in this context
, an array of growth factors and transcription factors have been shown to be involved in these regulatory pathways , providing an attractive perspective for the development of new therapeutic strategies to maintain adequate -cell mass for stabilization or even improvement of glucose metabolism in dm patients .
the question is which ones from the ever - growing list of factors will convey , alone or in combination , the best winning chance of survival and growth to -cells ? in this context
we have selected 4 candidates , the hepatocyte growth factor ( hgf ) , the growth inhibitory peptide or glucose - dependent insulinotropic polypeptide ( gip ) , the transcription factors pax4 , and the orphan nuclear liver receptor homolog-1 ( lrh-1 ) as rising stars in the field of -cell regeneration .
these factors exert several beneficial actions on -cells simultaneously such as conferring -cell protection and enhancing proliferation . in addition , some of them have been shown to improve -cell function under pathophysiological conditions .
thus , they are very attractive targets for that combinatorial approach to treat dm , in which -cell mass is not only increased but also protected from death .
these four factors could also be utilized in -cell replacement therapies as a part of either pre- or postislet transplantation treatments .
this paper highlights recent advances pinpointing to the importance of these candidates in -cell regeneration as well as to provide insight on how at the molecular level they merge towards similar targets involved in cell replication and survival .
these may eventually be employed alone or in combination in an effort to increase islet mass , viability , and function in patients with dm .
hgf is a heterodimeric protein that binds to the tyrosine kinase receptor c - met .
stimulation of c - met by hgf results in the activation of several downstream signal transduction pathways including pi3k / akt , mapk , and pkc .
interestingly , hgf was also shown to induce wnt - independent nuclear translocation of -catenin subsequent to met--catenin dissociation in liver cells resulting in cell replication . in this context
, the hgf / c - met axis possesses potent mitogenic effect on various tissues such as liver , lung , kidney , spinal cord , heart , and skeletal muscle upon injury [ 15 , 16 ] .
hgf and c - met are also expressed in the pancreas , and levels are significantly increased in islets of gestating mice as well as in cytokine - treated islets .
the latter suggests that the hgf / c - met signaling pathway may be crucial for islet adaptation in response to metabolic demands [ 17 , 18 ] .
consistent with this premise , pancreas - specific ablation of c - met increased sensitivity of islets to cytokine - induced apoptosis in vitro through increased nf-b signaling and nitric oxide production .
treatment of c - met null animals with multiple low doses of stz , a -cell specific diabetogenic agent , resulted in increased islet chemokine secretion , higher degree of insulitis , and increased -cell apoptosis as compared to that observed in wild type treated littermates .
these inflammation features combined with -cell death led to a reduced -cell mass and higher incidence of hyperglycemia . similarly , pregnant mice lacking c - met in the pancreas displayed blunted -cell replication with a concomitant increase in cell death leading to gdm .
this defect was linked to reduced levels of the prolactin receptor as well as in levels of the transcription factor foxm1 , two important players in cell proliferation .
a decreased nuclear translocation of stat5 and upregulation of the replication inhibitor p27 were also detected in c - met - ablated islets .
these studies clearly identify the hgf / c - met signaling pathway as an important axis activated in conditions of metabolic stress in which islets require increased protection and proliferation .
thus , manipulation of this pathway may provide a new therapeutic venue for the treatment of dm .
consistent with this premise , adenoviral - mediated expression of hgf in nonhuman primate islets markedly improved function of transplanted islets .
indeed , only a marginal mass of islets expressing hgf was required to correct hyperglycemia in nod - scid mice as compared to the number of control islets needed to normalize blood glucose levels in the same animals .
although similar effects need to be established for human islets , these results are certainly encouraging and validate the usefulness of hgf for novel regenerative and replacement dm therapies .
in addition to its effect on proliferation and survival , hgf in combination with betacellulin was recently shown to induce in vitro transdifferentiation of pancreatic ductal endothelial cells ( pdecs ) into -cells [ 22 , 23 ] . approximately , 30% of hgf - treated pdec cells transdifferentiated into insulin - producing cells .
the phenotype of these newly differentiated -cells was very similar to that of mature -cells , expressing near physiological levels of insulin and glut2 .
interestingly , transdifferentiation of these pdecs was dependent on the temporal and sequential expression of key endocrine development transcription factors such as pdx-1 , ngn3 , neurod , and pax4 . using specific inhibitors for the different signaling pathways activated in pdecs upon hgf treatment , li et al
. suggested that hgf induces pdecs differentiation into insulin - producing cells through the pi3k / akt cascade .
the latter will also be valuable to determine the potential mitogenic side effect of hgf on pdecs .
thus , the balance between hgf - mediated proliferation and transdifferentiation into -cells should be carefully investigated .
taken together , recent findings reinforce the value of hgf as a potential therapeutic agent that can increase islet number , viability , and functionality , three vital attributes for the treatment of dm through regenerative medicine .
gip and glucagon - like peptide-1 ( glp-1 ) are two incretin hormones produced by the k and l - cells of the intestine , respectively .
these incretins are secreted in response to food intake and potentiate glucose - induced insulin secretion from pancreatic -cells in healthy individuals . nonetheless , both peptides are rapidly degraded by dipeptidyl peptidase iv ( dpp - iv ) . in view of their insulinotropic properties ,
major efforts have focused on developing either mimetics of incretins , which are resistant to dpp - iv or inhibitors of dpp - iv .
historically , gip was rapidly discarded as a therapeutic target due to its impaired insulinotropic effect in t2 dm patients .
nonetheless , recent evidence suggests that gip may be a promising target for the preservation and regeneration of a functional -cell mass in dm .
indeed , gip was shown to be important for -cell development as well as postnatal islet mass expansion and function .
transgenic mice expressing a dominant negative gip receptor specifically in pancreatic -cells displayed an early disturbance in pancreatic islet development with a severe reduction in the -cell mass with a commensurate increase in - , - , and pp - cells .
adult transgenic animals had reduced number of islets and -cells as compared to control littermates .
intriguingly , islet proliferation and apoptosis were only slightly modified as compared to control mice .
consistent with altered islet architecture , insulin secretion was impaired and animals developed early - onset dm .
in addition to its profound impact on development , gip was also shown to increase mouse islet -cell survival in response to high glucose and lipid levels ( glucolipotoxicity ) through activation of the pi3k / pkb pathway and downregulation of the proapoptotic factor bax .
studies using human islets revealed that gip could partially block cytokine - mediated cell death clearly providing protective properties to this incretin .
interestingly , this antiapoptotic effect appeared to be conveyed by gip - mediated increases in islet osteopontin .
consistent with these in vitro data , administration of a dpp - iv - resistant analogue of gip to rats blunted the adverse effects of streptozotocin on islet -cell destruction and development of hyperglycemia .
furthermore , the gip analogue also preserved -cell mass in zdf rats through decreased apoptosis . in vitro ,
gip was shown to stimulate proliferation of newborn rat islet -cells , a mechanism potentially involving the activation of cyclin d1 .
thus , gip analogues resistant to dpp-4 cleavage may represent a promising new class of therapeutic compounds with properties to enhance as well as to preserve the critical -cell mass required to maintain normoglycemia in dm patients .
pax genes encode a family of transcription factors that are key regulators of tissue development and cellular differentiation in embryos acting to promote cell proliferation , migration and survival . in the pancreas ,
pax4 was shown to be essential for the generation of islet cell progenitors and subsequent - and -cell maturation during embryogenesis [ 32 , 33 ] .
although detectable , the expression of the transcription factor in adult islet -cells was found to be low as compared to its embryonic expression [ 34 , 35 ] .
in contrast , aberrantly high expression levels of pax4 were detected in human insulinomas as well as lymphomas [ 36 , 37 ] .
a distinctive attribute of pax4 is that mutations and polymorphisms in this gene have been associated with both t1 dm and t2 dm in several ethnic populations . taken together , these unique characteristics strongly indicate a vital role of pax4 not only during development but also in survival and/or maintenance of cell mass in mature islets .
consistent with the notion that pax4 expression may be important for -cell adaptation , in vitro studies performed in human islets demonstrated that glucose as well as growth factors such as betacellulin , activin a , and glp-1 increased pax4 mrna levels .
furthermore , pax4 levels were also found elevated in islets derived from t2 dm patients correlating with hyperglycaemia , indicating a potential adaptation of -cell mass in response to insulin resistance .
ectopic expression of mouse pax4 in either human or rat islets as well as in the mouse insulinoma min6 cell line conferred protection against cytokine - mediated cell death and promoted islet cell proliferation [ 34 , 39 ] .
interestingly , a diabetes - linked mutant variant r121w identified in the japanese population was less efficient in protecting human islets against cytokines . supporting the role of pax4 in survival / maintenance of -cell mass , repression of pax4 in the rat insulinoma ins-1e cell line and in hematologic cell lines that express high levels of the transcription factor provoked apoptosis [ 36 , 40 ] .
more recently , conditional overexpression of pax4 in adult -cells was shown to protect transgenic animals against stz - induced hyperglycemia and isolated islets against cytokines , while animals expressing the mutant r121w variant were susceptible to developing hyperglycemia and -cell death by both treatments .
these antiapoptotic effects were shown to be mediated by increased expression of the antiapoptotic gene bcl-2 and downregulation of the nf-b pathway .
consistent with a role for pax4 in -cell replication , the cell cycle - dependent kinase , cdk4 was increased in pax4 overexpressing islets and promoted the proliferation of a pdx1-positive subpopulation .
together , these studies suggest that pax4 functions as a survival and proliferation gene allowing mature islets to expand in response to physiological cues . an additional astonishing regenerative property of pax4 that was recently uncovered is its capacity to reprogram -cells to -cells .
indeed , using an elegant cre / loxp approach in which the cre recombinase was under the transcriptional control of the glucagon gene promoter , collombat et al . showed that forced expression of pax4 in developing -cells induced a phenotypic switch towards -cells .
this was accompanied by an increase in islet size and in the quantity of insulin positive cells with a concomitant decrease in -cell number .
remarkably , the conversion and thus decrease in the -cell population resulted in neogenesis of new -cells from duct - associated progenitor cells in adult animals .
nonetheless , these new replenished -cells were continuously converted to -cells due to pax4 ectopic expression .
regeneration of the -cell mass by aberrant expression of pax4 in -cell was able to transiently rescue hyperglycemia in young animals rendered diabetic by chemical treatment .
the mechanism by which pax4 achieves reprogramming of - to -cells is thought to occur through the antagonistic effect of pax4 on arx , a key transcription factor involved in -cell lineage commitment and subsequent mature function .
it will be of great interest to determine whether the conditional and selective expression of pax4 in mature -cells using an inducible and reversible system will promote conversion to -cells and whether repression of pax4 will revert these cells back to -cells . in this context
, two independent studies have recently provided elegant evidence for the replenishment of the -cell mass through -cells conversion subsequent to severe pancreatic damage .
using an animal model in which the diphtheria toxin receptor was expressed specifically in -cells , thorel and colleagues obtained a near total -cell ablation through administering of diphtheria toxin ( dt ) while maintaining all other endocrine cells intact .
this approach allowed the investigators to examine the contribution of remaining endocrine cell subtypes to putative -cell regeneration .
using an inducible , tamoxifen - dependent cre / lox - based lineage tracing system , the authors concluded that following -cell ablation , regeneration stemmed predominantly from a non--cell source .
the irreversible labeling of -cells showed that under approximately 99% -cell loss , bihormonal cells expressing both insulin and glucagon were observed which ultimately generated single - hormone insulin positive cells .
it is worth noting that the severity of the damage greatly influenced -to--cell conversion , since this transdifferentiation was not observed under approximately 95% destruction .
why such reprogramming mechanisms are not observed by slightly lower amounts of -cell loss remains to be understood .
consistent with these results , an independent study also claims to have observed pancreatic -cell neogenesis by direct conversion of mature -cells subsequent to pancreatic duct ligation ( pdl ) coupled to alloxan treatment . in this study , an astonishingly rapid - to -cell transdifferentiation
was detected , resulting in the formation of new islets within 2 weeks . nonetheless , treated mice never achieved normoglycemia .
the authors proposed that the latter was most likely due to the profound and continuing inflammation and disruption of normal organ homeostasis that occurred following pdl / alloxan treatment .
an alternatively explanation which is not addressed could also be that the newly formed insulin - positive cells are nonfunctional -cells .
although this study substantiates the work of thorel and colleagues , no genetic lineage - tracing experiments were performed to clearly ascertain that -cells were the predominant source of new -cells . in this context , it is intriguing that although there was a greater rate of -cell replication as compared to -cell replication ( 6% versus 5% at 7 days after treatment ) , the authors excluded these residual -cells as a potential source for regeneration in this particular injury model . thus , whether a bona fide- to -cell reprogramming occurs in the pdl / alloxan model remains to be clearly established , and key factors driving this process have yet to be identified . in this context , determining whether pax4 is implicated in the conversion of mature to -cells in these in vivo models of -cell regeneration will be of great interest .
indeed , a recent study has challenged the role of pax4 on the transdifferentiation of - to -cells , pointing to men1/menin as the main factor driving this process . in this case
, it was found that specific ablation of men1 in -cells triggered reprogramming towards -cells with the subsequent development of insulinoma .
although men1 could have a role in -cell plasticity , it is currently difficult to discriminate whether this is a specific effect or only related to tumorigenesis .
independently , the identification of signaling molecules that trigger reprogramming of -cells may offer new therapeutic tools for the treatment of dm . taken together
, pax4 certainly fulfills all requirements as a first - class target candidate for the development of innovative -cell regenerative therapies for the treatment of dm .
indeed pax4 ( 1 ) increases -cell survival in response to metabolic stresses ( 2 ) stimulates proliferation , and ( 3 ) promotes conversion of - to -cells .
nonetheless , it is important to note that long - term expression of pax4 may not be beneficial for -cells as the cells revert to a progenitor phenotype thereby losing their capacity to secrete insulin in response to glucose .
thus , identifying small molecules or factors that transiently activate pax4 in either - or -cells will be instrumental for the development of novel antidiabetic treatment .
lrh-1 is a member of the nr5a2 subfamily of nuclear receptors which is predominantly expressed in the liver , , exocrine pancreas [ 47 , 48 ] , intestine , and ovaries . in these tissues
, lrh-1 regulates expression of genes involved in cholesterol and bile acid metabolism as well as steroidogenesis .
lrh-1 was also found to attenuate the acute phase response ( apr ) that is triggered in response to inflammatory cytokine signaling in the liver thereby preventing cell death .
more importantly , lrh-1 was found to partially convey the beneficial effects of estrogens on -cell survival .
pharmacological studies using activators as well as inhibitors of estrogen receptors revealed that lrh-1 expression was predominantly induced through activation of estrogen receptor ( er). repression of lrh-1 by rna interference abrogated the protective effect conveyed by estrogen on islets against cytokines .
furthermore , previous studies have demonstrated that aberrant expression of lrh-1 is associated with the growth of intestinal tumors as well as with the proliferation of pancreatic and hepatic cell lines [ 49 , 53 ] .
however , the latter finding is in disagreement with adenoviral - mediated overexpression of lrh-1 in human islets , which did not increase -cell proliferation .
lrh-1 appears to promote cell replication by stimulating expression of cyclind1 and e1 , a process that involves a crosstalk with the -catenin / tcf4 signaling pathway .
low levels of -catenin in mature islet may provide an explanation for the lack of lrh-1 effect on cell proliferation .
in contrast , lrh-1 was found to confer protection against cytokine- and stz - induced apoptosis .
the steroidogenic enzymes cyp11a1 and cyp11b1 that are involved in glucocorticoid biosynthesis were increased in transduced islets .
as these steroids are potent immunosuppressors , glucocorticoids in a paracrine manner may mediate the protective effect of lrh-1 . of note
, glucocorticoids were shown to be diabetogenic and to hamper islet function in vivo [ 55 , 56 ] .
these findings led to their exclusion from immunosuppressive regimens given to patients subsequent to islet transplantation .
however , a recent study demonstrated that exogenous glucocorticoids have potent anti - inflammatory properties on human islets .
furthermore , although glucocorticoid - treated human islets exhibited a rapid reduction in glucose - induced insulin secretion observed within 24 hours , these islets performed considerably better than control islets in long - term culture .
consistent with the beneficial impact of glucocorticoids on islet integrity , a recent study demonstrated that optimal elevation of glucocorticoids in -cells was a compensatory mechanism that prevented high - fat diet - induced -cell failure .
thus , in contrast to previous beliefs , low levels of glucocorticoids generated endogenously by factors such as lrh-1 may be advantageous to preserve -cells against metabolic aggressions . given the importance of lrh-1 in regulating several key metabolic pathways including lipid metabolism as well as in modulating cellular homeostasis ( cell proliferation and survival ) , attempts to regulate its activity could be of therapeutic value for the treatment of dm . in this context , although lrh-1 is considered an orphan receptor that possesses constitutive activity , small endogenous phospholipid were shown to bind the ligand pocket domain of the protein and to increase its activity .
taking advantage of this knowledge , a recent study demonstrated that administration of the phospholipids dilauroyl phosphatidylcholine ( dlpc ) decreased hepatic steatosis and improved glucose homeostasis in two mouse models of insulin resistance .
these results have led to a pilot human clinical study in usa to explore the effects of dlpc in pre - t2 dm patients . in parallel , it will be of interest to determine whether small molecule agonists of lrh-1 recently developed by whitby and colleagues can protect human islets against stressed - induced cell death and prevent onset of hyperglycemia in animal models of experimental autoimmune diabetes .
the anti - inflammatory properties combined with the prosurvival effects of lrh-1 highlight the immense potential of this newcomer and rising star target for the treatment of both t1 dm and t2 dm .
dm is now considered one of the most common noncommunicable diseases in the world causing 5% of all deaths per year .
therefore , new therapies should aim at restraining -cell death and promote -cell performance in patients in order to improve blood glucose without treatment - derived side effects .
currently , a potpourri of growth factors and transcription factors have been highlighted for their ability to preserve and/or increase cell mass .
the hierarchy or specific networks connecting them together and value in treating diabetic patients are yet to be established .
most likely these factors will have to be used in combination to optimize viability of -cells as well as to increase the replication capacity .
nonetheless , as current published data point to a declining capacity of -cells to replicate with age [ 62 , 63 ] , efforts should focus on characterizing factors capable of preserving and protecting the -cell cell mass under pathophysiological situations . in this context ,
hgf , gip , pax4 , and lrh-1 in various permutations may hold the key to a successful regenerative therapy applied to dm . indeed , these factors appear to either complement or share common signaling pathways and downstream targets resulting in increase islet viability and performance ( figure 1 ) .
for instance , hgf and pax4 both inhibit the nf-b pathway leading to increased -cell survival .
similarly , gip and pax4 enhance expression of the antiapoptotic gene bcl-2 . as we have previously demonstrated that glp-1 stimulates pax4 expression in human islets , it will be of interest to determine whether gip also increases pax4 expression resulting in the downstream activation of the bcl-2 gene .
consistent with this possibility , both gip - mediated -cell protection and glp-1-conveyed increases in pax4 are relayed by the pi3k signaling pathway [ 27 , 35 ] .
hgf combined with small lrh-1 agonists may be sufficient to stimulate human islet -cell expansion .
indeed , hgf was shown to provoke the release of -catenin from c - met with its subsequent translocation to the nuclei .
accumulation of nuclear -catenin may reach sufficiently high levels to interact with lrh-1 and activate downstream target gene such as cycd1 .
in addition , both lrh-1 and hgf have been shown to decrease inflammation , an important mediator of cell death in dm [ 18 , 54 ] .
finally , hgf and pax4 have the additional property to promote transdifferentiation of pdecs and -cells into -cells .
this could be extremely beneficial as an alternative method to replenish a functional -cell mass due to the limited replication capacity of -cells .
it is also interesting to note that -cells appear less susceptible to autoimmune attack with an apparent increase in the number of -cells in type 2 diabetic subjects . in this context , a combined hgf
/ c - met , pax4 , and gip therapy could be optimal : -cell protection with increased proliferation as well as the generation of new -cells from -cells .
nonetheless one important consideration to take into account is that regeneration and tissue responses are very different under various contexts , such as the severity of the injury or the age of disease onset .
furthermore , vigilance is of essence also to restrain the potential deregulated cellular growth when using such factors .
thus , to be successful , this type of regenerative therapy requires intervention at a threshold point at which -cells are still present and that the pancreas retains some regenerative plasticity .
alternatively , these factors could also be useful for optimizing islet transplantation . indeed , increased islet isolation yields and posttransplantation islet performance and survival could be feasible using a combination of hgf , gip , pax4 , and lrh-1 .
the latter approach would reduce the number of islets required for transplantation and improve long - term islet function .
islet -cell regeneration is a fast moving field in which great advances can be achieved in the next few years with promising potential for the treatment of dm .
the next step is to elucidate the molecular mechanisms that intertwine hgf , gip , pax4 , and lrh-1 together in promoting survival and rejuvenation of islet cells .
these studies will most likely highlight additional factors that may become novel targets for regenerative therapies . | islet -cell replacement and regeneration are two promising approaches for the treatment of type 1 diabetes mellitus .
indeed , the success of islet transplantation in normalizing blood glucose in diabetic patients has provided the proof of principle that cell replacement can be employed as a safe and efficacious treatment .
nonetheless , shortage of organ donors has hampered expansion of this approach .
alternative sources of insulin - producing cells are mandatory to fill this gap .
although great advances have been achieved in generating surrogate -cells from stem cells , current protocols have yet to produce functionally mature insulin - secreting cells .
recently , the concept of islet regeneration in which new -cells are formed from either residual -cell proliferation or transdifferentiation of other endocrine islet cells has gained much interest as an attractive therapeutic alternative to restore -cell mass .
complementary approaches to cell replacement and regeneration could aim at enhancing -cell survival and function .
herein , we discuss the value of hepatocyte growth factor ( hgf ) , glucose - dependent insulinotropic peptide ( gip ) , paired box gene 4 ( pax4 ) and liver receptor homolog-1 ( lrh-1 ) as key players for -cell replacement and regeneration therapies .
these factors convey -cell protection and enhanced function as well as facilitating proliferation and transdifferentiation of other pancreatic cell types to -cells , under stressful conditions . |
cytologic examination of cerebrospinal fluid ( csf ) is routinely performed during the management of patients with malignancies that frequently have leptomeningeal spread , including patients with acute lymphoid leukemias ( all ) and medulloblastomas .
cytology laboratories in large centers treating cancer patients occasionally come across meningeal carcinomatosis or neoplastic meningitis ( nm ) , in which there is diffuse seeding of the csf by metastatic carcinoma cells .
detection of exfoliated malignant cells in csf due to the meningeal carcinomatosis may sometimes be the first diagnostic clue in patients with diverse neurological symptoms . while csf cytology is highly specific ( > 95% ) in detection of cancer cells
in addition , the detection of metastatic carcinoma cells in csf of patients suffering from an extracranial carcinoma also has important therapeutic and prognostic implications .
nm is a clinically important condition and numerous reports on cytology are available in literature ; however , mostly from early 80s and late 90s .
the central nervous system ( cns ) is becoming a more common site of involvement as cancer patients live longer due to improvements in systemic therapies and advancement in neuroimaging studies .
moreover , many chemotherapeutic agents do not cross the blood brain barrier , leaving the cns / meninges as a potential tumor hideout .
this is increasing the importance of effective detection methods of cancer cells in the csf as early management can increase the therapeutic benefit .
there are three methods to detect nm , which include clinical signs and symptoms , magnetic resonance imaging ( mri ) of the brain and spine and csf cytology .
mri sensitivity and specificity vary with the type of primary cancer with a detection rate of nm in fewer than 50% of patients . on the other hand
, csf cytology has a high specificity ( > 95% ) but associated with less sensitivity .
this retrospective study was undertaken to evaluate the utility of csf cytopathology for the diagnosis of metastatic malignancies and to describe cytomorphologic features of various tumors , which help in diagnosis of nm .
this study was a retrospective analysis of all csf samples , obtained by spinal tap exclusively and received in the cytopathology laboratory over a period of 20 years from january 1993 to june 2012 .
in most cases , csf samples were processed by cytocentrifugation technique ( cytospin ) and stained by papanicolaou and may grunwald giemsa ( mgg ) stains . in nine cases ,
immunostaining with cytokeratin ( ck ) ( thermo scientific , ca , usa ) and epithelial membrane antigen ( ema ) ( thermo scientific , ca , usa ) was carried out in four cases .
all cases reported positive and suspicious for metastatic carcinoma cells were included in the study .
clinically , these patients presented with neurologic deficits and thus were subjected to csf cytologic examination .
imaging details such as mri features were not available due to the retrospective nature of the study .
slides were reviewed by four cytopathologists ( gs , srm , vki , dj ) and classified based on the consensus into negative , positive and suspicious categories ; when multiple csf samples had been examined for a patient , the highest category of cytologic classification was selected .
a total of 15,430 csf samples were evaluated during the study period of 20 years .
three hundred thirty five of these specimens from 292 patients were positive or suspicious for malignant non - lymphoreticular tumors , whereas 755 specimens from 548 patients were positive or suspicious for lymphoreticular tumors [ tables 1 and 2 ] .
non - lymphoreticular neoplasms detected by cytologic examination of csf lymphoreticular neoplasms detected by cytologic examination of csf the most common non - lymphoreticular tumors were primary cns neoplasms ( 72.9% ) followed by metastatic carcinomas ( 22.6% ) .
the most common lymphoreticular tumors were all ( 60.2% ) followed by non - hodgkins lymphomas ( 29.1% ) .
36 ( 54.6% ) patients had already been diagnosed with systemic malignancy whereas 45.4% of the cases presented with neurological symptoms . in the former ,
the most common primary was breast ( 28.7% ) followed by ovary ( 6% ) and lung ( 4.5% ) [ table 3 ] .
types of metastatic tumors in csf cytology the age of patients with nm ranged from 22 years to 79 years with a mean of 50.5 years .
there were 22 males and 44 females ( m : f ratio of 1:2 ) .
csf smears of patients with metastasis from breast carcinoma were highly cellular [ figure 1a ] .
the tumor cells were arranged mainly singly [ figure 1b ] , although an occasional small cohesive cluster of tumor cells could be seen in most samples .
a cell in cell appearance with one cancer cell engulfing an adjacent cancer cell ( cellular cannibalism ) was seen in most of the cases [ figure 1d ] .
the cells contained central nuclei with a moderate amount of dense cytoplasm with only occasional cell showing fine peripheral vacuolation [ figure 1e ] .
prominent eosinophilic nucleoli most often multiple were seen in all cases [ figure 1f ] .
cerebrospinal fluid cytospin preparation from a case of carcinoma breast shows highly cellular smear ( a ) with largely dyscohesive atypical cells ( b ) ; frequent multinucleation ( c ) and cellular cannibalism is evident ( d ) .
individual cells show fine cytoplasmic vacuolations ( e ) and prominent nucleoli ( f ) .
( a : may grunwaldgiemsa , 200 , b : pap , 400 , c - f : pap , 400 ) the cellularity of cytospin csf preparation was high with an abundance of cell clusters , which in the majority of cases exhibited papillary pattern [ figure 2a ] .
case of carcinoma ovary shows tight papillary clusters ( a : pap , 400 ) and cytoplasmic vacuolation ( b : may grunwaldgiemsa , 400 ) singly lying cells with high nuclear cytoplasmic ratio and hyperchromatic nuclei were seen [ figure 3a ] .
intracytoplasmic coarse black granular pigment was identified in a significant number of tumor cells as well as within histiocytes , which failed to stain with iron ( prussian blue ) stain [ figure 3b ] and positive for melanin bleach stain .
cytospin preparation of csf of a case of melanoma displays large atypical cell with high nuclear cytoplasmic ratio present within hemorrhagic background ; coarse black pigment is seen in the cytoplasm of an adjacent degenerated cell ( a : may grunwaldgiemsa , 400 ) .
increase cellularity of singly lying atypical cells is observed in majority of cases of unknown primary site of cancer ( c : pap , 400 ) lung ( 4 ) , stomach ( 2 ) , gallbladder ( 1 ) , prostate ( 1 ) and neurondocrine carcinoma ( 1 ) : no specific features were identified due to a small number of cases .
the tumor cells mainly showed a dyscohesive pattern with singly lying cells having moderate cytoplasm .
one case each of tonsillar carcinoma and papillary carcinoma of thyroid could not be analyzed due to poor staining and cellular preservation .
the tumor cells were present singly in a majority ( 25 ) of the cases [ figure 3c ] .
the site of primary was suggested based on subtle morphologic features ; however , no follow - up could be obtained and exact primary remained unknown .
the tumor cells had moderate cytoplasm and centrally placed nuclei showing mild to moderate nuclear pleomorphism .
this pattern was largely seen in metastatic breast and lung carcinoma [ figure 4a ] .
a case of adenocarcinoma of lung shows singly lying cells with pleomorphic nuclei ( a : pap , 400 ) .
milipore membrane filtration preparation shows a cluster of atypical cells from another case of pulmonary adenocarcinoma ( b : pap , 400 ) .
immunocytochemistry for cytokeartin shows strong cytoplasmic positivity in a case of ovarian carcinoma ( c ) pattern ii consisted of large cells with abundant cytoplasm with frequent cell groupings and clusters .
pattern iii was characterized by the presence of necrotic debris , inflammatory background with a few tumor fragments .
few lung carcinomas , melanomas and cases of unknown primary showed pattern iii [ figure 4b ] .
immunocytochemistry ( icc ) for ck and ema was performed in 4 cases of breast ( 2 ) and ovarian ( 2 ) carcinoma .
in other cases , icc could not be carried out due to either scanty cellularity or a limited number of diagnostic slides .
further icc for diagnosis of primary site could also not be attempted in any of the cases as the quantity of csf sample obtained was always limited .
csf smears of patients with metastasis from breast carcinoma were highly cellular [ figure 1a ] .
the tumor cells were arranged mainly singly [ figure 1b ] , although an occasional small cohesive cluster of tumor cells could be seen in most samples .
a cell in cell appearance with one cancer cell engulfing an adjacent cancer cell ( cellular cannibalism ) was seen in most of the cases [ figure 1d ] .
the cells contained central nuclei with a moderate amount of dense cytoplasm with only occasional cell showing fine peripheral vacuolation [ figure 1e ] .
prominent eosinophilic nucleoli most often multiple were seen in all cases [ figure 1f ] .
cerebrospinal fluid cytospin preparation from a case of carcinoma breast shows highly cellular smear ( a ) with largely dyscohesive atypical cells ( b ) ; frequent multinucleation ( c ) and cellular cannibalism is evident ( d ) .
individual cells show fine cytoplasmic vacuolations ( e ) and prominent nucleoli ( f ) .
( a : may grunwaldgiemsa , 200 , b : pap , 400 , c - f : pap , 400 )
the cellularity of cytospin csf preparation was high with an abundance of cell clusters , which in the majority of cases exhibited papillary pattern [ figure 2a ] .
case of carcinoma ovary shows tight papillary clusters ( a : pap , 400 ) and cytoplasmic vacuolation ( b : may grunwaldgiemsa , 400 )
singly lying cells with high nuclear cytoplasmic ratio and hyperchromatic nuclei were seen [ figure 3a ] .
intracytoplasmic coarse black granular pigment was identified in a significant number of tumor cells as well as within histiocytes , which failed to stain with iron ( prussian blue ) stain [ figure 3b ] and positive for melanin bleach stain .
cytospin preparation of csf of a case of melanoma displays large atypical cell with high nuclear cytoplasmic ratio present within hemorrhagic background ; coarse black pigment is seen in the cytoplasm of an adjacent degenerated cell ( a : may grunwaldgiemsa , 400 ) .
increase cellularity of singly lying atypical cells is observed in majority of cases of unknown primary site of cancer ( c : pap , 400 ) lung ( 4 ) , stomach ( 2 ) , gallbladder ( 1 ) , prostate ( 1 ) and neurondocrine carcinoma ( 1 ) : no specific features were identified due to a small number of cases .
the tumor cells mainly showed a dyscohesive pattern with singly lying cells having moderate cytoplasm .
one case each of tonsillar carcinoma and papillary carcinoma of thyroid could not be analyzed due to poor staining and cellular preservation .
the tumor cells were present singly in a majority ( 25 ) of the cases [ figure 3c ] .
the site of primary was suggested based on subtle morphologic features ; however , no follow - up could be obtained and exact primary remained unknown .
the tumor cells had moderate cytoplasm and centrally placed nuclei showing mild to moderate nuclear pleomorphism .
this pattern was largely seen in metastatic breast and lung carcinoma [ figure 4a ] .
a case of adenocarcinoma of lung shows singly lying cells with pleomorphic nuclei ( a : pap , 400 ) .
milipore membrane filtration preparation shows a cluster of atypical cells from another case of pulmonary adenocarcinoma ( b : pap , 400 ) .
immunocytochemistry for cytokeartin shows strong cytoplasmic positivity in a case of ovarian carcinoma ( c ) pattern ii consisted of large cells with abundant cytoplasm with frequent cell groupings and clusters . marked cytoplasmic vacuolation was a frequent finding in this group [ figure 2b ] .
pattern iii was characterized by the presence of necrotic debris , inflammatory background with a few tumor fragments .
few lung carcinomas , melanomas and cases of unknown primary showed pattern iii [ figure 4b ] .
immunocytochemistry ( icc ) for ck and ema was performed in 4 cases of breast ( 2 ) and ovarian ( 2 ) carcinoma .
in other cases , icc could not be carried out due to either scanty cellularity or a limited number of diagnostic slides .
further icc for diagnosis of primary site could also not be attempted in any of the cases as the quantity of csf sample obtained was always limited .
leptomeningeal metastasis is a serious complication of cancer that occurs in 5 - 10% of patients with solid tumors and is observed most commonly in patients with breast cancer , lung cancer or melanoma .
nearly , 20% of patients with neurological symptoms and signs are found to have meningeal carcinomatosis at autopsy .
tumor cells reach the leptomeninges by hematogenous spread or by direct extension from lesions and are then disseminated throughout the nervous system by the flow of the csf . unfortunately , false negative results are common . it has been suggested that false negative results can be minimized by withdrawing more csf for cytologic analysis , processing the csf specimen immediately and repeating the procedure if the initial cytology is negative .
although there are ancillary markers or techniques available , which are helpful in detection of csf dissemination such as csf levels of protein , glucose and tumor markers or contrast - enhanced mri , none of these have shown a definite increase in the diagnostic yield compared to the cytological examination .
mri plays an important confirmatory role and can demonstrate involved sites , even in cytology negative cases .
however , almost similar character of enhancement in the presence of infective , inflammatory or neoplastic process is the reason for the restricted specificity of mri . on comparative analysis
, mri is found to have equal sensitivity to csf cytology , but suffers from lesser specificity .
several reports in the literature deal with a comparison of various techniques . in our experience , smears made by cytospin cytocentrifuge technique and one slide each stained by papanicolaou and mgg technique gives the maximum information .
filter membrane preparation may be reserved for cases with low yield or diagnostic problems . in our laboratory , we use filter membrane preparation for the diagnosis of primary cns neoplasms where low yield is expected ; however , this method suffers from the drawbacks of exhaustion of complete fluid ; hence , further ancillary studies can not be carried out .
thin monolayer technology has been suggested as an appropriate diagnostic method for metastatic tumors in csf .
a number of large series have described the statistical information regarding the prevalence of various primary carcinoma sites , which cause nm .
few studies have documented the morphologic peculiarities of carcinoma cells found in the csf depending on the primary sites .
the diagnosis of meningeal involvement is relatively easy when the patient has a history of carcinoma .
patients with neurological signs and symptoms of nm without any known primary site are more difficult to diagnose on cytology unless there is a high index of suspicion .
similar to several previous reports , the most common sites were breast , lung , stomach and melanoma .
we did not come across any squamous cell carcinoma , which is considered a rare diagnosis in csf cytology .
cns metastases occur in approximately 35% of patients with breast cancer , which is associated with poor survival and only 50% of patients with leptomeningeal carcinomatosis are diagnosed .
morphologic analysis of breast carcinoma patients was characterized by the presence of singly scattered isolated cells with minimal aggregation .
this pattern was without characteristics of the original tumor architecture and signifies extensive involvement of the subarachnoid space .
in contrast to earlier reports , characteristic indian file pattern was not conspicuous in our cases . ovarian cancer does not commonly involve the nervous system .
leptomeningeal metastasis is an even rarer complication of ovarian cancer with only a handful cases reported in the literature .
we have identified four cases of ovarian carcinoma in the present series with characteristic cytomorphologic features .
ovarian malignancies showed largely grouping of cells with papillary architecture ( pattern ii ) and prominent cytoplasmic vacuolation , which was degenerative in nature .
pattern iii was characterized by the presence of necrotic material with a few large tumor fragments and the presence of an inflammatory background , which may represent intraparenchymal metastasis ; however , it could not be correlated with imaging studies .
we have identified the same pattern in lung carcinomas , melanomas and cases of unknown primary malignancies .
although , exact site of primary was not identified due to either lack of follow - up or early demise of the patient due to disseminated malignancy , report of positive cytology helped the clinician in the overall management and prognostication of patient .
multidisciplinary therapy , such as radiation and chemotherapy can improve quality - of - life in patients of meningeal metastasis .
role of icc in diagnosis of nm is limited and is of minor help in the problem of false negative cytology .
combined use of conventional cytology and icc leads to a slight increase of sensitivity in detecting malignant cells compared with cytology alone .
an overview of research tools in the field of csf cancer detection reveals a variety of technologies that can be used to understand the biology of metastatic cancer .
methods currently under investigation include new icc methods and flow cytometry for detection of cells .
in addition , polymerase chain reaction , fluorescence in situ hybridization and mass spectrometry are being tested for assessment of the non - cellular biomarkers in csf . in primary cns neoplasms ( ependymoma retinoblastoma , medulloblastoma and pineoblastomas ) , the malignant cells appear in groups of cells , which seldom allow for the histological identification of the original tumor .
however , age of the patient , known diagnosis , high nuclear cytoplasmic ratio and nuclear molding were helpful features to distinguish these from carcinoma cells . in these cases ,
the csf cytology is useful only for confirmation of the presence of malignant cells and has no role in histological definition .
leukemia and lymphoma cells retain original characteristics of the tumor and the severity of the disease is not reflected necessarily in the csf cellularity , which may vary from scanty to elevated . a positive csf cytology result , especially in cases of metastatic non - lymphoreticular neoplasms
therefore , an attempt must be made to differentiate primary cns neoplasms from metastatic tumors on the basis of cytomorphology of tumor cells .
identification of the type of metastatic neoplasm facilitates the detection of the site of the primary neoplasm in such cases .
this study presents cases of nm diagnosed over a period of 20 years at a tertiary care referral center ; however , limited by follow - up information of cases , in which primary site of malignancy remained unknown .
cytologic examination of csf is an important modality to diagnose meningeal involvement by the systemic malignancies .
there are cytomorphologic clues by which this condition is diagnosed and site of primary cancer may be identified .
srm and vki contributed in the design of study , acquisition of data , analysis and interpretation of data .
dj has been involved in drafting the manuscript , revising it critically for important intellectual content , analysis and interpretation of data .
all authors take the responsibility of maintaining relevant documentation of records , slides and other data of cases used in this study on archival material as per the institutional policy .
to ensure the integrity and highest quality of cytojournal publications , the review process of this manuscript was conducted under a double - blind mode ( authors are blinded for reviewers and vice versa ) through automatic online system | background : neoplastic meningitis ( nm ) is a condition characterized by leptomeningeal involvement by metastatic carcinoma .
detection of exfoliated malignant cells in cerebrospinal fluid ( csf ) due to meningeal metastasis is frequently associated with diverse neurologic presentations.materials and methods : in this retrospective study of all cases of nm diagnosed in csf samples over a 20-year period at a tertiary care referral center , the cytomorphologic features were reviewed.results:sixty six cases of nm were identified of which 36 already had an established diagnosis of malignancy while in 30 patients , there was no previously known tumor .
the most common known primary in the former group was breast followed by ovary . single cell pattern , cellular cannibalism , moderate cytoplasm and rounded nuclei were seen in breast and lung tumors . papillary architecture and cytoplasmic vacuolation were seen in the ovarian primaries .
melanin pigment was seen in malignant melanoma.conclusion:csf cytology is an important tool for diagnosis of nm .
cytomorphologic features helped in diagnosis and for prediction of the primary site .
correct identification of this condition is important as it has therapeutic and prognostic implications . |
among the lipid nanoparticles ,
liposomes are widely studied as
drug delivery vehicles .
liposomes protect the encapsulated drugs from being
metabolized during the circulation prior to reaching the target .
the
us food and drug administration has approved liposome - based formulations
for the treatment of several types of cancer . however , upon targeting , the passive release of the encapsulated
drugs from the liposomes is often slow .
reorganization of the lipid domains has been used as a trigger to
enhance , and to control the rate and the extent of contents released
from liposomes . among the various triggers , decreased ph in the lysosomes
has been widely used as a successful strategy to efficiently release
the encapsulated liposomal contents . however , imparting
ph sensitivity to liposomes requires the synthesis of specialized
lipids with structures that are substantially modified , either due
to hydrolysis or due to changes in the protonation states of the lipid
head groups , at reduced ph . stabilized gas bubbles are widely used as contrast - enhancing
agents
for ultrasound imaging of perfused tissues .
there are many reports of ultrasound - mediated drug release from
nanoparticles , liposomes , and other carriers .
although ultrasound waves in the khz frequency efficiently
release drugs from the carriers ( due to cavitation and high local
temperatures ) , the harmful biological effects associated with low - frequency
ultrasound limit the usefulness of such strategies .
to make liposomes responsive to high - frequency ultrasound ,
they need to be coupled with gas pockets .
echogenic liposomes ( elips )
entrap small amounts of air along with the hydrophilic drug in their
aqueous interior , and are currently being developed as drug delivery
vehicles for ultrasound - triggered drug release and simultaneous imaging .
although there is uncertainty about the exact location and size
of the entrapped air bubbles in the elips , their acoustic characterization
has been reported extensively in the literature .
we are developing targeted ,
multimodal liposomes for triggered
release of encapsulated contents , and simultaneous ultrasound imaging .
furthermore , we are interested in enhancing the contents released
from the liposomes by employing diagnostic frequency ( mhz ) ultrasound .
we have recently demonstrated the ultrasound - enhanced , extracellular
release of liposomal contents mediated by the cancer - cell - secreted
enzyme matrix metalloproteinase-9 ( mmp-9 ) . herein , we report a strategy to render liposomes ph sensitive by
encapsulating ammonium bicarbonate which generates gas bubbles in situ in response to acidic ph
. our strategy does not require the use of ph - sensitive lipids in
the liposomal formulations .
we hypothesize that , at a reduced ph ,
the hydronium ions diffuse into the aqueous interior of the liposomes ,
and produce carbon dioxide bubbles , thereby turning on
the echogenicity .
as more bubbles are generated , the liposomal
bilayer is disturbed , leading to the release of encapsulated contents .
we observe that the release was further enhanced by applying ultrasound
with a frequency of 1 mhz . to the best of our knowledge
there are
no reports in the literature of ultrasound enhanced triggered release
from ph - tunable echogenic liposomes .
we have demonstrated the
usefulness of this liposomal delivery
system using the panc-1 pancreatic cancer cells .
pancreatic cancer
is one of the leading causes of cancer - related deaths in both men
and women in the united states , with a 5-year survival rate of less
than 5% . according to the american cancer society ,
38,460 pancreatic cancer related deaths ( almost equally split between
men and women ) occurred in united states in 2013 .
to demonstrate
tunable echogenicity , we prepared the liposomes from 1-palmitoyl-2-oleoyl - sn - glycero-3-phosphocholine ( popc ) , encapsulating 400 mm
ammonium bicarbonate along with the self - quenching dye carboxyfluorescein
( 100 mm ) .
we reasoned that , for multilamellar liposomes , the outside
hydronium ions need to diffuse through several lipid bilayers in order
to generate sufficient amounts of co2 gas inside the liposomes .
the presence of several lipid bilayers was also expected to decrease
the efficiency of the contents released in response to escaping gas
bubbles and ultrasonic excitation .
hence , we decided to formulate
unilamellar liposomes with a narrow size distribution by sonicating
and sequentially extruding ( through 800 and 200 nm polycarbonate membrane
filters ) the initially formed multilamellar vesicles .
we observed
( with dynamic light scattering ) that the average hydrodynamic diameter
of the liposomes is 110 15 nm with a polydispersity index of
0.05 ( supporting information , figure s1a ) .
these results were corroborated with transmission electron microscopic
imaging of the liposomes ( supporting information , figure s1b ) . to demonstrate the tunable echogenicity , we
added the liposomes to buffers with different phs ( 7.45.0 )
and recorded the images using a terason t3200 high - frequency ( 1214
mhz ) diagnostic ultrasound transducer .
we expected that the generated
gas bubbles would reflect the ultrasound , and that the contrast of
the images would be more pronounced as the amount of generated gas
is increased at a lower ph .
we observed that there was a lag time
before the liposomes became echogenic , and that the duration of this
lag phase decreased with the reduced ph .
for example , liposomes in
the ph 7.4 buffer did not show any ultrasound contrast in 10 min .
at ph 6 ,
the liposomes became weakly echogenic in 5 min , but at ph
5 , the liposomes were fairly echogenic within 3 min .
the ultrasound
images for the liposomes in buffers with different ph values after
5 min are shown in figure 1 .
figure 1a shows that there is no echo at ph 7.4 ; but as
the ph is reduced , progressively stronger echo from the entire cell
well is observed ( note that the ultrasound probe is placed at the
top of the cell well ) .
figures 1b and 1c show how the mean and maximum gray scale values
quantitatively change with ph .
the echo from the homogeneous suspension
of liposomes appears as light bands ( figure 1a ) .
they arise
due to interference between echoes from subresolution scatterers such
as liposomes which themselves are far smaller in size than the ultrasound
wavelength .
( a ) ph - dependent diagnostic frequency ultrasound imaging of popc
liposomes encapsulating 400 mm ammonium bicarbonate .
the dotted white
lines represent the regions of interest ( roi ) that were used to calculate
the gray scale values .
( b ) mean gray scale values and ( c ) maximum
gray scale values for the ultrasound images shown in panel a as a
function of ph ( n = 3 ) .
we anticipated that the concentration of hydronium ions in
the
external buffer would affect their diffusion rate inside the liposomes
as well as the subsequent generation of co2 bubbles .
as
the encapsulated ammonium bicarbonate was depleted , the generation
of co2 gas slowed down and finally stopped .
consistent
with this hypothesis , we observed that liposomes in the ph 5 buffer
are not echogenic after 20 min ( figure 2 ) .
however , we noted that the diameters of the gas bubbles inside the
liposomes are likely to be small ( in nanometers ) , and that they may
not reflect the ultrasound very well .
it is likely that the nanobubbles coalesce in the lipid bilayer
of the liposomes , generating larger bubbles , and reflect the ultrasound .
popc lipid has a gel low transition temperature ( 2 c ) ,
and the liposomal bilayer is in the fluid phase under the experimental
conditions ( 20 c ) .
the loose lipid
packing and fluidity of the popc bilayer accommodate the coalescence
and the size increase of the gas bubbles .
diagnostic frequency
ultrasound images of popc liposomes encapsulating
400 mm ammonium bicabonate as a function of frequency and incubation
time in a ph 5 buffer .
the images were acquired by employing high - frequency
( 1215 mhz ; a , b ) , medium - frequency ( 812 mhz ; c , d ) ,
and low - frequency ( 48 mhz ; e , f ) ultrasound transducers .
we analyzed the ultrasound images
shown in figure 1a using the imagej software
( http://rsbweb.nih.gov ) to calculate the mean and maximum
gray scale values for region
of interest ( roi ) shown in figure 1a .
as expected ,
the mean and maximum gray scale values increase with a decreasing
ph .
we observed that the highest gray scale value was observed at
ph 5 , and it does not increase any more below this ph ( data not shown ) .
we also observed a time - dependent decrease in the echogenicity of
these liposomes at ph 5.0 ( figure 2 ) .
these
results demonstrated that liposomes are programmed to reflect the
ultrasound only after reaching the acidic microenvironment of cancer
cells .
having demonstrated ph - tunable echogenicity , we decided to determine
if the escaping gas bubbles sufficiently disturb the lipid bilayer
to release the encapsulated contents from the liposomes .
for this
endeavor , we incubated the popc liposomes ( encapsulating carboxyfluorescein
and 400 mm ammonium bicarbonate ) in buffers with different ph values
( 7.45.0 ) , and monitored the emission intensity of carboxyfluorescein .
however , the emission intensity of carboxyfluorescein is quenched
as the ph is lowered . to correct for
this
decreased emission intensity , we measured the absorption spectra
of carboxyfluorescein as a function of ph , and we determined the isosbestic
point to be 460 nm . subsequently , the dye solution was prepared in
buffers with ph of 7.4 , 6.0 , and 5.0 ; the solution was excited at
460 nm , and the emission spectra were recorded .
we then monitored
the emission of the dye at 497 nm ( excitation : 460 nm ) for 2 h. the
correction factors were calculated at each ph as a function of time ,
and all emission intensities were appropriately corrected for calculating
the percentage released ( supporting information ) .
when the liposomes were incubated in acidic buffers , there
was a time lag before dye release ( figure 3 ) .
however , the liposomes continued to leak the contents for a considerably
long time ( 23 h ) .
the continued leakage indicates that the
disturbances in the lipid bilayers created by the escaping gas bubbles
either are not sealed or take a long time to heal .
representative release
profiles of carboxyfluorescein from popc
liposomes encapsulating 400 mm ammonium bicarbonate .
the liposomes
were incubated in buffers with ph 7.4 ( blue circles ) , ph 6.0 ( purple
triangles ) , and ph 5.0 ( green stars ) .
the lines are generated by connecting
the observed data points . while the liposomes at a ph of 7.4 ( control ) released
only
15%
of the encapsulated dye in 2 h , at a ph of 5 , the release increased
to 55% ( figure 3 ) . when we encapsulated sodium
bicarbonate in the liposomes ( instead of ammonium bicarbonate ) , the
amount of the content release decreased .
in 2 h , we observed that
the sodium bicarbonate encapsulated liposomes released 40% of the
encapsulated dye ( at ph = 5.0 ; supporting information , figures s3 and s4 ) . for both of these liposomal formulations ,
the
rate of contents release decreased considerably after 2 h. in 3 h
at ph 5.0 , the ammonium bicarbonate encapsulated liposomes released
75% of the contents , and the sodium bicarbonate encapsulated liposomes
released 44% of the contents ( figure 4a ) . decreasing
the amount of encapsulated ammonium bicarbonate ( from 400 mm to 200
mm ) also reduced the amount of contents release from the liposomes
( figure 4b ) .
release of encapsulated carboxyfluorescein
from popc liposomes
as a function of ph encapsulating ( a ) 400 mm ammonium bicarbonate
and ( b ) 200 mm ammonium bicarbonate after 3 h ( n =
3 ) .
the acidic decomposition of ammonium
bicarbonate generates nh3 and co2 , while sodium
bicarbonate produces the
sodium salt of the buffer , h2o , and co2
. the
ammonia gas will react with the hydronium ions in the liposome interior ,
leading to a reduction in proton concentration .
the resultant proton
gradient will facilitate the diffusion of more hydronium ions into
the liposomal lumen and generate more co2 gas and ammonia
.
amount of generated gas decreases by reducing the concentration of
encapsulated ammonium bicarbonate ( from 400 to 200 mm ) , leading to
a reduction in contents release from the liposomes ( figure 4b ) . as an additional control , we prepared the popc
liposomes without encapsulating any gas precursor and studied the
contents release as a function of ph .
we observed minimal release
( < 10% ) of the encapsulated carboxyfluorescein at ph 7.4 and 6.0 .
however , at ph 5.0 , about 20% of the dye was released in 2 h ( figure
s5 , supporting information ) .
we do not
have an explanation for this observation yet . in these liposome
formulations
the popc molecules contain the saturated palmitoyl and the
unsaturated oleoyl groups . due to the presence of an alkene in the
z - configuration
, this lipid does not form a tight bilayer , and the
gel transition temperature is also low ( 2 c ) .
it is possible that the loose packing of the
popc lipids will likely allow the escaping co2 bubbles
to coalesce inside the hydrophobic bilayer of the liposomes .
the resulting
larger gas bubbles will disturb the bilayer while escaping , allowing
the contents to leak . to determine if the lipid packing in the liposomal
bilayer and the gel transition temperature affect the contents released ,
we prepared two batches of dspc ( 1,2-distearoyl - sn - glycero-3-phosphocholine ) liposomes that encapsulate ammonium and
sodium bicarbonate respectively ( 400 mm each ) . the dspc molecules
contain two saturated stearoyl groups and form a tight bilayer with
a melting temperature of 56 c .
we
hypothesized that the tightly packed lipid molecules in the bilayer
would hinder the coalescence of the escaping co2 bubbles
generated inside the aqueous core of the liposomes .
in addition ,
the rate of diffusion of the hydronium ions across the lipid bilayer
would be slower compared to the popc bilayer .
we observed that both
ammonium bicarbonate and sodium bicarbonate encapsulated dspc liposomes
released less than 5% of their contents after incubation for 2 h at
a ph of 5.0 ( supporting information , table
s1 ) .
we employed tapping mode atomic force microscopic imaging
to determine
if the escaping gas bubbles caused any structural changes ( shape and
surface morphology ) to the ammonium bicarbonate encapsulated popc
liposomes .
after preparation , the ammonium bicarbonate encapsulated
liposomes ( ph = 7.4 buffer ) were spherical with an average diameter
around 100 nm ( figure 5a ) .
however , after incubating
in a ph 5.0 buffer for an hour , the liposomes fused , and the majority
of the structures showed irregular shapes with sizes up to 800 nm
( figure 5b ) .
these results demonstrated that
the escaping gas bubbles caused permanent changes to the liposomes
morphology , leading to leakage of the encapsulated contents .
( b ) liposomes containing 400 mm ammonium bicarbonate after incubation
in ph 5 buffer for an hour .
( c ) buffer containing liposomes after
incubation in a ph 5 buffer for an hour .
we reasoned that the released gas bubbles inside the liposomes
would allow an additional control on the contents released when employing
high - frequency ultrasound . to test this hypothesis
, we incubated the
ammonium bicarbonate encapsulated ( 400 mm ) popc liposomes in buffers
with ph of 6.0 ( figure 6a ) and 5.0 ( figure 6b ) , and after 5 min , we exposed them to continuous
wave ultrasound ( 1 mhz , 2 w / cm ) for 5 min . when incubated
in a ph 5.0 buffer , 80% of the encapsulated contents were released
from the liposomes in 2 h ( compared to 55% released in the absence
of ultrasound ; figure 6b ) .
the corresponding
content releases were considerably lower in ph 6.0 buffer ( figure 6a ) . decreasing the concentration of encapsulated
ammonium bicarbonate ( from 400 mm to 200 mm ) reduced the amount of
contents released upon the application of ultrasound , to 45% ( figure 7 ) .
we also observed that the applied ultrasound
exerted a maximum effect when applied within 515 min of incubating
the liposomes with the ph 5 buffer .
it is likely that the generated
co2 bubbles escape from the liposomes within 15 min , and
after that time , liposomes become less responsive to ultrasound . during
the imaging studies
, we observed a decrease in the echogenicity of
the liposomes after 15 min of incubation in the ph 5 buffer ( figure 2 ) .
ultrasound - enhanced
( 1 mhz , cw , 2 w / cm , 5 min ) , ph - triggered
release from popc liposomes encapsulating 400 mm ammonium bicarbonate
at ph = 6.0 ( a ) and ph = 5.0 ( b ) .
orange bars : release after 2 h with ultrasound
application ( n = 3 ) .
ultrasound - enhanced ( 1 mhz , cw , 2 w / cm , 5 min ) , ph - triggered
release from popc liposomes encapsulating 200 of mm ammonium bicarbonate
at ph = 6.0 ( a ) and ph = 5.0 ( b ) .
orange bars : release after 2 h with ultrasound
application ( n = 3 ) .
when the ammonium bicarbonate encapsulated popc liposomes
were
incubated in ph 6 buffer , we observed that applying the ultrasound
enhanced the release by 1520% .
contrary to the ph 5 experimental
results , this enhancement in contents release was not strongly dependent
on the time when the ultrasound was applied ( figures 6a and 7a ) . at a ph of 6 ,
the concentration
of hydronium ions was 10 times less compared to that at a ph of 5 .
the lower hydronium ion concentration at a ph of 5 contributed to
a slow generation of gas bubbles inside the liposomes , and it took
longer to consume the encapsulated ammonium bicarbonate .
these two
factors likely contributed to the results observed with ultrasound
at a ph of 6.0 .
we observed that applying ultrasound increased
liposome solutions
temperature from 25 to 30 c .
it is possible that a thermal effect
along with the mechanical effect could be responsible for the content
release . to determine if this temperature change influenced the contents
released from liposomes , we repeated the studies ( in a ph 5 buffer )
in a large ice bath .
the results from these
two experiments were identical , indicating that the temperature increase
did not influence the contents released from our ph - sensitive liposomes . however , we note that one can not rule out the
possibility of local hot spots being generated in the liposomes themselves
even when they are in the ice bath
. such temperature hotspot can only
be created by the mechanical compression of the air cavity entrapped
in the liposomes . having optimized the ultrasound - enhanced
release from the ph - sensitive
liposomes
, we proceeded to demonstrate the effectiveness of the strategy
in cellular studies . to demonstrate efficient cellular internalization
,
we prepared liposomes incorporating 1 mol % 1,2-distearoyl - sn - glycero-3-phosphoethanolamine - n-[folate(polyethylene
glycol)-5000 ] ( ammonium salt , commercially available from avanti polar
lipids ) and popc encapsulating 100 mm carboxyfluorescein .
we selected
the folate receptor overexpressing pancreatic ductal carcinoma cells
( panc-1 ) for our cellular studies . after incubating with the liposomes , we imaged the cells by employing
a confocal fluorescence microscope .
we noticed that liposomes incorporating
1 mol % of the folate lipid were taken up more effectively by the
panc-1 cells compared to the liposomes without the folate lipid ( figure 8) . if the cells had a higher expression of the folate
receptor , the internalization rate was faster .
for example , the breast
cancer cell line mcf-7 internalized the folate lipid containing liposomes
faster compared to the panc-1 cells ( supporting
information , figure s6 ) .
fluorescence microscopic images for the
uptake of ph - tunable , echogenic
popc liposomes encapsulating carboxyfluorescein by the folate receptor
overexpressing panc-1 cancer cells .
images were obtained using different
filters : brightfield ( bf ) , fluorescein isothiocyanate ( fitc , green
fluorescence ) , and 4,6-diamino-2-phenylindole ( dapi , blue
fluorescence ) .
( a ) nontargeted liposomes after 3 h of incubation ( magnification :
20 ) .
( b ) nontargeted liposomes after 6 h of incubation ( magnification :
20 ) .
( c ) folate - targeted liposomes after 3 h of incubation ( magnification :
20 ) . ( d )
folate - targeted liposomes after 6 h of incubation ( magnification :
20 ) .
after confirming cellular
internalization , we encapsulated the anticancer drug doxorubicin in
the popc liposomes and studied its release in the cytosol of the panc-1
cells ( in the absence and presence of applied diagnostic frequency
ultrasound ) .
although gemcitabine is the standard chemotherapeutic
drug for pancreatic cancer , doxorubicin is currently being tested
as a possible adjuvant therapy .
we noted , a priori , that some literature reports question the safety of ultrasound
for healthy tissues surrounding a tumor . to determine
if the ultrasound has any deleterious effects for the
normal cells , we seeded the panc-1 cells onto transwell inserts consisting
of two chambers .
diagnostic frequency ultrasound is reported to pass
through the insert and reach the lower chamber . in this experimental design
, the panc-1 cells in the upper chamber
represented the tumor tissue , receiving direct exposure to the liposomes
as well as the applied ultrasound .
the cells in the lower chamber
represented the neighboring tissue , which may be indirectly exposed
to the treatment ( figure 9a ) .
the pore size
for the transwell insert was 400 nm , and the average diameter for
the liposomes was 110 nm .
hence , we expected that some liposomes and
ultrasound waves would pass
through the membrane to reach the lower chamber .
( a )
panc-1 cell viability studies using live ( green ) and dead ( red )
cell staining of different treatment groups ( n =
3 ) . the upper chamber cells received direct exposure , whereas the
lower chamber cells received indirect exposure to popc liposomes and
ultrasound . ( 1 ) folate - targeted doxorubicin liposomes ( encapsulating
ammonium bicarbonate ) + ultrasound . ( 2 ) nontargeted doxorubicin liposomes
( encapsulating ammonium bicarbonate ) + ultrasound .
( 4 ) folate - targeted liposomes ( encapsulating ammonium
bicarbonate but no doxorubicin ) + ultrasound . ( 5 ) folate - targeted
doxorubicin liposomes ( no ammonium bicarbonate encapsulation ) + ultrasound .
( 6 ) ultrasound only . ( 7 ) no treatment ( control ) .
the final doxorubicin concentration used
was 25 g / ml . ( b ) cell viability of the upper chamber ( orange
bars ) and lower chamber ( violet bars ) . upon reaching confluency , we exposed the upper chamber s
cells to various combinations of targeted / nontargeted doxorubicin - encapsulated
liposomes and ultrasound ( applied between 15 and 20 min of incubation ;
figure 9a ) .
subsequently , we placed the cells
in an incubator for 6 h and stained to visualize the live and dead
cells .
we observed that indirect exposure to any of the treatments
did not cause cell death in the lower chamber ( figures 9a and 9b ) . on the other hand ,
direct
exposure to folate - targeted or nontargeted , ph - tunable , doxorubicin - encapsulated
liposomes and ultrasound led to significant cell death in the upper
chamber ( figures 9a and 9b ) .
we observed that the folate - targeted , doxorubicin and ammonium
bicarbonate encapsulated popc liposomes ( figure 9a-1 ) were more toxic ( 14% cell viability ) compared to the corresponding
liposomes without bicarbonate encapsulation ( cell viability 25% ; figure 9a-5 ) .
it was reported that the cavitation force
of exploding co2 bubbles in the lysosomes mechanically
disrupts the membranes , leading to the release of lysosomal proteolytic
enzymes in the cytosol and to cell death .
contrary to this report , we observed less than 5% cell death in
the presence of liposomes that only encapsulate ammonium bicarbonate
( i.e. , without doxorubicin ; figure 9a-4 ) .
these
results indicated that , in our experiments , cavitation induced by
co2 bubbles enhanced the toxicity of the liposomal formulations . clearly , the folate - targeted doxorubicin liposomes ( encapsulating
ammonium bicarbonate ) in the presence of applied ultrasound were most
effective in killing the panc-1 cells ( figures 9a-1 and 9b , group 1 ) .
this combination reduced
the cell viability to 14% ( figure 9b , group
1 ) .
interestingly , the free doxorubicin in the presence of applied
ultrasound was more effective compared to liposomal doxorubicin ( without
folate ) in inducing cell death ( figures 9a-2
and 9a-3 ) .
it is likely that sonoporation by
the ultrasound is contributing to this effect . in the absence of any
microbubbles , the pores formed in the cell membranes by the applied
ultrasound are likely to be small and transient .
possibly , the sizes
of these transient pores are large enough to allow doxorubicin molecules
to cross the cell membranes .
these observations
are consistent with literature reports demonstrating a higher uptake
of smaller particles compared to larger ones upon sonoporation .
we observed that , under our experimental conditions ,
direct or indirect exposure to the ultrasound does not induce cell
death ( figure 9a-6 ) .
our objective was
not to compare the efficacy of free doxorubicin
in the absence and presence of applied diagnostic - frequency ultrasound .
our goal was to determine the effectiveness of the ammonium bicarbonate
and doxorubicin coencapsulated liposomes when ultrasound is applied .
numerous literature reports demonstrate the efficacy of doxorubicin
for panc-1 cells ( without the applied ultrasound ) ; hence , we did
not include this control experiment .
panc-1 is a metastatic
pancreatic cancer cell line known to secrete
matrix metalloproteinase ( mmp ) -2 and -9 enzymes in the extracellular
matrix .
these two proteolytic enzymes
are responsible for the hydrolysis of the extracellular matrix , leading
to the migration and metastasis of cancer cells
. ultrasound treatment can loosen the extracellular material
surrounding a tumor , resulting in the dissemination of cancer cells
into the bloodstream .
this action leads to increased migration and
metastasis of the cancer cells when exposed to ultrasound . to determine if our experimental conditions
contribute to such effects , we conducted migration assays of the panc-1
cells in the presence of applied ultrasound . for this endeavor
after
6 h , we exposed the cells to ultrasound ( 1 mhz , 5 min ) , incubated
them overnight , and determined their migration .
we observed that there
was no significant difference ( p > 0.01 , n = 5 ) in the migration ability of the ultrasound - exposed
cells compared to the control samples ( no ultrasound exposure ) .
these
results suggested that , within our experimental parameters , the migration
of the panc-1 cells remained unaffected by the applied ultrasound .
further in vivo validation studies with the ammonium
bicarbonate encapsulated liposomes are in progress , and the results
will be reported in the future .
we
have successfully demonstrated the proof - of - concept for a new
strategy to release liposomal contents in response to reduced ph .
with our design ,
the liposomes encapsulate the gas precursor , ammonium
bicarbonate , and do not incorporate ph - sensitive lipids in the bilayer .
when incubated in buffers of acidic ph , co2 gas bubbles
are generated , thus , inducing echogenicity to the liposomes .
the escaping
gas bubbles cause structural changes to the liposomes , and release
the encapsulated contents ( up to 56% ) .
the content release is further
enhanced by the simultaneous application of diagnostic - frequency ultrasound
( 1 mhz , 5 min ; 80% release ) .
the fluidity of the liposomal membranes
plays a crucial role in the contents released . by incorporating a
folate lipid in the bilayer ,
we have successfully targeted the liposomes
to pancreatic cancer cells that overexpress the folate receptor on
the surface .
liposome - encapsulated doxorubicin is efficiently released
in the cancer cells , and the release is enhanced by the simultaneous
application of diagnostic frequency ultrasound .
while the ultrasound
was innocuous , the combination of doxorubicin released from the liposomes
and ultrasound reduced the viability of pancreatic cancer cells to
14% . with further developments
, these liposomes have the potential
to be an excellent option for ultrasound image guided , targeted drug
delivery at tumor sites . | liposomes are representative lipid
nanoparticles widely used for
delivering anticancer drugs , dna fragments , or sirna to cancer cells .
upon targeting ,
various internal and external triggers have been used
to increase the rate for contents release from the liposomes . among
the internal triggers ,
decreased ph within the cellular lysosomes
has been successfully used to enhance the rate for releasing contents .
however
, imparting ph sensitivity to liposomes requires the synthesis
of specialized lipids with structures that are substantially modified
at a reduced ph .
herein , we report an alternative strategy to render
liposomes ph sensitive by encapsulating a precursor which generates
gas bubbles in situ in response to acidic ph .
the
disturbance created by the escaping gas bubbles leads to the rapid
release of the encapsulated contents from the liposomes .
atomic force
microscopic studies indicate that the liposomal structure is destroyed
at a reduced ph .
the gas bubbles also render the liposomes echogenic ,
allowing ultrasound imaging .
to demonstrate the applicability of this
strategy , we have successfully targeted doxorubicin - encapsulated liposomes
to the pancreatic ductal carcinoma cells that overexpress the folate
receptor on the surface . in response to the decreased ph in the lysosomes ,
the encapsulated anticancer drug is efficiently released .
contents
released from these liposomes are further enhanced by the application
of continuous wave ultrasound ( 1 mhz ) , resulting in substantially
reduced viability for the pancreatic cancer cells ( 14% ) . |
interstitial lung diseases ( ild ) are a heterogeneous group of diffuse parenchyma disorders characterized by different grades of fibrosis and inflammation . despite varying pathogenesis
, they are grouped together because of their similar clinical presentation , chest radiographic appearance , histology , and physiological features.1,2 environmental , infectious , or self antigens provoke inflammation which , due to either ongoing antigen exposure or lack of resolution , results in fibrosis .
environmental triggers include silica , metals , and hard metal / organic dust exposure , fungi , or animal proteins .
fungal infections , atypical bacterial pneumonias , or viral pneumonias can result in ild , occurring predominantly in immunocompromised hosts .
primary ild is defined as the absence of underlying disease , whilst immunological diseases , such as systemic sclerosis , systemic lupus erythematosus , or rheumatoid arthritis , are generally responsible for secondary disease.3 idiopathic interstitial pneumonias comprise seven different entities according to their clinical , radiological , and pathological presentation.1 of these , idiopathic pulmonary fibrosis , which corresponds with the histopathological finding of usual interstitial pneumonia , is the prototype of fibrosing ild .
connective tissue diseases , hypersensitivity pneumonitis , and asbestosis can also lead to usual interstitial pneumonia , where abnormal proliferation of mesenchymal cells , especially the occurrence of fibrotic foci , leads to a reticular alteration of lung parenchyma , described as honeycombing.4 however , nonspecific interstitial pneumopathy , which is more typical for secondary ild , shows a diffuse histopathological picture and generally a more inflammatory , cell - rich infiltrate.5,6 patients with ild and lung fibrosis are susceptible to bacterial superinfection .
this is due to primary or iatrogenic immunosuppression , reduced mucus clearance , bacterial colonization , or biofilm production .
long - term treatment strategies similar to those used for cystic fibrosis are rare in ild , with the exception of chronic aspergillus or nontuberculous mycobacterial infection.7 antibiotics serve to reduce the bacterial load and virulence , and also , notably for macrolides , have additional beneficial properties .
azithromycin , clarithromycin , and erythromycin also reduce bacterial adherence and biofilm production , and have an immunomodulatory effect.8 these agents can potentially reinstall tolerance on the one hand and protect the patient from ongoing danger signals and damage produced by bacterial colonization or infections on the other . indeed , positive effects of macrolides have been reported , eg , in patient cohorts with diffuse panbronchiolitis.9 however , the question of whether macrolide treatment is beneficial in ild or lung fibrosis in general , is elusive .
this review gives an overview of the immunology in ild and the possible implications of the immunomodulatory effects of macrolide antibiotics .
according to our current understanding of lung fibrosis , an injury or danger signal leads to parenchymal damage and subsequently triggers lung fibrosis.10 initial inflammation in the form of alveolitis occurs in all forms of ild , although there is often less inflammation in usual interstitial pneumonia than in nonspecific interstitial pneumopathy ( wells au , personal communication ) .
the likely answer is that the normal resolution of inflammation is altered and that tolerance towards the host lung parenchyma is lost . in any case , inflammatory cells induce a th-1/2 imbalance in favor of profibrotic th-2 cytokines , such as interleukin ( il)-4 or il-13 , which are regarded as key drivers of fibrosis.11,12 il-17 produced by th17 t cell subsets has been identified as a further orchestrator of the inflammatory cascade and fibrosis in interstitial lung disease.13,14 once damage has occurred , immune cells of different lineages are activated ( figure 1 ) .
alveolar macrophages , basophils , lymphocytes , and mast cells are described in the inflammatory infiltrate , often with a perivascular distribution.15,16 how they are orchestrated in detail and their effects on stromal cells is not completely understood .
macrophages and monocytes , as members of the innate immune system , produce both proinflammatory and profibrotic cytokines.17 monocytes patrolling on the endothelium are recruited by certain stimuli , such as infection , and then differentiate into macrophages or dendritic cells.18 our research group has found that monocytes of patients with systemic sclerosis express significantly more tissue inhibitors of metalloproteinases than healthy controls ( huigens et al , submitted for publication ) .
in contrast with neutrophils , monocytes persist in the lung parenchyma for up to two months without persistent influx of blood monocytes.19 macrophages also promote fibroblast proliferation and collagen deposition.2 whether monocytes solely express cytokines or differentiate into direct profibrotic cells , such as fibrocytes , pericytes , or myofibroblasts , has not been completely clarified , but it has been reported that , like mesenchymal stem cells , monocytes do have plurigenic properties.20 mast cells belong to the innate immune system .
mast cell activation can be ige - mediated or occur directly via antigens or stimulation of toll - like receptors.21 mast cell degranulation has been observed in ild in several studies.22 mast cell vesicles contain various profibrotic factors , such as il-4 and transforming growth factor beta ( tgf- ) , and mast cells also produce metalloproteinases.23 our group has recently shown that degranulating mast cells are the main source of tgf- in the skin of patients with systemic sclerosis.24 their proximity to fibroblasts and blood vessels may facilitate fibrogenesis .
tgf- is of paramount importance in fibrotic lung disease and also a differentiation factor for th17 cells.25 gene expression profiles of ild lung samples demonstrated a tgf- fingerprint.26 similar to parasitic or allergic inflammation , mast cells , as well as basophils , are likely to be involved in producing a th2-immune response in lung fibrosis.21,27 lymphocytes belong to the adaptive immune system .
they are regularly encountered in the inflammatory infiltrate in ild samples and play an important role by their cytokine production and capacity to trigger ( auto ) antigen - specific immunity . both t cells and b cells
it has been shown in bacterial infection that t regulatory cells express il-10 which protects the tissue from friendly fire by reducing cellular interferon- expression.28
fibrocytes are circulating , bone marrow - derived cd14 cells which can produce collagen.29,30 they have features of both monocytes and stromal cells . in wound healing
, they differentiate into myofibroblasts , yet remain able to present antigen to lymphocytes.31 in animal models of lung fibrosis , circulating fibrocytes are recruited to injured lungs as an integral component of the pathogenesis of pulmonary fibrosis.32 in patients with systemic sclerosis , there are more fibrocytes in the circulation , expressing higher levels of il-10 upon proinflammatory stimulation compared with healthy individuals.33 the concept of fibrocytes being involved in ild is appealing because these cells are derived from an inexhaustible source , the bone marrow , and thus can replenish fibrotic effector cells in the tissue .
despite inflammation still being regarded as essential for fibrogenesis , there is convincing evidence that inflammation and fibrosis can be dissociated .
ongoing epithelial injury and activation can lead to a transdifferentiation of epithelial cells into mesenchymal cells , a process known as epithelial mesenchymal transition , which occurs when epithelial cells lose cell cell attachment , undergo cytoskeletal remodeling , and finally obtain a mesenchymal phenotype .
this process is considered to be a key factor for fibrogenesis in general , and epithelial
mesenchymal transition in alveolar epithelial cells is initiated by several factors , notably tgf- , which certainly is a main stimulatory factor for epithelial
mesenchymal transition in ild.34,36 however , several other factors , such as fibroblast growth factor , and also endothelin-1 and reactive oxygen species , can be responsible for epithelial mesenchymal transition.34
the source of these free radicals is typically inflammatory stimuli.37 regardless of the cause , tissue damage leads to oxidative stress.38 in lung inflammation , an increased oxygen burden mainly arises from the accumulation of inflammatory cells , including macrophages and neutrophils , which show an exaggerated release of oxygen radicals.39 nitric oxide species increase fibroblast proliferation.40 increased expression of nitric oxide species has been described in unclassified pulmonary fibrosis , and expression of nitric oxide species has been detected also during experimental granuloma formation in vitro and in granulomatous inflammation caused by silica , zymosan , and dextran beads in vivo.4143
according to current consensus , usual interstitial pneumonia in its classical presentation is generally not caused by infection .
notwithstanding , atypical pneumonias can lead to fibrosing ild , with a picture similar to cryptogenic organizing pneumonitis.1 in a recent case series , four patients with pulmonary histoplasmosis developed ild , all of them showing different forms of inflammation .
one had bron - chocentric granulomatosis , one had pulmonary alveolar proteinosis , one had diffuse alveolar damage , and , in one biopsy , the clinical manifestations suggested tuberculous primo - infection with systemic dissemination.44 in another study of patients with tuberculosis , atypical mycobacterial infections , or sarcoidosis , it was demonstrated that alpha - smooth muscle actin as a marker of fibrosis , is expressed around both necrotic and non - necrotic granulomas .
alpha - smooth muscle actin expression was higher in the granulomas of patients with mycobacterial infection than in those with sarcoidosis.45 this shows that the etiology of inflammation is important for fibrogenesis , rather than inflammation per se , and it is more likely that ild occurs in individuals with a genetic predisposition.46 these individuals are more likely to develop autoinflammation and , in some cases , also autoimmunity with identified ( self ) antigens .
one can argue that in certain patients suffering from atypical pneumonia , antibiotic treatment , eg , with macrolides or quinolones , may prevent autoinflammation or autoimmunity .
it remains unclear whether bacterial superinfection ild directly triggers fibrosis in individuals with underlying ild .
however , cystic fibrosis demonstrates that infections do accelerate deterioration of lung fibrosis , and antibiotic treatment or prophylaxis reduces mortality in these patients .
macrolides , such as erythromycin , clarithromycin , and azithromycin , are antibiotic compounds which are effective against gram - positive and gram - negative bacteria , including streptococci , haemophilus influenzae , staphylococci , mycoplasma , mycobacteria , rickettsia , and chlamydia .
apart from their established antibacterial effects , there is growing evidence for anti - inflammatory properties of macrolides in chronic respiratory diseases , such as diffuse panbronchiolitis , asthma , cystic fibrosis , or chronic bronchitis.8,9 macrolides share a macrocyclic lactone ring with other immunosuppressive substances , such as rapamycin.47 their antimicrobial and possibly immunosuppressive effect is exerted by binding to the 50s ribosomes of prokaryotic and eukaryotic organisms , affecting protein synthesis.48 interestingly , the immunomodulatory effect is limited to macrolides which share a 14-member ring , and the dose required for immunomodulation is lower compared with the dose necessary for antimicrobial activity .
in patients with cystic fibrosis , long - term treatment with azithromycin achieved a better forced expiratory volume in one second and fewer exacerbations than placebo.49 apart from the simple killing of bacteria , this effect seems to be supported by reducing bacterial adherence , inhibiting biofilm formation , and decreasing microbiological virulence.50 macrolides not only accumulate in bacteria , but also in host leukocytes.47 they have an inhibitory effect on proinflammatory cytokines , such as tumor necrosis factor- , il-1 , and nitric oxide .
in contrast , macrolides increase the expression of il-10 , one of the most important anti - inflammatory cytokines produced by t or b regulatory cells.51 il-10 is central in protecting host tissue during an infection by inhibiting the synthesis of interferon gamma by both t cells and natural killer cells and the synthesis of nitric oxide by macrophages ( figure 2).52 the exact mechanism by which cellular cytokines are either upregulated or downregulated by macrolides is not clear .
it seems that suppression of nuclear factor-b and an increase in cyclic adenosine monophosphate levels are involved.8,53 another important observation is that macrolides accelerate apoptosis of neutrophils and other leukocytes and the removal of cell debris by macrophages , respectively.54 proapoptotic effects has also been postulated for improvement of mucosa - associated lymphoid tissue tumors under long - term macrolide therapy.55 macrolide treatment has also been shown to reduce superoxide and elastase release from human leukocytes.56 positive effects of macrolides have been achieved in patients with cryptogenic organizing pneumonia and radiation - related ild .
however , these effects have only been observed in small case studies , and need to be confirmed in controlled trials .
although infection does not cause usual interstitial pneumonia , bacteria can trigger ild and probably contribute secondarily to the progression of idiopathic interstitial pneumonias in general .
macrolides are safe and effective against a broad range of bacteria , some of which are responsible for ild . apart from their antimicrobial effects
. these might protect individuals from ild progression by interfering with cytokine production , oxygen stress reduction , and host - pathogen interactions .
chronic low - dose macrolide therapy has been successful in patients suffering from diffuse panbronchiolitis and other chronic inflammatory airway diseases , including ild or lung fibrosis , but there are no randomized , placebo - controlled trials available . | interstitial lung disease ( ild ) and lung fibrosis are characterized by different grades of fibrosis and inflammation .
persistent low - grade inflammation is believed to play a major pathogenic role , leading to an imbalance of cytokines , growth factors , and tissue proteinases . recruited monocytes and macrophages play a pivotal role through their cytokine expression and possibly differentiation into fibrocytes , pericytes , or myofibroblasts .
atypical bacterial infections can cause ild , although not usually in the form of usual interstitial pneumonia . on the other hand ,
bacterial colonization is frequently encountered in patients with chronic fibrotic lung disorders , and patients regularly undergo antibacterial treatment . as demonstrated in patients with diffuse panbronchiolitis and other chronic respiratory disorders , treatment with macrolides can be beneficial .
this is partly explained by their antimicrobial effects but , for macrolides , immunomodulatory properties have been identified which might also be beneficial in patients with ild or lung fibrosis .
this article reviews the immunology of lung fibrogenesis and putative implications of macrolides for reinstallation of tolerance . |
since many decades , bioactive heterocyclic compounds are one of the main topics of interest for the medicinal chemists as it displays a number of pharmacological activities .
nitrogen , sulphur , and oxygen containing five- and six - membered heterocyclic compounds have occupied enormous significance in the field of medicinal chemistry .
the multicomponent reactions ( mcrs ) have emerged as an efficient and powerful tool in modern synthetic organic chemistry allowing the facile creation of several new bonds in a one - pot reaction .
therefore , in the last decade , research in academia and industry has increasingly emphasized the use of mcrs as well as domino reaction sequences for a broad range of products [ 1 , 2 ] . due to the atom economy ,
convergent character , and simplicity of one - pot procedures , multicomponent condensation reactions ( mcrs ) have an advantageous position among other reactions .
the discovery and development of novel mcrs is receiving a growing interest from industrial chemistry research groups and represents a new challenge for organic chemists and to the basic understanding of organic chemistry itself .
recently , intensive studies have been focused on the development of catalytic systems owing to their importance in synthetic organic chemistry .
one of the most attractive synthetic strategies favoured by organic chemists is the use of heterogeneous catalyst in increasing the efficiency of a wide range of organic synthesis .
heterogeneous catalysis is being used in the fine chemical industries because of the need for more environmental friendly production technology . this tendency is assisted by the availability of catalytic materials and modern techniques of creating and investigating specific active sites on catalyst surfaces [ 4 , 5 ] .
metal oxides exhibit both lewis acid and lewis base character at their surface . the basic skeleton of chalcones possesses an , -unsaturated carbonyl group , used as the starting material for the synthesis of variously substituted different sized heterocycles of physiological importance like antiviral , antimalarial [ 810 ] , antileishmanial [ 11 , 12 ] , antioxidant , anticancer [ 14 , 15 ] , and antimicrobial .
pyrimidines and its derivatives are known as an important class of heterocyclic compounds in the pharmaceutical industry as well as in synthetic chemistry . on the other hand ,
the pyrimidines unit is a privileged heterocyclic motif that forms the core of a large family of nucleic acids and natural products with strong bioactivity profiles and significant structural properties .
keeping in view of diverse biological activities of pyrimidines , it was thought to construct a novel system which may combine these bioactive rings together in a single molecular framework to see the additive effects towards their biological activities .
hence , as a part of our ongoing program to develop efficient and robust methods for the preparation of biologically relevant compounds , we have developed a facile and efficient catalytic approach for the multicomponent one - pot synthesis of novel 2-substituted-4,6-diarylpyrimidines ( scheme 1 ) .
s - benzylthiouronium chloride ( sbt ) and dicyandiamide ( dda ) have emerged from our laboratory team as versatile reagents for the continued synthesis of 2 , 4 , 6-tri substituted pyrimidines from , -unsaturated ketones and heterocyclic secondary amines .
consequently , facile synthesis of substituted pyrimidines was carried out using sbt , , -unsaturated ketones and organic bases under microwave irradiation with or without solvents .
to the best of our knowledge , there is no report available in the literature describing the use of zno as a catalyst for the synthesis of pyrimidine derivatives .
the surface area of the catalyst increases tremendously when size decreases and is responsible for the higher catalytic activity .
the effectiveness of the process was studied by comparing the results obtained with and without catalyst under normal conditions .
herein , we wish to report a novel synthesis of 4,6-diaryl-2-(4-morpholinyl/1-pyrrolidinyl/1-piperidinyl)-pyrimidines using zno as an efficient , nontoxic , reusable , and commercially available catalyst .
as a part of our ongoing research interest aimed at developing new synthetic strategies for the bioactive heterocyclic framework , the reaction of chalcones , s - benzylthiouronium chloride , and heterocyclic secondary amines was examined in the presence of catalytic amount ( 15 mol% ) of zno under stirring condition at 100c for 6 hour to give 2-substituted-4,6-diarylpyrimidine derivatives up to quantitative yields . a conceivable mechanism for the formation of the product would be as follows : the zno particle facilitates the michael addition type coupling through lewis acid sites ( zn ) coordinated to the enone functionality . on the other hand , zno particles can activate sbt so that deprotonation of the n
h bond occurs in the presence of lewis basic sites ( o ) . as a result ,
the formation of 4,6-diaryl-2-benzylthiopyrimidines proceeds by activation of reactants through both lewis acids and basic sites of zno catalyst and then nucleophilic substitution occurs by heterocyclic secondary amines and afforded 4,6-diaryl-2-(4-morpholinyl/1-pyrrolidinyl/1-piperidinyl)-pyrimidines .
the catalyst could be recovered easily by solvent extraction of the product from the reaction mixture . for this
, ethyl acetate was used ; the aqueous layer containing the zno particles could be used for the next cycle .
the reaction was optimized for various reaction parameters such as temperature , solvent , and catalyst loading .
the effect of temperature on the yield of product was monitored from 60 to 120c ( table 1 , entry 3b ) .
however , no further increase in the yield was obtained by increasing the temperature from 100 to 120c .
an attempt to catalyze the reaction in the absence of solvent resulted in very low yields ( table 2 , entry 3b ) . among the various solvents
studied , dmf was found to be the best solvent giving maximum yield of desired product .
catalyst concentration was optimized by varying its concentration from 5 to 20 mol% ( table 3 , entry 3b ) .
increase in the product yield was observed form 5 to 20 mol% of catalyst amount .
the transformations of the reacting species were also confirmed by the spectroscopic studies . in ftir ,
the disappearance of band at 16801710 cm was due to the carbonyl group of chalcone , the appearance of band at 15951630 cm due to cyclization , and in h nmr the appearance of multiplet at 3.403.90 for the ch2n
the catalyst was recovered by filtration from the reaction mixture and reused during three consecutive runs without any apparent loss of activity for the same reaction figure 1 . in order to confirm the effective involvement of zno catalyst during transformation
we have developed a simple , economic , eco - friendly and highly efficient synthetic strategy for exclusive synthesis of 2-substituted-4,6-diarylpyrimidines using inexpensive , recyclable , and commercially available catalyst .
on the other hand , zno is remarkably easier to use , nonhazardous , inexpensive , and works under mild conditions .
chemicals were purchased from sigma - aldrich , merck , and used without further purification .
h- and c nmr spectra were recorded using ( cdcl3 ) on 400 mhz h nmr spectrometer bruker av iii .
the chemical shifts are denoted in units ( ppm ) relative to tms ( = 0.00 ) for protons h : s ( singlet ) , t ( triplet ) , and m ( multiplet ) .
melting points ( c ) were measured in open glass capillaries using a veego ( vmp - mp ) melting point apparatus and are uncorrected .
infrared spectra ( , cm ) were recorded on a perkin - elmer spectrophotometer model rx i. elemental analyses ( c , h , n ) were in full agreement with the proposed structures within 0.5% of the theoretical values on a carlo erba 1108 analyzer .
monitoring the reactions and checking the purity of the final products were carried out by thin layer chromatography ( tlc ) using silica gel precoated aluminum sheets ( merck , 60120 mesh ) and visualization with ultraviolet light ( uv ) at 365 nm and 254 nm .
the starting compounds ( chalcones ) were prepared by the claisen - schmidt condensation . a mixture of substituted chalcone ( 0.002 mol ) , sbt ( 0.0022 mol ) , heterocyclic secondary amine ( 0.0024 mol ) , and zno ( 15 mol% ) in dmf ( 10 ml ) was taken in a 100 ml round bottomed flask and heated at 100c temperature for 6 h under vigorous stirring .
after completion of the reaction as indicated by tlc [ benzene : ethylacetate , 9 : 1v / v ] , reaction mixture was cooled at room temperature and filtered to separate the catalyst .
removal of the excess of solvent under reduced pressure gave crude solid which on recrystallization afforded the title products .
ir ( kbr ) : 3460 , 3115 , 1598 , 1481 , 1253 cm .
h nmr ( 400 mhz , cdcl3 ) : 3.453.65 ( m , 4h , ch2n
ch2 ) , 6.807.30 ( m , 5h , ar - h ) , 7.70 ( s , 1h ) , 8.488.62 ( m , 2h ) , 12.05 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 47.52 , 69.51 , 123.80 , 126.45 , 128.65 , 130.23 , 143.46 , 148.53 , 150.50 , 155.90 ppm .
calcd for c20h17n5o6 : c 56.74 ; h 4.05 ; n 16.54 . found : c 56.70 , h 3.99 , n 16.49 .
( 3b ) .
ir ( kbr ) : 3469 , 3125 , 1600 , 1478 , 1252 , 861 cm .
h nmr ( 400 mhz , cdcl3 ) : 3.503.70 ( m , 4h , ch2n
ar - h ) , 7.80 ( s , 1h ) , 8.258.55 ( m , 2h ) , 12.00 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 47.45 , 68.60 , 123.85 , 125.80 , 128.80 130.23 , 142.45 , 148.50 , 151.12 , 155.90 , 159.53 ppm ms
calcd for c20h16brn5o6 : c 47.83 ; h 3.21 ; n 13.94 . found : c 47.81 , h 3.18 , n 13.92 .
ir ( kbr ) : 3462 , 3116 , 1595 , 1475 , 1250 , 863 cm .
h nmr ( 400 mhz , cdcl3 ) : 3.553.70 ( m , 4h , ch2n
ch2 ) , 6.887.45 ( m , 4h , ar - h ) , 7.78 ( s , 1h ) , 8.458.63 ( m , 2h ) , 12.10 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 47.42 , 68.90 , 124.81 , 126.15 , 127.80 131.25 , 141.15 , 148.20 , 152.10 , 155.35 , 158.50 ppm .
calcd for c20h16brn5o6 : c 47.83 ; h 3.21 ; n 13.94 . found : c 47.85 , h 3.17 , n 13.90 .
ir ( kbr ) : 3465 , 3115 , 1598 , 1471 , 1253 , 810 cm .
h nmr ( 400 mhz , cdcl3 ) : 3.453.75 ( m , 4h , ch2n
ch2 ) , 6.807.20 ( m , 4h , ar - h ) , 7.75 ( s , 1h ) , 8.408.60 ( m , 2h ) , 11.90 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 47.45 , 68.60 , 123.85 , 125.80 , 128.80 130.23 , 142.45 , 148.50 , 151.12 , 155.90 , 159.53 ppm .
calcd for c20h16cln5o6 : c 52.47 ; h 3.52 ; n 15.30 . found : c 52.43 , h 3.51 , n 15.28 .
( 3e ) .
ir ( kbr ) : 3473 , 3118 , 1593 , 1480 , 1256 , 821 cm .
h nmr ( 400 mhz , cdcl3 ) : 3.503.65 ( m , 4h , ch2n
ch2 ) , 6.857.25 ( m , 4h , ar - h ) , 7.70 ( s , 1h ) , 8.458.62 ( m , 2h ) , 9.80 ( s , 1h , ar - oh ) , 12.00 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 47.05 , 68.15 , 124.80 , 125.95 , 129.15 , 131.45 , 144.23 , 148.15 , 150.36 , 155.90 , 159.95 ppm .
calcd for c20h17n5o7 : c 54.67 ; h 3.90 ; n 15.94 . found : c 54.55 , h 3.81 , n 15.78 .
( 3f ) .
ir ( kbr ) : 3468 , 3111 , 1605 , 1479 , 1258 , 818 cm .
h nmr ( 400 mhz , cdcl3 ) : 3.503.78 ( m , 4h , ch2n
ch2 ) , 6.657.05 ( m , 4h , ar - h ) , 7.55 ( s , 1h ) , 8.428.61 ( m , 2h ) , 12.10 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 47.05 , 68.95 , 123.48 , 126.95 , 128.35 , 131.55 , 144.25 , 148.86 , 150.85 , 156.25 , 159.25 ppm . ms m / z 457 ( m ) .
calcd for c20h16cln5o6 : c 52.47 ; h 3.52 ; n 15.30 . found : c 52.41 , h 3.49 , n 15.29 .
ir ( kbr ) : 3460 , 3114 , 1600 , 1472 , 1258 , 820 cm .
h nmr ( 400 mhz , cdcl3 ) : 3.553.78 ( m , 4h , ch2n
ch2 ) , 6.657.08 ( m , 4h , ar - h ) , 7.58 ( s , 1h ) , 8.428.61 ( m , 2h ) , 12.08 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 47.05 , 68.95 , 124.48 , 125.95 , 127.35 , 131.55 , 145.25 , 147.52 , 150.85 , 156.65 , 159.25 ppm .
calcd for c20h16cln5o6 : c 52.47 ; h 3.52 ; n 15.30 . found : c 52.40 , h 3.45 , n 15.23 .
( 4a ) .
ir ( kbr ) : 3462 , 3115 , 1598 , 1475 , 1266 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.701.90 ( m , 4h , ch2ch2 ) , 3.723.90 ( m , 4h , ch2n
ch2 ) , 6.807.20 ( m , 4h , ar - h ) , 7.35 ( s , 1h ) , 8.418.63 ( m , 2h ) , 11.80 ( s , 1h , ar - oh ) ppm . c nmr ( 400 mhz , cdcl3 ) : 25.23 , 27.68 , 47.80 , 123.15 , 126.26 , 128.30 , 130.13 , 143.50 , 148.45 , 155.30 ppm .
calcd for c20h17n5o5 : c 58.97 ; h 4.21 ; n 17.19 . found : c 58.93 , h 4.18 , n 17.15 .
ir ( kbr ) : 3460 , 3112 , 1595 , 1477 , 1258 , 868 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.701.93 ( m , 4h , ch2ch2 ) , 3.613.79 ( m , 4h , ch2n
ch2 ) , 6.907.25 ( m , 4h , ar - h ) , 7.61 ( s,1h ) , 8.418.62 ( m , 2h ) , 12.01 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 25.25 , 27.96 , 46.45 , 124.45 , 126.85 , 129.80 , 130.50 , 142.50 , 147.22 , 148.87 , 155.58 , ms m / z 486 ( m ) .
calcd for c20h16brn5o5 : c 49.40 ; h 3.32 ; n 14.40 . found : c 49.38 , h 3.28 , n 14.35 .
( 4c ) .
ir ( kbr ) : 3468 , 3121 , 1603 , 1478 , 1265 , 865 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.711.98 ( m , 4h , ch2ch2 ) , 3.523.75 ( m , 4h , ch2n
ch2 ) , 6.907.35 ( m , 4h , ar - h ) , 7.70 ( s , 1h ) , 8.408.60 ( m , 2h ) , 11.95 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 25.56 , 27.25 , 47.00 , 124.56 , 126.12 , 129.11 , 130.50 , 141.00 , 146.00 , 148.56 , 155.01 .
calcd for c20h16brn5o5 : c 49.40 ; h 3.32 ; n 14.40 . found : c 49.37 , h 3.31 , n 14.37 .
( 4d ) .
ir ( kbr ) : 3470 , 3120 , 1596 , 1481 , 1261 , 815 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.701.90 ( m , 4h , ch2ch2 ) , 3.523.70 ( m , 4h , ch2n
ch2 ) , 7.007.35 ( m , 4h , ar - h ) , 7.70 ( s , 1h ) , 8.358.55 ( m , 2h ) , 12.00 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 25.05 , 27.89 , 47.78 , 125.05 , 126.56 , 129.55 , 130.02 , 140.15 , 146.85 , 147.95 , 155.85 , 159.36 ppm .
calcd for c20h16cln5o5 : c 54.37 ; h 3.65 ; n 15.85 . found : c 54.35 , h 3.60 , n 15.81 .
ir ( kbr ) : 3455 , 3110 , 1600 , 1475 , 1258 , 818 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.701.92 ( m , 4h , ch2ch2 ) , 3.553.73 ( m , 4h , ch2n
ch2 ) , 6.857.25 ( m , 4h , ar - h ) , 7.75 ( s , 1h ) , 8.418.60 ( m , 2h ) , 9.56 ( s , 1h , ar - oh ) , 12.01 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 25.05 , 27.80 , 47.06 , 124.00 , 126.45 , 128.05 , 130.54 , 139.25 , 146.02 , 147.30 , 156.26 , 159.80 ppm .
calcd for c20h17n5o6 : c 56.74 ; h 4.05 ; n 16.54 . found : c 56.65 , h 3.92 , n 16.42 .
( 4f ) .
ir ( kbr ) : 3470 , 3135 , 1615 , 1469 , 1245 , 819 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.651.88 ( m , 4h , ch2ch2 ) , 3.583.78 ( m , 4h , ch2n
ch2 ) , 6.857.20 ( m , 4h , ar - h ) , 7.65 ( s , 1h ) , 8.358.55 ( m , 2h ) , 12.00 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 25.05 , 27.80 , 47.12 , 124.45 , 126.85 , 127.00 , 129.50 , 141.00 , 146.01 , 147.86 , 156.14 , 159.15 ppm .
ir ( kbr ) : 3475 , 3131 , 1612 , 1470 , 1248 , 822 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.681.86 ( m , 4h , -ch2-ch2- ) , 3.583.80 ( m , 4h , ch2n
ch2 ) , 6.827.20 ( m , 4h , ar - h ) , 7.65 ( s , 1h ) , 8.338.52 ( m , 2h ) , 12.02 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 25.08 , 27.82 , 47.12 , 123.45 , 125.80 , 127.05 , 129.55 , 141.06 , 147.05 , 147.86 , 156.20 , 159.10 ppm .
calcd for c20h16cln5o5 : c 54.37 ; h 3.65 ; n 15.85 . found : c 54.30 , h 3.60 , n 15.80 .
( 5a ) .
ir ( kbr ) : 3460 , 3119 , 1599 , 1479 , 1259 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.401.62 ( m , 6h , (ch2)2 ) , 3.403.71 ( m , 4h , ch2n
ch2 ) , 3.79 ( s , 3h , ar - och3 ) , 6.907.20 ( m , 4h , ar - h ) , 7.65 ( s , 1h ) , 8.358.60 ( m , 2h ) , 11.25 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz cdcl3 ) : 25.20 , 27.35 , 47.55 , 123.75 , 128.54 , 130.55 , 143.85 , 148.75 , 150.45 , 155.90 ppm .
found : c 59.80 , h 4.49 , n 16.68 .
( 5b ) .
ir ( kbr ) : 3465 , 3111 , 1605 , 1481 , 1261 , 855 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.301.58 ( m , 6h , (ch2)3 ) , 3.453.72 ( m , 4h , ch2n
ch2 ) , 6.607.00 ( m , 4h , ar - h ) , 7.65 ( s , 1h ) , 8.308.55 ( m , 2h ) , 11.90 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 25.42 , 27.40 , 47.75 , 124.00 , 129.15 , 130.05 , 143.15 , 148.00 , 148.85 , 150.04 , 155.00 ppm .
calcd for c21h18brn5o5 : c 50.41 ; h 3.63 ; n 14.00 . found : c 50.38 , h 3.61 , n 13.98 .
ir ( kbr ) : 3460 , 3115 , 1610 , 1490 , 1255 , 861 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.301.50 ( m , 6h , (ch2)2 ) , 4.404.71 ( m , 4h , ch2n
ch2 ) , 6.907.35 ( m , 4h , ar - h ) , 7.70 ( s , 1h ) , 8.458.62 ( m , 2h ) , 11.65 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 25.45 , 27.40 , 47.80 , 124.65 , 129.00 , 129.95 , 143.58 , 147.05 , 148.95 , 151.15 , 155.65 ppm .
calcd for c21h18brn5o5 : c 50.41 ; h 3.63 ; n 14.00 . found : c 50.37 , h 3.65 , n 14.02 .
( 5d ) .
ir ( kbr ) : 3469 , 3118 , 1603 , 1479 , 1253 , 802 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.401.65 ( m , 6h , (ch2)2 ) , 3.423.65 ( m , 4h , ch2n
ch2 ) , 6.957.35 ( m , 4h , ar - h ) , 7.66 ( s , 1h ) , 8.428.65 ( m , 2h ) , 12.00 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 25.55 , 27.05 , 47.80 , 124.15 , 129.45 , 130.02 , 143.15 , 147.00 , 148.23 , 151.01 , 156.35 ppm . ms m / z 455 ( m ) .
calcd for c21h18cln5o5 : c 55.33 ; h 3.98 ; n 15.36 . found : c 55.31 , h 3.95 , n 15.33 .
( 5e ) .
ir ( kbr ) : 3468 , 3121 , 1596 , 1471 , 1261 , 820 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.481.68 ( m , 6h , (ch2)3 ) , 3.483.71 ( m , 4h , ch2n - ch2 ) , 6.927.25 ( m , 4h , ar - h ) , 7.65 ( s , 1h ) , 8.428.60 ( m , 2h ) , 8.56 ( s , 1h , ar - oh ) , 12.10 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 25.50 , 27.23 , 47.56 , 124.15 , 130.01 , 131.55 , 143.50 , 147.48 , 148.01 , 150.45 , 156.85 , 159.50 ppm . ms m / z 437 ( m ) .
calcd for c21h19n5o6 : c 57.66 ; h 4.38 ; n 16.01 . found : c 57.51 , h 4.25 , n 15.92 .
( 5f ) .
ir ( kbr ) : 3464 , 3118 , 1601 , 1468 , 1258 , 809 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.351.53 ( m , 6h , (ch2)3 ) , 3.483.70 ( m , 4h , ch2n
ch2 ) , 6.807.30 ( m , 4h , ar - h ) , 7.60 ( s , 1h ) , 8.358.58 ( m , 2h ) , 12.00 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 25.21 , 27.23 , 47.15 , 124.56 , 130.00 , 131.35 , 141.52 , 146.14 , 148.45 , 151.56 , 156.42 , 159.23 ppm .
calcd for c21h18cln5o5 : c 55.33 ; h 3.98 ; n 15.36 . found : c 55.31 , h 3.95 , n 15.30 .
ir ( kbr ) : 3466 , 3120 , 16012 , 1465 , 1258 , 810 cm .
h nmr ( 400 mhz , cdcl3 ) : 1.351.55 ( m , 6h , (ch2)3 ) , 3.453.71 ( m , 4h , ch2n
ch2 ) , 6.787.32 ( m , 4h , ar - h ) , 7.65 ( s , 1h ) , 8.358.58 ( m , 2h ) , 12.02 ( s , 1h , ar - oh ) ppm .
c nmr ( 400 mhz , cdcl3 ) : 25.21 , 27.25 , 47.20 , 123.50 , 131.02 , 132.30 , 140.51 , 145.18 , 147.41 , 150.55 , 157.40 , 160.20 ppm .
calcd for c21h18cln5o5 : c 55.33 ; h 3.98 ; n 15.36 . found : c 55.28 , h 3.92 , n 15.25 . | a simple and efficient protocol is developed for the synthesis of 2-substituted-4,6-diarylpyrimidines from one - pot three - component reaction of 4-hydroxy-3,5-dinitro substituted chalcones , s - benzylthiouronium chloride ( sbt ) , and heterocyclic secondary amines ( morpholine / pyrrolidine / piperidine ) in the presence of 15 mol% of zno as a heterogeneous catalyst .
the present methodology offers several advantages such as being a simple procedure as well as providing excellent yields , and short reaction time .
the catalyst is inexpensive , stable , and can be easily recycled and reused for several cycles with consistent activity . |
the conventional oral examination ( coe ) or viva voce is an important format of assessment that allows probing of breadth and depth of the knowledge .
currently , this method is an integral part of formative and summative examinations in various medical universities in india .
coe is criticized for being too subjective and being influenced by academic and nonacademic factors related to teachers and students .
it may largely depend on the knowledge , attitude ( offering verbal / nonverbal clues and prompting ) , and mood of examiners .
the process related factors are leniency , central tendency , halo effect , and error of contrast .
studies have shown that scores are directly proportional to the number of words spoken by examiner and time taken by him .
another pitfall of viva voce is that unequal distribution of time , that is , initially appearing students may be asked greater number of questions but as time passes , an element of fatigue ensues in examiners , and thus students giving viva in last get much less time .
the outcome of this is that award of marks is based on just 23 questions asked .
this is because different examiners use a different set of questions with varying difficulty levels .
student related factors include gender , accent and vocabulary used , and ability to pick nonverbal cues .
these factors make coe less reliable and valid assessment tool for criterion - reference system , where the intention is to ascertain achievement of predetermined level of knowledge .
it is flexible , driven by student 's responses , and tests several aspects of clinical competence and ability to defend the decision in a given clinical situation that can not be tested by written examinations .
it can evaluate the depth of knowledge , application and analyzing capability , ethics and professionalism .
a correlation is found between viva and written components of final summative examination in pharmacology .
similarly , a longitudinal study of oral practical examination within a medical program revealed internal consistency and reliability of oral examination identifying a positive correlation to in - training examination and faculty evaluation scores . to overcome the limitations of this useful tool , a few modifications are suggested such as chart - stimulated reviews , models , problem - based learning , objective structuring of clinical and practical examination , targeted viva , and structured oral examination ( soe ) .
the soe is relatively a new phenomenon and a number of studies , conducted on small groups , have shown it to be reasonably reliable and valid , and both faculty and students show positive perception toward this examination tool . at present
, little is known about the implementation of soe in a large group of 150250 students in a batch . because soe is a resource - intensive and time - consuming exercise , it is of utmost importance to understand the feasibility and process of implementation and factors which determine its implementation in large groups consisting of 150250 students for pharmacology examination on regular basis .
the present study was designed with the primary objective to understand the process of implementation of structured viva voce examination and compare this method with the coe .
other objectives were to find the suitability of soe in its present form , compare marks obtained and perceptions of students , and to obtain the feedback of faculty regarding this format .
this study was conducted on the second professional students ( 140 students ) studying at a tertiary care hospital and medical college of north gujarat .
the students were informed about the date of the examination 15 days prior to the examination .
the marks obtained by the students in this study would not be counted in their formative or summative assessment .
the students were randomly divided into four groups ( a d ) , each of 35 students .
fifteen cards each having three questions of same difficulty level were prepared by two examiners who later conducted the structured viva ( examiners b and d ) .
these cards were mailed to five subject experts for comments on the language , order and relevance of the questions , entirety of topic , and any other specific comments . on the basis of comments received , the final questionnaire was prepared .
the final questionnaire was pretested on 10 students and questionnaire was again modified based on the student 's feedback . on the day of examination ,
proper arrangement was made so that students did not interact with each other before completion of the examination .
group a and c gave the unstructured ( traditional ) viva to two different examiners ( examiners a [ professor ] and examiner c [ assistant professor ] ) .
similarly , groups b and d gave the structured viva to two other examiners ( examiners b and d , both associate professors ) .
after the completion of the viva , each student was asked to fill a questionnaire ( four items ) to know their perception .
the marks obtained by the students in different viva groups were compared using unpaired t - test , one - way anova , and post - hoc tukey test .
there were 29 ( group a ) and 31 ( group c ) students who appeared in unstructured coe and 31 ( group b ) and 32 ( group d ) students appeared in soe .
the mean marks obtained by coe were significantly higher than those obtained by soe [ table 1 ] .
the marks allotted by examiner a ( mean = 9.43 ) were significantly lower as compared to those allotted by examiner c ( mean = 19.00 ) .
similarly , marks allotted by soe showed a marked inter - examiner variability ( mean marks of examiner b vs. examiner d were 15.74 and 8.12 , respectively ) .
the difficulty levels were similar for both examiners ( b and d ) , and this proves the internal consistency of the structured viva [ table 2 and figure 1 ] .
comparison of marks obtained by students in soe and coe comparative frequency distribution of responders according to increasing difficulty levels of questions in soe relationship between total marks obtained by students and difficulty level of questions in structured oral examination by examiners b and d the students did not feel difficulty in responding to the structured format and over 90% students understood the questions clearly .
furthermore , the students did not feel any difference in this format of viva as compared to their previous viva examinations [ table 3 ] .
students feedback on soe and coe ( unstructured ) the opinion and views expressed by the teachers who conducted viva voce examination are shown in table 4 .
they reported that this format led to less drift from the main topic and provided equal coverage of topics in the limited time allotted for students assessment . among the limitations ,
reported were difficulties in structuring viva from the entire syllabus , rigidity of time limits and knowledge content , and monotony for the teachers .
most authors agree that structuring and preplanning viva voce leads to a better validity and reliability of viva as an assessment tool for under graduates and postgraduates .
the results of this study show that soe format is acceptable to students and teachers and has internal consistency ( reliability ) .
thus , marks awarded are objective , evidence - based as against overall ( subjective ) assessment - based award of marks in coe .
there was a greater variation in mean marks allotted by two examiners in coe ( 9.419.0 ) as compared to those allotted in soe ( 9.115.7 ) .
this shows that structuring the viva voce contents reduces the effect of contrasting examiner behaviors on the marks alloted ( stringent vs. lenient ) .
however , structuring the contents significantly reduced the marks obtained and this is as reported elsewhere also .
reduction in marks by structuring is not surprising because structuring exposes all students to all types of questions ( from easy to tough ) as against the traditional viva in which examiners preferences and chance plays role ( some students are asked too many easy questions ) .
this is corroborated by the perception of teachers who have clearly stated that soe covers a wider breadth of syllabus as compared to conventional format .
this could also in part be due to the fact that not all students respond to all questions having increasing difficulty levels
. we found that structuring in the present form does not eliminate inter - rater variability as is reported elsewhere also .
conversely , another study found perfect agreement between the marks given by two examiners in objective structured viva voce ( osvv ) while the fair agreement was found between the marks given in osvv and conventional viva . however , each student was subjected to two viva formats unlike this study on parallel groups
. there can be different explanations for this discrepancy . during posttest interview of the teachers taking structured viva ( groups b and d ) ,
it was found that one of them used regional language frequently , while the other strictly adhered to the structured questionnaire .
the examiners of the four groups had a varied teaching experience ( from 3 years to 33 years ) which determined the depth and experience in evaluating students performance . however , it is a realistic , practical situation , prevailing in most of the departments of pharmacology .
training by organizing workshops and developing orientation manuals , is important for increasing effectiveness of examination .
development of ability in examiners to ask relevant questions in unambiguous words so that almost similar answer comes from all students that increases validity further .
inter - rater reliability can further be enhanced by the use of grading or scoring system .
the perception of the students to this form of viva is found to be encouraging . in this study
, students did not perceive any threat of a new format of examination and perceived structured format similar to conventional viva with respect to understanding and responding to the questions .
availability of time and human resources are important determinants of the feasibility of an effective evaluation tool .
at least four examiners are needed to conduct university practical examination and viva voce for 100 undergraduates and one more for every increase in 50 students .
it is customary in conventional format to divide total subject into two parts according to theory paper - i and ii .
one of the examiners takes viva from part - i and the other from part - ii . however , often , time becomes a big constraint [ table 5 ] .
this is important because ultimately 150250 students would be required to be examined . in one study
, authors fixed time duration of 1015 min for 10 items questionnaire in physiology with items having increasing difficulty levels .
six examiners were involved in taking viva each assessing 67 students only . in another study ,
increasing number of examiners may not be a practical proposition because of professional time needed , although it reduces inter - rater variability and improves reliability ( agreement in allotted marks between two examiners ) .
in a targeted viva , rangacahri engaged each student for about 25 min and thus only 56 students were examined in a day .
we found that arbitrary limit of 10 min is not sufficient because students would not reach till question 14 and 15 .
one remedy is to reduce the number of items in questionnaire to 10 and other is to increase the time allotted to the student .
we feel that assessment of students competence for certification ( pass / fail ) would require the development of questionnaire , which includes items from various systems .
therefore , reducing the number of items in the questionnaire may become counterproductive ! as shown in table 5 , increasing time duration from 10 to 15 min would result in continued work for 812 h a day !
if one examiner examines half of the students by structured viva format ( say 15 only ) and the other the remaining half , then time duration can be increased from 10 to 15 min .
the entire exercise could be tiring for examiner and stressful to the examinees . at present ,
relationship between duration of viva , number of examiners required , and total duration required for proper conduct of soe the limitation of the present study is that it involved a single batch of students who were examined on ans only .
more work is required to be done on several batches of students to ascertain a number of questions from the entire syllabus and exact time duration to successfully implement the structured viva format for final university examinations .
present work suggests that structured viva voice examination is a feasible method of assessment and students feel no difficulty to this format .
teachers opine that soe prevents deviations from the main topic . however , its conduct is a resource - intensive exercise and requires preplanning .
there are factors , which influence the performance of students and introduce an element of inter - rater variability .
these factors are the length of teaching experience , vernacular used , and lack of training of teachers .
there is a need of training of examiners , development of scoring system , and ascertaining time duration of viva voce examination before soe can be implemented as a part of fulfillment of university requirement for the summative assessment of student 's performance .
| objectives : the study aims to understand the process and factors influencing the implementation of structured oral examination ( soe ) for undergraduate medical students ; in comparison with conventional oral examination ( coe ) in pharmacology.methods:in a randomized , parallel group study , 123 students of pharmacology were divided into two groups , soe ( n = 63 ) and coe ( n = 60 ) .
students of each group were subdivided into two , and four examiners took viva voce individually .
three sets of questionnaires from autonomic nervous system were prepared , each having 15 items with increasing difficulty levels and were validated by subject experts and pretested .
ten minutes were allotted for each student for each viva .
feedback of students and faculty about the novel method was obtained.results:soe yielded significantly lower marks as compared to coe .
there were significant inter - examiner variations in marks awarded in soe and coe .
other factors influencing implementation were difficulty in structuring viva , rigid time limits , lack of flexibility in knowledge content , monotony , and fatigue .
the students perceived this format not different from coe but felt that it required in - depth preparation of topic .
faculty opined that soe led to less drift from main topic and provided uniform coverage of topics in given time.conclusion:conducting soe is a resource - intensive exercise . despite structuring ,
inter - examiner variability was not completely eliminated .
the students performance was depended on factors related to examiners such as teaching experience , vernacular language used , and lack of training .
orientation and training of examiners in assessment strategies is necessary .
standardization of questionnaire is necessary before the implementation of soe for summative assessment . |
perivascular epithelioid cell tumor ( pecoma ) is a family of related mesenchymal neoplasms that include angiomyolipoma , lymphangiomyomatosis and clear cell ' sugar ' tumor of the lung , and a group of rare , morphologically and immunophenotypically similar lesions arising at a variety of visceral and soft tissue sites1 ) .
it has distinct histological and immunohistochemical features defined by coexpression of melanocytic ( hmb-45 ) and smooth muscle markers ( smooth muscle actin and desmin ) , but negativity to s-100 protein2 ) .
data on gastrointestinal ( gi ) pecoma remain limited to isolated case reports . to our knowledge ,
17 cases have been reported in the literature , among which 10 occurred in adults3 ) .
because of the rarity of pecoma , its clinical , phenotypic and biological characteristics are not fully understood , and little is known about prognosis and treatment modalities for pecoma .
however , chemotherapy and radiotherapy have been used in locally advanced , metastatic and histologically malignant cases .
we report a child with pecoma in the ascending colon , treated by surgical excision and interferon-2b ( ifn-2b ) immunotherapy .
a previously healthy 7-year - old boy was admitted to our hospital because of hematochezia and abdominal pain .
there was no history of bleeding disorders , recent infection , change in bowel habits , or significant weight loss .
a complete blood count showed white blood cell 11,500/mm , hemoglobin 8.2 g / dl , hematocrit 26.0% , mean corpuscular volume 72.4 fl , platelet 401,000/mm and other biochemical tests were normal .
1a ) and colonoscopy displayed a 3.9 cm - sized pedunculated mass at the hepatic flexure of the ascending colon .
examination of the resected colon revealed a 43 cm in size , polypoid , yellow and partially brown mass ( fig .
the tumor cells were predominantly epithelioid cells having prominent nuclei and abundant cytoplasm ( fig .
the tumor was low - grade malignancy as evidenced by infiltrative growth but mild cellular atypia , low mitotic and proliferation index without necrosis and no vascular invasion .
all of the surgical margins were free of tumor . a metastatic workup including a bone scan , positron emission tomography , brain and chest ct was negative .
he was treated with adjuvant ifn-2b therapy ( intron - a , schering - plough , kenilworth , new jersey , new jersey , usa ) : 3 million iu / m , 3 times / week , subcutaneous injection , for 1 year .
short term side effects , such as fever , neutropenia and skin necrosis , were not seen in the present case .
a recently defined pecoma is a rare mesenchymal neoplasm of uncertain malignant potential affecting various organs . at first
, bonetti et al4 ) proposed the concept of perivascular epithelioid cell ( pec ) in 1992 and the terminology ' pecoma ' was suggested by zamboni et al5 ) in 1996 .
the world health organization accepted the designation ' pecomas , ' defining them as mesenchymal neoplasms that share the same distinctive cell type , the pec in 2002 .
pecomas have been reported in several organs including the uterus , falciform ligament , prostate , small and large bowel , rectum , lung , breast , cardiac septum , liver , kidney , pancreas and soft tissue of the thigh .
a review of 51 cases of pecoma documented in the literature revealed that 90% of cases affected females and 41% involved the uterus6 ) . in the pediatric population ,
there have been only a few documented pecomas in several organs including the duodenum , appendix , transverse colon , sigmoid colon , rectum , kidney , broad ligament , vagina and orbit . to our knowledge
, 17 cases of gi pecomas have been reported in the literature , among which 10 occurred in adults3 ) .
pediatric gi pecomas were documented in rectum3 , 7 , 8) , appendix9 ) , duodenum10 ) , sigmoid colon11 ) and transverse colon12 ) .
this report is the eighth documented case of the pediatric gi pecoma , and the third documented case of the pediatric colon pecoma .
the tumor cells have large epithelioid appearance with abundant clear to granular eosinophilic cytoplasm and a large vesicular nucleus .
immunohistochemically , pecoma expresses myogenic and melanocytic markers , such as hmb45 , hmsa-1 , melana / mart1 , microophthalmia transcription factor ( mitf ) , actin and , less commonly , desmin13 ) . on ultrastructural analysis
, pecoma contains microfilament bundles with electron - dense condensation , numerous mitochondria and membrane - bound dense granules .
little information is available on the possible molecular alterations occurring in pecomas . in one report ,
the loss of chromosome x and a t(3;10 ) translocation were identified by conventional cytogenetic techniques14 ) . in another report ,
histologic criteria indicative of malignant potential in pecomas have not been established , especially in the pediatric age group . however , in a recent study of pecoma of soft tissue and gynecologic origin , folpe et al15 ) suggested criteria to separate pecomas into benign , uncertain malignant potential , and malignant categories .
they proposed that malignancy was predicted by the presence of 2 or more of the followings : tumor size greater than 5 cm , infiltrative tumor border , high nuclear grade and cellularity ; more than 1 mitosis/50 high - power fields , tumor necrosis , and vascular invasion . in the present case
his tumor was regarded as low grade , as evidenced by infiltrative tumor border but lacking of other findings listed above .
however , locally advanced or metastatic disease portends a poor prognosis and strategies incorporating chemotherapy , radiation and immunotherapy have been reported .
various responses , including complete , partial or absent responses , have been noted for dacarbazine , vincristine and imatinib mesylate .
rigby et al16 ) reported an 11-year - old girl with metastatic renal pecoma treated with dacarbazine based chemotherapy and imatinib mesylate .
she presented with two large abdominal masses in the left flank and epigastrium and left supraclavicular lymphadenopathy .
the tumor did not respond to an initial treatment of chemotherapy , including dacarbazine , bicnu and vincristine .
a trial of imatinib mesylate based on the expression of c - kit was unsuccessful because of the lack of response and adverse effects of the drug . among 7 pediatric gi pecoma cases reported so far ,
six were treated with surgery alone7 - 12 ) , and the last was treated with surgery and adjuvant chemotherapy consisting of doxorubicin , ifosfamide , and mesna on the basis of non - rhabdomyosarcoma soft tissue sarcoma protocol arst0332 by children 's oncology group3 ) .
adjuvant ifn-2b was used in patients with melanoma17 ) , and for immunotherapy in a patient with pecoma of the bladder18 ) .
it reduced neomicrovascular density in the normal urothelium adjacent to the tumor after transurethral resection of superficial bladder carcinoma19 ) .
outpatient treatment with subcutaneous ifn-2b plus interleukin-2 treatment for metastatic renal cell cancer was also reported .
eight of 47 patients ( 17% ) responded to this regimen and overall response rate was similar to that seen with high - dose interleukin-2 alone , however , the response duration appeared to be shorter20 ) . while ifn-2b therapy for the management of pecoma remains experimental , we decide to use ifn-2b based on the vascular nature of this tumor and its anti - angiogenic effect .
the present case represents the first documented pediatric gi pecoma treated with surgical resection and adjuvant ifn-2b immunotherapy .
further studies involving larger number of cases and close monitoring by long - term follow - up are required in the light of its potential for local recurrence and distant metastasis . | a 7-year - old boy presented with hematochezia and abdominal pain .
a 3.7-cm - sized mass was identified in the ascending colon by abdominal computed tomography and colonoscopy .
the patient underwent surgical resection .
pathological examination revealed a low - grade perivascular epithelioid cell tumor ( pecoma ) .
pecoma in the colon is very rare .
only a few cases have been reported so far .
an effective treatment method for this rare tumor has not been established yet .
the patient received adjuvant interferon- immunotherapy for 1 year .
he has been tumor - free for 26 months since the initial diagnosis .
this report is the first documented case of the use of interferon- for pediatric pecoma of the colon . |
menarche is a vital maturational event of puberty in female adolescents . unlike other pubertal changes that are gradual and continuous ,
it is highly correlated with other pubertal characteristics and is , therefore , preferred as a benchmark for sexual maturation .
the timing of menarche is an important determinant of population size , reproductive performance , and other chronic outcomes , such as cancers of the reproductive organs ( 1 ) .
early onset of menarche has been associated with premature marriage and first childbirth , especially in developing countries , and is a risk factor for breast - cancer , ovarian cancer , and other diseases ( 1,2 ) . during the past century , there has been a secular ( time - related ) trend towards an earlier onset of menarche in most developed countries , with a decline of 23 months per decade in europe and the united states ( 3 ) .
general improvements in nutrition and health have been suggested to explain the downward trend ( 3,4 )
. the earlier onset of menarche has also been observed in some developing countries , such as bangladesh .
the most recent study of unmarried female adolescents conducted in 1996 in a rural area of bangladesh reported an average age at menarche of 13.0 years ( 4 ) , which was substantially lower than the previous estimate of 15.8 years in 1976 ( 5 ) .
the relatively high age at menarche in 1976 was linked to severe malnutrition caused by inflation , famine , and flooding following bangladesh 's war for independence in 1971 ( 5 ) .
the association between the nutritional status and the onset of menarche has been well - documented ( 46 ) . in general , adolescents who are taller and heavier with a greater body - fat mass tend to reach menarche at younger ages ( 46 ) .
female adolescents in bangladesh , particularly those in rural areas , are largely affected by undernutrition , with 48% and 59% being stunted ( height - for - age <3 percentile ) and thin ( body mass index [ bmi]-for - age < 5 percentile ) respectively , applying the national center for health statistics reference ( 7 ) .
considering the high prevalence of undernutrition and a lack of significant improvement in nutritional status during recent years ( 7 ) , it is not clear whether the age at menarche has continued to decrease in rural bangladesh . a marked seasonal pattern of menarche has previously been reported such that the monthly occurrence of menarche is not uniformly distributed throughout the year but peaks show up in summer and winter ( 8,9 ) .
seasonal factors , such as length of daylight , ambient temperatures , and the psychological effects of reduced stress and increased relaxation during school vacation , are some suggested explanations for this seasonal variation ( 811 ) .
the present analysis was conducted to determine the age at menarche using self - reported date of onset in a group of female adolescents aged 1219 years in a rural area of bangladesh and to examine its association with marital and nutritional status and season .
we believe that the study of onset of menarche is important not only from an anthropological point of view but also because the mean menarcheal age has been accepted as a particularly sensitive indicator of the biosocial status of the population ( 12 ) .
the mean age at menarche in rural bangladesh was last estimated more than a decade ago , and a number of biological , social and ecological factors have likely changed since then .
we believe that it is opportune to re - assess the onset of menarche and its association with various factors , particularly marital status , considering the numerous negative consequences of marriage and pregnancy in adolescence , which may be triggered by early onset of menarche .
data were collected as part of a cohort study of the consequences of pregnancy and lactation on growth of adolescents in gaibandha district in rural northwest bangladesh ( 13 ) .
this study was conducted in a smaller area ( 96 communities with 200 households in four unions of gaibandha district ) , which was part of the study area where a randomized community trial for assessing the impact of vitamin a and -carotene supplementation on maternal and infant survival called the jivita project was being conducted by our group .
this rural and densely - populated ( 1,000 per sq km ) region is characterized by average to below - average socioeconomic status indicators , rates of health service - use , child health , and nutritional status compared to national statistics . at the outset , all the households in this area were visited by 96 local female workers from january to march 2005 to identify and list all married and unmarried adolescents aged less than 20 years .
all enumerated adolescents were interviewed in the home to elicit dates of their birth , months and years of menarche , marital status , and pregnancy history using recall and to measure mid - upper arm circumference ( muac ) .
home records of date of birth , when available , were requested and , in their absence , parental input was obtained to confirm the self - reported year and month of birth .
various probes , such as age at school enrollment , differences in age between siblings , year of marriage , and tools , such as a local events calendar , were used for determining the year and month of birth .
adolescents who were post - menarcheal at the time of enumeration were asked to recall the year and month of menarche .
reference to age of school enrollment and the number of years spent in each class was used as recall probes as the majority of adolescents in the study area had received some schooling due to the government support for female education ( 14 ) .
for example , the adolescents were asked in which grade they had started menstruating , along with the highest grade completed and its corresponding calendar year . also , the number of years for which a particular grade was repeated was recorded .
family events , seasons , school examinations , and a local events calendar were used for probing the month of menarche .
in addition , the mother or other female relatives living in the household were asked to help with the recall of the age at menarche . the year and month of marriage
muac was assessed as a measure of nutritional status to the nearest millimetre following standard procedures ( 15 ) .
of the 5,582 female adolescents enumerated , 100 ( 1.8% ) refused to participate in the study , and 1,365 ( 24.4% ) were excluded either due to not meeting the age criteria of 1219 years or for not being able to provide years of their birth .
further , 29 ( 0.5% ) adolescents who were unable to report months of their menarche and 165 ( 3.0% ) who had previously been pregnant were excluded because the adolescent cohort study enrolled only never - pregnant adolescents ( 13 ) .
the resulting sample included in the analysis comprised 3,923 ( 70.3% ) married nulliparous and unmarried female adolescents aged 1219 years .
of the 3,923 female adolescents , 483 ( 12.3% ) were unable to report months of their birth .
thus , the mean age at menarche was assessed by assigning a random month of birth to this group using microsoft excel 2000 ( microsoft corp , redmond , wa , usa ) .
as some households had more than one female adolescent aged 1219 years and age at menarche of those living in the same households could be correlated , we estimated the mean age at menarche adjusting for the clustering of girls of the same households .
the differences in age at menarche , age , and muac between married and unmarried adolescents and that in muac and age between pre- and post - menarcheal adolescents were examined using a t - test .
a multiple linear regression analysis was conducted with age at menarche as the dependent variable and marital status , age , and muac as the independent variables . to examine the seasonality of menarche , frequencies of onset by calendar month and season were computed .
seasons were defined as follows : winter = novemberfebruary ; summer = marchjune ; and monsoon = julyoctober .
the uniformity of monthly and seasonal distribution of menarche was examined using a test ( 8,9 ) , accounting for the different number of days in each month .
the observed frequencies of menarche for each month and season were compared against the expected uniform distribution [ 31/3653,452 ( total number of adolescents ) , 28/3653,452 , etc . ] .
all analyses were performed using the stata software ( version 8.0 ) ( stata corp , college station , texas , usa ) .
the bangladesh medical research council and the institutional review board at the bloomberg school of public health , johns hopkins university , baltimore , md , usa , approved the study .
of the 3,923 female adolescents , 483 ( 12.3% ) were unable to report months of their birth .
thus , the mean age at menarche was assessed by assigning a random month of birth to this group using microsoft excel 2000 ( microsoft corp , redmond , wa , usa ) .
as some households had more than one female adolescent aged 1219 years and age at menarche of those living in the same households could be correlated , we estimated the mean age at menarche adjusting for the clustering of girls of the same households .
the differences in age at menarche , age , and muac between married and unmarried adolescents and that in muac and age between pre- and post - menarcheal adolescents were examined using a t - test .
a multiple linear regression analysis was conducted with age at menarche as the dependent variable and marital status , age , and muac as the independent variables . to examine the seasonality of menarche , frequencies of onset by calendar month and season were computed .
seasons were defined as follows : winter = novemberfebruary ; summer = marchjune ; and monsoon = julyoctober .
the uniformity of monthly and seasonal distribution of menarche was examined using a test ( 8,9 ) , accounting for the different number of days in each month .
the observed frequencies of menarche for each month and season were compared against the expected uniform distribution [ 31/3653,452 ( total number of adolescents ) , 28/3653,452 , etc . ] .
all analyses were performed using the stata software ( version 8.0 ) ( stata corp , college station , texas , usa ) .
the bangladesh medical research council and the institutional review board at the bloomberg school of public health , johns hopkins university , baltimore , md , usa , approved the study .
the mean ( sd ) age and muac of the adolescents included in the analysis ( n=3,923 ) were 15.1 ( 1.8 ) years and 22.4 ( 2.3 ) cm respectively .
only 13% of the adolescents were married at the time of interview , although most ( 88% ) were already menstruating . of those who had already attained menarche , the mean age of onset of menarche was 12.8 ( 1.4 ) years
. a higher proportion of married vs unmarried female adolescents was post - menarcheal ( 99% vs 86% , p<0.01 ) , and married adolescents had an earlier onset of menarche than unmarried girls ( 12.61.3 years vs 12.91.4 years , p<0.01 ) , a difference that remained significant after adjusting for age and muac ( =-0.44 , p<0.01 ) ( table ) .
the mean muac was significantly higher among post- vs pre - menarcheal adolescents ( 22.82.0 vs 19.51.9 cm , p<0.01 ) , and there was a negative linear association between age at menarche and muac , after adjusting for age and marital status ( =-0.11 , p<0.001 ) ( table ) . factors associated with mean age at menarche among adolescents in rural bangladesh r=0.20 , f=250.31 , p=<0.01 ; muac = mid - upper arm circumference the monthly occurrence of menarche was not uniformly distributed throughout the year ( = 885.97 , df=11 , p<0.001 ) but had peaks in december and january and troughs in august and september ( fig . ) .
more than half of the female adolescents reached menarche during the winter months whereas less than 20% had an onset in monsoon ( = 634.97 , df=2 , p<0.001 ) .
frequency distribution of calendar month of onset of menarche among adolescent girls , aged 1219 years , in rural bangladesh ; expected frequencies for each month calculated as 31/3653,452 ( total number of adolescents , 28/3653,452 , 30/3653,452 , etc . )
the estimated mean age at menarche of 12.8 years reported from this study indicated a slightly earlier onset of menarche of the female adolescents in a rural area of bangladesh by 2 months compared to the mean of 13.0 ( 0.9 ) years that had been estimated in narayanganj district of bangladesh in 1996 ( 4 ) .
while not directly tested , this apparent small difference in age at menarche compared to that found in a survey in 1996 may be attributable to differences in the timing of studies , location of study areas , and sample characteristics .
while the present study included both married and unmarried female adolescents aged 1219 years , the previous study included only unmarried ones aged 1017 years ( 4 ) .
on the other hand , one can conjecture that the mean age at menarche in rural bangladesh has lowered slightly over the past decade and that the downward trend in age of onset of menarche observed elsewhere ( 3 ) may also be occurring in rural bangladesh , albeit at a slower pace . in europe , a trend towards an earlier onset of menarche by 23 months per decade has been reported , with the smallest magnitude of decline of 1.1 months per decade observed in france ( 3 ) .
analysis of the national health and nutrition examination survey ( nhanes ) in the usa indicated declines in age at menarche for all race / ethnic groups , with non - hispanic white females having a decline in the mean age at menarche from 13.3 years in the pre-1920 birth - cohort to 12.5 years in the 19801984 birth - cohort ( 16 ) . while the declining trend in age at menarche has been attributed to improvements in health and nutrition in developed countries , a large proportion of female adolescents in rural bangladesh is still affected by undernutrition as reflected by the high prevalence of stunting and thinness ( 7 ) .
if real , factors associated with a potential declining trend in age at menarche in rural bangladesh remain to be elucidated .
the accuracy of recall of the date depends on factors , such as interval of recall ( 17 ) . in the present study ,
the mean interval of recall was 2.5 years , and 63% of the adolescents had reached menarche within three years of the time of interview .
previous studies that used a similar recall procedure reported a correlation coefficient of 0.83 and 0.67 between the actual and the recalled age at menarche when the mean interval of recall compared to occurrence of menarche was 4.8 years and 33 years respectively ( 18,19 ) .
therefore , the recall errors are expected to be low in this study due to the relatively short interval of recall .
the married adolescents reached menarche at an earlier age than the unmarried adolescents . in developing countries , such as bangladesh and pakistan , age at menarche
is suggested to be positively associated with age at marriage and first childbirth ( 20 ) .
a similar association has been found in some developed countries where the intervals between menarche and first marriage are much larger ( 20,21 ) .
although the mechanisms of this positive association are poorly understood , in developing countries , menarche has been suggested to serve as a marker of maturity and readiness for marriage , signalling the parents to place their daughters in the marriage market ( 2,20 ) .
the mean age at marriage in the jivita study area is 16.5 years despite the legal age of marriage being 18 years in bangladesh , and the first pregnancy ( conception ) occurs within an average of 13 months from marriage ( 13 ) .
the inverse association between age at menarche and muac shown in this study corresponds with the previous findings that adolescents who are taller and heavier with a greater body - fat mass tend to attain menarche at younger ages ( 4,5 ) .
the nutritional status of the adolescents was assessed by muac in this study whereas most previous studies measured weight , height , bmi , or skinfold thickness . in general , muac is a good indicator of nutritional status , serving as a proxy for wasting malnutrition and weight , particularly in adult women ( 22 ) . in a study of rural senegalese female adolescents , the mean muac
was shown to be higher among post- vs pre - menarcheal girls ( 23 ) , coinciding with the present finding .
the winter peak of menarche found in our study corresponds with the previous findings from rural bangladesh that about half of adolescents attained menarche in winter whereas less than 20% had an onset in may through august ( 5 ) .
a factor that most likely explains the winter peaking of menarche in rural bangladesh is the increased food consumption during the harvest season .
food availability and consumption generally increases during the winter harvest season in bangladesh , thereby improving nutritional status , a factor known to be associated with onset of menarche ( 5 ) . in a study by tetens et al . elsewhere in rural bangladesh ,
the mean energy intake increased from 6.5 mj per person per day in the lean season to 8.3 mj per person per day in the harvest season in female adolescents ( 24 ) . in the jivita study ,
the proportion of women consuming more than one egg per week increased from 37% in the lean season to 56% in the harvest season . likewise ,
73% of the women consumed dark green - leafy vegetables at least once a week in the harvest season compared to 60% in the lean season ( data not shown ) .
another potential explanation may be the psychological effects of reduced stress due to school vacation . during school season , adolescents have homework and regular examinations , including mid - term and final , which could contribute to the increased level of stress . in addition , the support for female education by the government of bangladesh , particularly for secondary school , is merit - based ; so , to receive continuous financial support from the government , the student needs to perform well in school .
thus , a relaxing and less - stressful atmosphere during school vacation has been postulated to trigger the onset of menarche by influencing the hypothalamus ( 810 ) .
the winter school vacation which follows the final examination in december may explain the high frequencies of menarche in winter , especially in december .
however , we are limited in supporting this hypothesis because , to our knowledge , there is no evidence showing that female adolescents in bangladesh have reduced stress during school holidays , and we lack data to estimate the proportion of adolescents enrolled in school at the time of onset of menarche
. the winter peak of onset of menarche in the present study is consistent with a previous finding in 1977 and may be related to increased intake of foods during the winter harvest season .
, the date of menarche was self - reported , and the associated recall bias can not be ruled out despite the relatively short interval of recall . although efforts were made to help elicit the date of birth of all the enumerated female adolescents , approximately 12% were unable to report the months of their birth .
assigning a random month of birth when only year was available ; as done in our study , may have limitations due to the seasonality of birth reported in bangladesh and other countries ( 25,26 ) . in this study
, muac was measured after the onset of menarche . using the post - menarcheal muac measurement as a proxy for nutritional status before the onset of menarche is not ideal .
in addition , the study sample comprised female adolescents , aged 1219 years , living in a defined study area .
thus , our findings may not be generalizable to or comparable with other randomly - sampled populations of adolescents in bangladesh . in conclusion ,
the mean age at menarche of the adolescents in this rural area of bangladesh was slightly lower than the previous estimate of 13.0 years in 1996 ( 4 ) .
although the small difference in age at menarche could be an artifact of different study sites and sample characteristics , it may also reflect the downward trend of onset of menarche taking place in rural bangladesh , as observed elsewhere .
these findings need confirmation in random samples of married and unmarried adolescents in rural bangladesh , assessing age at menarche using pros - pective and probit analysis methods ( 27,28 ) .
the negative association between the nutritional status and the onset of menarche in the present study was consistent with the previous findings that adolescents who are better - nourished tend to attain menarche at younger ages .
it is likely that , in a rural setting in bangladesh , in addition to the strong cultural and social norms favouring early marriage , an early onset of menarche may also trigger premature marriage and first childbirth .
this is associated with numerous adverse birth outcomes , such as premature birth , low birthweight , and neonatal and maternal mortality .
meanwhile , it is accepted that maintaining optimal nutritional status during adolescence is important for future reproductive outcomes in adulthood .
thus , while continuing efforts should be made to improve the nutritional status of female adolescents , educational activities , advocacy , and strong policies need to be in place at the same time to help delay marriage and first childbirth among female adolescents in the deve - loping world .
the jivita project was conducted under a global research activity cooperative agreement between the johns hopkins university and the office of health and nutrition , us agency for international development , washington , dc ( ghs - a-00 - 03 - 00019 - 00 ) , and the bill & melinda gates foundation , seattle , washington , dc ( global control of micronutrient deficiency , grant no .
. additional direct or in - kind support for this trial was provided by sight and life , basel , switzerland , the sight and life research institute , baltimore , md , nutrilite health institute ( nutrilite division , access business group , buena park , ca , usa ) , the canadian international development agency , and the national integrated population and health programme of the ministry of health and family welfare , government of bangladesh .
barkat ullah , hasmot ali , shafiul alam , shahab uddin , and sayeda khatun sharifa , and the jivita field management team .
additional appreciation goes to the field staff of the jivita project for their excellent work and dedication during data collection .
the authors acknowledge keith west , principal investigator of the jivita trial , for his insightful comments and guidance throughout the study and rolf klemm for his helpful comments and support .
special thanks are due to allan massie , maithilee mitra , ahasanul haque , and lee wu for computer programming and data - management support ; jonathan sugimoto and salahuddin ahmed for gis support ; and andre hackman for technical assistance . | menarche is an important milestone in the development of female adolescents .
the study assessed the age at menarche using recall , its seasonality , and association with marital and nutritional status ( using midupper arm circumference [ muac ] ) among 3,923 female adolescents aged 1219 years in a rural area of bangladesh . at the time of assessment ,
most ( 88% ) adolescents had attained menarche at the mean ( standard deviation [ sd ] ) age of 12.8 ( 1.4 ) years .
age of onset of menarche among married adolescents ( 13% ) occurred earlier than in those who were unmarried ( 12.61.3 years vs 12.91.4 years , p<0.01 ) .
age at menarche was negatively associated with muac after adjusting for age and marital status ( =0.10 , p<0.01 ) .
more than 50% of the adolescents had an onset of menarche during winter ( 2=634.97 ; p<0.001 ) , with peaks in december and january . in this rural population , the current age at menarche
was found to be slightly lower than the previous estimates of 13.0 years in bangladesh .
an early onset of menarche was associated with season and better nutritional status of the female adolescents and may be associated with early marriage . |
the main purpose of antiretroviral therapy ( art ) is to improve the prognosis of patients infected with human immunodeficiency virus ( hiv ) by decreasing the incidence of opportunistic infection and subsequent hospitalization and mortality.1 however , several studies have suggested that highly active antiretroviral therapy ( haart ) results in a higher incidence of cardiovascular events.2,3 in the normal fibrinolytic system , thrombin converts fibrinogen to active fibrin .
plasmin then degrades the cross - linked fibrin into soluble degradation products by the tissue type ( t - pa ) and the urokinase - type plasminogen .
it is the t - pa that is mainly responsible for the dissolution of fibrin formed in the circulation,4 and the normal process of fibrinolysis can be inhibited either by antagonizing plasmin through alpha-2-antiplasmin or by specific plasminogen activators ( pai ) of which there are three types .
pai type 1 ( pai-1 ) , which is synthesized in endothelial cells , adipocytes , and the liver , is physiologically the most important .
4 elevated plasma t - pa indicates inhibited endogenous fibrinolysis , and occurs when free t - pa released into the blood from endothelial cells forms a complex with circulating pai-1 . as a result , assays of t - pa antigen predominantly measure inactive t - pa / pai-1 complexes .
concentration of the t - pa/ pai-1 complex levels in plasma correlate strongly with levels of t - pa antigen and pai-1 activity.5,6 there is evidence that elevated t - pa levels predict cardiovascular disease in apparently healthy individuals,7 and this has been reported to account for more than 20% of deaths in some studies of hiv - infected patients.8 to date , most studies of the effects of art involve monitoring hiv - infected patients undergoing therapy for 6 months to 1 year , the general assumption being that the effects of art on hematological and hemostatic parameters will be noticed after a prolonged period .
the null hypothesis for the current study is that short - term therapy of hiv - infected patients will have no significant effect on fibrinolytic markers .
the main objective of a start study is to find out whether changes other than hematological changes occur during short - term art , which could form the basis of further monitoring and improvement in the management of hiv - infected patients .
this start study aimed to determine the values of fibrinolytic parameters within the first 3 months of art , determine the period before changes in these parameters are noticeable , and assess the dangers associated with late commencement or noncommencement of art .
the study participants comprised cohorts of 20 patients aged from 18 to 60 years who were receiving health care at the asokoro district hospital in the federal capital territory , abuja , nigeria .
the asokoro district hospital has a center where special care such as voluntary counseling and testing , art , and follow - up are provided .
a total of 40 participants were enrolled in the start study with each group consisting of 20 participants .
the inclusion criteria for patients were as follows : group 1 : aged 1860 years ; must have tested positive for hiv and not previously been on any antiretroviral drug , and must not present any symptom suggestive of a systemic disease .
group 2 : aged 1860 years ; must have tested positive for hiv but not be willing to commence art for at least 3 months , and must not present with any symptoms suggestive of a systemic disease .
participants with sickle cell disease or hepatitis , who were pregnant , or who were taking oral contraceptives were excluded from the study .
the start study received institutional ethical approval from the management of the asokoro general hospital .
patients signed a written informed consent form , and were enrolled into the study before blood samples were collected .
a repeated measures design comprising an experimental or treatment group and one control group was adopted for this study .
this design allowed for a longitudinal study of individual subjects in which fibrinolytic parameters were measured multiple times under different conditions , thereby monitoring trends during the 3-month study period .
the experimental group comprised hiv - positive individuals ( art nave subjects ) who registered for art ( group 1 ) , and the positive control group which consisted of hiv positive individuals but who were not on art ( group 2 ) .
a total of 7 ml of blood was collected by clean venous puncture from participants , with 4.5 ml blood delivered into a bottle containing 0.5 ml sodium citrate and 2.5 ml into a bottle containing edta anticoagulant .
principle and sample preparation : when red blood cells are mixed with cd4 monoclonal antibody in the presence of phycoerythrin , the cells are coated in phycoerythrin . when passed through the measuring area , cells or particles
twenty microliters of well mixed whole blood ( with edta added as an anticoagulant ) was pipetted into a partec test tube .
twenty microliters of cd4 mab pe was then added , mixed gently , and this was then incubated for 15 minutes at room temperature , protected from light , and 800 l of no lyse buffer was then added and mixed gently .
cd4-pe fluorescence was analyzed on a partec flow cytometer with an excitation light source with a wavelength of 488 nm . following this ,
840 l of the prepared blood sample was transferred to the cytometer for cd4 determination .
d - dimer concentrations in plasma were determined using elisa kits ( technozym d - dimer , lot # rh02b00 ) purchased from technoclone ( vienna , austria ) .
one hundred microliters of calibrators , control plasmas , and test samples was pipetted into test wells , covered with film , and incubated in a hot air oven at 37c for 60 minutes .
the test wells were then washed three times with 200 l washing buffer , using an automated elisa washer .
one hundred microliters of conjugate working solution was pipetted into wells , covered with strips of film , and then incubated at 37c for 60 minutes . following this ,
one hundred microliters of substrate solution was then pipetted into test wells , covered test strip with film , and then incubated at room temperature for 10 minutes .
one hundred microliters of stopping solution was then added into wells , these were shaken for 10 seconds , and measured within 10 minutes using an elisa reader at a wavelength of 450 nm .
concentrations of test samples were read off from the calibration curve and also checked with the controls . citrated plasma and
twenty - five microliters of calibrators , control plasmas , and test samples were pipetted into test wells , 75 l of incubation buffer was then added , and wells were covered test strips with film and incubated in a hot air oven at 37c for 60 minutes .
wells were emptied thoroughly , 100 l of conjugate working solution was pipetted into wells , and these were covered with film .
the test wells were incubated at 37c for 60 minutes and washed three times with 200 l of washing buffer .
one hundred l of substrate solution was then pipetted into test wells , covered test strip with film , and then incubated at room temperature ( 20c25c ) for 20 minutes .
one hundred l of stopping solution was pipetted into wells ; these were shaken for 10 seconds , and then measured using an elisa reader at a wavelength of 450 nm within 10 minutes .
concentrations of test samples were read off from the calibration curve and also cross checked with the controls . citrated plasma and all required components in the kit were brought to room temperature .
twenty - five l of calibrators , control plasmas , and test samples was pipetted into test wells , 75 l of incubation buffer was added , and then covered test strips with film and incubated in hot air oven at 37c for 60 minutes .
wells were emptied , and 100 l of conjugate working solution was pipetted into wells which were then covered with film .
the wells were further incubated at 37c for 60 minutes and washed three times with 200 l washing buffer .
one hundred l of substrate solution was then pipetted into test wells , covered test strip with film and then incubated at room temperature ( 20c25c ) for 20 minutes .
one hundred l of stopping solution was pipetted into wells , shaken for 10 seconds , and measured using an elisa reader at a wavelength of 450 nm within 10 minutes .
concentrations of the test samples were read off from the calibration curve , and checked with the controls .
data obtained from the study were subjected to descriptive statistics ( such as calculation of means and standard deviations ) to allow a general evaluation of all study variables .
inferential analyses were conducted using repeated measures analysis of covariance ( ancova ) with between - subject variable conditions ( experimental vs control ) , demographic characteristics , and therapy duration .
the measured parameter values within each group at baseline were used as covariates , while the interaction effect of associated independent factors was included in the analytical models of all study outcomes .
analysis to determine the existence or otherwise of relationships within and between fibrinolytic parameters over the start study duration was carried out by conducting correlation analyses .
all analyses were performed using spss software version 16.0 ( spss inc , chicago , il ) .
the study participants comprised cohorts of 20 patients aged from 18 to 60 years who were receiving health care at the asokoro district hospital in the federal capital territory , abuja , nigeria .
the asokoro district hospital has a center where special care such as voluntary counseling and testing , art , and follow - up are provided .
a total of 40 participants were enrolled in the start study with each group consisting of 20 participants .
the inclusion criteria for patients were as follows : group 1 : aged 1860 years ; must have tested positive for hiv and not previously been on any antiretroviral drug , and must not present any symptom suggestive of a systemic disease .
group 2 : aged 1860 years ; must have tested positive for hiv but not be willing to commence art for at least 3 months , and must not present with any symptoms suggestive of a systemic disease .
participants with sickle cell disease or hepatitis , who were pregnant , or who were taking oral contraceptives were excluded from the study .
the start study received institutional ethical approval from the management of the asokoro general hospital .
patients signed a written informed consent form , and were enrolled into the study before blood samples were collected .
a repeated measures design comprising an experimental or treatment group and one control group was adopted for this study .
this design allowed for a longitudinal study of individual subjects in which fibrinolytic parameters were measured multiple times under different conditions , thereby monitoring trends during the 3-month study period .
the experimental group comprised hiv - positive individuals ( art nave subjects ) who registered for art ( group 1 ) , and the positive control group which consisted of hiv positive individuals but who were not on art ( group 2 ) .
a total of 7 ml of blood was collected by clean venous puncture from participants , with 4.5 ml blood delivered into a bottle containing 0.5 ml sodium citrate and 2.5 ml into a bottle containing edta anticoagulant .
principle and sample preparation : when red blood cells are mixed with cd4 monoclonal antibody in the presence of phycoerythrin , the cells are coated in phycoerythrin . when passed through the measuring area , cells or particles
twenty microliters of well mixed whole blood ( with edta added as an anticoagulant ) was pipetted into a partec test tube .
twenty microliters of cd4 mab pe was then added , mixed gently , and this was then incubated for 15 minutes at room temperature , protected from light , and 800 l of no lyse buffer was then added and mixed gently .
cd4-pe fluorescence was analyzed on a partec flow cytometer with an excitation light source with a wavelength of 488 nm . following this ,
840 l of the prepared blood sample was transferred to the cytometer for cd4 determination .
d - dimer concentrations in plasma were determined using elisa kits ( technozym d - dimer , lot # rh02b00 ) purchased from technoclone ( vienna , austria ) . citrated plasma and
one hundred microliters of calibrators , control plasmas , and test samples was pipetted into test wells , covered with film , and incubated in a hot air oven at 37c for 60 minutes .
the test wells were then washed three times with 200 l washing buffer , using an automated elisa washer .
one hundred microliters of conjugate working solution was pipetted into wells , covered with strips of film , and then incubated at 37c for 60 minutes . following this , the wells were washed three times with 200 l of washing buffer .
one hundred microliters of substrate solution was then pipetted into test wells , covered test strip with film , and then incubated at room temperature for 10 minutes .
one hundred microliters of stopping solution was then added into wells , these were shaken for 10 seconds , and measured within 10 minutes using an elisa reader at a wavelength of 450 nm .
concentrations of test samples were read off from the calibration curve and also checked with the controls . citrated plasma and
twenty - five microliters of calibrators , control plasmas , and test samples were pipetted into test wells , 75 l of incubation buffer was then added , and wells were covered test strips with film and incubated in a hot air oven at 37c for 60 minutes .
wells were emptied thoroughly , 100 l of conjugate working solution was pipetted into wells , and these were covered with film .
the test wells were incubated at 37c for 60 minutes and washed three times with 200 l of washing buffer .
one hundred l of substrate solution was then pipetted into test wells , covered test strip with film , and then incubated at room temperature ( 20c25c ) for 20 minutes .
one hundred l of stopping solution was pipetted into wells ; these were shaken for 10 seconds , and then measured using an elisa reader at a wavelength of 450 nm within 10 minutes .
concentrations of test samples were read off from the calibration curve and also cross checked with the controls . citrated plasma and all required components in the kit were brought to room temperature .
twenty - five l of calibrators , control plasmas , and test samples was pipetted into test wells , 75 l of incubation buffer was added , and then covered test strips with film and incubated in hot air oven at 37c for 60 minutes .
wells were emptied , and 100 l of conjugate working solution was pipetted into wells which were then covered with film .
the wells were further incubated at 37c for 60 minutes and washed three times with 200 l washing buffer .
one hundred l of substrate solution was then pipetted into test wells , covered test strip with film and then incubated at room temperature ( 20c25c ) for 20 minutes .
one hundred l of stopping solution was pipetted into wells , shaken for 10 seconds , and measured using an elisa reader at a wavelength of 450 nm within 10 minutes .
concentrations of the test samples were read off from the calibration curve , and checked with the controls .
a total of 7 ml of blood was collected by clean venous puncture from participants , with 4.5 ml blood delivered into a bottle containing 0.5 ml sodium citrate and 2.5 ml into a bottle containing edta anticoagulant .
principle and sample preparation : when red blood cells are mixed with cd4 monoclonal antibody in the presence of phycoerythrin , the cells are coated in phycoerythrin . when passed through the measuring area , cells or particles
twenty microliters of well mixed whole blood ( with edta added as an anticoagulant ) was pipetted into a partec test tube .
twenty microliters of cd4 mab pe was then added , mixed gently , and this was then incubated for 15 minutes at room temperature , protected from light , and 800 l of no lyse buffer was then added and mixed gently .
cd4-pe fluorescence was analyzed on a partec flow cytometer with an excitation light source with a wavelength of 488 nm .
following this , 840 l of the prepared blood sample was transferred to the cytometer for cd4 determination .
d - dimer concentrations in plasma were determined using elisa kits ( technozym d - dimer , lot # rh02b00 ) purchased from technoclone ( vienna , austria ) . citrated plasma and all required components in the kit were brought to room temperature .
one hundred microliters of calibrators , control plasmas , and test samples was pipetted into test wells , covered with film , and incubated in a hot air oven at 37c for 60 minutes .
the test wells were then washed three times with 200 l washing buffer , using an automated elisa washer .
one hundred microliters of conjugate working solution was pipetted into wells , covered with strips of film , and then incubated at 37c for 60 minutes . following this ,
one hundred microliters of substrate solution was then pipetted into test wells , covered test strip with film , and then incubated at room temperature for 10 minutes .
one hundred microliters of stopping solution was then added into wells , these were shaken for 10 seconds , and measured within 10 minutes using an elisa reader at a wavelength of 450 nm .
concentrations of test samples were read off from the calibration curve and also checked with the controls .
twenty - five microliters of calibrators , control plasmas , and test samples were pipetted into test wells , 75 l of incubation buffer was then added , and wells were covered test strips with film and incubated in a hot air oven at 37c for 60 minutes .
wells were emptied thoroughly , 100 l of conjugate working solution was pipetted into wells , and these were covered with film .
the test wells were incubated at 37c for 60 minutes and washed three times with 200 l of washing buffer .
one hundred l of substrate solution was then pipetted into test wells , covered test strip with film , and then incubated at room temperature ( 20c25c ) for 20 minutes .
one hundred l of stopping solution was pipetted into wells ; these were shaken for 10 seconds , and then measured using an elisa reader at a wavelength of 450 nm within 10 minutes .
concentrations of test samples were read off from the calibration curve and also cross checked with the controls .
twenty - five l of calibrators , control plasmas , and test samples was pipetted into test wells , 75 l of incubation buffer was added , and then covered test strips with film and incubated in hot air oven at 37c for 60 minutes .
wells were emptied , and 100 l of conjugate working solution was pipetted into wells which were then covered with film .
the wells were further incubated at 37c for 60 minutes and washed three times with 200 l washing buffer .
one hundred l of substrate solution was then pipetted into test wells , covered test strip with film and then incubated at room temperature ( 20c25c ) for 20 minutes .
one hundred l of stopping solution was pipetted into wells , shaken for 10 seconds , and measured using an elisa reader at a wavelength of 450 nm within 10 minutes .
concentrations of the test samples were read off from the calibration curve , and checked with the controls .
data obtained from the study were subjected to descriptive statistics ( such as calculation of means and standard deviations ) to allow a general evaluation of all study variables .
inferential analyses were conducted using repeated measures analysis of covariance ( ancova ) with between - subject variable conditions ( experimental vs control ) , demographic characteristics , and therapy duration .
the measured parameter values within each group at baseline were used as covariates , while the interaction effect of associated independent factors was included in the analytical models of all study outcomes .
analysis to determine the existence or otherwise of relationships within and between fibrinolytic parameters over the start study duration was carried out by conducting correlation analyses .
all analyses were performed using spss software version 16.0 ( spss inc , chicago , il ) .
there were more males ( 60% ) than females ( 40% ) , and 60% of the study participants were between 26 and 36 years of age .
d - dimer was positively and significantly correlated with cd4 t lymphocyte counts in both aids - associated retrovirus ( arv ) and non - arv patients ( r = 0.304 , p < 0.01 vs r = 0.477 , p < 0.001 ) .
t - pa was negatively and significantly correlated with cd4 t lymphocytes only in those undergoing art ( r = 0.294 , p < 0.01 ) .
age was positively correlated with cd4 t lymphocytes and negatively correlated with d - dimer ( r = 0.244 , p < 0.001 vs r = 0.446 , p < 0.001 ) .
pai-1 was not significantly correlated with any of the parameters among patients undergoing art but was weakly correlated with d - dimer among patients not receiving art ( r = 0.261 , p < 0.05 ) .
when different durations of therapy were examined , pai-1 correlated negatively and significantly with t - pa at baseline and at month 1 ( r = 0.543 , p < 0.01 ) , while pai-1 correlated positively and strongly with d - dimer values at month 2 ( r = 0.550 , p < 0.01 ) . at month 3 , cd4 correlated negatively and significantly with d - dimer and t - pa ( r = 0.551 , p < 0.01 , and r = 0.583 , p < 0.01 , respectively ) , while pai-1 correlated positively with cd4 cell count ( r = 0.447 , p < 0.05 )
. the correlations of these parameters at baseline , month 1 , 2 , and 3 are presented in table 3 . among the hiv patients undergoing art , a progressive increase in cd4 cell count
was observed from 192 l / ml at baseline to 323 l / ml after 3 months of therapy .
in contrast , there was a significant drop in the cd4 count from 329 l / ml at baseline to 310 l / ml at the end of the third month among non - arv patients .
figure 1 shows a reciprocal trend in cd4 t cell count between arv and non - arv subjects . in arv patients ,
d - dimer values dropped from 301.0 l / ml at baseline to 172.0 l / ml at month 2 , and then increased again to 226.0 l / ml at the end of the third month .
the reverse was seen in patients who were not on art , as illustrated in figure 2 .
the median baseline value of pai-1 at the beginning of therapy was 14.0 g / ml , which increased progressively to 18.2 g / ml at the end of the third month .
the baseline value of t - pa at the beginning of therapy was 5.15 g / ml . this value progressively declined to 1.10 g / ml at the end of the first month .
the value increased slightly to 1.45 g / ml and 1.5 g / ml at the end of the second and third months , respectively .
the trend among the non - arv patients was reciprocal in nature when compared to those on therapy , and is illustrated in figure 3 .
the major finding from this preliminary start study is that there is interplay between t - pa , d - dimer , and pai-1 resulting from the impact of art .
it appears that haart increases the cd4 t cell count while also promoting the release of plasminogen activator inhibitor , which suppresses the action of t - pa .
this induces a hypofibrinolytic state , with a reduction in d - dimer values able to be observed by the end of the first month . by the second month , the pai-1 level drops considerably , allowing the t - pa level to start rising .
a further increase in pai-1 level occurred at the end of the second month with t - pa activity remaining low , maintaining a hypofibrinolytic state in the first 2 months of treatment . as the t - pa values increased moderately from the second month
, there was a corresponding increase in the d - dimer concentrations , but these remained within the normal range .
a positive correlation seems to exist , however , between t - pa and d - dimer , even though this was not statistically significant . a significant negative correlation exists between cd4 t cell count and d - dimer in haart patients .
it follows that with haart therapy , the cd4 t cell count increases while t - pa value decreases .
the hypofibrinolytic state observed in the current study is corroborated by earlier reports that art induces a hypofibrinolytic state as a result of the increase in pai-1 , which is reported to be marker of atherothrombotic risk.1416 several other cases of thrombosis associated with protease inhibitors ( pis ) containing haart have been reported.17,18 the pis containing haart are believed to promote thrombosis through pleiotropic effects , including alterations in lipid , pai-1 , and fibrogen levels .
crum - cianflone et al reported that the progression of hiv is associated with t cell proliferation and activation , as well as high levels of circulating inflammatory markers , with immune activation persisting long after initiation of haart rather than art.19 the inflammatory responses caused by advanced hiv disease play a pivotal role in the pathogenesis of atherosclerosis inflammation , endothelial dysfunction , and impaired fibrinolysis , which may further contribute to the increased cardiovascular risk observed in the hiv - infected population.911 the pro - inflammatory state associated with hiv infection may also give rise to atherogenic lipid changes .
the lipid profile in antiretroviral - nave hiv - infected subjects is characterized by low total cholesterol , hdl cholesterol , and ldl cholesterol , as well as elevated triglyceride levels ( mainly appearing as low density lipoprotein).1215 substantial evidence exists that haart induces a hypofibrinolytic state in hiv - infected individuals , as reflected in increased plasma levels of plasminogen activator and homocystein , which are thought to be markers of atherothrombotic risk.1416 in this study , a negative correlation was observed between cd4 t lymphocytes and d - dimer concentrations .
the implication is that an increase in cd4 t lymphocytes will lead to a decrease in the d - dimer concentrations , and vice versa .
this observation appears to agree with an earlier report by crum - cianflone et al,19 who found that venous thromboembolisms are associated with low cd4 cell counts .
this appears to be a result of immune / inflammatory activation causing increased d - dimer concentrations , which induces a hypercoagulable state .
art may play a major role in promoting arterial and venous thrombosis among hiv - infected persons as early as 3 months into the treatment .
prethrombotic assessment through measurement of fibrinolytic parameters should be introduced early in the course of art . | backgroundderangement in fibrinolytic markers can result in thrombosis and cardiovascular problems .
antiretroviral therapy ( art ) has been reported to affect the levels of these markers .
it is unclear how long a patient can be exposed to art before the effect of the drugs on the fibrinolytic markers becomes noticeable ; this short - term antiretroviral therapy ( start ) study aimed to answer this question.methodstwenty human immunodeficiency virus ( hiv)-positive subjects on art and 20 controls ( non - art ) were progressively monitored for three months .
cd4 t - cell count was determined while d - dimer , t - pa , and pai-1 parameters were determined.resultscd4 t - cell count increased from 192 l / ml at baseline to 323 l / ml at month 3 among patients on art .
d - dimer concentrations decreased from 301.0 l / ml at baseline to 172.0 l / ml at month 2 , then increased to 226.0 l / ml at the end of the third month .
the median baseline concentration of pai-1 at the beginning of therapy was 14.0 g / ml , which increased progressively to 18.2 g / ml at the end of the third month .
the baseline concentration of t - pa at the beginning of therapy was 5.15 g / ml . this progressively declined to 1.10 g / ml at the end of the first month and reached 1.45 g / ml and 1.5 g / ml at the end of the second and third months , respectively .
d - dimer was positively and significantly correlated with cd4 cell counts in both aids - associated retrovirus ( arv ) and non - arv patients ( r = 0.304 , p < 0.01 vs r = 0.477 , p < 0.001 ) .
t - pa was negatively correlated with cd4 t - lymphocytes in those undergoing art ( r = 0.294 , p < 0.01).conclusiona progressive increase in pai-1 and steady decline in t - pa concentrations within 3 months of commencement of art could predispose patients to thrombotic disorders earlier than is expected .
pre - thrombotic assessment during therapy is therefore advocated . |
several mechanisms have been proposed to explain the changes in balance during aging . since aging affects almost all physiological processes , reduction in postural stability can be explained by various factors , such as a loss of receptor cells in the vestibular organ , impaired sensory perception , a decline in muscle strength , and increased reaction times .
especially proprioception , which refers to the sensing where the body is located in space , is known to be a critical source of sensory feedback for the preservation of balance during upright standing in the elderly ( for review see ) .
besides physiological alterations , impaired balance at high age can also be explained by a general age - related reduction in physical activities , which in turn may further reduce the ability of living a physically active life .
balance disorders represent a growing public health concern due to the association with falls and fall - related injuries .
thereby falls often mark the beginning of a loss of independence and are the leading cause of injury - related institutionalizations in older adults [ 3 , 7 ] .
consequently , the documentation and understanding of age - related changes in balance performance is of utmost importance .
clinical scales , in addition to tests of stance and reach , are often used to rate balance performance .
functional assessments of this type have the advantage that they can be quickly applied and rarely require expensive equipment but they often lack a more detailed rating of impairment . by contrast , posturography is used to measure and quantify postural sway [ 9 , 10 ] by assessing cop deflections .
force platforms are the gold standard for posture assessment as they exceed many other techniques concerning reliability and simplicity of their design .
recently clark and coworkers compared cop - data obtained with a wii balance board with a laboratory - grade force platform and reported a high test - retest reliability of the wii board for cop assessment in young subjects .
we here investigated if age - related changes in standing balance can be revealed by using a wii balance board in aged participants . to this aim
, we compared the performance of young and older subjects during quiet standing and controlled displacement of their cop .
the target group was comprised of 21 older subjects aged 6094 years ( 69.0 7.7 years ; 8 male ) , and the control group was comprised of 24 adults aged 2032 years ( 25.2 3.4 years ; 9 male ) . at the time of testing , no subject reported any orthopedic or neurological conditions ( according to self - report , medical history and independence in activities of daily living ( everyday competence questionnaire ( ecq - score > 9 ) ) ) that could interfere with testing .
moreover , subjects underwent the mini mental status examination ( mmse - score > 27 ) to test for demetia .
we collected individual height ( m ) and weight ( kg ) for calculation of body - mass - indices ( bmi ) .
the average bmi of young subjects was 21.42 2.62 kg / m and 26.35 4.2 kg / m for elderly subjects .
the study was approved by the local ethics committee of the ruhr - university bochum .
we used the wii balance board ( nintendo , kyoto , japan ) as a measuring device and the wiiuse library to enable communication . according to a recent study ,
the wii balance board was shown to exhibit high concurrent validity for cop assessment with a laboratory - grade force platform ( intraclass correlation coefficients = 0.770.89 ) .
as raw sensor data ( rsd ) are linearly correlated with the weight of the subject , rsd changes reflect changes in the cop - position .
data from all four pressure - sensors were recorded with a sampling rate of 50 hz and were written to a file for offline analysis . for obtaining the cop ,
the rsd of the four sensors were transformed to xy - coordinates of a standard cartesian coordinate system .
for this purpose , for each individual the offsets of the rsd from the middle of the coordinate system were recorded prior to the various subtests in a separate session .
therefore , the subjects were required to stand still for 30 seconds with eyes open looking at a fixed reference point and arms at the sides of the body . for calibration , the individual cop - offset ( difference between actual cop coordinates and central point ( i.e. , the centre of the platform ) ) was calculated and subtracted from all values acquired in every subsequent measurement . in every subsequent subtest , percentage changes of the cop - position were determined by calculating deviations from the normalized initial rsd ( % rsd ) .
the subjects had to perform 8 subtests , with subtest 18 lasting 30 s each .
subtests 13 were used to detect and quantify displacements of the cop , when visual information was prevented or posture had to be altered in a test - specific way . in subtest 1 , ( looking at a fixed reference point ) , subjects were instructed to stand still with eyes open .
both arms reached out to the front ( angle of 90 to the body ) . in subtest 2 , subjects had to stand still with arms at the sides of the body and eyes closed .
subtests 47 were used to quantify the subjects ' ability to shift their cop without losing balance .
thereby , the subjects were asked to keep their body rigid , maintain the full plantar surface of the feet in contact with the platform , and lean over towards specified directions ( subtest 4 : forward right ; subtest 5 : forward left ; subtest 6 : backwards right , subtest 7 : backwards left ) .
subtest 8 was used to quantify the subjects ' ability to continuously change posture by circular movement in clockwise direction , trying to reach maximal displacement of their cop . in subtests 47 ,
subjects ' ability to shift their cop forward as far as possible without taking a step forward or falling was tested .
these subtests provide information about the ability to deflect the centre of gravity ( cog ) towards the edge of the base of support .
the tests resemble the so - called functional reach test , where subjects do not lean over , but actually reach forward .
the functional reach test has been shown to offer high inter - rater reliability and good predictive validity of subjects at risk of falls . for subtests 17 , we calculated the average xy - coordinates of cop and the appending scatter , that is , standard deviations of cop positions in anterior - posterior and medio - lateral directions
. to analyze performance in subtest 8 , we calculated the mean cop coordinate for each sector of the coordinate system .
subsequently , we calculated the euclidian distance between the origin of the coordinate system and these cop coordinates .
the four resulting euclidian distances were averaged and used as radius for the calculation of the circumference of cop rotation .
results are presented as mean cop coordinates sd ( scatter ) with coordinates describing balance performance and scatter describing postural sway .
statistical evaluation was carried out using student 's t - test and repeated measures analysis of variance ( rmanova ) with within - subject - factor direction and between - subject - factor group to calculate differences in anterior - posterior and medio - lateral displacements of cop ( direction ) of young and older subjects ( group ) as well as interactions of both factors .
correlation analyses were carried out by means of pearson - correlations of postural performance ( cop positions , cop scatter ) and individual age of elderly subjects . within the group of young subjects ,
in subtests 1 and 3 , we tested the impact of different postural positions on standing stability .
generally , displacements in anterior - posterior direction were larger than in medio - lateral direction .
these circumstances were found in the data of young subjects and were even more pronounced in the data of older subjects .
absolute cop displacements revealed no significant between - group differences in medio - lateral direction , but in anterior - posterior direction for data of subtests 2 and 3 with older subjects showing larger displacements . for young and older subjects ,
the scatter in all three subtests was larger in anterior - posterior directions than in medio - lateral directions .
average cop scatter was higher in older subjects in medio - lateral direction for subtest 1 and 3 and anterior - posterior direction for subtest 3 .
see table 1 for details . within the group of older subjects , correlation analyses of individual age and
postural performance revealed no significant results for subtests 1 , 2 , and 3 ( r 0.358 ; p .111 ) indicating a lack of dependence of posturographic performance on individual age .
in general , there was a higher cop displacement in young subjects compared to older subjects , except for x - coordinates of subtests 4 and 5 , showing an age - related reduction in the ability to shift the cop to the edge of the base of support . in subjects of both groups
, we found significantly higher cop displacements in medio - lateral directions than in anterior - posterior directions , although the effect was more distinct in older subjects .
analysis of scatter revealed higher values in anterior - posterior direction than in medio - lateral direction for all subjects .
in anterior - posterior direction , older subjects showed increased scatter subtests 4 and 6 . data of subtests 47 and the according statistics are summarized in table 1 and depicted in figure 1 . within the data of the group of older subjects we found significant correlations between age and postural performance . within the group of older subjects , the ability to shift the cop in subtests 4 , 5 , 6 , and 7 to extreme medio - lateral positions was particularly reduced in subjects of the upper age - range , while participants of the lower age - range showed less impairment ( r 0.448 ; p .042 ) .
furthermore , the ability to shift the cop to extreme anterior - posterior positions was reduced in subtest 5 ( r = 0.510 ; p = .018 ) .
there were no significant correlations between age and cop scatter in any direction ( r 0.288 ; p .205 ) .
in subtest 8 , subjects had to shift their cop continuously by repeated clockwise rotation ( figure 2 ) .
therefore , cop coordinates were transformed to radii and averaged for each sector of the coordinate system .
young subjects reached wider displacements of their cop in all sectors ( i(upper right ) : 46.20 7.53%-rsd ; ii(upper left ) : 52.97 9.74%-rsd ; iii(lower left ) : 37.26 6.12%-rsd ; iv(lower right ) : 43.93 8.18%-rsd ) compared to older subjects ( i(upper right ) : 27.90 6.86%-rsd ; ii(upper left ) : 34.49 8.12%-rsd ; iii(lower left ) : 24.94 7.49%-rsd ; iv(lower right ) : 24.41 6.67%-rsd ) ( t - test , p .001 ) ( figure 3 ) .
the average radius of all sectors per subject was used to calculate the circumference of cop displacement for young ( 283.32 36.22 rsd ) and older subjects ( 175.51 61.04 rsd ) . accordingly
, young subjects showed significantly larger rotations of their cop as compared to older subjects ( t - test , p .001 ) .
analyses of data obtained within the group of aged subjects showed a significant correlation between individual age and the ability to displace the cop in sectors i , ii , and iv ( r 0.447 ; p 0.042 ) , where the oldest participants showed the largest degradation in performance , indicating the existence of a gradient within the group of elderly participants .
in the present study , we used the wii balance board to investigate age - related changes in balance by comparing the performance of healthy young subjects and older adults during static stance , unidirectional and rotational displacement of their centre of pressure ( cop ) .
our data show that even low - cost computerized assessment tools allow for the detection of task - specific age - related degradation in balance performance in a group of older adults .
we observed postural sway , that is , scatter of cop , in all subjects .
cop scatter was significantly higher in anterior - posterior direction than in medio - lateral direction .
this observation appears reasonable as the position of the feet ( 30 cm apart ) assures a more stable position in medio - lateral rather than anterior - posterior direction . in anterior - posterior direction ,
the base of support is limited allowing larger displacements and higher scatter of the cop .
this directionality has been observed in other studies employing force platform measurements as well . when the subjects were asked to change posture by reaching out their arms , older subjects showed larger displacements of their cop in anterior direction , as compared to young subjects .
older participants might have developed a reduced sensitivity for the detection of posture - dependent changes of their cop .
alternatively , the threshold for the release of equilibrium reactions might be raised - resulting in greater deviations of cop shifts before a compensatory action is taken . during the quiet standing tests with eyes closed ( subtests 2 and 3 ) , the older subjects significantly shifted their cop in the anterior direction .
we assume that the displacement towards the anterior base of support increased the subjects ' margin of safety .
this assumption is in line with reports where the impact of proprioceptive input for postural control in older subjects was investigated during measurements of cop displacement .
the authors found that in older subjects the sensitivity for proprioceptive information shifted from the trunk to the ankles , resulting in an even higher sensibility of the ankle muscles than that observed in young subjects .
these data were taken as an argument that proprioceptive information coming from the ankle muscles is especially important for balance control in older individuals as it compensates for the age - related loss of vestibular , visual and pressoreceptive information .
accordingly , the large cop shifts of older subjects recorded in subtests 13 can be interpreted as compensatory action to enhance afferent proprioceptive information flow from the ankles to allow efficient postural control . in subtest 47 , we investigated age - related changes in balance while standing at the limits of stability . for the individual , forward and backward leaning performance
is of particular interest as being a crucial component of the individual limit of stability , typically decreasing with advanced age and thereby possibly leading to an increased risk of falling in older adults [ 21 , 22 ] .
this notion is supported by the observation that postural sway increased dramatically when the position of the subjects came close to the limit of stability .
the data of our tests are in accordance with such findings , as older subjects showed reduced abilities to lean to anterior and posterior directions .
although older subjects attained a smaller displacement of their cop as compared to young subjects , the postural sway was in the same range or only little higher than in young subjects .
this finding supports the assumption that healthy older subjects are aware of their reduced balance abilities and adjust their range of leaning accordingly . to find out whether there is a progressive increase of age - related degradation within the group of older participants
, we performed a correlation analysis , confirming that especially participants of very high age show an impairment of balance in more demanding tasks . for nondemanding subtests 1 , 2 , and 3
however , subtest 47 characterized by increased complexity showed significant correlations between age and postural performance , suggesting a progressive increase of age - related degradation within the group of elderly participants .
our results are in accordance with studies on hand motor performance and increasing age , suggesting an age - threshold up to which increasing task - complexity can by compensated by the individual .
once exceeded , this threshold is associated with a steady age - related impairment . in subtest 8 , we found significant group - differences in performance for every sector of the rotation movement and the overall circumference of cop rotation .
concomitantly , there were significant correlations between older subjects ' age and the according performance in subtest 8 , suggesting again a close relation between an age - related impairment of balance and the complexity of the task .
low - cost force platforms can be used for the assessment of balance performance in older subjects , thereby bridging the gap between sophisticated laboratory test equipments and low - level functional tests .
low - cost force platforms might turn to be out a simple but efficient way to assure data acquisition in short time on a routine basis .
a particularly interesting option could be the combination of low - cost force platforms and established functional tests . | as life expectancy continues to rise , in the future there will be an increasing number of older people prone to falling .
accordingly , there is an urgent need for comprehensive testing of older individuals to collect data and to identify possible risk factors for falling .
here we use a low - cost force platform to rapidly assess deficits in balance under various conditions .
we tested 21 healthy older adults and 24 young adults during static stance , unidirectional and rotational displacement of their centre of pressure ( cop ) .
we found an age - related increase in postural sway during quiet standing and a reduction of maximal cop displacement in unidirectional and rotational displacement tests .
our data show that even low - cost computerized assessment tools allow for the comprehensive testing of balance performance in older subjects . |
staphylococcus aureus , a gram - positive bacterium , is a commensal organism known to cause a wide range of hospital- and community - acquired infections .
it is also recognized for immune evasion mechanisms and its ability to develop multi - antibiotic resistance .
the burden of staphylococcal disease has increased worldwide with the emergence of community - acquired methicillin - resistant staphylococcus aureus ( ca - mrsa ) [ 1 , 2 ] .
incidence of s. aureus bacteremia in the united states ranges between 20 and 40 cases per 100,000 with the case fatality rates ranging from 19 to 24% .
the major threats are the increase in the drug resistance in s. aureus , the spread among community isolates , and the limited new drugs with demonstrable efficacy on the drug - resistant isolates . to address these challenges , we need to develop new tools and/or to retune old tools with new techniques .
therapeutic antibodies ( passive immunotherapy ) which can enhance the host immune system 's ability to overcome s. aureus infection are ideal candidates to be evaluated as alternatives to combating this infection .
p4 , a 28-amino acid peptide derived from pneumococcal surface adhesin a , has enhanced in vitro opsonophagocytosis in the presence of pathogen - specific igg and rescued mice from life - threatening pneumococcal infection ( p4-therapy ) [ 68 ] .
recently , we have shown that p4-therapy can also be used to rescue mice from serious secondary pneumococcal infection following h1n1 viral infection in mice .
we questioned if it is possible to use p4 therapy to treat staphylococcal infections in vivo ?
the amino acid sequence of the peptide designated as p4 was previously described [ 10 , 11 ] .
p4 peptide with free n- and c - terminus were synthesized and lyophilized at cdc core facility , atlanta , ga .
p4 peptide used in this study was synthesized in an act ( advanced chem tech ) 396 multiple peptide synthesizer by use of standard and modified fluorenylmethyloxycarbonyl ( fmoc ) protocols [ 1214 ] and analyzed for fidelity of synthesis based on the protocols previously described .
lyophilized peptide was resuspended in diethylpyrocarbonate- ( depc- ) treated water , sonicated for 3 minutes for dissolution and stored at 70c .
we derived 2 peptides , p6 and/or p7 from p4 sequence , and these peptides had no activation effect on the eukaryotic cells .
s. aureus - specific polyclonal and monoclonal antibodies used in this study are as follows : ( 1 ) gammaglobulin ( ivig , gamunex , telecris , nc ) , a pooled human serum having reactivity with a wide range of pathogens including s. aureus , ( 2 ) a rabbit polyclonal ( ab35194 , abcam , cambridge , ma ) directed towards the soluble and structural antigens of the s. aureus , ( 3 ) rabbit polyclonal igg directed towards the clumping factor a , clfa of s. aureus , pabclfa ( courtesy inhibitex , inc , alpharetta , ga ) , and ( 4 ) humanized mouse monoclonal anti - clfa igg , hm904 ( courtesy inhibitex , inc , alpharetta , ga ) .
our in vitro experiment design involved direct comparison of changes in opsonophagocytic killing or uptake in the presence or absence of p4 . to assess the relevance of p4 therapy to treat s. aureus infections
promyelocytic leucocytes differentiated into granulocytic lineage or fresh human polymorphonuclear neutrophills ( pmns ) were used as effector cells .
colony blot was used to screen three different s. aureus strains , namely , s. aureus strainl , strainn , and strainfb for the presence of surface - exposed antigens that react with the polyclonal and monoclonal antibodies listed above .
based on the colony blot analysis ( data not shown ) , s. aureus strainn was selected for opka . while all three s. aureus strains reacted with ivig ( gamunex ) , s. aureus strainn was the only that reacted with all four antibodies .
p4 peptide solution ( 100 g / ml ) was added to the opka mixture at the pre - opsonization stage , and the control wells received 10 l depc water instead .
opsonophagocytic killing of s. aureus strainn in the presence of strain - specific antibodies and complement without p4 served as the control .
increase in opsonophagocytic killing of the bacterium when p4 was added to this reaction mixture ( bacteria , antibody , and complement ) was calculated and expressed as % increase over control .
several experimental controls were maintained that include bacteria alone , bacteria with either one of the opka components , ( antibody , complement , hl60 cells ) , or an incomplete combination that lacks any of the listed components .
none of these controls results in the killing of bacteria . since the primary objective of this study is to demonstrate the effect of p4 on the opsonophagocytic killing of s. aureus strainn , these controls were not included in the figures .
heparinized venous blood was obtained from the emory blood donor services , atlanta , ga . the leukocyte separation kit , histopaque-1119 ( sigma , st .
mice ( mus musculus ) , strain swiss webster ( nd4-sw ) , were obtained from charles river laboratories ( wilimington , ma , usa ) .
intranasal inoculation of mice with s. aureus strainn and p4 therapy was performed using protocols previously described , with minor modifications [ 6 , 8 ] .
female swiss webster mice ( charles river laboratories , wilmington , ma ) 6 to 10 weeks of age were used in this study .
all experiments were approved by the institutional care and use committee ( iacuc ) and conducted according to the institutional ethical guidelines for animal experiments and safety guidelines .
swiss - webster mice ( n = 50 ) were infected intranasally with s. aureus strainn ( ~1.1 10 cells / mouse ) .
our initial attempts to develop an intravenous challenge model were unsuccessful due to the rapid pathogenesis .
hence , we selected an intranasal challenge model that provided a window between moribundity and rescue . at 15 hours after challenge , 40/50 mice were moribund ( score 2 ) .
moribund mice were divided into four groups ( 10/group ) that included three control groups ( no treatment , p4 only , and ivig only ) and p4 therapy group ( p4 + ivig ) .
treatment control groups received two doses of ivig ( i.p ; 100 l / mouse ) or p4 ( i.v ; 100 g / mouse ) at 15 hours and 24 hours after infection .
these time points were chosen based on pathogen - specific challenge and dosage optimization experiments .
similarly , p4 therapy group received 2 doses of ivig ( i.p ; 100 l / mouse ) , followed 20 minutes later by p4 ( i.v ; 100 g / mouse ) .
treated and untreated animals were monitored for disease symptoms and survival . due to iacuc limitations , we have only used ivig for in vivo experiments .
mice were ranked on a scale of 5 to 0 ; 5 = healthy , normal coat , skin , eyes , breathing and activity / movement ; 4 = healthy , beginning to look sick , ruffled coat ; 3 = sick , ruffled coat , decreased activity ; 2 = very sick , ruffled coat , decreased activity , eye secretions ; 1 = near death , ruffled coat , little / no activity , eye secretions , decreased breathing , hence euthanized ; 0 = dead .
all in vitro and in vivo experiments were performed in triplicate on three separate assay days unless specified otherwise .
number of moribund animals after the treatment was recorded till 80 hours and the data were computed for significant difference among various groups using t - test : paired two samples for means ( ms excel 2003 ) .
p4 peptide , a 28-amino acid putative binding domain of pneumococcal surface adhesin a ( psaa ) , is a multilineage cellular activator .
here we have demonstrated that this eukaryotic cellular activation potential in p4 peptide can be exploited for rescuing mice from serious staphylococcal infections .
requirement of target - specific functional antibodies and complement supports the hypothesis that p4 enhances opsonophagocytosis of the target bacteria by the effector cells .
p4 peptide has no direct effect on the bacterium and has no deleterious effect on human cells .
additional experiments have shown that p4 peptide does not directly increase the intraphagocytic respiratory burst as seen with oxyburst - labelled bacterium or reactive oxygen species ( ros ) production ( data not shown ) . p4
enhanced the in vitro opsonophagocytic killing of s. aureus strainn in the presence of species - specific antibody and complement .
the p4-mediated enhancement of opk for s. aureus strainn was observed with hl-60-derived granulocytes and fresh pmns from human peripheral blood ( figures 1 and 2 ) . among the antistaphylococcal antibodies , maximum enhancement in the opsonophagocytic killing of s. aureus strainn
was seen with the humanized anti - clfa mab ( hm904 ) with the fresh pmns as the effector cells ( 100% with 6.6
previously , humanized anti - clfa monoclonal antibody was shown to be effective as a prophylactic to protect lab animals from staphylococcal infection . to ascertain
if the p4-mediated enhancement of opsonophagocytosis would translate into therapeutic benefit , mouse rescue studies were carried out .
seventy percent ( 7/10 ) of mice that received p4 and ivig therapy survived with complete remission of symptoms compared to untreated control group that had no survivors ( p = 0.024 , figure 3 ) . even though there was a difference in the number of animals that survived in the single - treatment groups ( p4 only = 40% ; ivig only = 20% ) , these differences were not statistically significant ( p = 0.33 ) . in this study , we have shown that p4-therapy combined with ivig is effective in rescuing mice from severe s. aureus infection .
the p4-mediated rescue of mice is likely due to activation of circulating effector cells leading to an increase in the number of phagocytic cells participating in the opsonophagocytic clearance of the bacterial pathogen .
we have hypothesized a mechanism of p4-therapy ; although the exact mechanism is still under investigation , previous studies suggest that p4 therapy augments innate immunity .
polymorphonuclear neutrophils ( pmns ) are the major innate immune component activated by p4 peptide as we have observed that mice treated with a neutrophil - depleting antibody , rb6 - 8c5 , failed to respond to in vivo p4 therapy .
recently , we have demonstrated that both altered trafficking and enhanced capacity of professional phagocytes are also associated with the potential protective mechanism for p4-therapy .
we have also observed rapid clearance of bacteria associated with decreased surface display of fcri and fcrii on phagocytes . in short ,
the presence of pathogen - specific antibody , effector cells , and complement are the critical factors that determine the effectiveness of p4 therapy against a particular pathogen .
staphylococcus aureus continues to be a problem pathogen owing to its broad range of virulence factors and drug resistance .
passive immune - therapy ( ivig ) with immune - enhancing agents like p4 peptide provides a viable alternative to treat s. aureus . because of the high burden of staphylococcal disease and high case fatality rate , these findings merit further exploration | staphylococcus aureus ( sa ) is a major community - acquired pathogen .
the emergence of drug - resistant strains like , methicillin - resistant sa ( mrsa ) , poses stiff challenges to therapeutic intervention
. passive immune - therapy with specific antibodies is being actively examined to treat fulminant infections with limited success . in this study , we demonstrate that p4 , a 28-amino acid peptide , derived from pneumococcal surface adhesin a along with pathogen - specific antibody ( ivig ; p4 therapy ) is successful in enhancing the opsonophagocytic killing ( opk ) of s. aureus in vitro .
we questioned if it is possible to expand p4 therapy to treat staphylococcal infections in vivo .
p4 therapy in combination with ivig rescued 7/10 morbidly ill s. aureus - infected mice while only 2/10 survived in the control group . |
among the group - iii nitrides , wurtzite inn ( w - inn ) is a very promising semiconductor material of application in high - frequency / high - speed / high - power heterojunction field - effect transistors ( hfets ) [ 1 - 4 ] , due to its superior electron transport properties , small effective mass , and high mobility .
w - inn also has been used in field emitter because of its negative affinity ( net ) [ 5 - 7 ] .
hexagonal boron nitride ( h - bn ) is a sp - bonded layered compound isostructural to graphite . due to its wide band gap
there were several reports on field emission characteristics of h - bn films [ 8 - 10 ] .
chinaru and his co - workers designed an h - bn / gan field emission device , which appeared lower turning on voltage compared with the conventional devices .
the band structures of w - inn and h - bn are very similar to that of h - bn and gan , so w - inn / h - bn is promising for field device .
it is important to accurately determine the valence band offset ( vbo ) and conduction band offset ( cbo ) for using w - inn / h - bn - based electronic devices .
theoretical and experimental values of band structure have been extensively investigated for the w - inn and h - bn , respectively , but it is still scarce for the w - inn / h - bn heterojunction .
this letter reports the valence band discontinuity at the w - inn / h - bn heterojunction interface .
three samples were used in our x - ray photoelectron spectroscopy ( xps ) experiments .
a 40-nm - thick h - bn layer was deposited by ion beam assisted deposition on si substrate .
w - inn films were deposited by metal organic chemical vapor deposition ( mocvd ) : a 5-nm - thick w - inn grown on a prepared h - bn layer on si substrate and a 250-nm - thick w - inn grown on si(111 ) substrate .
the crystal qualities of w - inn were characterized using the high - resolution x - ray diffraction apparatus at beijing synchrotron radiation facility .
the full width at half maximum of the x - ray diffraction rocking curve ( xrc ) is 0.75. the w - inn is unintentionally n - type doped , the carrier concentration is 1 10 cm determined by hall performed in single field the van der pauw geometry at room temperature . however , the h - bn is high resistance .
xps measurement was performed on phi quantera sxm instrument with al k ( h = 1486.6 ev ) as the x - ray radiation source and the angle between the x - ray source and the detector is 45. the work function and the fermi energy level ( ef ) of the instrument had been carefully calibrated .
the surfaces of all the samples were exposed in the air , so existence of impurities ( such as oxygen and carbon ) on the surface may prevent the precise determination of the valence band maximum ( vbm ) . in order to reduce the contamination effect , all the samples were subjected to surface clean procedure by ar bombardment with a voltage of 1 kv at a low sputtering rate of 0.5 nm / min .
the total energy resolution of xps system is about 0.5 ev , and the precision of the binding energy is within 0.03 ev after careful calibration .
all xps spectra were calibrated by the c 1-s peak at 284.8 ev from contamination to compensate the charge effect .
the vbo can be calculated according to where is the energy difference between in 3d5/2 and b 1s cls at the w - inn / h - bn interface . in the terms of and , and
are the cls of w - inn and h - bn bulk constants of thick films , respectively , and , means the bulk position of the valence band maximum with respect to the ef .
the positions of valence band maximum ( vbm ) in valence band ( vb ) spectra are determined by linear extrapolation of leading edges of vb spectra to the base lines in order to account for the finite instrument resolution . since considerable fitted line to the original measured data
has been obtained , the uncertainty of the cl positions should be lower than 0.03 ev , as evaluated by numerous fitting with different parameters .
the in 3d5/2 spectra for w - inn and w - inn / h - bn samples , the b 1-s spectra for h - bn and w - inn / h - bn samples , and the valence band photoemission for both w - inn and h - bn samples are shown in fig .
1 . the parameters deduced from fig . 1 are summarized in table 1 for clarity . as illustrated in fig .
1a and 1e , the cl lineshapes of w - inn appeared a weak asymmetry .
the intrinsic plasmon is that a strong local potential produced when an electron of cl was removed from the matrix , leaving a positive charge of photohole and then the deexcitation of the photohole by quantized excitations the conduction - electron system .
however , the extrinsic plasmons are excited by the outgoing photoelectron traveling from the place of the photoexcitation process to the surface [ 14 - 17 ] .
considering the couple of the surface plasmons and photoelectrons , the final - state is projected onto screened component and unscreened component .
we attribute the lower energy component to the screened final - state and the higher - energy component to the unscreened final - state .
wertheim and his co - worker used this model to explain screening response in narrow band metal .
the energy of the surface plasmon is here n is the carrier concentration , ( ) and m are the high - frequency dielectric constant and the effective mass of the conduction electron , respectively .
for the unintentionally doped n - type w - inn , the carrier concentration is much lower than that of metal .
the energy of plasmon is always less than 1 ev , which is comparable with the intrinsic linewidth . the screened and unscreened peaks overlapped , resulting in an asymmetric core lineshape . the in 3d5/2 consists of three peaks by voigt fit using shirley background , the positions of peak locked at 443.71 , 444.54 , and 445.45 ev , as shown in fig .
1a . the binding energy of 443.71 and 444.54 ev associated with screened final state and the unscreened final states , respectively . the binding energy of 445.45 ev belongs to in - o bond .
similarly , in the w - inn / h - bn system , the binding energy of 443.78 and 444.67 ev belong to screened and unscreen final states , respectively . according to previous reports
, it is suggested that the energy 446.15 ev is in - o bonding in fig .
cl spectra of in 3d5/2 recorded on w - inn bulk ( a ) and w - inn / h - bn ( e ) samples , b 1-s spectra on h - bn bulk ( c ) and w - inn / h - bn heterojunction ( f ) .
samples , w - inn vb spectra ( b ) and h - bn vb spectra .
all peaks have been fitted to voigt line shapes using shirley background , and the vbm values are determined by linear extrapolation of the leading edge to the base line parameters ( binding energy , full width at half maximum ( fwhm ) ) of the xps peaks and vbms for w - inn , h - bn and w - inn / h - bn samples , the spectra as shown in fig .
1 energy is referenced to the fermi level ( 0 ev).the errors in the peak positions and vbm are 0.03 and 0.08 ev , respectively the energy differences between the unscreened and the screened are 0.83 and 0.89 ev for the bulk and the heterojunction .
bn 1-s peak in the bulk and heterojunction is 190.1 and 190.37 ev , respectively .
the vbm lineshape and the cl positions of h - bn are very similar to the latest reports . due to the peak and linewidth of higher - binding energy ( unscreened final - state ) depend on the excitement of bulk , surface treatment , we choose the lower - binding energy components related to screened final - state for vbo calculation , in this letter . at room temperature ,
taniguchi and his coworker have calculated the band gap of h - bn about 5.97 ev . according to obtained data ,
are the band gap of h - bn and w - inn , respectively .
is calculated to be 4.99 ev . according to these results , a type - ii band alignment forms at the w - inn / h - bn heterojunction , as shown in fig .
room temperature vbm and cbm line - up of the w - inn / h - bn heterojunction , showing a type - ii band alignment we noted that lattice mismatch between w - inn ( 0001 ) and h - bn ( 0001 ) is 20% , so the critical thickness is estimated to be about 1 monolayer ( ml ) .
the residual stress in the film is very small . because of the small linear pressure coefficient of inn ( ~0.06 mev / gpa )
according to his results , we estimate the magnitude of the field is in the order of 10 v / m . due to
the critical thickness is about 1 ml , the band bending caused by the piezoelectric effect is about 0.06 ev .
the effect of interface states is to shift the potential within the sampled region on both sides of the interface by the same constant value .
and then , any potential shift which due to band bending induced by interface states can be canceled .
in summary , the vbo of w - inn / h - bn heterojunction has been measured by xps to be 0.30 0.09 ev , and the corresponding cbo is 4.99 0.09 ev , so it belongs to a type - ii band line - up .
based on the calculation , the effect of piezoelectric caused by the lattice mismatch and band bending by the surface state can be neglected .
the accurate determination of the band alignment of w - inn / h - bn is important for designing the devices .
the authors are grateful to professor huanhua wang and dr . tieying yang of the institute of high energy physics , chinese academy of science .
this work was supported by national science foundation of china ( no.60776015 , 60976008 ) , the special funds for major state basic research project ( 973 program ) of china ( no.2006 cb604907 ) , and the 863 high technology r&d program of china ( no.2007aa03z402,2007aa03z451 ) .
this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited .
this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited . | x - ray photoelectron spectroscopy has been used to measure the valence band offset ( vbo ) of the w - inn / h - bn heterojunction .
we find that it is a type - ii heterojunction with the vbo being 0.30 0.09 ev and the corresponding conduction band offset ( cbo ) being 4.99 0.09 ev .
the accurate determination of vbo and cbo is important for designing the w - inn / h - bn - based electronic devices . |
gait recovery is a major objective in the rehabilitation program for individuals with
poststroke hemiparesis1 .
treadmill
training2 and treadmill training with
harness support3,4,5 have been reported to be
effective methods for retraining walking .
hollands et al . reported that repetitive
task - specific practice , an intervention that consists of repeating a specific task to regain
a functional movement , appeared to be a promising approach to restore gait coordination6 .
in contrast , physical therapy in acute
stroke patients tends to focus on improving a specific muscle activity or a partial movement
of some task due to poor muscle strength .
recovery of function after stroke has been
attributed to and based on reorganization of the brain in several reports7,8,9 .
additionally , some studies support the
hypothesis that such a neurologic change is greatly affected by repeated practice of the
movement task , which indicates that functional reorganization of the brain may be highly
associated with use of the cerebral cortex and its frequency10,11,12 .
when performance of a task is improved by movement training , transfer of learning occurs in
the background in motor skill learning , and this occurs due to the dynamic similarity of the
movements13,14,15 .
therefore , the therapist
should determine the component of the movement that is lacking or insufficient in the
patient and then elaborate the exercise according to the needed movement to regain a
determined task as described by carr and shepherd16 .
there is a method to improve the walking ability in adult patients with hemiparesis
according to exercises designed to increase weight - bearing and weight transfer on the
paretic lower limb .
the underlying foundation of such intervention is that improving the
symmetry of weight - bearing while in the bipedal stance can result in balance and locomotor
performance improvements .
davies17
reported that most patients with hemiparesis have difficulty propelling the paretic limb in
the swing phase .
kramers de quervain et al.18 reported that the duration of the pre - swing phase was prolonged in
patients who had the slowest gait speed , thus further emphasizing the importance of
improving the muscular strength and coordination of the paretic side during the pre - swing
phase .
the weight transfer from one lower limb to the other is important for locomotion and
is a requirement for walking and stair climbing19 . during rapid single - leg flexion movements in the standing
position , the lateral horizontal ground reaction force components are lower in subjects with
hemiparesis than in healthy subjects20 ,
and weight transfer to the non - paretic limb is insufficient21 , 22 .
consequently , the
ability to elevate the paretic foot in tasks that require single - leg stance is compromised .
for these reasons , hemiparetic patients tend to first incline the upper body to the support
side and then elevate the paretic foot .
therefore , we focused our attention on the
stepping - in - place movement task to improve the paretic swing phase in the gait , and we
designed a spring - loaded takeoff board device to assist the lifting of the paretic foot .
the purpose of this study was to investigate the effect of the training device designed to
assist heel elevation during repetitive stepping - in - place exercise on motor function and
walking ability in patients with chronic hemiplegic stroke .
we hypothesized that motor
function of the paretic lower limb would be improved , lateral movement of the upper body
would be reduced during paretic limb lifting , the pre - swing phase of the gait would be
shorter , and the step length would be longer .
ten subjects ( 6 males and 4 females ) with chronic hemiparetic stroke volunteered for this
study . three subjects dropped out during the intervention period .
thus , seven participants
( 4 males , 3 females ; age 80.94.9 years ) from a community - dwelling population who were
users of an adult daycare facility ultimately participated in this study .
such neurological
deficiencies were the consequence of either cerebral infarction or cerebral hemorrhage due
to an initial ( n=4 ) or a recurrent ( n=3 ) stroke .
five participants were able to ambulate independently , and two participants
required supervision or minimal assistance to walk .
six participants used a straight cane ,
and one participant used a four - point cane .
four individuals used an ankle - foot orthosis
( table 1table 1.initial characteristics of the participantsparticipantspapbpcpdpepfpggendermfmmfmfage ( years)83818480718478weight ( kg)56.258.155.266.459.254.750.8time after stroke ( years)69173103211type of strokeischemicischemicischemic(recurrent)hemorrhagicischemicischemicischemicischemichemorrhagicischemichemorrhagichemiparetic sideleftrightrightrightrightrightrightmaship1113021knee2013112ankle2111111le - fma152199191125use of an orthosisafoafoafoafowalking aidt - canet - canet - canequad - canet - canet - canet - canefac3542434mas : modified ashworth scale ( 05 ) ; le - fma : lower extremity subscale of the
fugl - meyer assessmen ; fac : functional ambulation category ( 05 ) ; afo : ankle - foot
orthosis ) .
the
inclusion criteria were as follows : ( 1 ) able to maintain the standing position
independently , and ( 2 ) able to walk at least 10 m on flat ground with or without minimum
assistance in walking balance .
the exclusion criteria were as follows : ( 1 ) clinical signs
of heart failure , ( 2 ) any orthopedic or neurologic conditions in addition to the stroke ,
and ( 3 ) gross cognitive sequelae .
this clinical study was approved by the kanazawa
university medical ethics screening committee ( approval number : 432 ) .
they were also
allowed to continue the exercise for an arbitrary period upon request .
mas : modified ashworth scale ( 05 ) ; le - fma : lower extremity subscale of the
fugl - meyer assessmen ; fac : functional ambulation category ( 05 ) ; afo : ankle - foot
orthosis an a - b study was applied as follows : during phase a ( baseline ) , the participant received
the usual care provided in the adult daycare facility . during phase b ( intervention ) , the
participant performed an additional exercise task ( stepping movement ) that consisted of
repeatedly lifting the paretic foot in the standing position for approximately 20 minutes
using a specific device designed for this study at the adult daycare facility .
each phase
was performed for 2 weeks . however , two participants wanted to voluntarily continue the
exercise , and they were also evaluated after a total of 16 weeks of intervention ( eva4 ) .
the subjects were evaluated three or four times .
each evaluation consisted of a clinical
evaluation and a kinematic analysis , which were performed before phase a and before and
after phase b ( designated hereafter as eva1 , eva2 , eva3 , and eva4 , respectively ) .
all
evaluations and interventions were performed in the adult daycare facility the
participants attended .
the device used during phase b consisted of a spring - loaded takeoff board that assisted
the lifting of the foot heel in the stepping movement ( fig .
1.the device that assists the lifting of the foot heel : ( a ) picture of the device ,
( b ) schematic illustration of the device ( side view ) , ( c ) schematic illustration of
the device ( rear view ) and adjustment by the number of springs ) .
the participants performed the stepping - in - place exercise using this device
during the intervention phase .
first , depending on the ability of the participant , the amount of assistance required to
lift the paretic foot is adjusted by changing the number of springs of the device .
second ,
movement using this device is similar to movement of the lower limbs in the walking
pre - swing phase , promoting hip joint flexion , knee flexion , and ankle plantar flexion .
we
considered that a sense of motion closer to real walking was more likely to be obtained .
third , a loading feedback sensation is obtained by applying weight to the paretic foot
against the device s spring .
it is thought that this is effective for improving the
movement in the pre - swing phase that allows transition from stance to swing to be
accomplished .
therefore , it is expected that the walking pattern ( improvement of the
paretic swing ) is improved by performing the movement using this device in patients with
hemiplegia .
we hypothesized that repetition of the stepping - in - place exercise using this
device would be effective for improving the motor function of the lower limbs and for
improving walking function .
in other words , we designed a movement task based on transfer
of learning .
the strength of the springs was adjusted to allow for a standing position
when they were stepped on and to allow for easy heel lifting .
the movement speed was
adapted according to the participant s ability to perform the exercise for approximately
20 minutes , including rest breaks .
the device that assists the lifting of the foot heel : ( a ) picture of the device ,
( b ) schematic illustration of the device ( side view ) , ( c ) schematic illustration of
the device ( rear view ) and adjustment by the number of springs to test the efficacy of the interventions , a clinical evaluation and kinematic analysis
of the stepping - in - place and walking exercises were performed for each evaluation
time .
the motor function of the lower limbs was assessed using the lower extremity items
( maximum score = 34 points ) of the fugl - meyer assessment ( fma ) , and walking ability was
assessed using the 10-m walking test and functional ambulation category ( fac ) .
the
spasticity of the lower limbs ( e.g. , hip , knee , and ankle joint ) was assessed using the
modified ashworth spasticity scale ( 05 ) . in the 10-m walking test , the subjects were
asked to walk a 12-m gait track ; the first and last meters were excluded from measurement ,
leaving a 10 m measurement section .
the subjects were instructed to walk at their own
preferred speed . the time and steps required for them to walk the measurement section were
recorded .
a two - dimensional motion analysis of movement in the sagittal plane of walking and in the
frontal plane of the stepping - in - place was performed .
the stepping - in - place exercise was
chosen to examine the lateral movement of the upper body and double support duration .
hemispheric reflection markers ( 1 cm in diameter ) were placed on the spinal column for the
spinous process of the 5th lumbar vertebra and bilateral posterior extremity of the heel .
one digital camera ( ex - zr800 , casio computer co. , ltd . , tokyo , japan ) mounted on a tripod
was positioned approximately 5 m perpendicular to the plane of each movement .
two - dimensional
coordinate data were calculated using a motion analysis software package ( frame - dias iv ,
dkh co. , ltd . , tokyo , japan ) . for the participants who required an ankle - foot orthosis ,
the measurement motion was
performed with them wearing shoes , while for the other participants , the measurements were
performed while barefoot .
care was taken to maintain the same measurement conditions for each evaluation in
all participants . as the walking was performed in the paretic sagittal plane , 3 trials
with a distance of 5 m were performed .
the stepping - in - place test was evaluated from
behind the subjects and was performed approximately 20 times in the same position .
the
subjects were instructed to perform both motions at a self - selected comfortable and safe
speed .
the walking speed ( m / sec ) and cadence ( steps / minute ) were calculated using the 10-m
walking test . for the purpose of the calculation , from each of two trials , the result that
was higher in value was selected .
it is assumed that the single stance phase becomes
shorter and the double supporting phase becomes longer as the walking speed becomes slower
and that the swing phase in natural walking accounts for 40% of the gait cycle .
in other
words , we hypothesized that the double supporting phase is shortened and that the swing
time is extended and becomes closer to 40% of the gait cycle as the walking speed is
increased .
therefore , the walking motion of 1 gait cycle was used for the kinematic
analysis .
the following values were calculated from the walking video : duration of one
gait cycle and swing phase of the paretic side ( 1 gc duration in sec , sw duration in sec )
and the percentage of the swing phase to one gait cycle ( % sw ) . the paretic step length ( m )
was calculated using the coordinates of the bilateral heel markers . for these parameters ,
the motions from the 6th to 15th repetitions of the stepping - in - place motion ( 20 in
total ) were used for the kinematic analysis . for the stepping - in - place exercise , it was
assumed that the lateral movement of the center of gravity becomes smaller and that the
duration from non - paretic foot touchdown to lifting of the paretic foot is shortened as
the walking speed increases . therefore , the following values were calculated during the
stepping - in - place exercise : lateral amplitude of l5 ( l5-amp in m ) and the time from
non - paretic heel contact to paretic heel off ( hc - ho duration in sec ) . the mean values for
the stepping - in - place motion
were calculated from ten motions . to test the changes compared with baseline , the wilcoxon signed - rank test
was used to
assess the difference between eva1 and eva2 for each evaluation result .
considering the
physical and emotional condition variability of each participant , the efficacy of a given
intervention was tested by comparing the mean of the results for eva1 and eva2 with the
eva3 or eva4 results .
a p value of 0.5 or lower was considered significant for all
statistical comparisons .
the seven hemiplegic patients who participated in this study completed the intervention
period of 2 weeks .
the durations of
exercise and rest were carefully considered so that the intervention would not cause any
significant fatigue or overload .
five of seven participants were able to continue the
exercise task for 20 minutes in each session .
two participants ( pa , pe ) expressed positive
opinions , such as the sensation of the paretic foot touching the floor became more
perceptible and it seems good during the stepping - in - place exercise .
these two
participants voluntarily continued the exercise for 14 more weeks after the 2-week
intervention period , for a total of 16 weeks of the intervention . upon obtaining their
consent ,
two
participants ( pd , pe ) , who were not able to perform the exercise for 20 minutes due to less
physical endurance , performed the exercise for shorter periods than the others ( 15 min and
10 min , respectively ) .
additionally , pd refused to undergo the kinematic analysis for the
stepping - in - place motion due to a feeling of fatigue on the evaluation day .
overall , no significant difference was found at the end points between eva1 and eva2
compared with baseline ( p > 0.05 ) .
the average valued were calculated for eva1 and eva2 ,
was and they were compared with the results for eva3 ; no significant difference was found
between the values ( p > 0.05 ) .
therefore , each evaluation outcome after the intervention ( eva3 or eva4 ) was
compared with the average of eva1 and eva2 as the baseline ( mean of eva1 and eva2 ) for each
participant .
the percentages of increase or decrease for eva3 and eva4 compared with the
baseline values are shown in table 2table 2.clinical assessment and the kinematic parameters of walking and stepping - in - place
of each participantparticipantspapbpcpdpepfpgclinical assessmentwalking speed ( m / sec ) baseline0.650.580.310.160.40.260.23eva30.680.590.300.170.410.210.26(+4.6)(+1.7)(3.2)(+6.3)(+2.5)(19.2)(+13.0)eva40.750.46(+15.4)(+15.0)cadence ( steps / min)baseline102.58475.143.978.156.774.6eva398.288.669.146.678.551.076.0(4.2)(+5.5)(8.0)(+6.2)(+0.5)(10.1)(+1.9)eva498.986(3.5)(+10.1)le - fma ( score/34)baseline14.5219919.51124.5eva315219920925eva41621walking1 gc duration ( sec)baseline1.181.561.692.451.722.771.68eva31.271.411.892.341.632.661.71(+7.6)(9.6)(+11.8)(4.5)(5.2)(4.0)(+1.8)eva41.231.41(+4.2)(18.0)swing phase duration ( sec)baseline0.410.530.570.520.570.540.48eva30.50.40.720.340.60.590.52(+22.0)(24.5)(+26.3)(34.6)(+5.3)(+9.3)(+8.3)eva40.50.52(+22.0)(8.8)%sw ( % ) baseline34.833.933.722.533.219.628.8eva338.928.537.914.43722.130.6(+11.8)(15.9)(+12.5)(36.0)(+11.4)(+12.8)(+6.3)eva440.737.1(+17.0)(+11.7)step length ( m)baseline0.290.310.340.10.320.240.17eva30.30.290.350.070.310.200.17(+3.4)(6.5)(+2.9)(30.0)(3.1)(16.7)(0)eva40.350.34(+20.7)(+6.3)stepping - in - placel5-amp ( m)baseline0.140.130.090.080.140.11eva30.120.120.120.050.130.1(14.3)(7.7)(+33.3)(37.5)(7.1)(9.1)eva40.120.06(14.3)(25.0)ho - hc duration ( sec)baseline0.440.190.320.321.040.27eva30.120.120.490.250.850.17(72.7)(36.8)(+53.1)(21.9)(18.3)(37.0)eva40.110.17(75.0)(46.9)eva1 : evaluation performed before phase a ; eva2 : evaluation performed before phase b ;
eva2 : evaluation performed after phase b ; eva4 : evaluation performed 16 weeks after
intervention .
le - fma : lower extremity
subscale of the fugl - meyer assessment ; gc : gait cycle , l5-amp : lateral amplitude of
l5 ; ho - hc duration : time from non - paretic heel contact to paretic heel off ; % sw(% ) :
percentage of the swing phase in a gait cycle .
the values in parentheses indicate the
percentages of increase or decrease of eva3 and eva4 compared with the baseline .. eva1 : evaluation performed before phase a ; eva2 : evaluation performed before phase b ;
eva2 : evaluation performed after phase b ; eva4 : evaluation performed 16 weeks after
intervention .
le - fma : lower extremity
subscale of the fugl - meyer assessment ; gc : gait cycle , l5-amp : lateral amplitude of
l5 ; ho - hc duration : time from non - paretic heel contact to paretic heel off ; % sw(% ) :
percentage of the swing phase in a gait cycle .
the values in parentheses indicate the
percentages of increase or decrease of eva3 and eva4 compared with the baseline .
a walking speed gain was found in three participants ( pa + 15.4% , pe + 15.0% , pg + 13.0% ) ,
and , furthermore , a cadence gain was found for pe and pg ( pe + 10.1% , pg + 1.9% ) .
however , no
change in walking speed was detected in the four other participants , and for pf , walking
speed became slower ( 19.2% ) .
the scores for the lower extremity subscale of the fugl - meyer
assessment ( le - fma ) of three subjects ( pc , pd , pf ) were lower than those ofthe other
participants . considering the parameters in the kinematic analysis of the three subjects who demonstrated
increased walking speeds ( pa , pe , and pg ) , the main changes were as follows : sw duration was
extended in pa and pg ( pa + 22.0% , pg + 8.3% ) , and the step length was increased in pa ( pa
+ 20.7% ) .
pa and pe obtained increases closer to 40% ( pa 40.7% , pe 37.1% ) .
additionally , the hc - ho duration of the stepping - in - place motion decreased in these three
patients ( pa 75.0% , pe 46.9% , pg 37.0% ) .
in contrast , the kinematic analysis results of the four participants whose walking speed
did not increase were as follows . for pb ,
the time from the support and swing phase became
shorter , and the hc - ho duration of the stepping motion decreased ( 36.8% ) .
for pc , the 1 gc
duration ( + 11.8% ) and sw duration ( + 26.3% ) increased , and % sw ( 37.9% ) became closer to 40%
in the walking motion .
for pf , the hc - ho duration in the stepping - in - place motion and 1 gc
duration in the walking motion decreased , showing some improvement ( hc - ho duration 18.3% , 1
gc duration 4.0% ) .
this study focused on the stepping - in - place exercise to improve the paretic swing of the
hemiplegic gait .
thus , a spring - loaded takeoff board was designed to assist the heel
elevation of the stepping - in - place early phase . performing the stepping - in - place exercise
using this device in patients with chronic hemiparesis
, we hypothesized that the motor
function of the paretic lower limb would be improved , the lateral movement of the upper body
would be reduced during paretic limb lifting , the pre - swing phase of the gait would become
shorter , and the step length would become longer . according to the results , the improvements
shown by the participants differed , with each participant showing specific improvements in
different areas .
the time after the initial stroke ( ranging from 3 to 32 years ) , baseline fma ( ranging from
9 to 25 points ) , and walking speed ( ranging from 0.16 to 0.65 m / sec ) of the participants in
this study varied widely .
six of the 7 participants used a cane or ankle - foot orthosis as a
walking aid , and 2 of the 7 participants ( pe , pg ) required supervision or minimal assistance
in walking . compared with the study subjects of kramers de quervain et al.18 and turns et al.23 , who also conducted gait analyses of patients with
hemiparesis , the present participants had a longer time after stroke , worse disorder of
paretic limb motor function , and slower walking speed .
two participants ( pc , pd ) were unable
to complete the 20-minute exercise task even with resting time , but other participants were
able to complete the exercise task . furthermore , the frequency of intervention was not
uniform ( from 2 to 4 times a week ) .
thus , probably due to the wide individual differences in
physical endurance , walking ability , motor function of the lower extremity , and the movement
pattern of the paretic lower extremity among the participants in the present study , the
intervention showed no common effectiveness in the present participants .
two participants ( pa , pe ) who had positive impressions of the exercise showed an increase
in walking speed and cadence after four months of performing the exercise . additionally ,
through the 2-week intervention , the walking speed and cadence of pg increased .
the level of
spasticity of the lower extremity of the participants was assessed using the modified
ashworth scale ( mas ) .
the participants spasticity ranged from 0 to 2 , except for
participant pd ( ranged from 1 to 3 ) , showing similarity in spasticity levels between
participants with and without improved results . in the kinematic analysis ,
three
participants ( pa , pe , and pg ) had increases in the duration ratio of the swing phase in the
non - paretic gait cycle and shortening of the time from non - paretic heel contact to the
paretic heel off during stepping - in - place .
the swing phase time was also extended for pa and
pg , and the step length was increased for pa .
the fma scores ( ranging from 15 to 25 points )
in the baseline period for the three participants who showed improvement ( pa , pe , and pg )
were higher than those of pc , pd , and pf ( ranging from 9 to 11 points ) . in the
flexor / extensor synergy of the hip and knee joints item of the fma , participants who showed
no improvement scored 1 point , whereas participants with improvement scored 2 points .
kramers de quervain et al.18 and turns et
al.23 reported that patients who walked
slower were unable to perform gait movements without a synergy pattern . additionally ,
kramers de quervain et al.18 reported
that the duration of the pre - swing phase was prolonged for patients who had the slowest gait
velocities and that the goal of therapy should therefore be focused on muscle strength and
coordination improvement of the hemiplegic side , especially during the pre - swing phase .
garcia et al.24 reported that the
frequency of stepping in the stepping - in - place motion was slower than in walking but that
the stepping - in - place motion incorporates reciprocal , rhythmic lower extremity movement
patterns similar to gait .
in other words , the participants who were able to perform lower
limb synergy patterns at a certain intensity transferred the weight from the supporting limb
to the swing phase limb in the stepping - in - place exercise faster , which could have
contributed to the smooth pre - swing phase and improved walking speed .
thus , the
stepping - in - place training using the foot lifting device seems to be appropriate for
hemiplegia patients who are able to show extension synergy of the lower extremity and enough
upper limb support to maintain the standing position .
pd and
pf showed larger knee flexion and ankle dorsiflexion with weight - bearing during the stance
phase , and pd had excessive pelvic hiking and toe drag during the swing phase .
in addition ,
two participants ( pc , pd ) were unable to complete the movement task for 20 minutes due to a
lack of physical endurance .
the participants with weaker support force of the lower
extremity and with flexion / extension movement difficulties showed knee buckling , a trunk and
pelvic compensation strategy during stepping - in - place exercise .
the lower limb spasticity
level of the participants ranged from 0 to 2 , except for pd ( 1 to 3 ) .
therefore , the motion
task ability seems to be more related to motor function than to the existence of spasticity .
the participants with weaker support force of the lower extremity needed assistance to
induce the stepping - in - place exercise manually by the therapist during the motion task using
the foot lifting device .
pb had higher motor function of the lower extremity than the other
participants and showed a normal knee pattern in the stance phase ; however , pb also showed
excessive ankle plantar flexion and hip flexion during the swing phase .
due to this
participant s high ability to swing the paretic limb , the effect of the intervention might
not have been evident .
these results suggest that patients with relatively high walking ability and motor function
had positive effects from the intervention .
some studies have reported that locomotor
parameters were improved after 6 months of combined functional training and 8 weeks of
one - leg exercise25 , 26 .
therefore , the movement task in the present study may be effective
for paretic lower limb movement in the paretic heel off from non - paretic heel contact , but
some form of long - term intervention is necessary to improve step length .
this study focused on the movement of the lower limbs during the pre - swing phase of the
gait cycle , and a movement task was designed .
movements of the hip joint , knee , and ankle
induced by paretic foot heel elevation with spring assistance were expected to be induced .
in this way , by obtaining a motion sensation close to normal gait , the sensory feedback was
expected to effectively improve movement . for the muscle activity in the pre - swing phase ,
perry27 reported that the activity of
the ankle plantar flexion muscle decreases as the body weight is rapidly transferred from
one limb to the other and that the residual gastrocnemius flexor muscle action moves the
tibia forward , flexing the knee .
additionally , in the stepping - in - place exercise , vertical
control of the center of mass ( com ) is mainly required .
jansen et al.28 reported that the ankle plantar flexor muscles ( soleus ,
gastrocnemius ) had the same function in vertically controlling the com during the loading
response period of forward and backward walking .
therefore , we hypothesized that the flexion
of the knee by gastrocnemius activity would be improved through exercise in which the heel
is moved up and down .
insufficient flexion of the paretic lower limbs during the pre - swing
phase was observed before the intervention in the three participants ( pa , pe , pg ) whose
walking speeds increased . thus , this repetitive movement task may contribute to improving
the control of the paretic lower limb in the pre - swing phase .
most participants in this study had chronic hemiparesis and were aged 75 years or older .
the participants who had relatively higher walking ability and better motor function showed
better results after the training period .
there were large differences among the individuals
in the time after stroke , the level of lower limb functional impairment , and walking
ability .
additionally , considering the results of two participants who continued exercising
for 16 weeks , the 2-week intervention is probably insufficient for obtaining the desired
effects in patients with chronic hemiparesis . to determine the efficacy of the movement
task , it is necessary to perform future studies with larger sample populations , longer
intervention periods , and prior classification of the gait pattern of the participants . in
this study ,
the effect of the intervention was investigated using kinematic analysis ;
however , use of the electromyographic method may be necessary to investigate more detailed
effects of this exercise task with the assistive device . | [ purpose ] the goal of this study was to investigate the efficacy of stepping - in - place
training using a foot lifting assist device on the walking gait of chronic hemiparetic
stroke patients .
[ subjects ] seven patients with chronic hemiplegic stroke ( age
80.94.9 years ) who were attending a local adult daycare facility participated in this
study . [ methods ] the participants had 2 or 16 weeks of intervention after a baseline
period of 2 weeks .
evaluations were performed before the baseline period and before and
after the intervention period .
the evaluation consisted of a two - dimensional motion
analysis of walking and stepping - in - place exercises and a clinical evaluation .
[ results ]
walking speed increased in three participants after 2 or 16 weeks of intervention .
the
swing phase percentage increased in the paretic gait cycle , and the time from non - paretic
heel contact to paretic heel off decreased during stepping - in - place in these participants .
[ conclusion ] given that the transition from the support phase support to the swing phase
was shortened after the intervention , the stepping - in - place exercise using the device
designed for this study may improve the muscle strength of the lower limb and coordination
in the pre - swing phase of the paretic limb . |
computational methodologies utilized for
in silico high throughput
screening ( hts ) are a critical component of drug discovery approaches . within the available in silico hts approaches , methodologies that
combine ligand- and structure - based screening procedures find the
widest application . the challenge in any hts
virtual
screening ( vs ) platform is to develop an algorithm that is sufficiently
fast and robust to evaluate many compounds while maintaining sufficient
accuracy to identify a subset of biological active compounds ( i.e. ,
hits ) that have diverse structural scaffolds ( i.e. , scaffold - hopping ) .
we sought to employ in silico screening to evaluate the repurposing
of current drugs for a new therapeutic target .
drug - repurposing
maximizes the potential value of each hit by screening well - known
compounds that have minimal toxicity and/or few side - effects .
comparative studies of well - established ligand- and docking - based
approaches concluded that shape - based ligand screening yielded markedly
better outcomes than protein docking schemes .
a ligand - based computational
method involved two essential elements : an efficient similarity
measure and a reliable scoring method .
the similarity measure
varied among different methods and focused on three factors : pharmacophores ,
molecular shapes , and molecular fields .
the molecular - shape approaches
maximized the overlap of shapes and determined a similarity value
based on the degree of shape overlap . over the years , despite the
investment made in developing scoring functions for molecular - shape
approaches , none possessed accuracy and general applicability .
consequently ,
investigators turned to the consensus - scoring technique that improved
the probability of finding solutions by combining the scores from
multiple scoring functions or using different reference molecules .
we recently developed an efficient 3d shape - based similarity
algorithm
encoding the consensus molecular shape pattern of a set of active
ligands into one descriptor , called the 4d fingerprint ( figure 1 ) .
the 4d fingerprint formalism was originally proposed
by hopfinger and co - workers and developed the quantitative structure
the 4d - qsar
model estimates molecular similarity measures as a function of conformation ,
alignment , and atom type .
the resulting
descriptors values were the occupancy measures for the atoms in the
investigated set of bioactive molecules .
while the similarity measures
achieved excellent predictions for a variety of enzyme inhibitors , the weakness of this approach lies with the occupancy measures for
the atoms ( or pharmacophoric groups ) which may also be present in
similar ,
the resulting 4d fingerprint encoded in the 3d shape of the candidate
ligand b is docked and ranked using the hwk scoring function .
the application of the 4d fingerprint
to the ligand b decreases the interaction
( purple arrow ) with the receptor . the 4d fingerprint approach implemented in the shape - approach - based
routines enhanced or sabre program possessed a number of
attractive advantages over other vs methods .
first , it depended explicitly on 3d shape , not on the underlying
chemical structure , and thus it excelled in identifying novel chemical
scaffolds based on a set of known active ligands ( scaffold - hopping ) .
the iterative 4d fingerprint approach was particularly robust for
several reasons : ( i ) the 4d fingerprint descriptors were very sensitive
to the details of molecular shape of active ligands , reducing the
need to use multiple conformers of multiple query structures ; ( ii )
the method excel by the incorporation of the spatial distributions
of chemical features of similar inactive ligands during the optimization
and screening procedures ; ( iii ) the algorithm was fast and had the
ability to scan a library of millions of compounds in a matter of
hours .
the method unified ligand- and structure - based 4d fingerprint
vs approaches by docking the shape filtered ligand structures into
the receptor - binding cavity . finally , running searches using this
methodology was remarkably easy and required only that the end - user
supply a query structure and runtime parameters to control the number
of hits that were returned . despite these advantages , the 4d fingerprint
method , as previously reported , suffered from a weakness in the empirical hwz scoring function for ranking
and selecting the active ligands from large databases . to remedy this
deficiency
, we modified the shape - based vs algorithm of the sabre
program and implemented a new , robust scoring function that accommodated
the diversity of ligand scaffolds with an accuracy that exceeded our
prior efforts .
tuberculosis ( tb ) is a chronic and complex disease
resulting from
infection with the bacterium mycobacterium tuberculosis .
tb remains an important public health problem worldwide , with 8.6
million estimated cases and 1.3 million deaths attributed to the disease
in 2012 . in order to combat the spread
of tb
it is necessary to identify new molecular targets for tb
drugs and develop new , more efficient , methods for screening ligands
as potential drug candidates than methods used in the past . historically ,
high - throughput screening ( hts ) approaches coupled with in vitro testing
served to identify promising hits with anti - tb activity . while successful
in some cases , the hts approach frequently failed in the antibacterial
drug discovery area due to the poor admet properties and insufficient
or improper molecular diversity of the compounds screened .
the mycobacterial esx secretion system , also referred to as the
type vii secretion system , represents a promising , new target for
tb drug development .
the esx secretion system is a
specialized system unique to mycobacteria that secrete a large number
of proteins necessary for m. tuberculosis virulence .
each esx secretion system includes a membrane - associated
subtilisin - like protease , called the mycosin : mycp1mycp5 ( numbered according to gene cluster ) .
mycp1 from
the esx-1 system hydrolyzes the esx associated protein b ( espb ) during
secretion , and this processing affects virulence in a mouse
model of tb infection . the recent description
of the molecular structure and substrate specificity of mycp1 prompted interest in mycp1 as a promising target for
structure - based drug design .
recently , we applied the combined
ligand- and structure - based virtual
screening procedure and 4d fingerprint algorithm to identify new inhibitors
for mycp1 protease .
the study
reported here extends our previous work and reports a rational approach
for ranking the ligand databases and demonstrates the performance
of the novel hwk scoring function using 81 targets
from the dekois database .
validation
of the efficiency of the vs method for scaffold - hopping and drug repurposing
involved the application of this methodology for the identification
of diverse inhibitor scaffolds against mycp1 protease and
experimental testing of some of these scaffolds in an in vitro enzyme
assay .
we have recently developed a ligand and structure
shape - based vs
algorithm implemented within the sabre program . unlike other ligand - based shape overlapping methods , our approach efficiently detected the key pharmacophore groups of
the active ligands responsible for binding to the target .
the main
advance of our methodology resided in the consideration of virtual
but similar inactive structures ( decoys ) during the consensus molecular - shape
detection process ( figure 1 ) . after similarity
scoring , the selected structures were ranked according to their shape
complementarity in the receptor - binding site .
this report highlights
the major steps of the algorithm and describes the approach used for
the development of this scoring function .
the molecular
shape density function (r ) of a ligand is expressed in terms of the shape density
functions of individual atoms and their overlap1 in which each atom i with
coordinates ri = ( xi , yi , zi ) is described by a spherical gaussian:2where
i is the van der waals radius of
the atom i. the
molecular volume v of the ligand is defined as3the volume vi of an atom i is4the intersection volume of atom pairs is defined
as5the overlap volume of two molecules a and
b is defined as6 in the sabre algorithm , the shape - density
model is enhanced and defined as a linear combination of weighted
atomic gaussian functions . thus , the molecular shape - density is the sum of all individual weighted
pharmacophore densities , and the molecular volume is defined as7where vkpharm k = idr
ki(r ) is
the partial volume of the pharmacophore group k and
is defined as a linear combination of atomic gaussian functions .
the
optimal coefficients { ck } are determined by iteratively adjusting the coefficients of the
set of known active ligands { a } in the
presence of virtual decoy structures { b } ( virtual decoys are inactive similar compounds that are not necessarily
synthetically feasible or identified in the previous vs rounds ) until
they satisfy these two criteria:7athis
algorithm quickly builds a consensus
molecular - shape pattern in which the optimal coefficients { ck } define a 4d fingerprint
of the entire set of active ligands that also effectively excludes
structurally similar , but inactive ligands ( decoys ) ( figure 1 ) .
given a set of known active ligands { ai } with volumes v{ai } and a query structure a with the volume va , we effect the shape - filtering and ranking
the candidate molecule b with volume vb . during
the vs process ,
we observe two trends : ( i ) vbi va or ( ii ) vbi va . as a result
, we can rank the structure b according to either the condition ( i ) , ( ii ) ,
or the combination of ( i ) and ( ii ) for two different ligands b and b. thus , we have two possible outcomes:(1)the volume of the
candidate structure
b is smaller than the volume of the query a : vbi va . the maximal overlap volume vabi for the two structures is restricted
as vabi vbi and rewritten as8(2)the volume of the structure b is larger than the volume of the query a : vbi va and vabi va is rewritten as 9(3)we illustrate this case by considering
two candidate structures with vbi va and vbj va . for clarity we consider that they have the same overlap volume
with the query structure and consequently , vabi vabj .
adding eqs 8 and 9 givesand we obtain
the tanimoto scoring function:10we rewrote eqs 8 and 9 as smooth gaussian distributions
and defined the
scoring function hwk ( hamza wei korotkov )
that converges to one for optimal similarity:1112the tanimoto function and eqs 11 and 12 clearly reveal that the ranking
of the candidate structure b is determined
by several inhomogeneous criteria . for a fixed overlap volume ,
eq 11 gives the highest score for the ligand b with a smallest size even if it possess less similar
chemical features than other ligands with larger volume sizes .
second ,
the vabi term takes into
account the overlap volume of the full ligand size instead the volume
of the key chemical features present in both the query a , and candidate ligand b. this result
in a higher ranking for the ligand b with
largest size since the overlap volume varies with the full size of
the ligand .
third , we recently demonstrated the weakness of the tanimoto
scoring function when used for filtering the 3d shape of the ligands
and found that the tanimoto function only efficiently ranks the ligands
with comparable volume size to the query .
the volume of the
candidate structure
b is smaller than the volume of the query a : vbi va .
the maximal overlap volume vabi for the two structures is restricted
as vabi vbi and rewritten as8 the volume of the structure b is larger than the volume of the query a : vbi va and vabi va is rewritten as 9 we illustrate this case by considering
two candidate structures with vbi va and vbj va .
for clarity we consider that they have the same overlap volume
with the query structure and consequently , vabi vabj .
adding eqs 8 and 9 gives these drawbacks can be overcome by taking into account the
specific
atom - type information , such as the consensus molecular shape pattern
or
according to the 4d fingerprint approach ( eq 7 ) , the volume of the query a and the set of active
ligands { ai } are defined as13the optimization of the
coefficients { ck } leads
to the residual volume v vapharm , and the value
of the vapharm term in eq 7 ranges
across the interval [ min v{a}pharm ;
maxv{a}pharm ] . in the following
demonstration
, we assumed that the candidate b is an active ligand and similar to the query a in the set of active ligands { ai } , since
if b is dissimilar the
overlap volume converges to a small value .
we haveusing the
computed 4d fingerprint coefficients ,
the volume of b is written as14the volume of b is defined by eq 7 and is equals to
the sum
of the weighted partial volumes of the key pharmacophore groups and
its volume size is in the interval of the set of active ligand volumes v{a}*. three possible scenarios exist:(1)vb * va*in this case , vb *
[ min(v{a } * ) ; va * ] and the optimal
similarity value is reached for(2)vb * va*in this
case , vb *
[ va * ; max(v{a } * ) ] and the optimal similarity is reached
for(3)according to the eqs 13 and 14 and the 4d fingerprint coefficients ,
the tanimoto scoring function is written as t = vab/(vb * + va * vab ) withthe optimal similarity is reached for t = vb*/va * t = va*/vb * 1 . in this case , vb *
[ min(v{a } * ) ; va * ] and the optimal
similarity value is reached for in this
case , vb *
[ va * ; max(v{a } * ) ] and the optimal similarity is reached
for according to the eqs 13 and 14 and the 4d fingerprint coefficients ,
the tanimoto scoring function is written as t = vab/(vb * + va * vab ) with as a result ,
the candidate ligands with a volume size slightly
smaller or larger than the query volume are ranked equivalently when
using the 4d fingerprint method with the tanimoto equation .
finally ,
we observe that the weighting coefficients of the 4d fingerprint adjust
and group the unknown active candidate
structures with miscellaneous volume sizes and scaffolds into three
classes relative to the query size .
this confers the advantage of
ranking more effectively these three types of shape using the hwk scoring function ( hwk , hwk , hwk ) .
the docking approach described
in our previous work combined the performance and speed of the ligand - based
4d fingerprint method with the shape characteristic of the receptor
binding site .
the current sabre docking
algorithm encodes both the 4d fingerprint and the novel hwk scoring function , and it generates alignments where patterns with
similar binding character are oriented in a similar fashion in the
binding site of the receptor ( figure 1 ) . during
the rigid docking process
, the sabre program takes into account only
the pharmacophore groups present in the vb(vb * ) that interact in designated ways with key receptor atoms .
five important chemical features were assigned to an atom type : hydrogen
bond donor , hydrogen bond acceptor , acidic center ( negatively charged
at physiological ph 7 ) , basic center ( positively charged at ph 7 ) ,
and metal - chelation .
the main novelty of the sabre docking approach
is that the pairwise interaction between the key pharmacophoric groups
( defined by the 4d fingerprint , figure 1 ) of
the ligand and the receptor atoms are calculated using the gaussian
function gij .
the pairwise
interaction of atoms i ( ligand atoms ) and j ( receptor atoms ) is defined as15where deqtype is the standard
distance
between the heavy atoms i and j for
each type of interaction ( i.e. , hydrogen bond interaction ,
electrostatic interactions ) and di , j is the distance between the two atom centers .
the parameter
is a freely adjustable parameter and controls
the distribution of the gaussian function .
the parameter controls the weight of the interaction type and depends
on the 4d fingerprint coefficients .
the pairwise interaction
is attractive for > 0 and repulsive for
< 0 .
the total of n pairwise
interactions
between the pharmacophoric groups of the ligand and the key receptor
atoms is defined by the geometric mean gi , jtotal(di , j ) as16thus , the combination of the total pairwise
interactions gi , jtotal(di , j ) and eqs 1012 takes into account both the 4d fingerprint and
the key interacting pharmacophoric groups of the ligand and leads
to improved enrichment of the vs process .
the hwkdock scoring function of the sabre docking method is summarized
by the three equations:171819it is interesting
to note that a ligand with
high similarity score ( eqs 1012 ) is reranked with a lower score if its chemical
features are close to repulsive receptor atoms .
therefore , our scoring
strategy developed in the docking method combines the fast and efficient
ligand - shape - based 4d fingerprint vs with an extremely quick calculation
of the interactions between the ligand pharmacophoric groups and the
key receptor atoms .
in addition , we observe in figure 1 that the interaction ( purple arrow ) involving the pharmacophore
groups present in both active and decoy structures become negligible .
analysis of the hwkdock function ( eqs 1719 ) highlights a new
strategy for improving scaffold - hopping and drug repurposing performances .
during the vs campaign ,
the shape size of the query is fundamental
and orients the choice of the scoring equations .
thus , if the shape
of the query is small and does not completely fill the receptor binding
cavity , the hwkdock+ is appropriate to identify structural hits
with either comparable or larger volume sizes than the query volume .
however , the hits with volume sizes ranging in the interval [ min(v{a } * ) ; va * ) ] of the set of active ligands
( eq 14 ) are also ranked with a high hwkdock+ score .
in contrast , if the shape of the query complement the receptor
binding cavity , the hwkdock is better suited to identify
hits with smaller volume sizes while keeping high overlap volume with
the pharmacophore groups of the query . finally , the hwkdocktanimoto is effective to identify hits with comparable query shape ( i.e. , rather smaller or larger structural sizes that fit
into the receptor binding cavity while retaining structural diversity ) .
consequently , three different classes of hits emerge based on the
equations of the hwk function that selected them .
in each list , the compounds are first ranked according to query similarity
using the 4d fingerprint approach , and the diversity is achieved by
selecting compounds ranked highly using one of these scoring equations .
the dekois ( version 2.0 ) database
of annotated active compounds and decoys was used to validate the hwk scoring function .
the dekois
database is a publicly available vs test database consisting of 81
targets . for our purposes ,
the ratio of the number of decoys to the
number of active ligands was fixed at 30 .
we used the dekois database
instead of the 40 targets of the dud database for our vs test in order
to measure the robustness of the scoring function when screening a
large number of targets .
this is one of the most commonly encountered
measures for estimating prediction accuracy of vs algorithms .
the effectiveness of the sabre program was evaluated using the enrichment
factor ( ef ) metric at a given percentage of the database screened , and the area under the roc ( receiver operator characteristics ) .
to test the efficiency of the hwk scoring function
defined by eqs 1012
, we screened each target 10 times using a different set of five
randomly selected active ligands ( as templates ) and reported both
the highest performance ( roc auc value ) and enrichment factor ef at 1% for the 81 targets .
screening results using the
empirical hwz scoring function were reported for
comparison . for each screening test ,
the five template structures where first removed from the list of
active ligands . the detailed vs procedure was described
in our previous work and summarized in
the supporting
information ( supplementary figure si-1 ) .
briefly , the 4d fingerprint
algorithm defined in the 3d - shape - based similarity method of sabre
was used as the first filter of the nci ( national cancer institute )
from the nci open database compounds ( release 4 , 265 000
structures ) and fda ( food and drug administration , 1217 compounds )
database downloaded from the zinc database .
it is important to note that the 4d fingerprint was generated using
both the previously identified leads ( active ligands ) and inactive
compounds ( considered as decoys ) .
the
multiple conformation states of each ligand in the database were generated
using omega ( openeye scientific software ) .
thereafter ,
we utilized the docking option of the sabre program
to place the filtered conformations of each ligand into the active
site of the mycp1 ( pdb i d : 4hvl ) and ranked them using the hwk scoring function .
according to eq 14 , the candidate b structure is similar to the set of known active
ligands { ai } if vb * [ min(v{a } * ) ; max(v{a } * ) ] and vb *
the volume vapharm is defined by the 4d fingerprint coefficients { ck } that encoded the chemical features
of the consensus molecular shape pattern of known active ligands ( eq 7 ) for the specific binding target .
therefore , this
suggests that the best fitted and most highly ranked ligands from
the vs of the database have similar 4d fingerprint coefficients and
thus should interact with the receptor of the known active ligands
( concept of the drug - target profile ) .
it is important to note that
this approach considers only the 4d fingerprint and the fast - fitting
method implemented in the sabre program .
to validate the effectiveness
of sabre for drug repurposing , we conducted a ligand- and structure - based
vs procedure using the fda database .
recombinant mycobacterium
thermoresistibile mycp1 was
expressed and purified as reported previously . a quenched
, fluorescent peptide assay was used to measure
the activity of mycp1 in the presence of inhibitors .
mycp1 was used to digest 20 m of the fluorescent substrate ,
abzavkaaslgk(dnp)oh ( genscript inc . ) .
potential mycp1 inhibitors
identified by sabre were diluted to a concentration of 150 m ,
and assays were measured in 96-well format .
compounds that were considered
hits showed less than 50% activity compared to controls ( dmso - buffer
blank ) . the same in vitro assay
was used to measure the inhibitory
concentration 50% ( ic50 ) of the most promising hits . for
ic50 measurements
, inhibitors were added at 0 , 5 , 10 , 50 ,
100 , 200 , 350 , and 500 m concentrations .
we evaluated
the accuracy of the hwk scoring function
and compared the current values to those obtained with the empirical hwz scoring function using
the multi conformational states of the decoys and active ligands of
the 81 targets from the dekois database .
the merits of scoring function
became clear as it accurately ranked compounds with subtle structural
changes . in the present vs trial , we selected query molecules according
to the procedures presented in kirchmair et al . and used to describe the performance of the algorithms .
as shown in figure 2 , we evaluated
the auc for each target of the dekois database and the average auc
using the sabre and sabre scoring functions .
the average auc value of the best performing query for the 81 dekois
targets using hwk and hwz scoring
functions was 0.875 0.054 and 0.851 0.054 , respectively .
the two scoring functions had similar overall performance for some
of the 81 targets based on the auc metric ; however , an analysis of
the complete set of targets revealed that sabre performed
more consistently in terms of auc with an average auc 0.9
for 26 targets and 0.9 > auc 0.8 for 51 targets than sabre . moreover
, sabre did not fail for any of
the 81 targets screened . in comparison ,
sabre ranked
the screening results with an auc > 0.9 for only 17 of the 81 dekois
targets ( 11 targets out of 81 have auc 0.8 ) .
one of the advantages of the sabre approach
is that the vs performance combining the 4d fingerprint and the novel hwk scoring function depended less on the screened targets ,
as already observed in our previous benchmark tests using the hwz function with the 40 dud targets .
comparison of the areas under the roc curves
( auc ) of the 81 dekois
databases using the sabre and sabre scoring
functions .
the
efficiency of the sabre scoring function was evaluated
using the enrichment factor at 1%
( ef ) , and the results were also compared to those using
the sabre function ( figure 3 and table si-1 ) .
the average ef values
for the 81 targets using the novel hwk and empirical hwz score - based virtual screening were 21.8 5.0 and
15.5 5.9 , respectively .
the sabre method performed
more consistently resulting in an ef less than 10% for
only two targets , whereas the results using the sabre method provided enrichment factors below 10% for 24 targets .
thus ,
the enrichments achieved with sabre are considerably
better than those obtained with the empirical hwz scoring function , indicating that the novel scoring function was
more efficient in identifying hits with notably different scaffolds
compared to the query structure .
therefore , on the basis of the auc
and enrichment factor ef values , these results indicated that the
novel hwk score demonstrated an improved and robust
vs performance , albeit with the caveat that we used only 81 targets
in this study .
comparison of the enrichment factor ef at 1% of the 81
dekois databases
using the sabre and sabre scoring functions .
the sabre program
was generally applicable for ranking any bioactive
scaffold classes with the exception of inactive decoys .
the recognition
of a wide variety of structurally different ligand classes was an
important goal of our virtual screening strategy .
the mycp1 protease represented a challenge for both ligand- and structure - based
virtual - screening approaches .
indeed , only the crystal structure of
the apo form of the enzyme was available , and the protein active site
is relatively large , which decreased the probability of successfully
identifying and ranking the correct pose of the screened ligands .
the structures of mycp1 inhibitors that we previously reported
were available , and visual analysis of their putative poses in the
active site revealed that the binding mode of compound 1 was reasonable .
these compounds have
chemical features that enabled sar ( structure activity relationship )
studies and generated a novel 4d fingerprint . for the purpose of sar ,
an intuitive strategy for scaffold - hopping used the hit compound 1 as query and the hwkdock+ scoring function to rank hits
with larger volume sizes from the nci database .
we constructed such
a ranking of the best 1000 structures ( top-1000 ) according to the
docking - score function .
the pharmacophore model reduced the number
of these structures to a small subset of promising mycp1 lead candidates .
the 135 hits derived from the nci database were
superimposed with the binding query ( compound 1 ) and
visually inspected .
forty molecules were selected from the hits and
tested in vitro for inhibitory activity against mycp1 .
notably , 9 compounds out of the 40 were able to inhibit mycp1 by more than 50% when added at 150 m ( table 1 and figure 4 ) and one compound showed
an ic50 less than 100 m .
compound 2 inhibited mycp1 activity in the low micromolar range
with an ic50 of 76.8 m and does not includes substructures
described as pan assay interference compounds ( pains ) .
structural scaffold of mycp1 inhibitors identified
during
the vs of the nci database .
pan assay interference compounds
( pains ) remover , see ref ( 64 ) .
the vs procedure
identified these compounds based on their common
chemical features ( 4d fingerprint ) present in the subset of known
active ligand structures and their fit in the binding pocket .
the
coefficients of the 4d fingerprint efficiently encoded the spatial
distributions of pharmacophoric points providing the alignment of
compounds relative to the binding site surfaces .
each point accounted
for an important chemical feature such as hydrogen bond donors / acceptors
and negative / positive charged groups .
the basic physicochemical features
of the known mycp1 compounds included the potential to
establish hydrogen bonds as donors with thr156 and ser202 , glu203
and thr333 residues .
furthermore ,
analysis of the docking results revealed that the lead compound 2 fit well within the binding site cavity .
the compound 2 formed hydrogen bonds with the thr156 , thr333 , ser202 , and
glu203 residues of mycp1 . the results were in agreement
with our previous docking studies pointing out ser202 and thr156 as
key residues to stabilize the ligand scaffold in the mycp1 catalytic binding site . a detailed
analysis of the docking mode of the 11 compounds ( figure 4 ) revealed a close match between the pattern of
hydrophobic and hydrogen bond donor pharmacophoric points of these
hits compared to the pharmacophore model defined in our previous study .
stick view of the binding compound 2 ( nsc-67021 )
and 11 ( hydroxystilbamidine ) in the mycp1 active
site . as shown in table 2 , the vs procedure ranked
9 lead compounds at different cut - offs among the initial 1000 docked
structures . among the top-30 , one lead compound was present , and this
outcome corresponded to 11% coverage .
furthermore , the 9 lead compounds
were among the top-300 of the filtered nci database .
these results
highlight the merits of our 4d fingerprint vs approach when combined
with the novel hwk scoring function .
we also compared
this simple approach to a complex approach including other likely
query conformations .
we modeled three plausible binding poses of the
compound 1 ( query ) with different conformations in mycp1 cavity and redocked the top-1000 ligands using these three
conformations , as shown in table 2 .
the fusion
approach markedly improved the percentage of retrieved lead compounds
in the top-75 and further underscored the potential of the 4d fingerprint
and hwkdock scoring vs procedure in the
identification of lead compounds using the structure of unliganded
receptor .
% coverage of leads = ( number of
leads in the top / total lead ) 100 .
the integration of this newly
generated computational method , which combined the 4d fingerprint
and the hwk scoring function with in vitro enzyme
inhibition studies , was a useful approach for evaluating current drugs ,
already on the market for a particular therapeutic purpose as potential
agents for treating tb . to demonstrate the applicability of this integrated
virtual and experimental screening for drug - repurposing , we undertook
the virtual screening of the fda - approved drug database consisting
of 1,217 compounds ( corresponding to 3358 structures including tautomers )
using the 4d fingerprints previously generated during nci database
screening .
hits were evaluated using the aforementioned mycp1 enzyme assay . in order to increase the structural diversity of the
compounds identified by this process
, we conducted the vs procedure
three times using compounds 1 , 8 , and 9 as query for each vs round .
the choice of the structural
query was critical to the success of this approach .
as described in methods , the scaffold diversity depended on the
selected hwk or hwk or hwk ( tanimoto ) scoring
equations , which also depended on the query size .
thus , compound 1 , discovered in our previous work , was used as query since
it has the highest affinity to mycp1 .
the compounds 8 ( larger volume than that of compound 1 ) and 9 ( smaller volume than that of compound 1 ) were
selected based on their differential volumes and structural diversity
compared to the structure of 1 .
the goal of our screen
was to find hits with diverse structural scaffolds and comparable
volume sizes to the queries .
thus , the resulting docked ligands of
the fda database were ranked using the hwkdocktanimoto scoring
function ( eq 19 ) . since the screening
process of the nci database and the benchmark test using the 4d fingerprint
of sabre program demonstrated high enrichment factor at 1% of the
screened database , we visually inspected the binding mode of the best
30 structures ( 1% ) identified within the fda database .
we
focused , in particular , on four compounds based on their high hwkdocktanimoto docking score and their interactions with the key residues ( thr156
and ser202 ) of the mycp1 binding cavity .
these four compounds were
chosen for in vitro inhibition assays , and three out of the four selected
compounds exhibited more than 50% inhibition of mycp1 when
used at 150 m ( table 1 ) , which validated
the merits of our vs approach . finally , the active compounds were
filtered for pan assay interference compounds ( pains ) ( table 1 ) and showed that the hydroxystilbamidine scaffold
may be used as starting structure for further optimization .
an analysis
of the three ranked fda approved drugs showed that the compounds 11 , 12 , and 13 were ranked by sabre
near the top at positions 2 , 24 , and 3 out of 1217 .
the high score
for compounds 11 and 13 was attributable
to the hwkdocktanimoto scoring function , which took into account
the ligand similarity as well as the optimal ligand / receptor pharmacophore
model ( eq 19 ) .
out of the three , compound 11 had the greatest effect , with an ic50 of 85.6
m , whereas the two other leads had ic50 > 100
m .
in addition , we noted the low structural similarity between the three
identified fda compounds ( figure 6 ) .
as observed
for the other leads , compound 11 formed hydrogen bonds
with the thr156 , glu203 , and thr333 residues of the mycp1 active site ( figure 5 ) .
interestingly , compound 11 is typically used as a histochemical stain to understand
the distribution and localization of biomarkers , and these results suggested that it or its analogs may
be repurposed for inhibition of mycp1 .
more importantly ,
these preliminary findings show that the sabre algorithm with hwk scoring provides an efficient means for the identification
of new uses for current drugs and encourages us to pursue the applicability
of methodology in drug repurposing strategy for other medically relevant
drug targets .
structural scaffolds of mycp1 inhibitors identified
during the vs of the fda database . the percentage of inhibition and
ic50 are displayed .
published data
suggested counting hits only when the chemotype of a molecule is not
equal to a template chemotype or any other chemotype that already
exists in the hit list .
this approach
resulted in a chemotype enrichment that emphasizes discovery of ligands
with different chemotype properties .
we assessed the novelty of the
confirmed 12 hits by comparing their structural similarities with
a
we computed the pairwise similarity index using the molecular access
system maccs structural keys ( maccs , 166 bits ) of our 13 compounds
( query + 12 leads ) and represented the structural diversity using the
heat map ( figure 7 ) .
the
map visualizes 15 15 = 225 pairwise comparisons and was color - coded
by similarity values ranging from red ( low similarity value ) to dark
blue ( high similarity value ) .
we observed only two lobes in dark blue
consistent with high similarity between the compounds ( maccs index
> 0.8 ) and most of the compounds were dissimilar .
this result supported
the increased structural diversity ( maccs index < 0.6 ) of the new
lead compounds using the combined 4d fingerprint and hwk scoring function .
considering the high degree of substructure encoded
in each vs round , it was not surprising that the 4d fingerprint algorithm
performed well at finding diverse chemotypes . heat map of the maccs
similarity index for the 13 compounds ( 12
leads + query ) .
we
report a rational method for the design of novel scoring function hwk and validated its performance using a large number of
targets from the dekois database .
the vs approach test using the 4d
fingerprint and the hwk scoring function provided
high enrichment factors in detecting active compounds at early stage
of the 81 screened databases .
we validated the efficiency of the combined
4d fingerprint and hwk scoring function in scaffold - hopping
strategy through the identification of nine novel lead compounds in
a short hit list from the vs of the nci database .
the result of the
vs round ranked these compounds in the top-300 of the database , and
one of them displayed an ic50 comparable to that of the
reference structure . in the absence of new drugs for infectious
diseases like tb , it
made sense to develop a vs strategy capable of exploring databases
of current drugs used to treat diseases other than infectious diseases
and potentially repurpose some of them for tb treatment .
the merit of this approach lies in the obvious point that these
commercially available drugs lack significant toxicity or side - effects . to test this notion ,
the screening of the fda database using our
screening approach identified three fda - approved compounds as potential
lead structures .
the distributions
of pairwise structural similarities presented in the heat map revealed
that the 13 lead compounds resulting from the vs of nci and fda databases
were structurally diverse . in summary , this study represents the comprehensive
quantification of vs approach for scaffold - hopping and drug repurposing
and provides a solid strategy for the discovery of new classes of
mycp1 inhibitors . | two
factors contribute to the inefficiency associated with screening
pharmaceutical library collections as a means of identifying new drugs :
[ 1 ] the limited success of virtual screening ( vs ) methods in identifying
new scaffolds ; [ 2 ] the limited accuracy of computational methods in
predicting off - target effects .
we recently introduced a 3d shape - based
similarity algorithm of the sabre program , which encodes a consensus
molecular shape pattern of a set of active ligands into a 4d fingerprint
descriptor . here , we report a mathematical model for shape similarity
comparisons and ligand database filtering using this 4d fingerprint
method and benchmarked the scoring function hwk ( hamza wei korotkov ) ,
using the 81 targets of the dekois database .
subsequently , we applied
our combined 4d fingerprint and hwk scoring function
vs approach in scaffold - hopping and drug repurposing using the national
cancer institute ( nci ) and food and drug administration ( fda ) databases ,
and we identified new inhibitors with different scaffolds of mycp1 protease from the mycobacterial esx-1 secretion system .
experimental
evaluation of nine compounds from the nci database and three from
the fda database displayed ic50 values ranging from 70
to 100 m against mycp1 and possessed high structural
diversity , which provides departure points for further structure
activity
relationship ( sar ) optimization .
in addition , this study demonstrates
that the combination of our 4d fingerprint algorithm and the hwk scoring function may provide a means for identifying
repurposed drugs for the treatment of infectious diseases and may
be used in the drug - target profile strategy . |
lupus erythematosus is a chronic , autoimmune disease resulting from an interaction of genetic , environmental , and hormonal factors and characterized by a spectrum of clinical forms with a variable evaluation from a localized cutaneous form to life - threatening systemic form .
specific skin lesions of cutaneous lupus erythematosus are classified as acute cutaneous lupus erythematosus , subacute cutaneous lupus erythematosus ( scle ) , and chronic cutaneous lupus erythematosus , according to the clinical characteristics of the lesions .
subacute cutaneous lupus erythematosus ( scle ) may present with annular or papulosquamous cutaneous lesions that are symmetrically located in the sun - exposed areas of the body .
scle shows typical serological findings , with anti - ro ( ss - a ) antibodies present in up to 100% of patients [ 3 , 4 ] .
however , antinuclear antibodies ( anas ) , complement c3/c4 deficiency , rheumatoid factor , circulating immune complexes , lymphopenia , and thrombocytopenia can frequently be detected .
severe neurological or nephrological involvement is rare in scle , whereas mild musculoskeletal involvement is commonly observed .
it is well known that some patients suffering from cle develop extracutaneous manifestations during the course of their disease ; up to 30% of patients with scle show systemic involvement .
most patients with scle can be sufficiently treated with photo protection , topical corticosteroids , antimalarials , or a combination of these .
the complement system is a group of plasma and membrane proteins that are sequentially activated via proteolytic cleavages to defend against microbial infections [ 7 , 8 ] .
complement contributes to inflammation and tissue damage in this disease , but seemingly in paradox , deficiency of some complement proteins dramatically increases the risk for sle .
deficiency states within the classical pathway are associated with increased risk to develop sle and sle - like disease .
genetically determined complement deficiencies are inborn errors and may have an impact on the development of the immune system . classical pathway deficiency has led to different hypothesis to explain roles for complement in sle pathogenesis .
complement deficiency leads to impaired handling of immune complex and inadequate clearance apoptotic cell debris [ 11 , 12 ] .
another hypothesis suggests that the complement system has an important role in the development of tolerance against self .
also , complement deficiency results in lack of normal b - cell tolerance and provides production of autoantibodies .
in addition , complement components are in some ways also important for regulation of cytokine production , especially type 1 interferons have been shown to have a central role in the pathogenesis of sle [ 14 , 15 ] .
while the genetic basis for a majority of sle cases is polygenic , a homozygous deficiency in one of the early complement components alone can be strong enough to cause the disease , a situation similar to a single gene defect in an autosomal recessive disease [ 16 , 17 ] . respectively , 93% and 78% of patients with complete c1q and
c4 deficiencies eventually develop sle or a lupus - like disease . genetically , the complement c4 gene located in the class iii region of the major histocompatibility complex ( mhc ) on chromosome 6p21.3 .
these proteins are segregated into two classes , the acidic c4a and the basic c4b .
c4a is believed to be important in the clearances of immune complexes , and c4b is more powerful in propagating the complement activation cascades .
the complete absence of both c4a and c4b proteins may therefore lead to decreased ability of immune defense against microbes as well as inefficient disposal of immune complexes . to date , 28 individuals with complete c4 deficiency from 19 families have been reported [ 21 , 22 ] . among them , 15 individuals developed sle , 7 developed lupus - like diseases , and four of the remaining subjects were only inflicted by kidney diseases . in this study , we present the clinical features and determine the molecular basis responsible for the complete c4a and c4b deficiencies in a lupus patient presented with subacute cutaneous lupus erythematosus and progression systemic form and resistance to treatment .
seventeen - year - old patient was a male born by parents of non consanguineous marriage .
he was diagnosed with scle at the age of 15 years old and had local therapy in dermatology clinic before admitting our clinic .
his temperature 38.3 , respiratory rate 38/min , pulse rate 100/min , and blood pressure was found as 90/70 mmhg . in auscultation , lungs were clear and the heart sounds were normal .
his clinical presentation included severe malar rash with marked photosensitivity and bullous lesions on the tips of fingers and hands ( figure 1 ) .
there was interface dermatitis with irregularity and loss of basal cells . in the papillary and upper reticular dermis was a perivascular and interstitial lymphocytic infiltrate .
there was granular deposition of ig a , igm , and c3 at the dermal - epidermal junction .
also he has arthritis which described swelling , tenderness , and pain on all small joints .
laboratory tests showed an erythrocyte sedimentation rate ( esr ) of 100 mm / h , c - reactive protein of < 0.3 mg / dl ( normal ) , hemoglobin of 11.1 g / dl , hematocrit of 31% , white blood cell count ( wbc ) of 4900/mm with normal differential count , platelet count of 197000/mm , serum urea of 25 mg / dl , serum creatinine of 0.8 mg / dl , albumine of 3.5 g / dl ,
total cholesterol of 106 mg / dl , triglycerides of 57 mg / dl , calcium of 8.7 mg / dl , sodium of 140 meq / l , potasium of 4.7 meq / l , chloride of 107 meq / l , alanine aminotransferase of 23
he had positivity for antinuclear antibody ( 1/1280 ) , positivity for anti - ro / ssa antibodies and negative ds dna .
prior laboratory measurements showed no detectable c4 proteins , serum c3 levels were lower ( 77 mg / dl ) and c1q inhibitor levels were normal .
immunofluorescence experiments showed mesangial deposits of igg , c3 ( + + + ) , iga ( + + + ) and c1q ( + ) . after he was diagnosed as sle
according to american college of rheumatology ( acr ) criteria , high - ose pulse therapy was performed with methylprednisolone ( 30 mg / kg / day for 3 days ) , followed by prednisone ( 2 mg / kg / day ) , hydroxychloroquine ( 5 mg / kg / day ) , and topical therapy .
he started cyclophosphamide pulse therapy ( 500 mg / m ) because his complains were not resolved .
after from second dose of cyclophosphamide ( 750 mg / m ) , he had urticarial lesions and stopped this therapy .
he started mycophenolate sodium ( 720 mg / day ) . in spite of these medications , his skin lesions ,
he received rituximab infusions at a dose of 1 gram at days 1 and 15 .
in addition , a 100-mg dose of intravenous methylprednisolone was given immediately prior to the rituximab infusion .
after rituximab therapy was administered , oral low dose prednisolone ( 0,5 mg / kg7day ) and mycophenolate sodium were continued .
his complaints and laboratory values and sledai scores were improved significantly after rituximab treatment , as shown in figure 1(b ) . repeated laboratory measurements showed no detectable c4 proteins , but serum c3 levels were normal .
after pcr amplification with intron - exon binding primers , mutation was detected by direct dna sequencing method .
we report a child with sle and c4 deficiency and with severe skin involvement that proved to be subacute cutaneous lupus erythematosus ( scle ) . in our patient ,
the diagnosis of sle was based on the presence of constitutional symptoms , malar rash , photosensitivity , oral ulceration , arthritis , anemia , a high titer of ana , and low c3 , c4 . the patient resistant to initial therapies including hqk , prednisolon and cyc .
rituximab is a chimeric monoclonal igg1antibody that binds specifically to the cd20 antigen and mediates b- cell lysis .
prior studies have shown that rituximab therapy can be a safe and efficacious addition to therapy with standard immunosuppressive agents in patients with refractory childhood sle [ 2429 ] . in our case ,
rituximab led to a remarkable improvement of skin lesions , resulting in a significant decrease of the sledai from 20 at the beginning to 5 at the end of therapy .
in addition , he exhibited a low c4 level during the extended period of observation .
finally , the genetic phenotyping of complement revealed that he was homozygous for c4b deficiency .
sle is a systemic autoimmune disease characterized by the breakdown of immunotolerance and the production of a wide range of autoantibodies that target multiple tissues and organs .
these are estimated to be found in less than 1% of sle patients [ 31 , 32 ] . respectively , 93% and 78% of patients with complete c1q and
c4 deficiencies eventually develop sle or a lupus - like disease [ 22 , 33 ] .
in addition , the concordance rates for siblings with homozygous deficiency of c1q or c4 to develop sle are 90% and 80% , respectively , which are even higher than the rate in monozygotic twins ( 2660% ) with other genetic defects .
indeed , approximately 15% of caucasian sle patients exhibit homozygous c4a deficiency , whilst more than 50% of caucasian patients with sle have heterozygous c4a deficiency .
c4b deficiency caused autoimmune - associated diseases , such as systemic lupus erythematosus , or diseases with an autoimmune component , such as autism [ 36 , 37 ] .
heterozygous and homozygous deficiencies of c4a were present in 4060% of sle patients from almost all ethnic groups such as northern and central europeans , anglo - saxons , caucasians in the us , african americans , asian chinese , koreans , and japanese .
the major causes for c4aq0 in caucasian and african sle patients are the presence of a mono - s rccx module with a single , short c4b gene and the 2-bp insertion into the sequence for codon 1213 at exon 29 of the mutant c4a gene .
we found heterozygous genetic deficiency of c4a gene , also heterozygous and homozygous deficiencies of c4b in our patient . in conclusion ,
we report a case of c4b deficiency accompanied with sle with therapy - resistant skin involvement .
further studies are needed to clarify the relationship of c4b deficiency and sle which presented severe skin involvement . | the complement system is of great importance in systemic lupus erythematosus . complete genetically determined deficiencies are with few exceptions reported for the various complement proteins , and most of the deficiency states are rare .
deficiencies of the factors in the classical pathway are also associated with development sle and sle - like disorders .
most of the patients with lupus present skin involvement .
approximately , 7595% of patients with cutaneous lupus erythematosus respond to antimalarial therapy and/or topical glucocorticosteroids .
immunosuppressive agents are usually considered a second - line approach in patients with resistant disease . in this study , we present the clinical features and determine the molecular basis responsible for the complete c4a and c4b deficiencies in a lupus patient presented subacute cutaneous lupus erythematosus and resistance to treatment . |
odor information is known to be of vital importance for most animals , and especially for insects . to achieve optimal fitness insects need to survive and reproduce in an optimal way .
odors are known to play vital roles as cues for both these functions . to survive ,
optimally an insect needs to eat ( in most cases ) and to avoid becoming victim to predators or parasites . to reproduce
optimally it needs to find a good mate and a suitable oviposition site . for one of the world
s foremost model organisms , the fruit fly drosophila melanogaster ( dm ) , odor information is known to be heavily involved in location and quality determination of mates , food and oviposition sites .
drosophila first appeared as a study organism for genetics when castle 1906 investigated effects of inbreeding . in the following two decades
it was further established as a real model organism by morgan ( 1910 ) who used crossing experiments in order to map genes onto different chromosomes . due to its small size , short generation time , and easy rearing ,
today , dm is the most well - developed model animal when it comes to genetic manipulations and presence of mutants for more or less any trait . here
, we describe our present state of knowledge regarding plant - odor - dependent neuroethology in dm .
we discuss which odors are important , how different odor molecules are detected and transduced , how peripheral information is processed and integrated in the antennal lobe , and , finally , which types of behavior that have been studied . in reviewing scientific progress in a single model organism ,
it is inevitable that decisive information from other systems is omitted . to get an impression of all the important studies performed in insect olfaction outside drosophila , we refer the reader to the following books and reviews : stengl et al .
( 1992 ) , hildebrand and shepherd ( 1997 ) , hansson ( 1999 ) , hallem et al .
( 2006 ) , de bruyne and baker ( 2008 ) , galizia ( 2008 ) , and spehr and munger ( 2009 ) .
the preferred food and oviposition substrate of dm is decaying fruit ( lachaise and tsacas 1983 ) and most key ligands identified can be connected either directly to the fruit , or to microorganisms living in and of the fruit ( stensmyr et al .
typical examples of directly fruit - related odors are a number of esters like ethyl hexanoate , geranyl acetate , and pentyl acetate . in addition , more green odors like e-2-hexenal and hexanol are detected . of the bacteria - associated odors 2,3-butanedione seems to play an important role .
a full account of the key stimuli identified so far is provided in table 1.table 1odorant receptors ( ors ) of the drosophila olfactory organs , their sensillumassociation , their central nervous target glomeruli , and their , so far , identified key ligandscolor labeling represents different sensillum types [ red basiconic ( antenna ) , yellow basiconic ( maxillary palp ) , green trichoid , blue coeloconic ] ors with the same number in brackets are expressed in the same sensillum odorant receptors ( ors ) of the drosophila olfactory organs , their sensillumassociation , their central nervous target glomeruli , and their , so far , identified key ligands color labeling represents different sensillum types [ red basiconic ( antenna ) , yellow basiconic ( maxillary palp ) , green trichoid , blue coeloconic ] ors with the same number in brackets are expressed in the same sensillum
in the fruit fly , volatile chemical information is detected by two pairs of olfactory organs ; the third antennal segment and the maxillary palps .
more specifically , odorants are detected by odorant receptors ( or ) , which are localized in the dendritic membrane of olfactory sensory neurons ( osn ) .
each antenna carries ca 1200 osns , which are housed in about 420 olfactory sensilla , whereas the maxillary palp has about 120 osns and 60 olfactory sensilla .
the olfactory sensilla come in three morphologically distinct types , namely sensilla basiconica , trichodea , and coeloconica that in turn can be divided into further subtypes ( shanbhag et al .
each osn typically expresses only a single or ( beyond the ubiquitous or83b , see below ) , which confers a unique odorant response profile on the osn . in dm ,
apart from the ors , a number of gustatory receptors ( gr ) is expressed in the antennae , e.g. gr21a and gr63a that detect carbon dioxide ( kwon et al .
the insect or genes are quite peculiar ; they show an inverted membrane insertion ( benton et al . 2006 ; lundin et al .
2007 ) , form heteromultimers ( neuhaus et al . 2005 , benton et al . 2006 ) and show no sequence homology to any other gpcrs .
another peculiarity is that , contrary to what has been found in vertebrates , most insect osns express two ors .
one is unique for each osn type , while one is expressed ubiquitously in all basiconic and trichoid - associated osns .
contrary to the osn - type - specific ors , or83b is highly conserved among most insects ( jones et al .
the initial coding of volatile chemical information is a consequence of the tuning spectra of the expressed ors .
how the peripheral olfactory system of the fly decodes odors has been rather well studied ( e.g. clyne et al .
2004 , 2006 ) . that the gene family encoding ors indeed act as chemosensors was first shown by strtkuhl et al .
( 2001 ) . taking a cue from work done in the mouse ( araneda et al .
subsequent electroantennogram recordings from the transgenic flies revealed an increased response to the ligand of the misexpressed or versus control flies .
further evidence showing that the or family encodes bona fide odor detectors was provided by dobritsa et al .
( 2003 ) , who elegantly exploited the genotype of the halo mutant , which lack ( among other things ) the or22a gene .
re - expression of or22a in the empty neuron created by the halo mutation fully rescued the response to ethyl butyrate , one of the ligands for or22a .
the empty neuron system of halo flies has since been used extensively to examine the molecular receptive range of a large variety of ors ( e.g. hallem et al .
the strength of this approach is that it allows for deorphanization in a more natural setting as compared to the alien environments provided by e.g. xenopus oocytes or human embryonic kidney cells , two frequently used systems for heterologous analysis of protein function .
the drawback to the halo approach is that it is both time and labor intensive compared to heterologous systems , which can be incorporated into high throughput screening pipelines , and that the environment surrounding the osns ( e.g. obps , see below ) remains the same , even if the ors are exchanged .
. however , those ors that respond to multiple compounds , typically respond to chemicals of structural proximity ( e.g. stensmyr et al .
available data accordingly suggest that insect ors are optimally configured for specific chemical properties , or even specific chemicals .
a problem though with any data regarding receptive range of ors is that the obtained tuning spectra are always dependent on the number of odor ligands screened , their relevance to the system as well as the concentrations tested .
most ors are capable of detecting almost any chemical as long as this compound is tested in high enough concentrations , a feat that extends even to notoriously selective pheromone receptors . likewise , perceived notions of , for example , extreme selectivity might simply be a consequence of missing key stimuli from the test panel .
thus , although a wide battery of odorants were used to deorphan the fly ors in the above - mentioned studies , the chosen stimuli only represent a minute fraction of all chemical volatiles that a fly might encounter in its daily life ( flies living in the wild that is ) .
for example , a banana alone contains well over 500 volatile compounds , most fruits contain similar numbers of volatiles ( stensmyr et al .
hence , it is quite possible that for many of the ors there exist better ligand matches that would differentiate the system further .
the use of gas chromatography linked with electrophysiology and/or optical imaging is a way of identifying potent new ligands for the system , which would increase our understanding of how odorants are decoded . in the case of dm
, odor sources should preferably be looked for among afrotropical fruit from the ancestral home range .
the or and gr families are not the only chemosensory - specific gene families expressed in the peripheral olfactory system .
the odorant binding protein family , first discovered in the moth ( vogt and riddiford 1981 ) comprises another large gene family [ 51 members in dm ( hekmat - scafe et al . 2002 ) ] encoding olfactory specific proteins .
the obps are produced and secreted by auxillary cells surrounding the osns . within the sensillium lymph , the obps bind the hydrophobic odor molecules and presumably guide them through the aqueous sensillum lymph to the ors in the dendritic membrane of the osns ( vogt and riddiford 1981 ; vogt 2003
; xu et al . 2005 ) . the obp family member lush nicely illustrates the importance of obps .
lush mutants fail to respond to the fly pheromone cis - vaccenyl acetate , both physiologically as well as behaviorally ( xu et al .
although the importance of obps for pheromone detection has been clearly demonstrated , their role in the detection of plant odors remains unclear .
ors misexpressed in the empty neurons of the halo mutant retain their odorant specificity in their new environment , in spite of a differing obp set - up .
recent work done on lush actually suggests that what the or is detecting is the conformationally altered lush molecule , rather than the pheromone itself ( laughlin et al . 2008 ) .
if this is a unique feature of the pheromone system or also holds true for the part of the system detecting , e.g. food - related volatiles remains to be elucidated .
detection of pheromones is furthermore dependent on the presence of another class of molecules , namely sensory neuron membrane proteins ( snmp ) ( rogers et al .
snmps constitute an insect - specific sub - group of the cd36 family , that comprises transmembrane receptors involved in lipid binding and transport . the snmps act as co - receptors with ors in the pheromone detection subsystem of dm ( benton et
2008 ) . whether snmps are also of importance outside pheromone detection remains to be investigated .
the osns found in coeloconica sensilla do not conform to the norm , as they do not express the ubiquitous or83b ( with the exception of coeloconica sensilla type 3 , that express or35a as well as or83b ) , suggesting that odorants in these sensilla are detected and/or transduced differently .
the identity of the coeloconica ors was recently revealed to be divergent members of the ionotropic glutamate receptor family ( benton et al .
the receptors , called ionotropic receptors ( irs ) form a large and divergent gene family comprising 63 members ( 61 putatively functional ) , of which 15 are expressed in the antennae .
contrary to the ors , the irs seem to be expressed in a combinatorial manner and also display a slightly different ligand specificity compared to the ors , responding to nitrogen - containing volatiles , such as ammonia and 1,4-diaminobutane .
in vertebrate olfactory orns the stimulated ors couple to golf proteins that stimulate like gs proteins adenylyl cyclase and raise the level of camp .
these messenger molecules diffuse to and bind on ion channels , the cyclic - nucleotide - gated ( cng ) channels , which they activate .
cng channels are non - selective cation channels that conduct na , k , and ca .
the rise in intracellular ca activates ca - dependent cl channels that cause a robust depolarization and is the step in the signal transduction cascade providing the strongest amplification of the odor signal ( kaupp et al .
the present knowledge regarding how odorant molecule binding to its or is converted into an electrical signal in insects arises from two sources .
first , from manipulating parts of putative signal transduction cascades and observing the effect on odor response , and second , from studies of or function in heterologous expression systems . dm mutants with disturbed camp signaling ( dunce and rutabaga ) show abnormal olfactory behavior ( martin et al . 2001 ) .
this was especially the case when the phosphodiesterase dunce was overexpressed in orn subsets , and thereby decreasing the camp level in these neurons ( gomez - diaz et al .
there is also evidence that dag / ip3 signaling may play a role in odorant signal transduction ( krieger and breer 1999 ) .
dm norpa mutants show impaired olfaction , which indicates that plc activity is required for appropriate processing of odor information ( riesgo - escovar et al .
furthermore , mutations in the dgq gene , which encodes the gq alpha subunit result in reduced responses to odor stimulation ( kain et al .
the responses were further attenuated by additional mutations in plc21c , a gene encoding for a plcb .
interestingly , the dgq mutant phenotype was rescued by mutation of the dag kinase rdga ( kain et al .
this finding indicates that the efficiency of olfactory signal transduction is controlled by a phospholipid messenger .
support for this hypothesis comes from a study on mutants in stmbha , a gene encoding a putative pip2-dag lipase .
these mutants show a markedly reduced electroantennogram response to odor stimulation ( kain et al .
taken together , any disturbance of the pip2 cleavage and regeneration cycle seems to impair an appropriate processing of the olfactory signal in insect orns .
thus , both a gs- and a gq - mediated pathway seem to be involved in dm olfactory transduction .
expression of ors in heterologous systems allows us either to perform functional tests by using endogeneous parts of the signal transduction machinery or to coexpress useful reporters . to identify ligands for vertebrate ors a variety of assays
has been developed , such as detection of camp production and ca imaging ( katada et al .
for example , by coexpression of drosophila or43a with the promiscous g protein gaa15 in xenopus ooytes receptor activation could be monitored by measuring cl currents activated by intracellular ca release ( wetzel et al .
elevation of free ca could also be obtained in hek293 cells when or22a was coexpressed with the ubiquitous receptor protein or83b ( neuhaus et al . 2005 ) .
further investigations of the or22a / or83b complex in hek293 cells ( wicher et al . 2008 ) or or47a / or83b in hela cells , hek293 t cells and xenopus oocytes ( sato et al . 2008 ) revealed that these heterodimers form non - selective cation channels permeable to na , k , and ca .
even in the absence of any stimulation , these channels show some constitutive activity leading to elevated levels of free ca .
short odor stimulation was seen to produce an immediate transient response that was independent of g proteins , i.e. the ors act as ionotropic receptors .
the fast ionotropic response is followed by a slower developing , but more sensitive , metabotropic response ( wicher et al .
it was shown that stimulation of or22a , either expressed alone or coexpressed with or83b , lead to camp production .
on the other hand , or83b , either expressed alone or coexpressed with or22a , responded to camp elevation with current production .
mutagenesis in the or83b protein caused a change in the permeability ratio of ions , which demonstrates that or83b is responsible for the channel activity of dm ors ( wicher et al .
2008 ) . taken together , the odorant - specific part of the or dimere seems to couple to stimulatory g proteins to stimulate camp production .
this g - protein - dependent pathway provides a highly sensitive odor detection , while at higher odor concentrations there is a very fast , ionotropic mechanism of or activation .
it remains to be seen what role gq signaling may play ( kain et al .
the insect odorant receptor complex is composed of an odorant - specific receptor protein orx and the non - selective cation channel or83 that conducts na , k and ca .
the direct activation of or83b by orx ( red flash ) leads to a fast and transient cation flow .
the adenylyl cyclase ( ac ) activity ( violet flash ) and thus the camp production . camp in turn activates or83b ( blue - green flash ) .
the ionotropic pathway ensures a very rapid recognition of high odor concentrations while the metabotropic pathway allows highly sensitive odor detection scheme of odorant signal transduction .
the insect odorant receptor complex is composed of an odorant - specific receptor protein orx and the non - selective cation channel or83 that conducts na , k and ca .
the direct activation of or83b by orx ( red flash ) leads to a fast and transient cation flow .
the adenylyl cyclase ( ac ) activity ( violet flash ) and thus the camp production . camp in turn activates or83b ( blue - green flash ) .
the ionotropic pathway ensures a very rapid recognition of high odor concentrations while the metabotropic pathway allows highly sensitive odor detection
the neural components , mediating olfactory information in the brain of the fruit fly , have been intensively studied and are well described ( stocker 1994 ) .
the olfactory system of the dm adult is organized according to similar principles as the vertebrate olfactory system , but with vastly reduced numerical complexity ( hildebrand and shepherd 1997 ; hallem and carlson 2004 ) ( fig .
as mentioned in the two previous sections , odors are recognized by osns ( not shown in fig .
the osns send their axons to the first olfactory neuropil in the insect brain , the antennal lobe ( al ) , which processes the olfactory information .
the al is a structure common to all insects except some anosmic species that have lost it secondarily ( strausfeld and hildebrand 1999 ) .
the insect al represents an analogous structure to the olfactory bulb in vertebrates but has evolved independently ( strausfeld and hildebrand 1999 ) .
the drososphila al comprises 49 olfactory glomeruli , which can be identified individually due to their specific position and size ( laissue et al .
however , in dm , osns form an axonal commissure between the two als and individual axons innervate homologous glomeruli in the two lobes ( stocker 1994 ) .
interestingly , a few glomeruli ( as v , vl1 , vp1 , vp2 and vp3 ) are innervated only unilaterally ( stocker et al .
as mentioned above , each osn expresses only a single or gene ( besides or83b ) .
all the osns expressing the same or converge onto a common glomerulus , which thus collects osn input from only one functional type
. the glomerulus acts as a collecting basket of osns with identical odor response profiles .
1995 ) , but was finally proven by molecular techniques in dm ( gao et al .
2000 ) . this condition is also assumed to hold true for other insect species , but has not yet been experimentally proven .
however , a few aberrant cases of 1 osn type to 2 glomeruli and of 2 to 1 innervation ratios in dm have been described as well ( couto et al .
2schematic of the drosophila olfactory pathway . a antennal olfactory sensory neurons ( osn , blue ) converge in specific glomeruli of the antennal lobe .
some of them send an axonal branch through the antennal commissure to the other hemisphere .
local interneurons ( ln , green ) branch in all glomeruli and interconnect these with each other .
projections neurons ( pn , red ) collect the olfactory information within the antennal lobe and send their axons to higher processing centers as the calyx and the lateral protocerebrum .
the three principal populations of neurons and their synaptic connections within the glomeruli ( gray circles ) are represented .
, the existence of both inhibitory local interneurons ( iln ) as well as excitatory local interneurons ( eln ) has been shown schematic of the drosophila olfactory pathway . a antennal olfactory sensory neurons ( osn , blue ) converge in specific glomeruli of the antennal lobe .
some of them send an axonal branch through the antennal commissure to the other hemisphere .
local interneurons ( ln , green ) branch in all glomeruli and interconnect these with each other .
projections neurons ( pn , red ) collect the olfactory information within the antennal lobe and send their axons to higher processing centers as the calyx and the lateral protocerebrum .
the three principal populations of neurons and their synaptic connections within the glomeruli ( gray circles ) are represented .
, the existence of both inhibitory local interneurons ( iln ) as well as excitatory local interneurons ( eln ) has been shown a glomerulus receives not only the input from osns , but contains a highly ordered synaptic organization including two types of interneurons ( fig .
2b ) : the local interneurons ( lns ; approximately 100 , probably analogous to periglomerular cells in mammals ) and projection neurons ( pns ; approximately 150 , analogous to mitral / tufted cells in mammals ) .
lns of the al represent an enigmatic element of early olfactory coding in the cns of insects .
they have all their projections restricted to the al , where most form wide - field arborizations within most glomeruli .
the majority of lns appears to be inhibitory ( ilns ) and release -aminobutyric acid ( gaba ) as a neurotransmitter ( wilson and laurent 2005 ) , indicating that they form a lateral multi - level inhibitory network modulating the olfactory signal within the al .
however , a recently described population of excitatory cholinergic lns ( elns ) forms a dense network of lateral excitatory connections between different glomeruli assumed to boost the al output ( olsen et al . 2007 ; shang et al .
pns have dendritic arborizations within the glomeruli and convey the olfactory signals through axonal projections to higher olfactory processing centers such as the lateral protocerebrum and the mushroom bodies .
a great majority of the pns is uniglomerular with dendrites confined to a single glomerulus , but a few have multiglomerular dendritic fields .
several imaging studies in different insect species using either calcium - sensitive dyes ( e.g. joerges et al .
1997 ; galizia et al . 1999 ; sachse et al . 1999 ; carlsson et al .
2002 ) , genetically encoded reporters to measure intracellular calcium ( fiala et al . 2002 ; wang et al .
2003 ; silbering et al . 2008 ) or synaptic vesicle release ( ng et al . 2002 ; yu et al . 2004 ) have shown that odors are encoded as specific spatio - temporal across - glomeruli patterns .
each odor evokes activity in several glomeruli , whereas each glomerulus participates in the patterns of several odors ( fig .
the olfactory system has in this way developed a strategy to encode a huge number of odors with a limited number of coding units .
although the different studies agree on how odors are encoded , different publications report contradicting results regarding the transformation of odor representations at the different processing levels within the al ( i.e. osn versus pn responses , fig . 3 ) .
these results reach from sharpening and contrast - enhancement of the olfactory input due to inhibitory processing in honeybees ( sachse and galizia 2002 ) to either not processing at all ( ng et al .
2002 ; wang et al . 2003 ) or a broadening of the output pattern in comparison to the input pattern in dm ( wilson et al . 2004 ) .
adding to the already existing complexity of the al network , a recently published study in dm shows that presynaptic inhibition onto osn terminals leads to an inhibitory network activity ( olsen and wilson 2008 ) .
odor information processing mechanisms underlying olfactory coding are thus highly diverse and appear to be specific for particular glomerulus - odor combinations ( silbering et al . 2008).fig .
the calcium - sensitive protein g - camp has been genetically expressed in either projection neurons ( above ) or sensory neurons ( below ) .
calcium signals to two different odors have been superimposed onto the morphological image of the antennal lobe .
comparison of the activity patterns between the sensory and the projection neurons to the same odor reveals similar but not identical responses odors evoke specific patterns of glomerular activity in the drosophila antennal lobe .
the calcium - sensitive protein g - camp has been genetically expressed in either projection neurons ( above ) or sensory neurons ( below ) .
calcium signals to two different odors have been superimposed onto the morphological image of the antennal lobe .
comparison of the activity patterns between the sensory and the projection neurons to the same odor reveals similar but not identical responses the al output responses are further processed on their way to higher processing centers .
there is a massive divergence between pns and the intrinsic neurons of the mushroom body , the kenyon cells .
while most pns have a relatively broad response profile with various levels of activity , a large number of units encode that same information with very few spikes , in an almost binary fashion , with only few units active at any time among kenyon cells ( perez - orive et al .
this coding strategy is in strong contrast to the one found in the al , where each pn covers a wide dynamic range .
deciphering the coding of odors on all processing levels is crucial for understanding the remarkable capacity of the olfactory system in recognizing and discriminating the vast array of odor molecules .
when investigating the sense of smell the first question that comes up is , do flies have to smell ? in an elegant set of experiments , asahina et al .
( 2008 ) demonstrated that the sense of smell is important at least for the survival of fruit fly larvae : when being reared under food ad libitum , anosmic or83b mutants developed as successfully as mutants whose or83b system had been rescued .
however , when food was limited , i.e. when larvae had to search for new food sources , the anosmic flies were less successful compared to the rescued flies . in a direct competition experiment anosmic mutants were selectively eliminated in competition with fly larvae whose or83b had been rescued .
interestingly , partial rescue of the olfactory system ( only one of 61 receptors was functioning ) led to survival rates that were intermediate between the anosmic and the fully rescued mutants .
although a simple sense of smell ( partially rescued mutants ) already increased the fly larvae s survival rates , a more powerful smell ( fully rescued mutants ) was even more efficient .
the efficiency of the adults sense of smell can be demonstrated easily by putting about 50 flies in an enclosed arena that is equipped with two traps .
when one trap is empty and the other is filled , e.g. with rotten banana , one of drosophila s favorite food sources , the first flies will enter the smelling trap already after a few minutes and after 24 h between 90 and 100% of the total number is usually captured .
( 2004 ) and was recently used , e.g. to demonstrate that different dm strains like wildtype berlin , wildtype canton s , etc .
differ substantially in their odor preferences and in their response latencies ( ruebenbauer et al .
however , as a dm fly can live for more than 2 weeks , it has ample time to experience diverse and varying qualities of different food sources . although the flies are equipped with some innate odor preferences , i.e. every inexperienced drosophila will head for a plume of rotten banana or balsamico vinegar , they can learn associations of odors with good or bad experiences .
a substantial amount of work has been done on olfactory learning , mainly using pavlovian conditioning procedures , where one odor ( conditioned stimulus ) is temporally paired with a positive ( i.e. sugar water ) or negative ( i.e. electric shock ) reinforcement , the so - called unconditioned stimulus ( tully and quinn 1985 ) .
this procedure provided knowledge regarding the formation and capacity of short - term and long - term memory in fruit flies .
( 2007 ) could map which cells in the brain are necessary for olfactory memory retrieval ( kenyon cells in the mushroom body whose axons form the /-lobes ) , and which are needed for acquisition and consolidation of memory ( /-kenyon cells ) .
however , apart from helping to understand learning in flies , conditioning experiments provide a solution to another problem : only few odors provoke strong innate behavioral responses in dm , e.g. the main component of banana odor isoamylacetate is highly attractive , while benzaldehyde the typical smell of bitter almond is a repellent . in order to check the flies olfactory threshold for innately neutral odors these have to be provided with a meaning by positive or negative reinforcement . after conditioning
, it is possible to test , for example , the minimum concentration the flies react to .
however , to tell the truth , for an ethologist interested in the sense of smell drosophila would not have been the first choice .
while trap assays and mass learning experiments often yield valuable results , the investigation of individual flies is often frustrating . in order to study the sense of smell
, one would like to make predictions on how a specific fly responds before and after some kind of manipulation .
however , to make any predictions about the fly s response to an odor you need to know the fly s motivational state .
contrary to , for example , workers of eusocial insects that have no sex but are dedicated just to foraging , fruit flies are sometimes in the mood for sex , sleeping , ovipositioning or foraging .
each motivational stage can provoke different responses to different stimuli , which makes the prediction how a fly will respond rather difficult . despite these problems , experiments using individual flies are necessary in order to investigate , for example , the speed of odor processing or the response to minute differences in an odor s concentration . to illustrate the difficulties in establishing good bioassays for single dm
one of us invested considerable time in establishing an experiment where individual flies were exposed to a continuous airflow within 1 cm - wide glass tubes .
the flies were tracked automatically and an elaborate stimulus controller allowed exposure of the flies to odor pulses well - defined in timing , blend composition , and concentration .
we expected the flies to show upwind runs whenever facing a positive odor , e.g. banana or aceto balsamico . by coupling the stimulus controller to the tracking device
, we were able to compare the upwind speed directly before odor contact with the one afterwards .
however , despite a comprehensive analysis until now we never found any consistent responses of the flies to different kinds of stimuli ( fig . 4 ) .
the picture changes when flies are not tested while sitting or running but during flying .
budick and dickinson ( 2006 ) successfully investigated individual drosophila flies in a free - flight wind tunnel . under these conditions , the contact to an odor plume provoked directed upwind flights , while the loss lead to a so - called casting behavior , where the trajectory of the flies becomes more and more perpendicular to the wind direction ( a strategy that is well known from moths and that under natural conditions increases the chance to re - enter the odor plume , fig .
like in our walking assay , the use of a tracking device allowed the authors to measure the response latencies after the flies entered ( < 250 ms ) and lost the plume ( ca .
this experiment thus provides the tool to investigate fine scale temporal dynamics of the flies sense of smell .
these experiments use innate responses of tethered , flying individuals to odor stimuli provided in a constant airflow ( duistermars and frye 2008 ) .
the development of admittedly rather complicated experimental procedures gives a vantage point to unravel more details about the fine structure of the dm s sense of smell.fig .
c a computer - controlled stimulus device generates odor stimuli , that meet the flies at a predictable time .
a 3-d tracking system detects the time of plume contact and plume loss and calculates the flight s directionality and upwind speed before and afterwards steck - knaden assay .
c a computer - controlled stimulus device generates odor stimuli , that meet the flies at a predictable time .
a 3-d tracking system detects the time of plume contact and plume loss and calculates the flight s directionality and upwind speed before and afterwards
considering the progress reported above , we are presently in an extremely interesting time regarding dm olfactory neuroethology .
so much background data have been produced on neural and molecular function at different levels that we are approaching stages where behavioral questions can be attacked with a full arsenal of neurogenetic tools . by using the knowledge regarding receptors , transduction mechanisms , and primary and higher integration we can dissect the system , but
only when we have relevant and preferably nature - based bioassays and stimuli will we start to really understand the olfactory neuroethology of drosophila melanogaster . | drosophila melanogaster is today one of the three foremost models in olfactory research , paralleled only by the mouse and the nematode . in the last years
, immense progress has been achieved by combining neurogenetic tools with neurophysiology , anatomy , chemistry , and behavioral assays .
one of the most important tasks for a fruit fly is to find a substrate for eating and laying eggs . to perform this task
the fly is dependent on olfactory cues emitted by suitable substrates as e.g. decaying fruit .
in addition , in this area , considerable progress has been made during the last years , and more and more natural and behaviorally active ligands have been identified .
the future challenge is to tie the progress in different fields together to give us a better understanding of how a fly really behaves . not in a test tube , but in nature . here
, we review our present state of knowledge regarding drosophila plant - odor - related olfactory neuroethology to provide a basis for new progress . |
staphylococcus aureus is one of the most common nosocomial pathogens which can cause a broad spectrum of infections , ranging from mild skin infections to severe abscesses , sepsis , endocarditis , osteomyelitis , urinary tract infections ( uti ) , and fatal necrotizing pneumonia ( 1 ) .
staphylococcus aureus strains have the ability to become resistant to different classes of antimicrobial agents such as methicillin ( 2 ) .
resistance to methicillin in s. aureus was first reported in 1961 , just one year after its introduction , and methicillin - resistant staphylococcus aureus ( mrsa ) has spread extensively worldwide during the last few decades ( 3 ) . resistance to methicillin is due to the presence of the staphylococcal cassette chromosome mec ( sccmec ) element , which is composed of regulatory genes such as the meca , c , i and r gene complex , and the ccr ( cassette chromosome recombinase ) gene complex , encoding the recombinase gene ( 4 ) . based on the presence of different regulatory and structural genes ,
the most important feature of mrsa isolates is their resistance to a broad spectrum of antimicrobial agents , which makes infections by these bacteria difficult to treat ( 5 , 6 ) .
aminoglycosides are one of the classes of antibiotics that play an important role in the treatment of staphylococcal infections ( 7 ) .
the main mechanism of resistance to aminoglycosides is the inactivation of antibiotics by aminoglycoside - modifying enzymes ( ames ) that are encoded by genetic elements ( 7 , 8) .
the aac ( 6)-ie + aph ( 2 ) , ant ( 4)-ia , aph ( 3)-iiia , and ant ( 6)-ia genes that encode aminoglycoside-6'-n - acetyltransferase/2"-o - phosphoryltransferase , aminoglycoside-4'-o - nucleotidyltransferase i , aminoglycoside-3'-o- phosphoryltransferase iii , and streptomycin modifying enzyme , respectively , are hence the most important genes in this regard . resistance to gentamicin , kanamycin , and tobramycin in staphylococci
is mediated by a bi - functional enzyme displaying aac ( 6 ' ) and aph ( 2 " ) activity . the ant ( 4')-ia enzyme inactivates neomycin , kanamycin , tobramycin , amikacin , and kanamycin , while the aph ( 3')-iii , enzyme inactivates neomycin ( 8 , 9 ) .
different genotyping and phenotyping methods are available for the typing of bacteria , and they are useful in studies of the stability and diversity of bacterial populations in investigations .
the genotyping methods are highly discriminative , useful , and flexible , although they are very expensive and laborious , especially when comparing data obtained from many isolates ( 10 ) .
phenotyping involves methods used in studying the biochemical characterization of bacteria . the phene - plate ( php )
system is an automated phenotyping method based on the quantitative measurement of the kinetics of biochemical reactions formed by bacterial metabolism in the presence of different substrates .
compared to genotyping methods such as pfge and mlst , php typing is a very simple , rapid , and cheap method that provides the necessary information required for the subtyping of bacteria . however , for some cases in which php typing could not be performed , genotyping is required in order to obtain the necessary information ( 10 , 11 ) .
this study aimed to describe the frequency and the antibiotic susceptibility patterns of clonal groups of gentamicin - resistant strains of mrsa isolated from a tertiary care hospital in tehran , iran .
during january to november 2012 , a total of 301 s. aureus strains were collected from a tertiary care hospital in tehran , iran .
this hospital is ranked as one of the top hospitals in the country and it is located in the center of tehran .
all specimens were collected from hospitalized patients who showed infections 72 hours after admission to the hospital . of the 301 strains ,
139 , 99 , 23 , 21 , ten , and nine were isolated from wounds , urine , blood , sputum , cerebrospinal fluid ( csf ) , and eyes , respectively .
all of the isolates were cultured on hicrome aureus agar ( himedia , india ) and then identified at the species level using species - specific nuca gene primers as described previously ( 12 ) .
the dna of all the s. aureus strains was extracted using the boiling method as described previously ( 13 ) . moreover , a high pure pcr template preparation kit ( roche , germany ) was employed for dna extraction from the mrsa strains .
all of the 301 s. aureus strains were tested for susceptibility to oxacillin ( 1 g ) and cefoxitin ( 30 g ) ( mast diagnostics , merseyside , united kingdom ) on muller - hinton agar ( merck , germany ) according to the guidelines of the clinical and laboratory standards institute ( clsi ) ( 14 ) .
the antibiotics used were : kanamycin ( 30 g ) , amikacin ( 30 g ) , penicillin ( 5 g ) , minocycline ( 30 g ) , erythromycin ( 15 g ) , clindamycin ( 2 g ) , tobramycin ( 10 g ) , rifampin ( 5 g ) , sulfamethoxazole - trimethoprim ( 1.25 - 23.75 g ) , linezolid ( 10 g ) , quinupristin - dalfopristin ( 15 g ) , ciprofloxacin ( 30 g ) , neomycin ( 30 g ) , gentamicin ( 10 g ) , and tetracycline ( 30 g ) .
the minimum inhibitory concentrationsof oxacillin , gentamicin , and vancomycin were evaluated using a broth microdilution assay according to the guidelines of the clsi ( 15 ) .
the presence of aac ( 6)-ie / aph ( 2 ) , ant ( 4)-ia , aph ( 3)-iiia , and ant ( 6)-ia genes among the mrsa strains was examined using specific primers in a pcr assay as described previously ( 7 , 16 ) . all of the mrsa strains were typed using high resolution php - cs plates ( phplate ab , stockholm , sweden ) . the biochemical fingerprinting method was performed as reported by rahimi et al .
during january to november 2012 , a total of 301 s. aureus strains were collected from a tertiary care hospital in tehran , iran .
this hospital is ranked as one of the top hospitals in the country and it is located in the center of tehran .
all specimens were collected from hospitalized patients who showed infections 72 hours after admission to the hospital . of the 301 strains ,
139 , 99 , 23 , 21 , ten , and nine were isolated from wounds , urine , blood , sputum , cerebrospinal fluid ( csf ) , and eyes , respectively .
all of the isolates were cultured on hicrome aureus agar ( himedia , india ) and then identified at the species level using species - specific nuca gene primers as described previously ( 12 ) .
the dna of all the s. aureus strains was extracted using the boiling method as described previously ( 13 ) . moreover , a high pure pcr template preparation kit ( roche , germany ) was employed for dna extraction from the mrsa strains .
all of the 301 s. aureus strains were tested for susceptibility to oxacillin ( 1 g ) and cefoxitin ( 30 g ) ( mast diagnostics , merseyside , united kingdom ) on muller - hinton agar ( merck , germany ) according to the guidelines of the clinical and laboratory standards institute ( clsi ) ( 14 ) .
the antibiotics used were : kanamycin ( 30 g ) , amikacin ( 30 g ) , penicillin ( 5 g ) , minocycline ( 30 g ) , erythromycin ( 15 g ) , clindamycin ( 2 g ) , tobramycin ( 10 g ) , rifampin ( 5 g ) , sulfamethoxazole - trimethoprim ( 1.25 - 23.75 g ) , linezolid ( 10 g ) , quinupristin - dalfopristin ( 15 g ) , ciprofloxacin ( 30 g ) , neomycin ( 30 g ) , gentamicin ( 10 g ) , and tetracycline ( 30 g ) .
the minimum inhibitory concentrationsof oxacillin , gentamicin , and vancomycin were evaluated using a broth microdilution assay according to the guidelines of the clsi ( 15 ) .
the presence of aac ( 6)-ie / aph ( 2 ) , ant ( 4)-ia , aph ( 3)-iiia , and ant ( 6)-ia genes among the mrsa strains was examined using specific primers in a pcr assay as described previously ( 7 , 16 ) .
all of the mrsa strains were typed using high resolution php - cs plates ( phplate ab , stockholm , sweden ) .
of the 301 s. aureus strains isolated from the clinical samples , 90 strains ( 29.9% ) were confirmed as mrsa using phenotypic and genotypic methods .
these isolates originated from wounds ( 46% ) , urine ( 30% ) , sputum ( 13% ) , and blood ( 11% ) , respectively .
the isolates were recovered from hospitalized patients and so were classified as hospital - acquired mrsa ( ha - mrsa ) strains .
the mrsa strains were resistant to penicillin ( 100% ) , ciprofloxacin ( 100% ) , tobramycin ( 99% ) , kanamycin ( 99% ) , erythromycin ( 97% ) , tetracycline ( 90% ) , clindamycin ( 89% ) , and amikacin ( 82% ) ( figure 1 ) .
all of the strains were susceptible to vancomycin , linezolid , and quinupristin - dalfopristin .
an , amikacin ; cip , ciprofloxacin ; cd , clindamycin ; e , erythromycin ; gm , gentamicin ; k , kanamycin ; lzd , linezolid ; mn , minocycline ; n , neomycin ; p , penicillin ; tn , tobramycin ; t , tetracycline ; rp , rifampin ; ts , sulfamethoxazole - trimethoprim ; va , vancomycin ; syn , quinupristin - dalfopristin .
overall , 22 antibiotic resistance patterns were identified among the mrsa strains , of which 1.1% were resistant to at least three different antibiotics ( table 1 ) . of these
moreover , six strains ( 6.7% ) were resistant to all of the antibiotics tested except for vancomycin , linezolid , and quinupristin - dalfopristin .
abbreviations : an , amikacin ; cd , clindamycin ; cip , ciprofloxacin ; e , erythromycin ; gm , gentamicin ; k , kanamycin ; mn , minocycline ; n , neomycin ; p , penicillin ; rp , rifampin ; t , tetracycline ; tn , tobramycin ; ts , sulfamethoxazole - trimethoprim .
the mic range varied from 16 to 512 g / ml , with 33% and 26% of strains having an mic of 128 g / ml and 256 g / ml for oxacillin , respectively .
moreover , one strain had an mic of 16 g / ml . also , for vancomycin , the mics ranged from 0.06 to 0.5 g / ml . further , most of the strains ( 22.2% ) had an mic of 128 g / ml for gentamicin , whilst 11 strains showed an mic 16 g / ml . seven ( 7.8% ) , ten ( 11.1% ) , and 12 ( 13.3% ) strains had an mic of 1024 , 512 , and 256 g / ml , respectively .
all of the aminoglycoside - resistant strains were tested for the presence of different genes , with aac ( 6)-ie + aph ( 2 ) being found among 59 ( 65.6% ) strains ( table 2 ) and hence being the most prevalent resistance .
abbreviations : an , amikacin ; gm , gentamicin ; k , kanamycin ; n , neomycin ; tn , tobramycin .
forty - three ( 47.8% ) isolates harbored the ant ( 6)-ia resistance gene , while ant ( 4)-ia was detected in 38 ( 42.2% ) strains .
moreover , the aph ( 3)-iiia gene was present in 18 ( 20% ) strains .
also , 14 isolates ( 15.6% ) carried four detected resistance genes together , and none of the genes were positive in 25 ( 27.8% ) strains . on the other hand , aac ( 6)-ie + aph ( 2 ) , aph ( 3)-iiia and ant ( 6)-ia were detected alone in 19 ( 21.1% ) , two ( 2.2% ) and one ( 1.1% ) isolates , respectively .
the php typing of the 90 mrsa strains revealed the presence of diverse ( diversity index , di = 0.818 ) php types among the isolates , consisting of seven common types ( ct ) and four single types ( st ) ( data not shown ) . amongst the php types , ct 3 was the dominant type , with 31% of the isolates classified in this pattern .
cts 4 and 2 were also found among 24% and 11% of the isolates , respectively .
on the other hand , the four sts were common among strains isolated from wounds and urine .
the least number of strains belonged to cts 5 - 7 , which contained six isolates ( 7% ) .
of the 301 s. aureus strains isolated from the clinical samples , 90 strains ( 29.9% ) were confirmed as mrsa using phenotypic and genotypic methods .
these isolates originated from wounds ( 46% ) , urine ( 30% ) , sputum ( 13% ) , and blood ( 11% ) , respectively .
the isolates were recovered from hospitalized patients and so were classified as hospital - acquired mrsa ( ha - mrsa ) strains .
the mrsa strains were resistant to penicillin ( 100% ) , ciprofloxacin ( 100% ) , tobramycin ( 99% ) , kanamycin ( 99% ) , erythromycin ( 97% ) , tetracycline ( 90% ) , clindamycin ( 89% ) , and amikacin ( 82% ) ( figure 1 ) .
all of the strains were susceptible to vancomycin , linezolid , and quinupristin - dalfopristin .
an , amikacin ; cip , ciprofloxacin ; cd , clindamycin ; e , erythromycin ; gm , gentamicin ; k , kanamycin ; lzd , linezolid ; mn , minocycline ; n , neomycin ; p , penicillin ; tn , tobramycin ; t , tetracycline ; rp , rifampin ; ts , sulfamethoxazole - trimethoprim ; va , vancomycin ; syn , quinupristin - dalfopristin .
overall , 22 antibiotic resistance patterns were identified among the mrsa strains , of which 1.1% were resistant to at least three different antibiotics ( table 1 ) . of these
moreover , six strains ( 6.7% ) were resistant to all of the antibiotics tested except for vancomycin , linezolid , and quinupristin - dalfopristin .
abbreviations : an , amikacin ; cd , clindamycin ; cip , ciprofloxacin ; e , erythromycin ; gm , gentamicin ; k , kanamycin ; mn , minocycline ; n , neomycin ; p , penicillin ; rp , rifampin ; t , tetracycline ; tn , tobramycin ; ts , sulfamethoxazole - trimethoprim .
the mic range varied from 16 to 512 g / ml , with 33% and 26% of strains having an mic of 128 g / ml and 256 g / ml for oxacillin , respectively .
moreover , one strain had an mic of 16 g / ml . also , for vancomycin , the mics ranged from 0.06 to 0.5 g / ml . further , most of the strains ( 22.2% ) had an mic of 128 g / ml for gentamicin , whilst 11 strains showed an mic 16 g / ml . seven ( 7.8% ) , ten ( 11.1% ) , and 12 ( 13.3% ) strains had an mic of 1024 , 512 , and 256 g / ml , respectively .
all of the aminoglycoside - resistant strains were tested for the presence of different genes , with aac ( 6)-ie + aph ( 2 ) being found among 59 ( 65.6% ) strains ( table 2 ) and hence being the most prevalent resistance .
abbreviations : an , amikacin ; gm , gentamicin ; k , kanamycin ; n , neomycin ; tn , tobramycin .
forty - three ( 47.8% ) isolates harbored the ant ( 6)-ia resistance gene , while ant ( 4)-ia was detected in 38 ( 42.2% ) strains .
moreover , the aph ( 3)-iiia gene was present in 18 ( 20% ) strains .
also , 14 isolates ( 15.6% ) carried four detected resistance genes together , and none of the genes were positive in 25 ( 27.8% ) strains . on the other hand , aac ( 6)-ie + aph ( 2 ) , aph ( 3)-iiia and ant ( 6)-ia were detected alone in 19 ( 21.1% ) , two ( 2.2% ) and one ( 1.1% ) isolates , respectively .
the php typing of the 90 mrsa strains revealed the presence of diverse ( diversity index , di = 0.818 ) php types among the isolates , consisting of seven common types ( ct ) and four single types ( st ) ( data not shown ) . amongst the php types , ct 3 was the dominant type , with 31% of the isolates classified in this pattern .
cts 4 and 2 were also found among 24% and 11% of the isolates , respectively . moreover , cts 3 and 4 were common among all strains with different origins .
on the other hand , the four sts were common among strains isolated from wounds and urine .
the least number of strains belonged to cts 5 - 7 , which contained six isolates ( 7% ) .
previous studies have revealed that the rate of mrsa in iran varies from 19% to 90% in different cities ( 3 , 13 , 17 - 23 ) .
the variation seen in the different reports concerning iran could be in part due to different populations , different geographical locations , and the quality of hospital sampling carried out . of the 15 antibiotics tested in this study , all of the isolates showed susceptibility to vancomycin , linezolid , and quinupristin - dalfopristin , which is consistent with other studies in iran ( 3 , 13 , 17 - 23 ) .
although vancomycin is frequently used in a hospital setting , no vancomycin - intermediate s. aureus ( visa ) or vancomycin - resistant s. aureus ( vrsa ) isolates were found in this study , which suggests that the increased use of certain antibiotics is not sufficient to ensure the appearance of resistant strains . yet
, most of the isolates were resistant to penicillin ( 100% ) , ciprofloxacin ( 100% ) , kanamycin ( 99% ) , tobramycin ( 99% ) , erythromycin ( 97% ) , tetracycline ( 90% ) , and clindamycin ( 89% ) , which indicates that these antibiotics are no longer effective antibiotics against mrsa infections in tehran .
in previous studies ( 3 , 17 , 19 - 23 ) , a high rate of resistance to these antibiotics was reported .
these antibiotics are used extensively in hospitals for the treatment of different infections and so the high rate of resistance is not surprising .
the rates of resistance tosulfamethoxazole - trimethoprim , rifampin , minocycline , and gentamycin in this study were also higher than those reported in other reports .
this could be explained by the high level of these antibiotics being prescribed for the treatment of infections .
moreover , gentamicin is one of the most important antibiotics used in combination with other antibiotics worldwide for treatment of s. aureus infections ( 20 , 24 - 26 ) . in this study ,
similar to the findings of other reports ( 20 , 24 - 27 ) , the aac ( 6)-ie + aph ( 2 ) gene was dominant among the gentamicin - resistant strains of mrsa , and the isolates that were positive for this gene showed a high level resistance to gentamicin , which is consistent with other reports ( 16 , 28 - 30 ) .
we also found 16 gentamicin - susceptible strains that harbored the aac ( 6)-ie + aph ( 2 ) gene .
although these isolates harbored the aac ( 6)-ie + aph ( 2 ) gene considered to be resistant to gentamicin and all aminoglycosides , we also found strains that were susceptible to gentamicin and showed resistance to other aminoglycosides , which is consistent with other reports ( 7 ) .
detection of resistance genes in antibiotic susceptible strains is due to amplification of repressed antibiotic resistance gene or ame of these strains display lower enzymatic activity ( 7 ) .
moreover , the prevalence rate of the ant ( 4)-ia gene was higher than in other reports ( 7 , 16 , 20 , 26 ) , which could be due to the high resistance to kanamycin , with 89 out of 90 strains being kanamycin - resistant . also , we found a strain that was susceptible to all of the aminoglycoside antibiotics tested and was also not positive for all of the genes .
differences between reports from different countries could be due to differences among the isolates and different geographical regions .
our results illustrated that all of the aminoglycosides tested in this study are no longer effective agents against mrsa strains .
the results of the php typing showed the presence of diverse php types consisting of seven cts and four sts , indicating that the presence of mrsa strains in this hospital in tehran is attributable to the spread of a limited number of clonal types .
cts 3 and 4 were common between mrsa strains with different origins , which further supports the spread of these clonal types among strains collected from this hospital in tehran . in another study in tehran ,
more diverse php types ( consisting of 18 cts and 15 sts ) were reported among the mrsa strains isolated from a tertiary care hospital ( 3 ) .
on the other hand , 16 cts and 13 sts were identified in mrsa strains isolated from sewage treatment plants in tehran ( 31 ) .
javidnia et al . reported six cts and 13 sts among mrsa strains in tehran ( 19 ) .
seven cts identified in this study were also common among the mrsa isolates reported in other studies , in which ct 3 was the predominant type and its dissemination is consistent with previous studies in tehran ( 3 , 9 , 31 , 32 ) . in this study ,
different php types were common among different samples , which indicates the prevalence of mrsa strains in different wards of the hospital and also highlights the presence of common cts in this hospital .
the mrsa strains isolated from wounds and urine were grouped in different cts and showed the highest frequency .
a certain php mrsa clonal type , i.e. ct 3 ( comprising 31% of the isolates ) , was identified in various samples tested , indicating an epidemiological link between the mrsa strains isolated from different sources .
the results indicate that mrsa strains are endemic in this hospital in tehran ; therefore , contamination of patients during the hospitalization process may be responsible for these infections .
as previously reported , the aminoglycoside - resistant ha - mrsa strains have spread widely through the community and identical ha - mrsa strains from different sources in iran have been isolated , indicating the hospital origin of these strains . in conclusion
, our results showed that the php typing method provided useful information for clonal dissemination and also for the epidemiological links of clonal groups of aminoglycoside - resistant strains of mrsa in hospitals in tehran .
moreover , the presence of predominant clonal types among all strains isolated from different sources with different antimicrobial resistance patterns suggested that cross - infection was a factor in the maintenance of these strains in hospitals in tehran . | background : methicillin - resistant staphylococcus aureus ( mrsa ) is one of the most common nosocomial pathogens which can cause a broad spectrum of infections.objectives:the current study aimed to describe the frequency and antibiotic susceptibility patterns of clonal groups of gentamicin - resistant strains of mrsa isolated from a tertiary care hospital in tehran , iran.materials and methods : a total of 301 s. aureus isolates were collected during january to november 2012 . all of the isolates were identified at the species level and typed using the phene - plate ( php ) system .
the antibiotic susceptibility patterns of the mrsa strains and the presence of different aminoglycoside resistance genes were determined.results:of the 301 s. aureus isolates , 90 ( 29.9% ) strains were confirmed as mrsa , and they showed high resistance to penicillin , ciprofloxacin , kanamycin , tobramycin , erythromycin , and tetracycline . on the other hand , 43 of the 90 strains ( 47.8% ) were resistant to gentamicin .
aac ( 6)-ie + aph ( 2 ) , ant ( 4)-ia , aph ( 3)-iiia , and ant ( 6)-ia were detected in 65.6% , 42.2% , 20% , and 47.8% of the gentamicin - resistant strains , respectively .
diverse php types consisting of seven common types and four single types were identified among the strains.conclusions:our results illustrated the presence of clonal groups of highly gentamicin - resistant strains of mrsa in hospitals in tehran .
the php typing method provided useful information for both clonal dissemination and determining the epidemiological links of the clonal groups of the mrsa strains . |
stroke is a major cause of acquired disability and the secondleading cause of death in the world.1 , 2 the primary causes of stroke are unclear3 ; however , family studies indicate that genetic factors may be involved.4 , 5 a previous study demonstrated that 70% to 85% of strokes are ischemic , with the percentage varying by ethnicity.6 based on a nationwide surveillance program in taiwan , including clinical data from 30 599 stroke admissions,7 ischemic stroke is most frequent ( 74% ) , followed by intracerebral hemorrhage ( 16.1% ) , transient ischemic attack ( 6.7% ) , subarachnoid hemorrhage ( 2.8% ) , and cerebral venous thrombosis ( 0.2% ) .
ischemic stroke includes 3 major subtypes according to the trial of org 10172 in acute stroke treatment ( toast ) criteria : largeartery atherosclerosis ( laa ) ; cardioembolism ; and smallvessel occlusion .
the laa subtype , for example , has been shown to be more strongly correlated with family history than other subtypes.8 recent genomewide association studies ( gwass ) of laa stroke subtypes conducted in australian populations have reported 1 susceptibility loci in 6p21.1.9 in addition , the international stroke genetics consortium and the wellcome trust case control consortium 2 have also identified a replicated genetic association with ischemic stroke by conducting a gwas examining the major specific stroke subtypes.10 notably , based on 844 laa stroke cases in a discovery population from 4 centers in europe , a genetic variant at chromosome 7p21.1 ( ie , hdac9 , which encodes the histone deacetylase [ hdac ] 9 protein ) is specifically associated with the laa stroke subtype.10 this association has been replicated in an independent caucasian group.11 however , although existing genetic data in caucasian have demonstrated that unique genetic variants may predispose patients to a specific subtype of ischemic stroke,9 , 10 it remains unclear whether other genetic variants are associated with laa stroke .
furthermore , it is also important to identify genetic factors by conducting a gwas in other ethnics . therefore , in this study , we aimed to clarify the contributions of complex genetic effects to the pathogenesis of laa stroke by identification of novel susceptibility loci and to validate the associations between previously reported loci in different ethnic groups .
this study was approved by the institutional review board and the ethics committee of the institutional review board of chang gung memorial hospital and academia sinica , taiwan . written informed consent was obtained from the patients or their family members , in accord with institutional requirements and the principles of the declaration of helsinki .
individuals with laa stroke ( n=763 ; including the 444 patients with laa stroke in the gwas and the 319 patients with laa stroke in the replication study ) were consecutively recruited at different geographic medical centers , including chang gung memorial hospital taipei branch , chang gung memorial hospital linkou medical center , chang gung memorial hospital chiayi branch , and chang gung memorial hospital kaohsiung medical center ( from the northern to southern regions of taiwan ) .
patient enrollment and data management were performed in collaboration with the translational resource center for genomic medicine of taiwan .
all of the cases were diagnosed according to toast criteria.12 in addition , the cases received carotid ultrasound and transcranial colorcoded doppler to screen for large vessel disease . in those cases with suspected large vessel disease , digital subtraction , magnetic resonance , or computed tomographic angiography was performed for further confirmation .
the clinical and imaging data were centralized and the classification of intracranial and extracranial laa was identified and confirmed by dr tsonghai lee . in the present study , we have included both intracranial atherosclerosis and extracranial atherosclerosis . because identification of effects specific to morerefined phenotypes is critical for genetic studies of stroke,9 , 10 we focused our gwas on patients with carotid artery stenosis attributed to atherosclerotic mechanisms.13 the controls used for our discovery and replication studies were independent groups for comparison in the gwas study .
the 1727 controls in the gwas were randomly selected from the taiwan han chinese cell and genome bank in taiwan , as reported previously.14 the singlenucleotide polymorphism ( snp ) genotyping results of another independent group of 1802 controls in the replication study were randomly selected from the publically available summary frequency of the taiwan biobank website ( https://taiwanview.twbiobank.org.tw/taiwanview/twbchipinfo.do ) .
genomic dna was extracted from blood using a puregene dna isolation kit ( gentra systems , inc . ,
each individual was genotyped using the axiom genomewide chb ( with 642 832 snps ) , which is the most comprehensive commercially available genomewide coverage of the han chinese population , according to the manufacturer 's protocols , at the national center for genome medicine , academia sinica .
all of the sample call rates were greater than 99% , and the mean individual sample call rate was 99.70.18% .
firstdegree relatives ( parentoffspring and full sibling pairs ) of patients with laa stroke disease and controls were identified by kinship analysis and were excluded from further analysis .
genotyping quality control for each snp was further evaluated by determining the total call rate ( successful call rate ) and minor allele frequency ( maf ) in cases and controls .
snps were excluded from further analysis if only 1 allele was successfully genotyped in cases and controls to avoid experimental errors .
the total call rate was less than 0.95 , or the total maf was less than 0.05 and the total call rate was less than 0.99 .
in addition , snps that departed significantly from hardy weinberg equilibrium were excluded ( p<110 ) .
genomewide association analysis was carried out to compare allele and genotype frequencies between cases and controls , using the cochran armitage trend test implemented in plink 1.07 .
heterogeneity tests ( i
and p values of the q statistics ) between gwass and replication groups were performed using the described methods.15
the top 58 snps ( p<510 ) from the genomewide association analysis of the 444 patients with laa stroke and 1727 controls were further validated in 444 patients with laa stroke , using either matrixassisted laser desorption ionization timeofflight mass spectrometry ( massarray ; sequenom , inc . , san diego , ca ) or direct sequencing .
fortyone snp genotypes with a successful rate of over 99% and over 99% concordance between 2 platforms were then genotyped in an additional 319 patients with laa stroke for replication .
this study was approved by the institutional review board and the ethics committee of the institutional review board of chang gung memorial hospital and academia sinica , taiwan . written informed consent was obtained from the patients or their family members , in accord with institutional requirements and the principles of the declaration of helsinki .
individuals with laa stroke ( n=763 ; including the 444 patients with laa stroke in the gwas and the 319 patients with laa stroke in the replication study ) were consecutively recruited at different geographic medical centers , including chang gung memorial hospital taipei branch , chang gung memorial hospital linkou medical center , chang gung memorial hospital chiayi branch , and chang gung memorial hospital kaohsiung medical center ( from the northern to southern regions of taiwan ) .
patient enrollment and data management were performed in collaboration with the translational resource center for genomic medicine of taiwan .
all of the cases were diagnosed according to toast criteria.12 in addition , the cases received carotid ultrasound and transcranial colorcoded doppler to screen for large vessel disease . in those cases with suspected large vessel disease , digital subtraction , magnetic resonance , or computed tomographic angiography was performed for further confirmation .
the clinical and imaging data were centralized and the classification of intracranial and extracranial laa was identified and confirmed by dr tsonghai lee . in the present study , we have included both intracranial atherosclerosis and extracranial atherosclerosis . because identification of effects specific to morerefined phenotypes is critical for genetic studies of stroke,9 , 10 we focused our gwas on patients with carotid artery stenosis attributed to atherosclerotic mechanisms.13 the controls used for our discovery and replication studies were independent groups for comparison in the gwas study .
the 1727 controls in the gwas were randomly selected from the taiwan han chinese cell and genome bank in taiwan , as reported previously.14 the singlenucleotide polymorphism ( snp ) genotyping results of another independent group of 1802 controls in the replication study were randomly selected from the publically available summary frequency of the taiwan biobank website ( https://taiwanview.twbiobank.org.tw/taiwanview/twbchipinfo.do ) .
genomic dna was extracted from blood using a puregene dna isolation kit ( gentra systems , inc . , minneapolis , mn ) .
each individual was genotyped using the axiom genomewide chb ( with 642 832 snps ) , which is the most comprehensive commercially available genomewide coverage of the han chinese population , according to the manufacturer 's protocols , at the national center for genome medicine , academia sinica .
all of the sample call rates were greater than 99% , and the mean individual sample call rate was 99.70.18% .
firstdegree relatives ( parentoffspring and full sibling pairs ) of patients with laa stroke disease and controls were identified by kinship analysis and were excluded from further analysis .
genotyping quality control for each snp was further evaluated by determining the total call rate ( successful call rate ) and minor allele frequency ( maf ) in cases and controls .
snps were excluded from further analysis if only 1 allele was successfully genotyped in cases and controls to avoid experimental errors .
the total call rate was less than 0.95 , or the total maf was less than 0.05 and the total call rate was less than 0.99 .
in addition , snps that departed significantly from hardy weinberg equilibrium were excluded ( p<110 ) .
genomewide association analysis was carried out to compare allele and genotype frequencies between cases and controls , using the cochran armitage trend test implemented in plink 1.07 .
heterogeneity tests ( i
and p values of the q statistics ) between gwass and replication groups were performed using the described methods.15
the top 58 snps ( p<510 ) from the genomewide association analysis of the 444 patients with laa stroke and 1727 controls were further validated in 444 patients with laa stroke , using either matrixassisted laser desorption ionization timeofflight mass spectrometry ( massarray ; sequenom , inc . , san diego , ca ) or direct sequencing .
fortyone snp genotypes with a successful rate of over 99% and over 99% concordance between 2 platforms were then genotyped in an additional 319 patients with laa stroke for replication .
we performed a casecontrol gwas to identify loci associated with increased risk of laa stroke in the han chinese population by using an affymetrix axiom chb array containing 642 832 snp probes ( affymetrix , inc .
we initially enrolled 444 patients with laa stroke and 1727 controls in a han chinese population residing in taiwan .
after kinship analysis and strict quality control filtering , we analyzed 570 275 snps ( representing 89% of array snps ) in the discovery stage .
multidimensional scaling analysis ( figure 1a and 1b ) and results of permutation tests for identitybystate revealed no evidence for strong population stratification between laa and control groups .
quantilequantile ( qq ) plots were used to examine pvalue distributions ( figure 1c ) , and the lambda value is 1.07 . in total , we found 58 snps associated with laa ( p<510 ) .
fortyone snps were validated using either sequenom massarray or direct sequencing ( figure 2 and table 1 ) and subsequently replicated in an independent cohort of 319 patients with laa and 1802 controls ( table 2 ) . in a combined analysis of the discovery and replication cohorts ,
the p values of 8 of the identified snps were lower than 10 ( table 3 ) , and 5 exceeded the threshold for genomewide significance in the joint analysis ( p<510 ; table 3 ) .
we observed no strong evidence of heterogeneity between samples from the discovery and the replication study for these 5 snps ( i
= 0 ) .
multidimensional scaling analysis . a , results of the multidimensional scaling analysis of the gwas samples with hapmap populations .
b , results of the multidimensional scaling analysis of the gwas samples with the gwas samples only .
results of genomewide association analysis ( log10
p ) shown in chromosomal order for 570 275 snps tested for association in initial samples from 444 patients with laa stroke and 1727 controls .
< 510
in the discovery stage chr indicates chromosome ; gene , genes containing the snp or the closest gene up to 50 kb upstream or downstream of the snp ; laa , large artery atherosclerosis ; or , odds ratio for risk allele ; raf in case , risk allele frequency in laa cases ; raf in control , risk allele frequency in controls ; risk allele , allele with higher frequency in cases compared to controls ; snp , singlenucleotide polymorphism .
validated snps ( n=41 ) in the replication stage chr indicates chromosome ; gene , genes containing the snp or the closest gene up to 50 kb upstream or downstream of the snp ; laa , large artery atherosclerosis ; or , odds ratio for risk allele ; raf in case , risk allele frequency in laa cases ; raf in control , risk allele frequency in controls ; risk allele , allele with higher frequency in cases compared to controls ; snp , singlenucleotide polymorphism .
snps with p values < 110
in the joint analysis stage 1 ( genome scan ) included 444 cases and 1727 controls .
snps with p<110 in the laa gwas collection and with p<0.05 in the laa replication collection and the results of the joint analysis .
gwas indicates genomewide association study ; laa , large artery atherosclerosis ; snps , singlenucleotide polymorphisms .
two of the snps that reached genomewide significance in the joint analysis were rs2415317 ( p=3.1010 ; odds ratio [ or]=1.37 [ 95% ci , 1.2261.536 ] ; table 3 ) and rs934075 ( p=4.0010 ; or=1.39 [ 95% ci , 1.2471.558 ] ; table 3 ) , which were located in the intron of the ptcsc3 gene ( encoding papillary thyroid carcinoma susceptibility candidate 3 ) .
three additional snps reached genomewide significance in the joint analysis : rs944289 ( p=3.5710 ; or=1.37 [ 95% ci , 1.2241.533 ] ; table 3 ) ; rs2787417 ( p=1.7610 ; or=1.38 [ 95% ci , 1.2321.538 ] ; table 3 ) ; and rs1952706 ( p=2.9210 ; or=1.37 [ 95% ci , 1.2261.534 ] ; table 3 ) .
these snps were located at upstream of the ptcsc3 gene ( figure 3a ) .
two snps ( rs2415317 and rs944289 ) were found to be in strong linkage disequilibrium ( ld ; d=0.971 and r
= 0.919 ; figures 3a and 4 ) and mapped to a 39.6kb ld block ( position 36 609 67836 649 246 ) at 14q13.3 ; this block comprises the promoter , exon , and intron of ptcsc3 .
regional association plot for ptcsc3 and mbip loci on chromosome 14 ( a ) or twist1 and hdac9 loci on chromosome 7 ( b ) , with gene annotations superimposed .
each snp is plotted with respect to its chromosomal location ( x axis ) and its log10
p values ( left y axis ) for the trend test from the primary gwas scan and joint analysis at that region of the chromosome .
the results from the discovery analysis and joint analysis for key snps are indicated using their rs numbers .
gwas indicates genomewide association study ; snps , singlenucleotide polymorphisms .
ld structure and logistic regression analyses in ptcsc3 region .
a , shows log10 ( p values ) of snps for the best test from the primary scan as a function of genomic positions for ptcsc3 region ( b ) ld patterns , d value , and r
among the diseaseassociated snps in ptcsc3 region .
in this study , we sought to identify novel genetic variations that predisposed individuals to laa stroke in a han chinese population residing in taiwan . from 2 independent groups ( table 4 ) , we found 5 new snps within the ptcsc3 gene for laa stroke that reached genomewide statistical significance .
these findings provide insights into the genetic basis of laa stroke and identify a novel pathway that may be applicable for future therapeutic interventions .
baseline demographic summary of patients ( n=763 ) hdlc indicates highdensity lipoprotein ; iqr , interquartile range ; ldlc , lowdensity lipoprotein ; vldl , verylowdensity lipoprotein . in the discovery stage , we imputed 134 snps with p value < 110 .
notably , the rs934075 and rs944258 snps with high p value ( < 110 ) were directly genotyped in our discovery sample , whereas rs934075 could be imputed with an equally high statistical value ( < 110 ) .
in addition , the snp rs944289 , located in chromosome 14q13.3 , is associated with an increased risk of papillary thyroid cancer ( ptc ) based on a gwas including patients with thyroid cancer in iceland , spain , and the united states.16 this snp is located in the region upstream of a long intergenic noncoding rna ( lincrna ) , named ptcsc3 , and functional studies have indicated that this lincrna is involved in ptc susceptibility.17
ptcsc3 is highly expressed in the thyroid and weakly expressed in the kidney,17 and the downregulation of ptcsc3 in thyroid tumors of ptc patients is significantly associated with the risk allele ( t ) in rs944289.17 in addition , the risk allele ( t ) for ptc in the snp rs944289 has also been shown to be associated with a low concentration of thyroidstimulating hormone in the general population,16 and a recent report also indicated that hyperthyroidism may be associated with an increased risk for ischemia stroke in young adults.18 it raises a likelihood that ptcsc3 may affect thyroid function , and the disruption of thyroid function may , in turn , be associated with a worse cardiovascular risk factor profile , potentially leading to progression of atherosclerosis.19 therefore , further studies are warranted to investigate the mechanism through which ptcsc3 is involved in the susceptibility for laa . in a previous gwas conducted in caucasians , the snp rs11984041 , which had the strongest significance ( ie , the lowest p values ) for laa stroke , was shown to be located in the final intron of the hdac9 gene.10 because this snp ( rs11984041 ) is not polymorphic in the han chinese population , an additional study investigated other potential snps associated with hdac9 in han chinese individuals.20 this previous report showed that there are 2 snps , located in the different intron of hdac9 ( ie , not in ld with rs11984041 ) , which may be associated with laa in han chinese individuals.20 however , the p values of these snps ( rs2389995 and rs2240419 ) did not reach the first criterion ( p<510 ) in the discovery stage of our gwas . in the present study ,
2 novel suggestive snps ( rs2074633 and rs28688791 ) represent a different , more significant locus in the hdac9 gene ( ie , in ld with rs11984041 ) in han chinese individuals .
the snps ( rs28688791 and rs2074633 ) at chromosome 7p21 were associated with laa in the discovery phase ( p<510 ; figure 2 ) , and their p values in the joint analysis were close to reaching gwas significance ( rs28688791 , p=3.6610 , or=1.38 [ 95% ci , 1.1951.496 ] ; rs2074633 , p=3.2010 ; or=1.34 [ 95% ci , 1.1981.501 ] ; table 3 ) .
the snp rs2074633 was located in the 3untranslated region ( utr ) exon of hdac9 , and the snp rs28688791 was located downstream of the hdac9 locus and in the 3 utr of twist1 ( encoding twist family bhlh transcription factor 1 ; figure 3b ) locus .
interestingly , a difference in the locations of the snps ( rs28688791 and rs2074633 ) identified in han chinese and the snp ( rs11984041 ) identified in caucasians implies multiple regulation pathways in expression of hdac9 gene in laa stroke .
this was a casecontrol gwas conducted in a han chinese population residing in taiwan for laa stroke , a subphenotype of ischemia stroke differentiated based on toast criteria .
although the findings identified a novel locus , ptcsc3 , associated with laa stroke and provide insight into the pathogenic mechanism for laa stroke , the interpretation of the results of this study require caution owing to the limited number of ethnic groups considered .
future investigations of laa stroke in other populations from asia will be critical to clarify whether these newly identified genetic variants for laa stroke are shared in other populations .
although the snps with genomewide significance could be identified based on the combined analysis , there was still an incomplete validation of these snps in an independent cohort , which may be one of the study limitation in the present study .
this was a casecontrol gwas conducted in a han chinese population residing in taiwan for laa stroke , a subphenotype of ischemia stroke differentiated based on toast criteria .
although the findings identified a novel locus , ptcsc3 , associated with laa stroke and provide insight into the pathogenic mechanism for laa stroke , the interpretation of the results of this study require caution owing to the limited number of ethnic groups considered .
future investigations of laa stroke in other populations from asia will be critical to clarify whether these newly identified genetic variants for laa stroke are shared in other populations .
although the snps with genomewide significance could be identified based on the combined analysis , there was still an incomplete validation of these snps in an independent cohort , which may be one of the study limitation in the present study .
in the present study , we identified novel associations between laa stroke and polymorphisms in the ptcsc3 gene based on 5 snps with gwassignificant p values .
because the ptcsc3 gene also contains a risk locus correlated with ptc , our data provide strong support for future studies of the association between laa and ptc .
in addition , compared to previous snp studies in han chinese individuals , here , we observed 2 snps with moresignificant p values located in the hdac9 locus , which was in close proximity to the most significant snp identified by gwas in caucasian individuals .
these results support the notion that genetic predisposition to laa may vary by ethnicity . in conclusion , our study revealed that the ptcsc3 signaling pathway may be involved in the pathogenesis of laa stroke and that ptcsc3 may potentially serve as a therapeutic target for stroke prevention .
this study was supported by the academia sinica genomic medicine multicenter study , taiwan ( 4005gmm ) and chang gung memorial hospital ( bmrp 274 , cmrpg35072 , cmrpg 35073 , and cmrpg 39082 ) .
the funders had no role in study design , data collection or analysis , the decision to publish , or preparation of the manuscript .
we gratefully acknowledge the members of the translational resource center ( nsc1022325b001023 ) of national research program for biopharmaceuticals and the national center for genome medicine ( nsc1022319b001001 ) of national core facility program for biotechnology , national science council , at academia sinica for their support in subject recruitment , genotyping , and statistical analysis .
| backgroundischemic stroke is a major cause of death and disability in the world .
a major ischemic stroke subtype , largevessel ischemic stroke ( large artery atherosclerosis ; laa ) , has been shown to have some genetic components in individuals of european ancestry . however , it is not clear whether the genetic predisposition to laa stroke varies among ethnicities .
we sought to identify genetic factors that contribute to laa stroke in 2 independent samples of han chinese individuals.methods and resultsnovel genetic variants that predispose individuals to laa stroke were identified using a genomewide association study ( gwas ) of 444 individuals with laa stroke and 1727 controls in a han chinese population residing in taiwan .
the study was replicated in an independent han chinese population comprising an additional 319 cases and 1802 controls .
we identified 5 singlenucleotide polymorphisms , including rs2415317 ( p=3.10108 ) , rs934075 ( p=4.00109 ) , rs944289 ( p=3.57108 ) , rs2787417 ( p=1.76108 ) , and rs1952706 ( p=2.92108 ) , at one novel locus on chromosome 14q13.3 within ptcsc3 ( encoding papillary thyroid carcinoma susceptibility candidate 3 ) that were associated with laa stroke at genomewide significance ( p<5108).conclusionsour data provide strong support for future studies on the role of ptcsc3 in the pathogenesis of laa stroke and the association between laa stroke development and thyroid function . in addition , these findings provide insights into the genetic basis of laa stroke and identify a novel pathway that might be applicable for future therapeutic intervention . |
with the increasing utility of invasive procedures in inpatient settings , nosocomial infections are encountered with more prevalence among the hospitalized population .
hospital-/noncommunity acquired infections ( hai ) not only lengthen the duration of hospital stay with increased demand for additional health care resources but also are potential sources for acquisition of microorganisms by the health care providers , burdens health care system itself , and sets up the transmission into shorter cycle [ 1 , 2 ] .
in essence , the most common pathogens responsible for hospital - acquired infections differ from those of community - acquired infections . on the other hand ,
antimicrobial susceptibility of each organism is influenced by the origin of infection , periodic alterations , and epidemiological factors of that region [ 1 , 35 ] .
urinary and respiratory tract infections are the leading cause of in - hospital infections consuming huge amounts of health resources . in addition
, these infections impose the risk of high morbidity and mortality on admitted patients . empirical treatment for hai
should be instituted based on the knowledge of susceptibility of responsible pathogens to available antibiotics [ 57 ] .
although this approach optimizes the effects of antimicrobial agents , inappropriate extended - spectrum antibiotics should strongly be discouraged .
the importance is more sensible if increased resistance to many antibiotics is taken into account and action programs have developed to restrict overuse of antibiotics [ 3 , 5 , 79 ] .
for this reason , specific nationwide surveillance studies should be conducted to provide for microbiological resistance pattern and antibacterial activity of antibiotics .
the aim of our study was to provide objective evidence in terms of antibiotic susceptibility and resistance of pathogens isolated from patients afflicted by either community- or noncommunity acquired uti and rti in a tertiary care center in iran .
the study population included patients attending to the laboratory or admitted to cardiac wards in tehran heart center ( thc ) , tehran , iran .
the inclusion criteria comprised clinical evidence of urinary or respiratory tract infection , according to the definition of center for disease control and prevention ( cdc ) , in patients admitted to the hospital before 48 hours of admission and in patients presenting to the outpatient clinic having symptoms for less than 72 hours .
the inclusion criteria comprised community - acquired infections diagnosed in patients attending to the laboratory without prolonged duration ( > 72 hrs ) and previous antibiotics reception and hospital - acquired infections considered in patients developing u / r tract infections more than 48 hours after hospital admission . admitted patients with documented uti or rti on admission or outpatient subjects who had received antibiotic therapy within 48 hours , immune compromised patients , and those with documented complicated infections were excluded from the study .
the study design and protocol was approved by the research and ethics committee of thc .
patients with suggestive symptoms of upper respiratory tract infection or clinical evidence of urinary tract infection underwent sampling for sputum and urine analysis before antibiotic therapy , respectively .
fifty milliliter ( ml ) of clean - catch midstream urine from patients with a probable diagnosis of uti was collected in a sterile container for uti as soon as possible after admission . in those with evidence of an rti
, 20 to 30 ml of early morning sputum was obtained in a sterile plastic container .
bacteriuria was determined with quantitative technique using 0.01 ml calibrated wire loop to inoculate the blood agar , which provides for growth of most organisms .
the same technique was accomplished with the macconkey culture medium specialized for isolation of gram - negative bacteria .
culture was considered positive if at least 10 cfu / ml was isolated for a single organism .
identification of isolates was obtained by their characteristic appearance on their respective media and gram staining .
the isolated colony was confirmed by the pattern of biochemical reactions using the standard method and also by pcr for the type of microorganism .
antibiotic susceptibility was evaluated by kirby - bauer disc diffusion method on mueller - hinton agar according to the guidelines of clinical and laboratory standards institute ( clsi ) and antibiogram was obtained .
the followings are the concentrations of drugs used for disc diffusion testing : ampicillin ( 10 g ) , amikacin ( 30 g ) , coamoxiclav ( 20/10 g ) , cefepime ( 30 g ) , cefoxitin ( 10 g ) , ceftazidime ( 30 g ) , ceftriaxone ( 30 g ) , cephalotin ( 30 g ) , ciprofloxacin ( 5 g ) , clindamycin ( 2 g ) , cotrimoxazole ( 23.75 g sulfamethoxazole/1.25 g trimethoprim ) , erythromycin ( 15 g ) , gentamicin ( 10 g ) , imipenem ( 10 g ) , meropenem ( 10 g ) , nitrofurantoin ( 100 g ) , penicillin ( 10 units ) , tobramycin ( 10 g ) , and vancomycin ( 30 g ) .
data were assessed using the statistical package for social sciences ( ibm spss statistics , version 19 , ibm corporation ) and presented as number ( percent ) and mean sd when appropriate .
urinary and respiratory samples from admitted patients in 4 intensive care units ( icu ) , 5 coronary care units ( ccu ) , 12 inpatient wards , and those attended to the laboratory were analyzed . of 1099 positive cultures , 835 ( 75.9% ) and 264 ( 24.1% ) samples were related to uti and rti , respectively .
of 835 positive urine cultures , 664 samples ( 79.5% ) were obtained from hospitalized patients compared with 171 samples ( 20.5% ) from outpatient .
e. coli was the most prevalent isolated organism in both the hospital - acquired and the community - acquired utis followed by klebsiella and enterococcus ( table 2 ) . in outpatients , e. coli was the leading cause followed by klebsiella , staphylococcus epidermidis , and inactive e. coli .
e. coli was highly resistant to cephalotin in the majority of samples ( 56.6% ) followed by cotrimoxazole ( 49.4% ) and ceftriaxone ( 38.5% ) as presented in table 3 .
antibiotic susceptibility and resistance pattern of klebsiella and enterococcus species have been also presented in table 3 .
it is perceived from the table that the best antibiotics for klebsiella and enterococcus were imipenem and nitrofurantoin , respectively . on the other hand
, we found a high susceptibility of e. coli to imipenem , amikacin , and nitrofurantoin .
table 4 summarizes the prevalence of microorganisms isolated from urine samples according to the source of infection and time of sampling .
two hundred sixty - four positive cultures were obtained from respiratory secretions . of these , 135 samples ( 51.1% ) were related to icu wards compared with 129 samples ( 48.9% ) obtained from hospital wards .
regarding the admission wards , acinetobacter was the most prevalent organism in the icu , while pseudomonas aeruginosa was the most prevalent organism in non - icu wards .
acinetobacter demonstrated the greatest resistance to ceftriaxone with the greatest susceptibility and lowest resistance to imipenem .
staphylococcus aureus was highly susceptible to vancomycin and highly resistant to erythromycin and cefoxitin , respectively .
susceptibility and resistance to antibiotics of the isolated respiratory organisms are summarized in table 5 .
the importance of regional specification of rti and uti etiology and their antibiotic susceptibility has been convincingly proved by several studies [ 5 , 1318 ] . however , the knowledge needs to be regularly revised with changing trends in microbiological patterns of the responsible organisms .
this accelerates the initiation of adequate antibiotic treatment in nosocomial infection with better results in terms of outcome and improved survival .
our study confirmed that e. coli is still the most frequent pathogen in both outpatient and inpatient settings .
although this is in accord with a number of previous reports [ 13 , 16 , 17 ] , muvunyi and colleagues ( 2011 ) proposed that the prevalence of urinary infections with e. coli is decreasing probably due to other superseding members of the enterobacteriaceae .
the second and the third most prevalent uropathogens in the hospitalized population of our study were klebsiella and enterococcus , respectively .
similar to other investigations , e. coli constituted a lower percentage of isolates in inpatients than outpatients .
however , the pattern of isolates in an ambulatory setting may be quite variable , with e. coli being the most common organism , followed by staphylococcus saprophyticus , proteus mirabilis , and enteric gram - negative rods in one study .
another observational study on microbiologic patterns of uti in general practice also revealed e. coli as the most common culprit followed by typical uropathogens and enterococcus faecalis . according to current evidence , irrespective of the chronological pattern of the infection ,
e. coli still accounts for the most common organism isolated from urinary tract infections in either of the inpatient or outpatient populations which should be investigated in terms of antimicrobial susceptibility . with respect to rti
, acinetobacter constituted the most common pathogen in 2008 followed by pseudomonas aeruginosa and staphylococcus aureus .
nevertheless , the trend has been different in 2007 with pseudomonas aeruginosa being the most prevalent and acinetobacter being the least frequent organisms . in a study by wang et al . from northern china , pseudomonas aeruginosa was the most common isolated organism in hospitalized patients with lower respiratory tract infection .
however , a sentry antimicrobial surveillance program showed that staphylococcus aureus comprised 28 percent of isolates followed by pseudomonas aeruginosa in 20.0 percent , streptococcus pneumonia in 9.1 percent , and klebsiella saprophyticus in 7.5 percent among hospitalized patients in northern america and canada .
xia and colleagues investigated the changing pattern of isolated pathogens in lower respiratory tract infection among a chinese population and found that acinetobacter was more frequently isolated in 2006 than in 2010 which is also confirmed by our study ( 15% in 2007 versus 36.8% in 2008 ) .
moreover , it seems that acinetobacter is commonly isolated more from icu patients than from other wards perhaps due to the compromised immunity of the critically ill patients [ 5 , 18 ] .
the urinary isolated e. coli was susceptible to nitrofurantoin in 90 percent and to gentamicin in 71.8 percent of cases .
although susceptibility to imipenem and meropenem remained high ( 100 percent and 80.4 percent , resp . ) , cotrimoxazole represented a susceptible proportion of less than 50 percent .
additionally , klebsiella demonstrated 80.7 percent susceptibility to gentamicin , 83.9 percent to ciprofloxacin , 58.5 percent to nitrofurantoin , and more than 60 percent to cephalosporin .
however , it raised concern because of resistance to coamoxiclav in 61.8 percent and to ampicillin in 92.6 percent of the isolates . similarly , enterococcus showed susceptibility to nitrofurantoin ( 74.1% ) and gentamicin ( 48% ) with 55.2 percent resistance to vancomycin , hence , categorized as vancomycin resistant enterococcus ( vre ) .
however , the susceptibility and resistance patterns were relatively comparable so as both features are close to 50 percent . in a study by cullen and colleagues , e. coli , as the most common uropathogen , showed significant resistance to penicillin , trimethoprim , and ciprofloxacin .
their results also showed a decreasing susceptibility to gentamicin during the period of study for 11 years .
in contrast , resistance against cefoxitin and erythromycin exceeded 80 percent implying that more than 80 percent of the organisms were methicillin resistant s. aureus ( mrsa ) .
acinetobacter , as the most common isolate in rti , represented the best susceptibility to imipenem ( 50% ) .
nevertheless , its resistance to imipenem ( 47.9% ) was relatively too high to be selected as the first line antibiotic . on the other hand
, other antibiotics did not reveal high activity against this organism with the best susceptibility varying from 10 to 15 percent ( see table 5 ) .
interestingly , pseudomonas aeruginosa had high susceptibility to available antibiotics such as meropenem ( 90% ) , ciprofloxacin ( 87.5% ) , imipenem ( 84.4% ) , and amikacin ( 73.4% ) . in their study ,
. rated antimicrobial resistance of pathogens in pediatric infections and reported that ceftriaxone and cefepime were generally more effective against e. coli and klebsiella pneumonia . however , imipenem was the most effective antibiotic with 100 percent susceptibility .
these findings confirm that despite current trends in pediatric population , where administration of imipenem is not widely established yet , the community - acquired pathogens are still amenable with high susceptibility to this antimicrobial agent .
the present study was employed as surveillance of current microbiologic pattern and antibiotic susceptibility in uti and rti among a large hospital and outpatient population in order to revise the existing knowledge for the establishment of proper and adequate empirical antibiotic therapy .
however , a multicenter investigation would have complied with this objective more sufficiently . furthermore , the history of infection and previous administration of antibiotics are influential factors for striding towards understanding elements of antimicrobial resistance . on the other hand ,
the role of other nonbacterial microorganisms in community- and in - hospital acquired infections should be taken into account .
periodic domestic antimicrobial surveillances are needed to regularly update the guidelines on proper empiric and organism - specific antibiotic treatment .
our study showed the changing trends in antibiotic susceptibility of isolates from uti and rti with respect to the source of infection during the time . while e. coli and acinetobacter remain the most common urinary and respiratory organisms , respectively , their increasing resistance to wide - spectrum imipenem and meropenem is a major concern . | aim . to demonstrate the prevalence of isolated organisms in urinary / respiratory tract infections and their antibiotic susceptibilities in a tertiary care center . methods and material . between january 2008 and january 2010 , patients referring to the clinic of cardiology or those admitted to the cardiac wards were enrolled in this cross - sectional descriptive study .
urine and sputum sampling was done for all the patients and the specimens underwent microbiologic examination and , in case of isolation of microorganism , antibiotic disk diffusion test was performed .
results .
escherichia coli ( e. coli ) was the most prevalent isolated organism in - hospital and community - acquired utis and was highly resistant to cephalothin in all the samples followed by cotrimoxazole , and ceftriaxone .
it revealed high sensitivity to imipenem , amikacin , and nitrofurantoin .
acinetobacter constituted the most prevalent organism isolated from respiratory secretions and represented the highest resistance to ceftriaxone and the greatest sensitivity to imipenem . conclusions .
e. coli and acinetobacter remain the most common uropathogenic and respiratory organisms , respectively
. however , their increasing resistance to wide - spectrum imipenem , meropenem , and vancomycin is a major concern . |
coarctation of the aorta refers to a congenital narrowing of the aortic lumen and occurs in approximately 3.2 of 10,000 live births .
the overall incidence has been reported to be between 5 and 8% of all congenital heart defects .
aortic coarctation can be either pre - ductal ( 10% ) or post - ductal ( 90% ) , depending upon the relation of the point of narrowing with the embryological ductus arteriosus ( or ligamentum arteriosum ) and the origin of the left subclavian artery . while the former presents with severe heart failure , mostly within the first week of life , the latter form has a relatively late presentation with incidental hypertension noted during evaluation of acute associated ailments or non - specific pathologies like life - threatening intracranial hemorrhage .
the obstruction of blood flow through the aortic arch provokes the development of collateral vessels that would allow blood to flow from high - pressure to low - pressure areas .
collateral vessels most frequently emerge from the branches of the subclavian arteries above the obstruction and supply blood to the tissues below the obstruction .
the collateral pathways that develop most commonly in proximal thoracic aortic stenosis are as follows : ( 1 ) subclavian artery - internal mammary artery ( also called internal thoracic artery)-intercostal arteries ( retrograde flow)-postcoarctation descending thoracic aorta ; ( 2 ) subclavian artery - thyrocervical and costocervical trunks - thoracoacromial and descending scapular arteries - postcoarctation descending thoracic aorta ; and ( 3 ) subclavian artery - vertebral artery - anterior spinal artery - intercostal arteries - postcoarctation descending thoracic aorta . these abnormal vessels , rarely if ever , appear due to compression of adjacent vital structures or hemorrhages .
only few reports were encountered in the contemporary literature where intraspinal collaterals and a hypertrophied anterior spinal artery had a causative role toward compressive myelopathy in a case of aortic coarctation , as in the present case , with the maximum documented age of a patient being 30 years as against an advanced age of 57 years in this case .
further , none of these patients had an associated epidural hematoma , which was seen in this case and was an important cause of cord compression probably due to rupture of one of these abnormal vessels .
a 57-year - old female patient presented to the emergency department of our hospital with sudden - onset symmetric paralysis of bilateral lower limbs .
the patient had no other contributory history including that of fever , acute bouts of cough , coagulopathy , or any other chronic medical or surgical co - morbidity .
she was referred for magnetic resonance imaging ( mri ) of the spinal cord to evaluate the cause of paraplegia on a 1.5 tesla whole body magnet ( siemens medical systems , erlangen , germany ) .
an examination was performed on a 1.5 t scanner [ figure 1 ] which revealed a mixed intensity complex multilobulated lesion in the anterior epidural space with convex posterior margin , adjacent to the c7-d2 vertebral bodies .
the lesion was seen to cause gross compression and displacement of the spinal cord in the region with altered cord signal intensity ( extending from c3 to d3 levels ) suggestive of cord edema .
this raised a suspicion of small anterior epidural hematoma which , however , could not explain the gross compression of cord along with the length of the edematous cord segment .
the mri also showed multiple dilated tortuous vascular channels in the epidural space along with the hematoma , as well as in the paravertebral space .
this prompted a computed tomography ( ct ) angiography [ figure 2 ] which confirmed the presen ce of extensive epidural , paravertebral , and chest wall collateral vessels , along with a hypertrophied anterior spinal artery compressing the spinal cord in the cervicodorsal region .
the imaging was performed on a 64 slice mdr ct scanner ( ge medical systems , milwaukee , usa ) .
the collaterals were connected to bilateral internal thoracic , vertebral , and anterior spinal arteries .
in addition , the long segment cord edema was probably due to vascular congestive state in the region as a result of slow flow and compression of perimedullary veins by the intraspinal space - occupying lesion hence formed .
an interesting finding emerging at this stage was severe post - ductal coarctation of aorta , which could explain the genesis of all above features .
the patient was referred for further management to the cardiovascular surgery unit , where she was counseled for a possible shunt surgery , in the event of a cardiac emergency .
surgical therapy is associated with a low risk of restenosis and recurrence , whereas endovascular therapy , consisting of percutaneous balloon angioplasty and endovascular stent repair , has much higher incidence of restenosis , but is a safe and acceptable modality in poor surgical candidates . as for the present episode , she was managed conservatively with supportive hospital care and showed satisfactory improvement in grade of power , sensations and gait .
sagittal t1w ( a ) and t2w ( b ) images showing the multilobulated intraspinal extradural space - occupying lesion ( white arrow ) grossly compressing and displacing the spinal cord .
the cord ( black arrow ) appears hyperintense on t2w images over a long segment suggesting edema ( myelopathy ) .
note the flow voids ( dark areas on both t1w and t2w ) and areas of organized blood ( bright areas on t1w ) on the images , which raise a suspicion of abnormal vessels with small epidural hematoma ct scan of the patient performed during clinical workup , ( a - c ) volume - rendered , and ( d - f ) multiplanner thick maximum intensity projection images .
note the stenosed aortic segment ( straight white arrows ) , as described in text , associated with extensive collaterals in all areas including the paravertebral and epidural space ( hollow arrows ) .
the anterior spinal artery appears quite dilated ( curved arrow ) , especially in the compressed segment of the cord
collateral shunting of blood , in a case of post - ductal aortic coarctation , develops to decompress the high - pressure proximal segment to the low - pressure distal segment , usually via dilated intercostal and internal mammary arteries .
the same remains a slowly evolving process , hence the patient may present in second or early third decade with systemic hypertension .
aortic coarctation is not uncommonly diagnosed during evaluation of such incidental hypertension , unless the patient presents due to associated complex cardiac anomalies . as the pressure of the proximal segment increases , certain pre - existing embryologic vessels also hypertrophy , along the body wall , as was seen in the present case .
all these vessels , however , remain asymptomatic per se , serving as the tell - tale sign of the inciting pathology . under rare circumstances ,
collaterals develop inside the spinal canal as well , along with hypertrophy of the spinal cord vasculature .
when present , these vessels can be potentially dangerous , mainly due to chances of hemorrhage associated with rupture of these channels . in exceptionally rare cases , these vessels may contribute toward spinal cord compression , as was noted in our patient .
although these vessels rarely attain aneurysmal dimensions , the compression is probably a result of constant pulsation under pressure in a closed space .
further , increased intraspinal canal pressure can lead to lymphovenous congestion which can result in chronic myelopathy .
the patient described in the present report represents one such situation where a sub - acute process of cord edema and sub - clinical myelopathy was unmasked by an acute episode of epidural hematoma , which led to presentation above the clinical horizon .
other uncommon causes of primary compressive myelopathy in a case of aortic coarctation are spinal artery aneurysm , compression due to radicular artery aneurysm , aortic steal mechanism , dislodgement of microthrombi from dilated collaterals , and spontaneous bleed from dilated weak collaterals .
however , all these complications have been described within the age window of first to third decades , unlike the present patient where the presentation was delayed to the late sixth decade . from an imaging perspective , on one hand , this case emphasizes the importance of thorough evaluation of the vascular system in all cases of spinal epidural hematomas , while on other hand it warns one to be wary of making a blind diagnosis of spinal arteriovenous malformations without such investigation . | a 57-year - old female presenting with acute - onset paraplegia was referred for magnetic resonance imaging ( mri ) of cervico - dorsal spine . on mri , multiple tortuous dilated vessels
were noted in the epidural space with long segment cord compression and imaging features of compressive myelopathy .
associated small acute cervico - dorsal epidural hematoma was also noted in the same region .
computed tomography ( ct ) angiography was performed subsequently which revealed post - ductal coarctation of aorta with multiple arterial collaterals in the chest wall and spinal canal . an extensive review of english language literature pertaining to the clinical presentations of adult aortic coarctation revealed only few reports of acute compressive myelopathy due to spinal epidural collateral vessels .
further , presentation at such a late age has not been reported before . in the present case ,
apart from a hypertrophied anterior spinal artery and perispinal collaterals , an anterior epidural hematoma was an additional important factor in the causation of myelopathy . |
integration is the goal of many human service organizations , policymakers , theorists , and professionals .
integrated health services hold the promise of improved efficiency , capacity , performance / quality , cost - effectiveness , and enhanced working environment with improved communication and cooperation [ 1 , 2 ] .
the canadian council on health services accreditation ( 2006 ) offers a definition of integration which encapsulates the many definitions found in the limited health literature
services , providers , and organizations from across the continuum working together so that services are complementary , coordinated , in a seamless unified system , with continuity for the client . in ontario , there are increasing efforts to promote health services integration especially in local health integration networks ( lhins ) . in a synthesis of reviews of
. concluded that comprehensive interventions address multiple risk and protective factors , operate across multiple environments such as school , home , and community , and provide a mix of universal , targeted , and clinical services that are often proactive .
this can be achieved by providing integrated care coordination ( adjusting one provider 's care because of what other providers do ) or collaboration ( jointly planning the type of care , provided how and by whom ? ) .
[ 1 , 2 ] recently the children 's treatment network ( ctn ) of simcoe county and york region , ontario created integrated child and family teams of rehabilitation provider 's from different and autonomous organizations whose providers work together using network interdisciplinary teams and a single plan of care to address the range and mix of any client 's problems . recently
, the children 's treatment network ( ctn ) in ontario was formed with funding from the ontario ministry of children and youth services to create network interdisciplinary teams that target the needs of each child and their families with complex disabilities in simcoe county and york region of ontario .
the ctn model is a new approach for care of children and their families with complex needs that is based on local service providers from different agencies and organizations collaborating and taking a team approach to the comprehensive rehabilitation and psychosocial needs of both children and their families without the use of a single children 's treatment centre organization and building .
the ctn model of team service provision consists of an integrated package with the following key elements .
single point of access , service navigation , and a comprehensive child and family interview , assignment of a service coordinator , development of the individual child and family team , and development of a single plan of care recorded in the shared electronic client record .
this integrated network incorporates the key principles necessary for success as outlined by suter et al . in their comprehensive health systems integration review .
common services available to families in the ctn model of delivery are developmentally appropriate physiotherapy , occupational therapy , speech therapy , augmentative communication , in - home family support worker , child behavior therapy , inclusive recreation , parenting instruction , family therapy , psychology , early childhood educator , or special educational resource teacher depending on the child 's school age ( http://www.ctn-simcoeyork.ca/ ) . to date , evaluation of health service integration efforts has been largely cross - sectoral in nature with some reported benefits to the system .
system - level positive outcomes include reduction in nonemergency cases using the emergency room ; reduction in the average length of stay in hospital ; better financial performance ; a flatter organizational structure ( fewer management tiers ) .
some of the positive program / provider - level outcomes include increased job satisfaction ; increased cooperation with other agencies ; a blending of professional cultures into one shared culture .
our team took the bioecological and biopsychosocial perspectives of human development that it is not possible to fully understand quality of life in children with complex needs by considering only simple associations between child / parent / family / social or health service provider factors .
a multitude of levels of factors and interactions between these factors are simultaneously present as in figure 1 , and care of these families requires a holistic approach .
the purpose of this paper was to test the value of the integrated efforts of a team of rehabilitation providers from networked organizations that can be moderated by child and parent variables and relate these interactions to the change in the child 's physical function after two years .
we hypothesized that the effects of current integrated child and family team function would be more pronounced or stronger among families with fewer parent and child risk characteristics [ 6 , 8 ] because the physical rehabilitation providers are not educated to deal with cumulative parent or child risk factors .
when integrated teams are able to manage dysfunctional parents and child behaviors , there would be improvements in child physical function two years later .
parents and children interact and can moderate the effectiveness of integrated team function whereby either the child or the parent in interaction with service providers either facilitates or inhibits the success of physical rehabilitation efforts .
this descriptive study is part of a prospective cohort study examining the effects and expense of the ctn .
ethics approval was obtained for the study by the research ethics board of mcmaster university .
the depth of integration of ctn service providers on each child and family team was also measured at the 2-year followup . completed integration measures were obtained from service providers on 110 ctn child and family teams .
this was a 2-year longitudinal survey of families with a special needs child enrolled in the ctn from may to december 2007 .
families were deemed eligible if the child was aged 019 years , were residents of simcoe / york , and there were , in addition to the child 's physical rehabilitation needs , multiple other needs within the family ( child 's special cognitive , communication , and behavioral needs and families ' needs e.g. parenting style , a parent 's medical or mental health problem ) .
the consenting parent / guardian most knowledgeable ( pmk ) returned a signed consent form to mcmaster university indicating their willingness to participate .
the pmk then completed a baseline telephone interview ( 1 hour ) by one of three trained interviewers from mcmaster university .
a followup telephone interview was completed after 2 years by the same mcmaster interviewer who was masked to the child and family receipt of integration care .
integration of the ctn teams among families enrolled in this research was measured using the integration of human services measure [ 1 , 2 ] .
this measure evaluates observed and expected depth of integration among service providers on each ctn child and family team .
depth of integration represents the perceived and expected self - reported degree of exchange between all service providers along a continuum of involvement from nonawareness = 0 , awareness = 1 , communication = 2 , cooperation = 3 , collaboration = 4 .
the total observed integration score is the mean of the average group observed depth of integration scores .
the total expected integration score is the mean of the average group expected depth of integration scores .
both observed and expected depth of integration scores about the service coordinator for each team were calculated by the average of individual members ' inputs on a four - point scale from 0 ( nonawareness ) to 4 ( collaboration ) .
the number of team members who responded to the study and the corresponding response rate were also calculated .
the shortened version consists of 15 items comprising three core scales and addresses the physical ( 5 items ) , emotional ( 4 items ) , social ( 3 items ) , and school functioning ( 3 items ) .
parent proxy report formats were used for children ages from 2 to 18 due to the inclusion of children with limited cognitive or communicative abilities .
each item for ages from 8 to 18 asks how much of a problem it has been during the past month on a five - point scale ( 0never a problem to 4almost always a problem ) . for children aged 5 to 7
items are reverse - scored and linearly transformed to a 0100 scale so that higher scores indicate better quality of life .
psychosocial quality of life ( psychql ) is computed as the sum of the emotional , social , and school scale scores ( 10 items , range 0100 ) .
behavior was measured using the child behavior checklist ( cbcl ) questionnaire for children ages 219 also used in the canadian longitudinal survey of children and youth ( nlscy ) .
the questionnaire asks about how the child seems to feel or act regarding age - specific behaviors such as getting into fights , inability to sit still , and worrying .
the parent is asked to rate the specific behavior from 1never to 3often .
behavior subscales include hyperactivity / inattentive , prosocial , anxiety / emotional disorder , conduct disorder/ physical aggression , indirect aggression , and property offence .
items differ for age groups 0 - 1 years , 25 years , and 619 years .
specifically , questions pertaining to aggression , property offense , and prosocial behavior do not apply to the younger age groups .
internal consistency is reported by subscale and age group ( cronbach 's alpha 0.680.84 ) [ 11 , 12 ] .
the kessler scale ( k10 ) [ 13 , 14 ] measures pmk symptoms of depression and anxiety , a frequent accompaniment of depression .
ten questions measure the frequency of feeling : sad , nervous , restless , hopeless , worthless , everything was an effort , tired for no good reason , so nervous that nothing could calm down , fidgety , so restless could not sit still , or depressed during the past month .
chronic aspects of distress in the past month are examined on a five - point scale ( 1all of the time to 5none of the time ) .
scores range from 10 to 50 where 19 indicates no clinically important level of distress , 2024 indicates mild distress , 2529 indicates moderate distress , and 3050 severe distress .
parents were asked to rate their mental , physical health and general life satisfaction on a five - point scale ( 1very satisfied or
these questions were taken from the canadian community health survey ( cchs 2.2 ) that allowed comparisons with national samples . the impact on family ( iof ) scale determines the effects of a chronic illness on parents and families .
parents respond on a four - point scale about the degree to which statements apply to their family ( 1strongly agree to 4strongly disagree ) .
the revised iof scale ( 15 items ) has been validated [ 17 , 18 ] .
statements cover four dimensions : financial burden , family / social impact , personal strain , and mastery ( e.g. , fatigue is a problem , see family and friends less , need to change plans at last minute , little desire to go out ) .
the nlscy parenting scale was used and consists of twenty - five questions adapted from the validated parenting practices scale .
the following four parenting behaviors were measured : positive interaction ( praise , play ) , hostility / ineffective ( anger , ineffective discipline ) , consistency ( follow through ) , and punitive ( yelling , physical punishment ) .
pmk rated each item ( e.g. , do something special with your child that he / she enjoys ) in terms of frequency from 0never to 4many times each day .
internal consistency is reported by subscale and age group ( cronbach 's alpha 0.390.75 ) .
the level of social support of the pmk was assessed using an eight - item shortened version of the social provisions scale .
different social support constructs were measured : guidance , reliable alliance ( i.e. , feeling assured that others would be available to offer practical help ) , and attachment .
pmk rated each item along a four - point scale from 0strongly disagree to 3strongly agree .
thirteen items from the nlscy population survey , based on a subscale of the mcmaster family assessment device , were used to gather information on various aspects of family functioning ( problem solving , communication , roles , affective responsiveness , affective involvement , behavior control ) .
pmk rated each item ( e.g. , we avoid discussing our fears or concerns ) along a four - point scale from 0strongly agree to 3strongly disagree .
the measure of processes of care ( mpoc-20 ) is a 20-item , well - validated , and reliable self - report measure of parents ' perceptions of the extent to which the services they and their child receive are family - centered [ 22 , 23 ] .
respondents use a seven - point scale to describe the extent to which they experience service provider behaviors across five domains with response options ranging from 1never to 7-to a great extent .
the five domains are . enabling and partnerships , providing general information , providing specific information , comprehensive and coordinated care , and respectful and supportive care .
they include , child age , gender , grade and pmk report of the main medical and other important diagnosis .
a standard form including spiritual or faith orientation , ethnicity , and languages was selected from the nlscy that also includes community dwelling disabled children .
sociodemographic data were gathered on the pmk gender , age , and educational level as well as on household income and family status .
descriptive statistics ( numbers , percentages , means , and standard deviations ) were calculated for all child and family variables , team integration , and team functioning scores .
specifically , prosocial , indirect aggression , and property offence behavior scale items are applicable for children and youth from 6 to 19 years old .
the behavior scales for different age groups were transformed using the interpolation technique where the mean of the behavior scale scores for children from 2 to 5 years old with fewer items were multiplied times the number of items for older children .
there were reports of two or three children with complex needs in the same family and only one report of parent variables . in these instances ,
the pmk was counted multiple times to ensure a matched number of children and parents in the analysis .
a multiple linear regression model was used to study the interactions among the integrated team variables with other child / family / health services variables to explain the variation in the child 's physical quality of life ( ql ) at followup .
variables consistent with the ecological conceptual framework that showed high correlation with and strong prediction on the followup child 's physical ql in the exploratory regression were selected .
the selected child / family / health services / integration variables ( i.e. , independent variables ) were then studied for all 2-way interactions with the outcome followup child physical ql ( i.e. , dependent variable ) .
the fit of the model was assessed by the regression coefficient ( r ) , as it measures the percentage of variation of the dependent variable explained by the model . in the final model ,
all possible 2-way interactions of variables were tested , and interactions that were not statically significant were removed using the forward stepwise selection technique , where the inclusion significance level and exclusion significance level were chosen to be 0.05 and 0.10 respectively . the variables in the final model were centralized to adjust for possible multicolinearity . the normal probability plot for the residuals
the association between one variable and the outcome was plotted as a regression line under three conditions of the other variable .
the literature suggested applying one standard deviation from the mean to approximate scores of different conditions . in our analysis
, the three conditions were conventionally defined as high ( any score more than 1 standard deviation above the mean ) , moderate ( any score within 1 standard deviation of the mean ) , and low ( any score more than 1 standard deviation below the mean ) .
the majority of pmk surveyed were mothers of the children ( 80% ) , born in canada ( 74% ) , and spoke english ( 88% ) .
the average pmk was 40 years , 86% were female ( as 6% of the female respondents were not the child 's mother ) , 84% were married / common - law , 69% were employed , and the median household income was $ 60$69,000 .
there was an even split between families residing in simcoe region ( 50% ) and york county .
the average child age at interview was 7 years with 63% of the sample being male .
forty - four percent of the children were in pre - school ( up to and including kindergarten ) , 34% in grades 15 ( elementary ) , and 22% in grades 6 to 12 ( junior and high school ) .
fifty - seven percent of children were receiving service from community care access centers and school boards at time of entry into the ctn .
the top diagnoses for the children reported by pmk ( table 2 ) were mental and behavioral disorders ( 82% ) including autism ( 29% ) , diseases of the nervous system ( 45% ) including cerebral palsy ( 22% ) , and congenital malformations , deformations , and chromosomal abnormalities ( 26% ) .
fifty - four percent of children had more than one reported medical problem . in table 3 , it can be seen that the ctn study sample included children with complex needs with very low physical and low psychosocial quality of life as indicated by the pmk compared to varni 's children and adolescents with other chronic diseases . generally , this sample of children exhibited prosocial behavior and low levels of anxiety , aggression , and property offence behaviors .
pmk positive interaction and consistency parenting practices were moderate , and pmk hostile or ineffective parenting and punitive parenting were generally low in this sample . on average pmk report having social supports without family dysfunction and good overall life satisfaction .
forty - five percent , however , were exhibiting mild to severe symptoms of depression and anxiety ( k10 > 19 ) . for measures of processes of care , respectful and supportive care received the highest rating , and providing general information
received the lowest rating by pmk . observed levels of ctn team depth of integration indicate teams were currently functioning at a communication level while team members expect to be cooperating
the service coordinators were on average observed to be functioning at an awareness level and expected to be communicating .
ctn teams were rated on their high ( 3.0 to 4.0 ) and low ( < 2.5 ) observed depth of team collaboration and expected team collaboration . of 110 teams measured 43 were deemed high functioning ( high observed and expected integration levels bolded cells in table 4 ) .
sixty - seven teams were deemed low functioning based on low observed and expected integration scores ( table 4 ) . a comparison of the children 's characteristics , family functioning , and extent of health services received by families between the families engaged by high and low functioning teams is shown in table 5 .
the difference in quality of life , although not statistically significant , is clinically important .
higher functioning teams were serving more physically and medically fragile functioning children with higher psychosocial quality of life , less aggression , and less prosocial behavior .
in addition higher integrated teams were serving parents with more positive and less hostile parenting . finally , the observed and expected service coordinator depth of integration scores were higher in teams scored as highly integrated .
table 6 presents the summary interaction regression analysis on the child 's physical ql at followup .
eighty - nine percent of the variability in the child physical ql score at followup was explained by the model .
a total of sixteen 2-way interactions among child / family / health services / integrative team variables were found to be statistically significant .
three tested the hypothesized health services / integration team variables interacting with child / family variables : child psychosocial ql interacting with integrated team function ; child emotional disorder interacting with comprehensive and coordinated care ; hostile parenting interacting with integrated team function .
the interaction effect between two variables ( e.g. , a and b ) was comprised of the main effects ( a and b ) and the cross effect ( ab ) .
therefore , the regression coefficients of both components were included when interpreting a complete interaction effect .
figures 24 display the aforementioned three hypothesized interactions and show how integration was interacting with child / family variables .
child physical ql at followup was positively associated with child psychosocial ql at baseline ( figure 2 ) .
the strength of such association , however , interacted with the functioning of an integrative team .
when the child and family team was highly by integrated , one additional unit of child psychosocial ql at baseline was associated with an average 1.7 score increase in child physical ql at followup .
it was only associated with an average 0.9 score increase in child physical ql when the integrative team was low functioning .
in other words , for each additional unit in children 's psychosocial ql at baseline , there could be an average 82% improvement on the child 's physical ql score at followup for children engaged by a high integrated team versus a low integrated team .
more hostile or ineffective parenting was not always positively associated with better child 's physical ql ( figure 3 ) . when the child and family team had low integration , for each unit increase in the baseline hostile ineffective parenting score on average , there was a deterioration of 1.1 in child 's 2-year followup physical ql score . when the team was high functioning , there was on average a 0.79 improvement in the child 's physical ql at followup .
for each unit increase in hostile parenting at baseline , the high integration team effect could account for about 170% improvement in child physical ql at followup compared to the case of a similar situation receiving care from a low integrated team .
for each additional unit in child emotional disorder at baseline , there was an average 1.6 score increase in child physical ql at followup when the family received good comprehensive and coordinated care ( figure 4 ) . in families receiving moderate and poor comprehensive and coordinated care at baseline , for each unit increase in child emotional disorder there were , on average , 0.13 and 1.83 decreases in child 's physical ql scores at followup , respectively .
the level of comprehensive and coordinated care received by the family interacted with the child 's emotional status at baseline in its effect on the child 's physical ql at followup . for families that received little to moderate comprehensive and coordinated care , the child 's physical ql deteriorated at followup as their emotional status at baseline was worse .
contrarily , the child 's physical ql improved at followup with poorer emotional function at baseline when the families received good comprehensive and coordinated support from service providers .
this study provides original information about the effect of integrative efforts of individual child and family service teams for children with complex needs and reaffirms the value of a bioecological perspective .
the primary hypothesis was corroborated about the effect of integrated team function on the improvement in child physical function after 2 years being more pronounced among families with fewer parent / child risk factors .
teams with higher integration scores worked with children with higher levels of psychosocial function and parents with more positive and less hostile ineffective parenting style at baseline .
the physical function of these children improved more with the higher integrated team compared to the improvement in a similar child with less integrated team function .
further , when highly integrated teams worked with parents endorsing hostile - ineffective parenting styles at baseline , there was greater improvement in the child 's physical function and quality of life two years later .
a less integrated team working with parents with similar hostile - ineffective parenting styles at baseline resulted in the child 's physical functioning actually deteriorating after 2 years .
this same improvement in the child 's physical function after 2 years was observed when parents of children with high emotional disorder at baseline reported receiving a high level of comprehensive coordinated care at followup compared to similar children receiving less comprehensive coordinated care .
generally , ctn child and family teams rated themselves as functioning at a communication level of integration .
this combined with the response rate of moderate among service providers reflects the complexity of integrating service providers from different agencies all at differing locations .
the ctn network is also still in its infancy with respect to organization , planning , and system support .
higher expected integration scores reflect the recognition from service providers of improving integration efforts over time .
this study also provides information about the physical quality of life of children with complex needs and the associations and interactions of system integration variables .
the low ql scores in this sample compared to others , particularly for physical quality of life , illustrate the multifaceted needs and issues faced by this heterogeneous group of children and youth with multiple diagnoses .
this study supports previous findings and confirms that reports of simple associations between research outcomes do not give a comprehensive picture of the issues .
a multitude of factors ( e.g. , child behavior , child quality of life , parenting practices , provider processes of care , health service integration ) and interactions among these factors are simultaneously present ; therefore , care of these families requires a holistic approach that addresses all aspects of the child 's environment .
finally , this study informs service planners of the positive characteristics of children and families more likely to be served by highly integrated teams , the risk variables at intake most likely to impair progress from children 's rehabilitation services , and the need for teams to have behavioral mental health members .
results and findings are difficult to generalize outside of this study population because other contexts may differ .
this study may be missing important information from working , lower educated , single parents and their children likely those with greater need .
highly integrated teams had already been working with a greater proportion of medically fragile children at intake into the study .
while these families had less pronounced risk factors at intake into the study , this could have been due to the services of this team prior to the outset of the study . due to the cross - sectional nature of the team integration measure in of this research
, we do not understand the causation or directional influence of integration on child quality of life .
longitudinal followup is needed to determine whether documented improvements in integrative team function can improve the well - being of the child or if in fact providers need to engage actively those difficult to reach families ( i.e. , families with low child psychosocial ql and unfavorable parenting practices ) . of course randomized clinical trials
would be the ideal design to address this question , but these are complex to undertake in circumstances like these .
these questions are also important in order that team integration efforts can be targeted and evaluated to include the needs of parents so that child quality of life can be maximized . in this study ,
generally , parents underestimate their child 's quality of life compared to child self - reports .
therefore , the associations and interactions may vary when child self - report data are used .
it was not feasible to obtain self - report data from this complex needs group due to the wide range of limitations present in the children and budget constraints of the study . finally , clinically important change was difficult to quantify in this patient population .
research to date has not determined the minimally important difference in quality of life in a diverse group of children with complex needs .
rehabilitation providers working with children with complex needs need preparation to address child and parent problematic behaviors that limit progress in physical functioning . when this was the case in high integrated teams , the child 's physical quality of life improved after two years . | purpose . to explore the interactions between child and parents psychosocial factors and team integration variables that may explain improvements in physical dimensions of the peds ql quality of life of children with complex needs after 2 years
. methods . in this 2-year study , parents were identified by the children 's treatment network .
families were eligible if the child was aged 019 years , had physical limitations , resided in either simcoe county or the region of york , ontario , and there were multiple other family needs .
regression analysis used to explore associations and interactions ; n = 110 . results . a child 's physical quality of life was affected by interacting factors including child 's behavior , parenting , and integrated care .
statistically significant interactions between team integration , processes of care , and child / parent variables highlight the complexity of the rehabilitation approach in real - life situations . conclusions .
rehabilitation providers working with children with complex needs and their families should also address child and parent problematic behaviors .
when this was the case in high integrated teams , the child 's physical quality of life improved after two years . |
at the end of january 2003 , connecticut clinical laboratories were notified by mail that gpr isolates identified from csf or blood within 72 hours of culture inoculation must be reported to cdph epidemiology program .
cdph asked laboratories to call the department immediately if the isolate was identified within 32 hours of inoculation and collected either from an outpatient or an inpatient within 3 days of admission .
other gpr reports were to be mailed to cdph . although cdph was most interested in timely telephone reporting of isolates identified within 24 hours of inoculation , we chose 32 hours to identify isolates missed in laboratories lacking sufficient staff to continuously examine blood cultures during night shifts ( generally 8-hour periods ) .
blood cultures were processed according to each clinical laboratory 's usual culture practices since reported culture isolates were obtained from routine diagnostic testing . in clinical settings ,
blood cultures are generally performed by filling commercially manufactured bottles , primed to promote either anaerobic or aerobic bacterial growth , with the patient 's blood at the time of phlebotomy .
immediate clinical follow - up was conducted whenever > 1 of the patient 's blood culture bottles yielded the isolate within 32 hours of inoculation and for all csf isolates .
this follow - up involved clinically characterizing the patient 's illness through telephone discussion with the patient 's physician or inpatient nurse to determine whether the illness was suspicious for anthrax ( e.g. , respiratory symptoms or widened mediastinum seen on chest radiograph ) .
laboratory follow - up was conducted for all isolates , with daily laboratory contact until genus identification . for bacillus spp .
, laboratories were asked to report isolates ' hemolysis and motility characteristics , and , if necessary , isolates were forwarded to connecticut 's state laboratory to rule out b. anthracis by -phage lysis .
laboratory audits were conducted to ensure complete reporting of qualifying isolates ; 33 of connecticut 's 34 clinical laboratories participated .
we provided laboratories a list of gpr genera , and they provided a list of blood and csf cultures that had yielded these genera within 72 hours of inoculation during 2003 .
we compared patient names , culture dates , and results with the 2003 gpr reports to identify unreported isolates .
health department labor resources were estimated by staff questionnaire administered october 2003 . because laboratories required several weeks to implement the reporting requirement after notification , the analysis period was limited to march
in addition , only the first isolate from a given patient 's illness was counted in this analysis . from march to december 2003 , a total of 623 gpr isolates were identified .
, 14 listeria spp . , 10 propionibacterium spp . , and 9 other genera ( table 1 ) . annualized incidence of gpr blood isolates was 21.3/100,000 persons .
twenty - three of the 195 bacillus isolates were forwarded to connecticut 's state laboratory to rule out b. anthracis by -phage lysis ( all were negative ) . *
no . of isolates for which information on time from inoculation to growth and number of bottles to which samples had been added and number of bottles yielding isolate were available , respectively .
other category includes bifidobacterium ( 2 ) , brevibacterium ( 2 ) , actinomyces ( 1 ) , aureobacterium ( 1 ) , erysipelothrix ( 1 ) , eubacterium ( 1 ) , and oerskovia spp .
( 1 ) . among the 498 blood isolates with available incubation period , 171 ( 34% )
of these , 131 ( 76% ) were reported to cdph : 97 by telephone ( 61% reported on date detected and 42% reported outside office hours ) , 31 by mail , and 2 by unknown reporting method .
overall , 82% of these rapid - growing isolates were either bacillus ( 52% ) or clostridium spp .
unreported isolates ( n = 304 ) identified by laboratory audit only grew more slowly ( 80% incubation period > 24 hours versus 54% of reported isolates , p<0.001 ) and/or presumed contaminants ( 65% corynebacterium spp . ) . nearly all ( 98% ) unreported isolates were from clinical laboratories that had reported other isolates but failed to report all isolates .
corynebacterium isolates ( all nondiphtheria species , i.e. , " diphtheroids " ) were less likely to be reported than other genera ( 30% vs. 70% ; p<0.001 ) .
clostridium isolates grew significantly more quickly in blood culture than other genera ( median incubation 15.3 hours ; table 2 ) and more frequently in inoculated anaerobic culture bottles ( 68% ) than in aerobic culture bottles ( 13% ) .
annualized incidence of clostridial bacteremia was 2.3/100,000 persons , excluding 6 postmortem cultures likely due to agonal bacteremia .
the 67 patients were elderly ( median age 76 years ) and frequently critically ill ( 22 deaths ) .
underlying immune - compromise ( 49% ) and malignancy ( 60% ) were common ; 24% had neither condition .
* mean difference is -coefficient of univariate linear regression comparing each genus to clostridium spp .
, the reference group ; p value is the p value associated with that -coefficient .
other category includes propionibacterium ( 7 ) , bifidobacterium ( 2 ) , brevibacterium ( 2 ) , actinomyces ( 1 ) , aureobacterium ( 1 ) , erysipelothrix ( 1 ) , and oerskovia spp .
( 1 ) . from march to september 2003 , an average of 56 staff hours was required per month to receive , respond to , and process reports . for september 2003
specifically , the most recent month assessed , aggregate personnel time was 45 hours ( 20% outside office hours ) .
a major public health preparedness challenge is increasing the sensitivity and timeliness of recognition of individual , potentially sentinel cases of category a bioterrorism agent disease .
each category a agent has unique clinical and diagnostic features : no one system can meet the challenge for all agents . for anthrax , we attempted to shorten the time from occurrence of the earliest specific diagnostic finding , gpr identified by gram stain of blood or csf culture , to notification of the public health system . in doing so , we established an around - the - clock gpr laboratory reporting system with < 1 full - time staff position .
the system has enhanced rapid communication between cdph and laboratories and provided baseline information on gpr sepsis epidemiology .
additional anthrax cases have not occurred to test this system , and most bacillus isolates are attributable to culture contamination .
however , through auditing , we determined that 62% of bacillus isolates identified within 24 hours of inoculation were reported by telephone .
improvement is needed , but , through auditing , the system tracks the timeliness and completeness of reporting and speciation of all bacillus organisms , including , potentially , the next b. anthracis isolate . overcoming laboratory personnel 's reticence to report results that are likely spurious culture contaminants has been a challenge of implementing the system .
( i.e. , " diphtheroids " ) with their unique gram stain appearance and rare association with pathology . despite this
, our analysis indicates that the system has met its second objective of ensuring around - the - clock laboratory reporting of potential bioterrorism events , given that many gpr reports were made by telephone outside office hours .
however , during a repeat anthrax attack , the distinct epidemiology of clostridial sepsis could help differentiate clostridial sepsis from inhalational anthrax among persons who are critically ill with a gpr sepsis .
predominately grow in anaerobic culture bottles , and clostridial sepsis usually affects elderly persons with abdominal conditions , malignancy , or immune suppression ( 11,12 ) .
notably , recent clostridial sepsis outbreaks involving contaminated tissue transplants and illicit drugs have an epidemiology different from this baseline , in which illness predominately affects persons < 50 years of age ( 1315 ) .
an ongoing challenge to this surveillance approach is that no precise clinical algorithm exists for how to readily identify whether a bacterium isolated from blood culture is from culture contamination .
are now required to report by telephone any blood or csf specimen with growth of gprs within 32 hours of inoculation .
growth after 32 hours is no longer reportable , to reduce reporting of culture contaminants without significantly sacrificing sensitivity to detect anthrax or clostridial infections .
immediate clinical follow - up is conducted on isolates most likely to be sentinel events : aerobic bottle isolates ( possible anthrax event ) and anaerobic isolates in patients < 50 years of age ( unusual clostridium event ) .
the earliest possible knowledge of an anthrax attack could minimize illness and death by allowing more lead time for intervention .
connecticut has successfully implemented a laboratory - based system that allows for early detection of even a single case of inhalational anthrax . | connecticut established telephone - based gram - positive rod ( gpr ) reporting primarily to detect inhalational anthrax cases more quickly . from march to december 2003 , annualized incidence of blood isolates was 21.3/100,000 persons ; reports included 293 corynebacterium spp . , 193 bacillus spp . , 73 clostridium spp . , 26 lactobacillus spp . , and 49 other genera .
around - the - clock gpr reporting has described gpr epidemiology and enhanced rapid communication with clinical laboratories . |
animals : this study used client - owned 96 dogs that met the following
criteria : suffering from spinal cord compression located between t3 and l3 vertebral
articulation for duration of more than 6 hr and less than 4 days of neurologic dysfunction
prior to mri and disk extrusion confirmed by mri and/or decompressive surgery . all dogs with
thoracolumbar hansen type
i ivdh were admitted to kyoto animal referral medical center
( kyoto ar ) between november 2010 and august 2012 .
age , sex , breed , duration of clinical
signs and treatment history before admission were recorded for all dogs .
neurological
dysfunction was classified into five categories at admission as previously reported with
some modifications : grade i , spinal
hyperesthesia only ; grade ii , ambulatory paraparesis ; grade iii , non - ambulatory paraparesis ;
grade iv , paralysis of the hind limb with intact deep pain sensation ; grade v , paralysis of
the hind limb without deep pain sensation .
serum sample collection ; pnf - h measurement : approximately 1
ml of serum samples were obtained prior to anesthesia for each mri .
peripheral blood was collected into a microsample tube ( fuji plain tube , fujifilm medical
co. , ltd . ,
pnf - h was
measured using a commercial elisa kit ( elisa kit for neurofilament subunit nf - h ver 2.1 ,
encor biotechnology inc . ,
pnf - h is reported to
have extensive cross - species immunoreactivity ;
previous data proved that this kit could detect canine pnf - h using the mouse anti - pnf - h
antibody .
mri : mri scans were performed using 0.3 t permanent magnetic equipment
( airis vento , hitachi medical systems , tokyo , japan ) . t1w spin - echo images and t2w fast
spin - echo images were obtained in the sagittal and transverse planes , respectively .
t1w
transverse ( tr 450 , te 2125 , slice thickness 3.0 mm ) , t1w sagittal ( tr 400 , te 25 , slice
thickness 3.0 mm ) , t2w transverse ( tr 3000 , te 100 , slice thickness 3.0 mm ) and t2w sagittal
( tr 3000 , te 100 , slice thickness 3.0 mm ) images were acquired .
tokyo , japan ) , t2w sagittal and transverse images were analyzed to
determine the presence of spinal cord t2w hyperintensity .
image analysis was performed
individually by two investigators ( y.n . and t.u . ) , who were blinded to clinical information .
when both investigators agreed that t2w hyperintensity was present on the sagittal mri , the
length of the hyperintensity was measured and divided by the length of the 2nd lumbar
vertebra to calculate a standardized ratio ( t2h / l2 ) as described previously .
surgical procedures : all dogs received hemilaminectomy on the same day or
a day after mri at kyoto ar or at one of seven other referral veterinary hospitals .
the length of the decompression was determined by the extent of
the dispersed disc material .
postoperative care included opioid analgesics , bladder
management , passive range of motion and physical rehabilitation .
administrations of corticosteroids and/or
nonsteroidal anti - inflammatory drugs ( nsaids ) before , at admission and during perioperative
periods were recorded .
long - term follow - up : all surviving dogs with thoracolumbar ivdh were
assessed for voluntary ambulation 12 weeks after the first admission to this study .
ambulatory status was determined by in - hospital examination or through a questionnaire sent
to referring veterinarians , which consisted of inquiries about the motor function of the
affected limb and the dog s ability to ambulate with or without assistance .
functional
outcome was considered successful , if the dog regained the ability to walk with conscious
proprioception without assistance .
dogs that regained motor function of the hind limbs but
were unable to walk without assistance were considered to have an unsuccessful outcome .
dogs
that did not regain ambulation during the follow - up period or that were died because of
progressive myelomalacia were also classified as unsuccessful outcomes .
statistical analysis : linear regression was used to assess the
associations of serum pnf - h concentration and t2h / l2 value .
receiver - operating
characteristics ( roc ) curve analysis was performed to estimate the effectiveness of serum
pnf - h concentration or t2h
the optimal cutoff value was
selected to maximize the youden index ( sensitivity + specificity 1 ) . to evaluate
prediction efficacy of concurrent examination of serum pnf - h concentration , t2h / l2 value and
deep pain sensation for unsuccessful surgical outcome
sensitivity and specificity were calculated by a cross table made from the results of
logistic regression analysis .
all analyses were performed
using commercially available software ( jmp , sas institute japan ltd . ,
since two dogs were excluded because of loss
of follow - up , 94 dogs with thoracolumbar ivdh was examined in this study .
six dogs died due
to progressive myelomalacia ; functional outcome of these dogs was considered unsuccessful
and included in the statistical analyses .
there were 25 sexually intact
females , 12 spayed females , 44 sexually intact males and 13 castrated males .
breeds included
miniature dachshund ( 81 ) , french bulldog ( 3 ) , pekingese ( 3 ) , papillon ( 2 ) , welsh corgi ( 2 ) ,
toy poodle ( 1 ) , beagle ( 1 ) and mixed breed ( 1 ) .
the median duration of neurological signs
before admission was 2 days ( range , 14 days ) .
after long - term follow - up , the functional outcomes of 74 dogs were
considered successful .
all the dogs with non - ambulatory outcome were in grade iv or v. of
the 20 dogs with non - ambulatory outcomes , 6 dogs ( all were in grade v ) died because of
progressive myelomalacia , and 14 dogs ( 4 in grade iv and 10 in grade v ) did not regain
ambulation ( table 1table1.serum pnf - h concentration and sagittal length of t2w hyperintensity within
initial neurologic grade and surgical outcomeneurologic gradeserum pnf - h
( ng / ml)t2h / l2surgical outcomenmean(sd)mean(sd)n#successunsuccesspmii121.9(1.1)0.10(0.34)11200iii202.9(4.5)0.11(0.49)12000iv382.6(3.3)0.43(0.85)143440v247.1(6.2)1.93(2.05)188106total943.5(4.3)0.71(1.38)3474146neurologic grade means neurologic grade at presentation .
t2h / l2 , sagittal length of t2w hyperintensity ( mm ) divided by 2nd lumber
vertebral body length ( mm ) .
compressive lesions were seen at 109 articulations ; t11 - 12 ( 10 ) , t12 - 13
( 19 ) , t13-l1 ( 30 ) , l1 - 2 ( 28 ) and l2 - 3 ( 22 ) . the number of compressive lesions was observed
at one ( 80 ) , two ( 13 ) or three intervertebral disc spaces ( 1 ) .
the long - term outcome was
investigated at 12 weeks after the first admission at kyoto ar ( 18/94 ) and through
questionnaires to veterinarians ( 76/94 ) .
sixty - five dogs were administered corticosteroids ,
12 were given nsaids , 2 were given both corticosteroids and nsaids , and 19 received
neither .
t2h / l2 , sagittal length of t2w hyperintensity ( mm ) divided by 2nd lumber
vertebral body length ( mm ) .
the mean serum pnf - h concentration in all dogs was 3.5 4.3
ng / ml .
serum pnf - h concentration and t2h / l2 value for
each grade at the initial neurological examination are listed in table 1 .
correlation analysis between serum pnf - h concentration and t2h / l2 value exhibited no linear
relationship ( r=0.046 , fig . 1fig .
1.correlation between serum pnf - h concentration and sagittal length of intramedullary
t2w hyperintensity ( t2h / l2 ) .
dogs with serum pnf - h < 2.4 ng / ml had
successful outcome , except for one case .
falsely diagnosed cases were in the area
( shadows ) , when serum pnf - h was used for detection of intervertebral disc herniation
alone .
linear relationship was not observed between t2h / l2 value and serum pnf - h
concentration ( r=0.046 ) . ) .
all the dogs with serum pnf - h higher than 5.9
ng / ml or t2h / l2 value higher than 3.9 had unsuccessful
outcome ; with only one exception , all dogs with serum pnf - h lower than 2.4
ng / ml had successful outcome .
correlation between serum pnf - h concentration and sagittal length of intramedullary
t2w hyperintensity ( t2h / l2 ) .
dogs with serum pnf - h < 2.4 ng / ml had
successful outcome , except for one case . falsely diagnosed cases were in the area
( shadows ) , when serum pnf - h was used for detection of intervertebral disc herniation
alone .
linear relationship was not observed between t2h / l2 value and serum pnf - h
concentration ( r=0.046 ) .
the roc curve analysis suggested that optimal serum pnf - h cutoff concentration was 2.6
ng / ml . the sensitivity and specificity for predicting
unsuccessful outcome at this value were 95% ( 95% ci ; 90.699.4% ) and 75.7% ( 95% ci ;
67.084.4 ) , respectively .
the area under the roc curve was 0.91 ( 95% ci ; 0.840.98 ) , and the
overall ability of serum pnf - h concentration to predict unsuccessful long - term outcome was
significant ( p=0.010 , fig .
2afig . 2.receiver-operating characteristic ( roc ) curve to predict unsuccessful outcome by
serum pnf - h concentration ( a ) and t2h / l2 value ( b ) .
a ) sensitivity and specificity of
serum pnf - h concentration at 2.6 ng / ml were 95% and
75.7 % , respectively .
area under the roc curve was 0.91 , and the overall ability of
serum pnf - h concentration in this analysis to predict unsuccessful long - term outcome
was significant ( p=0.010 ) .
b ) sensitivity and specificity of t2h / l2
value at 0.84 were 65 % and 86.5 % , respectively .
area under the roc curve was 0.78 ,
and the overall ability to predict unsuccessful long - term outcome was significant
( p=0.043 ) .
the sensitivity of serum pnf - h was higher than those of
t2h / l2 , although the specificity of t2h / l2 was higher than that of pnf - h . ) .
on the other hand , the sensitivity and specificity of t2h / l2 were 65% ( 95% ci ;
55.474.6% ) and 86.5% ( 95% ci ; 79.693.4% ) , respectively .
the cut - off value of t2h / l2 was
0.84 based on the roc analysis .
the area under the roc curve was 0.78 ( 95% ci ; 0.660.90 ) ,
and the overall ability of t2h / l2 to predict unsuccessful long - term outcome was also
significant ( p=0.043 , fig .
receiver - operating characteristic ( roc ) curve to predict unsuccessful outcome by
serum pnf - h concentration ( a ) and t2h / l2 value ( b ) .
a ) sensitivity and specificity of
serum pnf - h concentration at 2.6 ng / ml were 95% and
75.7 % , respectively .
area under the roc curve was 0.91 , and the overall ability of
serum pnf - h concentration in this analysis to predict unsuccessful long - term outcome
was significant ( p=0.010 ) .
b ) sensitivity and specificity of t2h / l2
value at 0.84 were 65 % and 86.5 % , respectively .
area under the roc curve was 0.78 ,
and the overall ability to predict unsuccessful long - term outcome was significant
( p=0.043 ) .
the sensitivity of serum pnf - h was higher than those of
t2h / l2 , although the specificity of t2h / l2 was higher than that of pnf - h .
an increase in serum pnf - h concentration , t2h / l2 and deep pain sensation by one unit
conferred an increase in the odds ratio ( or ) of unsuccessful outcome at long - term follow - up
( or : 2.6 , 95% ci : 1.35.2 , or : 1.9 , 95% ci : 1.13.6 and or : 2.3 , 95% ci : 0.315.5 ,
respectively ) .
in addition , serum pnf - h concentration and t2h / l2 value were significantly
correlated to long - term surgical outcome ( p=0.009 and 0.032 , respectively ) ;
however , deep pain sensation was not ( p=0.41 ) .
cross table based on
logistic regression analysis indicated that the combination of serum pnf - h concentration and
t2h / l2 value revealed a sensitivity of 90% and a specificity of 97.5% in predicting an
overall long - term unsuccessful outcome .
the results of this study exhibited that the sensitivity and specificity for predicting
long - term outcome by combination of serum pnf - h concentration and t2h / l2 value were 90% and
97.5% , respectively .
these were sufficiently reliable and showed an improvement in
specificity , compared to using each parameter separately .
the sensitivity to predict
unsuccessful surgical outcome of serum pnf - h concentration was superior to other
conventional factors , such as t2w hyperintensity alone or deep pain sensation .
however , the
specificity of t2h / l2 was superior compared with those of serum pnf - h concentration .
this
implies that prediction with serum pnf - h alone would lead to inaccurate prognosis as was
seen in a case with serum pnf - h concentration of 2.0 ng / ml
revealed unsuccessful outcome .
deep pain sensation had been used as the standard marker to predict functional
outcome , though it was not significantly associated with unsuccessful outcome in this study
based on the result of logistic regression analysis ( p=0.41 ) .
however , dogs
without deep pain sensation had increased risk of nonambulatory outcome ( or : 2.3 , 95% ci :
0.315.5 ) . the sensitivity to predict unsuccessful surgical outcome by serum pnf - h concentration was
sufficient enough , although a wide range of serum pnf - h levels , ( more than 2.4 and lower
than 5.9 ng / ml ) were obtained in this study . there has
been no report about blood pnf - h level in patients with spinal cord injury , although
increased serum pnf - h in dogs with thoracolumbar ivdh in grades iv and v has been reported
within 3 days after the onset of clinical signs .
pnf - h is thought to be released from damaged axons and then enters blood circulation
directly or through damaged barrier .
pnf - h had
an initial peak of expression at 16 hr , and the second peak at 3 days in experimentally
induced spinal cord injury in rats .
thereafter ,
pnf - h levels returned to the baseline over the following few days .
since serum samples were collected 1 to 4 days after the onset of
the clinical signs , pnf - h was released into blood circulation at a significantly high level .
decreased serum pnf - h in unsuccessful dogs
might be due to proteolysis , because proteolysis
of neurofilament in ischemic tissue has been reported . in this study ,
although t2w hyperintensity is easily examined , additional
parameters are required for accurate prediction of outcomes , because of relatively low
sensitivity of t2w for predicting poor functional outcome .
length of t2w hyperintensity has
been associated with poor functional outcome with cervical spinal cord injury in human
patients [ 8 , 18 ] and dogs with thoracolumbar ivdh [ 13 ,
15 ] .
the usefulness of such signal characteristics
on mri might be limited without histopathological information .
t2w hyperintensity includes
various pathological changes , such as edema , inflammation or hemorrhage [ 2 , 9 , 10 , 20 ] .
intraparenchymal hemorrhage has been of greater prognostic value in human patients with
spinal cord injury compared to those without hemorrhage [ 3 , 18 , 19 , 27 , 30 ] . in veterinary medicine ,
detection of intraparenchymal hemorrhage by mri has a
limitation due to the body size of the patients and relatively lower - field magnetic strength
of equipment .
t2 star weighted image is used to depict intraparenchymal hemorrhage in
various tissues and lesions ; however , t2 star
weighted images had difficulty detecting spinal cord intraparenchymal hemorrhage in dogs .
thus , t2w is the sole imaging parameter for detecting spinal cord intraparenchymal
hemorrhage in dogs at present .
the supposition was that serum pnf - h concentration and t2w hyperintensity would reflect
spinal cord injury independently , since each of them represents different histopathological
events .
our findings revealed that correlation between these two parameters was
significantly low ; however , histopathological events of dogs with increased serum pnf - h
concentration and higher t2h / l2 value might occur concurrently .
primary injury produces
intraparenchymal hemorrhage and edema , which results in expression of pnf - h .
secondary demyelination including swelling and
degeneration of myelin sheath results in continuous , and higher expression of pnf - h .
this secondary demyelination was reported to occur
in canine ivdh - associated injury . in our present
study ,
0.3 t low - field strength mri was used , and t2w imaging might have not completely
detected lesions associated with demyelination .
the sensitivities of 3 t and 1 t instruments
in detecting t2w spinal cord hyperintensity were not significantly different from a previous
study .
however , the results of our study may not
directly apply to all imaging studies , especially those obtained using higher magnetic field
units .
though serum pnf - h was measured as a prognostic biomarker in this study , human pnf - h
in cerebrospinal fluid had been studied previously .
a serum biomarker may
provide quick and simple clinical diagnosis / prognosis in animals with spinal injuries , if
this assay becomes commercially available .
in addition , repeated measurements of a serum
biomarker allow monitoring of disease progression without anesthesia . further studies using
higher field strength of mri equipment and consecutive examination of pnf - h in dogs with
spinal cord injury are needed in order to apply these combinatory measurements for accurate
prognosis . from the study reported here , a combinatory analysis of serum pnf - h concentrations and
especially , serum pnf - h concentration of
> 2.6 ng / ml and t2h / l2 value of > 0.84 can be
associated with unsuccessful long - term outcome . | the aim of this study was to evaluate the prognostic value of concurrent measurement of
serum phosphorylated neurofilament heavy subunit ( pnf - h ) concentration and intramedullary
t2w hyperintensity in paraplegic to paraplegic dogs .
our hypothesis was that concurrent
measurement of these would provide a more accurate prediction of functional outcome in
dogs with thoracolumbar intervertebral disc herniation ( ivdh ) .
a prospective case - control
clinical study was designed using 94 dogs with acute onset of thoracolumbar ivdh .
the
association of serum pnf - h concentration , t2w hyperintensity on sagittal mri ( t2h / l2 ) ,
deep pain perception and surgical outcome were evaluated with logistic regression analysis
after three months for all 94 surgically treated dogs .
sensitivity to predict
non - ambulatory outcome was compared among pnf - h and t2h / l2 and combination of both .
logistic regression analysis indicated that serum pnf - h concentration and t2h / l2 were
significantly correlated with surgical outcome ( p<0.05 ) ; however , deep
pain perception was not ( p=0.41 ) .
the results of logistic regression
analysis indicated that the odds ratios of unsuccessful long - term outcome were 2.6 for
serum pnf - h concentration , 1.9 for t2h / l2 and 2.3 for deep pain sensation .
the sensitivity
and specificity to predict non - ambulatory outcome for using serum parameter pnf - h>2.6
ng / ml , using t2h / l2 value of>0.84 and using both
serum pnf - h and t2h / l2 , were 95% and 75.7% , 65% and 86.5% , and 90.0% and 97.5% ,
respectively .
therefore , combined measurements of serum pnf - h and t2h / l2 might be useful
for predicting long - term outcome in dogs with thoracolumbar ivdh . |
the metabolic syndrome ( ms ) is defined as a cluster of metabolic alterations , which includes the following diagnostic criteria : hypertension , diabetes , insulin resistance , dyslipidemia , and obesity .
obesity , as component of ms , is considered a public health problem because of its magnitude and importance .
the accumulation of abnormal or excessive fat stored in adipose tissue is the result of a chronic imbalance between energy intake and energy expenditure [ 24 ] .
adipose tissue , which was previously regarded as a tissue with few metabolic functions and considered only as passive reservoir , is now known to be metabolically active .
several studies have suggested that obesity is associated with increased free radical concentrations , which can cause oxidative stress in the endoplasmic reticulum of the adipocyte .
an increase in oxygen consumption by mitochondria of the adipocyte leads to excess processing of free fatty acids [ 911 ] , which are produced by the hydrolysis of triglycerides in adipose tissue .
an excess of adipose tissue is also a source of inflammatory cytokines such as il-1 , il-6 , and tnf- , and obesity is considered as a chronic inflammatory state .
moreover , the mammalian cells are equipped with enzymatic antioxidant defense mechanisms among which are superoxide dismutase ( sod ) , catalase ( cat ) , glutathione peroxidase ( gpx ) enzyme , and the nonenzymatic systems such as vitamins a , c , and e , among others [ 14 , 15 ] .
the antioxidant enzymes contribute to eliminate radicals such as superoxide ( o2 ) and hydrogen peroxide ( h2o2 ) , preventing the formation of the very active species o2 and radical hydroxyl ( ho ) which are damaging to cells .
sexual dimorphism is involved in the clinical manifestations of ms and this disease tends to occur more often in postmenopausal than in premenopausal women [ 1719 ] .
additionally , increased oxidative stress after menopause is associated with loss of endogenous estrogen synthesis .
protection by female sex hormones is attributed to the well - demonstrated antioxidant properties of estrogen in vivo ; estrogen decreases the occurrence of cardiovascular diseases in postmenopausal women , and in vitro estradiol acts as a molecule with antioxidant activity decreasing lipid peroxidation in rat liver microsomes .
gpx activity in female rat liver is increased by 60% when compared to ovx female rats .
postulated that the antioxidant activity of estradiol in neuronal cells depends on the presence of the hydroxyl group ( oh ) at the c-3 position of the phenolic ring of the molecule , and another study showed that e2 can inhibit the oxidation cascades through the hydroxyl group of phenolic ring a .
cellular protection against oxidative stress has been demonstrated in neural cells , through the synergistic activity of estrogens and gsh .
other studies show that postmenopausal women have a higher incidence of abdominal adiposity , associated with an increase in systemic levels of inflammatory cytokines , which suggests that estrogen can modulate body fat and systemic inflammation .
stubbins et al . recently demonstrated that estrogen protected females against inflammation and oxidative stress when compared to males when studying intact female mice adipocytes , ovx plus estradiol mice , and males subjected to a high - fat diet for 10 weeks .
it has been demonstrated that in kidney homogenates of intact rats with ms the activity of the enzymes cat and sod was significantly increased when compared to the ms ovx group .
these results suggest that female rats are protected against the estrogen prooxidant effects in the renal system induced by the high consumption of sucrose in the diet , but the protective effect decreases after ovariectomy . on the other hand , reaven and ho developed ms in rats by the administration of high - sucrose or fructose diets , which induce hypertriglyceridemia , hypertension , hyperinsulinemia , and insulin resistance and increase intra - abdominal fat tissue . in our laboratory
we have developed a variant ms rat model by chronic administration of 30% sucrose in the drinking water for a period of 24 weeks .
excess adipose tissue generates oxidative stress and estrogens have antioxidant properties ; however , studies of the antioxidant capacity of estrogens in adipocytes are scarce . therefore , the aim of this study was to evaluate the association between estrogen removal in ms female rat model and levels of antioxidant enzymes and oxidative stress generated by obesity .
experiments in animals were approved by the laboratory animal care committee of our institution and were conducted in compliance with the guide for the care and use of laboratory animals of nih .
weanling female rats weighing 100 10 g , n = 8 per group .
the groups were control ( c ) , 30% sucrose - fed ( ms ) , ms ovariectomized ( ovx ) , and ms ovx + estradiol ( e2 ) .
the animals were housed in ad hoc plastic boxes and were subjected to 12-hour light / obscurity cycles and environmental temperature between 18 and 26c .
they were fed commercial rodent pellets ( 23% of crude protein , 4.5% of crude fat , 8% of ashes , and 2.5% of added minerals ; pmi nutrition international , inc .
, labdiet 5008 , richmond , in usa ) ad libitum . at the end of the experimental period of 24 weeks
, the rats were weighed and their blood pressure ( bp ) was measured by the tail - cuff method ; after overnight fasting , the animals were subjected to euthanasia with a guillotine and their blood was collected in vacutainer tubes .
the samples were centrifuged for 20 min at 936 g and 4c , in order to collect the serum in aliquots of 400 l and store it at 70c .
this was performed under anaesthesia ( pentobarbital sodium 63 mg / kg of body weight ) .
the abdominal and pelvic area of the back was depilated , cleaned with soap , and disinfected with ethanol .
a longitudinal incision of 1.5 cm was made , the skin was separated from the muscle , and a second incision of 0.5 cm was made in the muscle on both sides of the first , to exteriorize the ovaries .
estradiol valerate ( primogyn , schering , mexico ; 1 mg / kg body weight ) was injected i.m .
serum estradiol was measured using the diagnostic products corporation kit ( los angeles , ca ) and determination of some rat biochemical variables , such as glucose , cholesterol , triglycerides , and insulin , was determinate using commercially obtained kits .
white adipocytes were isolated by collagenase digestion as described by rodbell with the following modifications : 4 g of adipose tissue was removed and transferred into krebs buffer ( containing 2% bovine serum albumin ( bsa ) , 118 mm nacl , 24 mm nahco3 , 1.2 mm kh2po4 , 1.2 mm mgso4 , 4.7 mm kcl , 2.5 mm ca2cl , and 4.5 mm d - glucose at ph 7.35 ) .
adipose tissue pieces were minced and digested with collagenase ii ( sigma ) and at 37c for 90 min in a shaking water bath ; the fat cell suspension thus obtained was filtered through a 250 m nylon mesh and centrifuged for 1 min at 300 g. the adipocytes collected from the top phase were washed with 10 ml of krebs buffer without bsa three times , then resuspended in 900l buffer sucrose containing ( 1 mm edta , 10 mm tris and 250 mm sucrose ) and 100 l of protease inhibitors ( 1 mm pmsf , 2 mm pepstatin , 2 mm leupeptin , and 0.1% aprotinin ) and homogenized ; the sample was frozen at 30c .
the measurement of the activity of antioxidant enzymes was carried out by electrophoresis in 10% polyacrylamide native gels . to determine the activity of cat ,
the gel was washed with distilled water during 5 minutes ; this procedure was repeated three times ; then it was incubated with a mixture of 1% k3fe ( cn)6 and 1% of fecl3 6h2o for 10 minutes in the dark and then washed with distilled water to stop the reaction . to determine the activity of sod ,
the gel was washed with distilled water during 5 minutes ; this procedure was repeated three times ; then it was incubated with 2.45 mm nitro blue tetrazolium ( nbt ) for 20 minutes ; then the nbt solution was discarded and the gel was incubated in a solution of 28 mm edta , 0.028 mm riboflavin , and 36 mm phosphate buffer , ph 7.8 .
after 15 minutes of incubation in the dark , the nbt stain for o2 was developed by exposure to uv light for another 10 minutes .
the activity of enzyme gpx was measured by spectrophotometry : 1 mg of protein from the adipocyte homogenate was suspended in 1.6 ml of 50 mm phosphate buffer ( ph 7.0 ) , with added 0.2 mm nadph , 1 mm ghs , and 1 ui / ml glutathione reductase .
the mixture was incubated for 5 minutes at room temperature ; then 100 l of 0.25 mm h2o2 was added and the reading was taken immediately at 340 nm ( initial reading ) and again after 5 minutes ( final reading ) .
for the precipitation of the proteins in the samples , 100 l of 10% znso4 and 100 l of 0.5 n naoh were added to one mg of protein from the adipocyte homogenate and centrifuged at 7155 g ; the supernatant was suspended in 1.5 ml of reaction mixture ( 300 mm acetate buffer ph 3.6 , 20 mm hexahydrate of ferric chloride , 10 mm of 2 , 4 , 6 tris-2-pyridil - s - triazine dissolved in 40 mm chlorhydric acid ( hcl ) were added in a relation of 10 : 1 : 1 v / v , resp . )
tbars , a marker of damage by free radicals , was measured by a standard method . to 1 mg of protein from the adipocyte homogenate , 50 l methanol with 4% bht plus phosphate buffer ph 7.4 was added .
the mixture was shaken vigorously in a vortex for 5 seconds and then incubated in a water bath at 37c for 30 minutes .
this was followed by the addition of 1.5 ml of 0.8 m thiobarbituric acid and then incubated in a water bath at boiling temperature for 1 hour .
after this time and to stop the reaction , the samples were placed on ice ; 1 ml 5% kcl was added to each sample as well as 5 ml n - butanol ; they were shaken in a vortex for 30 seconds and centrifuged at 2000 rpm .
. then the n - butanol phase was extracted and the absorbance was measured at 532 nm .
statistical significance was determined by one - way anova test , followed by the post hoc tukey test .
the body mass , intra - abdominal fat , triglycerides , insulin , and homa index were significantly elevated in ms in comparison with c ( p < 0.001 ) , and the ms ovx increased it in comparison to ms intact ( p < 0.01 ) .
ovx+e2 rats hormonal treatment did not modify the variables in comparison with ms intact rats . there was no difference in the activity of cat in adipocyte homogenate between female c , ms intact , or ms ovx+e2 . however , a significant decrease in cat activity was observed in ms ovx when compared with ms intact ( p = 0.01 ) ( figure 1 ) .
the treatment with estradiol induced a significant increase in ms ovx+e2 versus ms ovx ( p = 0.05 ) .
there were no differences in mn sod activity except between ms intact and ms ovx , the latter being reduced ( p = 0.05 ) ( figure 2 ) , but treatment with estradiol significantly increased it in ms ovx+e2 versus ms ovx ( p = 0.05 ) . figure 3 shows the cu - zn sod activity . there were no significant differences between groups
however , a significant decrease in this enzyme activity was observed in ms ovx when compared with ms intact ( p = 0.03 ) ( figure 1 ) .
the treatment with estradiol induced a significant increase in ms ovx+e2 versus ms ovx ( p = 0.01 ) .
figure 4 shows the activity of the gpx enzyme in c and ms intact groups ; there are no significant changes ; however , the ms ovx group showed lower activity than the ms intact rat group ( p = 0.04 ) .
the treatment with estradiol in ms ovx+e2 rats group tended to increase the activity but the change was not statistically significant .
the lipid peroxidation index in adipocyte homogenates showed no changes between c and ms intact .
ovariectomy increased lipid peroxidation in the ms group in comparison to ms intact and ms ovx+e2 rats groups ( p < 0.001 ) .
the hormonal treatment did not produce significant changes in ms ovx+e2 when compared to ms intact group ( figure 5 ) .
figure 6 shows that there were no statistically significant changes in the antioxidant capacity of the nonenzymatic system in the c and ms intact group but ovariectomy decreased the antioxidant capacity in the ms ovx group versus ms intact group ( p = 0.01 ) . in the ms ovx+e2 group
there were significant increases in the antioxidant capacity of the nonenzymatic system in comparison with ms ovx ( p = 0.04 ) .
obesity is a component of ms and is the consequence result of a positive energy balance resulting from the interaction of several factors , including feeding , reduced physical activity , and genetic components .
there is enough literature showing that in diseased states , such as ms and obesity , there is increased systemic oxidative stress [ 3234 ] .
moreover , the reduction of the synthesis endogenous estrogen is associated with the onset of ms development .
the aim of this study was to evaluate the association between estrogen removal and antioxidant enzymes and oxidative stress generated by obesity in a ms female rat model .
the results showed that body weight in the ms group was significantly higher than in the c group ; however , the group with the highest increase in weight was the ms ovx group ; these results are similar to those obtained by stubbins et al . who showed that after 10 weeks of consuming high - fat diet male mice had significantly higher body weight than intact female mice .
ovx females show similar changes to male mice with respect to changes in body weight , but when supplemented with estradiol , changes in body weight were minimal and similar to intact females .
accumulation of intra - abdominal adipose tissue is considered as a risk factor for the development of ms [ 3537 ] .
intra - abdominal fat is more expandable than subcutaneous adipose tissue ; it is metabolically active and secretes substances directly to the portal circulation such as inflammatory cytokines and free fatty acids which are associated with insulin resistance , hypertension , and cardiometabolic risk .
estrogens are important regulators of adipose tissue deposition in humans , rodents , and other species .
our results show that ms ovx group had a higher amount of intra - abdominal fat when compared to ms intact and ms ovx+e2 groups .
these results suggest that intra - abdominal fat increases in the ms ovx group and this is probably due to the absence of estradiol . in premenopausal women
it has been reported that fat tissue is located primarily in subcutaneous deposits ; however , at menopause , there is redistribution to visceral adiposity , which is sensitive to estrogen therapy .
it has been described that the intra - abdominal adipose tissue expresses and receptors but that receptor expression is predominant ; meyer et al .
likewise , brown et al . mention that estrogens can regulate energy intake through direct action of estrogen receptor or through indirect action decreasing orexigenic peptides ; therefore the absence of estrogens may promote hyperphagia , although some authors report that ovariectomy is not necessarily accompanied by increased food intake .
another study , in a female mice model subjected to ovariectomy and in which there was no decrease in energy expenditure or concomitant changes in energy intake and adipocyte hypertrophy , showed that ovx female mice replaced with estradiol were protected from adipocyte hypertrophy .
estrogen may directly inhibit the deposition of adipose tissue by reducing lipogenesis through decreased mrna , activity , and expression of lipoprotein lipase , an enzyme that regulates the storage of triglycerides in the adipocytes .
it has been described that ovariectomy can increase the activity of lipoprotein lipase and lipid deposition in adipocytes , but the administration of physiological estrogen doses reverses this condition .
our results show that the ms ovx rats had increased body weight and intra - abdominal adipose tissue when compared to the ms intact and ms ovx+e2 rats .
in addition , estrogens may also affect lipid deposition through the hormone - sensitive lipase and increased fatty acid oxidation , diminishing the likelihood of lipotoxicity .
it has been reported that in postmenopausal women the adipocyte hypertrophy and lipolytic activity are high , which may explain why postmenopausal women show high levels systemic of ffa [ 26 , 42 ] .
the ms ovx group showed a significant increase in sbp when compared to the other groups .
this result is consistent with basic and clinical research , in which it was demonstrated that the sbp is elevated in premenopausal women compared to postmenopausal women [ 43 , 44 ] .
in addition , it is known that nitric oxide , a potent vasodilator , participates in the regulation of sbp ; nitric oxide metabolism is better preserved in females than in males , partly as a result of the action of estrogen .
the results show that , in the c groups and ms and ms ovx+e2 groups , sbp was decreased when compared to ms ovx group .
another study showed that estradiol replacement in ms ovx female rats with ms is associated with an increased activity of nitric oxide synthase , endothelium - dependent vasodilation , and decreased blood pressure .
diets high in carbohydrates , such as fructose , sucrose , or both , induce hypertriglyceridemia and reduction in antioxidant reserves .
the results show that triglycerides are increased in ms groups and decreased when compared to the c group and are similar to those obtained by pettersson et al . who induced ms in female rats by administering a high - fat diet ( 60% ) over a period of 14 weeks and found a significant increase in triglycerides when compared to the c group .
another study showed that hypertriglyceridemia , resulting from the intake of high carbohydrate diet in rats , was associated with hyperinsulinemia , increased sbp , and insulin resistance .
moreover , decreased levels of ovarian hormones associated with menopause or ovariectomy have been related to a decrease in glucose uptake by insulin .
our results show that the serum insulin levels were increased in the ms group when compared to the c group , but the group ms ovx showed the highest values ; therefore , it appears that estrogen may have protective effect against the development of hyperinsulinemia .
in addition , alterations in lipid metabolism and fat body distribution coupled with estrogen deficiency have been postulated as a causative factor contributing to the increased prevalence of insulin resistance in postmenopausal when compared to premenopausal women .
furthermore , as previously mentioned , the ms ovx group was the one that had the highest rate of insulin resistance when compared to the ms ovx+e2 .
saglam et al . showed that hormone replacement therapy increased insulin peripheral action in postmenopausal women , and , in another study , abbas and elsamanoudy found that estrogen exerted effects upon insulin resistance ; these authors found that the estrogen administration in ovx rats significantly decreased the plasma glucose , insulin concentration , and homa index when compared with c .
insulin binding to its receptors on the cell membrane is required to cause the hormonal actions .
therefore , the structure and functional integrity of the cell membrane influence the properties of the insulin receptor .
cell membrane properties , particularly its fluidity , depend upon the fatty acid composition . in hyperinsulinemic states , increased saturated fatty acids lead to a decrease in the affinity and number of insulin receptors , which may cause insulin resistance associated with hyperinsulinemia .
evidence suggests that estrogen can increase the action of insulin in adipocytes via activation of transcription factors ( protein-1 activator than response to camp ) which are orchestrated by insulin [ 35 , 48 ] .
moreover , a high concentration of h2o2 ( 100 m ) decreases insulin receptor affinity .
our results show that lipoperoxidation index in ms ovx group was higher when compared to the other experimental groups ; this suggests that the elimination of estradiol through ovariectomy increases reactive oxygen species that can oxidize polyunsaturated fatty acids of cell membrane favoring insulin resistance and oxidative stress .
leptin , an adipokine secreted by adipose tissue , is directly proportional to the fat content .
the results show that the ovariectomy reduces serum leptin concentration in comparison to ms intact female rats and this was restored by estradiol replacement .
these results suggest that estradiol may modulate leptin secreted by adipocytes . to support the above
, it has been described that leptin levels are increased in women when compared to men , partly as result of inhibition of androgen and estrogen stimulation .
leptin action is mediated via a specific receptor ob - rb , located mainly in the hypothalamus ; estrogen may modulate the catabolic action of leptin in the brain and it has been described that estrogens are associated with increased leptin sensitivity . a study by alonso et al . demonstrated that estradiol can directly modulate the expression of ob - rb receptor in adipose tissue and skeletal muscle .
another study in ovx rats demonstrated that leptin mrna expression in adipose tissue was associated with decreased plasma leptin concentration when compared to rats treated with estradiol .
the mechanism responsible for the effect of estrogen on leptin concentrations in plasma remains unclear , but it is postulated that estrogen may have a direct action on the leptin gene in the adipocytes .
investigations on the differences in gender related antioxidant reserves include studies in humans and in several animal species in both normal populations and pathological conditions and different organs .
several studies indicate that females have higher antioxidant potential , given by the enzymatic and nonenzymatic activity .
in addition , the activity of the antioxidant enzymes sod , cat , and gpx plays an important role in obesity associated with ms .
the results show that the activity of the cu - zn sod in the ms ovx group was significantly decreased when compared to the ms intact and ms ovx+e2 group ; concerning the activity of mn sod , the results showed the same tendency .
it has been described that estrogens may regulate the nuclear transcription factor , nrf-2 pathway , which controls the expression and induction of genes that are encoded for phase ii antioxidant enzymes , including sod isoforms . moreover ,
our results are similar to those of a study conducted by kumar et al . ,
in which the antioxidant effect of estradiol in liver fractions of rat females of 3 , 12 , and 24 months of age was evaluated which showed that the treatment with estrogens normalized the decrease of the sod activity induced by aging and menopause .
another study in kidney homogenate of ms female rat , which evaluated the activity of the cu - zn and mn sod , with estradiol replacement , showed an increase in the activity of these enzymes in the control rats in comparison to ms rats ; the activity decreased after ovariectomy and treatment with e2 restored it .
furthermore , baos et al . showed that sod activity in the heart of ms male rats was decreased while oxidative stress was increased but these changes were not present in female rats .
busserolles et al . demonstrated that the sod activity was decreased in the heart of male rats that were fed with sucrose for two weeks , when compared to female rats .
moreover , it has been shown that fructose or sucrose may inactivate cat in vitro .
however , our results on cat activity in adipocyte homogenates showed no significant changes between c , ms , and ms ovx+e2 groups but showed significant difference when comparing the ms intact and ovx+e2 group with the ms ovx group .
these results are similar to those of other studies which showed significant decrease in cat activity in the ms ovx female rats when compared to ms female intact and replaced with estradiol .
furthermore , pajovi and saici mention that females had lower oxidative stress in the brain and increased activity of cat in comparison with males . regarding the activity of gpx ,
the results show that the control group showed no significant difference when compared to the ms group , but there was significant decrease in the activity of this enzyme in the ms ovx group compared to ms intact group .
demonstrated in murine skeletal muscle that genes encoded for type 3 gpx expressions are sensitive to estradiol and regulated via receptors .
in addition , another study showed that the activity of gpx was significantly increased in premenopausal women and it decreased after menopause .
however , another study showed no significant difference in the activity of this enzyme in the brain of male and female mice , while in the liver the enzyme activity was significantly higher in females than in males . supporting the above , in vitro studies
have shown that damage induced in myocardial cells by free radicals was stopped by nuclear translocation of nrf-2 and that this effect was promoted by pretreatment with estrogen , since it controls and induces expression of genes encoded for gpx .
likewise , other investigations have shown synergistic interaction between estrogens and gsh in neuronal protection against oxidative stress .
the nonenzymatic antioxidant capacity in adipocyte homogenates showed no significant differences when comparing the c group with the ms group , but the ms ovx group showed a significant decrease in comparison with ms intact and ms ovx+e2 .
this result suggests that the e2 have antioxidant properties that allow the increase in nonenzymatic antioxidant capacity in the adipocytes of the ms rats .
another study , which determined the protection of estradiol upon oxidative stress in visceral tissue in a murine model subjected to high - fat diet , showed that male mice and ovx females have a significant increase in h2ax , a biomarker for oxidative stress , in adipocyte core compared to intact and ovx females with estradiol replacement .
the researchers concluded that estradiol may protect from the development of oxidative stress in adipose tissue . with respect to lipid peroxidation
, the results show no significant difference in the c group compared to the ms groups , but in the ms ovx group there was a significant increase when compared to ms and ms ovx+e2 group , which had similar lipoperoxidation values .
moreover , a study conducted by taskiran and evren demonstrated that h2o2 induced lipid peroxidation in cell cultures of adipose tissue and that it was attenuated with pretreatment with different concentrations of estradiol ; the maximum effect was observed at 10 nm .
demonstrated that oxidative stress damage , measured by the concentrations of 4-hydroxynonenal , a waste product of the oxidation of lipids , was significantly increased in postmenopausal women when compared to premenopausal women , which suggest that estrogen may protect against lipid peroxidation .
the effect of estrogen decreasing the rate of lipid peroxidation can be explained by the key structure of the phenolic ring of estradiol which renders the molecule with antioxidant protection .
proposed that cell membranes are one of the primary targets of the antioxidant effects of estrogen .
antioxidant actions of estrogens on cell membranes are independent of estrogen receptor and the phenolic ring structure may play an important role in this effect . in addition , another study postulated that the antioxidant capacity of e2 in neuronal cells depends on the presence of the hydroxyl group at the c-3 position of the phenolic ring of the molecule .
this mechanism has also been previously demonstrated by jellinck and bradlow who postulated that e2 could inhibit oxidative cascades through the hydroxyl group of the a phenolic ring [ 25 , 64 ] .
in conclusion , the results suggest that removal of e2 by ovariectomy decreases the activity of the antioxidant enzymes in the intra - abdominal tissue of ms female rats ; this is reflected in increased lipid peroxidation and decreased nonenzymatic antioxidant capacity .
replacement with e2 can protect ms female rats from increases in body weight , intra - abdominal fat accumulation , and hypertension .
the oxidative stress and obesity present in ms ovariectomized female rats may be attenuated by hormonal replacement therapy ; however , more studies are still needed on the antioxidant capacity of e2 in metabolic syndrome . | the aim of this study was to evaluate the association between estrogen removal , antioxidant enzymes , and oxidative stress generated by obesity in a ms female rat model .
thirty two female wistar rats were divided into 4 groups : control ( c ) , ms , ms ovariectomized ( ovx ) , and ms ovx plus estradiol ( e2 ) .
ms was induced by administering 30% sucrose to drinking water for 24 weeks .
after sacrifice , intra - abdominal fat was dissected ; adipocytes were isolated and lipid peroxidation , non - enzymatic antioxidant capacity , and the activities of cu - zn and mn superoxide dismutase ( sod ) , catalase ( cat ) , and glutathione peroxidase ( gpx ) were determined .
there were no significant differences in the activities of cu - zn , mn sod , cat , and gpx between the c and ms groups , but in the ms ovx group there was a statistically significant decrease in the activities of these enzymes when compared to ms and ms ovx+e2 .
the increased lipid peroxidation and nonenzymatic antioxidant capacity found in ms ovx was significantly decreased when compared to ms and ms ovx+e2 . in conclusion
, the removal of e2 by ovariectomy decreases the activity of the antioxidant enzymes in the intra - abdominal tissue of ms female rats ; this is reflected by increased lipid peroxidation and decreased nonenzymatic antioxidant capacity . |
cryoglobulins are special serum immunoglobulin 's that usually precipitate at a temperature between 0c and 4c and dissolve when re - warmed to 37c .
this in vitro phenomenon can be observed in a wide spectrum of infectious diseases , autoimmune disorders and with hematological malignancies .
both type i and type ii are associated with lymphoproliferative disorders . during the winters in the north india temperature
such cold weather is likely to produce cold - induced symptoms in patients with cryoglobulinemia .
as very low temperature is unusual in indian subcontinent , cases of cryoglobulinemia are usually remains symptomless and hence undetected .
we encountered an interesting case of cryoglobulinemia in a 68-year - old - male who presented with cryoglobulinemic manifestations for the last 18 months .
a 68-year - old male patient who was chronic alcoholic presented with complain of headache on and off for the last 18 months before presenting to us in september 2011 .
, there was hepatomegaly ( 3 cm below costal margin ) and splenomegaly ( 2 cm below costal margin ) however no palpable lymph nodes are noted . in the past history
however , he was not able to get any report since his sample clotted soon after sampling .
although , phlebotomist had taken the venous blood sample but it clots itself even in the presence of anticoagulants .
following this , patient was called on the next day and sampling was done by maintaining the whole set up temperature at 37c and above .
serological investigations for hepatitis b virus , hepatitis c virus , and human immunodeficiency virus infection were performed to exclude any viral infection and no associated infective etiology was found .
serum sample for detection of antibodies ( rheumatoid factor , antinuclear antibodies , smooth muscle antibody , anti - mitochondrial antibody ) for any underlying autoimmune disorder was sent for however all the tests came negative .
the hemogram showed bicytopenia with hemoglobin of 3.9/dl and total leucocyte count of 2.9 10/l .
the marrow was cellular and clotted ; however showed the presence of homogenous pale pink background due to the presence of cryoglobulins [ figure 1b ] .
differential nucleated cell count showed extensive increase in lymphocytes ( 73% ) along with plasma cells ( 8% ) [ figure 1c ] .
the sinusoids were dilated and are filled with pale eosinophillic material ( cryoglobulins ) [ figure 1d ] .
immunophenotying was performed on bone marrow sample and that showed expression of cd19 , cd79b along with heterogeneous expression of cd23 [ figure 2 ] .
serum protein electrophoresis showed the presence of sharp m band in the gamma region , hence proving monoclonality of disease .
on the basis of peripheral blood , bone marrow and flowcytometry findings a diagnosis of lymphoplasmacytic lymphoma was made .
the patient was started on prednisolone 1 mg / kg / day and was asked to report weekly .
the patient is now in follow - up and show improvement in their symptoms and easy sampling of blood .
peripheral blood shows rouleaux formation ( mgg - giemsa , 400 ) ( a ) . bone marrow aspirate shows presence of pink homogenous material due to cryoglobulins ( mgg - giemsa , 200 ) ( b ) .
high power view demonstrates increase in numbers of lymphocytes and plasma cells ( mgg - giemsa , 1000 ) ( c ) . dilated sinusoids filled with pale eosinophillic material are seen on trephine biopsy section ( h and e , 100 ) ( d ) panel of scatter plots showing the multicolor immunophenotyping of bone marrow aspirate sample by flow cytometry .
the gating of cells in each tube has been done on side scatter - a ( ssc - a ) versus forward scatter - a ( fsc - a ) ( a ) .
the cell is lymphoid region p1 were subsequently gated in ssc - a versus cd19 plot with the gated p2 population showing surface cd19 expression ( b ) .
the gated cells show heterogeneous expression of cd23 along with homogeneous expression of cd79b ( c and d )
cryoglobulins are proteins that can precipitate at low temperatures ( < 4c ) and dissolve when re - warmed to 37c .
the cryoglobulin can be defined on the basis of its composition : polyclonal or monoclonal immunoglobulins ; or the presence of rheumatoid activity ( ra ) .
three types of cryoglobulinemia have been identified namely : type i includes monoclonal cryoglobulins ( igm , igg and iga ) without any ra ; type ii includes a monoclonal component ( usually igm with ra ) and a polyclonal component ( usually igm / igg ) ; type iii have several polyclonal components and a component with ra ( usually igg / igm ) .
type ii and type iii are classically referred to as mixed cryoglobulinemia . in general , cryoglobulinemia regardless of their type are associated with skin manifestations , but may also cause rheumatologic symptoms that involve the kidneys , the peripheral nerves or central nervous system , the lungs , the myocardium and the gastrointestinal tract . interesting
type i cryoglobulinemia is associated with low grade lymphoproliferative disorders such as multiple myeloma , waldenstrom macroglobulinemia , chronic lymphatic leukemia and account for 10 - 15% of all cases of cryoglobulinemia .
type ii cryoglobulinemia is associated not only with lymphoproliferative diseases but also with autoimmune disorders and infective etiologies especially hepatitis .
this case is also having lymphoplasmacytic lymphoma and hence can be categorized in to type i cryoglobulinemia . in tropical and subtropical countries like india where the winter is either nonexistent or very brief , most of the patient with cryoglobulinemia did not show any symptoms and remain undetected . in this case ,
difficulty in processing of sample raises the suspicion of disease which was confirmed by bone marrow examination and by exclusion of other autoimmune etiology along with infective pathology .
the diagnosis of lymphoplasmacytic lymphoma on bone marrow aspiration solves the underlying pathogenesis of the cryoglobulinemia .
we presented a case of cryoglobulinemia which is very rare in indian subcontinent and was suspected due to the problem in sampling and processing of the blood . | cryoglobulinemias rarely been reported from india even though associated conditions such as hepatitis c infection , rheumatoid arthritis and plasma cell dyscrasias , etc .
, are common occurrences . in many regions of the country , temperatures in winter
can be conducive to the precipitation of cryoglobulins , yet epidemiology of the disease suggests that it is a common condition in the west . we encountered a 68-year - old - male patient who presented with a history of headache off and on along with hepatosplenomegaly .
the rare occurrence of cryoglobulinemia in our setting can delay the diagnosis , as happened in our case , since the index of suspicion of clinicians and laboratory personnel is low .
we are reporting this case because of the rarity and protean clinical manifestations of cryoglobulinemia . |
the organophosphate poisons ( opps ) , i.e. , herbicides and pesticides , are chemical compounds that are hazardous to environment ( 1 ) .
increased population followed by increased demands for food , especially agricultural products , has pushed farmers to increase their products , and this has led to the greater use of pesticides and poisons ( 2 ) .
opps can enter the human body through skin and mucous membranes , such as eyes , mouth , or by inhaling the poison while it is being sprayed .
generally , opps have high toxicity and induce many negative effects on different organs ( 3 ) .
they can cause many complications , including nausea , dizziness , dyspnea , and urticaria ( 4 ) .
the human organs and systems that can be affected by opps are the liver , kidneys , pancreas , heart , immune system , and vascular walls ( 57 ) .
studies have shown the destructive effects of opps on the endocrine and reproductive systems of animals ( 8) .
one of the effects of these pesticides is that they produce free radicals , which consequently change cell antioxidant systems and induce membrane lipid peroxidation ( 9 ) . in the human body
, there are two types of cholinesterase enzyme ; one is the real cholinesterase ( acetyl - cholinesterase ) , which is in the red blood cells , neural systems , and muscular systems .
the other type is pseudo - cholinesterase , which has a structure similar to that of acetyl - cholinesterase and is in serum , the pancreas , the liver , the brain , and in heart cells ( 1012 ) .
opps inhibit the activity of both types of cholinesterase , causing the accumulation of acetylcholine neurotransmitter in the sympathetic and parasympathetic fibers and in muscles neural connections . as a consequence ,
this accumulation disrupts the transportation of messages through the cholinergic synapses ( 4 , 13 ) .
decreased serum cholinesterase activity ( pche ) is a sign of acute intoxication , and decreased acetylcholinesterase ( ache ) in erythrocytes indicates chronic intoxication ( 14 ) .
malathion is one of the most important and most used opps in world , including iran .
malathion ( diethyl methoxy thio phosphine thio succinate ) is a parasympatholytic organophosphadate poison , which makes an irreversible bond / link with cholinesterase ( 15 ) . after being absorbed into the body , malathion is converted to malaoxon and oxygen analogs by the metabolism , and malaoxon is 61 times more toxic than malathion ( 16 ) .
the mechanism of induced oxidative stress by malathion is producing free radicals including reactive oxygen species ( ross ) .
oxidative stress harms many macromolecules by starting destructive processes , including lipid peroxidation , dna oxidation , protein oxidation , inactivation of enzymes , and causing dysfunction in different membranes ( 18 ) .
most of insecticides have hydrophobic molecules that readily attach to biological membranes , especially to the two phospholipid layers of membranes , which causes membrane lipid peroxidation ( 13 ) .
one of the ways of dealing with opp intoxication is by using antioxidants , which prevent excessive production of toxic free radicals and the damage they induce .
vitamin c or ascorbic acid is a known antioxidant that seems necessary in many processes in the body , including forming bones and and repairing tissue scars ( 19 ) .
vitamin c decreases oxidative stress and lipid peroxidation , thereby preventing many damaging processes in cells ( 20 ) .
since malathion is one of the most commonly used opps and it inhibits cholinesterase activity , our aim in this study was to determine the toxic effects of malathion on serum and erythrocyte cholinesterase activity in male rats .
this was an experimental study performed in pharmacology laboratory of pharmacy faculty and in advanced histology techniques laboratory of medical faculty of mashhad university of medical sciences ( mums ) in january 2014 .
the study s sample size was calculated based on a formula and previous studies ( 11 , 13 ) .
the study population consisted of 30 two - month - old vistar rats that weighed between 200 and 250 grams .
the groups exposures were as follows : experimental group 1 : daily administration of 50 mg / kg of malathion in normal saline solution experimental group 2 : daily administration of 200 mg / kg of vitamin c experimental group 3 : daily administration of 50 mg / kg of malathion and 200 mg / kg of vitamin c sham group : administration of 50 mg / kg of normal saline control group : received nothing ( 21 , 22 ) .
exposure to malathion , vitamin c , and normal saline ( product of sigma company ) were by intra - peritoneal injection ( 23 ) .
after six weeks of daily exposure , the levels of acetylcholinesterase in erythrocyte and serum were measured .
malathion 99% was purchased from ariashimi company and stock solution with a concentration of 50 mg / ml in normal saline was prepared as needed . to measure erythrocyte cholinesterase ,
the rats were anesthetized with intra - peritoneal injection of 0.1 ml/100 g ( 24 ) .
half of the blood sample was centrifuged and then 3 ml of reactant dtnb ( dithiobis nitrobenzoic acid ) and 100 ml of the substrate solution ( acetyl thio colin idone ) were added to a glass tube , and the tube was placed in a water bath at 37 c for 10 seconds .
then , 100 l of the hemolysis solution were added , and the glass tube remained in the water bath at 37 c for 10 more minutes , after which 1 ml of reactant stopper was added to it .
the contents of the tube were stirred , and the tube was removed from the water bath .
the blank samples were prepared with this same method with the exception that , in the last step after adding reactant stopper , 100 l of hemolysis solution were added to each tube that was taken out of the water bath . since each hemolyzed sample had its own absorption characteristics , one separate blank was prepared independently for use in determining the enzyme activity in each sample , and each sample s absorption in front in of its blank was read immediately at the wavelength of 440 nm .
this process was repeated three times for each hemolyzed sample , and their mean was calculated .
the element method was used to measure the inhibition of acetyl - cholinesterase enzyme in erythrocyte ( 51 ) , and serum cholinesterase was measured with titrometery . in this method , the main solution was acetylcholine chloride , and 0.5 ml of serum was added to 10 ml of the acetylcholine chloride .
then , two drops of trizol reagent ( a ph indicator that is yellow in acidic condition and purple in alkaline condition ) were added and mixed .
also , 5 cm3 of 10% acetic acid were added to the acetylcholine chloride to enhance its stability .
the collected results were entered into and analyzed by spss version 16 ( spss inc . , chicago , illinois , usa ) .
the statistical analysis of erythrocyte cholinesterase was made by anova , and the means were compared by the tukey - kramer test . since serum cholinesterase data were reported as percentages , the mann - whiney test was used to compare the means between the groups , and p - values < 0.05 were considered to be significant .
this was an experimental study performed in pharmacology laboratory of pharmacy faculty and in advanced histology techniques laboratory of medical faculty of mashhad university of medical sciences ( mums ) in january 2014 .
the study s sample size was calculated based on a formula and previous studies ( 11 , 13 ) .
the study population consisted of 30 two - month - old vistar rats that weighed between 200 and 250 grams .
the groups exposures were as follows : experimental group 1 : daily administration of 50 mg / kg of malathion in normal saline solution experimental group 2 : daily administration of 200 mg / kg of vitamin c experimental group 3 : daily administration of 50 mg / kg of malathion and 200 mg / kg of vitamin c sham group : administration of 50 mg / kg of normal saline control group : received nothing ( 21 , 22 ) .
exposure to malathion , vitamin c , and normal saline ( product of sigma company ) were by intra - peritoneal injection ( 23 ) .
after six weeks of daily exposure , the levels of acetylcholinesterase in erythrocyte and serum were measured .
malathion 99% was purchased from ariashimi company and stock solution with a concentration of 50 mg / ml in normal saline was prepared as needed . to measure erythrocyte cholinesterase ,
the rats were anesthetized with intra - peritoneal injection of 0.1 ml/100 g ( 24 ) .
half of the blood sample was centrifuged and then 3 ml of reactant dtnb ( dithiobis nitrobenzoic acid ) and 100 ml of the substrate solution ( acetyl thio colin idone ) were added to a glass tube , and the tube was placed in a water bath at 37 c for 10 seconds .
then , 100 l of the hemolysis solution were added , and the glass tube remained in the water bath at 37 c for 10 more minutes , after which 1 ml of reactant stopper was added to it .
the contents of the tube were stirred , and the tube was removed from the water bath .
the blank samples were prepared with this same method with the exception that , in the last step after adding reactant stopper , 100 l of hemolysis solution were added to each tube that was taken out of the water bath . since each hemolyzed sample had its own absorption characteristics , one separate blank was prepared independently for use in determining the enzyme activity in each sample , and each sample s absorption in front in of its blank was read immediately at the wavelength of 440 nm .
this process was repeated three times for each hemolyzed sample , and their mean was calculated .
the element method was used to measure the inhibition of acetyl - cholinesterase enzyme in erythrocyte ( 51 ) , and serum cholinesterase was measured with titrometery . in this method , the main solution was acetylcholine chloride , and 0.5 ml of serum was added to 10 ml of the acetylcholine chloride .
then , two drops of trizol reagent ( a ph indicator that is yellow in acidic condition and purple in alkaline condition ) were added and mixed .
also , 5 cm3 of 10% acetic acid were added to the acetylcholine chloride to enhance its stability .
the collected results were entered into and analyzed by spss version 16 ( spss inc . ,
the statistical analysis of erythrocyte cholinesterase was made by anova , and the means were compared by the tukey - kramer test . since serum cholinesterase data were reported as percentages , the mann - whiney test was used to compare the means between the groups , and p - values < 0.05 were considered to be significant .
the mean of serum cholinesterase activity was 26.66 2.88 , 24 4.18 , and 29.16 4.91 in the control , normal saline , and vitamin c groups .
these means in the malathion and malathion + vitamin c groups were 12 2.73 and 18 4.47 , respectively .
the results indicated that the activity of serum cholinesterase in the malathion group was significantly decreased compared to the other groups .
the differences between the means for the control group , normal saline group , and vitamin c groups and the mean of the malathion group were significant ( p - value < 0.001 for all three comparisons ) ( table 1 ) .
the mean of erythrocyte cholinesterase activities in the control , normal saline , and vitamin c groups were 3.33 0.28 , 2.72 0.42 , and 2.8 0.43 .
these means in the malathion and the malathion + vitamin c groups were 1.29 0.17 and 2.04 0.18 , respectively .
the comparison of mean erythrocyte cholinesterase activities in the control , normal saline , vitamin c and malathion + vitamin c groups with the malathion group showed significant differences ( p < 0.0001 for the first three groups and p = 0.002 for the last group ) ( table 2 ) .
regarding the protective effects of vitamin c , the comparison of mean and standard deviation of both serum and erythrocyte cholinesterase activity between the control group and the group that received only vitamin c showed that enzyme activity was significantly improved by the administration of vitamin c ( p = 0.03 for both comparisons ) .
our results also showed that the mean of serum cholinesterase activity in the rats that received malathion + vitamin c was not significantly different from the control group ( p = 0.009 ) , while the difference between the group that was exposed only to malathion and the control group was significant ( p < 0.0001 ) .
the differences between the mean of erythrocyte cholinesterase activity in the control group and the malathion and the malathion + vitamin c groups also were significant ( p < 0.0001 for both ) .
this study aimed to evaluate the activity level of serum and erythrocyte cholinesterase in male rats exposed to malathion and vitamin c. our results showed that the activity of both serum and erythrocyte cholinesterase significantly decreased in rats exposed to malathion compared with control group ( p < 0.0001 ) .
the administration of vitamin c alone significantly increased serum and erythrocyte cholinesterase activity in comparison with control group ( p < 0.03 ) .
the difference between serum cholinesterase activity in the rats that received malathion + vitamin c and the control group was not significant ( p = 0.09 ) , however the difference between mean of erythrocyte cholinesterase activity was significant ( p < 0.0001 ) .
these findings indicated that vitamin c had a protective effect on serum cholinesterase activity but not on erythrocyte cholinesterase activity .
the results of this study showed that serum and erythrocyte cholinesterase activities in the group exposed to malathion were significantly less than the control group ( p < 0.001 ) , which were similar to the results of other studies .
these findings confirmed the results of inbaraj et al.s study that was performed on fish exposed to malathion ( 25 ) .
the results of ansari et al.s study on fish and abdollahi et al.s study on rats also demonstrated the decrease in acetylcholinesterase activity upon exposure to opps , especially malathion ( 26 , 27 ) .
another study that evaluated the effects of three opps ( malathion , diazinon , and parathion ) on wildfowl eggs showed that all of these opps can significantly decrease the activity of fetal plasma cholinesterase ( 28 ) .
the results of all of these studies indicated the intoxication of live animals by opps , especially malathion .
since opps are very commonly used poisons worldwide , intoxication by them seems inevitable , therefore attention is now being focused on determining ways to reduce their intoxication .
the studies results have shown that vitamin c can reduce the production of free radicals produced by oxidative stress ( 13 ) . in our study ,
one group of rats received vitamin c and malathion , and the results illustrated a significant increase in serum cholinesterase compared with the group that received only malathion .
this finding was similar to the results of uzun et al.s study about malathion - induced testicular toxicity in male rats and the protective effect of vtamins c and e ( 13 ) .
their results indicated that co - treatment of rats exposed to malathion with vitamins e and c had a protective effect on sperm count , sperm motility , and abnormal sperm numbers .
kalender et al . also found that vitamins c and e can reduce malathion hepatotoxicity ( 29 ) .
the reduction in serum cholinesterase caused by malathion restrains the activity of hypothalamus - hypophysis - gonadal axis and leads to the reduction of the production of sexual hormones and causes disorders in the reproductive system ( 30 ) .
it must be considered that the results of this study only showed changes of serum and erythrocyte cholinesterase activity under malathion exposure and also indicated that vitamin c , as an antioxidant , reduced the effects of oxidative stress caused by malathion intoxication .
however , the results do not imply any protective effect of vitamin c for the reproductive system upon exposure to malathion . since antioxidants can reduce the harmful effects of exposure to opps , people who are exposed to opps in direct ways ( contact or inhalation ) or indirect ways ( using contaminated agricultural products or proteins ) , the use of antioxidants , such as vitamin c , may decrease the damage .
our findings showed that malathion decreased the activity of serum and erythrocyte cholinesterase in exposed rats and that the administration of vitamin c reduced the induced damage .
since malathion is a very commonly used insecticide and people are exposed to it in different ways , it could have similar intoxication effects on people who are exposed to it .
vitamin c has been shown to have protective effects against malathion toxicity in animal studies , therefore vitamin c supplementation is suggested for people who are exposed to malathion .
however , to generalize these results , additional studies with larger sample sizes or different populations are recommended . | introductionmalathion is one of organophosphate poisons ( opps ) that inhibit cholinesterase activity and induce oxidative stress in target organs , such as the reproductive system .
the aim of this study was to assess the effects of malathion on serum and erythrocyte cholinesterase activity in male rats and also to assess the protective effects of vitamin c in this regard.methodsthis experimental study was performed in the pharmacology laboratory of the pharmacy faculty and in the advanced histology techniques laboratory of the medical faculty of mashhad university of medical sciences ( mums ) in january 2014 .
thirty male wistar rats , weighting 200250 g , were divided into five groups of six .
the different groups were exposed as follows : group 1 : malathion 50 mg / kg ; group 2 : vitamin c ; group 3 : malathion plus vitamin c with the specified doses ; sham group : normal saline ; and control group : no exposure .
after six weeks , 3 ml blood samples were taken from the rats , and titrimetric and ellman methods were used to assess serum and erythrocyte cholinesterase activity , respectively .
the data was analyzed by spss 16 , and p < 0.05 was considered significant.resultsthe activities of serum and erythrocyte cholinesterase were inhibited significantly in the malathion exposed group compared to the control group ( p < 0.001 ) .
the administration of vitamin c alone significantly increased the activities of serum and erythrocyte cholinesterase .
the serum and erythrocyte cholinesterase inhibition showed improvement in the group that received both malathion and vitamin c.conclusionmalathion reduced the activities of serum and erythrocyte cholinesterase in exposed animals .
it probably has the same intoxication effects on people who are exposed .
improvement of cholinesterase activity by antioxidant effects of vitamin c suggests that vitamin c supplementation can be used to decrease side effects of opp exposure . |
the incidence of heterotopic ossification ( ho ) after primary hip arthroplasty varies between 8% and 90% in literature .
the reason why heterotopic ossification develops is unknown , but it has been assumed that the inflammatory reaction due to the surgical trauma is the major driving force .
the fact that the incidence of ho in patients receiving non steroidal anti - inflammatory drugs ( nsaids ) after a total hip arthroplasty ( tha ) is much lower compared to patients not receiving nsaids is a confirmation of this assumption .
nsaids are still the cornerstone of ho prophylaxis , which are sometimes used in combination with radiation therapy in high risk patients [ 15 , 23 ] .
multiple cytokines are involved in inflammatory reactions . the main pro - inflammatory cytokines interleukin-1 ( il-1 ) , interleukin-6 ( il-6 ) and tumour necrosis factor- ( tnf- ) are involved in the inflammatory response after injury .
after elective surgery a temporary elevation of il-6 levels in serum or plasma has been observed [ 2 , 9 , 17 , 21 , 25 , 26 , 28 , 30 ] . increased levels of il-6 were also observed in patients having had total hip arthroplasty more then ten years previously .
even more important for orthopaedic surgeons is the finding that higher il-1 and tnf are also elevated in prosthetic loosening .
as one of the most important anti - inflammatory cytokines , elevated serum levels of interleukin 10 ( il-10 ) after trauma have been shown [ 11 , 12 ] . for il-10
even a positive correlation between higher levels immediately after trauma and the occurrence of sepsis later in the course was reported .
most reports on the increase of cytokines after trauma or surgery are based on serum levels .
there are limited data about the cytokine concentrations at the site of surgery [ 2 , 26 , 29 ] .
however , as cytokines are very effective in cell - to - cell communication , the concentration of cytokines locally at the surgical site is of major interest .
furthermore , in most studies only the pro - inflammatory cytokines are measured , resulting in a lack of knowledge about the elevation of anti - inflammatory cytokines in drainage fluid .
this study was conducted to investigate if the levels of different pro- and anti - inflammatory cytokines are measurable in drainage fluid after total hip arthroplasty and whether a difference in cytokine concentration between one and six hours postoperatively could be detected .
samples from the drainage system were collected from 30 patients following total hip arthroplasty .
all patients were treated according to our local protocol which included pre - operative antibiotics ( cefazoline 2 g i.v . ) and non steroidal anti - inflammatory drugs to prevent infection and heterotopic ossification , respectively . to facilitate taking samples from the standard hip drainage system
we inserted this connector , which originally is a part from a suprapubic catheter system ( cook ; limerick , ireland ) , to the drain , on which we placed a three - way connector from an intravenous infusion system .
a standard collection bag was placed at one end of the three - way system , while the other connection was used to collect the samples . in this way we were able to take samples from a closed suction drainage system at different time intervals instead of taking samples from the collection bag , which would have given an average of the time interval
after centrifugation of the fluid at 10,000 rpm for five minutes , the supernatant was taken and analysed using the bioplex 17 system ( bio - rad , herculus , usa ) .
gm - csf , g - csf , ifn- , tnf , mcp-1 , il-1beta , il-2 , il-4 , il-5 , il-6 , il-7 , il-8 , il-10 , il-12 , il-13 and mip-1beta levels were measured in the drainage fluids using commercially available kits according to the manufacturer 's instructions ( bio - rad , hercules , usa ) .
cytokine levels were measured and analysed using the bio - plex system ( bio - rad , hercules , usa ) .
the differences between the samples taken after one and six hours were compared using the paired sample t - test .
in three of the 30 patients it was not possible to take samples after one hour , because the drain production was too low . in another eight patients ,
only one measurement was done because the wound drains clotted and stopped draining before the collection at six hours .
the average drain production after one hour was 55 ml ( sd 31 ml ) and after six hours it was 268 ml ( sd 134 ml ) .
we found a significant elevation of almost all cytokines between the samples after one hour and six hours postoperatively .
in particular , elevation in this time interval of the concentrations of il- 6 and il-8 by a factor of 31.6 and 49.3 , respectively , is striking . calculating the il-6 to il-10 ratio , this ratio increased from 304 ( sd 256 ) to 12,357 ( sd 6788 ) ( p < 0.000 ) , which shows an increased predominance of the pro - inflammatory cytokines when comparing the measurements after one and six hours , respectively .
table 1cytokine concentrations in drainage fluidcytokineconcentration after 1 hour ( pg)concentration after 6 hours ( pg)significanceil-23352861p < 0.000il-45,50545,910p < 0.000il-6313,9149,916,640p < 0.000il-810,615523,257p < 0.000il-107971,012p = 0.215il-1b4988,126p < 0.000il-546197p < 0.000il-7551965p < 0.000il-123461,126p < 0.000il-13103560p < 0.000gm - csf2,28522,058p = 0.001ifn-5,47750,363p <
0.000tnf-1,24111,559p < 0.000g - csf20,200348,667p < 0.000mcp-134,086529,352p < 0.000mip-1b19,44816,454p = 0.392 cytokine concentrations in drainage fluid no ( negative ) correlation between the total drain volume and cytokine level was found , so the higher levels of cytokines are not caused by a concentration effect .
high levels of numerous cytokines can be detected in drainage fluid after total hip arthroplasty .
furthermore , the il-6 to il-10 ratio is increased between these two measurements , suggesting a relative rise in the pro - inflammatory interleukins .
these cytokine levels were found despite the fact that all patients received nsaids before surgery to prevent heterotopic ossification . it would have been ideal to compare the levels of cytokines in drainage fluid in patients who did not receive nsaids .
however , this was considered unethical due to our local protocol . to measure cytokine levels
it is possible to analyse up to 100 different analytes in a single microtiter well , with a high correlation using the traditional elisa method . as it is almost impossible to measure the interstitial levels of cytokines
, we believe the levels in drainage fluid are a better representation of these levels than the levels in serum . although cytokines in general function in cell - to - cell communication and not at long distances , many studies describe cytokine levels in serum [ 8 , 17 , 30 ] .
these systemic levels could represent either an over- or under - representation of the actual interstitial levels .
found a difference in cytokine levels in chest tubes , and in the same patients they did not detect a difference in the serum levels .
most studies in which cytokine levels are measured both in drainage fluid and in serum show comparable results , i.e. the levels in drainage fluid are higher than in serum [ 13 , 16 , 26 ] .
furthermore , in most studies only the rise in interleukin level in the drainage fluid was significant , the levels in serum were not , or only for a subset of interleukins [ 1 , 2 , 16 , 26 ] .
as pro - inflammatory interleukins ( mainly tnf- , il-1 and il-6 ) initiate elaboration and release other interleukins , anti - inflammatory cytokines ( il4 , il-10 and il-13 ) serve to down - regulate synthesis of pro - inflammatory cytokines .
taniguchi et al . showed that the ratio of il-6 and il-10 was correlated with injury severity after major trauma and it was recommended as a useful marker to predict the degree of injury following trauma .
il-6 levels in serum correlate with disease severity and patient mortality in patients with sepsis [ 5 , 10 ] .
di vita et al . showed that in patients who underwent surgical incisional hernia repair the local levels of cytokines differed between the group in which a mesh was used as compared to the group with a direct repair . in the group in which a mesh was implanted , the il-1 production was higher , whereas the direct repair group showed higher levels of il-1ra and il-10 , which are anti - inflammatory cytokines . in mice
il-1 stimulates bone formation and il-1-antagonist completely abolishes bone formation . il-4 and il-13 induce bone formation and the anti - inflammatory cytokine il-10 does not induce bone .
the high levels of these cytokines found in our study in the drain fluid ( though not measurable in serum in former studies ) can be a clue to better understanding the pathogenesis of ho .
in further research it would be preferable to include a reference group not receiving any nsaids . | as cytokines are involved in wound healing and other inflammatory processes , it could be valuable to measure their levels at the operative site .
this study was conducted to investigate whether different cytokines are measurable in drainage fluid and , when measurable , whether we can find a difference in cytokine levels between one and six hours postoperatively .
samples from the drainage system in 30 consecutive patients undergoing primary total hip replacement were collected at one and six hours after closure of the wound .
levels of several cytokines were measured in the drainage fluids .
a significant elevation of almost all cytokines was observed between the sample after one hour and six hours postoperatively .
we found a strong correlation between the different pro - inflammatory cytokines .
the il-6 to il-10 ratio were also raised , showing a pro - inflammatory predominance .
levels were much higher than those previously shown in serum . |
the early onset of sexual activity has been linked to risky health behaviors such as having a greater number of sexual partners over time and substance abuse.13 sexual activity for any teenage girl is risky due to multiple factors such as elevated risk of sexually transmitted infections ( sti ) and unwanted pregnancy .
girls who experience sex at the age of 15 years or younger are a particularly high risk subset for other physical and psychosocial health problems.4 these younger girls have been found to be more likely than boys to have sex with an older individual and more likely to be a victim of instances of involuntary or unwanted sex.4,5 because children may not fully understand the potential consequences of sex , having sexual contact with a girl who has not reached the legal age of consent is considered statutory rape . in most states , it is illegal to have sex with a girl aged 15 years or younger .
individual abilities , traits , norms , and behaviors have been found to be transferred from parents to their children .
behavioral scientists have particularly focused on the intergenerational transmission of problem behaviors.6 parents personality and behavioral attributes are thought to be transmitted across generations through parenting and the parent child relationship . 6 parent socioeconomic adversity,7 welfare dependency,8 antisocial and problem behaviors911
children who were exposed to inter parental violence were also at an elevated risk for using violent conflict resolution within intimate relationships.12 in light of this literature , mother and child health risky behaviors within the understudied latino mother
while studies support that the early onset of sexual activity is a negative life event,13,14 the intergenerational connection of early sex is not well understood , particularly among latinas in the united states ( us ) .
studies have found contradictory associations between a mother s early sexual experience and her daughter s experience.15 these studies have been done mostly among whites and african american women.15 in the current study , childhood sexual experience is defined as at least one type of consensual sexual encounter ( oral , vaginal , or anal ) at the age of 15 years or younger .
we hypothesized that childhood sexual activity , even if it was consensual , is associated with adult substance abuse if it occurred at the age of 15 years or younger , and this behavior is associated between mothers and daughters .
thus , the current study aims to investigate if latina mothers early sexual experience and adult substance abuse is associated with similar behaviors among their daughters . among all intergenerational relationships , the mother
in fact , a study showed that a mother s risky health behaviors were linked to her daughters but not to her sons.7 literature supports that various maternal behavior problems can be transmitted to daughters.16,17 a mother s experience of childhood sexual abuse has been suggested to be associated with her behavior and to her daughter s likelihood of experiencing sexual abuse.1719 because of this association between the experience of sexual abuse across mother
daughter generations , a similar relationship for childhood sexual experience for mothers and their daughters is highly plausible . in accordance with the literature on the intergenerational transmission of problem behaviors,7,12,17,18 we hypothesized that maternal childhood sexual experience directly or indirectly influences her daughter s childhood sexual experience as well as later substance abuse .
familism among latinos refers to family structures operating within an extended family system .
it is believed to be the most important influence in the lives of latinos.20 the affect of mothers experience and attitudes may be considerable to their daughters due to the strength of familial influence in latino culture . despite the strong family structure among latino families , studies also show that latina mother daughters were least likely to discuss sex.20 this lack of discussion is often due to the fact that intrafamily conversations about sexual behavior are inherently taboo in the latino culture.21 this study is significant in investigating the latina daughter s substance abuse in the context of intergenerational childhood sexual experience among mothers and daughters due to the pre - existing gap in the literature as well as the need to inform substance abuse and hiv / aids prevention programs .
adult latinas are an underrepresented population in the substance abuse literature.22 since the general latino population and the number of latino women who abuse illicit substances continues to increase in the us,2325 this added knowledge on intergenerational transmission of childhood sexual experience will further inform health care professionals in the design of effective interventions to reduce childhood sexual experience and substance abuse among latinas .
the purpose of the current study is to examine the relationship between early sexual experiences and substance abuse both within and across generations among a sample of latina mothers and daughters . to test the direct and indirect effects of latina mothers childhood sexual experience on their adult daughters substance abuse , we constructed two competing causal paths ( figure 1 ) .
based on the findings of literature review , we included two paths : i ) childhood sexual experience is associated with adult substance abuse among mothers and daughters , and ii ) maternal childhood sexual experience and current adult substance abuse is associated with daughters childhood sexual experience and current adult substance abuse . in the path diagram , the single - headed arrows indicate explanatory variables to the dependent variables . the first path diagram ( a ) shows that a daughter s current , adult substance abuse is indirectly related to her mother s childhood sexual experience . the second path diagram ( b )
shows that daughters current substance abuse is also directly influenced by maternal childhood sexual experience .
the current study was conducted with latina mothers and daughters residing in miami , florida between 2004 and 2006 . prior to the interview
, all participants learned the purpose of the study and then signed a written consent form .
the institutional review board ( irb ) of a large university reviewed and approved the current study .
participants were recruited through community fairs , health clinics , advertisements on local spanish radio and television stations .
other successful recruiting methods were advertising in a local alternative newspaper , on an fm radio station , and via announcements at local drug court programs .
women were also recruited from community based substance abuse support groups such as narcotics anonymous ( na ) and alcoholics anonymous ( aa ) .
the general criteria for inclusion of latino mothers and daughters in the study were : ( a ) consent to be interviewed for at least 23 hours , ( b ) aged 18 years or older , ( c ) identifying themselves as latinas , ( d ) living in miami dade county , florida , and ( e ) willing to provide two telephone numbers where they could be reached during the study period .
for the current study , both mother and daughter have never been sexually abused . as a result ,
all study participants currently in this analysis ( 92 dyads ) have never reported experiencing childhood sexual abuse .
instruments used in the questionnaire had been validated with minority populations and some were available in spanish .
face - to - face interviews were conducted in the participants language of preference ( either spanish or english ) by trained bilingual female interviewers .
eight master s level female interviewers and two bachelor s level female interviewers with backgrounds in social work , public health , psychology and nutrition conducted the interviews using a structured questionnaire . mothers and daughters were interviewed separately and each individual interview took approximately 23 hours to complete .
interviews were scheduled at times and at locations convenient to participants such as their homes .
participation rate was high among dyads that were eligible for the study since there was a incentive referral system established as part of the recruitment strategies and in cases where a woman was unable to participate , the most common reason why was that she did not have a mother or daughter to form an eligible dyad .
demographic variables and descriptive variables were collected such as age , place of birth , education ( > high school to college degree / graduate school ) and employment ( yes / no ) .
a participant was identified as a current substance abuser based on the frequency of alcohol , illicit drugs ( marijuana , cocaine , heroin , ecstasy ) , or prescription drugs used during the last 12 months .
the health and daily living ( hdl ) instrument was used to measure alcohol abuse .
this instrument is composed of 12 indices that tap into two main areas of health functioning : ( 1 ) self - confidence and mood , and ( 2 ) extent of use and problematic substance use .
the instrument was validated and considered reliable among a sample of 424 community adults and a sample of clinically depressed patients.26 the alcohol consumption section on adult form b was used for this study .
the questions in this form elicit the usual amount of alcohol consumption ( ie , alcohol quantity ) using beverage - specific questions ( ie , beer , wine , distilled liquors ) and subsequent questions that assess how frequently participants consume alcohol ( ie , answers ranged from never to everyday ) .
for the purpose of the current study , alcohol abusers were defined in terms of at least one heavy drinking episode per month ( adapted from naimi and colleagues):27 at least 45 glasses of wine , 34 cans / bottles of beer , or 34 four - ounce drinks of hard liquor per occasion - during the 12 months prior to assessment.27 the drug use frequency scale ( duf)28 was used to assess the frequency of drug use among mothers and daughters.28 it assessed illicit drug use and prescribed drugs used without a doctor s authorization ( eg , sedatives ) in the past 12 months .
the duf scale categorized frequency of drug use from 0 ( never uses ) to 8 ( uses every day ) .
psychometric properties for this measure include its concurrent validity as having good agreement ( 0.87 ) with collateral reports of drug use frequency and with self - reports using the timeline follow - back measure ( 0.830.98).28 the current study utilizes drug use for the last 12 months .
mothers and daughters were classified as abusers of marijuana , cocaine , heroin , ecstasy , and/or prescription drugs .
illicit drug abusers were defined as participants who reported at least three days per week of marijuana use , two days per week of cocaine use , one or more occasions of heroin use per week , and/or at least three ecstasy use occasions per month during the 12 months prior to assessment .
abuse of prescribed medication was measured by asking participants whether they had taken medicine without a doctor s authorization , in larger amounts than prescribed , or for longer periods than prescribed , in the 12 months prior to assessment ( adapted from turner and et al).29 the age at which participants first sexual experience occurred was obtained for each type of sexual encounter ( how old were you the first time you had vaginal [ or anal , oral ] sex ) ? if participants reported at least one type of consensual sexual encounter at the age of 15 years or younger , they were eligible for our sample as an individual with a childhood sexual experience .
we chose the term childhood sexual experience because our data does not permit us to know if the first sexual encounter was an isolated event or if it was indeed an onset of sexual activity .
the age of the first sexual experience was categorized into three groups : i ) childhood , defined as the age of 15 years or younger , ii ) ages between16 and 19 years , and iii ) 20 years or older .
since measures from the mother and daughter are not independent ( correlated dyad ) , each pair of mother
we aimed to explain the intergenerational association of childhood sexual experience as a risk factor for current substance abuse . therefore , to select a path model most consistent with the pattern of correlations found in the data , we fitted two competing models using path analysis . because our outcome variables were binary , a series of general linear models using a logit link and path estimates
were calculated by maximum likelihood estimation.30 the best fitting of two models is evaluated based on the akaike information criterion ( aic ) .
the aic methodology attempts to find the model that best explains the data with a minimum of free parameters .
data analyses were performed using the statistical packages , stata version 10.031 and mplus version 4.1.32
participants were recruited through community fairs , health clinics , advertisements on local spanish radio and television stations .
other successful recruiting methods were advertising in a local alternative newspaper , on an fm radio station , and via announcements at local drug court programs .
women were also recruited from community based substance abuse support groups such as narcotics anonymous ( na ) and alcoholics anonymous ( aa ) .
the general criteria for inclusion of latino mothers and daughters in the study were : ( a ) consent to be interviewed for at least 23 hours , ( b ) aged 18 years or older , ( c ) identifying themselves as latinas , ( d ) living in miami dade county , florida , and ( e ) willing to provide two telephone numbers where they could be reached during the study period .
for the current study , both mother and daughter have never been sexually abused . as a result ,
all study participants currently in this analysis ( 92 dyads ) have never reported experiencing childhood sexual abuse .
instruments used in the questionnaire had been validated with minority populations and some were available in spanish .
face - to - face interviews were conducted in the participants language of preference ( either spanish or english ) by trained bilingual female interviewers .
eight master s level female interviewers and two bachelor s level female interviewers with backgrounds in social work , public health , psychology and nutrition conducted the interviews using a structured questionnaire . mothers and daughters were interviewed separately and each individual interview took approximately 23 hours to complete .
interviews were scheduled at times and at locations convenient to participants such as their homes . a monetary incentive of $ 80 was provided to each mother daughter dyad .
participation rate was high among dyads that were eligible for the study since there was a incentive referral system established as part of the recruitment strategies and in cases where a woman was unable to participate , the most common reason why was that she did not have a mother or daughter to form an eligible dyad .
demographic variables and descriptive variables were collected such as age , place of birth , education ( > high school to college degree / graduate school ) and employment ( yes / no ) .
a participant was identified as a current substance abuser based on the frequency of alcohol , illicit drugs ( marijuana , cocaine , heroin , ecstasy ) , or prescription drugs used during the last 12 months .
the health and daily living ( hdl ) instrument was used to measure alcohol abuse .
this instrument is composed of 12 indices that tap into two main areas of health functioning : ( 1 ) self - confidence and mood , and ( 2 ) extent of use and problematic substance use .
the instrument was validated and considered reliable among a sample of 424 community adults and a sample of clinically depressed patients.26 the alcohol consumption section on adult form b was used for this study .
the questions in this form elicit the usual amount of alcohol consumption ( ie , alcohol quantity ) using beverage - specific questions ( ie , beer , wine , distilled liquors ) and subsequent questions that assess how frequently participants consume alcohol ( ie , answers ranged from never to everyday ) . for the purpose of the current study ,
alcohol abusers were defined in terms of at least one heavy drinking episode per month ( adapted from naimi and colleagues):27 at least 45 glasses of wine , 34 cans / bottles of beer , or 34 four - ounce drinks of hard liquor per occasion - during the 12 months prior to assessment.27 the drug use frequency scale ( duf)28 was used to assess the frequency of drug use among mothers and daughters.28 it assessed illicit drug use and prescribed drugs used without a doctor s authorization ( eg , sedatives ) in the past 12 months . the duf scale categorized frequency of drug use from 0 ( never uses ) to 8 ( uses every day ) .
psychometric properties for this measure include its concurrent validity as having good agreement ( 0.87 ) with collateral reports of drug use frequency and with self - reports using the timeline follow - back measure ( 0.830.98).28 the current study utilizes drug use for the last 12 months .
mothers and daughters were classified as abusers of marijuana , cocaine , heroin , ecstasy , and/or prescription drugs .
illicit drug abusers were defined as participants who reported at least three days per week of marijuana use , two days per week of cocaine use , one or more occasions of heroin use per week , and/or at least three ecstasy use occasions per month during the 12 months prior to assessment .
abuse of prescribed medication was measured by asking participants whether they had taken medicine without a doctor s authorization , in larger amounts than prescribed , or for longer periods than prescribed , in the 12 months prior to assessment ( adapted from turner and et al).29
the age at which participants first sexual experience occurred was obtained for each type of sexual encounter ( how old were you the first time you had vaginal [ or anal , oral ] sex ) ? if participants reported at least one type of consensual sexual encounter at the age of 15 years or younger , they were eligible for our sample as an individual with a childhood sexual experience .
we chose the term childhood sexual experience because our data does not permit us to know if the first sexual encounter was an isolated event or if it was indeed an onset of sexual activity .
the age of the first sexual experience was categorized into three groups : i ) childhood , defined as the age of 15 years or younger , ii ) ages between16 and 19 years , and iii ) 20 years or older .
since measures from the mother and daughter are not independent ( correlated dyad ) , each pair of mother
we aimed to explain the intergenerational association of childhood sexual experience as a risk factor for current substance abuse .
therefore , to select a path model most consistent with the pattern of correlations found in the data , we fitted two competing models using path analysis .
because our outcome variables were binary , a series of general linear models using a logit link and path estimates were calculated by maximum likelihood estimation.30 the best fitting of two models is evaluated based on the akaike information criterion ( aic ) .
the aic methodology attempts to find the model that best explains the data with a minimum of free parameters .
data analyses were performed using the statistical packages , stata version 10.031 and mplus version 4.1.32
the average age of daughters was 29 years and ranged from 18 to 55 years .
approximately 13.0% of mothers and 46.7% of daughters were born in the us and a little more than half of the participants were us citizens ( 55.4% of mothers and 64.1% of daughters ) .
the education level of this sample was lower than that of the us . in 2007 , 86% of all adults aged 25 years and older reported they had completed at least high school and 29% completed at least a bachelor s degree in the us.33 however , among the mother participants in our study , only 71% had completed a high school or equivalent education and 24% had a bachelor s or higher degree .
since a daughter participant could be aged as young as 18 years , we could not compare the proportion of college degrees with the general population .
approximately 58.7% of daughters and 38.0% of mothers were current substance abusers ( table 1 ) .
if the mother was a substance abuser , then the daughter was more likely to be a substance abuser ( or = 2 ; p < 0.07 )
. the average ages of first sexual encounter for daughters and mothers were 16.1 and 18.3 years , respectively . on average ,
a daughter s first sexual experience was at an age two years younger than that of her mother s ( paired t - test ; p < 0.01 ) .
the first sexual experience occurred at ages as young as 8 years among daughters and 11 years among mothers .
approximately 88% of daughters and 91% of mothers reported that their first sexual encounter was vaginal sex with / without other types of sexual contact .
the proportion of participants who had a childhood sexual experience among daughters and mothers were 41.3% and 19.6% , respectively .
the difference between the two correlated proportions were statistically significant ( mcnemar s test ; p < 0.01 ) .
daughters current substance abuse was associated independently with their own childhood sexual experience ( or = 6.0 ; p < 0.01 ) .
we further investigated the role of having first sexual contact as a late teenager ( aged 1619 years ) versus at the age of 20 years or older on current substance abuse ( table 2 ) . compared with daughters who experienced sex at the age of 20 years or older ,
the odds of using a substance was 17.7 times higher ( p < 0.01 ) among daughters with a childhood sexual experience and 3.8 times higher ( p < 0.01 ) among daughters who first experienced sex during the ages of 1619 years .
those who had their first sexual experience between the ages of 1619 years ( at the legal age of consent ) were more likely to be current substance abusers compared to those who had it at the age of 20 years or older . among mothers , childhood sexual experience was a risk factor for substance abuse as an adult as well ( or = 2.45 ; p < 0.05 ) .
unlike what was seen among daughters , having their first sexual encounter as a late teenager was not a significant risk factor for current substance abuse among mothers . compared with mothers who first experienced sex at the age of 20 years or older , the odds of using a substance was 3.3 times higher ( p < 0.03 ) if a mother had childhood sexual experience , and 1.6 times higher ( p < 0.18 ) if a mother first experienced sex during the ages of 1619 years .
mothers who had their first sexual experience between the ages of 1619 years ( at legal age of consent ) were not more likely to be current substance abusers compared to those who had it at the age of 20 years or older .
we tested the competing models using the aic method , which attempts to find the model that best explains the data with a minimum of free parameters .
the best model is therefore the one with a smaller aic value.34 based on the aic , we selected the first model ( a ) , which fits our data slightly better : 353.5 for the first model ( a ) , and 354.9 for the second model ( b ) .
the path coefficients found in the logit model were exponentiated and presented as odds ratios in the selected model ( figure 2 ) .
path analysis showed that mothers childhood sexual experience was not significantly associated with daughters current substance abuse .
rather , mothers childhood sexual experience contributed to daughters current substance abuse indirectly by increasing the risk of daughters childhood sexual experience .
we reported previously that the daughter s current substance abuse was associated independently with the mother s current substance abuse ( or = 2.0 ; p < 0.07 ) .
however , when both characteristics were entered into the prediction model for daughters substance abuse , only daughters childhood sexual experience remained as a significant risk factor ( or = 5.57 ; p < 0.01 ) .
the affect of the mothers current substance abuse on the daughters current substance abuse became less important ( or = 1.37 ; p < 0.52 ) in the presence of the daughters own childhood sexual experience .
the reason was , as shown in figure 2 , that both mothers current substance abuse and daughters childhood sexual experience were connected to mothers childhood sexual experience .
therefore , we concluded that the daughters childhood sexual experience was a strong risk factor for current substance abuse , which was also strongly predicted by the mother s childhood sexual experience ( or= 7.29 ; p < 0.01 ) .
the average age of daughters was 29 years and ranged from 18 to 55 years .
approximately 13.0% of mothers and 46.7% of daughters were born in the us and a little more than half of the participants were us citizens ( 55.4% of mothers and 64.1% of daughters ) .
the education level of this sample was lower than that of the us . in 2007 , 86% of all adults aged 25 years and older reported they had completed at least high school and 29% completed at least a bachelor s degree in the us.33 however , among the mother participants in our study , only 71% had completed a high school or equivalent education and 24% had a bachelor s or higher degree .
since a daughter participant could be aged as young as 18 years , we could not compare the proportion of college degrees with the general population .
approximately 58.7% of daughters and 38.0% of mothers were current substance abusers ( table 1 ) .
if the mother was a substance abuser , then the daughter was more likely to be a substance abuser ( or = 2 ; p < 0.07 ) .
the average ages of first sexual encounter for daughters and mothers were 16.1 and 18.3 years , respectively . on average ,
a daughter s first sexual experience was at an age two years younger than that of her mother s ( paired t - test ; p < 0.01 ) .
the first sexual experience occurred at ages as young as 8 years among daughters and 11 years among mothers .
approximately 88% of daughters and 91% of mothers reported that their first sexual encounter was vaginal sex with / without other types of sexual contact .
the proportion of participants who had a childhood sexual experience among daughters and mothers were 41.3% and 19.6% , respectively .
the difference between the two correlated proportions were statistically significant ( mcnemar s test ; p < 0.01 ) .
daughters current substance abuse was associated independently with their own childhood sexual experience ( or = 6.0 ; p < 0.01 ) .
we further investigated the role of having first sexual contact as a late teenager ( aged 1619 years ) versus at the age of 20 years or older on current substance abuse ( table 2 ) . compared with daughters who experienced sex at the age of 20 years or older , the odds of using a substance was 17.7 times higher ( p < 0.01 ) among daughters with a childhood sexual experience and 3.8 times higher ( p < 0.01 ) among daughters who first experienced sex during the ages of 1619 years .
those who had their first sexual experience between the ages of 1619 years ( at the legal age of consent ) were more likely to be current substance abusers compared to those who had it at the age of 20 years or older . among mothers , childhood sexual experience was a risk factor for substance abuse as an adult as well ( or = 2.45 ; p < 0.05 ) .
unlike what was seen among daughters , having their first sexual encounter as a late teenager was not a significant risk factor for current substance abuse among mothers
. compared with mothers who first experienced sex at the age of 20 years or older , the odds of using a substance was 3.3 times higher ( p < 0.03 ) if a mother had childhood sexual experience , and 1.6 times higher ( p < 0.18 ) if a mother first experienced sex during the ages of 1619 years .
mothers who had their first sexual experience between the ages of 1619 years ( at legal age of consent ) were not more likely to be current substance abusers compared to those who had it at the age of 20 years or older .
we tested the competing models using the aic method , which attempts to find the model that best explains the data with a minimum of free parameters .
the best model is therefore the one with a smaller aic value.34 based on the aic , we selected the first model ( a ) , which fits our data slightly better : 353.5 for the first model ( a ) , and 354.9 for the second model ( b ) .
the path coefficients found in the logit model were exponentiated and presented as odds ratios in the selected model ( figure 2 ) .
path analysis showed that mothers childhood sexual experience was not significantly associated with daughters current substance abuse .
rather , mothers childhood sexual experience contributed to daughters current substance abuse indirectly by increasing the risk of daughters childhood sexual experience .
we reported previously that the daughter s current substance abuse was associated independently with the mother s current substance abuse ( or = 2.0 ; p < 0.07 )
. however , when both characteristics were entered into the prediction model for daughters substance abuse , only daughters childhood sexual experience remained as a significant risk factor ( or = 5.57 ; p < 0.01 ) .
the affect of the mothers current substance abuse on the daughters current substance abuse became less important ( or = 1.37 ; p < 0.52 ) in the presence of the daughters own childhood sexual experience .
the reason was , as shown in figure 2 , that both mothers current substance abuse and daughters childhood sexual experience were connected to mothers childhood sexual experience .
therefore , we concluded that the daughters childhood sexual experience was a strong risk factor for current substance abuse , which was also strongly predicted by the mother s childhood sexual experience ( or= 7.29 ; p < 0.01 ) .
this study investigated the relationships between mothers and daughters age of first sexual experience and adult substance abuse among latinas in the us .
our study indicated several key findings with implications for substance abuse prevention efforts involving latinas in the us .
first , having sex as a child , even when it was a consensual act , was a strong predictor for later substance abuse . additionally , although a mother s adult substance abuse was a predictor for the daughter s adult substance abuse , our study supported that the daughter s own childhood sexual experience was a stronger factor for later substance abuse .
this result suggests that guarding latina girls from early sexual contact may have a protective effect against later adult substance abuse .
although our data are limited in answering the underlying emotional processes , we believe that sex could be an overwhelming experience for children , which could prevent them from dealing with normal developmental tasks including academic performance .
therefore , we conclude that interventions and educational efforts are needed to protect children from early sexual activity . prevention programs may need to aim to educate young teens about negative outcomes of early sex in order to decrease the risks that early sexual activity may create .
further , our study tested and confirmed a strong positive association between age of first sexual experience for mothers and their daughters . that is , if a mother experienced sex at an early age , then her daughter was likely to experience sex at an earlier age . while a causal link can not be determined in the current cross sectional study ,
intergenerational transmission of sexual activity has been suggested to occur through a variety of mechanisms ( environmental contributions ) between mothers and daughters .
behavioral scientists often framed it within the context of social learning theory . according to social learning theory , most human behavior
is learned observationally through modeling within a social context.35 daughters often learn behaviors by modeling on their mothers and by sharing a similar environment .
daughter observation , the attitudes and level of knowledge are acquired through interactions with the mother , who is usually the primary care taker in latino families .
a previous study reported that the level of parental education explains the sexual behaviors of adolescents36 and this highlights the importance of family environment .
indeed some animal behavior studies concluded that intergenerational transmission of behaviors resulted from environmental contributions rather than genetic contributions.37 therefore , intergenerational transmission of behaviors may be modifiable to some degree by implementing interventions targeting causal mechanisms indicated by future research .
the goal of prevention programs is to prevent or delay the onset of a problem among particularly high risk groups .
if a woman had childhood sexual experience , then more intense protection is needed to guard her daughter from having childhood sexual experience .
for instance , if a woman was identified as a mother who experienced childhood sex in any clinical setting , na , or aa , a family - based prevention effort may need to be extended to the daughter to protect her from having sex at an earlier age .
a study supported that parent education was a promising intervention for promoting early adolescent s sexual abstinence.3 education and intervention may include informing mothers about the detrimental effects of early sex as well as the potential nature of intergenerational transmission of childhood sexual experience . along with education , empirically proven parenting skills can be taught as a part of family - based prevention programs.3840 since young girls have been found to be more likely to be a victim of unwanted sex,4,5 educating young daughters to protect themselves from unwanted sex may be a part of intervention .
when the mother herself is at high risk and ill equipped to educate her daughter , providing intervention to both mother and daughter may be particularly beneficial . extending prevention services to the daughters of high risk groups
further , findings revealed that the daughters first sexual experience occurred at an average age more than two years younger than the mothers first experience .
it is noteworthy that the proportion of daughters who had sex as a child was also two times larger than that of mothers .
this is consistent with a meta - analysis study41 suggesting that more people have become sexually active at an earlier age over the past generations .
although our database was limited to answering why daughters were having sex at younger ages than their mothers , we infer that it could be due to changes in culture , peer norms , and family structure .
additionally , for the mothers who were born outside of the us , the importance of maintaining their virginity before marriage in latin culture42 may have influenced the later initiation of sexual activity ( when compared to their daughters ) .
recently , the media has covered a surge in teen pregnancy at one particular high school where most of the pregnant girls were sophomores aged as young as 15 years.43 their city mayor attributed the local spike in teenage pregnancies in part to a popular culture that glorifies sex and pointed out movies and media.44 while an increasing number of people acknowledge the role of media on teen s decisions on sexual activity , changes in sexual behavior over generations is not well understood .
further study is needed to describe why more teenagers have become sexually active at an earlier age .
regardless , our study finding suggests that the education of human sexuality and its consequences should be offered to younger girls now more than ever before .
another finding worthy of note is that having a first sexual experience as a late teenager ( age between 16 and 19 years ) compared to adulthood ( age of 20 years or older ) significantly elevated the likelihood of being a current substance abuser for daughters , although this was not replicated for mothers .
further study using larger samples and longitudinal data is needed to understand the moderating effect a woman s generation has on her behavior .
we contemplate the relative importance of education on socioeconomic status among the daughters generation compared to a mothers generation .
teenage girls engaging in sexual activity are reportedly less likely to graduate from high school or attend college.13 it may be that these sexually active youth also receive less education and experience a lower socioeconomic reality .
the lowered socioeconomic status is then often linked with substance abuse.45 there are several limitations to this study .
therefore , their background information is not necessarily compatible to that of the general public .
respondents consisted mainly of cubans and other latinas from latin america ( eg , colombian and venezuelans ) .
thus , the results may not be generalizable to other latinas such as mexicans . in an effort to secure a high enough number of substance abusers in our study , some of the participants
additionally , the women who are participating in self - help programs may also indicate a greater than average desire to change their behaviors .
therefore , results from this study may not be generalizable to the general population as these women s characteristics may not be the norm among women substance abusers .
another limitation of our study is that we relied on self - reported data . due to social stigma
although we have no basis to believe that a longitudinal study would guard from underreporting , we believe that a longitudinal follow - up study would protect against recall bias . additionally , a longitudinal follow - up study involving potential co - varying risk factors such as parental psychopathology and parenting behaviors associated both with childhood sexual activity and substance - related problems in parents and their children would allow researchers to better describe causal mechanisms between early sexual experiences and lifetime substance abuse problems among mothers and daughters .
we did not collect data on personality risk taking variables , which poses a limitation for the current study and could have helped explain if participants personality traits played a role in these latino women s risk health behaviors .
we acknowledge that the path analysis itself is a correlation analysis and can not test the direction of causation .
therefore , we used terminology of prediction rather than causation . however , our pre - specified causal path was built on causal paths found in the literature review .
additionally , our model maintained the temporal relationship in the intergenerational transmission framework and this enhanced the plausibility of the path , although it was limited to current substance abuse of latina mothers and daughters .
the assessment of a lifetime substance use problem would have allowed us to more accurately assess risk factors occurring earlier in life and , most importantly , during the daughters childhood .
we recommend future longitudinal studies involving latina substance abusing and non - substance abusing mothers to measure substance use rates and relationship quality with their daughters in early childhood .
these variables should be measured over time to determine causal inferences about associations between maternal substance abuse and the development of daughters substance use disorders in the context of early sexual experience .
therefore , their background information is not necessarily compatible to that of the general public .
respondents consisted mainly of cubans and other latinas from latin america ( eg , colombian and venezuelans ) .
thus , the results may not be generalizable to other latinas such as mexicans . in an effort to secure a high enough number of substance abusers in our study , some of the participants were recruited from aa and na meetings .
additionally , the women who are participating in self - help programs may also indicate a greater than average desire to change their behaviors .
therefore , results from this study may not be generalizable to the general population as these women s characteristics may not be the norm among women substance abusers .
another limitation of our study is that we relied on self - reported data . due to social stigma
although we have no basis to believe that a longitudinal study would guard from underreporting , we believe that a longitudinal follow - up study would protect against recall bias . additionally , a longitudinal follow - up study involving potential co - varying risk factors such as parental psychopathology and parenting behaviors associated both with childhood sexual activity and substance - related problems in parents and their children would allow researchers to better describe causal mechanisms between early sexual experiences and lifetime substance abuse problems among mothers and daughters .
we did not collect data on personality risk taking variables , which poses a limitation for the current study and could have helped explain if participants personality traits played a role in these latino women s risk health behaviors .
we acknowledge that the path analysis itself is a correlation analysis and can not test the direction of causation .
however , our pre - specified causal path was built on causal paths found in the literature review .
additionally , our model maintained the temporal relationship in the intergenerational transmission framework and this enhanced the plausibility of the path , although it was limited to current substance abuse of latina mothers and daughters .
the assessment of a lifetime substance use problem would have allowed us to more accurately assess risk factors occurring earlier in life and , most importantly , during the daughters childhood .
we recommend future longitudinal studies involving latina substance abusing and non - substance abusing mothers to measure substance use rates and relationship quality with their daughters in early childhood .
these variables should be measured over time to determine causal inferences about associations between maternal substance abuse and the development of daughters substance use disorders in the context of early sexual experience .
our study supported the relevance of intergenerational association of having consensual sex as a child and substance abuse from mother to daughter .
mother and daughter childhood sexual experiences were highly correlated with current , adult substance abuse .
furthermore , the mothers childhood sexual experience were strongly related to that of their daughters .
more importantly , the path between the mothers childhood sexual experience and the daughters current , adult substance abuse was interceded by the daughters childhood sexual experience .
therefore , our study suggests the need for further research to explore mothers childhood sexual experiences and its detrimental effects for their daughters . | purpose : early onset of sexual activity has been linked to later substance abuse .
our study aimed to further describe the associations between latina mothers and daughters early sexual activity and adult substance abuse.methods:a survey was conducted with 92 latina mother
daughter dyads whose members never experienced sexual abuse .
childhood sexual experience was defined as the occurrence of a consensual sexual encounter at the age of 15 years or younger .
substance abusers were identified by the extent of substance use during the 12 months prior to the interview .
path analysis was used to fit our conceptual models to the data.main findings : daughters current , adult substance abuse was associated independently with : their own childhood sexual experience ( odds ratio [ or ] = 6.0 ) and mothers current , adult substance abuse ( or = 2.0 ) . compared with daughters who first experienced sex after the age of 19 , the odds of using substances were 17.7 times higher among daughters who had childhood sexual experience and 3.8 times higher among daughters who first experienced sex between the age of 1619 years . explicitly , sexual experiences between the ages of 1619 years were also risk factors for later adult substance abuse .
mothers childhood sexual experience ( or = 7.3 ) was a strong predictor for daughters childhood sexual experience.conclusions:our study supported a link between mother and daughter childhood sexual experience among latinas , and indicated it is a correlate of adult substance abuse .
family based substance abuse prevention efforts and future longitudinal studies should consider maternal childhood sexual experience as a potential indication of risk for latina daughters . |
video - assisted thoracoscopic ( vats ) lobectomy has gradually gained popularity , and been accepted as an alternative procedure to thoracotomy for resectable lung cancer by national comprehensive cancer network ( nccn ) since 2013 .
interest has developed on whether vats preserves better immune status and benefits long - term survival .
regulatory t - cell ( treg ) , known as a negative regulator of the cellular immunity , has been considered as a negative prognostic factor for cancer progression .
little is known on the influence of lobectomy on treg population in lung cancer patients .
natural killer ( nk ) cells are known to play a significant role in tumor immunosurveillance through their ability to recognize , target , and directly destroy tumor cells without prior sensitization . in this study , we examined peripheral levels of treg and nk cells in stage i nonsmall cell lung cancer ( nsclc ) patients undergoing lobectomy by vats or thoracotomy , to disclose perioperative fluctuation of treg and nk , as well as the correlation between surgical invasiveness and postoperative cell - mediated immune functions .
totally , 110 consecutive patients with clinical stage i nsclc in our team were recruited from october 2012 to november 2013 .
preoperative evaluations and tnm stage were performed according to 2014 nccn clinical guideline for nsclc .
exclusion criteria were as follows : history of malignancies ; receiving surgical or intervene operation in recent 1-year ; receiving immune therapy including traditional chinese medicine within 6 months ; concomitant immune - enhancing or immune - suppressing diseases including lupus erythematosus , crohn 's disease , and myasthenia gravis ; allergic constitution ; acquired human immune deficiency syndrome ; and any known infection by microorganisms .
ethical approval was given by the clinical research ethics committee of the second affiliated hospital of zhejiang university , school of medicine .
the choice of vats or open procedure was made by the patient himself / herself and was independent to enrollment .
all patients received identical anesthesia with selective one lung ventilation and major lung resection , followed by lymphadenectomy ( 4 , 5 , 6 , 7 , 8 , 9 , 10 stations for left side cases and 2 , 3 , 4 , 7 , 8 , 9 , 10 for right side ones .
levels 11 - 13 nodes were dissected during anatomic lobectomy and proceeding in vitro dissection ) .
all resected nodes were individually labeled and submitted entirely for pathological examination . compared with conventional posterolateral thoracotomy ,
our three - ports vats technique used one 34 cm utility thoracotomy in the fourth or fifth intercostal space near anterior axillary line without rib spreading .
exploring port was designed in the seventh or eighth intercostal space on the middle axillary line , and an 12 cm auxiliary operation hole was made below the inferior angle of the scapula .
severe pleural adhesions and completely fused fissures were no longer contraindications of vats on anatomic grounds . in conditions of lymph nodes ( lns ) firmly adhering to pulmonary vessels which imply a high risk of life - threatening hemorrhage , vats procedures were converted to thoracotomy for safety reasons .
those whose dissected lns were positive for metastasis were excluded from the study because subsequent adjuvant therapy could impact immune function .
postoperative pain control was achieved by patient - controlled intravenous or paravertebral analgesia within first 48 h followed by oral analgesics if indicated .
two milliliters of heparinized peripheral venous blood samples were collected on 10 am 1-day before surgery as a baseline , and at the same time on postoperative day ( pod ) 1 , 3 , 7 , 30 and 90 . samples were immediately processed .
mononuclear cells were isolated from the peripheral blood by centrifugation over histopaque ( hettich universal 320r , germany ) .
a flow cytometry of treg and nk subpopulations was performed using appropriate isotype controls and the following markers :
cd4 fitc ( cat no .
340133 , bd biosciences , usa)cd25 pe ( cat no . 341009 , bd biosciences)cd45apc ( cat no .
340943 , bd biosciences)cd127 percp cy5.5 ( lot : 90916 , bd pharmingen , usa)cd3 fitc / cd16 56 pe ( cat no . 340042 , bd biosciences ) .
340133 , bd biosciences , usa ) cd25 pe ( cat no . 341009 , bd biosciences ) cd45apc ( cat no . 340943 , bd biosciences )
cd127 percp cy5.5 ( lot : 90916 , bd pharmingen , usa ) cd3 fitc / cd16 56 pe ( cat no . 340042 , bd biosciences ) .
data were obtained and analyzed using the facsdiva6.0 software ( bd biosciences ) . in order to identify the treg subsets ,
differences of age ( years ) , tumor diameter ( cm ) , number of dissected ln , operation duration ( min ) and blood loss ( ml ) between vats and thoracotomy groups were determined by independent t - test .
chi - square and nonparametric test ( kruskal wallis test ) were used to compare the distribution of sex and tumor histopathology in these two groups .
time trend and variances in treg / nk level with the change in postoperative time in either vats or thoracotomy group were calculated by repeated measures test of general linear model ( glm ) according to mauchly 's test of sphericity results .
differences of treg / nk level between vats and thoracotomy groups were determined by one - way analysis of variance ( anova ) .
comparison of treg / nk level in various times after the operation with preoperative level as a control in each group was carried out by one - way anova dunnett t - test .
totally , 110 consecutive patients with clinical stage i nsclc in our team were recruited from october 2012 to november 2013 .
preoperative evaluations and tnm stage were performed according to 2014 nccn clinical guideline for nsclc .
exclusion criteria were as follows : history of malignancies ; receiving surgical or intervene operation in recent 1-year ; receiving immune therapy including traditional chinese medicine within 6 months ; concomitant immune - enhancing or immune - suppressing diseases including lupus erythematosus , crohn 's disease , and myasthenia gravis ; allergic constitution ; acquired human immune deficiency syndrome ; and any known infection by microorganisms .
ethical approval was given by the clinical research ethics committee of the second affiliated hospital of zhejiang university , school of medicine .
the choice of vats or open procedure was made by the patient himself / herself and was independent to enrollment .
all patients received identical anesthesia with selective one lung ventilation and major lung resection , followed by lymphadenectomy ( 4 , 5 , 6 , 7 , 8 , 9 , 10 stations for left side cases and 2 , 3 , 4 , 7 , 8 , 9 , 10 for right side ones .
levels 11 - 13 nodes were dissected during anatomic lobectomy and proceeding in vitro dissection ) .
all resected nodes were individually labeled and submitted entirely for pathological examination . compared with conventional posterolateral thoracotomy ,
our three - ports vats technique used one 34 cm utility thoracotomy in the fourth or fifth intercostal space near anterior axillary line without rib spreading .
exploring port was designed in the seventh or eighth intercostal space on the middle axillary line , and an 12 cm auxiliary operation hole was made below the inferior angle of the scapula .
severe pleural adhesions and completely fused fissures were no longer contraindications of vats on anatomic grounds . in conditions of lymph nodes ( lns ) firmly adhering to pulmonary vessels which imply a high risk of life - threatening hemorrhage , vats procedures were converted to thoracotomy for safety reasons .
those whose dissected lns were positive for metastasis were excluded from the study because subsequent adjuvant therapy could impact immune function .
postoperative pain control was achieved by patient - controlled intravenous or paravertebral analgesia within first 48 h followed by oral analgesics if indicated .
two milliliters of heparinized peripheral venous blood samples were collected on 10 am 1-day before surgery as a baseline , and at the same time on postoperative day ( pod ) 1 , 3 , 7 , 30 and 90 . samples were immediately processed .
mononuclear cells were isolated from the peripheral blood by centrifugation over histopaque ( hettich universal 320r , germany ) .
a flow cytometry of treg and nk subpopulations was performed using appropriate isotype controls and the following markers :
cd4 fitc ( cat no .
340133 , bd biosciences , usa)cd25 pe ( cat no . 341009 , bd biosciences)cd45apc ( cat no .
340943 , bd biosciences)cd127 percp cy5.5 ( lot : 90916 , bd pharmingen , usa)cd3 fitc / cd16 56 pe ( cat no . 340042 , bd biosciences ) .
340133 , bd biosciences , usa ) cd25 pe ( cat no . 341009 , bd biosciences )
340943 , bd biosciences ) cd127 percp cy5.5 ( lot : 90916 , bd pharmingen , usa ) cd3 fitc / cd16 56 pe ( cat no . 340042 , bd biosciences ) .
data were obtained and analyzed using the facsdiva6.0 software ( bd biosciences ) . in order to identify the treg subsets ,
spss version 21.0 ( spss inc . , usa ) was used for statistical analysis .
differences of age ( years ) , tumor diameter ( cm ) , number of dissected ln , operation duration ( min ) and blood loss ( ml ) between vats and thoracotomy groups were determined by independent t - test .
chi - square and nonparametric test ( kruskal wallis test ) were used to compare the distribution of sex and tumor histopathology in these two groups .
time trend and variances in treg / nk level with the change in postoperative time in either vats or thoracotomy group were calculated by repeated measures test of general linear model ( glm ) according to mauchly 's test of sphericity results .
differences of treg / nk level between vats and thoracotomy groups were determined by one - way analysis of variance ( anova ) .
comparison of treg / nk level in various times after the operation with preoperative level as a control in each group was carried out by one - way anova dunnett t - test .
in total , 2284 dissected regional lns , 37 lns from 12 patients were pathologically diagnosed as positive for metastasis .
those 12 patients were then confirmed as advanced stage nsclc and were excluded from the study .
two vats procedures were converted to open thoracotomy after encountering lns firmly adhere to pulmonary vessels , imposing the high risk of massive hemorrhage .
eventually 98 stage i patients were enrolled , with 70 patients in vats group and 28 in thoracotomy group .
no patient withdrew , and no death or tumor recurrence was observed during the 3-month follow - up .
clinical demographics of patients in vats and thoracotomy groups * mean sd ; kruskal wallis test ; chi - square tests - fisher s exact test .
adeno : adenocarcinoma ; scc : squamous cell carcinoma ; vats : video - assisted thoracoscopic ; sd : standard deviation ; ln : lymph node
. flow cytometric analysis of treg cells and nk cells in the peripheral blood of vats and thoracotomy groups was demonstrated in figures 1 and 2 .
repeated measures test of glm results demonstrated that there were significant differences of treg / nk level in various times in each group ( f = 35.34 , p = 0.000 of nk , f = 6.284 , p = 0.000 of treg ) .
time trend was obvious in nk ( f = 72.972 , p = 0.000 ) but not significant in treg ( f = 16.74 , p = 0.185 ) .
level of nk was found increasing with the extension of postoperative recovery time in both vats and thoracotomy groups .
representative dot plot of cd4cd25cd127 expression in the peripheral blood from patients undergoing thoracotomy ( upper ) or video - assisted thoracoscopic ( lower ) .
cd4 cells were analyzed for cd25pe and cd127percp - cy5.5 staining , cd25 high expression , and low expression of cd127 were then gated .
representative dot plot of cd5616cd3 cells in the peripheral blood cd45 leukocytes from patients undergoing video - assisted thoracoscopic lobectomy ( upper ) or thoracotomy ( lower ) .
cd45 leukocytes were analyzed for cd3fitc / cd1656pe staining , subsequently cd1656 high expression , and negative expression of cd3 were gated .
comparison of treg / nk level in various times after operation with preoperative level as a control in each group was demonstrated in table 2 . in vats group ,
all postoperative treg levels were found statistically lower than preoperative status . in thoracotomy group , differently , significant lower treg percentages was only found on pod 30 ( 5.76 2.71 , p = 0.042 ) . in both groups , on pod 1 , nk percentages were significantly lower than preoperative status , and there was a clear rising time trend . in thoracotomy group
nevertheless , in vats group , nk population recovered to preoperative status on pod 3 and kept rising , and peripheral nk levels on pods 7 , 30 , and 90 were statistically higher than preoperative level [ table 2 ] .
comparison of postoperative treg / nk subpopulation with preoperative levels in vats and thoracotomy groups by one - way anova dunnett t - test pod : postoperative day ; nk : natural killer ; vats : video - assisted thoracoscopic ; treg : regulatory t - cells .
there was no significant difference on preoperative treg or nk levels between vats and thoracotomy groups ( treg : 7.61 3.08 vs. 8.01 4.20 , p = 0.603 ; nk : 18.44 6.19 vs. 19.28 7.63 , p = 0.572 ) .
furthermore , in comparison between treg levels in vats and thoracotomy groups , no significant difference was confirmed on pods 1 , 3 , 7 and 30 ( pod 1 : 5.88 2.81 vs. 5.98 2.59 , p = 0.874 ; pod 3 : 5.83 3.39 vs. 6.43 3.30 , p = 0.426 ; pod 7 : 5.32 3.15 vs. 6.39 2.70 , p = 0.117 ; pod 30 : 5.05 3.13 vs. 5.76 2.71 , p = 0.295 ) , unless that on pod 90 , treg percentages in vats group were significantly lower than those in thoracotomy group ( 5.26 2.75 vs. 6.99 3.60 , p = 0.012 ) [ figure 3a ] .
meanwhile , compared with thoracotomy group , in vats group , higher levels of nk were found on all pods except on pod 90 ( 15.38 6.39 vs. 12.60 5.68 on pod 1 , p = 0.024 ; 19.15 6.23 vs. 12.90 4.54 on pod 3 , p = 0.000 ; 20.78 6.62 vs. 16.16 7.40 on pod 7 , p = 0.003 ; 24.86 8.03 vs. 20.86 7.02 on pod 30 , p = 0.023 ; 25.90 8.52 vs. 22.72 7.34 on pod 90 , p = 0.087 ) [ figure 3b ] .
the results show that in stage i nsclc patients , vats approach indicates less inhibition and faster recovery of circulating nk cells , compared to thoracotomy . in our observation ,
comparison of peripheral regulatory t - cells ( a ) and natural killer cells ( b ) levels in patients undergoing video - assisted thoracoscopic lobectomy or thoracotomy by one - way anova , * p < 0.05 .
in total , 2284 dissected regional lns , 37 lns from 12 patients were pathologically diagnosed as positive for metastasis .
those 12 patients were then confirmed as advanced stage nsclc and were excluded from the study .
two vats procedures were converted to open thoracotomy after encountering lns firmly adhere to pulmonary vessels , imposing the high risk of massive hemorrhage .
eventually 98 stage i patients were enrolled , with 70 patients in vats group and 28 in thoracotomy group .
no patient withdrew , and no death or tumor recurrence was observed during the 3-month follow - up .
clinical demographics of patients in vats and thoracotomy groups * mean sd ; kruskal wallis test ; chi - square tests - fisher s exact test .
adeno : adenocarcinoma ; scc : squamous cell carcinoma ; vats : video - assisted thoracoscopic ; sd : standard deviation ; ln : lymph node .
flow cytometric analysis of treg cells and nk cells in the peripheral blood of vats and thoracotomy groups was demonstrated in figures 1 and 2 . repeated measures test of glm results demonstrated that there were significant differences of treg / nk level in various times in each group ( f = 35.34 , p = 0.000 of nk , f = 6.284 , p = 0.000 of treg ) .
( f = 72.972 , p = 0.000 ) but not significant in treg ( f = 16.74 , p = 0.185 ) . level of nk was found increasing with the extension of postoperative recovery time in both vats and thoracotomy groups .
representative dot plot of cd4cd25cd127 expression in the peripheral blood from patients undergoing thoracotomy ( upper ) or video - assisted thoracoscopic ( lower ) .
cd4 cells were analyzed for cd25pe and cd127percp - cy5.5 staining , cd25 high expression , and low expression of cd127 were then gated .
representative dot plot of cd5616cd3 cells in the peripheral blood cd45 leukocytes from patients undergoing video - assisted thoracoscopic lobectomy ( upper ) or thoracotomy ( lower ) .
cd45 leukocytes were analyzed for cd3fitc / cd1656pe staining , subsequently cd1656 high expression , and negative expression of cd3 were gated .
comparison of treg / nk level in various times after operation with preoperative level as a control in each group was demonstrated in table 2 . in vats group ,
all postoperative treg levels were found statistically lower than preoperative status . in thoracotomy group , differently , significant lower treg percentages was only found on pod 30 ( 5.76 2.71 , p = 0.042 ) . in both groups , on pod 1 , nk percentages were significantly lower than preoperative status , and there was a clear rising time trend . in thoracotomy group , nk population did not recover to preoperative level until pod 7 .
nevertheless , in vats group , nk population recovered to preoperative status on pod 3 and kept rising , and peripheral nk levels on pods 7 , 30 , and 90 were statistically higher than preoperative level [ table 2 ] .
comparison of postoperative treg / nk subpopulation with preoperative levels in vats and thoracotomy groups by one - way anova dunnett t - test pod : postoperative day ; nk : natural killer ; vats : video - assisted thoracoscopic ; treg : regulatory t - cells .
there was no significant difference on preoperative treg or nk levels between vats and thoracotomy groups ( treg : 7.61 3.08 vs. 8.01 4.20 , p = 0.603 ; nk : 18.44 6.19 vs. 19.28 7.63 , p = 0.572 ) .
furthermore , in comparison between treg levels in vats and thoracotomy groups , no significant difference was confirmed on pods 1 , 3 , 7 and 30 ( pod 1 : 5.88 2.81 vs. 5.98 2.59 , p = 0.874 ; pod 3 : 5.83 3.39 vs. 6.43 3.30 , p = 0.426 ; pod 7 : 5.32 3.15 vs. 6.39 2.70 , p = 0.117 ; pod 30 : 5.05 3.13 vs. 5.76 2.71 , p = 0.295 ) , unless that on pod 90 , treg percentages in vats group were significantly lower than those in thoracotomy group ( 5.26 2.75 vs. 6.99 3.60 , p = 0.012 ) [ figure 3a ] .
meanwhile , compared with thoracotomy group , in vats group , higher levels of nk were found on all pods except on pod 90 ( 15.38 6.39 vs. 12.60 5.68 on pod 1 , p = 0.024 ; 19.15 6.23 vs. 12.90 4.54 on pod 3 , p = 0.000 ; 20.78 6.62 vs. 16.16 7.40 on pod 7 , p = 0.003 ; 24.86 8.03 vs. 20.86 7.02 on pod 30 , p = 0.023 ; 25.90 8.52 vs. 22.72 7.34 on pod 90 , p = 0.087 ) [ figure 3b ] .
the results show that in stage i nsclc patients , vats approach indicates less inhibition and faster recovery of circulating nk cells , compared to thoracotomy . in our observation ,
comparison of peripheral regulatory t - cells ( a ) and natural killer cells ( b ) levels in patients undergoing video - assisted thoracoscopic lobectomy or thoracotomy by one - way anova , * p < 0.05 .
in spite of improvements on surgical skills , new chemical agents , evolution of radiation therapy , prognosis of lung cancer remains poor , the curing rate for nsclc is reported lower than 20% .
treg is a subset of t - cells with immune - suppressive function , defined by cd4cd25foxp3/cd127 .
treg is considered to play key roles in suppressing cell - mediated immunity in lung cancer patients . in nsclc patients ,
circulating treg levels were elevated from an early stage , and a higher level of treg in tumor tissue , regional lns , and peripheral blood is regarded as a negative prognostic factor .
interestingly , peripheral blood treg levels in advanced cancer patients dropped significantly after effective chemotherapy or chemo - radiation therapy , parallel to clinical remission .
as tumors may promote expansion , recruitment , and activation of treg , surgical tumor removal may directly lead to a reduction of treg population in cancer patients . after monitoring peripheral levels of treg in gastric and esophageous cancer patients , kono et al . reported that elevated number of cd4cd25 treg was significantly reduced after curative resection but increased again in the cases of cancer relapse .
recently , chen et al . reported a direct assessment of the perioperative circulating treg population in 36 nsclc patients , demonstrating decreased cd4 cd25 foxp3 treg percentages on pod 30 ( preoperative vs. pod 30 : 3.16% 1.32% vs. 2.46% 1.43% , p = 0.007 ) . similarly in our observation , in both vats and thoracotomy groups , cd4 cd25
cd127 treg levels dropped significantly and remained below preoperative status within 30 days after surgery .
that postoperative treg values in early stage patients were not statistically different from treg frequencies of control patients , which implies that tumor mediated immune suppression by treg may be completely eliminated after tumor removal in early nsclc . meanwhile , although with controversy , saito et al . suggested that treg could also be an efficient indicative biomarker for surgical invasiveness . in their study , markedly lower levels of peripheral treg were found after laparoscopic surgeries when compared to open ones . in this study , we examined circulating treg in nsclc patients undergoing major lung resection by vats or thoracotomy . to minimize the influence of tumor progression on treg level ,
only stage i patients were enrolled . to our knowledge , it is a relatively early continuous observation on postoperative treg population in stage i nsclc cases , focusing on variances of surgical invasiveness by vats or conventional thoracotomy
. mechanisms of expansion , recruitment , and activation of treg cells in postoperative patients are undoubtedly very complex , but tumor removal and surgical stress are believed to play important roles .
our study showed that peripheral cd4 cd25 cd127 treg proportions significantly dropped promptly after operations in both vats and thoracotomy groups , but there was no significant difference between the two groups on pods 1 , 3 , 7 , and 30 .
this result suggests that within the 1 month postoperative , direct tumor removal ceases the tumor mediated treg proliferation and release , and may be the most important factor on treg reduction in early postoperative period .
however , in vats group , treg proportion on pod 90 was found statistically lower than that in thoracotomy group .
it may be explained that the diminished surgical trauma by vats approach does not change the treg level directly , but gradually induces less immune disturbance in multiple ways and hence inhibits treg for a longer time .
less immune disturbance after vats lobectomy was previously shown in several researches on plasma immunomodulatory mediators and nk cells .
notably , differences in nearly all of the postoperative cytokines and plasma immunomodulatory mediators measured thus far between vats and thoracotomy groups are short - lived , in the order of hours to a couple of days . in our study , on pods 1 , 3 , 7 , 30 , nk cell numbers were found to be significantly higher following vats lobectomy compared to the open approach , suggesting that vats is associated with less inhibition and quicker recovery of nk cell than conventional thoracotomy .
the rationale behind remains to be fully elucidated and actually encompasses numerous factors , including reduced acute - phase cytokine responses and postoperative pain , differences in patient expectations , and possible psychological effects . on the contrary ,
the difference on treg levels between vats and thoracotomy group was not significant except on pod 90 .
this phenomenon suggests that , unlike plasma immune molecules and nk counts , difference of treg levels between vats and thoracotomy is a delayed and perhaps longer - lived marker for lesser immune disturbance .
thus , vats major lung resection for nsclc is associated with less postoperative immune - suppression when compared with the thoracotomy approach .
nevertheless , whether a better - preserved postoperative immune status could be linked to survival benefit remains uncertain .
study including large - scale randomized trial and longer time follow - up recording multiple immune function markers after vats and thoracotomy is needed for further evidence . however , for the reasons of patients intention and 2015 nccn recommendation for nsclc , it 's difficult to randomize patients into thoracotomy group .
in addition , diversities in vats technique may have additional effects on the postoperative immune markers . the correlation between treg proportions and histological subtypes in nsclc
several reports claimed higher treg proportions in adenocarcinoma than squamous carcinoma , but this difference seems existed in tumor and invaded lns , but not in peripheral blood .
it is also noteworthy that identification of pure or naive immune - suppressive treg population is still a challenge , explaining the varying results by different groups in clinical studies .
treg cells in cancer patients were initially determined by cd4 and cd25 co - expression . since the discovery of transcription factor foxp3 in 2003 , it became the most common marker for treg cells .
however , even the inclusion of foxp3 assessment has been interpreted differentially when assessing frequencies of treg cells in healthy individuals and cancer patients .
furthermore , given that foxp3 is an intracellular protein , detection of foxp3 requires permeabilization of cells ; hence this technique can not be used to isolate viable treg population .
on basis of several reports , the low cell - surface expression of cd127 allows for an accurate estimation of treg numbers and the isolation of pure populations for in vitro studies , providing a flexible alternative to the transcription factor foxp3 . on the other hand ,
moreover , klein et al . demonstrated these two markers did not represent the same population of treg cells .
recently , beyer et al . supported the superiority of combining cd127 and foxp3 for further quantification of treg cells in malignant diseases . in our study , cd4 cd25 cd127 were used to define treg cells .
the conclusion that vats better preserves postoperative cellular immune function from our observation is not going to be confirmed unless the cd4 cd25 cd127 cells assessed in our study displayed immune depressive activity in future in vitro or even in vivo studies . | background : regulatory t - cells ( treg ) play key roles in suppressing cell - mediated immunity in cancer patients . little is known about perioperative treg fluctuations in nonsmall cell lung cancer ( nsclc ) .
video - assisted thoracoscopic ( vats ) lobectomy , as a minimal invasive procedure for treating nsclc , may have relatively less impact on the patient 's immune system .
this study aimed to observe perioperative dynamics of circulating treg and natural killer ( nk ) cell levels in nsclc patients who underwent major lobectomy by vats or thoracotomy.methods:totally , 98 consecutive patients with stage i nsclc were recruited and assigned into vats or thoracotomy groups .
peripheral blood samples were taken on 1-day prior to operation , postoperative days ( pods ) 1 , 3 , 7 , 30 , and 90 .
circulating treg and nk cell counts were assayed by flow cytometry , defined as cd4+cd25+cd127low cells in cd4 + lymphocytes and cd56 + 16+cd3 cells within cd45 + leukocytes respectively . with spss software version 21.0 ( spss inc . ,
usa ) , differences between vats and thoracotomy groups were determined by one - way analysis of variance ( anova ) , and differences between preoperative baseline and pods in each group were evaluated by one - way anova dunnett t-test.results:in both groups , postoperative treg percentages were lower than preoperative status .
no statistical difference was found between vats and thoracotomy groups on pods 1 , 3 , 7 , and 30 . on pod 90 ,
treg percentage in vats group was significantly lower than in thoracotomy group ( 5.26 2.75 vs. 6.99 3.60 , p = 0.012 ) .
however , a higher level of nk was found on all pods except on pod 90 in vats group , comparing to thoracotomy group.conclusions:lower treg level on pod 90 and higher nk levels on pods 1 , 3 , 7 , 30 in vats group might imply better preserved cell - mediated immune function in nsclc patients , than those in thoracotomy group . |
over the last 60 years , work performed on animal models , chiefly mouse , rat , and avian , and on human samples , has revealed and explored the capacity of adult stem cells - also called somatic stem cells to self - renew and to differentiate into unipotent progeny within their residing tissue , generally for the purpose of repair .
resident stem cell populations have now been described in most tissues , including bone marrow , blood vessels , peripheral blood , skin , teeth , gut , liver , heart , brain and skeletal muscle .
once body growth has stopped and adulthood is reached , most of these stem cells become quiescent , and will only be activated for tissue turnover .
although this turnover can be very active as in circulating blood or gut epithelium in other tissues such as liver the stem cells usually remain unsolicited as hepatic damage rarely occurs in healthy adults . despite this heterogeneity , a decline in number and properties is universally observed in aged stem cells , a phenomenon which alters the maintenance of tissue homeostasis with aging . in aged skeletal muscle , a tissue with low turnover , this decline in the adult stem cell ( also called satellite cell ) , which is responsible for muscle repair ,
is associated with muscle atrophy and muscle weakness [ 1315 ] , although their depletion in the mouse has differential effects depending on the muscle .
muscle stem cells or satellite cells are localized beneath the basal lamina , peripheral to the muscle fibers , and express pax7 and notch3 .
after muscle injury , satellite cells are driven out of their quiescent state , and start to proliferate .
most of the activated satellite cells rapidly co - express myod or myf5 [ 16 , 18 ] .
the proliferating satellite cells - also called myogenic precursor cells or myoblasts - expand under the control of notch3 and notch1/hey1 pathways [ 19 , 20 ] .
they divide asymmetrically , with self - renewal of the stem cell pool being maintained by a minor population of myogenic precursor cells that down - regulate their expression of myod and myf5 and return to a quiescent state [ 18 , 2123 ] .
this asymmetrical division involves numb , an antagonist of the notch signalling pathway [ 19 , 24 ] .
numb is asymmetrically localized during myoblast mitosis and it is the cell that has a high level of numb that goes back to quiescence for self - renewal [ 19 , 2426 ] .
after several rounds of proliferation , activated myoblasts decrease their expression levels of pax7 , myf5 [ 16 , 18 ] and notch3 .
the notch1 pathway is then repressed by stra13 through the cbf1 pathway [ 20 , 27 ] .
myoblasts exit the cell cycle by expressing p57 , and then cyclin inhibitors - p21 and hypophosphorylated prb [ 3032 ] - together with higher levels myod followed by myogenin , a driver which triggers the expression of the differentiation genes [ 33 , 34 ] .
the myoblasts consequently undergo differentiation into myocytes , and fuse either with each other or with existing multi - nucleated myofibers in order to repair injured muscle [ 35 , 36 ] .
the differentiation and maturation process is regulated by mef2 , mef3 , and mrf4 pathways [ 3739 ] , while other factors , such as myomaker , are involved in fusion .
muscle precursor cell proliferation , fusion and differentiation are tightly orchestrated by circulating hormones ( e.g. growth hormone , testosterone [ 42 , 43 ] and thyroid hormones [ 44 , 45 ] ) , growth factors ( e.g. igf system , fgf system [ 4648 ] , tgf - b [ 49 , 50 ] ) , g - csf , chemokines ( e.g. interleukines [ 5255 ] , mpc [ 55 , 56 ] ) and other secreted components ( e.g. vesicles [ 57 , 58 ] ) present in the muscle stem cell environment . aged human or murine [ 6062 ] muscle can regenerate and repair , although the rate of regeneration declines [ 6062 ] .
this slower regeneration can be explained by : ( 1 ) changes in the muscle stem cell environment ( growth factors , growth hormones , inflammation , and extracellular matrix content ) ; ( 2 ) a lowered responsiveness of progenitor cells to repair stimuli ; and ( 3 ) decrease in the number of muscle stem cells with aging .
each of these factors may impact on muscle homeostasis and each may both participate to , and be affected by , age - associated changes in intercellular communication .
the subsequent sections will describe the different roles that intercellular communication may play in muscle aging , from hormonal and other circulating endocrine factors to local paracrine and autocrine secretory environment of the stem cell niche that may also modify the intrinsic properties of the stem cells themselves .
the decline in muscle regenerative capacity with age has been partly attributed to a decline in extrinsic environmental cues ( see fig . 1 ) .
levels of circulating hormones , such as testosterone or il-6 or growth hormone ( gh ) or igf-1 , are low in serum samples of aged subjects [ 6466 ] .
the endocrine hypothalamic - pituitary axis is altered with aging , leading to changes in hormone secretion that can contribute to cognitive decline or depression .
epidemiological studies have also shown a correlation between the decrease in growth hormone ( gh ) secretion and sarcopenia as well as other signatures of aging ( e.g. intra - abdominal adiposity , osteopenia , etc . ) .
it acts on myoblasts through its receptor ghr and activates nfatc2 that in turn stimulates the expression and secretion of il-4 [ 41 , 68 , 69 ] - il-4 being critical for myoblast fusion [ 68 , 69 ] .
gh also stimulates igf-1 secretion by both liver and muscle . igf-1 and its splice variants - igf-1ea and igf-1eb - modulate myoblast proliferation and differentiation through mapk and erk1/2 signalling .
the latter regulates myogenesis , for example by interacting with p38
mapk and the asymmetric division and self - renewal of satellite cells .
these age - associated changes in the endocrine hypothalamic - pituitary axis can have further effects on the gonadotropic axis .
sex - steroid privation associated with age participates to , among other phenomena , loss of muscle mass .
the sex - steroid testosterone , secreted by the testis , has been extensively studied in muscle , and can be considered as a double - sided blade , acting both on myoblast proliferation and differentiation .
it acts on myoblasts through the androgen receptor localized in the nucleus or through g protein - coupled receptors .
it promotes myoblast proliferation through protein kinase c ( pkc ) signaling - for instance through npkc and extracellular signal - regulated kinases 1 and 2 ( erk1/2 ) activation .
once erk1/2 is phosphorylated , it is accompanied by an increase in cyclin e and cdk2 which are involved in myoblast proliferation .
testosterone acts also on myoblast differentiation via protein kinase a ( pka ) signaling - pka being required for myoblast fusion [ 77 , 78 ] .
aging is associated with an increase in low grade chronic and systemic inflammation , also called inflammaging .
inflammaging could be due to microbial infection , cell debris , over - activated coagulation system , or an increase in cellular senescence with the associated changes in secretion .
indeed , while young macrophages have been shown to have a beneficial effect to clear muscle debris after injury and stimulate myogenesis [ 8183 ] , aged macrophages can release a higher level of osteopontin that inhibits the muscle regeneration process . not only macrophages are involved in the muscle regeneration process , but also neutrophils , lymphocytes , dendritic cells , etc .
these inflammatory cells secrete numerous chemokines and cytokines , but little is known about the impact of aging on cytokine secretion . in the literature , it is described that il-6 serum level is decreasing during aging .
it has been shown to be an important regulator of muscle stem cells , as it activates janus kinase 2 ( jak2 ) that will in turn phosphorylate stat3 .
once stat3 is phosphorylated , it homodimerizes and translocates to the nucleus to bind to the -interferon activation sequence in the promoter regions of genes involved in myoblast proliferation such as c - myc .
il-6 not only regulates myoblast proliferation , but also promotes myoblast differentiation through the p38 mapk pathway .
the tissues from which circulating factors originate , such as muscle , hypothalamus , gonads , and liver , become atrophic and less active with age [ 8 , 66 , 89 ] . this change in body composition and
activity with aging can thus participate to the decrease in circulating hormones ( see fig . 1 ) .
consequently , when muscle damage occurs in an aged person , satellite cells be less prone to activation and differentiation , leading to a less efficient repair .
elegantly showed that muscle regeneration could be partly rescued in aged mice exposed to serum from young mice through a parabiosis system .
similarly , hormones released during pregnancy rescued the muscle regenerative capacity of aged female mice . when aged subjects are trained , a rejuvenating effect is observed on muscle
this benefit effect could probably be due to a decrease of the inflammation for instance , as observed in exercised patients affected by myositis [ 92 , 93 ] .
when aged muscle stem cells were engrafted into young mice , their capacities to proliferate and differentiate were partly restored .
together these data suggest that circulating agents , which can originate from different tissues , impinge on muscle regeneration efficiency .
aging affects both the size and function of each tissue and consequently tissue secretory capacity .
in addition to its classical role as a locomotive system , skeletal muscle has recently been shown to have a secretory activity .
for instance , il-6 and musculin have been identified to originate from and be secreted by skeletal muscle in vivo . in vitro , the secretome profile of c2c12 myotubes [ 55 , 56 ] , human myotubes and rat muscle explants suggest that muscle cells secrete numerous growth factors ( e.g. follistatin like protein 1 , igf-2 , tgf , etc ) and cytokines
. secreted proteins - also named myokines - may act in an autocrine / paracrine manner on neighboring muscle cells and contribute to muscle growth and regeneration .
have shown that an increased secretion of fgf-2 by aged myofibers in mice inhibits sprouty1 expression in satellite cells , and consequently reduces their capacity to go back to quiescence and replenish the pool of the muscle stem cell .
the muscle secretome includes not only hormones , but also extracellular matrix components ( ecm , e.g. timp2 , fibronectin ) , mirnas , and vesicles ( exosomes and microvesicles ) [ 57 , 58 , 97 , 98 ] .
myocyte exosomes contain mirnas that inhibit sirtuin expression , and thus stimulate the myoblast differentiation into myotubes . a decrease in muscle mass with aging
may thus reduce muscle secretory output . in a transcriptomic analysis performed on quadriceps muscle from young ( 1524 years old ) and
elderly ( 7280 years old ) subjects , we indeed observed down - regulation of secretome markers in aged muscle .
however , little is known about the changes in the composition of the muscle secretome of aged muscle and further investigation is needed .
the local niche of muscle stem cells includes growth factors and cytokines secreted not only by the myofibers themselves , but also potentially by other cell types present within muscle , such as fibroblasts , endothelial or peri - endothelial cells [ 100 , 101 ] .
this local secretome can also be altered with aging ( fig . 2 ) .
for instance , fibroblasts present in aged skeletal muscle express a high level of tgf- a growth factor that inhibits differentiation of myoblasts , and thus slows down the regeneration process .
in addition , aging is described to be associated with an increase in senescent or pre - senescent cells in muscle and other tissue [ 103 , 104 ] . during the last decade ,
the secretome of senescent cells from different tissues has been investigated and has been described to have an impact on the inflammatory response ( by stimulating it in chronic obstructive pulmonary disease ) and to be instrumental in poor tissue regeneration ( as observed in aged skin ) .
altogether , these data suggest that the presence of senescent cells distinct from satellite cells within muscle tissue could alter these microenvironment of the satellite cells , and thus their behavior .
muscle perfusion is decreased with aging , which may render myofibers and satellite cells less accessible to circulating hormones .
indeed , sarcopenic muscle presents a disruption of the dystroglycan complex , leading to nos-1 mis - localization , due to the link of nos-1 to the dystrophin protein .
the mis - localization of nos-1 results in decreased no production , thereby diminishingmuscle perfusion .
aged skeletal muscle presents a thickening of the ecm and a general increase in fibrosis .
even if muscle fibers can secrete collagens and other components of the ecm [ 57 , 97 ] , little is known about their role in ecm thickening .
a recent study shows that fibroblasts present in aged rat muscles express a higher level of collagen iva2 and laminin 2 which may participate in the thickening of the ecm .
this increase in the ecm thickness can interfere with the muscle regeneration process by modifying myoblast activation , proliferation and migration [ 48 , 113 ] .
finally , a thickened ecm may act as a partial barrier , reducing the accessibility of the satellite cells to circulating growth factors , as observed for smooth muscle cells , and thus impair satellite cell activation and differentiation during musclerepair .
together , these data suggest that the changes in the secretory composition of the muscle stem cell s local niche with aging can slow down the regenerationprocess and decrease the replenishment of the pool of reserve cells
. repetitive iterations of this could contribute to the loss of muscle stem cells with aging .
exposure to a young environment by engraftment into young subjects or by parabiosis experiments only partly rescues the properties of aged satellite cells . for instance their capacity to replenish the pool of reserve cells
these data suggest that some intrinsic properties of satellite cells are altered with aging and are not easily manipulated by external cues .
intrinsic properties rely at least partly on dna methylation , which may regulate gene expression in two ways : ( 1 ) the accessibility of methylated enhancer regions to transcription factors is reduced , resulting in gene expression repression ; ( 2 ) methyl - cpg - binding proteins bind to methylated dna and alter the activity of histone deacetylases and methyltransferases . consequently , local histones are hypermethylated , stabilizing the nucleosomes , so that dna in methylated regions is tightly packed preventing binding of transcription factors or rna polymerases .
a recent study shows that histone methylation patterns are different between aged and young satellite cells in mice , and that the methylation profile can be modified by the presence of local growth factors such as fgf-2 .
the authors associated this histone methylation profile to a slower capacity of aged satellite cells to re - enter the cell cycle for aged satellite cells .
interestingly , this study , as well as our own observations on culture of aged human muscle stem cells , show that once activated , aged satellite cells have a similar myogenic potential to young satellite cells .
this indicates that muscle stem cells do not lose their differentiation potency with age , suggesting that the decrease with aging in the differentiation program during muscle regeneration is strongly related to changes in circulating factors .
dna methylation has been shown to be increased in several tissues with aging , and the skeletal muscle is no exception [ 119 , 120 ] .
we have observed a higher level of dna methylation in satellite cells of aged subjects ( unpublished data ) .
this hypermethylation could impact on the satellite cell fate and interfere with their capacity for self - renewal as observed in previously published studies ( our data and [ 47 , 115 ] ) .
repeated stress over time can be one of the parameters implicated , involving for instance reactive oxygen species ( ros ) . increased ros production with age
can be due to an increase in inflammation with aging or to mitochondrial dysfunction in aged muscle [ 123 , 124 ] .
a decrease of circulating gh is also associated with a higher level of ros and a lower level of anti - oxidants .
consequently , dna methyltransferases ( dnmt ) are recruited to the dna damage site , potentially inducing dna silencing of the region nearby .
when we re - analyzed the transcriptome data available online ( gse9103 ) , we indeed confirm a significant enrichment in the cellular response to oxidative stress in aged muscles ( fig .
ros diffuse easily through membranes of fibers , thus potentially affecting dna damage in neighboring satellite cells , and modifying their methylation status .
factors discussed above - changes in the composition of circulating hormones in serum , as well as in the microenvironment - could also modify the epigenetic status of satellite cells and thus their behavior during regeneration , slowing satellite cell activation and decreasing their capacity to go back to quiescence
the number of muscle stem cells declines with age in mouse [ 13 , 47 , 90 , 94 ] and humans [ 128 , 129 ] .
although this loss can be caused by an increase in cell death , cellular senescence , or a deficiency in re - quiescence , apoptosis is rarely observed in aged murine and human muscle stem cells [ 94 , 130 , 131 ] , suggesting that this can not by itself explain the loss of muscle stem cells with aging .
however , we can not exclude the fact that apoptosis is a short punctual event that may be missed experimentally .
cellular senescence - also called replicative senescence - is defined as a phenomenon by which normal diploid cells cease to divide .
it can be induced by telomere shortening that occurs during cell proliferation , and has been proposed to contribute to the loss of satellite cell function with aging .
furthermore , there may be insufficient activation and turnover of satellite cells to allow senescence to be a major contributor to stem cell decline .
satellite cells are rarely activated in healthy adult human or mouse , and once muscle growth is complete in young human adults , subsequent myonuclear turnover is slow , being estimated at 15 years during adulthood . in mouse models , myofiber growth by the addition of new nuclei through satellite cell fusion is completed by 21 days postnatally , and there is little evidence to suggest significant turnover . as discussed earlier , the capacity to re - quiesce through the sprouty1 pathway is decreased in aged stem cells [ 47 , 117 ] .
consequently , when satellite cells are activated for muscle repair in elderly subjects , they do not replenish the pool of reserve cells .
this failure of re - quiescence is a likely contributor to stem cell population decline .
the decrease in the number of satellite cells with aging can affect muscle homeostasis by altering the ecm composition .
indeed , aged muscle depleted in satellite cells in a pax7-dta murine model shows an increase in fibrotic deposition , while fiber size was unaffected .
resulting thickening of the ecm may increase myofiber fragility , and reduce the response of satellite cells to muscle damage , as discussed earlier .
therefore a loss of satellite cells could impinge directly upon muscle homeostasis , and exacerbate muscle fragility with aging .
the interplay between whole - body tissue composition , the quantity and content of circulating serum hormones , and whole - body stress , such as ros production , changes with age , and contributes to the decline in muscle mass and function ( fig . 4 ) .
increased stress can act through epigenetic marking of satellite cells , changing their intrinsic properties with age - aged satellite cells show a decrease in their activation rate due to epigenetic changes .
in addition , satellite cell number is decreased during aging , a loss that can contribute not only to a decreased regenerative capacity , but also to an increase in fibrotic deposition and ecm thickening . increased
muscle stiffness renders myofibers more fragile , requiring the activation of an already reduced and less responsive satellite cell population .
age - associated changes in the local signalling environment can affect the myogenic program causing a lower regeneration efficacy , a decrease in myonuclearturnover , and a failure in replenishing the pool of reserve cells , further contributing to the loss of muscle mass .
changes in the whole system of intercellular communication both at the whole - body scale and in muscle microenvironment may thus act as a vicious circle to exacerbate sarcopenia as the body ages .
it is noteworthy that most studies on muscle aging in the literature have been done on muscle stem cells , rather than myofibers , and thus emphasize the role of satellite cells in muscle mass maintenance .
the effect of hormones and cytokines and more generally the effect of aging on myofibers is difficult to assess directly and should not be neglected .
the myofibers themselves comprise the bulk of the muscle mass and are clearly a key part of the maintenance of their own mass with aging , as indicated by disequilibrium of protein synthesis and degradation or the expression of micropeptides such as myoregulin that have a key role in muscle performance .
| abstractaging is associated with both muscle weakness and a loss of muscle mass , contributing towards overall frailty in the elderly .
aging skeletal muscle is also characterised by a decreasing efficiency in repair and regeneration , together with a decline in the number of adult stem cells .
commensurate with this are general changes in whole body endocrine signalling , in local muscle secretory environment , as well as in intrinsic properties of the stem cells themselves .
the present review discusses the various mechanisms that may be implicated in these age - associated changes , focusing on aspects of cell - cell communication and long - distance signalling factors , such as levels of circulating growth hormone , il-6 , igf1 , sex hormones , and inflammatory cytokines .
changes in the local environment are also discussed , implicating il-6 , il-4 , fgf-2 , as well as other myokines , and processes that lead to thickening of the extra - cellular matrix .
these factors , involved primarily in communication , can also modulate the intrinsic properties of muscle stem cells , including reduced dna accessibility and repression of specific genes by methylation .
finally we discuss the decrease in the stem cell pool , particularly the failure of elderly myoblasts to re - quiesce after activation , and the consequences of all these changes on general muscle homeostasis . |
after arrival , rats were maintained on a constant 12-h light/12-h dark cycle with free access to water and ad libitum fed with a standard chow diet and allowed to acclimate for at least a week .
all procedures were approved by the institutional animal care and use committee ( iacuc ) of the university of pittsburgh , and were in accordance with the national research council 's guide for the care and use of laboratory animals .
chronic indwelling catheters were implanted in the left common carotid artery and the right jugular vein ( 18 ) .
three dietary groups were established 1 ) standard chow 2 ) high fat ( hf ; td 96001 , 45% of calories from fat ; harlan teklad , madison wi ) , and 3 ) high sucrose ( hs ; 68% of calories from sucrose and 11% of calories from fat ; research diet ) .
each of the three dietary groups was further divided into two subgroups ; one subgroup was injected via the carotid artery with gadolinium chloride ( gdcl3 ; sigma , st .
gdcl3 is a selective toxicant for kcs and is commonly used to deplete the liver of these cells ( 1921 ) . in the current study ,
depletion of kcs was evaluated by quantification of cd68 ( a macrophage marker)-positive cells by immunohistochemistry ( 19,20 ) and measurements of cd68 and f4/80 mrna levels using quantitative ( q)rt - pcr ( supplemental table 1 , available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-0016/dc1 ) .
one week prior to the beginning of diet exposures , all animals received two injections of a sterile filtered gdcl3 ( 10 mg / kg ) or saline solution into the carotid artery cannula ( at days 7 and 4 ) .
four further injections were administered during dietary exposures ( at days 0 , + 3 , + 7 , and + 10 ) . at day + 14
( i.e. , after 2 weeks of dietary exposure ) , animals were fasted overnight .
subsequently , animals were killed and tissues ( blood , liver , adipose tissue ) were isolated or animals underwent a hyperinsulinemic - euglycemic clamp ( see below ) and were then killed and tissues isolated . for all experiments , caloric intake , weight gain during diet exposures , and
the method for simultaneous isolation of hepatocytes and kcs from the same rat was adapted from smedsrd et al .
briefly , livers were perfused through the portal vein in situ with an oxygenenated modified ( no ca , and kh4po4 was substituted with nah2po4 ) krebs - henseleit buffer plus 2.5 mmol / l egta at 37c at a rate of 18 ml / min for 10 min ( 24 ) .
subsequently , 100 ml of krebs - henseleit buffer in the presence of ca ( 2.5 mmol / l ) and containing 0.04% collagenase ( type iv ; sigma ) was recirculated through the liver for 10 min .
the resulting cell suspension was filtered through a sterile 150-mesh nylon screen and centrifuged three times at 50 g at 4c for 2 min , and the cell pellet containing hepatocytes was further purified in a 30% percoll / dulbecco 's modified eagle 's medium ( dmem ) solution ( ge healthcare bioscience ab , uppsala , sweden ) by centrifugation at 50 g for 10 min .
the hepatocytes were plated at a density of 1.5 10 cells / well in collagen - coated ( sigma ) 6-well plates with complete dmem containing 10% fbs , 25 mmol / l glucose , 10 mmol / l hepes , 250 units / ml penicillin , and 250 g / ml streptomycin and incubated for 2 h at 37c in 5% co2 .
nonattached cells were removed by washing with pbs after 1 h. for isolation of kcs , the combined supernatant from the non - percoll centrifugations above was centrifuged at 50 g for 2 min , and the resulting supernatant ( enriched in nonparenchymal cells ) was centrifuged at 350 g for 5 min .
the cell pellet containing nonparenchymal cells was resuspended in 4 ml complete dmem medium and mixed with 6 ml 30% ( wt / vol ) histodenz ( sigma ) in pbs .
the resulting suspension was layered under 10 ml dmem containing 10% fbs and centrifuged at 1300 g for 20 min at 22c with the brake off .
subsequently , the cell pellet was suspended in dmem at a density of 1.0 10 cells per milliliter .
approximately 1.0 10 cells were then plated on transwell inserts ( 0.4-m pore size membrane ; corning , lowell , ma ) in 2 ml to allow attachment of kcs .
after 1 h , the medium containing non - kcs was replaced with fresh medium .
cell viability as assessed by trypan blue exclusion was greater than 95% for kcs and greater than 90% for hepatocytes .
4 ) , kc attachment was assessed by cd68 immunofluorescence ( abd serotec , killington , oxford , u.k . ) .
hepatocytes were incubated in the absence or presence of kcs , and/or lipopolysaccharide ( lps ; 500 ng / ml ) , and/or 0.4
mmol / l [ h]-palmitate ( 5 ci / ml ) for the measurement of fatty acid oxidation and esterification and triglyceride accumulation .
all fatty acid incubations were for 24 h , except for the measurement of fatty acid esterification where labeled palmitate was present for only 2 h after the 24-h coculture period . at the end of incubations ,
media were collected and cells were washed two times in an excess volume of ice - cold pbs , briefly treated with 12.5% trypsin - edta , and collected by scraping into 2 ml of pbs , centrifugation , and retention of the pellet for analysis of lipids and proteins . for all conditions , triplicate ( 3-well ) measurements were made in each experiment . for neutralizing antibody experiments , anti - tnf , anti
ifn- , at 5 g / ml . all antibodies were from r&d systems ( minneapolis , mn ) . for analysis of insulin
signaling pathways , cells were serum deprived for 2 h after 24-h coculture , and were subsequently stimulated with 100 nm insulin for 10 min .
after 2 washes with pbs containing 2 mmol / l protease inhibitors and phosphatase inhibitors , cells were scraped into phosphatidylinositol 3 kinase ( pi 3-kinase ) assay buffer or cell lysis buffer for subsequent analysis .
for the assessment of basal hepatic glucose output ( hgo ) , a 10-ci [ 3-h]-glucose bolus was administered intravenously followed by a 120-min infusion at a rate of 0.1 ci / min .
arterial blood samples were taken at 60 , 90 , and 120 min for the determination of plasma glucose specific activity . to assess insulin suppression of hgo
, a constant rate insulin ( humulin ; eli lilly ) infusion ( 4 mu kg min ) and a variable rate glucose infusion commenced at + 120 min , and the [ 3-h]-glucose infusion continued at a rate of 0.18 ci / min for another 90 min .
blood glucose concentration was monitored at 10-min intervals to determine the exogenous glucose infusion rate necessary to maintain euglycemia .
blood samples taken during the final 30 min of the clamp were used to assess plasma radioactivity for the determination of hgo and the glucose disposal rate ( gdr ) ( 25,26 ) . for immunohistochemistry , tissues ( liver and epididymal fat )
cd68-positive cells were detected using -cd68 ( abd serotec ) and were quantified on 89 fields of 40 sections using an olympus ( new york , ny ) light microscope . for immunofluorescence , cd68 and tnf were detected in liver sections after antigen retrieval by heating sections in 1.6 mmol / l edta in a high - pressure cooker for 7 min .
subsequently , sections were immunostained with -cd68 ( 1:200 ) and -tnf ( 1:100 ; mbl , woburn , ma ) followed by incubation with alexa 488conjugated or cyanin 3conjugated secondary antibodies , respectively .
images were visualized using an olympus provis fluorescence microscope and modified with magnafire software ( olympus , melville , ny ) .
triglycerides , diacylglycerol ( dag ) , ceramide , fatty acid oxidation , and fatty acid esterification were determined as described previously ( 27,28 ) .
cholesterol was assessed using the infinity cholesterol kit ( thermo , rockford , il ) .
insulin receptor substrate 1 ( irs-1)associated pi 3-kinase activity , and irs-1 , insulin receptor ( ir ) , acetyl - coa carboxylase ( acc ) , amp - activated protein kinase ( ampk ) , and akt phosphorylation were determined as previously described ( 24,29 ) .
tnf ( by elisa ; r&d systems ) , lps ( limulus amebocyte lysate assay ; lonza bioscience , walkersville , md ) , insulin ( by elisa ; alpco , salem , nh ) , and free fatty acids ( roche , indianapolis , in ) were measured using commercial kits according to the protocols provided by the manufacturer .
gene expression was measured using quantitative real - time pcr ( supplemental table 1 ) as previously described ( 30 ) .
statistical significance was determined by t test and , where appropriate , one - way anova ( bonferroni post hoc test ) was performed using the systat statistical program ( evanston , il ) .
after arrival , rats were maintained on a constant 12-h light/12-h dark cycle with free access to water and ad libitum fed with a standard chow diet and allowed to acclimate for at least a week .
all procedures were approved by the institutional animal care and use committee ( iacuc ) of the university of pittsburgh , and were in accordance with the national research council 's guide for the care and use of laboratory animals .
chronic indwelling catheters were implanted in the left common carotid artery and the right jugular vein ( 18 ) .
three dietary groups were established 1 ) standard chow 2 ) high fat ( hf ; td 96001 , 45% of calories from fat ; harlan teklad , madison wi ) , and 3 ) high sucrose ( hs ; 68% of calories from sucrose and 11% of calories from fat ; research diet ) .
each of the three dietary groups was further divided into two subgroups ; one subgroup was injected via the carotid artery with gadolinium chloride ( gdcl3 ; sigma , st .
gdcl3 is a selective toxicant for kcs and is commonly used to deplete the liver of these cells ( 1921 ) . in the current study ,
depletion of kcs was evaluated by quantification of cd68 ( a macrophage marker)-positive cells by immunohistochemistry ( 19,20 ) and measurements of cd68 and f4/80 mrna levels using quantitative ( q)rt - pcr ( supplemental table 1 , available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-0016/dc1 ) .
one week prior to the beginning of diet exposures , all animals received two injections of a sterile filtered gdcl3 ( 10 mg / kg ) or saline solution into the carotid artery cannula ( at days 7 and 4 ) .
four further injections were administered during dietary exposures ( at days 0 , + 3 , + 7 , and + 10 ) . at day + 14 ( i.e. , after 2 weeks of dietary exposure ) , animals were fasted overnight .
subsequently , animals were killed and tissues ( blood , liver , adipose tissue ) were isolated or animals underwent a hyperinsulinemic - euglycemic clamp ( see below ) and were then killed and tissues isolated . for all experiments , caloric intake , weight gain during diet exposures , and
the method for simultaneous isolation of hepatocytes and kcs from the same rat was adapted from smedsrd et al .
, livers were perfused through the portal vein in situ with an oxygenenated modified ( no ca , and kh4po4 was substituted with nah2po4 ) krebs - henseleit buffer plus 2.5 mmol / l egta at 37c at a rate of 18 ml / min for 10 min ( 24 ) .
subsequently , 100 ml of krebs - henseleit buffer in the presence of ca ( 2.5 mmol / l ) and containing 0.04% collagenase ( type iv ; sigma ) was recirculated through the liver for 10 min .
the resulting cell suspension was filtered through a sterile 150-mesh nylon screen and centrifuged three times at 50 g at 4c for 2 min , and the cell pellet containing hepatocytes was further purified in a 30% percoll / dulbecco 's modified eagle 's medium ( dmem ) solution ( ge healthcare bioscience ab , uppsala , sweden ) by centrifugation at 50 g for 10 min .
the hepatocytes were plated at a density of 1.5 10 cells / well in collagen - coated ( sigma ) 6-well plates with complete dmem containing 10% fbs , 25 mmol / l glucose , 10 mmol / l hepes , 250 units / ml penicillin , and 250 g / ml streptomycin and incubated for 2 h at 37c in 5% co2 .
nonattached cells were removed by washing with pbs after 1 h. for isolation of kcs , the combined supernatant from the non - percoll centrifugations above was centrifuged at 50 g for 2 min , and the resulting supernatant ( enriched in nonparenchymal cells ) was centrifuged at 350 g for 5 min .
the cell pellet containing nonparenchymal cells was resuspended in 4 ml complete dmem medium and mixed with 6 ml 30% ( wt / vol ) histodenz ( sigma ) in pbs .
the resulting suspension was layered under 10 ml dmem containing 10% fbs and centrifuged at 1300 g for 20 min at 22c with the brake off .
subsequently , the cell pellet was suspended in dmem at a density of 1.0 10 cells per milliliter .
approximately 1.0 10 cells were then plated on transwell inserts ( 0.4-m pore size membrane ; corning , lowell , ma ) in 2 ml to allow attachment of kcs .
after 1 h , the medium containing non - kcs was replaced with fresh medium .
cell viability as assessed by trypan blue exclusion was greater than 95% for kcs and greater than 90% for hepatocytes . in preliminary experiments ( supplemental fig .
4 ) , kc attachment was assessed by cd68 immunofluorescence ( abd serotec , killington , oxford , u.k . ) .
hepatocytes were incubated in the absence or presence of kcs , and/or lipopolysaccharide ( lps ; 500 ng / ml ) , and/or 0.4 mmol / l [ h]-palmitate ( 5 ci / ml ) for the measurement of fatty acid oxidation and esterification and triglyceride accumulation . all fatty acid incubations were for 24 h , except for the measurement of fatty acid esterification where labeled palmitate was present for only 2 h after the 24-h coculture period . at the end of incubations ,
media were collected and cells were washed two times in an excess volume of ice - cold pbs , briefly treated with 12.5% trypsin - edta , and collected by scraping into 2 ml of pbs , centrifugation , and retention of the pellet for analysis of lipids and proteins . for all conditions ,
triplicate ( 3-well ) measurements were made in each experiment . for neutralizing antibody experiments , anti - tnf , anti
ifn- , at 5 g / ml . all antibodies were from r&d systems ( minneapolis , mn ) . for analysis of insulin
signaling pathways , cells were serum deprived for 2 h after 24-h coculture , and were subsequently stimulated with 100 nm insulin for 10 min .
after 2 washes with pbs containing 2 mmol / l protease inhibitors and phosphatase inhibitors , cells were scraped into phosphatidylinositol 3 kinase ( pi 3-kinase ) assay buffer or cell lysis buffer for subsequent analysis .
hyperinsulinemic - euglycemic clamps were performed as previously described ( 18 ) . for the assessment of basal hepatic glucose output ( hgo ) ,
a 10-ci [ 3-h]-glucose bolus was administered intravenously followed by a 120-min infusion at a rate of 0.1 ci / min .
arterial blood samples were taken at 60 , 90 , and 120 min for the determination of plasma glucose specific activity . to assess insulin suppression of hgo , a constant rate insulin ( humulin ; eli lilly ) infusion ( 4 mu kg min ) and a variable rate glucose infusion commenced at + 120 min , and the [ 3-h]-glucose infusion continued at a rate of 0.18 ci / min for another 90 min .
blood glucose concentration was monitored at 10-min intervals to determine the exogenous glucose infusion rate necessary to maintain euglycemia .
blood samples taken during the final 30 min of the clamp were used to assess plasma radioactivity for the determination of hgo and the glucose disposal rate ( gdr ) ( 25,26 ) .
for immunohistochemistry , tissues ( liver and epididymal fat ) were fixed overnight in a 4% paraformaldehyde solution , and subsequently embedded in paraffin .
cd68-positive cells were detected using -cd68 ( abd serotec ) and were quantified on 89 fields of 40 sections using an olympus ( new york , ny ) light microscope . for immunofluorescence , cd68 and tnf were detected in liver sections after antigen retrieval by heating sections in 1.6 mmol / l edta in a high - pressure cooker for 7 min .
subsequently , sections were immunostained with -cd68 ( 1:200 ) and -tnf ( 1:100 ; mbl , woburn , ma ) followed by incubation with alexa 488conjugated or cyanin 3conjugated secondary antibodies , respectively .
images were visualized using an olympus provis fluorescence microscope and modified with magnafire software ( olympus , melville , ny ) .
triglycerides , diacylglycerol ( dag ) , ceramide , fatty acid oxidation , and fatty acid esterification were determined as described previously ( 27,28 ) .
cholesterol was assessed using the infinity cholesterol kit ( thermo , rockford , il ) .
insulin receptor substrate 1 ( irs-1)associated pi 3-kinase activity , and irs-1 , insulin receptor ( ir ) , acetyl - coa carboxylase ( acc ) , amp - activated protein kinase ( ampk ) , and akt phosphorylation were determined as previously described ( 24,29 ) .
tnf ( by elisa ; r&d systems ) , lps ( limulus amebocyte lysate assay ; lonza bioscience , walkersville , md ) , insulin ( by elisa ; alpco , salem , nh ) , and free fatty acids ( roche , indianapolis , in ) were measured using commercial kits according to the protocols provided by the manufacturer .
gene expression was measured using quantitative real - time pcr ( supplemental table 1 ) as previously described ( 30 ) .
statistical significance was determined by t test and , where appropriate , one - way anova ( bonferroni post hoc test ) was performed using the systat statistical program ( evanston , il ) .
to begin to address the role of kcs in dysregulated hepatic metabolism , we first determined the metabolic effects of 2 weeks of hf or hs feeding in rats in the absence and presence of kcs .
1a ) , increased liver cholesterol and dag , but not ceramide levels ( fig .
d ) , and induced systemic hypertriglyceridemia ( table 1 ) without increasing adiposity or body weight gain ( table 1 ) , compared with standard chow ( sc)fed controls . there was a trend toward an increase in systemic tnf levels on the hf diet , but this increase did not attain statistical significance ( table 1 ) . finally ,
although fasting plasma insulin and glucose concentrations were similar in all diet groups , hf and hs induced hepatic insulin resistance as measured by the glucose clamp ( fig .
thus , hgo during the glucose clamp was elevated 40% in hs- and hf - fed animals compared with controls ( fig .
this corresponded to a decrease in the capacity of insulin to suppress hgo of 29 in hf- and 28% in hs - fed animals compared with 58% in controls ( fig .
basal hgo and clamp gdr were similar in sc- , hf- , and hs - fed animals ( supplemental fig .
depletion of kcs by gdcl3 decreased liver mrna levels of the kc - specific markers cd68/ed1 and f4/80 by 50 and 80% , respectively ( fig .
histochemical analysis of liver confirmed an 70% decrease in cd68/ed1-positive cells ( fig . 3c and e ) .
interestingly , adipose tissues levels of the same markers were unaltered by gdcl3 ( fig .
furthermore , the effects of gdcl3 were independent of diet , whereas a hf or hs diet had no effects on liver kcs or adipose tissue macrophage ( atm ) numbers in control ( saline - treated ) animals ( supplemental fig .
2 ) . although the depletion of kcs had no effects on liver triglyceride levels in sc - fed animals , the development of hepatic steatosis was prevented in hf- and hs - fed animals ( fig .
however , plasma hypertriglyceridemia was not resolved by kc depletion ( table 1 ) , and indeed , there was a trend toward increased triglycerides ( tgs ) in kc - depleted hs- and hf - fed , but not sc - fed , animals .
liver peroxisome proliferator activated receptor- ( ppar ) and acc1 gene expression were increased in kc - depleted hf and hs , and cpt1 expression trended upward , with no changes in mttp , lcad , or dgat2 expression ( fig .
hepatic insulin resistance induced by hf and hs diets was prevented in kc - depleted animals ( fig .
2 ) , and there were no effects on fasting glucose or insulin concentrations ( table 1 ) , or basal hgo and clamp gdr ( supplemental fig .
1 ) . the effects of kc depletion on liver triglycerides , dag , ceramide , and cholesterol in response to a high - fat or high - sucrose diet .
male wistar rats depleted of kcs or control rats were exposed to a high - fat or high - sucrose diet for 2 weeks as described in research design and methods .
subsequently , animals were killed after an overnight fast , livers were isolated , and triglyceride ( a ) , dag ( b ) , cholesterol ( c ) , and ceramide ( d ) content of the liver was determined .
body weight , epididymal fat , and plasma measurements in the saline- or gdcl3-treated rats exposed to nc , hf , or hs diets for 2 weeks data are means se ; n = minimum 5/group except post - clamp sc insulin where n = 3 .
values for tgs , ffas , tnf , and lps are from overnight - fasted , preclamp blood samples . * significantly different from nc saline .
the effects of kc depletion on the development of liver insulin resistance on a high - fat or high - sucrose diet .
male wistar rats depleted of kcs or control rats were exposed to a high - fat ( a and b ) or high - sucrose ( c and d ) diet for 2 weeks .
subsequently , animals were fasted overnight and then underwent 4 mu kg min euglycemic - hyperinsulinemic clamp in the presence of [ 3-h]-glucose for the measurement of hepatic insulin sensitivity as described in research design and methods .
hepatic glucose output ( a and c ) and insulin suppression of hepatic glucose output ( b and d ) were assessed .
male wistar rats were depleted of kcs by administration of gdcl3 as described in research design and methods .
subsequently , liver and adipose tissue were isolated and the presence of macrophages was determined by qrt - pcr assessment of cd68/ed1 and f4/80 mrna levels ( a and b ) and counting of cd68/ed1-positive cells after immunohistochemical staining of liver and adipose tissue sections ( c f ) as described in research design and methods .
n = a minimum of six in each group for qrt - pcr and n = 3 for immunohistochemical analysis of cd68/ed1-positive cells .
( a high - quality digital representation of this figure is available in the online issue . ) expression of lipid metabolism genes in the liver of sc- , hf- , and hs - fed rats with or without gdcl3 administration .
male wistar rats were depleted of kcs by administration of gdcl3 as described in research design and methods .
subsequently , liver was isolated , rna was extracted , and the expression of a number of lipid metabolism genes was determined by qrt - pcr .
the demonstration that a liver depleted of kcs is protected against diet - induced steatosis and insulin resistance implicates a mechanistic role for these cells in the determination of hepatic insulin sensitivity and the regulation of lipid metabolism .
however , this in vivo study does not directly assess the effects of kcs on hepatocyte metabolism and insulin action .
studies provide supportive evidence in this regard , demonstrating that lps injection rapidly induces steatosis ( 31 ) , whereas mice with macrophages lacking the ability to m2 polarize have decreased hepatocyte oxidative metabolism and steatosis ( 15,16 ) . again , however , these data implicate , rather then demonstrate , a role for kcs in hepatocyte metabolic abnormalities . to more
directly address this issue , a coculture system composed of kcs and hepatocytes isolated from the same rat liver was used .
4 ) were incubated in the presence of lps and free fatty acids to induce m1 polarization and , subsequently , readouts of lipid metabolism and insulin action in hepatocytes were assessed .
importantly , lps alone had no effect on hepatocyte triglyceride , fatty acid esterification , or fatty acid oxidation ( fig .
c ) . however , when kcs were present , hepatocyte triglycerides and fatty acid esterification were increased , and fatty acid oxidation was decreased . furthermore ,
phospho - acc was decreased , with a trend toward decreased phospho - ampk ( fig .
f ) . lipogenesis ( as measured by c - acetate incorporation into total lipids ) , was not increased by kcs ( supplemental fig .
thus , m1 activation of kcs resulted in a marked decrease in insulin 's capacity to stimulate phosphorylation of the insulin receptor and irs-1 , pi 3-kinase activity , and akt phosphorylation ( fig .
notably , saturated fatty acids alone in the presence of kcs induced decreases in hepatocyte fatty acid oxidation , and increases in fatty acid esterification , but did not alter triglyceride levels ( supplemental fig .
the effects of m1-polarized kcs on hepatocyte fatty acid oxidation and esterification and triglyceride accumulation .
hepatocytes and kcs were isolated from rat livers , plated , and cultured as described in research design and methods .
subsequently , the effects of the indicated exposures on fatty acid oxidation , fatty acid esterification , and triglyceride levels ( a c ) and acc and ampk phosphorylation ( d f ) were assessed as described in research design and methods .
were isolated from rat livers , plated , and cultured as described in research design and methods .
/ l insulin for 10 min , and protein extracts were prepared and insulin receptor ( ir ) phosphorylation , irs-1 phosphorylation , irs-1associated pi 3-kinase activity , and akt phosphorylation were assessed as described in research design and methods .
the data presented above demonstrate metabolic cross talk between kcs and hepatocytes , which results in altered lipid metabolism and insulin sensitivity , but do not address the biochemical mechanisms of these effects .
an obvious candidate mechanism is tnf , because it has a well - described role in the pathogenesis of insulin resistance , has been implicated in the development of dyslipidemia and steatosis , and is a prototypical m1 cytokine produced by macrophages when they are activated ( 3239 ) . to address this possibility
, we first evaluated the effects of overnutrition on tnf production by kcs in our model systems .
importantly , in both hs- and hf - fed animals kcs had increased tnf , and this increase was not present in kcs of sc - fed animals as assessed by immunofluorescence ( fig .
we next directly evaluated the potential role of this cytokine in the adverse effects of kcs on hepatocyte lipid metabolism and insulin responsiveness , using fatty acid oxidation , triglyceride accumulation , and pi 3-kinase activity as readouts , respectively . in response to lps exposure ,
kcs increased production of tnf , an effect that was substantially greater than that observed when hepatocytes were exposed to lps alone ( fig .
7b ) . importantly , blocking of tnf activity using a tnf-neutralizing antibody resulted in an improvement of the adverse effects of kcs on hepatocyte fatty acid oxidation and accumulation of tgs ( fig .
notably , neutralizing antibodies against a panel of other m1-associated cytokines ( il-1 , il-1 , il-6 , ifn- , ifn- , il-12 , il-18 ) were unable to prevent the effects of m1-polarized kcs on hepatocyte lipid metabolism ( supplemental fig . 7 ) .
tnf expression in kcs in liver in response to standard chow , high - fat , and high - sucrose diets and tnf secretion from isolated m1-polarized kcs .
male wistar rats were exposed to a high - fat or high - sucrose diet for 2 weeks .
subsequently , the livers were isolated , sections were prepared , and immunofluorescent staining for kcs and tnf was performed ( a ) , as described in research design and methods .
the left panel shows cd68/ed1-positive cells ( green ) , the center panels show tnf-positive cells ( red ) , and the right panels show the merged images . in all panels ,
n = a minimum of three . for in vitro experiments ( b ) , hepatocytes and kcs were isolated from rat livers , plated , and cultured as shown .
after the indicated exposures , media were taken and tnf was quantified by enzyme - linked immunosorbent assay ( elisa ) .
( a high - quality digital representation of this figure is available in the online issue . ) the effects of tnf depletion on hepatocyte lipid metabolism and insulin - stimulated pi 3-kinase activity .
hepatocytes and kcs were isolated from rat livers , plated , and cultured as described in research design and methods .
subsequently , the effects of the indicated exposures on fatty acid oxidation and triglycerides in the absence or presence of a tnf-neutralizing antibody were assessed as described in research design and methods ( a ) . in separate experiments
, hepatocytes were incubated with 100 nmol / l insulin for 10 min after similar exposures to those in ( a ) , proteins extracts were then prepared , and irs-1associated pi 3-kinase activity was assessed as described in research design and methods ( b ) .
n = a minimum of six for each experimental condition , except for triglycerides ( n = 3 ) .
to begin to address the role of kcs in dysregulated hepatic metabolism , we first determined the metabolic effects of 2 weeks of hf or hs feeding in rats in the absence and presence of kcs .
1a ) , increased liver cholesterol and dag , but not ceramide levels ( fig .
d ) , and induced systemic hypertriglyceridemia ( table 1 ) without increasing adiposity or body weight gain ( table 1 ) , compared with standard chow ( sc)fed controls . there was a trend toward an increase in systemic tnf levels on the hf diet , but this increase did not attain statistical significance ( table 1 ) . finally ,
although fasting plasma insulin and glucose concentrations were similar in all diet groups , hf and hs induced hepatic insulin resistance as measured by the glucose clamp ( fig .
thus , hgo during the glucose clamp was elevated 40% in hs- and hf - fed animals compared with controls ( fig .
this corresponded to a decrease in the capacity of insulin to suppress hgo of 29 in hf- and 28% in hs - fed animals compared with 58% in controls ( fig .
basal hgo and clamp gdr were similar in sc- , hf- , and hs - fed animals ( supplemental fig .
depletion of kcs by gdcl3 decreased liver mrna levels of the kc - specific markers cd68/ed1 and f4/80 by 50 and 80% , respectively ( fig .
histochemical analysis of liver confirmed an 70% decrease in cd68/ed1-positive cells ( fig . 3c and e ) .
interestingly , adipose tissues levels of the same markers were unaltered by gdcl3 ( fig .
furthermore , the effects of gdcl3 were independent of diet , whereas a hf or hs diet had no effects on liver kcs or adipose tissue macrophage ( atm ) numbers in control ( saline - treated ) animals ( supplemental fig .
2 ) . although the depletion of kcs had no effects on liver triglyceride levels in sc - fed animals , the development of hepatic steatosis was prevented in hf- and hs - fed animals ( fig .
however , plasma hypertriglyceridemia was not resolved by kc depletion ( table 1 ) , and indeed , there was a trend toward increased triglycerides ( tgs ) in kc - depleted hs- and hf - fed , but not sc - fed , animals .
liver peroxisome proliferator activated receptor- ( ppar ) and acc1 gene expression were increased in kc - depleted hf and hs , and cpt1 expression trended upward , with no changes in mttp , lcad , or dgat2 expression ( fig .
hepatic insulin resistance induced by hf and hs diets was prevented in kc - depleted animals ( fig .
2 ) , and there were no effects on fasting glucose or insulin concentrations ( table 1 ) , or basal hgo and clamp gdr ( supplemental fig .
1 ) . the effects of kc depletion on liver triglycerides , dag , ceramide , and cholesterol in response to a high - fat or high - sucrose diet .
male wistar rats depleted of kcs or control rats were exposed to a high - fat or high - sucrose diet for 2 weeks as described in research design and methods .
subsequently , animals were killed after an overnight fast , livers were isolated , and triglyceride ( a ) , dag ( b ) , cholesterol ( c ) , and ceramide ( d ) content of the liver was determined .
body weight , epididymal fat , and plasma measurements in the saline- or gdcl3-treated rats exposed to nc , hf , or hs diets for 2 weeks data are means se ; n = minimum 5/group except post - clamp sc insulin where n = 3 .
values for tgs , ffas , tnf , and lps are from overnight - fasted , preclamp blood samples . * significantly different from nc saline .
the effects of kc depletion on the development of liver insulin resistance on a high - fat or high - sucrose diet .
male wistar rats depleted of kcs or control rats were exposed to a high - fat ( a and b ) or high - sucrose ( c and d ) diet for 2 weeks .
subsequently , animals were fasted overnight and then underwent 4 mu kg min euglycemic - hyperinsulinemic clamp in the presence of [ 3-h]-glucose for the measurement of hepatic insulin sensitivity as described in research design and methods .
hepatic glucose output ( a and c ) and insulin suppression of hepatic glucose output ( b and d ) were assessed .
male wistar rats were depleted of kcs by administration of gdcl3 as described in research design and methods .
subsequently , liver and adipose tissue were isolated and the presence of macrophages was determined by qrt - pcr assessment of cd68/ed1 and f4/80 mrna levels ( a and b ) and counting of cd68/ed1-positive cells after immunohistochemical staining of liver and adipose tissue sections ( c f ) as described in research design and methods .
n = a minimum of six in each group for qrt - pcr and n = 3 for immunohistochemical analysis of cd68/ed1-positive cells .
( a high - quality digital representation of this figure is available in the online issue . ) expression of lipid metabolism genes in the liver of sc- , hf- , and hs - fed rats with or without gdcl3 administration .
male wistar rats were depleted of kcs by administration of gdcl3 as described in research design and methods .
subsequently , liver was isolated , rna was extracted , and the expression of a number of lipid metabolism genes was determined by qrt - pcr .
the demonstration that a liver depleted of kcs is protected against diet - induced steatosis and insulin resistance implicates a mechanistic role for these cells in the determination of hepatic insulin sensitivity and the regulation of lipid metabolism .
however , this in vivo study does not directly assess the effects of kcs on hepatocyte metabolism and insulin action .
studies provide supportive evidence in this regard , demonstrating that lps injection rapidly induces steatosis ( 31 ) , whereas mice with macrophages lacking the ability to m2 polarize have decreased hepatocyte oxidative metabolism and steatosis ( 15,16 ) . again , however , these data implicate , rather then demonstrate , a role for kcs in hepatocyte metabolic abnormalities . to more
directly address this issue , a coculture system composed of kcs and hepatocytes isolated from the same rat liver was used .
4 ) were incubated in the presence of lps and free fatty acids to induce m1 polarization and , subsequently , readouts of lipid metabolism and insulin action in hepatocytes were assessed .
importantly , lps alone had no effect on hepatocyte triglyceride , fatty acid esterification , or fatty acid oxidation ( fig .
c ) . however , when kcs were present , hepatocyte triglycerides and fatty acid esterification were increased , and fatty acid oxidation was decreased . furthermore
, phospho - acc was decreased , with a trend toward decreased phospho - ampk ( fig .
lipogenesis ( as measured by c - acetate incorporation into total lipids ) , was not increased by kcs ( supplemental fig .
thus , m1 activation of kcs resulted in a marked decrease in insulin 's capacity to stimulate phosphorylation of the insulin receptor and irs-1 , pi 3-kinase activity , and akt phosphorylation ( fig .
notably , saturated fatty acids alone in the presence of kcs induced decreases in hepatocyte fatty acid oxidation , and increases in fatty acid esterification , but did not alter triglyceride levels ( supplemental fig .
the effects of m1-polarized kcs on hepatocyte fatty acid oxidation and esterification and triglyceride accumulation . hepatocytes and
kcs were isolated from rat livers , plated , and cultured as described in research design and methods .
subsequently , the effects of the indicated exposures on fatty acid oxidation , fatty acid esterification , and triglyceride levels ( a c ) and acc and ampk phosphorylation ( d
were isolated from rat livers , plated , and cultured as described in research design and methods .
after the indicated exposures , hepatocytes were incubated with 100 nmol / l insulin for 10 min , and protein extracts were prepared and insulin receptor ( ir ) phosphorylation , irs-1 phosphorylation , irs-1associated pi 3-kinase activity , and akt phosphorylation were assessed as described in research design and methods .
the data presented above demonstrate metabolic cross talk between kcs and hepatocytes , which results in altered lipid metabolism and insulin sensitivity , but do not address the biochemical mechanisms of these effects .
an obvious candidate mechanism is tnf , because it has a well - described role in the pathogenesis of insulin resistance , has been implicated in the development of dyslipidemia and steatosis , and is a prototypical m1 cytokine produced by macrophages when they are activated ( 3239 ) . to address this possibility
, we first evaluated the effects of overnutrition on tnf production by kcs in our model systems .
importantly , in both hs- and hf - fed animals kcs had increased tnf , and this increase was not present in kcs of sc - fed animals as assessed by immunofluorescence ( fig .
we next directly evaluated the potential role of this cytokine in the adverse effects of kcs on hepatocyte lipid metabolism and insulin responsiveness , using fatty acid oxidation , triglyceride accumulation , and pi 3-kinase activity as readouts , respectively . in response to lps exposure
, kcs increased production of tnf , an effect that was substantially greater than that observed when hepatocytes were exposed to lps alone ( fig .
7b ) . importantly , blocking of tnf activity using a tnf-neutralizing antibody resulted in an improvement of the adverse effects of kcs on hepatocyte fatty acid oxidation and accumulation of tgs ( fig .
notably , neutralizing antibodies against a panel of other m1-associated cytokines ( il-1 , il-1 , il-6 , ifn- , ifn- , il-12 , il-18 ) were unable to prevent the effects of m1-polarized kcs on hepatocyte lipid metabolism ( supplemental fig . 7 ) .
tnf expression in kcs in liver in response to standard chow , high - fat , and high - sucrose diets and tnf secretion from isolated m1-polarized kcs .
male wistar rats were exposed to a high - fat or high - sucrose diet for 2 weeks .
subsequently , the livers were isolated , sections were prepared , and immunofluorescent staining for kcs and tnf was performed ( a ) , as described in research design and methods .
the left panel shows cd68/ed1-positive cells ( green ) , the center panels show tnf-positive cells ( red ) , and the right panels show the merged images . in all panels ,
n = a minimum of three . for in vitro experiments ( b ) , hepatocytes and kcs were isolated from rat livers , plated , and cultured as shown .
after the indicated exposures , media were taken and tnf was quantified by enzyme - linked immunosorbent assay ( elisa ) .
( a high - quality digital representation of this figure is available in the online issue . ) the effects of tnf depletion on hepatocyte lipid metabolism and insulin - stimulated pi 3-kinase activity .
hepatocytes and kcs were isolated from rat livers , plated , and cultured as described in research design and methods .
subsequently , the effects of the indicated exposures on fatty acid oxidation and triglycerides in the absence or presence of a tnf-neutralizing antibody were assessed as described in research design and methods ( a ) . in separate experiments
, hepatocytes were incubated with 100 nmol / l insulin for 10 min after similar exposures to those in ( a ) , proteins extracts were then prepared , and irs-1associated pi 3-kinase activity was assessed as described in research design and methods ( b ) .
n = a minimum of six for each experimental condition , except for triglycerides ( n = 3 ) .
the purpose of the current study was to address the potential role of kcs in the pathogenesis of two of the liver metabolic abnormalities associated with states of overnutrition , specifically hepatic steatosis and insulin resistance .
the data demonstrate that 1 ) kcs are m1 activated in states of overnutrition ; 2 ) depletion of kcs protects against the development of diet - induced steatosis , increased dag , and insulin resistance ; 3 ) m1 activation of kcs in vitro induces changes in hepatocyte lipid metabolic pathways and insulin sensitivity that are consistent with the effects of diet in vivo , and 4 ) tnf plays a role in mediating the detrimental effects of kcs on hepatocyte lipid metabolism and insulin responsiveness .
the number and activity of adipose tissue macrophages are increased in obesity in mice and humans ( 811 ) . however , to date it has been unclear whether there is a similar effect of obesity on the activity and/or number of macrophages in other metabolic tissues of relevance to obesity and type 2 diabetes . in the case of liver ,
resident kcs comprise 5% of the total cell mass and their anatomical position in the sinusoidal spaces of the liver permits them to act as immune sentinels for the portal ( gut ) and systemic circulations . as such , they are most likely to see potential mediators of macrophage activation in obesity
. furthermore , their proximity to parenchymal cells presents opportunities both to influence glucose and lipid metabolism and potentially to respond to parenchymal cell derived signals .
data presented in the current study clearly demonstrate activation of kcs ( as measured by increased tnf expression ) in response to overnutrition , whether a high - fat diet or a high - sucrose diet .
one issue that arises from these observations is the nature of the dietary signal responsible for the activation of the kcs .
based on known activators of the m1 response in macrophages and a number of other recent studies , an increase in lps derived from gut bacteria may mediate the effects of overnutrition ( 4046 ) . indeed , raising lps to levels found in obese mice induces hepatic steatosis and insulin resistance ( 40 ) , whereas the treatment of obese mice with antibiotics reduces lps levels and improves steatosis and insulin resistance ( 41 ) .
furthermore , it is now well established that obesity alters the composition of the gut bacterial population ( 4346 ) , that there is increased permeability of the gut to lps in obesity ( 41 ) , and that populating the gut of a lean mouse with bacteria derived from an obese mouse results in increased body fat ( 45 ) .
however , a note of caution should be introduced regarding this discussion . although increases in systemic lps have previously been reported in obese mice ( 40,41 ) , significant increases in plasma lps
were not observed in the current study , although a distinct trend was clear in sucrose - fed animals ( table 1 ) .
it is possible that factors such as the diet length / sampling time point ( after 2 weeks of diet ) , the sampling site ( systemic arterial ) , the nutritional status of the animals ( fasted ) , or diurnal alterations may have masked changes . however , an alternative explanation is that the activation of kcs is mediated by other signals . in this regard ,
specifically , saturated fatty acids activate toll - like receptor 4 ( tlr-4 ) , the lps receptor , in macrophages ( 47 ) , obese tlr-4null mice have improved insulin sensitivity and lipid profiles ( 48 ) , tlr-4null mice are protected against lipid - induced insulin resistance ( 30 ) , and diabetes - induced obesity is a state of dyslipidemia .
7 ) that saturated free fatty acids can recapitulate the effect of kc - mediated alterations in hepatocyte fatty acid oxidation and esterification , but not triglyceride accumulation . therefore , it is possible that a combination of bacterial - derived lps and elevated free fatty acids may together be important mechanisms of activation of kcs in states of overnutrition .
the current study builds on recent reports that have indirectly implicated a role for kcs in altering hepatic metabolism ( 15,16 ) .
thus , myeloid deletion of ppar , which plays an important role in mediating the alternative activation ( the th-2 or m2 anti - inflammatory response ) of macrophages , increases susceptibility to insulin resistance , liver steatosis , and reduced hepatocyte oxidative metabolism in obesity .
an implied , although indirect , implication of these data is that conditions that favor a proinflammatory m1/th-1 polarization ( the classic activation ) of kcs , such as states of overnutrition , play a role in the development of liver metabolic abnormalities .
thus , overnutrition results in increased tnf production by kcs , and the rapid development of steatosis and insulin resistance . when kcs are depleted , the effects of diet on liver steatosis and insulin resistance are prevented
furthermore , the m1 polarization of kcs in vitro induces changes in hepatocyte lipid metabolic pathways ( fatty acid oxidation , esterification , and triglyceride accumulation ) that would be expected to promote the development of steatosis . taken together with the studies discussed above ( 15,16 ) and other studies that have demonstrated hepatic metabolic alterations in response to the altered myeloid activity ( 12,14 ) ,
these data suggest that cross talk between kcs and parenchymal cells plays an important role in the regulation of hepatic metabolism .
the current study implies a role for tnf in the pathogenesis of hepatic insulin resistance and dysregulated lipid metabolism induced by overnutrition .
the source of tnf is most likely the kcs because high - fat and high - sucrose diets did not increase systemic tnf levels but did increase kc tnf levels in vivo , lps profoundly increased tnf production from kcs in vitro but far less so in hepatocytes , and blocking of tnf activity attenuated the effects of kcs on hepatocyte fatty acid oxidation , tg accumulation , and insulin activation of pi 3-kinase .
tnf is the prototypical m1 cytokine and is rapidly produced by macrophages in response to proinflammatory signals .
importantly , in the context of the current study , numerous studies have implicated tnf in the pathogenesis of insulin resistance and dyslipidemia .
thus , obese tnf-null and tnf receptor null mice have improved insulin sensitivity compared with obese controls ( 37 ) , and the induction of insulin resistance by tnf is well established ( 35,36,39 ) . in the context of lipid metabolism ,
the inhibition of tnf activity with infliximab decreases liver steatosis and improves insulin signaling in liver of high - fat fed rats ( 32 ) , tnf bone marrow introduction into tnf mice induces hepatic steatosis on a high - fat diet ( 33 ) , and tnf injection induces hepatic steatosis in mice ( 34 ) .
finally , lps injections in mice produce hepatic steatosis within hours , possibly by decreasing fatty acid oxidation ( 31 ) , and it is possible that the in vivo effects of lps are mediated by kc - derived tnf , although the contribution of other factors can not , and should not , be ruled out .
an implication of our work and that of others ( 15,16 ) is that interventions that decrease m1 activity of kcs in the liver may have beneficial metabolic effects on insulin action , dyslipidemia , and elevated hepatic glucose output in situations of overnutrition .
however , the removal of kcs has substantial effects on the innate immune response in liver ( 49,50 ) .
thus , a more likely approach may be to target the activity of the specific pathways that are activated in kcs in response to overnutrition , while maintaining the other vital immune functions of kcs .
furthermore , the long - term deletion of kcs from liver may lead to off - target effects , which could present as effects on liver function , or effects on peripheral tissue metabolism . again
, however , it should be emphasized that complete removal of kcs from liver is most likely not a viable therapeutic intervention for the treatment or prevention of the metabolic abnormalities of obesity / type 2 diabetes . in conclusion , we have demonstrated a critical role for kcs in the pathogenesis of liver steatosis and insulin resistance in states of overnutrition and identified tnf as one potential mediator of these effects .
the most important implications of these observations , taken with other studies in this area , is that the activity of components of the immune system such as macrophages , and potentially other immune cells type , is altered by dietary composition and/or excess nutrients and , furthermore , that cross - talk between immune cells and cells / tissues that are intimately involved in the regulation of systemic metabolism , such as adipose tissue and liver , have profound effects on systemic metabolic homeostasis .
| objectiveincreased activity of the innate immune system has been implicated in the pathogenesis of the dyslipidemia and insulin resistance associated with obesity and type 2 diabetes . in this study
, we addressed the potential role of kupffer cells ( liver - specific macrophages , kcs ) in these metabolic abnormalities.research design and methodsrats were depleted of kcs by administration of gadolinium chloride , after which all animals were exposed to a 2-week high - fat or high - sucrose diet .
subsequently , the effects of these interventions on the development of hepatic insulin resistance and steatosis were assessed . in further studies ,
the effects of m1-polarized kcs on hepatocyte lipid metabolism and insulin sensitivity were addressed.resultsas expected , a high - fat or high - sucrose diet induced steatosis and hepatic insulin resistance . however , these metabolic abnormalities were prevented when liver was depleted of kcs . in vitro ,
kcs recapitulated the in vivo effects of diet by increasing hepatocyte triglyceride accumulation and fatty acid esterification , and decreasing fatty acid oxidation and insulin responsiveness . to address the mechanisms(s ) of kc action
, we inhibited a panel of cytokines using neutralizing antibodies . only neutralizing antibodies against tumor necrosis factor- ( tnf ) attenuated kc - induced alterations in hepatocyte fatty acid oxidation , triglyceride accumulation , and insulin responsiveness .
importantly , kc tnf levels were increased by diet in vivo and in isolated m1-polarized kcs in vitro.conclusionsthese data demonstrate a role for liver macrophages in diet - induced alterations in hepatic lipid metabolism and insulin sensitivity , and suggest a role for these cells in the etiology of the metabolic abnormalities of obesity / type 2 diabetes . |
although surgery is curative for localized disease , up to 30% of patients with rcc present with metastatic disease at the time of diagnosis , and more than 25% of patients with locally advanced rcc develop distant metastasis despite curative resection .
since rcc is highly resistant to chemotherapy , high dose interleukin-2 or interferon - alfa therapy is widely used as a first - line treatment of metastatic disease , but they provide only a modest response rate of less than 20% .
thus , the outcome of metastatic rcc is quietly depressing : the 5-year overall survival rate is less than 10% .
effective systemic therapy for rcc is mandatory . in conventional rcc , the loss of von hippel - lindau protein function leads to overexpression of vascular endothelial growth factor ( vegf ) and platelet - derived growth factor that promote tumor angiogenesis .
sunitinib is an orally active multi - targeted tyrosine kinase inhibitor that specifically inhibits vegf receptor ( vegfr ) , platelet - derived growth factor receptor ( pdgfr ) , fms - like tyrosine kinase-3 ( flt-3 ) , and stem c - kit protein ( c - kit ) .
the efficacy on metastatic rcc has been confirmed in both phase ii and iii trials , where it was shown to improve the median progression - free survival ( pfs ) , yield a higher response rate ( rr ) , and afford a better quality of life over interferon - alfa [ 9 - 11 ] .
based on current data , sunitinib is now the preferred drug for first - line treatment of metastatic rcc .
although the nature of these variations and associated molecular basis is not demonstrated , it is reasonable to evaluate the efficacy of sunitinib on metastatic rcc in those of different ethnic backgrounds .
therefore , we perfomed this retrospective study to assess the efficacy and safety of sunitinib in korean patients with metastatic rcc using an institutional treatment protocol .
the medical records of patients treated with sunitinib for metastatic rcc were retrospectively reviewed between september 2007 and december 2009 .
the inclusion criteria were as follows : histologically confirmed clear - cell rcc ; metastases measurable on computed tomography ( ct ) or magnetic resonance imaging ( mri ) ; a performance status of 0 - 2 based on eastern cooperative oncology group ( ecog ) criteria .
patient demographics , prior therapy , best responses , and relevant toxicities were obtained from medical records , and survival data were collected by telephone interviews .
risk factors associated with shorter survival were assessed according to the memorial sloan - kettering cancer center ( mskcc ) risk classification : a low serum hemoglobin level , an elevated corrected serum calcium level , an elevated serum lactate dehydrogenase level , a poor performance status , and an interval of less than 1 year between diagnosis and treatment .
sunitinib was administered orally at a dose of 50 mg daily , consisting of 4 weeks of treatment followed by a 2-week rest period in cycles of 6 weeks ( schedule 4 - 2 ) .
dose reduction of sunitinib was allowed to 37.5 mg and then 25 mg daily depending on the type and severity of adverse events . treatment with sunitinib was continued until the occurrence of disease progression , unacceptable adverse events , or patient withdrawal .
the primary end point of this study was the objective clinical response ( complete response , partial response , stable disease , or progressive disease ) , assessed by response evaluation criteria in solid tumors ( recist ) using regular physical examinations , ct / mri , and bone scans ( if bone metastases were present at baseline ) after each cycle for the first 4 cycles thereafter until the end of treatment .
the secondary end points were progression free survival ( pfs ) and overall survival ( os ) rates .
pfs was defined as the time from the start of treatment to the date of progressive disease or death .
os was defined as the time from start of treatment to death or the date at which patients were last known to be alive .
the adverse events secondary to treatment were evaluated at each visit according to the national cancer institute common terminology criteria for adverse events ( ctcae , version 3.0 ) .
estimates of median pfs and os were calculated using the kaplan - meier method , and 95% cis were considered statistically significant .
the medical records of patients treated with sunitinib for metastatic rcc were retrospectively reviewed between september 2007 and december 2009 .
the inclusion criteria were as follows : histologically confirmed clear - cell rcc ; metastases measurable on computed tomography ( ct ) or magnetic resonance imaging ( mri ) ; a performance status of 0 - 2 based on eastern cooperative oncology group ( ecog ) criteria .
patient demographics , prior therapy , best responses , and relevant toxicities were obtained from medical records , and survival data were collected by telephone interviews .
risk factors associated with shorter survival were assessed according to the memorial sloan - kettering cancer center ( mskcc ) risk classification : a low serum hemoglobin level , an elevated corrected serum calcium level , an elevated serum lactate dehydrogenase level , a poor performance status , and an interval of less than 1 year between diagnosis and treatment .
sunitinib was administered orally at a dose of 50 mg daily , consisting of 4 weeks of treatment followed by a 2-week rest period in cycles of 6 weeks ( schedule 4 - 2 ) .
dose reduction of sunitinib was allowed to 37.5 mg and then 25 mg daily depending on the type and severity of adverse events . treatment with sunitinib was continued until the occurrence of disease progression , unacceptable adverse events , or patient withdrawal .
the primary end point of this study was the objective clinical response ( complete response , partial response , stable disease , or progressive disease ) , assessed by response evaluation criteria in solid tumors ( recist ) using regular physical examinations , ct / mri , and bone scans ( if bone metastases were present at baseline ) after each cycle for the first 4 cycles thereafter until the end of treatment .
the secondary end points were progression free survival ( pfs ) and overall survival ( os ) rates .
pfs was defined as the time from the start of treatment to the date of progressive disease or death .
os was defined as the time from start of treatment to death or the date at which patients were last known to be alive .
the adverse events secondary to treatment were evaluated at each visit according to the national cancer institute common terminology criteria for adverse events ( ctcae , version 3.0 ) .
estimates of median pfs and os were calculated using the kaplan - meier method , and 95% cis were considered statistically significant .
between july 2007 and march 2010 , all twenty - one patients who had metastatic rcc with a clear - cell component were included in the analysis ( table 1 , 2 ) .
there were 17 males ( 81% ) and 4 females ( 19% ) , and the median age was 63.9 ( range , 46 - 75 years ) .
of those patients , 4 patients ( 19.0% ) had low - risk disease , 10 patients ( 47.6% ) had intermediate - risk disease , and 7 patients ( 33.3% ) had high - risk disease according to the mskcc criteria .
the previous treatments were as follows : previous nephrectomy in 13 patients ( 61.9% ) , cytokine therapy in 7 patients ( 33.3% ) , and radiation therapy in 3 patients ( 14.3% ) .
the most prevalent sites of metastases were as follows : the lung in 15 patients ( 71.4% ) , lymph nodes in 9 patients ( 42.9% ) , bone in 7 patients ( 33.3% ) , and liver in 3 patients ( 14.3% ) .
after a median of 17.4 months ( range , 5.7 - 33.1 months ) of treatment , 14 patients ( 66.7% ) remained alive with the disease , and treatment was ongoing in 11 patients ( 52.4% ) .
reasons for discontinuing treatment were progressive disease in 2 patients and adverse events in 1 patient . according to assessment with the recist criteria , 11 patients ( 52.4% ) had an objective response rate , with a complete response in 1 patient ( 4.8% ) , and a partial response in 10 patients ( 47.6% ) as the best tumor response rate ( table 3 ) .
the median pfs was 13.4 months ( 95% confidence interval [ ci ] , range , 12.3 - 14.5 months ) ( fig .
1 ) , and the median os was 28.1 months ( 95% ci , 21.8 - 34.4 months ) ( fig .
all patients experienced adverse events of some sort : fatigue , diarrhea , and hand - foot syndrome were the most common adverse effects .
however , the treatment protocol under study was well tolerated and most patients experienced reversible grade 1 or 2 toxicities ( table 4 ) .
the most commonly observed severe adverse events were hand - foot syndrome , fatigue , and generalized edema ; hand - foot syndrome was observed in 4 patients ( 19.0% ) , fatigue was observed in 3 patients ( 14.3% ) , and generalized edema was observed in 3 patients ( 14.3% ) as grade 3 or 4 .
the most common laboratory abnormalities of grade 3 or 4 were neutropenia , thrombocytopenia , and anemia , with neutropenia in 6 patients ( 28.6% ) , thrombocytopenia in 6 patients ( 28.6% ) , and anemia in 4 patients ( 19.0% ) .
neutropenia was observed in 6 patients ( 28.6% ) , but there was no occurrence of associated fever or sepsis .
thrombocytopenia was observed in 6 patients ( 28.6% ) , but there was no clinical significance such as bleeding tendencies . 1 patient ( 4.8% ) experienced hypothyroidism and needed thyroid hormone replacement .
a total of 6 patients ( 29% ) required dose reduction from 50 mg / day to 37.5 mg / day with further reductions to 25 mg / day due to grade 3 or 4 adverse events , and 1 patient ( 4.8% ) discontinued treatment due to severe adverse events .
the remaining 14 patients ( 66.7% ) tolerated and continued treatment with a standard dose of sunitinib .
between july 2007 and march 2010 , all twenty - one patients who had metastatic rcc with a clear - cell component were included in the analysis ( table 1 , 2 ) .
there were 17 males ( 81% ) and 4 females ( 19% ) , and the median age was 63.9 ( range , 46 - 75 years ) .
of those patients , 4 patients ( 19.0% ) had low - risk disease , 10 patients ( 47.6% ) had intermediate - risk disease , and 7 patients ( 33.3% ) had high - risk disease according to the mskcc criteria .
the previous treatments were as follows : previous nephrectomy in 13 patients ( 61.9% ) , cytokine therapy in 7 patients ( 33.3% ) , and radiation therapy in 3 patients ( 14.3% ) .
the most prevalent sites of metastases were as follows : the lung in 15 patients ( 71.4% ) , lymph nodes in 9 patients ( 42.9% ) , bone in 7 patients ( 33.3% ) , and liver in 3 patients ( 14.3% ) .
after a median of 17.4 months ( range , 5.7 - 33.1 months ) of treatment , 14 patients ( 66.7% ) remained alive with the disease , and treatment was ongoing in 11 patients ( 52.4% ) .
reasons for discontinuing treatment were progressive disease in 2 patients and adverse events in 1 patient . according to assessment with the recist criteria , 11 patients ( 52.4% ) had an objective response rate , with a complete response in 1 patient ( 4.8% ) , and a partial response in 10 patients ( 47.6% ) as the best tumor response rate ( table 3 ) .
the median pfs was 13.4 months ( 95% confidence interval [ ci ] , range , 12.3 - 14.5 months ) ( fig .
1 ) , and the median os was 28.1 months ( 95% ci , 21.8 - 34.4 months ) ( fig .
all patients experienced adverse events of some sort : fatigue , diarrhea , and hand - foot syndrome were the most common adverse effects .
however , the treatment protocol under study was well tolerated and most patients experienced reversible grade 1 or 2 toxicities ( table 4 ) .
the most commonly observed severe adverse events were hand - foot syndrome , fatigue , and generalized edema ; hand - foot syndrome was observed in 4 patients ( 19.0% ) , fatigue was observed in 3 patients ( 14.3% ) , and generalized edema was observed in 3 patients ( 14.3% ) as grade 3 or 4 .
the most common laboratory abnormalities of grade 3 or 4 were neutropenia , thrombocytopenia , and anemia , with neutropenia in 6 patients ( 28.6% ) , thrombocytopenia in 6 patients ( 28.6% ) , and anemia in 4 patients ( 19.0% ) .
neutropenia was observed in 6 patients ( 28.6% ) , but there was no occurrence of associated fever or sepsis .
thrombocytopenia was observed in 6 patients ( 28.6% ) , but there was no clinical significance such as bleeding tendencies
a total of 6 patients ( 29% ) required dose reduction from 50 mg / day to 37.5 mg / day with further reductions to 25 mg / day due to grade 3 or 4 adverse events , and 1 patient ( 4.8% ) discontinued treatment due to severe adverse events .
the remaining 14 patients ( 66.7% ) tolerated and continued treatment with a standard dose of sunitinib .
rcc is one of the most challenging malignancies with a dismal prognosis because of the modest response to conventional cytotoxic chemotherapeutic agents and limited sensitivity to radiation therapy .
cytokine therapy with interferon - alfa or il-2 have been the main treatment options for metastatic disease , but these agents have limited efficacy and are associated with considerable toxic effects .
recent advances in understanding the molecular biology of rcc have led to the development of several systemic therapeutic agents targeting the vegf and mammalian target of rapamycin ( mtor ) pathways as first and second line treatments for metastatic disease , with impressive improvements in oncologic outcome .
sunitinib is one of several agents , including sorafenib , bevacizumab , and temsirolimus , which target the inhibition of pro - angiogenic growth factor activity and have shown favorable results in clinical trials against metastatic clear - cell rcc [ 15 - 17 ] .
recent studies have confirmed the efficacy of sunitinib as a first line treatment for metastatic clear - cell rcc , but these series were mainly performed in different ethnicities in western countries .
thus , the potential ethnic differences in the efficacy and safety of sunitinib have not been established .
this study evaluated whether korean patients with metastatic rcc had comparable oncologic outcomes and safety as patients in previous randomized studies . in patients with a poor prognosis according to the mskcc criteria ,
temsirolimus is recommended as a first - line treatment , with sunitinib as a viable alternative , but temsirolimus is not available for korean patients because of problems related to the insurance system ; more patients with poor prognostic factors were included in this study . in terms of he
considering the selection bias of randomized controlled trials which include relatively more favorable or intermediate risk group , the results of this study seem to reflect more reliable results in korean clinical practice .
for the treatment outcome , sunitinib treatment showed an objective response rate of 39% ( range , 34 - 44% ) and a pfs of 11.0 months ( range , 10.7 - 13.4 months ) as well as an os of 26.4 months ( range , 23.0 - 32.9 months ) in previous phase iii randomized trials . in the current study ,
the objective response rate was 52.4% , which included a complete response of 4.8% , and a partial response of 47.6% as the best response rates .
the median pfs and os were 13.4 months and 28.1 months , respectively . even though it is difficult to directly compare this retrospective study with previous randomized trials , it is obvious that metastatic rcc patients benefitted from sunitinib treatment .
all patients experienced treatment - related adverse events , the majority of which were grade 1 or 2 in severity .
fatigue , diarrhea , and hand - foot syndrome were the most frequent adverse events , but grade 3 or 4 adverse events were not frequent and were manageable .
most of patients were able to resume sunitinib treatment following dose reduction , and only 1 patient among all cases discontinued because of serious adverse events .
previous trials have reported that side effects of sunitinib treatment were reversible and tolerable ; patients with grade 3 or 4 side effects did not exceed 10% .
nevertheless , routine monitoring such as evaluation of blood pressure / ejection fraction and a thyroid function test is recommended because there is possibility of serious adverse events .
emerging safety data indicate that cardiotoxicity may be associated with sunitinib ; left ventricular dysfunction is the main cardiac side effect of sunitinib and might be partly a result of cardiomyocyte toxicity exacerbated by hypertension . therefore ,
blood pressure and left ventricular ejection fraction should be monitored , especially in patients with cardiac risk factors .
it is reported that in patients treated with sunitinib , 85% of patients had abnormal results on thyroid function tests , including elevation of thyroid stimulating hormone levels , decreased t3 levels , and less commonly , decreased t4 or free - thyroxine index levels . because an abnormal thyroid function test may rapidly progress from mild to profound , regular surveillance is warranted at baseline and every 2 - 3 months . in terms of adverse events , neutropenia , thrombocytopenia , and anemia
were the most frequent grade 3 or 4 laboratory abnormalities reported previously , and most of them were improved by dose reduction .
neutropenia was observed in 6 patients ( 28.6% ) , but there was no event of associated fever or sepsis ; thrombocytopenia was observed in 6 patients ( 28.6% ) , but there was no clinical significance such as bleeding tendencies ; anemia increased amylase / lipase was observed in 7 patients ( 33.3% ) , but there were no associated clinical manifestations of pancreatitis . compared to western trials , sunitinib treatment in korean patients achieved favorable oncological outcomes in terms of objective response rate , pfs , and os .
it is interesting to note that the favorable outcomes of the current study are consistent with previous korean studies .
although the underlying reason for such a discrepancy remains unclear at this time , one possible explanation is the inherent differences caused by ethnic backgrounds .
further large prospective studies are required to clarify whether the ethnic background and its associated molecular mechanisms contribute to the difference in the efficacy of sunitinib across ethnic groups . in terms of adverse effects , a higher incidence of hand - foot syndrome and facial / generalized edema were observed relative to western trials , but they were mainly mild to moderate , and managed readily .
this was a retrospective analysis of a small number of patients treated at a single institution , which allows for potential selection bias .
furthermore , survival benefit may not be weighted properly because this was not a randomized controlled trial .
sunitinib was efficacious and was well tolerated in korean patients ; the objective response rate , pfs , and os in korean patients were compatible with the oncologic outcomes in previous randomized trials .
further large prospective investigations are required to clarify such favorable efficacy profiles in korean patients .
sunitinib was efficacious in the treatment of metastatic clear - cell rcc , and was well tolerated in korean patients .
the objective response rate , pfs , and os in korean patients were compatible with the benefits shown in previous randomized trials .
although sunitinib treatment - related adverse events such as hand - foot syndrome and facial / generalized edema were observed in higher incidence than in western trials , they were mainly mild to moderate , and readily managed . | purposewe assessed the efficacy and safety of the tyrosine kinase inhibitor sunitinib in korean patients with metastatic renal cell carcinoma ( mrcc).materials and methodsbetween september 2007 and december 2009 , all twenty - one patients who had mrcc with a clear - cell component were retrospectively reviewed .
sunitinib was administered orally at a dose of 50 mg daily until disease progression or intolerance to treatment occurred .
the primary end point of this study was the objective tumor response assessed by response evaluation criteria in solid tumors ( recist ) , and the secondary end points were progression - free survival ( pfs ) and overall survival ( os ) rates as well as assessment of adverse effects.resultsafter a median of 17.4 months ( range , 5.7 - 33.1 months ) of treatment , 11 patients ( 52.4% ) had an objective response with a complete response in 1 patient ( 4.8% ) , and a partial response in 10 patients ( 47.6% ) as the best tumor response .
the median pfs was 13.4 months ( 95% confidence interval [ ci ] , range , 12.3 - 14.5 months ) , and the median os was 28.1 months ( 95% ci , 21.8 - 34.4 months ) .
all patients experienced adverse events of some sort , but the studied treatment protocol was well tolerated and most patients experienced reversible grade 1 or 2 toxicities.conclusionssunitinib was efficacious in the treatment of metastatic clear - cell rcc , and was well tolerated in korean patients . although sunitinib treatment - related adverse events such as hand - foot syndrome and facial / generalized edema were observed with a higher incidence than in western trials , they were mainly mild to moderate , and readily managed . |
in this issue of critical care , cuthbertson and colleagues report the views of 141 intensive care and infection control specialists from four countries on the potential utility , risks and research opportunities of selective digestive decontamination ( sdd ) . using structured interviews , a delphi process , and a theoretical behavioural domains framework
, they determined the extent of consensus and perceived importance of specific issues relating to sdd .
respondents demonstrated substantial equipoise on risks and benefits of sdd combined with moderate agreement on concerns that sdd might contribute to antimicrobial resistance .
there was uncertainty about the generalisability of sdd research to local context or to all patient groups , and moderately strong support for participating in a national randomised controlled trial of sdd despite a common view that sdd was not a high clinical priority , presumably related to the reported use of other strategies to minimise healthcare - associated infections and ventilator - associated pneumonia ( vap ) .
sdd is unique amongst intensive care interventions in having the largest and most consistent evidence base for benefit in terms of minimising secondary infections and reducing mortality . since the initial publications by stoutenbeek and van saene in 1983 and 1984 describing sdd in mechanically ventilated trauma patients ,
there have been at least 65 randomised controlled trials and 12 meta - analyses involving around 15,000 patients .
no other intervention approaches this weight of evidence , and yet expert opinion frequently disregards the technique .
sdd was omitted from the first consensus statement of the surviving sepsis campaign ; in the second iteration sdd was considered but no recommendation made , since expert opinion was shown to be bimodal , demonstrated through the development of the grade grid . in the third iteration in 20122013 , sdd has achieved a level 2b recommendation ( suggested use based on ' moderate evidence ) .
the main barrier to sdd relates to the perceived risk of antimicrobial resistance ( or emergence of species not covered by the traditional regimen , such as gram - positive bacteria ) if sdd were to be widely adopted , with the spread of these organisms to the wider environment .
the historical over - use of antimicrobials ( intravenous and oral in humans , as growth promoters in animals ) has led to calls for better antimicrobial stewardship , and doctors are now conditioned to minimise frequency and duration of prescriptions .
the current survey respondents tended to support the statements that sdd increases antimicrobial resistance and that research to date has not adequately addressed this issue .
however , recent studies [ 8 - 12 ] do not support either position ; in the two largest trials , rates of resistance were lower in the sdd group .
indeed , it is the conventional use of broad - spectrum intravenous antimicrobials that may promote the emergence of resistance by creating sub - lethal concentrations of antimicrobials in the gut , which then becomes a reservoir of pathogenic aerobic organisms in critically ill patients .
this suggests the possibility that sdd may not only be unlikely to promote resistance , but also might actually prevent their emergence .
the second barrier relates to local perceptions of performance : the sense that sdd is not required because hospital acquired infections are already well - controlled .
the majority of respondents agreed with the statement that ' our vap rates are low. this may be the case if icus are regularly auditing their vap rates .
however , as we found in the matching michigan project [ 13 - 15 ] , many icus were surprised to find that their performance in minimising blood stream infections from central venous catheters was not as good as they had expected .
the third barrier may be the availability of ' competing non - antimicrobial interventions for preventing vap in mechanically ventilated patients , often combined in ' vap bundles. sdd should be compared with these non - antimicrobial approaches to determine whether there is synergy , or whether the newer techniques can substitute for sdd .
the final barrier to sdd might be uncertainty about who should receive it , in what form and with which components .
originally promoted as a technique for preventing gut overgrowth with potentially pathogenic gram - negative aerobes by preserving the normal colonic anaerobic flora , it gradually came to be seen primarily as a technique for preventing vap from retrograde oropharyngeal spread of enteric organisms .
the classical nosocomial gram - negative pathogens of the 1980s were replaced in the 1990s and 2000s by resistant gram - positives for which sdd was not specifically designed ; in recent years multiply - resistant gram - negatives have returned .
this means that the sdd regimen must be adapted to local circumstance - for example , including enteral vancomycin or modifying the anti - gram - negative components . evolving concepts of the mechanism(s ) of action of sdd now re - emphasise the gut as the primary reservoir of pathogenic organisms , and establishment of normal enteric flora as the main therapeutic aim .
to this extent sdd and interventions directed at increasing splanchnic blood flow share the same conceptual framework of the gut as ' the largest undrained abscess in the body. one question that the survey did not directly ask is ' what evidence and effect size would encourage you to use sdd as a routine intervention in mechanically ventilated patients? the answer to this is likely to include the absence of emergence of resistance over several years ( at both the individual and environmental level ) and improvements in survival to at least 1 year .
it is clear that the research will need to compare sdd against non - antimicrobial interventions directed against vap , and will need to take into account local microbial ecology . a multicentre cluster - randomised trial has been proposed ; this might usefully include a factorial design with blinding of the sdd component to explore potential synergies between interventions rather than a straight head - to - head comparison .
such a trial might finally allow us to move from practice based on ' gut instinct to evidence - based medicine .
| barriers to the use of selective digestive decontamination include concerns about emergence of resistant organisms , over - estimation of current performance in preventing ventilator - associated pneumonia ( vap ) , alternative methods of preventing vap , and misunderstanding of mechanisms of action .
a definitive cluster - randomised trial should be undertaken that incorporates practitioner concerns and effect - size preferences . |
pertussis , an acute infectious illness of the respiratory tract remains endemic in developed nations despite high vaccination coverage [ 7 , 8 , 16 ] .
while the early use of whole - cell vaccine was highly effective in reducing the incidence of reported pertussis in the united states in the 1970s , there has been a resurgence of reported pertussis over the last 15 years [ 8 , 16 , 31 ] .
worldwide , there are an estimated 50 million cases occurring annually ( 90% of which are in developing countries ) , and there are as many as 400,0000 pertussis - related deaths [ 16 , 31 ] .
it is general consensus , moreover , that the reported incidence of pertussis is considerably lower than its actual incidence [ 8 , 31 ] .
though in the prevaccine era pertussis was regarded as a childhood disease affecting primarily young children , pertussis epidemiology in the postvaccine era is different [ 8 , 17 ] .
infants are the most vulnerable group with the highest rates of complications and mortality , yet adolescents and adults now comprise a significant percentage of cases and a conduit of infection for the infants [ 8 , 13 , 17 ] .
pcr , culture , and serology are the mainstay of the laboratory diagnosis of pertussis , with various factors affecting the sensitivity and specificity of each modality [ 8 , 24 , 36 ] .
however , in recent years , pcr has become an increasingly more popular tool and has significantly contributed to the increasing laboratory diagnosis of pertussis [ 8 , 27 , 36 ] .
advances have also been made with regard to prevention and disease control , with experts from 17 countries recently establishing the global pertussis initiative ( gpi ) with the aim of analyzing the status of pertussis and enhancing existing immunization strategies [ 8 , 15 ] .
before the introduction of the whole - cell pertussis vaccine in the1940s , there were approximately 200,000 cases reported annually in the us .
immunizations reduced disease rates and in 1976 pertussis incidence reached a nadir of 1,010 reported cases [ 13 , 37 ] .
however , since that time , there has been a substantial increase in the number of cases reported [ 8 , 13 , 31 ] . indeed , over the past 15 years , there has been a marked increase in the incidence of pertussis with reported disease in the us reaching a rate of 8.9 per 100,000 in 2004 with nearly 19,000 provisional reported cases [ 7 , 17 ] .
it is also well established that , despite high vaccination coverage for primary immunization in infants and children , pertussis continues to be a global concern with increased incidence in many countries including argentina , australia , canada , italy , japan , the netherlands , switzerland and the us .
it is also widely noted that in recent years there is a general shift in the age distribution of pertussis , with adults and adolescents an underrecognized but significant source of infection for neonates and infants [ 8 , 13 , 1517 ] .
data from the euvac - net project , a network for the epidemiologic surveillance and control of communicable diseases in the european community , demonstrate that between 1998 and 2002 , the rate of disease incidence remained stable at a high rate among children less than 1 year old .
nevertheless , these data indicate that the incidence rate among adults doubled in 5 years .
similarly , centers for disease control and prevention ( cdc ) surveillance data from 19902003 demonstrate that the reported incidence of pertussis among adolescents has substantially increased with a nearly ten - fold rise .
moreover , when comparing pertussis disease rates in 19901993 , recent cdc data from 2004 reveal a nearly 19-fold increase in the number of cases in persons aged 1019 years and a 16-fold increase in persons over 20 years .
several factors have been proposed as underlying the increasing incidence of pertussis disease including waning immunity with subsequent atypical disease manifestations , increasing awareness by public health personnel with subsequent enhanced surveillance and improved laboratory diagnostics [ 8 , 17 , 31 ] .
waning of both vaccine - induced immunity and infection - acquired immunity is widely cited as an important reason for recent epidemiologic trends [ 7 , 8 , 36 , 37 ] . while the assessment of the duration of immunity afforded after either natural infection or vaccination is complex , individuals are clearly susceptible to initial infection / reinfection after vaccination or previous pertussis illness , respectively .
studies vary in their estimation of protection against disease with protective immunity after natural infection waning 720 years after illness , and duration of immunity after vaccination waning at approximately 412 years in children . yet , regardless of the precise interval , when individuals do contract pertussis after the waning of their immunity , their disease manifestations are frequently atypical [ 8 , 17 , 27 ] . as such
such underdiagnosis poses a potentially serious public - health concern in that those untreated persons with protracted cough continue to unknowingly transmit the disease to others .
finally , it has been proposed that the increased incidence rates may also be a function of enhanced surveillance as well as improved and more sensitive diagnostic lab techniques ( e.g. , pcr ) , in that such techniques allow for the diagnosis of cases that would probably have been missed in the past [ 8 , 17 , 27 , 35 ] . nevertheless , it is important to note , that the current estimates are likely to be , if anything , an underrepresentation of the true incidence of disease [ 8 , 31 ] .
first , the clinical diagnosis of pertussis is complicated by underconsulting , particularly among adolescents and adults .
second , with prolonged cough often being their only clinical feature , by the time these adolescents and adults finally do seek medical attention , it is often too late to culture or detect the organism by pcr , thus potentially resulting in a missed diagnosis [ 8 , 17 , 31 , 35 ] .
moreover , the wide heterogeneity in disease expression , modification of disease by immunization , mixed infection , inconsistent definition , and insensitive nonstandardized , poorly performed , or lack of available laboratory tests , further complicate physician diagnosis . while the classic or typical
pertussis may be easily recognized , it is seen less often since general immunization began . instead
, atypical pertussis , usually characterized by the absence of whoop and often a somewhat shorter duration of cough , is more common than classical pertussis among adolescents and adults [ 8 , 17 ] . and
finally , it should be noted that , immunized young children that are pcr positive for b pertussis can be asymptomatic [ 29 , 31 ] . regardless of whether an individual displays classical pertussis signs and symptoms or a more protracted , atypical cough , pertussis may not be suspected because of the misconception among many physicians that pertussis is a childhood disease [ 8 , 17 ] .
co - occurrence of other infections like influenza a or b , adenovirus , and rsv may also complicate the clinical diagnosis . and , finally , even when diagnosed , pertussis is often underreported .
indeed , sutter and cochi report that in the us , only an estimated 11.6% of pertussis cases were actually reported [ 17 , 30 ] .
thus multiple institutional , clinical , and laboratory factors diminish the true assessment of pertussis incidence , and the current data clearly are an underestimation of the true burden of disease .
because accurate diagnosis of pertussis can not be made by clinical signs and symptoms alone , there is a need for improved laboratory diagnosis of pertussis .
while several laboratory techniques exist for the identification of b. pertussis , namely , culture , serology and pcr , overall , several practical factors may adversely affect the sensitivity of its laboratory diagnosis .
delayed specimen collection , poor specimen collection techniques , specimen transport problems , and lab media contamination are but a few of the practical constraints often influencing the outcomes of the laboratory diagnosis of pertussis . moreover , previous exposure to the organism , patient s age , stage of disease , previous antibiotic administration , and immunization are other factors that may have a substantial impact on the sensitivity of the tests .
finally , limited access to diagnostic or laboratory methods , in both developed and developing countries , undoubtedly affects b. pertussis laboratory confirmation [ 8 , 24 ] .
culture b. pertussis is a fastidious gram - negative cocobacillus , and its isolation from nasopharyngeal secretions remains the gold standard for diagnosis .
culture requires collection of a posterior nasopharyngeal specimen with a dacron or calcium alginate swab . to increase the yield of positive cultures
, specimens should be immediately plated onto selective regan lowe agar or bordet gengou medium , selective media that are seldom readily available in physician 's offices because of their cost and short shelf - life [ 17 , 24 ] .
the main reasons for failure of bacterial growth in culture , from correctly collected and transported specimens , stem from bacterial and fungal contamination and the lack of fresh media .
generally , 710 days are required to grow , isolate , and identify the organism , an obvious limitation of the culture method.the timing of obtaining specimens for culture is also of paramount importance and greatly affects its yield .
the proportion of patients testing positive for pertussis by culture is highest when the initial specimens are obtained early in the course of illness , i.e. , during the early catarrhal phase of the illness when the organism is present in the nasopharynx in sufficient quantity .
however , adults and adolescents often present late in the course of their illness , thereby greatly reducing the likelihood of culturing the organism [ 17 , 24 ] .
studies also demonstrate that proportions of positive cultures decline in patients who have been previously immunized and undoubtedly in those in whom antibiotics have been started .
thus , given the limited window of opportunity for positive culture , it is important to stress that a negative culture does not exclude pertussis . finally , it is important to emphasize , that despite its low yield , culture should be attempted , as the bacterial isolates are needed for genotypic and phenotypic analysis .
pcr the use of pcr for the diagnosis of pertussis is rapidly evolving as it provides a sensitive , rapid means for laboratory diagnosis in circumstances in which the probability of a positive culture is low [ 8 , 17 , 32 , 35 ] .
notably , the cdc and world health organization ( who ) now include a positive pcr in their lab definition of pertussis .
while the sensitivity of pcr also decreases somewhat with the duration of cough and among previously immunized individuals , it is nevertheless a significantly more robust tool for diagnosis for those in the later stages of the disease or for those who have already received antibiotics [ 17 , 35 ] . specifically , in their 2005 consensus paper , the european research programme for improved pertussis strain characterization and surveillance ( eupertstrain ) state that the real - time pcr is more sensitive than culture for the detection of b. pertussis , especially after the first 34 weeks of coughing and after antibiotic therapy has been initiated [ 16 , 27 ] . in a prospective study in which nasopharyngeal samples were obtained simultaneously for both pcr and culture ,
the identification of b. pertussis infections was nearly four - fold higher with pcr [ 8 , 28 ] .
finally , pcr is an invaluable tool for the diagnosis of pertussis among young infants since the yield of culture is low and serology is problematic in this age group [ 1 , 17].as with culture , important factors for the successful application of pcr in the diagnosis of infection by bordetella species include proper sample collection and preparation .
for example , a dacron swab with a fine flexible wire shaft , and not calcium alginate , is the recommended swab . after obtaining the nasopharyngeal sample ,
the swab should be shaken vigorously in saline solution , the swab discarded and the vial sealed for further processing .
appropriate primer selection , amplification conditions , and controls are also essential for effective pcr testing .
primers have been derived from four chromosomal regions and common primers employed in pcr detection systems include is481 , is1001 ptp1 , and ptp2 [ 8 , 24 ] .
inherent with the high sensitivity , false positive results are a well - recognized problem associated with the pcr diagnosis of pertussis and other respiratory illnesses .
while at the present time , pcr is not routinely available and its methods need more standardization , optimization , and quality control , in the future , an internationally accepted standardized kit might be available , which would facilitate the expanded use of pcr for pertussis diagnosis [ 16 , 35 ] .
serology natural infection with b. pertussis is followed by an increase in serum levels of iga , igm , and igg antibodies to specific pertussis antigen whereas the primary immunization of children induces mainly igm and igg antibodies . during the past 15 years
, elisas have constituted the mainstay of serologic diagnosis using specific b. pertussis protein as antigens , and the serologic diagnosis of pertussis is suspected with increases in iga or igg antibody titers to pertussis toxin ( pt ) , filamentous hemmaglutinin ( fha ) , pertactin , fimbriae or sonicated whole organisms in two serum samples collected 24 weeks apart .
notably , these antibody responses to fha are not specific to b. pertussis , but also occur following other bordetella species ; moreover , these antibodies may be cross - reacting epitopes to other bacteria including h. influenzae and m. pneumoniae .
thus , the greatest sensitivity and specificity for the serological diagnosis of b. pertussis infection is by elisa measurement of igg and iga antibodies to pt demonstrating at least a two - fold rise in titer between acute- and convalescent - phase sera .still , the main problem in the serologic diagnosis of b. pertussis by elisa is the frequent delay in obtaining the acute - phase specimen . in individuals with re - infections , there is a rapid increase in titer such that if a
delayed acute - phase sample is obtained , the titer is likely to have already peaked , thereby hampering the detection of the significant titer increase between the acute- and convalescent - phase serum samples .
notably , for those individuals not recently immunized , a single - serum sample elisa may circumvent the problem , as ill patients will have significantly higher elisa titers than the geometric mean titers ( gmt ) of healthy controls [ 2325 ] . with this in mind , although a rise in pt iga is more suggestive of a recent antibody response , it is less consistent than a pt igg rise ; hence , in adolescents and adults , a single high value of igg or iga antibodies to pt suggests pertussis infection [ 17 , 24 , 35 ] . indeed , de melker et al . demonstrated that an igg concentration to pt of at least 100 units / ml in a single serum sample was diagnostic of either a recent or active pertussis infection .the serological diagnosis of pertussis among infants also has notable limitations .
some culture - positive patients , particularly infants younger than 3 months , do not develop measurable antibodies , a finding that calls into question the utility of even obtaining a serum specimen for serology in young infants .in summary , despite the shortcomings of serology , a single - sample serology test can be a useful tool , particularly among older patients presenting late in the course of their illness when culture and pcr testing are negative .
use of antibiotics in the treatment and prevention of pertussis antimicrobial agents administered early in the course of disease , i.e. , during the catarrhal stage , may ameliorate the disease ; although , after the cough is established antibiotics do not have a discernable effect on the course of the illness , but rather are recommended to limit the spread of organisms to other individuals .erythromycin , clarithromycin or azithromycin are now considered first - line agents for treatment ( and prophylaxis ) of pertussis in individuals 6 months of age or older ( table 1 ) .
the antibiotic choice for infants younger than 6 months of age , however , requires special attention .
the fda has not yet approved azithromycin or clarithromycin for use in infants younger than 6 months ; however , the 2006 aap endorsed red book lists azithromycin as the preferred macrolide for this age group because of the risk of idiopathic hypertrophic pyloric stenosis associated with erythromycin .
notably however , there was a recent report of infantile hypertrophic pyloric stenosis among two young infants treated with azithromycin for pertussis .
table 1recommended antimicrobial therapy and postexposure prophylaxis for pertussis in infants , children , adolescents , and adults agerecommended drugsalternativeazithromycinerythromycinclarithromycintmp - smx<1 mo10 mg / kg per day as a single dose for 5 days4050 mg / kg per day in 4 divided doses for 14 daysnot recommendedcontraindicated at < 2 mo of age15 mosee abovesee
above15 mg / kg per day in 2 divided doses for 7 days2 mo of age : tmp , 8 mg / kg per day ; smx , 40 mg / kg per day in 2 doses for 14 days6 mo and children10 mg / kg as a single dose on day 1 ( maximum 500 mg ) ; then 5 mg / kg per day as a single dose on days 25 ( maximum 250
mg / day)see above ( maximum 2 g / day)see above ( maximum 1 g / day)see aboveadolescents and adults500 mg as a single dose on day 1 , then 250 mg as a single dose on days 252 g / day in 4 divided doses for 14 days1 g / day in 2 divided doses for 7 daystmp , 300 mg / day ; smx , 1600 mg / day in 2 divided doses for 14 daysused with permission of the american academy of pediatrics .
red book : 2006 report of the committee on infectious diseases book , american academy of pediatrics , 2006tmp trimethoprim , smx sulfamethoxazolepreferred macrolide for this age because of risk of idiopathic hypertrophic pyloric stenosis associated with erythromycin recommended antimicrobial therapy and postexposure prophylaxis for pertussis in infants , children , adolescents , and adults used with permission of the american academy of pediatrics .
red book : 2006 report of the committee on infectious diseases book , american academy of pediatrics , 2006 tmp trimethoprim , smx sulfamethoxazole preferred macrolide for this age because of risk of idiopathic hypertrophic pyloric stenosis associated with erythromycin postexposure prophylaxis the american academy of pediatrics 2006 red book recommends that chemoprophylaxis be administered to all household contacts and other close contacts , regardless of age and immunization status .
the rationale behind this recommendation is that administration of chemoprophylaxis to asymptomatic contacts within 21 days of onset of cough in the index patient can limit secondary transmission .
other countries like the united kingdom limit the use of prophylaxis for the protection of only those with the greatest risk from pertussis , namely , young infants [ 11 , 33 ] . notably , an evidence - based review of literature on the use of erythromycin in preventing secondary transmission of pertussis to close contacts concluded that in countries where effective pertussis vaccines are in use , chemoprophyalxis should be limited to those most susceptible to the complications of pertussis ( i.e. , unimmunized or partially immunized infants ) and to those individuals who come in close contact with the latter [ 11 , 12 ] .
regardless of the policy , the agents , dose , and duration of prophylaxis are the same as for treatment of pertussis .
pertussis vaccines licensed for use in infants , children , and adults vary across countries .
these vaccines differ both in terms of their active ingredients and in terms of the other diseases for which coverage is provided ( e.g. , polio , diptheria ) .
for example , repevax ( sanofi pasteur ) contains diptheria , tetanus , pertussis ( acellular , component ) as well as inactivated polio , whereas adacel contains only tetanus toxoid , reduced diphtheria toxoid , and acellular pertussis .
, many potential immunization strategies have been proposed to improve pertussis control ( table 2 ) .
universal immunization of adolescents and adults , selective perinatal immunization of women who recently gave birth , and close contacts of newborns , are but a few of the strategies that were discussed by the global pertussis initiative ( gpi ) , which first convened in 2001 .
the second gpi convened in 2005 and reiterated several intervention strategies to address the ongoing severe pertussis disease among neonates and infants .
table 2immunization strategies assessed by gpi participants ( see , table 1 , pg .
universal adult immunizationreduce morbidity in adultsreduce transmission to young infantsdevelop herd immunityreduce morbidity in older children2 .
selective immunization of new mothers , family , and close contacts of newbornsreduce transmission to infantsreduce morbidity in adults , particularly young adults3 .
preschool booster at 4 years of agereduce morbidity in 4- to 6-year oldsreduce transmission to infantsdevelop herd immunity7 .
reinforce and/or improve the current infant and toddler immunization strategyreduce morbidity and mortality in infants , toddlers , and childrenreduce overall circulation of pertussisused with permission from lippincott williams & wilkinsentries represent the consensus of opinion of the gpi participants immunization strategies assessed by gpi participants ( see , table 1 , pg .
s70 ) used with permission from lippincott williams & wilkins entries represent the consensus of opinion of the gpi participants immunization of adolescents as previously noted , the incidence of pertussis among adolescents is increasing and these individuals then serve as a reservoir of infection to unvaccinated or incompletely vaccinated infants .
two tdap vaccines ( boostrix and adacel ) are licensed for use in the us .
recently , the cdcs advisory committee on immunization practices ( acip ) has recommended routine tdap for adolescents from 1118 years [ 3 , 13 , 16 ] .
several other countries including canada , austria , australia , france , and germany have also introduced the universal immunization of adolescents . in germany , for example , the current immunization schedule recommends dtap at 2 , 3 , 4 , and 1114 months , and dtap at 56 years and at 917 years . for
a complete overview of the pertussis vaccination in other european countries please access the euvac.net website .
future studies will be needed to evaluate the duration of protection afforded and the potential need for an adult booster .
immunization of adults the adult pertussis trial ( apert ) , a study sponsored by the united states national institute of health ( nih ) , has recently demonstrated the efficacy of acellular pertussis vaccines in preventing pertussis disease in adults ( and adolescents ) . [ 16 , 20 , 21 , 34 ] . to date ,
only adacel is licensed for use in adults , and the recommended adult immunization schedule in the us ( october 2006september 2007 ) now recommends that tdap replace a single dose of td for adults < 65 years who have not previously received a dose of tdap ( either in the primary series , booster or for wound management ) .
given the increased public awareness of adolescent and adult pertussis , in conjunction with perhaps an increased awareness about vaccines in general ( e.g. , hpv and influenza ) , the general public may be more receptive to a universal adult vaccination against pertussis .
the expected benefits of such programs would be to build up herd immunity and reduce disease .
alternatively , the selective vaccination of only those adults at highest risk of transmitting b. pertussis to vulnerable infants is likely to decrease both the incidence and the impact of pertussis on young infants .
regardless of the approach used , successful adult vaccination programs must include education and public awareness .
cocoon strategy the vaccination of household members , including parents and siblings of newborn infants , has been recently coined the cocoon strategy .
recent studies have demonstrated that parents are frequently the source of pertussis infection to their infants [ 2 , 13 , 16 , 19 , 22 ] . while implementation of this strategy is expected to lead to only modest reductions in typical adult cases ,
there is a strong indirect effect on infants and young children . in countries where universal immunization of adults is not yet feasible , many experts consider such targeted immunization as
presently , the cocoon strategy is recommended in several european countries , including australia , france , germany , and austria . maternal vaccination
although there is efficient placental transfer of pertussis antibodies , low maternal levels and rapid decay in newborns render the infants vulnerable to life - threatening pertussis [ 16 , 18 ] . maternal immunization during pregnancy might afford some degree of protection to mother and infant during a vulnerable period , and the use of tdap during pregnancy is currently under consideration . neonatal vaccination
given the resurgence of reported pertussis in infant populations noted in multiple countries , and the high morbidity and mortality in this age group , newborn pertussis immunization is a potentially attractive strategy [ 5 , 16 , 19 ] .
it is still unclear , however , if such a strategy will induce sufficient and timely immunity for this targeted immunization .
despite the increasing awareness of b. pertussis , it continues to affect millions of people worldwide . while classical pertussis was once regarded as a child s disease , today , pertussis poses a serious threat to infants , and greatly affects adolescents adults , now functioning as reservoirs of infection .
while advances in molecular biology have undoubtedly increased the capacity to diagnose pertussis , work is still needed to standardize laboratory techniques .
the increased awareness of the pertussis problem among experts and the lay public will hopefully pave the way for the implementation of various vaccine strategies to enhance its control . | despite high vaccination coverage , over the last fifteen years there has been a worldwide resurgence of b. pertussis infection .
while classical pertussis in the prevaccine era was primarily a childhood disease , today with widespread vaccination , there has been a shift in the incidence of disease to adolescents and adults .
centers of disease control and prevention ( cdc ) data from 2004 reveal a nearly 19-fold increase in the number of cases in individuals 1019 years and a 16-fold increase in persons over 20 years .
indeed adolescent and adults play a significant role in the transmission of pertussis to neonates and infants who are vulnerable to substantial morbidity and mortality from pertussis infection .
several explanations have been proposed to explain the increasing incidence of disease , with waning immunity after natural infection or immunization being widely cited as a significant factor .
improving molecular biology diagnostic techniques , namely pcr assays , also accounts for the increasing laboratory diagnosis of pertussis .
expanding vaccination strategies including universal immunization of adolescents , targeted immunization of adults , and in particular , healthcare workers , childcare providers and parents of newborns , will likely improve pertussis control . with pertussis continuing to pose a serious threat to infants , and greatly affecting adolescents and adults , there remains a need to : ( a ) increase the awareness of physicians as to the growing pertussis problem , ( b ) standardize diagnostic techniques , and ( c ) implement various new vaccine strategies to enhance its control . |
although in most cases post - lp headaches are not severe and have a benign course , they can also be a manifestation of a potentially life - threatening complication such as subdural hematoma ( sdh ) .
we describe a patient in whom a massive sdh developed after lp and cerebrospinal fluid ( csf ) drainage , which were performed during the diagnostic evaluation of freezing of gait .
sdh should not be excluded from the differential diagnosis of headache following lp , especially when there is a loss of csf .
in most cases headache following lumbar puncture ( lp ) is not severe and has a benign course,1 but it can also be a manifestation of a potentially life - threatening complication such as subdural hematoma ( sdh ) .
we present herein a case of massive sdh after lp and cerebrospinal fluid ( csf ) drainage .
a 57-year - old man was admitted to our hospital with freezing of gait ( fog ) and bradykinesia .
he had suffered three minor ischemic strokes over the past 15 years , from which he had completely recovered .
amantadine was administered following the diagnosis of parkinson 's disease , but the patient did not improve .
mri revealed multiple ischemic changes in the periventricular white matter and bilateral basal ganglia , as well as diffuse cerebral atrophy with ventriculomegaly ( fig .
levodopa was administered following the diagnosis of vascular parkinsonism , but did not improve the condition of the patient .
lp and csf drainage were performed to rule out normal - pressure hydrocephalus ( nph ) .
the patient 's gait did not improve , and lp and csf drainage were again performed 3 days later .
the opening pressure at that time was 7.7 cmh2o , and a further 30 ml of csf was drained .
after the second drainage , the patient 's gait improved slightly , and he was pleased with the result .
however , because the improvement was not marked , ventriculoperitoneal shunting was not performed and he was discharged .
he was taking aspirin ( 100 mg daily ) and ramipril ( 5 mg daily ) .
brain computed tomography ( ct ) revealed slight progression of ventriculomegaly and no signs of intracranial hemorrhage ( fig .
csf drainage was repeated once more because his gait had improved slightly after csf drainage on the first admission and aggravation of fog due to progression of hydrocephalus could not be completely ruled out .
a 22-gauge tuohy needle was used in the lateral decubitus position . the opening pressure during this procedure was 7 cmh2o , and 25 ml of csf was drained .
two days after drainage , he began to develop mild posterior neck pain and an occipital headache accompanied by nausea .
he received conservative treatment but showed no improvement . on the 3rd day post - lp ,
although his headache was not aggravated on the 4th day , on the 5th day he was found in the bathroom stuporous and with right hemiplegia .
an emergency craniotomy and evacuation of the hematoma were performed , and he recovered to his pre - sdh condition .
sdh is a rare but well - known complication of lp performed for spinal anesthesia2 and diagnostic lp performed for suspected meningitis.3 however , a massive sdh after lp and csf drainage , which were performed as part of the diagnostic evaluation of our patient with fog , has not been described previously .
the pathophysiological mechanism of post - lp sdh may involve low intracranial pressure ( icp ) as a result of lp and subsequent congestion , dilatation , and tearing of the subdural vein.4 this could explain the occurrence of sdh in patients with ventriculoperitoneal shunts4 and in those with spontaneous csf hypovolemia,5 where the icp is chronically low .
considering these findings , it is surprising that most of the reported cases of post - lp sdh were associated with lp performed for spinal anesthesia , in which the loss of csf is negligible , rather than with diagnostic lp for csf analysis , in which the loss of csf is greater and the risk of consequent intracranial hypotension is higher . in lp and csf drainage for the diagnosis of nph , as in our patient
, the loss of csf is by substantially greater than for diagnostic lp for csf analysis .
it is conceivable that patients undergoing lp and csf drainage are at an increased risk of post - lp sdh .
it was initially thought that the headache in our patient was a common post - lp headache because it developed 2 days after lp , which is when post - lp headaches usually occur,1 and because of the absence of focal or lateralized neurologic abnormality , which would have suggested the presence of an intracranial space - occupying lesion .
furthermore , the patient 's headache improved with recumbency , although it did not completely disappear .
the preexisting gait disturbance and parkinsonism observed in our patient , which are occasionally initial symptoms of sdh , might have hindered the early detection of an sdh .
this case shows that sdh should not be excluded from the differential diagnosis of headache following lp , especially when there has been a loss of csf . | backgroundheadache is a common complication of lumbar puncture ( lp ) .
although in most cases post - lp headaches are not severe and have a benign course , they can also be a manifestation of a potentially life - threatening complication such as subdural hematoma ( sdh).case reportwe describe a patient in whom a massive sdh developed after lp and cerebrospinal fluid ( csf ) drainage , which were performed during the diagnostic evaluation of freezing of gait.conclusionssdh should not be excluded from the differential diagnosis of headache following lp , especially when there is a loss of csf . |
anemia is a disease that can co - exist with depression , other mental disorders , or somatic diseases .
anemia can imitate symptoms of depression , while depression symptoms can mask concurring symptoms of anemia .
i am presenting a case of a 48-year - old woman with addison biermer anemia , with co - existing mood disorders .
the clinical analysis of the presented patient s history indicates diagnostic problems and a need for a detailed analysis of drug - related complications that occurred during previous treatment , eg , in the form of neuroleptic malignant syndrome .
the presented case report contains valuable guidelines that can be of assistance in diagnostics and treatment of patients treated for mental disorders , who are also diagnosed with somatic diseases .
pernicious anemia , also called addison biermer anemia , is an autoimmune disease most often occurring in people with a blood type , and caused by vitamin b12 absorption disturbances ( figure 1 ) . in the initial clinical presentation
, symptoms of this anemia , including apathy , psychomotor retardation , lack of energy , fatigability , or excessive sleepiness , can indicate a possibility of concurring depression.1,2 furthermore , symptoms of depression can overlap with somatic symptoms of anemia , further complicating the clinical presentation , and therefore , the treatment of underlying disease , or even persisting when anemia symptoms have resolved .
patients particularly susceptible to stress and suffering from anxious personality disorders concomitant with somatic diseases belong to a risk group prone to depressive disorders and anemia .
depression can develop against a background of a chronic stress reaction related to the somatic disease.3 chronic stress can also lead to development of conversion disorders , with partial or complete loss of correct integration of past memories with a sense of own identity.4,5 increased conversion or depression symptoms in patients with addison
biermer anemia can represent a difficult diagnostic and treatment challenge to hematology specialists , general practitioners , and psychiatrists .
treatment of depression and conversion symptoms should combine pharmaco- and psychotherapy.6 for severe depression , treatment with anti - depressive drugs alone may be insufficient , requiring additional inclusion of atypical neuroleptics.7 it is worth noting that in people suffering from depression and with a positive history of somatic diseases , such as addison
biermer anemia or endocrine diseases , the neuroleptic malignant syndrome ( nms ) is more likely to occur following neuroleptic treatment , than in people without somatic diseases .
i am presenting a clinical case of a 48-year - old patient , with a blood type , admitted to the surgical ward due to anemia .
it is known from the interview that the patient was previously pharmacologically treated for hypothyroidism , but has not taken medications for several years .
the patient felt weak , had concentration problems , and reduced tolerance of physical exercise for approximately 1 month . in physical examination ,
the patient underwent the following examinations : ultrasound scan of the abdominal cavity , gastroscopy , colonoscopy , computed tomography of the abdominal cavity , and ultrasound scan of the thyroid .
laboratory tests conducted on admission day revealed : white blood corpuscules 4.56 k/l ; lymphocytes 2.41 ; red blood corpuscules 3.00 m/l ; hemoglobin 8.74 g / dl ; mean corpuscular volume 81.8 fl ; mean corpuscular hemoglobin 28.7 pg ; mean corpuscular hemoglobin concentration 35.7 g / dl ; platelets 158 k/l ; vitamin b12 level 120 pg / ml ( reference value 180900 pg / ml ) ; iron level 160 g / dl ( reference value 60160 g / dl ) .
thyroid hormone levels for free thyroid hormone triiodothyronine , free thyroid hormone thyroxine , and thyroid - stimulating hormone levels were within the reference values . only in the tenth day of her hospitalization , the patient disclosed that in the past she had underwent psychiatric treatment for depression and conversion disorders .
five years before current hospitalization , the patient had had nms due to treatment with olanzapine for psychotic depression . during psychiatric consultation ,
for the last 3 months , the patient has complained about deteriorating psychical condition revealing symptoms such as : low mood , apathy , anhedonia , anxiety , memory and concentration problems , sleep disturbances , and suicidal thoughts .
depression diagnosis was based on clinical assessment of the patient and followed by performing beck depression inventory in which the patient received 26 scores.8 pharmacological treatment was commenced , with venlafaxine , 225 mg / day , and valproic acid , 1,000 mg / day .
after 4 weeks of treatment , mirtazapine was added at a dose of 30 mg / day .
mood and psychomotor drive were partially improved after 10 weeks of treatment . following 4 weeks of treatment
this time the patient received 19 scores , which indicate improvement of the patient s mental status .
the vitamin was administered intramuscularly daily for 10 days , then three times a week for 3 weeks , and then twice a week for the next 3 weeks . at the next stage of the treatment folic acid
was added at a dose of 15 g / d and after 10 weeks of therapy , anemia symptoms disappeared .
when suffering from somatic symptoms of anemia or symptoms resulting from a thyroid function disorder , patients usually visit their general practitioner , hematologist , endocrinologist , or surgeon .
the most important task of the doctor is to establish whether some or all of presented symptoms are of an organic origin , or not .
the organic cause requires a clinical intervention , eg , in the form of pharmacological or surgical treatment.9 however , it should be remembered that the initial organic disease may be accompanied by concurrent secondary mental disorders.10,11 it is recommended to perform screening laboratory tests in patients with depression , excluding anemia and hypothyroidism , such as : complete blood count , serum iron level , total iron binding capacity , unsaturated iron binding capacity , serum vitamin b12 level , and thyroid - stimulating hormone . in patients belonging to a risk group susceptible to depression , it is recommended to determine oxidative stress markers , eg , chemokines , cytokines .
these markers may constitute an early predictor of affective disorders.12 when the organic cause is excluded , or when concurrent symptoms of mental disorders are observed , then the basic medical procedure involves psychiatric consultation for correct diagnosis and treatment initiation .
biermer anemia can co - exist with other somatic diseases or accompany mental disorders ( depression , anxiety disorders , conversion disorders).13 it is a strong predictor of adverse clinical incidents related to cardiac ischemia .
anemia is associated with higher short - and long - term risk of death in coronary disease patients with a stable form of that disease , heart infarction with st segment elevation , and with acute coronary syndromes without st segment elevations , as well as in patients after coronary vessel interventions .
a decrease in hemoglobin ( hb ) by 1 g / dl is associated with 14%18% increase in mortality in a dialysis patient population , while hb level decrease below 8 g / dl doubles the risk of death versus patients with hb of 1011 g / dl . in depression , concurrence of somatic diseases , such as addison
biermer anemia or thyroid hormone disturbances can delay therapy , for example , using electroconvulsive therapy in treatment of severe depression.14 in treatment of depression , delayed use of electroshocks can result in exacerbation of depression and contribute to the increased risk of suicide.15 moreover , in patients treated with atypical neuroleptics there is a risk of nms . according to the diagnostic and statistical manual of mental disorders , fourth edition ( dsm - iv ) , it is possible to diagnose nms when muscle rigidity and fever are found with at least two of the following symptoms concurring : diaphoresis , dysphagia , incontinence , changes in level of consciousness , mutism , tachycardia , increased or labile blood pressure , leukocytosis , and increased ck levels , indicating muscle injury .
other criteria proposed by levenson include major symptoms ( fever , muscle rigidity , and increased ck levels ) and minor symptoms
( tachycardia , variable blood pressure , tachypnea , changes in level of consciousness , diaphoresis , and leukocytosis ) . the nms diagnosis is justified in cases with all major symptoms present , or when two of them are accompanied by at least two
minor symptoms.16 nms can also develop in patients with positive history of somatic diseases , such as thyroid disorders , anemia , and neurological diseases , or in patients without chronic diseases.17 furthermore , patients who suffered from nms caused by olanzapine are predisposed to nms in the future also after administration of other drugs affecting the dopaminergic system.18,19 metabolic changes secondary to hypothyroidism or addison biermer disease , particularly in the dopaminergic pathways within the central nervous system , can also predispose to the development of nms.20
in treatment of depressive disorders , a possibility of concurrence of somatic disorders in the same patient should also be considered .
taking into consideration the fact that mental disorders often represent prodromal signs of various somatic diseases , it is necessary to remember that additional tests and evaluation of the somatic status are of particular importance in psychiatric patients .
it is worth noting that these patients focus on their emotional experience and ignore their somatic problems . | backgroundanemia is a disease that can co - exist with depression , other mental disorders , or somatic diseases .
anemia can imitate symptoms of depression , while depression symptoms can mask concurring symptoms of anemia.case presentationi am presenting a case of a 48-year - old woman with addison biermer anemia , with co - existing mood disorders .
the clinical analysis of the presented patient s history indicates diagnostic problems and a need for a detailed analysis of drug - related complications that occurred during previous treatment , eg , in the form of neuroleptic malignant syndrome.conclusionthe presented case report contains valuable guidelines that can be of assistance in diagnostics and treatment of patients treated for mental disorders , who are also diagnosed with somatic diseases . |
plasmodium falciparum is responsible for the main disease burden afflicting primarily sub - saharan africa . in areas with stable malaria transmission , due to protracted exposure to infectious bites , partial protective immunity to clinical malaria
there is however one exception to this general rule : pregnancy - associated malaria ( pam ) . despite their semi - immune status ,
approximately 25 million pregnancies are at risk of p. falciparum infection every year , and 25% of these women have evidence of placental infection at the time of delivery [ 13 ] .
clinical features of infection during pregnancy vary with the degree of preexisting immunity and thus the epidemiological setting . in high - transmission areas ,
maternal anaemia and low birthweight ( lbw ) , as a result of prematurity and/or intrauterine growth restriction ( iugr ) , are the main adverse outcomes of placental infection and tend to be more severe in first pregnancies and in younger mothers [ 2 , 48 ] .
each year between 100 000 to 300 000 infant deaths may be attributable to maternal malaria in africa [ 10 , 11 ] .
the pathophysiological processes preceding adverse outcomes in pam are initiated by the accumulation of p. falciparum - infected red blood cells ( prbcs ) in placental intervillous spaces , causing inflammatory responses and deposition of fibrinoid material .
adhesive interactions between parasite - encoded erythrocyte surface antigens and intervillous host receptors such as chondroitin sulphate a ( csa ) , hyaluronic acid ( ha ) , and nonimmune immunoglobulins ( igs ) are believed to be involved in the sequestration process .
iugr appears to be related to reduced nutrient transport to the foetus due to high parasite and inflammatory cell density [ 13 , 14 ] .
maternal anaemia may also independently contribute to iugr , most likely via a reduction in oxygen transport to the foetus . in uganda ,
the overall burden of malaria is high and its adverse outcomes to the infected mother and the unborn child are widespread .
there is growing awareness that pregnancy - associated malaria is also of importance in areas of low and seasonal transmission worldwide .
although uganda is regarded as being a malaria - endemic region , the transmission level varies considerably across the country .
similar to studies from other countries , data on malaria burden are mainly available from areas of high transmission . in light of this , we conducted a cross - sectional study to assess the pam burden in a periurban / urban setting with low , seasonal malaria transmission .
moreover , this is the first study providing baseline data on the burden of pam and its possible adverse outcomes ( anaemia , lbw ) at uganda 's national referral hospital at mulago .
mulago hospital serves as uganda 's national referral hospital and is situated in the capital city of kampala . in uganda , there is stable p. falciparum transmission in 95% of the country .
the remaining 5% of the country , mainly the highland areas with altitudes > 1,600 m , are subject to low and unstable malaria transmission .
kampala is located 1,3001,500 m above the sea level close to the equator and experiences a tropical climate with rainfalls throughout the year .
the population in the area experiences low - intermediate malaria transmission with the highest peaks toward the end of the two major rainy seasons ( march to may and october to december ) .
there was an average of 146.7 mm of rainfall between october and december 2004 and 40 mm in january 2005 , a level comparable to the corresponding seasons in previous years . since the city is built on hills and valleys , the entomological infection rates ( eir ) vary considerably depending on the residential / occupational area .
water usually collects in the valley floors resulting in breeding sites for the anopheline mosquitoes . but generally speaking the eir is low ( < 10 bites per person per year ) .
except for the main commercial centre , the city and the surrounding areas are essentially rural .
mulago hospital has 33,000 antenatal attendances and 23,000 deliveries per year , a maternal mortality ratio of 505 deaths per 100,000 live births , a stillbirth rate of 5% , and an hiv prevalence of about 11% among pregnant women .
the current national policy for prevention of malaria in pregnancy in uganda is the use of insecticide - treated bednet and intermittent preventive treatment with two doses of sulfadoxine - pyrimethamine . in uganda ,
pregnant women are also given iron and folic acid supplementation and antihelminth drugs to prevent anaemia and hookworm infestation , respectively . from october 2004 to january 2005 , women delivering at the mulago hospital labour suite , aging 15 years and 28 weeks of gestation , were recruited to the study .
patients with cardiac disease , chronic hypertension , renal disease , clinical aids , or diabetes and those with obstetric complications during the present pregnancy , such as preeclampsia , eclampsia , antepartum haemorrhage , and chorioamnionititis were excluded from the study . full informed consent ( or assent for those < 18 years of age ) was obtained from all the participants . on average , five to seven participants were recruited consecutively per day , from 8.00 am to 5.00 pm excluding weekends and public holidays .
all ethical aspects of the study were granted by the makerere university medical school research and ethics committee and uganda national council for science and technology ( permit no .
mv922 ) , and the ethical committee at karolinska institutet , sweden ( permit no . 04 - 533/2 ) . a precoded
, standardized questionnaire was used to record pregnancy history , clinical examination outcome , and pregnancy outcome for each study subject .
some key aspects covered included area of residence , age , marital status , occupation , education , parity , visits to antenatal clinic ( anc ) , bednet use , use of intermittent preventive antimalarial treatment ( ipt ) , iron and folic acid supplementation , gestational age , birth status ( live or stillbirth ) , and birthweight .
the information on use of ipt , iron and folic acid supplementation was obtained from interview and/or antenatal card .
venous blood was collected within a few hours ( 24 hours ) prior to delivery for peripheral blood diagnosis of malaria and for haemoglobin testing .
after delivery , the placentas were collected in 0.9% nacl for smear and histological assessment of malaria .
a small incision was made paracentric on the maternal - facing side of the placentas to prepare blood films .
thick and thin blood films of peripheral and placental blood were stained by giemsa , and malaria diagnosis was assessed by microscopy following standard procedures . a small biopsy of the maternal - facing surface of each collected placenta was also removed and preserved in 10% neutral buffered formalin .
the biopsies were paraffin embedded and stained with haematoxylin and eosin for histological evaluation of placental malaria infection .
reexamination was performed by two different pathologists in all cases where histology and blood films were in disagreement . upon histological assessment
, placental biopsies were classified according to the following criteria [ 16 , 17 ] : ( a ) active acute infection : parasites present in maternal erythrocytes , ( b ) active chronic infection : presence of parasites and a significant amount of pigment deposition in fibrin or monocytes within fibrin , ( c ) past infection : presence of pigment within fibrin only , no parasites , and ( d ) not infected : no evidence of parasites or pigment .
low birthweight is defined as weight < 2500 g. anaemia is defined as haemoglobin ( hb ) level < 11 g / dl and severe anaemia as hb < 7 g / dl .
bednet users refer to individuals using net of any category ( untreated as well as insecticide - treated nets ) .
data were entered and verified by two independent individuals using epi info version 6.1 and exported to spss version 12.0 for further analysis .
potential risk factors or confounders considered were area of residence , literacy , age , use of bednet , ipt , and iron and folic acid supplementation .
following the assessments of the crude effect of each risk factor , the list of interesting risk factors was organised into three blocks : background , intermediate and proximate risk factors .
background risk factors were adjusted for each other : intermediate for background and intermediate , and proximate for all other risk factors . adjusted
variables with a p - value of < .1 were included in the final model . due to the presence of missing values in the dataset , missing value analysis was performed prior to logistic regression modelling in order to assess the total number and randomness of missing values .
multiway univariate analysis of variance ( anova ) was used to study the effects of placental infection , gravidity and age , and combinations thereof , on haemoglobin level and birthweight .
a total of 399 women who consented to take part in the study were recruited between october 2004 and january 2005 .
the age of the participants ranged from 15 to 44 years , median 20 ( iqr : 1825 ) .
most participants were residents of kampala ( 68.6% ) and wakiso ( 22.9% ) districts .
the majority had primary ( 46.4% ) or secondary ( 42.3% ) level of education ; 66.3% were housewives or unemployed ; 74% were married .
most women ( 96.8% ) had attended an antenatal clinic at least once during the present pregnancy .
one hundred and sixty five ( 41.5% ) had received intermittent preventive antimalarial treatment ( ipt ) ; of these , the majority had received one dose ( 74.5% ) , whereas 20.5% had received the two recommended doses .
other preventive measures taken during pregnancy consisted of the use of mosquito bednets : two thirds ( 267/397 ; 67.3% ) utilized nets of any sort : 32% ( 127/397 ) were strict insecticide - treated net ( itn ) users .
most women had also received iron ( 79.3% ) and folic acid ( 70.4% ) supplementation during the present pregnancy ( see table 1 for general characteristics ) .
the study population consisted of 196 ( 49.4% ) gravidae 1 ( g1 ) or primigravidae , 142 ( 35.8% ) gravidae 2 - 3 ( g2 - 3 ) , and 59 ( 14.9% ) gravidae 4 or above ( g4 ) .
primigravidae tended to be younger ( p < .0001 ) and more literate ( p = .001 ) , delivered more low - birthweight babies ( p = .06 ) , used less ipt ( p < .0001 ) , and were more afflicted by placental malaria infection ( p = .035 ) as compared to multigravidae ( g2 and above ; table 2 ) .
the prevalence of malaria by each of the three measures peripheral smear , placental smear and placental histology , was 9% ( 35/391 ) , 11.3% ( 44/389 ) and 13.9% ( 53/382 ) , respectively . out of 53 women with histological evidence of infection , 34 ( 64.1% )
were classified as acute , 2 ( 3.8% ) as chronic , and 17 ( 32.1% ) as past infection .
a total of 380 cases , where placental histology and the corresponding blood film data were available , were used for further associative analysis . in order to avoid loss of data , all cases diagnosed as being acute or chronic infection by histology or as p. falciparum positive by placental blood film examination
based on the new case definition criteria , a total of 15.5% ( 59/380 ) and 4.5% ( 17/380 ) had active versus past placental infection , respectively .
peripheral parasites were present in 50.9% ( 28/55 ) and 5.9% ( 1/17 ) of cases with active versus past infection . in patients with no evidence of active or past placental infection , only 1.3% ( 4/304 ) had peripheral parasitaemia .
placental infection could thus be used as a reliable measure of malaria burden in the remainder of the analysis .
twenty - two percent of the women were anaemic ( hb < 11 g / dl ) prior to delivery .
severe anaemia ( hb < 7 g / dl ) was however uncommon ( 3/389 ; 0.8% ) .
the mean haemoglobin level was 12.3 g / dl ( iqr = 10.913.4 ) ( table 1 ) .
the overall prevalence of stillbirths was 2.8% ( 11/389 ) and preterm deliveries 3.1% ( 12/389 ) . among live - born babies , 12.2% ( 46/378 ) were of low birthweight and the mean birthweight was 3100 g ( iqr = 28003500 ) ( table 1 ) .
table 3 illustrates crude and adjusted odds ratios for factors associated with placental p. falciparum infection .
whilst higher age and use of bednet were found protective , district of residence , educational level , and use of ipt showed no association .
being multigravid ( g4 ) was protective in the crude analysis ( or = 0.38 ; ci = 0.140.88 ; p < .05 ) ( figure 1(a ) ) ; the effect was , however , lost in the adjusted model ( table 3 ) .
as gravidity and age are highly correlated variables , an age - stratified analysis was performed to separate out the effect of the two .
gravidity groups were stratified by two age groups ( 1519 years versus 20 years ) . a trend of higher infection rate ,
although not significant , was observed in young primigravidae ( g1 : 33/126 = 23.1% versus g2 : 4/28 = 14.3% ; or = 2.1 ; ci = 0.696.6 ; p = .18 ) .
the analysis was , however , limited by the absence of higher parities ( g4 ) in the younger age group .
the crude analysis and the adjusted final model , both , identified a strong association between active placental malaria infection and anaemia ( or = 2.76 ; ci = 1.45.5 ; p = .003 ) ( table 4 , figure 1(b ) ) .
the mean haemoglobin level was 11.6 g / dl ( ci : 11.112.3 ) versus 12.6 g / dl ( ci : 12.312.9 ) in patients with active infection or no infection , respectively , ( p = .02 ) .
no associations were observed with any of the other considered risk factors . of note ,
factors associated with low birthweight are outlined in table 5 . increased haemoglobin level and to some extent age showed protective association with low birthweight . increased gravidity ( g4 ) showed a crude but not adjusted protective association .
no overall associations were found with district of residence , education , placental malaria infection , use of bednet , ipt , and iron and folic acid supplementation .
a significant association was , however , found when interactions between gravidity and placenta infection groups and their effect on mean birthweight were analyzed ( table 6 ; p = .036 ) .
however , interpretation of the effect size of gravidity and placental infection on mean birthweight becomes complicated in light of the significant covariation of gravidity by age ( p = .034 ; see table 6 and supplementary table in supplementary material available online at doi : 10.406/2010/913857 ) . to analyze the pattern of the identified interaction , the age parameter was thus fixed at a mean value in all subgroups ( tables 7 and 8) .
the smallest mean birthweight in primigravidae were found in mothers with active infection , whereas in multigravidae it was observed in mothers with past infection ( tables 7 and 8) .
data on the burden of malaria in pregnancy , in particular from areas of low transmission , are scarce in uganda as well as in other countries .
a cross - sectional study was thus conducted from october 2004 to january 2005 in the periurban / urban setting of kampala where the population experiences relatively low and seasonal malaria transmission . exploiting placenta histology and blood film examination ,
a high proportion of the study population was found burdened with active placental infection ( 15.5% in total ) .
in addition , histological examination identified a number of women with past placental infection ( 4.5% ) .
adverse clinical outcomes associated with malaria in pregnancy are linked to pathological changes in the parasite - burdened placentas , and histology is the only method that provides insight on pathological changes as well as timing of infection ( acute , chronic , and past ) .
past infections would have been missed had we relied solely on blood film examination . of note , a minor proportion of women with no evidence of placental infection ( 1.3% ) were afflicted by peripheral parasites .
hence , the mere presence of peripheral parasites coinciding with pregnancy is not a proof of their involvement in placental sequestration and adverse clinical outcomes .
placental infection was thus used as a reliable measure of pam burden in this study .
the majority of the placental malaria cases was concentrated among gravidae 1 through 3 . observed pattern
acquired antibodies recognize an antigenically and functionally distinct subpopulation of prbcs , which is clonally expanded owing to the new niche of growth provided by the placenta [ 19 , 20 ] .
the functional distinction between pregnancy - associated parasites and parasites of nonpregnant individuals has partly been explained by the csa - adhesion ability of the former [ 21 , 22 ] .
accordingly , in a related study , we found csa - adhesion to constitute a prominent functional feature of ugandan placental prbcs .
the parity dependency , found herein , was however not as marked as previously reported from high - transmission areas .
this shift may be a reflection of the lower transmission level in the area but may also reflect the presence of other confounding factors such as hiv .
interestingly , placental parasites from this region were found to interact with several placental receptors ; whereas exclusive csa adhesion has been reported from highly endemic areas . of note ,
although a trend of higher infection rate in younger primigravidae was observed , the effect of gravidity could not be separated from age .
the analysis was hampered by sample size limitations , in particular the absence of higher parities ( g4 ) in the younger age group .
anaemia , one of the main adverse outcomes of placental infection , was present in 22% of the study participants .
a median hb level of 12.3 g / dl and the low prevalence of severe anaemia ( 0.8% ) may reflect a good general health status but is also comparable with levels reported previously from low- and intermediate - transmission areas in africa .
a majority of the study participants had received iron and folic acid supplementation during pregnancy ( 79.3% and 70.4% , respectively ; table 1 ) , which may in part explain the moderate level of anaemia observed in the study population .
active placental infection constituted the only significant risk factor for anaemia in women of all parities ( or = 2.8 ) . in the tropics ,
anaemia is multifactorial and may be caused by iron deficiency , parasitic infections , and haemoglobinopathies .
available data also suggest that severe anaemia is more common in women coinfected by malaria and hiv , which probably is a consequence of the increased level of parasitaemia observed in hiv - infected pregnant women [ 25 , 26 ] .
the potential role of infections other than malaria was not assessed in this study . in a recent study from western uganda ,
both hookworm infections and malaria were reported to be considerably associated with anaemia during pregnancy . whilst stillbirths and preterm deliveries were uncommon at mulago 's labour suite , delivery of lbw babies was more prevalent ( 12.2% ) .
no direct associations were found between placental infection and lbw or mean birthweight ( tables 5 and 6 ) .
parity and placental infection were , however , found to have an interactive effect on mean birthweight ( p = .036 ) .
birthweight reduction was most obvious in primigravidae with active infection and multigravidae with past infection ( tables 7 and 8) .
it is however difficult to assess the significance of the observed pattern as the role of other confounding factors could not be assessed due to sample size limitation .
the worst birthweight outcomes , for example , lbw , ( < 2500 g ) have previously mainly been reported to be associated with chronic infections [ 28 , 29 ] .
a recent longitudinal study has also reported that the risk of lbw is higher with increased frequency of malaria episodes and with infections occurring in the second than in the third trimester or at delivery .
the majority of the cases in our study was afflicted by acute infection suggesting that infection was contracted close to delivery , which may explain the lack of association between placental infection and lbw .
moreover , the low transmission level in the area in combination with better access of preventive measures in urban settings probably decreases the number of malaria episodes and prevents the establishment of stubborn chronic infections , hence affecting the risk of lbw .
increased haemoglobin level was interestingly identified as the only factor with a strong protective effect against lbw ( or = 0.83 ; table 5 ) . according to previous reports
, maternal anaemia may on its own , independent of placental malaria infection , contribute to intrauterine growth retardation and consequently lbw , most likely via a reduction in oxygen transport to the foetus .
antenatal clinics constitute an important channel for administration of ipt and for passing on information on malaria prevention in general .
a great majority of the women in this study attended anc during their pregnancy ( 96.8% ) , which is comparable to the national levels ( anc attendance = 94% ) reported in uganda demographic health survey of year 2000 - 2001 . still , relative to this , the coverage of ipt was low ( 41.5% ) , with a majority receiving only one dose of sp .
uganda 's national policy for ipt administration during pregnancy is 2 doses of sp . of note , significantly fewer primigravidae used ipt as compared to multigravidae ( table 2 ; g1 = 31.6% ; g2 - 3 = 49.3% ; g4 = 55.7% ) .
the low coverage may be explained by inadequate knowledge on how to offer ipt by the health workers and/or scarcity of the drugs .
it is pivotal to reach first - time mothers in time , especially since they are more prone to the most adverse outcomes of pam .
the use of bednet was widespread ( 67.3% ) but only 32% were strict itn users , a number that is unacceptably low . using bednet significantly protected against placental malaria ( or = 0.56 ; table 3 ) .
a trend of protective effect , although not significant , was also observed with anaemia . considering their ease of use and reported benefits to both mother and the newborn baby , increased accessibility and use of low - cost itns should be more promoted .
this study was limited by the small sample size , the lack of hiv , and helminth infection data , which may have weakened observed associations .
the hiv seroprevalence in pregnant women at mulago has been around 11% during the past recent years , a level that is higher than that of the national estimates ( 6.4% ) but comparable to the estimates in other major urban hospitals in uganda .
hence , although we excluded aids patients , a proportion of hiv - positive mothers are most probably present in the study population .
moreover , the study may be biased by the time of patient recruitment which was limited to weekdays between 8:00 . a.m and 5:00 p.m. despite these limitations , our study provides a first glimpse of the burden of malaria in pregnancy at uganda 's national referral hospital in an urban area of lower transmission .
it may also have bearings for the future design of larger studies and the development of public health policies to prevent pam , maternal anaemia , and lbw .
ultimately , to gain a better insight on the actual clinical burden of malaria in pregnancy versus transmission level and to identify additional high - risk subpopulations , data from multi - site longitudinal cohort studies are required .
however , such studies are logistically demanding , thus very infrequent but would , for example , provide insights on disease kinetics and enable the optimal targeting of preventive interventions , such as ipt , during pregnancy .
f. namusoke was in charge of patient enrollment , management and care , specimen collection and helped in data analysis and manuscript writing .
n. rasti co - supervised laboratory - related activities , analyzed the data , drafted and revised the manuscript and assisted in manuscript submission .
f. kironde co - supervised laboratory - related activities , helped in data analysis and manuscript writing .
f. mirembe was in charge of hospital - related activities and helped in manuscript writing .
all authors conceptualized and designed the study together , read and approved the final version of the manuscript . | pregnancy - associated malaria is a major global health concern . to assess the plasmodium falciparum burden in pregnancy we conducted a cross - sectional study at mulago hospital in kampala , uganda .
malaria prevalence by each of three measures peripheral smear , placental smear , and placental histology was 9% ( 35/391 ) , 11.3% ( 44/389 ) , and 13.9% ( 53/382 ) respectively .
together , smear and histology data yielded an infection rate of 15.5% ( 59/380 ) of active infections and 4.5% ( 17/380 ) of past infections ; hence 20% had been or were infected when giving birth .
a crude parity dependency was observed with main burden being concentrated in gravidae 1 through gravidae 3 .
twenty - two percent were afflicted by anaemia and 12.2% delivered low birthweight babies .
active placental infection and anaemia showed strong association ( or = 2.8 ) whereas parity and placental infection had an interactive effect on mean birthweight ( p = .036 ) .
primigravidae with active infection and multigravidae with past infection delivered on average lighter babies .
use of bednet protected significantly against infection ( or = 0.56 ) whilst increased haemoglobin level protected against low birthweight ( or = 0.83 ) irrespective of infection status .
albeit a high attendance at antenatal clinics ( 96.8% ) , there was a poor coverage of insecticide - treated nets ( 32% ) and intermittent preventive antimalarial treatment ( 41.5% ) . |
diabhycar was a 6-year clinical trial conducted in men and women with type 2 diabetes selected on the basis of persistent microalbuminuria ( uae , 20200 mg / l ) or macroalbuminuria ( uae
the trial tested whether a low dose of ramipril , an ace inhibitor able to reduce uae , also would reduce cardiovascular and/or renal events such as myocardial infarction , stroke , acute heart failure , esrd , and cardiovascular death .
for the purpose of the original diabhycar trial , a renal event was defined as the doubling of serum creatinine levels or the requirement of hemodialysis or renal transplantation ( esrd ) during follow - up .
an independent committee reviewed all case records to validate selection criteria , to grade the renal involvement of each patient , and to adjudicate the clinical events during follow - up ( 11 ) .
participants gave written informed consent and study protocols were approved by the ethics committee of angers university hospital .
copeptin concentration was measured in fasting plasma - edta samples , collected at baseline , and kept frozen at 80c .
an automated immunofluorescent sandwich immunoassay was used ( brahms copeptin us kryptor ct - proavp ; thermofisher scientific , hennigsdorf , germany ) ( 13 ) .
estimated glomerular filtration rate ( egfr ) was calculated according to the modification of diet in renal disease formula ( 15 ) .
variation of egfr during the study was computed as the difference between values at the end of follow - up and at baseline divided by the duration of follow - up .
tertiles of plasma copeptin concentration were computed separately for women and men to take into account sex - related differences in copeptin levels .
differences between groups were assessed by pearson test , wilcoxon / kruskal - wallis test , anova , and ancova .
when anova or ancova were significant , comparisons between pairs were made using the tukey - kramer honestly significant difference test .
kaplan - meier curves were used to plot survival ( renal event - free ) rates over time by sex - specific tertiles of plasma copeptin .
cox proportional hazards survival regression analyses were used to examine the effect of explanatory variables on time - related survival ( renal event - free ) rates in prospective analyses .
competing risk regression analysis ( fine and gray model ) was performed to estimate subhazard ratios of risk factors assuming death as a competing risk ( 16 ) .
adjustments for clinical and biological parameters were performed by including these parameters as covariates in the regression models .
interaction between plasma copeptin tertiles and sex or study treatment ( randomization group in the original diabhycar study : ramipril vs. placebo ) on the risk of renal events or in the comparison of egfr decline were assessed by including in the regression model ( cox or ancova ) a crossed compound covariate ( copeptin tertiles / sex or copeptin tertiles / study treatment ) .
c - statistics were used to compare areas of receiver operating characteristic ( roc ) curves .
data were log - transformed for the analyses when the normality of the distribution was rejected by the kolmogorov - smirnov - lilliefors goodness - of - fit test .
statistics were performed with jmp ( sas institute , cary , nc ) and stata ( statacorp , college station , tx ) software .
diabhycar was a 6-year clinical trial conducted in men and women with type 2 diabetes selected on the basis of persistent microalbuminuria ( uae , 20200 mg / l ) or macroalbuminuria ( uae
the trial tested whether a low dose of ramipril , an ace inhibitor able to reduce uae , also would reduce cardiovascular and/or renal events such as myocardial infarction , stroke , acute heart failure , esrd , and cardiovascular death .
for the purpose of the original diabhycar trial , a renal event was defined as the doubling of serum creatinine levels or the requirement of hemodialysis or renal transplantation ( esrd ) during follow - up .
an independent committee reviewed all case records to validate selection criteria , to grade the renal involvement of each patient , and to adjudicate the clinical events during follow - up ( 11 ) .
participants gave written informed consent and study protocols were approved by the ethics committee of angers university hospital .
copeptin concentration was measured in fasting plasma - edta samples , collected at baseline , and kept frozen at 80c .
an automated immunofluorescent sandwich immunoassay was used ( brahms copeptin us kryptor ct - proavp ; thermofisher scientific , hennigsdorf , germany ) ( 13 ) .
estimated glomerular filtration rate ( egfr ) was calculated according to the modification of diet in renal disease formula ( 15 ) .
variation of egfr during the study was computed as the difference between values at the end of follow - up and at baseline divided by the duration of follow - up .
tertiles of plasma copeptin concentration were computed separately for women and men to take into account sex - related differences in copeptin levels .
differences between groups were assessed by pearson test , wilcoxon / kruskal - wallis test , anova , and ancova .
when anova or ancova were significant , comparisons between pairs were made using the tukey - kramer honestly significant difference test .
kaplan - meier curves were used to plot survival ( renal event - free ) rates over time by sex - specific tertiles of plasma copeptin .
cox proportional hazards survival regression analyses were used to examine the effect of explanatory variables on time - related survival ( renal event - free ) rates in prospective analyses .
competing risk regression analysis ( fine and gray model ) was performed to estimate subhazard ratios of risk factors assuming death as a competing risk ( 16 ) .
adjustments for clinical and biological parameters were performed by including these parameters as covariates in the regression models .
interaction between plasma copeptin tertiles and sex or study treatment ( randomization group in the original diabhycar study : ramipril vs. placebo ) on the risk of renal events or in the comparison of egfr decline were assessed by including in the regression model ( cox or ancova ) a crossed compound covariate ( copeptin tertiles / sex or copeptin tertiles / study treatment ) .
c - statistics were used to compare areas of receiver operating characteristic ( roc ) curves .
data were log - transformed for the analyses when the normality of the distribution was rejected by the kolmogorov - smirnov - lilliefors goodness - of - fit test .
statistics were performed with jmp ( sas institute , cary , nc ) and stata ( statacorp , college station , tx ) software .
characteristics of participants at baseline by plasma copeptin tertiles and by sex are shown in table 1 .
for both men and women , subjects in the highest tertile were older , had higher hba1c levels , had lower egfr , and more often had arterial hypertension and proteinuria .
renal events during follow - up comprised 67 cases of doubling of serum creatinine and 19 cases of esrd in 76 subjects ( 2.45% ) .
individuals who presented a renal event , as compared with those who did not , at baseline had a longer duration of diabetes , and higher copeptin , hba1c , and triglyceride levels , and had lower hdl cholesterol levels .
they had lower egfr , higher uae , more often had arterial hypertension and proteinuria , and more often were treated by diuretics .
a history of myocardial infarction was more frequent in individuals who presented a renal event ( supplementary table 1 ) .
clinical characteristics at baseline by tertiles of plasma copeptin and by sex the incidences of renal events during follow - up by sex - specific tertiles of plasma copeptin were 1.06% ( t1 ) , 1.45% ( t2 ) , and 4.84% ( t3 ) for the whole population ( n = 3,101 ) .
they were 2.43% ( t1 ) , 5.11% ( t2 ) , and 11.81% ( t3 ) for the subset of subjects with macroalbuminuria at baseline ( n = 729 ) .
cox proportional hazards survival regression analyses showed a positive association of the highest tertile of plasma copeptin with the incidence of renal events in the whole population , as well as in the subset of subjects with macroalbuminuria at baseline ( fig . 1 and table 2 , model 1 ) .
this association remained significant when adjusted for baseline uae and egfr ( table 2 , model 2 ) .
the highest tertile of plasma copeptin was associated with the incidence of both outcomes comprising the renal events ( doubling of plasma creatinine and esrd ) in subset analyses stratified by outcomes ( supplementary table 2 ) . despite the smaller number of renal events in the subset of subjects with microalbuminuria at baseline ( 25 events in 2,372 subjects ) , the highest tertile of plasma copeptin
plasma copeptin levels were , on average , 15% higher in subjects treated with diuretics as compared with those who were not ( mean sem , 7.55 0.3 vs. 6.58 0.02
however , associations of copeptin tertiles with renal events were similar in subjects treated or not treated by diuretics , and no interaction copeptin / use of diuretics was observed ( data not shown ) .
kaplan - meier survival ( renal event - free ) curves during follow - up by tertiles of plasma copeptin .
renal events were defined as the doubling of the serum creatinine levels or esrd during follow - up .
risk of renal events during the follow - up by tertiles of plasma copeptin at baseline a stepwise multiple regression analysis was performed to evaluate the independence of the association of plasma copeptin levels with renal events from other potentially confounding covariates ( table 3 ) .
the renal event status during follow - up ( yes or no ) was entered in the model as the dependent variable .
sex , age , duration of diabetes , arterial hypertension status ( yes or no ) , use of diuretics ( yes or no ) , hba1c , triglycerides , hdl cholesterol , egfr , uae , and copeptin ( tertiles ) at baseline were entered as independent covariates .
uae and copeptin remained positively associated and hdl cholesterol and egfr were inversely associated with the incidence of renal events .
another potential confounder , smoking behavior , was not associated with plasma copeptin levels and had no impact on the association of copeptin with renal events ( data not shown ) . in an additional analysis , the inclusion in the regression model of blood glucose levels and blood pressure at baseline and changes in blood glucose levels and blood pressure during follow - up had no impact on the results .
we constructed roc curves with uae , plasma copeptin levels , or both as markers of renal events ( data not shown ) .
roc areas were similar for uae and plasma copeptin ( 0.78 vs. 0.73 ; c - statistics p = 0.16 ) adjusted for age , sex , and study treatment .
we observed an added effect for the combined markers ( uae plus copeptin roc area , 0.82 ) as compared with the uae effect ( p = 0.03 ) .
covariates associated with the incidence of renal events in a stepwise regression analysis death occurred in 454 subjects ( 14.65% ) during follow - up , including 19 subjects who had presented a renal event .
the association between tertiles of plasma copeptin and the incidence of renal events evaluated with the cox model might be biased if many patients died of other causes related to or associated with copeptin levels before achieving the renal end point ( 17 ) .
consequently , we performed competing risk regression analyses to estimate subhazard ratios of plasma copeptin tertiles as a risk for renal events assuming death as a competing risk .
subhazard ratios and hazard ratios from the cox model were similar , indicating that death was not a competing risk in the association of plasma copeptin levels with renal events ( table 2 , model 3 ) .
moreover , we observed no independent association of plasma copeptin levels with mortality during follow - up in our cohort ( supplementary table 3 ) .
the yearly variations of egfr during follow - up by tertiles of plasma copeptin were 0.65 0.24 ( t1 ) , 0.77 0.24 ( t2 ) , and 1.91 0.24 ml / min/1.73 m per year ( t3 ) ( mean sem , ancova p = 0.0001 , adjusted for sex , age , and study treatment in the original diabhycar trial ) for the whole population . they were 1.43 0.51 ( t1 ) , 2.29 0.49 ( t2 ) , and 3.52 0.44 ml / min/1.73 m per year ( t3 ) ( p = 0.005 ) for the subset of subjects with macroalbuminuria at baseline ( supplementary fig .
these differences remained significant after additional adjustment for the duration of diabetes , hba1c , triglycerides , hdl cholesterol , uae , arterial hypertension status ( yes or no ) , and use of diuretics ( yes or no ) at baseline ( p = 0.003 for the whole population and p = 0.03 for the subjects with microalbuminuria ) .
in all comparisons , either of the risk of renal events or of the variation of egfr during follow - up , we observed no interaction between copeptin tertiles and sex or between copeptin tertiles and study treatment ( ramipril vs. placebo ) in the original diabhycar study ( data not shown ) .
characteristics of participants at baseline by plasma copeptin tertiles and by sex are shown in table 1 .
for both men and women , subjects in the highest tertile were older , had higher hba1c levels , had lower egfr , and more often had arterial hypertension and proteinuria .
renal events during follow - up comprised 67 cases of doubling of serum creatinine and 19 cases of esrd in 76 subjects ( 2.45% ) .
individuals who presented a renal event , as compared with those who did not , at baseline had a longer duration of diabetes , and higher copeptin , hba1c , and triglyceride levels , and had lower hdl cholesterol levels .
they had lower egfr , higher uae , more often had arterial hypertension and proteinuria , and more often were treated by diuretics .
a history of myocardial infarction was more frequent in individuals who presented a renal event ( supplementary table 1 ) .
the incidences of renal events during follow - up by sex - specific tertiles of plasma copeptin were 1.06% ( t1 ) , 1.45% ( t2 ) , and 4.84% ( t3 ) for the whole population ( n = 3,101 ) .
they were 2.43% ( t1 ) , 5.11% ( t2 ) , and 11.81% ( t3 ) for the subset of subjects with macroalbuminuria at baseline ( n = 729 ) .
cox proportional hazards survival regression analyses showed a positive association of the highest tertile of plasma copeptin with the incidence of renal events in the whole population , as well as in the subset of subjects with macroalbuminuria at baseline ( fig . 1 and table 2 , model 1 ) .
this association remained significant when adjusted for baseline uae and egfr ( table 2 , model 2 ) .
the highest tertile of plasma copeptin was associated with the incidence of both outcomes comprising the renal events ( doubling of plasma creatinine and esrd ) in subset analyses stratified by outcomes ( supplementary table 2 ) . despite the smaller number of renal events in the subset of subjects with microalbuminuria at baseline ( 25 events in 2,372 subjects ) , the highest tertile of plasma copeptin
plasma copeptin levels were , on average , 15% higher in subjects treated with diuretics as compared with those who were not ( mean sem , 7.55 0.3 vs. 6.58 0.02 pmol / l ; p < 0.0001 , adjusted for age and sex )
. however , associations of copeptin tertiles with renal events were similar in subjects treated or not treated by diuretics , and no interaction copeptin / use of diuretics was observed ( data not shown ) .
kaplan - meier survival ( renal event - free ) curves during follow - up by tertiles of plasma copeptin .
renal events were defined as the doubling of the serum creatinine levels or esrd during follow - up . a : subjects with microalbuminuria or macroalbuminuria at baseline ( n = 3,101 ) .
risk of renal events during the follow - up by tertiles of plasma copeptin at baseline a stepwise multiple regression analysis was performed to evaluate the independence of the association of plasma copeptin levels with renal events from other potentially confounding covariates ( table 3 ) . the renal event status during follow - up ( yes or no ) was entered in the model as the dependent variable .
sex , age , duration of diabetes , arterial hypertension status ( yes or no ) , use of diuretics ( yes or no ) , hba1c , triglycerides , hdl cholesterol , egfr , uae , and copeptin ( tertiles ) at baseline were entered as independent covariates .
uae and copeptin remained positively associated and hdl cholesterol and egfr were inversely associated with the incidence of renal events .
another potential confounder , smoking behavior , was not associated with plasma copeptin levels and had no impact on the association of copeptin with renal events ( data not shown ) . in an additional analysis ,
the inclusion in the regression model of blood glucose levels and blood pressure at baseline and changes in blood glucose levels and blood pressure during follow - up had no impact on the results .
we constructed roc curves with uae , plasma copeptin levels , or both as markers of renal events ( data not shown ) .
roc areas were similar for uae and plasma copeptin ( 0.78 vs. 0.73 ; c - statistics p = 0.16 ) adjusted for age , sex , and study treatment .
we observed an added effect for the combined markers ( uae plus copeptin roc area , 0.82 ) as compared with the uae effect ( p = 0.03 ) .
death occurred in 454 subjects ( 14.65% ) during follow - up , including 19 subjects who had presented a renal event .
the association between tertiles of plasma copeptin and the incidence of renal events evaluated with the cox model might be biased if many patients died of other causes related to or associated with copeptin levels before achieving the renal end point ( 17 ) .
consequently , we performed competing risk regression analyses to estimate subhazard ratios of plasma copeptin tertiles as a risk for renal events assuming death as a competing risk .
subhazard ratios and hazard ratios from the cox model were similar , indicating that death was not a competing risk in the association of plasma copeptin levels with renal events ( table 2 , model 3 ) .
moreover , we observed no independent association of plasma copeptin levels with mortality during follow - up in our cohort ( supplementary table 3 ) .
the yearly variations of egfr during follow - up by tertiles of plasma copeptin were 0.65 0.24 ( t1 ) , 0.77 0.24 ( t2 ) , and 1.91 0.24 ml / min/1.73 m per year ( t3 ) ( mean sem , ancova p = 0.0001 , adjusted for sex , age , and study treatment in the original diabhycar trial ) for the whole population . they were 1.43 0.51 ( t1 ) , 2.29 0.49 ( t2 ) , and 3.52 0.44 ml / min/1.73 m per year ( t3 ) ( p = 0.005 ) for the subset of subjects with macroalbuminuria at baseline ( supplementary fig .
these differences remained significant after additional adjustment for the duration of diabetes , hba1c , triglycerides , hdl cholesterol , uae , arterial hypertension status ( yes or no ) , and use of diuretics ( yes or no ) at baseline ( p = 0.003 for the whole population and p = 0.03 for the subjects with microalbuminuria ) . in all comparisons ,
either of the risk of renal events or of the variation of egfr during follow - up , we observed no interaction between copeptin tertiles and sex or between copeptin tertiles and study treatment ( ramipril vs. placebo ) in the original diabhycar study ( data not shown ) .
in this study , we demonstrated that high plasma copeptin concentration was strongly associated with the risk of severe renal outcomes ( doubling of plasma creatinine concentration and/or esrd ) in patients with type 2 diabetes and albuminuria .
this association was independent of relevant covariates such as age , duration of diabetes , blood pressure , and baseline levels of hba1c , uae , and egfr .
plasma copeptin and uae similarly predicted the incidence of renal outcomes , and a 4% added effect was observed for the combined markers . to our knowledge , this is the first clinical study that investigates the association between vasopressin or copeptin concentration and accelerated renal function decline in type 2 diabetic patients during a long - term follow - up .
plasma copeptin has been shown to be positively associated with the prevalence of microalbuminuria in cross - sectional observational and long - term follow - up studies in the general population ( 8,18 ) . in autosomal - dominant polycystic kidney disease
, copeptin is associated with various markers of disease severity including albuminuria and gfr ( 1921 ) . in renal transplant recipients , higher copeptin level at baseline
was associated with a more rapid decline in effective gfr during 3- to 4-year follow - up ( 22 ) .
moreover , studies in australian and canadian community - based cohorts of the general population showed , respectively , an inverse linear relationship between fluid intake and prevalence of chronic kidney disease ( ckd ) ( 23 ) and a faster decline of egfr over time in people with lower 24-h urine volume ( 24 ) . the results of those population studies are in agreement with an adverse effect of vasopressin on kidney function . as in any epidemiological study ,
age and sex have been shown to influence urinary concentrating activity and vasopressin levels ( 25 ) .
we observed a positive association of age with plasma copeptin levels in men and women .
we also found copeptin levels to be higher in men than in women as previously observed ( 8,18,26 ) .
however , we observed no interaction between copeptin levels and sex on the risk of renal events .
moreover , when adjusted for confounding covariates , neither age nor sex was associated with renal events . in a recent study of 1,241 hemodialysis patients with type 2 diabetes in germany , high levels of copeptin were found to be associated with increased risk for all - cause mortality ( 17 ) . in our study ,
death was not a competing risk in the association of copeptin levels with renal events and we observed no association of plasma copeptin levels with mortality .
however , it is noteworthy that all subjects in the german cohort had esrd and were more severely ill than our patients .
it is possible to speculate that the association between copeptin and renal events could be explained , at least in part , by vasopressin - mediated changes in blood pressure .
vasopressin may contribute to hypertension through activation of v1a receptors on the vascular smooth muscle or by v2-receptor
however , the association between copeptin and renal outcomes was independent of blood pressure as previously noted for the association of copeptin and uae ( 8) .
experimental evidence strongly supports a causal role of vasopressin in aggravation of diabetic ckd through v2-receptor activation .
besides well - known antidiuretic effects at the collecting duct level , a v2-receptor agonist was shown to induce glomerular hyperfiltration and to increase uae in normal rats ( 9,28 ) .
moreover vasopressin has been shown to participate in progression to renal failure in rats with five - sixths reduction in renal mass ( 29,30 ) and in rodent models of type 1 diabetes ( 10,31 ) .
acute administration of ddavp has been shown to increase uae in healthy humans but not in patients with diabetes insipidus caused by mutations in the v2-receptor ( 9 ) .
. they may involve changes in the composition of the tubular fluid at the macula densa that influence tubuloglomerular feedback control of gfr , as well as an increase in intraglomerular pressure subsequent to afferent arteriole vasodilatation ( 32 ) .
the latter hemodynamic effect is supposed to be one of the main drivers in the decline of renal function in diabetic ckd since the pioneering works by brenner and colleagues ( 33,34 ) .
however , our study can not preclude or confirm any of these mechanisms because of its observational nature .
first , the design did not allow any conclusion regarding the possible causal relationship between copeptin and disease progression .
second , we have not measured the true gfr , but we used an estimation index based on plasma creatinine levels .
finally , half of the patients of diabhycar received ramipril during the follow - up and this drug may influence blood pressure .
however , we observed no interaction between copeptin and study treatment ( ramipril vs. placebo ) in any of our results , and adjustment for ramipril treatment had no impact on the results .
the strong and independent associations of copeptin with baseline albumin excretion rate and with progression to ckd offer new tools to identify patients with highest risk of progression .
several novel therapeutic strategies have been proposed for slowing the progression of ckd ( 4 ) .
some of them , like double - blockade of the renin - angiotensin system ( va - nephron - d study , nct00555217 ) or antibodies against tumor growth factor-1 ( nct01113801 ) , are still undergoing evaluation but their use will induce a higher risk of side effects , as suggested by the ontarget trial ( 35 ) .
we propose that plasma copeptin can help target patients with the highest risk of ckd progression to optimize the benefit / risk ratio .
water intake may lower vasopressin secretion ; such medicinal use of water has been discussed recently for kidney diseases other than diabetic nephropathy ( 36 ) .
also , vaptans ( vasopressin receptor antagonists ) could selectively target the v2 receptor mediated deleterious effects of vasopressin .
if the increase of water intake or v2 receptor antagonists were shown to be beneficial , then this could open the way to individualized therapy .
these interventions then could be used specifically in subjects with high copeptin levels who , presumably , would benefit the most from the reduction of vasopressin effects .
our study is the first investigation studying the association between endogenous vasopressin and kidney dysfunction in type 2 diabetic patients .
it highlights the role of copeptin as a risk marker for long - term renal outcomes in these patients .
furthermore , it provides a rationale for intervention studies aiming to reduce vasopressin secretion or action .
| objectiveplasma copeptin , a surrogate for vasopressin , was associated with albuminuria in population - based studies .
these associations are consistent with the effect of vasopressin on albuminuria observed in humans and rodents .
the objective of this study was to determine whether plasma copeptin is an independent marker of risk of renal events in people with type 2 diabetes and albuminuria.research design and methodswe studied 3,101 participants of the diabhycar trial ( 6-year follow - up ) with type 2 diabetes and albuminuria .
a renal event was defined as doubling of serum creatinine or development of end - stage renal disease.resultsduring follow - up , 86 renal events occurred in 76 subjects ( 2.45% ) .
incidences by tertiles of baseline plasma copeptin were 1.06% ( t1 ) , 1.45% ( t2 ) , and 4.84% ( t3 ) .
they were 2.43% ( t1 ) , 5.11% ( t2 ) , and 11.81% ( t3 ) for the subset of subjects with macroalbuminuria at baseline ( n = 729 ) .
hazard ratio for plasma copeptin tertiles as a risk for renal events was 4.79 ( 95% ci , 2.489.24 ; p < 0.0001 ; for t3 vs. t1 ) . in a stepwise regression analysis , urinary albumin excretion and plasma copeptin remained positively associated and hdl cholesterol and estimated glomerular filtration rate were inversely associated with the incidence of renal events .
these independent predictors explained 18% of the variance of the outcome .
the yearly variations of estimated glomerular filtration rate by copeptin tertiles were 1.43 0.51 ( t1 ) , 2.29 0.49 ( t2 ) , and 3.52 0.44 ml / min/1.73 m2 per year ( t3 ) ( p = 0.005 ) in subjects with macroalbuminuria.conclusionsplasma copeptin may help to identify subjects with diabetic chronic kidney disease who are at high risk for renal function decline . |
this seeming paradox is rooted in the fact that there is intense skeletal growth and development during childhood and adolescence , and much more bone is formed than lost . later in life , the loss of bone tissue exceeds the rate of bone replacement .
it , therefore , follows that lifelong bone health is dependent on maximizing peak bone mass during the critical periods of growth and maturation .
bone bank , in which early deposits lay the foundation for skeletal health ; later , during aging or in response to metabolic stresses , skeletal remodeling accelerates and withdrawals from the account exceed deposits , thereby compromising skeletal integrity .
the natural process of bone remodeling makes youth the best time to invest in one 's bone health .
development and growth of the skeleton occur through the coordinated interaction of osteoblasts and osteoclasts .
osteoblasts are bone - forming cells , and are derived from pluripotent mesenchymal stem cells that can also differentiate into muscle , adipocytes , cartilage , or fibrous tissue .
bone is resorbed by osteoclasts , large , multinucleated cells that can dissolve mineral and release calcium and phosphorus into the extracellular fluid .
osteoclasts are related to monocyte / macrophage cells . during embryogenesis , and after birth as the child grows , the skeleton continues to undergo changes in architecture and size that are termed
in addition to modeling , bones are continuously reshaped by removing and replacing skeletal structures already present , a process termed remodeling .
exquisitely complex cross - talk between osteoblasts and osteoclasts is required to effect these changes through the remodeling of existing bone and modeling of new bone as bone growth proceeds .
linear growth during childhood and adolescence occurs by growth of cartilage at the end plates of long bones , followed by endochondral bone formation .
the width of the bones increases by periosteal apposition . during puberty and early adult life , endosteal apposition and trabecular thickening provide maximum skeletal mass and strength ( peak bone mass ) . locally and systemically produced factors and mechanical forces influence these processes and control the coordinated functions of osteoblasts and osteoclasts to preserve structural strength .
the adult skeleton continues to undergo remodeling throughout life , replacing approximately 15% of the mature skeleton each year to maintain mineral homeostasis , to repair damaged bone , and to respond to changes in skeletal stress .
bone remodeling occurs most often in skeletal sites rich in cancellous ( trabecular ) bone , such as the vertebrae , proximal femur , calcaneus , and ultradistal radius .
a second form of bone , termed cortical bone , is less metabolically active but provides great strength and integrity to the skeleton .
cortical bone comprises 80% of the skeleton , is dense and compact , and constitutes the outer part of all skeletal structures . during the first two decades of life
, the skeleton grows in both size and density , and it is estimated that more than half of peak bone mass is acquired during the teen years .
the process of bone growth is not uniform , and the axial and appendicular skeleton increase in size at different rates .
specifically , there is proportionately greater growth in the limbs than the trunk prior to puberty . in early and mid - puberty
, the relative rate of growth of the spine increases and growth slows at all sites in late puberty .
the rapid growth of the skeleton during puberty exceeds the rate of mineralization , and bone mineral accrual lags behind growth in height by 8 months .
women tend to experience minimal change in total bone mass between age 30 and menopause .
but , in the first few years after menopause , many women experience a period of rapid bone loss , which then slows but continues throughout the post - menopausal years .
this loss of bone mass can lead to osteoporosis , a condition of weakened bones and increased risk of fragility fracture . in men ,
age - related bone loss occurs later and proceeds at a steady rate . in both men and women ,
it is estimated that 10 million americans over age 50 have osteoporosis , which represents significant health and economic costs to society .
if osteoporosis has origins in childhood , then understanding the factors affecting bone accretion in childhood may be the key to early prevention of this common , disabling condition . however , there is increasing recognition that many children fail to optimize bone accretion during childhood and adolescence and concern that inadequate skeletal mass will result in fragile bones and increased risk of fractures both in childhood and later as adults .
for example , many childhood conditions pose threats to bone health through primary disease effects such as mal - absorption , secondary effects such as prolonged periods of physical inactivity or treatment effects such as glucocorticoid therapy .
moreover , improvements in treatment now enable many children with severe medical conditions , such as cystic fibrosis , inflammatory bowel disease , and cancer , to enjoy significant improvements in life expectancy and in many cases , surviving to adulthood .
endocrine disorders such as growth hormone deficiency , hypothyroidism or hypoparathyroidism may limit growth , but apparently do not impair acquisition of bone mass .
by contrast , primary hyperparathyroidism and hyperthyroidism , although uncommon in children , can have significant adverse effects on bone mass . and finally , many otherwise normal children experience nutritional deficiencies of calcium or vitamin d that can impair acquisition of optimal bone mass .
several risk factors have been associated with childhood fracture , including lower bone density , a previous fracture , european ancestry , obesity , and low dairy intake.[1417 ] based on these concerns , in 2000 , the u.s .
national institutes of health convened experts at a consensus development conference on osteoporosis prevention , diagnosis and treatment . among other measures ,
the conference recommended developing research strategies to optimize bone mass during the first two decades of life , and to identify and intervene in disorders that compromise attainment of peak bone mass , particularly in children with chronic disease .
bone mass is determined through a complex interaction of environmental , behavioral , and genetic traits .
about 60% to 80% of the contribution to peak bone mass is thought to be genetically determined , although not all the relevant genes have yet been identified .
the effect of heredity , and genetics , is manifest during childhood , prior to puberty .
these genetic effects can also account for differences in bone density between population groups and are evident in childhood .
for example , areal bone mineral density ( abmd ) is greater for african american compared to caucasian , while caucasians have greater abmd than either asians and hispanics .
the identification of specific genetic mutations that cause low bone density in subjects with rare bone disorders ( e.g. collagen 1 alpha 1 ( col1a1 ) in osteogenesis imperfecta and low - density lipoprotein receptor - related protein 5 ( lrp5 ) in osteoporosis pseudoglioma syndrome ) have stimulated large population studies to discover genetic variants that are associated with bone density and risk of osteoporosis .
these population variants include polymorphisms in the regulatory region of col1a1 gene that are associated with decreased bone mineral content and abmd at several sites in pre - pubertal or adolescent girls . in adolescents , polymorphisms of the estrogen receptor , aromatase , interleukin-6 , lrp5 , and osteocalcin genes have also been shown to be independent predictors of bone size , bmc , or bmd.[2535 ] recent discoveries resulting from genome - wide association studies ( gwas ) further confirm the relevance of genetic contributions to bone density .
there have been more than 40 published gwas on skeletal phenotypes , predominantly focused on dual - energy x - ray absorptiometry ( dxa)-derived abmd of the hip and spine .
remarkably , 66 bmd loci have been replicated across all the published gwas , confirming the highly polygenic nature of bmd variation .
only seven of the 66 previously reported genes ( lrp5 , sost , esr1 , tnfrsf11b , tnfrsf11a , tnfsf11 , pth ) from candidate gene association studies have been confirmed by gwas .
in addition , 59 novel bmd gwas loci have been recently identified , including some that are involved in important biological pathways involving the skeleton , particularly wnt signaling ( axin1 , lrp5 , ctnnb1 , dkk1 , foxc2 , hoxc6 , lrp4 , mef2c , pthlh , rspo3 , sfrp4 , tgfbr3 , wls , wnt3 , wnt4 , wnt5b , wnt16 ) , bone development and ossification ( clcn7 , csf1 , mef2c , mepe , pkdcc , pthlh , runx2 , sox6 , sox9 , spp1 , sp7 ) , mesenchymal - stem - cell differentiation ( fam3c , mef2c , runx2 , sox4 , sox9 , sp7 ) , osteoclast differentiation ( jag1 , runx2 ) , and tgf - signaling ( foxl1 , sptbn1 , tgfbr3 ) ( reviewed in . by contrast , gwas of bmd in children have been more limited and have identified few loci ( e.g. near the osterix ( sp7 ) gene and wnt16 gene that are associated with bone density .
each of these different genetic variants can explain only a very small effect on overall bmd , however .
environmental and behavioral factors account for the remaining 20% to 40% of variability in bone mass , and variations in nutrition ( particularly calcium and vitamin d ) and physical activity are particularly important.[21217213943 ] calcium supplementation studies in children showed that children with calcium - deficient diets experience a modest ( about 3% ) increase in bmd with calcium supplementation.[4446 ] the effect is most pronounced in pre - pubertal children .
nevertheless , other studies have suggested that increasing calcium intake during childhood through dietary fortification with dairy sources may provide more long - lasting improvements in bmd .
high - energy uvb light , principally from sunlight , penetrates the epidermis and photochemically cleaves 7-dehydrocholesterol to produce previtamin - d3 .
previtamin - d3 then undergoes a thermally - induced isomerization to vitamin d3(cholecalciferol ) that takes two to three days to reach completion .
therefore , after a single sunlight exposure , cutaneous synthesis of vitamin d3 continues for many hours .
it is not possible to generate too much vitamin d3 in the skin , as prolonged sunlight exposure activates a mechanism that converts excess previtamin d3 and vitamin d3 to biologically inert products .
vitamin d can also be obtained from the diet , from plant sources as ergocalciferol ( vitamin d2 ) , and from animal sources as cholecalciferol ( vitamin d3 ) .
dietary and endogenously - produced vitamin d can be stored in fat for later use . to become metabolically active ,
vitamin d first undergoes 25-hydroxylation in the liver by the cytochrome p450 enzyme cyp2r1 to form 25(oh)d .
subsequently , 25-(oh)d3 is directed to the kidney where it is either converted to 24,25-dihydroxyvitamin d3 ( an inactive derivative ) or to 1,25-dihydroxyvitamin d3 [ calcitriol , the active hormone ] .
activation to calcitriol requires hydroxylation by a 1-hydroxylase enzyme ( cyp27b1 ) that is tightly regulated and is the rate - limiting step in the bioactivation of vitamin d : parathyroid hormone increases production of calcitriol by stimulating cyp27b1 activity while fgf23 decreases cyp27b1 activity .
dietary intake of vitamin d is inadequate in many parts of the world and , therefore , daily requirements for vitamin d depend upon cutaneous synthesis and sunlight exposure .
dark skin , use of uv sunblockers , or customs of dress that largely cover the skin can reduce cutaneous absorption of uvb light and thereby prevent adequate synthesis of vitamin d to meet daily or long - term requirements .
it is also important to note that other nutrients , such as vitamin d and k , copper , protein , phosphorus , magnesium , manganese , zinc , energy , and iron , also appear important for bone health .
in addition to diet , physical activity , particularly weight - bearing activity , is an important determinant of bone mass .
bone contains a network of osteocytes that constitute a bio - mechanostat that can detect load and stress on the skeleton .
bone stress induces signals that stimulate osteoblast bone formation and reduces osteoclast bone resorption , leading to increased bone mass .
muscle mass provides an excellent index of the mechanical stimulation to bone and is highly correlated to bone mass , density , and architecture ( wetzsteon et al .
multiple studies in healthy children have shown an association between physical activity and abmd,[41425355 ] and athletes , such as gymnasts and tennis players , have increased bone density , dimensions , and strength during growth . moreover , modest increases in weight - bearing physical activity can result in significant improvements in bone density and strength in growing children and adolescents .
importantly , the benefits of enhanced physical activity on bone density can persist beyond adolescence and result in greater bone density in young adulthood .
by contrast , children who are unable to bear weight or have neuromuscular disorders that reduce load on the skeleton have significantly reduced bone density and are at increased risk of fractures , particularly in the lower limbs .
although obese children typically have higher bone mass and density and larger bones,[6164 ] their risk of fracture is increased and visceral fat mass is inversely related to bone mass . by contrast , lean body mass ( i.e. , muscle mass ) is positively correlated to bone mass . hormonal influences ( including estrogen , testosterone , and parathyroid hormone ) , infectious agents ( such as hiv ) , metabolic disorders , and cancer . because gonadal hormones secreted during puberty increase bone mass , delayed puberty
has a limiting effect on bmd during adolescence that appears to resolve over time in males .
chronic inflammatory diseases , such as crohn 's disease or juvenile idiopathic arthritis , may accelerate bone resorption due to inflammatory cytokines produced in the disease process . childhood malignancy , particularly leukemia , can compromise bone health . and , endocrine disorders such as diabetes mellitus , hyperthyroidism , primary hyperparathyroidism , and glucocorticoid excess are associated with reduced bone mass and increased risk of fracture . a history of recurrent fractures , particularly low - impact or atraumatic fractures , should lead the clinician to carefully consider whether a child may have reduced bone strength , and the international society for clinical densitometry has recommended that a child with a history of two upper extremity or one lower extremity fractures undergo an assessment of bone density .
however , bone demineralization becomes visibly apparent only after bone density loss exceeds 40% , making this test too insensitive for clinical use .
more quantitative imaging technologies for assessing bone health have been developed , and currently used modalities include metacarpal morphometry , quantitative ultrasound , quantitative computed tomography ( qct ) , and dual energy x - ray absorptiometry ( dxa ) . at present ,
qct has an advantage over the other techniques because it measures bone volume and thus accurately computes volumetric bmd ( vbmd ) .
its drawback is that it exposes the patient to a substantial amount of radiation ( effective radiation dose 60 sv ) , which limits utility for follow - up studies .
peripheral qct is emerging as an attractive alternative technology because it is able to distinguish between the trabecular and cortical bone compartments , but exposes the patient to far less radiation than conventional qct .
dxa provides considerable advantages : low radiation exposure ( 1 - 3 sv versus 50 sv for adult pa chest x - ray and 8 sv per day background radiation in the u.s . ) , precise results , and lower cost than qct .
however , unlike qct , it does not directly measure true volume , and thus computes areal density , not volumetric density .
derived from the area of bone , areal density is a two - dimensional estimation of a three - dimensional property , and the algorithms that make the conversion to density are not entirely satisfactory .
the measurement of bone density in children is less standardized than in adults and requires special consideration of the effects of growth and puberty on bone mass .
interpretation of bone density in children relies on z - scores the number of standard deviations ( sd ) from the norm of a reference database of children . a z - score of -2 sd represents low bone density , but indications for treatment and specific therapy
are not yet established . in contrast , bone mass density in adults is measured in t scores - standard deviations from peak bone mass , with a t - score of -2.5 sd or worse representing osteoporosis , as codified by the world health organization in 1994 . in children ,
the relationship between bone density and fracture risk is less firmly established than in adults .
there are important confounding factors to consider when performing dxa in children and adolescents , such as variations in age , race , gender , pubertal status , and height .
for example , many early reference data sets did not distinguish between boys and girls .
as girls experience an earlier puberty than boys , this can lead to an overestimation of low bone mass .
for example , leonard et al . showed that reference ranges that are not sex - specific incorrectly identified 913% of girls and 2444% of boys as having low bone mass compared to only 1116% of girls 10% of boys
racial differences may be relevant ; in the u.s . , bone density tends to be higher in african americans than in other groups .
the lack of suitable reference ranges has been addressed by a multi - center u.s . study , the bone mineral density in childhood study ( bmdcs ) , that evaluated 2014 children , aged 519 years at enrollment , annually for up to 7 years .
this study now provides robust reference ranges for bone measurements at different sites and allows distinctions for race , age , and gender .
children who are tall for age have larger bones and hence , greater bmc and abmd than those who are average or short for age .
the effect of height on abmd is intensified around the ages when pubertal development typically occurs , because taller children are often earlier maturing children in the early pubertal years and short children are often later maturing children in the later pubertal years .
consequently , dxa measurements should be adjusted for absolute height , preferably as height - specific z - scores .
similarly , a child 's pubertal status must be considered when analyzing bone densitometry , as children with delayed maturation will have lower bone mass than their peers who have higher levels of estrogen or testosterone .
dxa technology has addressed the lower bone density in children with the introduction of a low density software option for young children .
this option uses a different bone edge detection algorithm to accommodate the lower attenuation values that occur in measuring young children .
differences between machines , particularly of different manufacturers , can introduce measurement differences that limit comparisons between studies .
recently , cross - calibration equations have been developed for whole - body bone density and composition derived using ge healthcare lunar and hologic dxa systems .
these equations reduce differences between abmd and body composition as determined by ge healthcare lunar and hologic systems and will facilitate combining study results in clinical or epidemiological studies .
finally , errors in interpretation of pediatric bone densitometry can lead to spurious results that generate unnecessary worry and expense .
a 2004 study found significant overdiagnosis of pediatric osteoporosis among children who had been referred to an osteoporosis trial on the basis of low abmd scores inferred from dxa . in that study ,
88% of the scans had one or more errors in interpretation , including non - gender - specific reference data , inattention to short stature , and the incorrect use of a t - score instead of a z - score .
after correcting for these errors , 53% of the children who been referred for low bmd scores were found to have normal bone mineral density .
development and growth of the skeleton occur through the coordinated interaction of osteoblasts and osteoclasts .
osteoblasts are bone - forming cells , and are derived from pluripotent mesenchymal stem cells that can also differentiate into muscle , adipocytes , cartilage , or fibrous tissue .
bone is resorbed by osteoclasts , large , multinucleated cells that can dissolve mineral and release calcium and phosphorus into the extracellular fluid .
osteoclasts are related to monocyte / macrophage cells . during embryogenesis , and after birth as the child grows , the skeleton continues to undergo changes in architecture and size that are termed
in addition to modeling , bones are continuously reshaped by removing and replacing skeletal structures already present , a process termed remodeling .
exquisitely complex cross - talk between osteoblasts and osteoclasts is required to effect these changes through the remodeling of existing bone and modeling of new bone as bone growth proceeds .
linear growth during childhood and adolescence occurs by growth of cartilage at the end plates of long bones , followed by endochondral bone formation . the width of the bones increases by periosteal apposition . during puberty and early adult life , endosteal apposition and trabecular thickening
locally and systemically produced factors and mechanical forces influence these processes and control the coordinated functions of osteoblasts and osteoclasts to preserve structural strength .
the adult skeleton continues to undergo remodeling throughout life , replacing approximately 15% of the mature skeleton each year to maintain mineral homeostasis , to repair damaged bone , and to respond to changes in skeletal stress .
bone remodeling occurs most often in skeletal sites rich in cancellous ( trabecular ) bone , such as the vertebrae , proximal femur , calcaneus , and ultradistal radius .
a second form of bone , termed cortical bone , is less metabolically active but provides great strength and integrity to the skeleton .
cortical bone comprises 80% of the skeleton , is dense and compact , and constitutes the outer part of all skeletal structures . during the first two decades of life , the skeleton grows in both size and density , and it is estimated that more than half of peak bone mass is acquired during the teen years .
the process of bone growth is not uniform , and the axial and appendicular skeleton increase in size at different rates .
specifically , there is proportionately greater growth in the limbs than the trunk prior to puberty . in early and mid - puberty
, the relative rate of growth of the spine increases and growth slows at all sites in late puberty .
the rapid growth of the skeleton during puberty exceeds the rate of mineralization , and bone mineral accrual lags behind growth in height by 8 months .
women tend to experience minimal change in total bone mass between age 30 and menopause .
but , in the first few years after menopause , many women experience a period of rapid bone loss , which then slows but continues throughout the post - menopausal years
. this loss of bone mass can lead to osteoporosis , a condition of weakened bones and increased risk of fragility fracture . in men ,
age - related bone loss occurs later and proceeds at a steady rate . in both men and women ,
it is estimated that 10 million americans over age 50 have osteoporosis , which represents significant health and economic costs to society .
if osteoporosis has origins in childhood , then understanding the factors affecting bone accretion in childhood may be the key to early prevention of this common , disabling condition . however , there is increasing recognition that many children fail to optimize bone accretion during childhood and adolescence and concern that inadequate skeletal mass will result in fragile bones and increased risk of fractures both in childhood and later as adults .
for example , many childhood conditions pose threats to bone health through primary disease effects such as mal - absorption , secondary effects such as prolonged periods of physical inactivity or treatment effects such as glucocorticoid therapy .
moreover , improvements in treatment now enable many children with severe medical conditions , such as cystic fibrosis , inflammatory bowel disease , and cancer , to enjoy significant improvements in life expectancy and in many cases , surviving to adulthood .
endocrine disorders such as growth hormone deficiency , hypothyroidism or hypoparathyroidism may limit growth , but apparently do not impair acquisition of bone mass .
by contrast , primary hyperparathyroidism and hyperthyroidism , although uncommon in children , can have significant adverse effects on bone mass . and finally , many otherwise normal children experience nutritional deficiencies of calcium or vitamin d that can impair acquisition of optimal bone mass .
several risk factors have been associated with childhood fracture , including lower bone density , a previous fracture , european ancestry , obesity , and low dairy intake.[1417 ] based on these concerns , in 2000 , the u.s .
national institutes of health convened experts at a consensus development conference on osteoporosis prevention , diagnosis and treatment . among other measures ,
the conference recommended developing research strategies to optimize bone mass during the first two decades of life , and to identify and intervene in disorders that compromise attainment of peak bone mass , particularly in children with chronic disease .
bone mass is determined through a complex interaction of environmental , behavioral , and genetic traits .
about 60% to 80% of the contribution to peak bone mass is thought to be genetically determined , although not all the relevant genes have yet been identified .
the effect of heredity , and genetics , is manifest during childhood , prior to puberty .
these genetic effects can also account for differences in bone density between population groups and are evident in childhood .
for example , areal bone mineral density ( abmd ) is greater for african american compared to caucasian , while caucasians have greater abmd than either asians and hispanics .
the identification of specific genetic mutations that cause low bone density in subjects with rare bone disorders ( e.g. collagen 1 alpha 1 ( col1a1 ) in osteogenesis imperfecta and low - density lipoprotein receptor - related protein 5 ( lrp5 ) in osteoporosis pseudoglioma syndrome ) have stimulated large population studies to discover genetic variants that are associated with bone density and risk of osteoporosis .
these population variants include polymorphisms in the regulatory region of col1a1 gene that are associated with decreased bone mineral content and abmd at several sites in pre - pubertal or adolescent girls . in adolescents , polymorphisms of the estrogen receptor , aromatase , interleukin-6 , lrp5 , and osteocalcin genes
have also been shown to be independent predictors of bone size , bmc , or bmd.[2535 ] recent discoveries resulting from genome - wide association studies ( gwas ) further confirm the relevance of genetic contributions to bone density .
there have been more than 40 published gwas on skeletal phenotypes , predominantly focused on dual - energy x - ray absorptiometry ( dxa)-derived abmd of the hip and spine .
remarkably , 66 bmd loci have been replicated across all the published gwas , confirming the highly polygenic nature of bmd variation .
only seven of the 66 previously reported genes ( lrp5 , sost , esr1 , tnfrsf11b , tnfrsf11a , tnfsf11 , pth ) from candidate gene association studies have been confirmed by gwas . in addition , 59 novel bmd gwas loci have been recently identified , including some that are involved in important biological pathways involving the skeleton , particularly wnt signaling ( axin1 , lrp5 , ctnnb1 , dkk1 , foxc2 , hoxc6 , lrp4 , mef2c , pthlh , rspo3 , sfrp4 , tgfbr3 , wls , wnt3 , wnt4 , wnt5b , wnt16 ) , bone development and ossification ( clcn7 , csf1 , mef2c , mepe , pkdcc , pthlh , runx2 , sox6 , sox9 , spp1 , sp7 ) , mesenchymal - stem - cell differentiation ( fam3c , mef2c , runx2 , sox4 , sox9 , sp7 ) , osteoclast differentiation ( jag1 , runx2 ) , and tgf - signaling ( foxl1 , sptbn1 , tgfbr3 ) ( reviewed in . by contrast , gwas of bmd in children have been more limited and have identified few loci ( e.g. near the osterix ( sp7 ) gene and wnt16 gene that are associated with bone density .
each of these different genetic variants can explain only a very small effect on overall bmd , however .
environmental and behavioral factors account for the remaining 20% to 40% of variability in bone mass , and variations in nutrition ( particularly calcium and vitamin d ) and physical activity are particularly important.[21217213943 ] calcium supplementation studies in children showed that children with calcium - deficient diets experience a modest ( about 3% ) increase in bmd with calcium supplementation.[4446 ] the effect is most pronounced in pre - pubertal children .
nevertheless , other studies have suggested that increasing calcium intake during childhood through dietary fortification with dairy sources may provide more long - lasting improvements in bmd .
high - energy uvb light , principally from sunlight , penetrates the epidermis and photochemically cleaves 7-dehydrocholesterol to produce previtamin - d3 .
previtamin - d3 then undergoes a thermally - induced isomerization to vitamin d3(cholecalciferol ) that takes two to three days to reach completion .
therefore , after a single sunlight exposure , cutaneous synthesis of vitamin d3 continues for many hours .
it is not possible to generate too much vitamin d3 in the skin , as prolonged sunlight exposure activates a mechanism that converts excess previtamin d3 and vitamin d3 to biologically inert products .
vitamin d can also be obtained from the diet , from plant sources as ergocalciferol ( vitamin d2 ) , and from animal sources as cholecalciferol ( vitamin d3 ) .
dietary and endogenously - produced vitamin d can be stored in fat for later use . to become metabolically active ,
vitamin d first undergoes 25-hydroxylation in the liver by the cytochrome p450 enzyme cyp2r1 to form 25(oh)d .
subsequently , 25-(oh)d3 is directed to the kidney where it is either converted to 24,25-dihydroxyvitamin d3 ( an inactive derivative ) or to 1,25-dihydroxyvitamin d3 [ calcitriol , the active hormone ] .
activation to calcitriol requires hydroxylation by a 1-hydroxylase enzyme ( cyp27b1 ) that is tightly regulated and is the rate - limiting step in the bioactivation of vitamin d : parathyroid hormone increases production of calcitriol by stimulating cyp27b1 activity while fgf23 decreases cyp27b1 activity .
dietary intake of vitamin d is inadequate in many parts of the world and , therefore , daily requirements for vitamin d depend upon cutaneous synthesis and sunlight exposure .
dark skin , use of uv sunblockers , or customs of dress that largely cover the skin can reduce cutaneous absorption of uvb light and thereby prevent adequate synthesis of vitamin d to meet daily or long - term requirements .
it is also important to note that other nutrients , such as vitamin d and k , copper , protein , phosphorus , magnesium , manganese , zinc , energy , and iron , also appear important for bone health .
in addition to diet , physical activity , particularly weight - bearing activity , is an important determinant of bone mass .
bone contains a network of osteocytes that constitute a bio - mechanostat that can detect load and stress on the skeleton .
bone stress induces signals that stimulate osteoblast bone formation and reduces osteoclast bone resorption , leading to increased bone mass .
muscle mass provides an excellent index of the mechanical stimulation to bone and is highly correlated to bone mass , density , and architecture ( wetzsteon et al .
multiple studies in healthy children have shown an association between physical activity and abmd,[41425355 ] and athletes , such as gymnasts and tennis players , have increased bone density , dimensions , and strength during growth . moreover , modest increases in weight - bearing physical activity can result in significant improvements in bone density and strength in growing children and adolescents .
importantly , the benefits of enhanced physical activity on bone density can persist beyond adolescence and result in greater bone density in young adulthood .
by contrast , children who are unable to bear weight or have neuromuscular disorders that reduce load on the skeleton have significantly reduced bone density and are at increased risk of fractures , particularly in the lower limbs .
although obese children typically have higher bone mass and density and larger bones,[6164 ] their risk of fracture is increased and visceral fat mass is inversely related to bone mass . by contrast , lean body mass ( i.e. , muscle mass ) is positively correlated to bone mass . hormonal influences ( including estrogen , testosterone , and parathyroid hormone ) , infectious agents ( such as hiv ) , metabolic disorders , and cancer . because gonadal hormones secreted during puberty increase bone mass , delayed puberty
has a limiting effect on bmd during adolescence that appears to resolve over time in males .
chronic inflammatory diseases , such as crohn 's disease or juvenile idiopathic arthritis , may accelerate bone resorption due to inflammatory cytokines produced in the disease process .
, endocrine disorders such as diabetes mellitus , hyperthyroidism , primary hyperparathyroidism , and glucocorticoid excess are associated with reduced bone mass and increased risk of fracture .
a history of recurrent fractures , particularly low - impact or atraumatic fractures , should lead the clinician to carefully consider whether a child may have reduced bone strength , and the international society for clinical densitometry has recommended that a child with a history of two upper extremity or one lower extremity fractures undergo an assessment of bone density .
however , bone demineralization becomes visibly apparent only after bone density loss exceeds 40% , making this test too insensitive for clinical use .
more quantitative imaging technologies for assessing bone health have been developed , and currently used modalities include metacarpal morphometry , quantitative ultrasound , quantitative computed tomography ( qct ) , and dual energy x - ray absorptiometry ( dxa ) . at present , adequate databases for children are lacking for metacarpal morphometry and quantitative ultrasound .
qct has an advantage over the other techniques because it measures bone volume and thus accurately computes volumetric bmd ( vbmd ) .
its drawback is that it exposes the patient to a substantial amount of radiation ( effective radiation dose 60 sv ) , which limits utility for follow - up studies .
peripheral qct is emerging as an attractive alternative technology because it is able to distinguish between the trabecular and cortical bone compartments , but exposes the patient to far less radiation than conventional qct .
dxa provides considerable advantages : low radiation exposure ( 1 - 3 sv versus 50 sv for adult pa chest x - ray and 8 sv per day background radiation in the u.s . ) , precise results , and lower cost than qct .
however , unlike qct , it does not directly measure true volume , and thus computes areal density , not volumetric density . derived from the area of bone ,
areal density is a two - dimensional estimation of a three - dimensional property , and the algorithms that make the conversion to density are not entirely satisfactory .
the measurement of bone density in children is less standardized than in adults and requires special consideration of the effects of growth and puberty on bone mass .
interpretation of bone density in children relies on z - scores the number of standard deviations ( sd ) from the norm of a reference database of children .
a z - score of -2 sd represents low bone density , but indications for treatment and specific therapy are not yet established .
in contrast , bone mass density in adults is measured in t scores - standard deviations from peak bone mass , with a t - score of -2.5 sd or worse representing osteoporosis , as codified by the world health organization in 1994 . in children ,
the relationship between bone density and fracture risk is less firmly established than in adults .
there are important confounding factors to consider when performing dxa in children and adolescents , such as variations in age , race , gender , pubertal status , and height .
for example , many early reference data sets did not distinguish between boys and girls .
as girls experience an earlier puberty than boys , this can lead to an overestimation of low bone mass .
for example , leonard et al . showed that reference ranges that are not sex - specific incorrectly identified 913% of girls and 2444% of boys as having low bone mass compared to only 1116% of girls 10% of boys
racial differences may be relevant ; in the u.s . , bone density tends to be higher in african americans than in other groups .
the lack of suitable reference ranges has been addressed by a multi - center u.s .
study , the bone mineral density in childhood study ( bmdcs ) , that evaluated 2014 children , aged 519 years at enrollment , annually for up to 7 years .
this study now provides robust reference ranges for bone measurements at different sites and allows distinctions for race , age , and gender .
children who are tall for age have larger bones and hence , greater bmc and abmd than those who are average or short for age .
the effect of height on abmd is intensified around the ages when pubertal development typically occurs , because taller children are often earlier maturing children in the early pubertal years and short children are often later maturing children in the later pubertal years .
consequently , dxa measurements should be adjusted for absolute height , preferably as height - specific z - scores . similarly
, a child 's pubertal status must be considered when analyzing bone densitometry , as children with delayed maturation will have lower bone mass than their peers who have higher levels of estrogen or testosterone .
dxa technology has addressed the lower bone density in children with the introduction of a low density software option for young children .
this option uses a different bone edge detection algorithm to accommodate the lower attenuation values that occur in measuring young children .
differences between machines , particularly of different manufacturers , can introduce measurement differences that limit comparisons between studies .
recently , cross - calibration equations have been developed for whole - body bone density and composition derived using ge healthcare lunar and hologic dxa systems .
these equations reduce differences between abmd and body composition as determined by ge healthcare lunar and hologic systems and will facilitate combining study results in clinical or epidemiological studies .
finally , errors in interpretation of pediatric bone densitometry can lead to spurious results that generate unnecessary worry and expense .
a 2004 study found significant overdiagnosis of pediatric osteoporosis among children who had been referred to an osteoporosis trial on the basis of low abmd scores inferred from dxa . in that study ,
88% of the scans had one or more errors in interpretation , including non - gender - specific reference data , inattention to short stature , and the incorrect use of a t - score instead of a z - score .
after correcting for these errors , 53% of the children who been referred for low bmd scores were found to have normal bone mineral density .
clearly , refinements in reference data will improve the accuracy of clinical assessments of bone health in children and adolescents .
recently , the international society for clinical densitometry ( iscd ) issued recommendations for dxa interpretation in children .
the iscd stated that an appropriate reference dataset must include a sample of the general healthy population sufficiently large to characterize the normal variability in bone measures that takes into consideration sex , age and race / ethnicity .
another recommendation stated that in children with linear growth or maturational delay , bmc and bmd results should be adjusted for absolute height or height age , or compared to pediatric reference data that provide age- , sex- , and height - specific z - scores . specific therapy for children with low bone density
is best left to clinicians who are highly experienced in the evaluation and management of pediatric bone disorders .
available agents for adults with osteoporosis and other pharmacologic treatments may be useful in selected circumstances for children with low bone density , but such children must be treated very carefully as long - term safety data are not yet available . in summary ,
evaluation of bone density by dxa is appropriate for children and adolescents who have a history of fragility fracture or specific risk factors for low bone density .
as better diagnostic techniques become available and specific criteria for diagnosis are developed , it is likely that pediatric - specific pharmacologic agents will be forthcoming . until that time
, it is reasonable to refer children and adolescents who have a suspected metabolic bone disease to a pediatric bone specialist . | during normal childhood and adolescence , the skeleton undergoes tremendous change . utilizing the processes of modeling and remodeling , the skeleton acquires its adult configuration and ultimately achieves peak bone mass .
optimization of peak bone mass requires the proper interaction of environmental , dietary , hormonal , and genetic influences . a variety of acute and chronic conditions , as well as genetic polymorphisms ,
are associated with reduced bone density , which can lead to an increased risk of fracture both in childhood and later during adulthood .
bone densitometry has an established role in the evaluation of adults with bone disorders , and the development of suitable reference ranges for children now permits the application of this technology to younger individuals .
we present a brief overview of the factors that determine bone density and the emerging role of bone densitometry in the assessment of bone mass in growing children and adolescents . |
edentulism is regarded as a poor health outcome since it may compromise an individual 's quality of life .
majority of these edentulous patients are treated in teaching institutes in which a large number of complete dentures are delivered by final year students and interns guided by staff members .
a successful treatment depends on three factors namely efficient work by the clinical student , appropriate guidance by staff members and patient cooperation and satisfaction .
the confluence of these factors leads to a successful treatment [ figure 1 ] . both final years and as well as interns work under the supervision of staff , therefore evaluating the quality and efficiency of the treatment procedures and the treating doctor becomes mandatory for the welfare of any department .
furthermore , patients with identical clinical problems receive the dissimilar care , therefore , to arrive at a consensus with regards to the various clinical and treatment aspects of edentulous patients , clinical audit can be performed .
clinical audit is a quality improvement process , which seeks to improve patient care wherein the process and outcome of care are selected and systematically evaluated against explicit criteria .
it is a cyclic and multidisciplinary process involving a series of steps ranging from planning the audit ( by measuring the performance ) to implementing and sustaining the change .
audit is defined as the systematic appraisal of the implementation and outcome of any process in the context of prescribed targets and standards .
for doing an audit , various methods can be utilized as tools to assess the self - perception of oral health and its impact on the quality of life of individuals , e.g. , oral health related quality of life questionnaires like the oral health impact profile ( ohip ) , oral impacts on daily performance etc .
one of such instruments is the geriatric / general oral health assessment index questionnaire ( gohai ) .
venn diagram showing correlation of factors responsible for a successful treatment dental clinical auditing is nowadays evolving worldwide , but still with many areas unfolded .
although there are plenty of studies for assessing patient satisfaction / quality of complete dentures and concluding correlation between oral health related quality of life and denture satisfaction but there are very few clinical dental audits conducted dealing with quality of complete dentures in prosthodontics .
changes indicated from such audit process can be implemented at an individual , team , or service level and further monitoring can be done to confirm improvement in healthcare delivery .
since we encountered more number of postinsertion complaints from elderly complete denture wearers treated by final years and interns in our institution , therefore it was mandatory to assess the reason for the same and initiate necessary measures for correction .
therefore , an audit was designed to assess the efficiency and quality of complete dentures delivered by final year students and interns after improved staff supervision .
after obtaining research and ethical committee approval , we performed a clinical audit in our department .
we encountered more number of postinsertion complaints from complete denture wearers treated by final years and interns in our institution , therefore to assess the reason and to initiate necessary measures for correction , we planned for a clinical audit in two cycles wherein patient satisfaction was assessed using gohai [ figure 2 ] . audit cycle in complete denture all the complete denture patients for whom complete data were available were included .
complete denture wearers who had incomplete records and those who could not be contacted were excluded .
patients were explained about the study , and informed consent was taken . since the study was time bound , so we included all the patients who fulfilled our inclusion criteria for a stipulated ( around 2 years ) time both in first and second cycle .
the age of the participants ranged from 42 to 75 years , with the mean age of 58 8.12 years . in the first cycle of the audit , all the complete denture patients treated from january 2007 to january 2009 by interns and final years were recalled .
the investigator was trained and calibrated in the department before the commencement of the study and a kappa consistency of < 0.05 was maintained .
of 430 patients treated during that period , only 308 ( 76 males and 232 females ) fulfilled our selection criteria .
detailed analysis of the gohai responses obtained in the first cycle was done and based on that recommendations were suggested for improvement , circulated to the staff members of the department , and their consensus was taken .
the recommendations included increasing the number of clinical demonstrations for students , by teaching lab procedures and aiding students in improving their communication skills with patients .
recommendations implemented after analyzing results of first cycle to assess the progress , a second cycle of audit was planned from march 2009 to january 2011 , which consisted of the different set of complete denture patients treated during that period by interns and final years . again the quality of denture delivered during this period was assessed using same gohai questionnaire .
a total of 278 patients ( 92 males and 186 females ) were included who satisfied the inclusion criteria ; gohai questionnaire was administered to them and scores were obtained . in the entire study , two calibrated staffs were employed to avoid bias and a kappa consistency of < 0.05 was maintained between them .
they were instructed about the problems encountered and the difficulties faced by the patients in the first cycle .
all the patients participating in both the cycles were told to complete the questionnaire and their satisfaction responses were graded from 1 ( never ) to 5 ( always ) .
. it is composed of 12 items that deal with oral health conditions , by self - perception in three dimensions : the physical , psychosocial and that of pain or discomfort .
the psychosocial includes worry / concern about and interest in oral health , dissatisfaction with appearance , self - consciousness about oral health , and avoidance of social contacts because of oral problems .
the dimension of pain and discomfort includes the use of medications to relieve pain or discomfort from the mouth . for each question
, the questionnaire offers the alternatives never , seldom , often sometimes and always which are given scores 1 , 2 , 3 , 4 and 5 , respectively .
the index is the result of the sum of scores to the questions on a scale from 12 to 36 so that the higher the score , the better the oral health self - evaluation .
last question deals with sensitivity to hot , cold or sweet food which is not applicable to edentulous patients .
geriatric / general oral health assessment index scores obtained from both the cycles were compared to find out if any improvement was there in the level of patient satisfaction owing to the recommendations implemented .
the data obtained were compared and subjected for statistical analysis using statistical package for social science ( spss , version 19 ; ibm spss inc . , chicago , illinois , usa ) software and appropriate conclusions were drawn .
the above study dealt with the assessment of the efficiency and quality of complete dentures delivered by clinical students after improved staff supervision .
the study was carried out in two cycles . in the first cycle which was retrospective ,
gohai scores were obtained , and it was found that the problems were due to lack of proper patient education and inappropriate execution of procedures by the students .
therefore , keeping this in mind recommendations were made for correction of these problems [ table 1 ] .
after implementing the recommendations , the second cycle was planned , and gohai scores were obtained from another set of patients .
the mean scores of each domain between two cycles using t - test were tabulated [ table 2 ] .
it was found that the lower the score , the better was the satisfaction of the patients with the dentures .
it was observed that the second cycle patients were more satisfied as shown by mean ( standard deviation ) score 3.81 ( 1.41 ) than in the first cycle 5.19 ( 1.23 ) .
comparison of mean scores of each domain between two cycles using student 's t - test the frequencies and percentages of the distribution of subjects according to the different responses for gohai items were calculated [ tables 3 and 4 ] .
patients who limited contact with people in the first and second cycle also reduced significantly by 29% .
patients who were uncomfortable eating in front of others also reduced by 9.4% as compared to the first cycle .
there was a significant decrease of 25.4% in patients who complained of the problem with speaking clearly .
distribution of subjects according to the responses for gohai items ( 1 - 6 ) in the first and second cycle and results of kruskal
wallis test distribution of patients according to the responses for gohai items ( 711 ) in the first and second cycle and results of kruskal
wallis test there was a significant decrease of 39.2% in patients who complained of limiting the kind of food .
there was a significant decrease of 37.9% in patients who faced the discomfort while eating any kind of food in the second cycle .
67.5% of patients had difficulty in swallowing comfortably in the first cycle whereas in the second cycle it showed a decrease of 43.4% .
32.4% reduction was found in the patient who used medication to relieve pain as compared to the first cycle .
patients who were nervous / self - conscious in first cycle also reduced by 36.8% .
a significant increase of 18% was noticed in patients who were pleased with the appearance in second cycle . in the first cycle patient who complained of trouble while biting or chewing in the first cycle also showed a reduction of 22% .
last question ( patients who were sensitive to hot , cold or sweet foods ) was not significant as the patients were edentulous .
therefore the results show a significant improvement in the gohai scores in the second cycle ( statistically significant as p < 0.001 ) thereby indicating an improvement in patient satisfaction level .
it is of paramount importance that we constantly reevaluate our performance , identify deficiencies and rectify them .
audit is one of the many ways by which we can perform effective self - evaluation . in this study
, we correlated the dissatisfaction of the patients ( based on the grading of gohai ) with the reasons for the same veiled in denture construction and insertion procedures . in our audit
, it can be well appreciated that increased supervision helped in improving the quality of work rendered .
a significant improvement in quality of life of patients was observed based on their satisfaction level .
valuable improvements were achieved in carrying out this clinical audit . in particular , importance of improved staff supervision and the impact
it has created in improving the quality of dentures delivered can not be over emphasized .
these audits focused on the referral letters , perceptions of care by patients and the quality of the prosthesis .
dable et al . evaluated the oral health related quality of life before and after administration of the prosthodontic care in 63 patients .
similar study was done by viola et al . in 70 patients treated by undergraduate students wherein ohip - edent
however in our study , we evaluated the problems encountered in the first cycle using gohai questionnaire and after doing modifications as well as increased staff supervision , the improvement in oral health related quality of life was determined .
gohai consists of questions that reflect on the aspects which are considered to have an impact upon the quality of life of the older population , such as functional limitation , esthetic dissatisfaction , chewing discomfort , avoidance of certain food , the avoidance of social contacts and self - medication administered for dental pain .
the 12 question dealing with sensitivity to hot , cold or sweet food did not yield significant results and so can be eliminated from the questionnaire as the patients were completely edentulous . in our study
it was observed that audit ultimately helped us to find out common hiccups faced by students in clinical procedures ( like border molding and recording accurate final impression , posterior palatal seal , face - bow transfer , recording of vertical jaw relation , centric relation , and focus more on these issues by increasing the number of clinical demonstrations ) , lab procedures ( increasing demonstrations for the use of semi - adjustable articulators , lab remounting to the students and concentrating more on these lab procedures by strict guidance by staff members ) , lack of communication skills in the students ( students were motivated to increase rapport with the patient by explaining and educating patients with videos , clinical preoperative and postoperative photographs regarding motivation toward treatment , steps in the denture construction , time involved in the procedures , postinsertion counseling with the help of videos , photographs and models ) .
the difficulties observed in the above steps were rectified in second cycle by strictly implementing the recommendations . following which it was found that there was more satisfaction of patients ( as evident from statistically significant results as p < 0.001 ) , difference in gohai scores in terms of function , speech , pain and discomfort and psychosocial aspects and also a positive change in undergraduate training as well as quality of work ( reduction in gohai scores , number of visits for denture construction , number of postinsertion visits , etc ) .
feedback forms were given to the patients and told to fill in their language during the postinsertion checkup , regarding the treatment experience in the department .
the feedback forms were analyzed by all the staff members , and steps were taken for implementation of the suggestions given by the patient .
audit certainly has its own limitations such as it is time taking and involves patience from the patients in filling the questionnaire and cooperation from the staff in implementing the modified changes .
as a quality improvement tool , audit can demonstrate that real efforts are being made by dedicated hard pressed staff to deliver high - quality professional care to all their patients .
although this audit focused on denture delivery system , but the recommendations suggested can be applied to other prosthodontics procedures as well .
although an audit of this nature is demanding of clinician 's time but it does show where improvements can be made in patient management which will result in better health care resulting in improved quality of life . if the use of audit is conducted efficiently , it can result in wide - ranging benefits for both patients and practitioners , by ensuring the best use of limited resources and constantly evaluating and improving the quality of care . | purpose : the purpose was to assess the outcome of improved staff supervision on the efficiency and quality of complete dentures delivered by clinical students.materials and methods : the audit was performed in two parts . in the first cycle ,
retrospective analysis for complete dentures delivered by clinical students was undertaken , and patient 's satisfaction was graded using geriatric / general oral health assessment index ( gohai ) .
all the impeding factors encountered in the first cycle were identified , and corrective measures were implemented .
subsequently , a prospective analysis for the dentures delivered under strict staff supervision was undertaken in the second cycle .
patient satisfaction was graded again using gohai.results:improved staff supervision increased the patient satisfaction significantly.conclusions:the quality of care had improved in leaps and bounds compared to the first cycle due to increased level of supervision and strict adherence to the recommendations made at the end of the first cycle . |
psychologists have systematically studied the issue of transfer of training for over a century . the early work of american psychologist edward thorndike ( 18741949 ) set the stage for much of the research that followed .
thorndike , a professor at columbia university s teachers college , conducted a series of influential studies in which participants practiced one task ( for example , estimating the area of a rectangle ) repetitively for an extended period of time .
after participants demonstrated improvement , he would ask them to perform a different , so - called transfer task ( such as estimating the area of a triangle ) .
thorndike consistently observed large gains on practiced tasks , but these gains were weakly ( if at all ) associated with improved performance on transfer tasks .
thorndike also tested the idea that training in latin would result in a more disciplined mind , which would improve performance in a variety of other subjects .
thorndike s research led him to conclude that transfer of training occurred only if the practiced task and the transfer tasks shared identical elements,4 and that the elements of most tasks are different enough from those of other tasks that transfer of training was rare .
he believed that the mind is so specialized into a multitude of independent capacities that we alter human nature only in small spots , and any special school training has a much narrower influence upon the mind as a whole than has commonly been supposed.5 thorndike s conclusions are consistent with modern theories proposing that practice results in cognitive adaptations that develop over time and are specific to the practiced task,6 as well as with theories of learning that link improved task performance to the retrieval from memory of specific instances of the same task encountered previously.7 the implication of thorndike s empirical findings and theoretical views is that attempts to train a person on one task and thus bring about improvements in tasks other than the trained task are likely to fail unless the tasks are similar in terms of their elements or components .
other scholarly views , however , allow for greater possibilities when it comes to transfer of training .
one moderator is the degree of variability encountered during training , such that more variable training leads to greater transfer.8 , 9 transfer may also be more likely to occur when performance of the practiced task and the transfer task depend on overlapping neural circuits .
for example , some researchers observed transfer between a trained and an untrained task to the extent that both tasks activated a region of the brain called the striatum , while they observed no transfer when this region was not activated during an unpracticed task.10 finally , certain types of training may sharpen abilities that are so fundamental to a wide variety of tasks that performance of additional untrained tasks improves .
for example , the performance of all tasks requires some degree of learning . if cognitive training helps individuals make better use of statistical / probabilistic information within a task , it could account for superior performance across a variety of untrained tasks .
( for discussion of the learning to learn hypothesis of transfer , see endnote 11 . )
while many theoretical accounts of learning reflect skepticism regarding the ability of cognitive training to improve the performance of untrained tasks , under certain conditions and with certain types of training , these effects may be observable .
these theoretical accounts make it clear that it is not safe to assume that all types of cognitive training will produce meaningful benefits affecting important everyday tasks .
empirical evidence that certain software packages and digital games are capable of improving perceptual and cognitive abilities that transfer to untrained tasks is mixed .
and even in studies with positive results , interpretations of transfer effects are nt always straightforward .
there are three popular approaches to improving cognition : brain - training programs , working - memory training , and video - game training . the active ( advanced cognitive training for independent and vital elderly ) clinical trial was the largest test of whether brain training can improve perceptual and cognitive abilities in older adults.12 over 2,800 participants
were randomly assigned to one of four conditions : memory training , reasoning training , speed - of - processing training , or a no - contact control group .
intervention groups received 10 training sessions , each approximately 60 to 75 minutes long ( some participants also received a few booster sessions in the years following training ) .
transfer tasks included laboratory - based tests of cognition ( proximal outcomes ) and self - reported and simulated performance - based measures of daily functioning ( primary outcomes ) .
immediately after training , researchers observed large improvements that were specific to each type of training intervention ( for example , speed - of - processing trained participants improved on laboratory tasks measuring speed but not on tasks measuring memory or reasoning ) .
however , researchers observed no improvements on measures of everyday functioning immediately after training , one year after training , or two years after training .
compared to the no - contact control group , five years after training , the reasoning group self - reported fewer daily - living problems , the speed - of - processing group was less likely to cease driving , the speed - of - processing and reasoning groups were involved in fewer at - fault automobile crashes , and the speed - of - processing group reported less of a decline in health - related quality of life .
researchers attributed these delayed effects to the facts that ( 1 ) at the start of the intervention participants were cognitively healthy , and ( 2 ) a certain amount of decline was necessary in order to reveal transfer effects .
for example , adrian owen and colleagues randomly assigned more than 11,000 online participants between the ages of 18 and 60 to receive six weeks of reasoning training , to receive six weeks of visuospatial / attention training , or to be part of an active control group that answered trivia questions.13 despite the tremendous sample size , neither training group demonstrated improved general ability on a battery of neuropsychological tests . in general , it is hard to draw straightforward conclusions from the current body of literature on brain training , even when significant effects are observed . with the notable exception of the active trial , these studies generally focus on outcome measures based on abstract neuropsychological tests and utilize weak control groups . a recent test of a popular commercial cognitive - training program , for example , assessed transfer with an abstract digit / tone categorization task.14 while researchers observed some evidence of transfer to neuropsychological tests of alertness and distraction , the extent to which transfer to the performance of important everyday tasks was unclear . as with any intervention ,
brain - training studies need to prove convincingly that transfer - task improvement can not be accounted for by a placebo effect.15 that is , researchers need to rule out any possibility that the group receiving brain training did nt improve more than the control group did simply because their treatment caused them to expect this outcome.16 julia mayas et al . compared a group that received intense brain training to a control group that participated in discussion groups.14
it is unclear whether participants who merely discussed issues related to aging would expect as much improvement on the transfer task compared to participants who received challenging and adaptive cognitive training .
much of the recent cognitive - training literature has focused on the potential of working - memory training to improve iq and , specifically , fluid intelligence ( the ability to reason and to solve novel problems ) .
susanne jaeggi , martin buschkuehl , john jonides , and walter perrig first reported that training that involved juggling multiple pieces of information in the mind affected fluid intelligence.17 training was adaptive , as participants had to remember visual and auditory information on each trial and compare this information to the information heard and seen one , two , three , or n trials back ( referred to as an n - back task ) . when participants were able to remember information more successfully , they were given more information to remember (
n was increased throughout training ) . compared to participants who did not receive training , participants who received n - back training
jaeggi and colleagues interpreted the adaptive nature of their training and the necessity of working memory to solve complex problems as being supportive of transfer to measures of intelligence .
however , after this initial positive finding , other scholars raised a variety of methodological criticisms of this and other working - memory - training studies.18 furthermore , other studies could not replicate the effect of working - memory training on fluid intelligence.1921 a recent meta - analysis found that when most existing studies were considered together , working - memory training appeared to have a small but reliable effect on measures of iq.22 but the most rigorous studies those that included an active control group to help address the problem of placebo effects found almost no effect at all . given the mixed state of the literature ,
two problematic possibilities exist : ( 1 ) working - memory training may not improve fluid iq , or if it has an effect , the effect may be small , and ( 2 ) important but unknown moderators may determine who benefits from this type of training and who does not.23 over the past decade , some commercial and custom video games have also generated excitement about their potential to improve a variety of perceptual and cognitive abilities .
this excitement has been heavily influenced by the groundbreaking work of c. shawn green and daphne bavelier.24 their initial study , which focused on the effects of fast - paced action video games ( typically involving violent , first - person shooters ) , found not only that action gamers demonstrated superior visual and attentional abilities compared to nongamers , but also that nongamers could improve these abilities with just a small amount of action - game training .
this finding led to dozens of additional investigations into other abilities that might be improved through action - game training .
researchers have linked superior attention , vision , processing speed , dual - tasking ability , and decision - making to action - game play through cross - sectional studies comparing gamers to nongamers , intervention studies training nongamers to play action games , or both.25 other studies have suggested that game training could ameliorate age - related cognitive decline.26 unlike focused n - back training , video games tap a variety of perceptual , cognitive , and motor processes , likely ensuring a greater degree of cognitive and neural overlap between trained and untrained tasks .
this might explain the broad degree of transfer that seems to come from game training . while this line of research is exciting , and it appears to indicate transfer that is much broader than that caused by any type of intervention investigated thus far , we must consider some important caveats when proposing to improve general cognitive abilities with video - game interventions .
first , game effects do not always replicate , 27 , 28 again suggesting either smaller effects on cognition than previously reported or the existence of moderators that determine whether an individual might benefit from game training .
second , scholars have raised a variety of methodological criticisms of the studies that provide evidence in support of game effects.15,29,30 finally , as with previous types of interventions discussed here , there is a dearth of studies linking video - game interventions to better performance of meaningful everyday tasks and meaningful activities such as avoiding crashes while driving , succeeding academically or professionally , and making complex life decisions such as those involved in the purchase of a new home .
what do the sellers of cognitive - training products promise ? should consumers purchase and use them ?
a careful inspection reveals that most commercial brain - training companies are relatively conservative with respect to their advertised claims , at least when explicitly discussing potential improvements on everyday tasks .
it is exceedingly unlikely for a company to claim that its product could help a driver avoid a dangerous crash , a worker advance his or her career , or an older adult live independently longer .
they highlight improvements to more abstract qualities , such as reaction time , attention , and memory .
few specify the exact nature of these improvements for example , reaction to what ?
memories of what ? these vague claims are justified in that the products training tasks involve these abilities , and performance on the training tasks improves with practice . the critical question , however , is the degree to which these improvements transfer to more meaningful activities .
these ads typically feature product users ( or actors portraying users ) discussing why they are using the product ( for example , to remember names of people i meet , to get ahead at work ) .
the companies websites also tend to feature user anecdotes , as well as a section explaining the science behind their product and referencing completed , peer - reviewed ( but sometimes non - peer - reviewed ) studies . in many instances , however ,
these studies examine something other than the program being advertised ; they assess benefits with abstract laboratory tasks rather than everyday ones ; and they lack critical control conditions necessary to link improvements to the product .
while pharmaceutical advertisements are strictly regulated , this is not the case for brain - fitness program advertisements .
this may partly be due to the companies lack of explicit claims regarding improvements to everyday , meaningful activities , as well as the lack of claims that their products are intended to treat specific conditions , such as age - related brain diseases .
before confidently recommending the use of brain - training programs to improve cognition meaningfully and to address age - related cognitive decline , researchers must address the following questions and issues :
comparative effectiveness .
if brain - training programs and video games are in fact effective , researchers must determine the programs comparative effectiveness .
per hour invested , how do brain - training programs and games compare to one another with respect to their ability to improve cognition meaningfully ?
how do they compare to other cognitively beneficial ( and potentially more enjoyable ) activities such as aerobic exercise,31 digital photography , quilting , and volunteer work?3234 do certain activities transfer especially well to tasks such as driving , while other activities improve the memory functions that support medication adherence ? answers to these questions would help shape recommendations regarding the amount and type of brain - training activities a given individual should engage in.intervention adherence . as with physical exercise and pharmaceutical treatments ,
a recent study found that digital game - based training associated with a variety of perceptual and cognitive improvements resulted in no benefit in a sample of older adults , likely due to the fact that adherence was poor for the intervention expected to produce the largest effect.35 the challenges of ensuring cognitive - intervention adherence may be most analogous to the challenges of promoting adherence to hypertension treatments . given
that hypertension is typically asymptomatic , treatment benefits are not readily apparent , such that the costs ( e.g. , drug side effects ) become more salient than the real but unseen benefits .
similarly , cognitive training may not result in immediate , perceptible benefits , but it might reduce cognitive problems years in the future.36 thus it is important that researchers examine individual differences that predict adherence ( for such an attempt with exercise , see endnote 37 ) as they determine how to promote adherence to brain - training games and programs.moderating variables .
however , researchers have begun to use data from the active trial in an attempt to answer this question .
george w. rebok et al . found that memory - training benefits were greater for participants with higher levels of education and better self - reported health .
the discovery of moderating variables may help health - care professionals prescribe either general cognitive training or specific types of cognitive training .
however , answering these questions will require fairly large samples to tease out the cognitive , environmental , disease , and genetic factors that make an individual more or less susceptible to the benefits of cognitive training.methodological rigor and replication .
scholars have leveled a variety of criticisms against studies that report evidence of transfer of training from video games and brain - training programs to other tasks .
these criticisms should be addressed before practitioners make strong recommendations that individuals engage in these activities . in addressing the potential of placebo effects , expectations for improvement on transfer tasks
can be assessed upon completion of the intervention,16 or in a separate group of individuals.39 when expectations for improvement are equal for intervention and control groups , but actual transfer effects differ , placebo effects are unlikely .
in addition to addressing methodological concerns , researchers should also note that the brain - training literature contains few direct replications .
however , replication studies would be of tremendous value in answering the question of whether reliable transfer gains can be expected to result from any specific type of training . these types of studies should be incentivized . comparative effectiveness .
if brain - training programs and video games are in fact effective , researchers must determine the programs comparative effectiveness .
per hour invested , how do brain - training programs and games compare to one another with respect to their ability to improve cognition meaningfully ?
how do they compare to other cognitively beneficial ( and potentially more enjoyable ) activities such as aerobic exercise,31 digital photography , quilting , and volunteer work?3234 do certain activities transfer especially well to tasks such as driving , while other activities improve the memory functions that support medication adherence ? answers to these questions would help shape recommendations regarding the amount and type of brain - training activities a given individual should engage in .
a recent study found that digital game - based training associated with a variety of perceptual and cognitive improvements resulted in no benefit in a sample of older adults , likely due to the fact that adherence was poor for the intervention expected to produce the largest effect.35 the challenges of ensuring cognitive - intervention adherence may be most analogous to the challenges of promoting adherence to hypertension treatments . given
that hypertension is typically asymptomatic , treatment benefits are not readily apparent , such that the costs ( e.g. , drug side effects ) become more salient than the real but unseen benefits .
similarly , cognitive training may not result in immediate , perceptible benefits , but it might reduce cognitive problems years in the future.36 thus it is important that researchers examine individual differences that predict adherence ( for such an attempt with exercise , see endnote 37 ) as they determine how to promote adherence to brain - training games and programs . moderating variables .
however , researchers have begun to use data from the active trial in an attempt to answer this question .
george w. rebok et al . found that memory - training benefits were greater for participants with higher levels of education and better self - reported health .
the discovery of moderating variables may help health - care professionals prescribe either general cognitive training or specific types of cognitive training .
however , answering these questions will require fairly large samples to tease out the cognitive , environmental , disease , and genetic factors that make an individual more or less susceptible to the benefits of cognitive training .
scholars have leveled a variety of criticisms against studies that report evidence of transfer of training from video games and brain - training programs to other tasks .
these criticisms should be addressed before practitioners make strong recommendations that individuals engage in these activities . in addressing the potential of placebo effects , expectations for improvement on transfer tasks
can be assessed upon completion of the intervention,16 or in a separate group of individuals.39 when expectations for improvement are equal for intervention and control groups , but actual transfer effects differ , placebo effects are unlikely .
in addition to addressing methodological concerns , researchers should also note that the brain - training literature contains few direct replications .
however , replication studies would be of tremendous value in answering the question of whether reliable transfer gains can be expected to result from any specific type of training . these types of studies should be incentivized .
it s a no - brainer that individuals purchase and engage in brain - training programs because they wish to perform better on certain tasks that are meaningful to them . yet
the majority of studies in the literature use relatively simple , process - pure laboratory tasks to assess transfer of benefit.40 few studies assess performance on simulated everyday tasks ( for example , through a driving simulation ) , and far fewer assess real - world outcomes ( e.g. , automobile crash rate , loss of independence , or loss of wealth due to fraud ) .
these types of important and meaningful outcomes can be assessed only in large - scale longitudinal studies that follow cognitively trained individuals over a decade or more .
other important questions relate to when cognitive training should begin , how much an individual should train , and how long training gains might last . if brain training is judged to be effective , should it begin when someone is in his 20s ? in her 60s ? should individuals train every day ? most days of the week ?
is it better to engage in long , spaced - out training sessions or fewer , shorter training sessions ? does an individual need to continue training in order to maintain gains , or do training gains persist long after training has ceased ?
is there a point of diminishing returns at which the training task becomes so automated that it no longer exercises the abilities it was designed to improve ?
can people enhance the potential benefits of cognitive training if they pair it with physical activity and/or social interaction ?
what , if anything , can today s doctors recommend to those who wish to enhance ( or to maintain ) their cognitive abilities ? at this point , any blanket endorsement of a certain brain - training program would be premature .
yet there appears to be enough accumulated evidence that being cognitively inactive is not a good strategy for maintaining cognitive health .
cognitive activity takes many forms , and there is currently little evidence suggesting that any particular software package is best at improving cognition , or that any brain - training product is better than other engaging activities , such as learning a new language or instrument , creative writing , or learning to dance .
these latter alternatives have the advantages of being inexpensive , being especially enjoyable , and providing a useful and valuable skill even if there were no general cognitive benefits associated with them .
aerobic exercise may be one of the safest bets for those wishing to improve their cognition , as animal models and human cross - sectional and intervention studies all indicate benefits to brain function , structure , and cognition.41 this option may be particularly beneficial because it also comes with a host of physical health benefits .
exercise would be a worthwhile investment even if it had no effect on cognition . in the future ,
more precise recommendations will be possible as more evidence accumulates and the methodological rigor of intervention studies continues to advance .
large - sample studies that include real or simulated performance on important everyday tasks , extended post - training testing and observation periods ( similar to those used in the active study ) , and large individual - difference batteries ( cognitive , genetic , neurophysiological ) that assess moderators of transfer effects will be especially valuable in informing these recommendations . | editor s note : few topics in the world of neuroscience evoke as much debate as the effectiveness of cognitive training .
do you misplace your keys regularly ?
forget appointments ?
have trouble remembering names ? no worries .
a host of companies promise to train your brain with games designed to stave off mental decline .
regardless of their effectiveness , their advertising has convinced tens of thousands of people to open their wallets . as our authors review the research on cognitive - training products , they expose the science surrounding the benefits of brain games as sketchy at best . |
expansion of antibody
scaffold diversity has the potential to expand
the neutralizing capacity of the immune system and to generate enhanced
therapeutics and probes .
systematic exploration of scaffold diversity
could be facilitated with a modular and chemical scaffold for assembling
proteins , such as dna .
however , such efforts require simple , modular ,
and site - specific methods for coupling antibody fragments or bioactive
proteins to nucleic acids . to address this need ,
we report a modular
approach for conjugating synthetic oligonucleotides to proteins with
aldehyde tags at either terminus or internal loops .
the resulting
conjugates are assembled onto dna - based scaffolds with low nanometer
spatial resolution and can bind to live cells .
thus , this modular
and site - specific conjugation strategy provides a new tool for exploring
the potential of expanded scaffold diversity in immunoglobulin - based
probes and therapeutics . | |
myoinositol ( mi ) and d - chiro inositol ( dci ) are isomeric forms of inositol that were found to have insulin - like properties , acting as second messengers in the insulin intracellular pathway ; both of these molecules are involved in the increasing insulin sensitivity of different tissues to improve metabolic and ovulatory functions [ 13 ] .
it is produced by the human body from d - glucose , but it is present in all living cells as membrane phospholipids and phytic acid . in food
it is contained especially in pulses ( beans , grains , and nuts ) and fruits ( in particular citrus fruits ) .
dci and mi have different physiological roles since the former is crucial for glycogen synthesis while the latter increases cellular glucose uptake . each tissue has its own mi / dci ratio , which is maintained through the conversion of myoinositol to d - chiro inositol occurring in tissues expressing the specific epimerase .
high dci levels are present in glycogen storage tissues , such as fat , liver , and muscle , whereas very low levels of dci are typical of tissues with high glucose utilization , such as the brain and heart [ 5 , 6 ] .
the inositol is mainly catabolized by the kidney , which seems to be an important regulator of plasma inositol concentrations ; however urinary excretion represents only a small fraction . indeed , deficiency or abnormalities in inositol metabolism induce a defect in glucose uptake and have been linked to insulin resistance and long term microvascular complications of diabetes .
a depletion of intracellular myoinositol and an excessive urinary excretion , along with lower level of chiro inositol and lower excretion , have been frequently observed in type ii diabetic patients and in other conditions associated with insulin resistance , such as polycystic ovary syndrome , gestational diabetes , and metabolic syndrome . in general , certain data suggest that chiro inositol deficiency or imbalance is related more directly to insulin resistance itself , rather than to type ii diabetes . the chiro inositol deficiency observed in urine has also been confirmed in muscle and in blood , indicating a general defect in the body .
this finding has provided the basis for initial trials of the administration of d - chiro inositol in stz diabetic rats , monkeys , and subsequently humans [ 2 , 8 ] .
thus administration of myoinositol and d - chiro inositol might play a role in restoring better insulin sensitivity , as well as delaying the onset of diabetes complications . in this preliminary study
obese male children have undergone an ogtt without inositol and then in association with inositol , in order to find out if the acute administration of inositol has a positive effect on insulin sensitivity .
we hypothesized that there may be a direct relation between higher bmi and a greater increase of insulin after glucose administration and that the effect of inositol might be different in subjects with higher bmi .
we also proposed the hypothesis that there might be a relation between fasting insulin level and degree of insulin increase after glucose intake .
twenty - three consecutive obese patients , aged 11.5 2.3 ( range 715 ) , with a mean bmi of 29.8 3.1 kg / m ( mean sd ) were recruited .
exclusion criteria were delayed puberty , hypogonadism ( such as klinefelter syndrome ) , thyroid dysfunctions , and obesity - linked genetic disease .
anthropometric measures , like waist - hip ratio and percent of body fat , blood pressure , and blood samples for determination of total cholesterol , ldl , hdl , and triglycerides , were assessed .
all patients consumed a normocaloric diet , balanced for macronutrient distribution , in accordance with the national guidelines for the treatment of childhood obesity [ 10 , 11 ] .
specifically , it is recommended that children follow , for a 6-month period , a normocaloric diet ( daily caloric intake by age and sex ) consisting of protein ( 12%15% ) , carbohydrates ( 55%60% ) , fat ( 25%30% ; < 10% saturated fatty acids , polyunsaturated fatty acids up to 10% , and monounsaturated fatty acids up to 15% ) , and fiber ( range : age ( year ) plus 5 g - age ( year ) plus 10 ) [ 11 , 12 ] . additionally , it was recommended that children engage in at least 60 min of moderate - to vigorous - intensity physical activity daily , based on walking and tailored to individual preference .
after nutritional intervention patients who recorded in the first ogtt fasting insulin 15 u / ml and thus are considered as insulin - resistant were submitted to a second ogtt , which was preceded by the administration of 1 soft gel capsule of inositol [ myoinositol 1100 mg + d - chiro inositol 27.6 mg + folic acid 400 g ; inofolic combi , lo.li pharma s.r.l . , 00156 rome , italy ] . in these insulin - resistant patients , blood samples for glucose and insulin
were collected before and after the ogtt and data from the first and second ogtt were compared .
to assess the differences between variables over time we performed the wilcoxon signed rank sum test assuming p 0.05 as significant level .
the spearman correlation coefficient was employed to identify a correlation between bmi and insulin increase after ogtt and between fasting insulin and insulin level after glucose load ( figures 1 , 2 , and 3 ) .
correlation is used to assess the strength and direction of the linear relationship between two variables .
figure 1 shows that the baseline correlation between bmi and insulin increase in the whole sample was statistically significant ( r = 0.2951 ; p = 0.0336 ) , confirming that higher bmi is associated with a greater insulin increase .
therefore , we performed an ogtt preceded by inositol administration in a subgroup of 11 children only , where the high fasting insulin level ( 15 u / ml ) suggested increasing insulin resistance .
figure 2 shows the correlation between basal insulin value and its increase after the ogtt performed without inositol and with inositol in the patients with basal insulin 15 u / ml .
while correlation was strong and statistically significant in the first case ( r = 0.2281 ; p = 0.0009 ) , it lost significance when the ogtt was preceded by inositol administration ( r = 0.2447 ; p = 0.0767 ) . in this case , basal insulin level and insulin increase got close to those observed in the children who had a basal insulin level 15 u / ml ( figure 3 ) , suggesting that inositol is more effective in lowering insulin increase in children with higher basal insulin level , though this assumption is still uncertain since only a few samples have been tested .
table 2 reports baseline values and variations of blood glucose and insulin after 120 minutes in the two groups of children , respectively , with insulin level or 15 u / ml . both groups recorded a significant increase of glucose and insulin after 120 minutes : in particular , in the first group the mean glucose increase after the ogtt was 29.4 17.9 mg / dl ( p = 0.001 ) and mean insulin increase was 93.5 75.9 u / ml ( p = 0.001 ) ; in the second one mean glucose increase after the ogtt was 12.3 15.0 ( p = 0.0029 ) and mean insulin increase was 39.8 23.3 ( p = 0.0005 ) .
table 3 shows the comparison between data without inositol and the ogtt performed after inositol administration in the patients with baseline insulin 15 u / ml : fasting glucose was not significantly different from the previous test ( 88.5 3.4 versus 86.9 3.9 mg / dl ) and there was a small nonsignificant reduction of glucose after 120 minutes ( 117.9 19.2 versus 106.2 18.0 mg / dl ) , while a reduction of fasting insulin ( 22.6 10.0 versus 14.7 6.7 u / ml ; p = 0.001 ) was noted , and a decrease of insulin after 120 minutes ( 116.1 81.4 versus 77.3 58.4 u / ml ; p = 0.0176 ) .
in addition , in these 11 patients mean bmi after six months was not significantly different from the baseline ( 31.0 2.1 versus 31.0 2.6
in fact , they resulted to have had a bmi variation 2.5 kg / m .
in particular , some children have obtained a bmi reduction ( n = 4 ) , stabilization ( n = 3 ) , or an increase ( n = 4 ) , in a similar distribution .
thus bmi variation did not influence insulin variations and the results can be attributed to inositol only .
the effectiveness of inositol in lowering plasma glucose concentration and postprandial blood glucose levels has been reported in several cases of mellitus diabetes in rats , monkeys , and humans .
these studies showed that this effect was related to insulin - sensitizing activity [ 1518 ] .
d - pinitol exerted an acute and chronic insulin - like antihyperglycaemic effect on glucose transport in stz - diabetic mice , but acute administration of d - pinitol did not significantly alter plasma glucose or insulin concentration over 6 hours in severely insulin - resistant ob / ob mice . when administered to insulin - resistant and diabetic monkeys , d - chiro inositol accelerated glucose disposal and activated glycogen synthase in muscle biopsies beyond that of maximal insulin stimulation .
pinitol was administered to humans with type ii diabetes for 13 weeks and it significantly decreased mean fasting plasma glucose and insulin and improved lipid profile , while four weeks of pinitol treatment did not alter insulin - mediated glucose disposal in individuals with obesity and mild type ii diabetes [ 21 , 22 ] .
it seems that body weight is not significantly affected by inositol treatment [ 19 , 21 ] while inositol has been reported to improve insulin sensitivity and ovulatory function in young women affected by polycystic ovary syndrome . when the effect of inositol has been investigated in postmenopausal women with metabolic syndrome and in pregnant women with gestational diabetes , it resulted in improvements of fasting serum insulin and blood glucose levels [ 2325 ] .
in particular , in pregnant women with a family history of type 2 diabetes a supplement of myoinositol throughout the pregnancy also reduced the 1-hour glycemia at the ogtt stage and reduced the incidence of gestational diabetes .
however , those studies only include women with a specific hormonal status ( gestation , menopause , or pcos ) which does not allow us to confirm a similar effect of inositol supplementation in other contexts ; therefore the true mechanism of action is still unclear .
to our knowledge this is the first study to test the effect of inositol in children , even though our results are only preliminary .
the main aim of this process was to determine whether an acute effect of inositol on insulin sensitivity in children exists , when administered before a glucose tolerance test .
our results indicate that insulin increase after glucose intake may be attenuated when inositol is administered before the ogtt .
in particular , it seems that inositol reduces insulin increase mainly in children with high basal insulin level .
so patients with high fasting insulin might be the ones to benefit more from the administration of inositol . in our study
the observed correlations are not high , but this may be due to the low number of units in the sample analyzed .
they seem however indicative of an association between the observed insulin increase and the level of basal insulin that should be analyzed in detail with ad hoc larger studies .
myoinositol and d - chiro inositol have been shown to reduce insulin increase after glucose intake in obese children .
further investigations and larger studies are required to define the physiological and potential therapeutic effects of their administration , but they could be effective oral nonpharmacological agents in the prevention of type ii diabetes in children . | myoinositol and d - chiro inositol , which are inositol isomers , have been shown to possess insulin - mimetic properties and to improve insulin resistance , especially in women with polycystic ovary syndrome .
however , it has not been determined if this relationship exists also in children .
based on these previous findings , we hypothesized that inositol could be effective in improving insulin sensitivity in children with insulin resistance . to evaluate this hypothesis , we administered both inositol formulations before carrying out an oral glucose tolerance test ( ogtt ) in a group of obese insulin - resistant male children with high basal insulin levels and compared the values obtained with an ogtt previously conducted without inositol , in the same group , with unchanged bmi .
our results confirm that myoinositol and d - chiro inositol acutely reduce insulin increase after glucose intake mainly in children with high basal insulin level . |
lipoid proteinosis , also known as hyalinosis cutis et mucosae ( omim 247100 ) , was first described by urbach and wiethe in 1929 . since then , over 250 cases of this autosomal recessive disorder have been described .
it is characterized by the deposition of an amorphous hyaline substance ( glycoprotein ) in the mucous membrane and skin .
hoarseness and thickening of vocal cords are the most characteristic symptoms present from infancy or early childhood.3
,
4 another classic and most easily recognizable sign is the beaded eyelid papules .
the other cutaneous changes may include waxy , yellow papules and nodules with generalized skin thickening .
the mucosa of the pharynx , tongue , soft palate , tonsils and lips is also infiltrated.6
,
7 other features may include epilepsy and calcification in the temporal lobes or hippocampi .
since suturing is difficult because of rigid mucosa in these patients , the use of cryosurgery seems to offer advantages for removing oral nodular lesions .
therefore , cryosurgery ( n2o ) was performed to remove and reshape the lip lesions in a case of this rare syndrome .
the patient was a 24-year - old female from shahrekord , central iran , who sought medical care at the department of oral medicine , isfahan university of medical sciences in 2003 .
the patient was completely edentulous and showed the classic signs of lipoid proteinosis ( figure 1 ) . during oral examination ,
the patient had six sisters and one brother , and two of her sisters ( 25 and 11 years old ) suffered from the same syndrome .
the results of complete blood analysis and routine urinalysis were all within the normal limits .
the biopsy of lip lesions was performed with a scalpel under local anesthesia and examined by a pathologist to confirm the diagnosis .
suturing after biopsy was difficult because the mucosa was rigid and the sutures cut into it .
the patient suffered from some nodules on upper lip . after applying local anesthetic spray on the site , cryosurgery ( n2o , c 502 t , emd co ; tehran , iran )
was performed ( 63c for one minute ) , as this treatment has been used for similar superficial lesions .
the surgery was done in two sessions ; half of the lip was involved in each ( figure 2a , b ) .
the superficial layers were fallen by day 3 . after the operation , the patient had pain for about a week with a visual analogue scale of up to five .
follow up , no new nodules were formed ; however , some fissures were created on her lip ( figure 2c ) .
after the treatments , the appearance and the emotional state of this young female had improved .
lipoid proteinosis is a rare autosomal recessive disorder accompanied by hoarseness as well as infiltration and thickening of the skin and certain mucous membranes .
recently , lipoid proteinosis was mapped to 1q21 and pathogenetic loss - of - function mutations were identified in the extracellular matrix protein 1 ( ecm1 ) gene.2
,
4 some treatments for this disorder have already been reported . a case of lipoid proteinosis was successfully treated with dimethyl sulfoxide , however , in three other cases , it showed no beneficial effect .
retinoids have shown encouraging results in cutaneous lesions in previous studies.12
,
13d - penicillamine had a favorable effect in a patient with this syndrome .
microlaryngoscopy and dissection of the vocal cords , dermabrasion , chemical skin peeling and blepharoplasty were performed in some cases.5
,
1 lasers are used in many fields of medicine and dentistry .
carbon dioxide laser surgery of thickened vocal cords and beaded eyelid papules has proved to be helpful in some studies.2
,
1 nd : yag and er : yag lasers were applied to remove oral lesions in one case of this syndrome .
cryosurgery is the use of very low temperatures to destroy tissue . immediately following cryosurgery ,
tissues are virtually indistinguishable from the normal , but latent damage is produced which progresses to severe destruction of the tissue .
it is a safe , effective method of treatment for many benign soft tissue lesions in the oral cavity .
as suturing was difficult in this patient and mucosa was rigid , the use of cryosurgery seemed to offer some advantages in removing oral lesions in this case .
it seems that surgical methods like cryosurgery and laser1
,
1 have some advantages over conventional surgery for removing oral lesions of lipoid proteinosis syndrome as there is no bleeding and no need to suture , and it is more comfortable for the patient .
the described approach is considered an early report of n2o cryosurgery being used in removal and reshaping of lip lesions of this rare syndrome . | lipoid proteinosis is a rare hereditary metabolic disorder transmitted as an autosomal recessive trait .
it is characterized by the deposition of an amorphous hyaline - like material ( glycoprotein ) in the mucous membranes , skin and various internal organs .
cryosurgery ( n2o ) was applied to remove and reshape the lip lesions in a case of this rare syndrome .
the patient was a 24-year - old female .
cryosurgery ( 63c n2o for one minute ) was performed to re - shape some areas of the upper lip .
the lips were softer and had better esthetics after treatment .
the use of cryosurgery offers advantages over surgery in reshaping of the lip lesions in this syndrome , since suturing is not feasible in rigid mucosa of these patients . |
worldwide , it is the second leading cause of death and the leading cause of adult disability . so far
, acute stroke therapies aim at recanalizing the occluded brain vessels by means of pharmacologic thrombolysis or thrombectomy .
decades of research on ( neuro)protective drugs have established several promising candidates that reduced infarct size in experimental animal models of stroke with positive effects on neurological outcome in short term observations . however , none of these substances could prove efficiency in large scale randomized controlled trials in stroke patients .
a relatively new experimental approach is to target the dysfunction and mechanism of recovery within the nonischemic tissue surrounding the infarcted area , the so - called peri - infarct cortex .
the peri - infarct tissue of the photothrombotic stroke model shows high morphological similarities to the penumbra in other stroke models such as distal middle cerebral artery occlusion , but most importantly , this model allows the investigation of long - term functional outcome in mice .
sphingolipids are a complex class of signaling molecules and an essential part of cellular membranes .
their cellular levels regulate proliferation , apoptosis , and inflammation depending on the specific sphingolipid species , cell and receptor type , and different intracellular targets .
ceramides are the backbone of more complex sphingolipids and the precursor of the versatile signaling molecule sphingosine-1-phosphate .
they are essential for specific membrane functions ( e.g. , the formation of lipid rafts and caveolae ) and directly modulate intracellular effector proteins such as pkc , c - raf , and capp .
ceramide is tightly regulated in the cells , and its participation in cell death signaling pathways is controlled by rapid conversion of ceramide into less noxious / toxic sphingolipids .
ceramides are generated in different cellular compartments by three different pathways ( supplemental figure 3 in supplementary material available online at http://dx.doi.org/10.1155/2015/503079 ) : the de novo pathway in the endoplasmatic reticulum , the salvage / sphingomyelinase pathway in the golgi , lysosome , and the plasma membrane , as well as by recycling of glycosphingolipids .
the cellular function of ceramides is in part dependent on the chain length , which is determined by differential activity of specific ceramide synthases ( cers 16 ) .
there is some evidence that alterations in sphingolipid metabolism , leading to enhanced ceramide production , occur in neurological disorders , such as multiple sclerosis , wilson 's disease , and alzheimer 's disease .
cytokines such as tumor necrosis factor - alpha ( tnf- ) and reactive oxygen species ( ros ) induce the production of ceramide through activation of sphingomyelinases in this context .
therefore , the activation of the sphingomyelinase pathway is believed to be a general cellular stress response . in experimental stroke
, there are several studies showing an increase in ceramide synthesis via higher acid sphingomyelinase ( asm ) activity [ 1315 ] directly within the ischemic lesion .
however , these studies did not investigate the relevance for long - term functional outcome as they focused on the ischemic , death prone tissue and a short observation period . in that context , an experimental reduction of ceramide production
was shown to be ( neuro)protective leading to smaller infarct sizes and better short term outcome .
intriguingly , the antidepressant fluoxetine , a selective serotonin reuptake inhibitor and the only drug which has been shown to improve poststroke motor recovery in a randomized controlled neurorehabilitation trial in stroke patients , has recently been shown to inhibit asm activity in the rodent healthy brain .
as the different functions of ceramide indicate a possible role in peri - infarct inflammatory , degenerative , and recovery processes , we hypothesized that ceramides are relevant for long - term functional outcome after stroke .
given the potential of fluoxetine to inhibit the asm , the prorehabilitative effect of fluoxetine in stroke recovery might be attributable to the modulation of ceramide levels in the peri - infarct cortex .
we therefore hypothesized that ( a ) the peri - infarct region shows alterations of ceramide levels , that ( b ) these alterations result from a change of asm activity , and ( c ) that fluoxetine improves motor recovery after stroke , and this effect might be mediated by asm inhibition .
sample size calculations for all experiments were performed , assuming a power of 80% , previously published standard deviations and a difference between treatment groups of 20% .
briefly , 68 week old c57/bl6 mice were anaesthetized by 1.7% isoflurane and 0.1 mg / kg buprenorphine s.c . and placed into a stereotactical frame .
( sigma - aldrich , taufkirchen , germany ; 10 mg / ml ) , the skull was illuminated at the motor cortex by a cold light source . at days 1 , 3 , 7 , and 28 , respectively ,
10 mice per group ( sham , saline , and fluoxetine ) were killed by a lethal dose of isoflurane and immediate transcardial perfusion with 0.9% saline .
after measurement of stroke size by either ttc staining or a photograph of the brain surface , 10 mg blocks of the peri - infarct cortex ( supplemental figure 1 ) were dissected and immediately frozen in liquid nitrogen . at days
7 , 7 , and 28 , behavioral outcome was determined by the cylinder task and the grid - walking test as previously described .
fluoxetine ( ratiopharm , ulm , germany ) was given from day 3 to day 28 after stroke via drinking water ( concentration : 120 mg / l ) as previously published .
fluoxetine plasma - levels were measured at day 7 and 28 ( supplemental method 1 ) .
for quantification of ceramides , their precursors and metabolites , about 10 mg tissue was homogenized with pbs and liquid - liquid extracted with methanol : chloroform : hcl ( 15 : 83 : 2 ) .
the analytical procedure was similar to the method published elsewhere ( see supplemental method 2 ) .
the samples were lysed in 250 mm sodium acetate ( ph 5.0 ) , 1% np40 and 1.3 mm edta .
the tissue was then homogenized using the tissuelyser lt ( 1 min , 50 hz ; qiagen , hilden , germany ) .
aliquots of the lysates were diluted to 250 mm sodium acetate ( ph 5.0 ) , 0.1% np40 , and 1.3 mm edta , then incubated with 10 nci per sample [ c]sphingomyelin for 10 min at 37c .
the reaction was stopped by addition of 600 l of chloroform / methanol ( 2 : 1 ) , and phases were separated by centrifugation .
radioactivity of the aqueous phase was quantified by scintillation counting and enabled quantification of asm activity . for the nsm assay another lysis - buffer ( hepes 100 mm ; 0.1% np40 ; 5 mm dtt ; 10 mm mgcl2 ; 1.4 mm edta ) ,
reaction , and suspension buffer ( hepes 100 mm ; 0.1% np40 ; 5 mm dtt ; 10 mm mgcl2 ) were used .
substrate concentration , protein concentration , and reaction time were chosen after pilot studies ( supplemental figures 2c and d ) .
after homogenization using the tissuelyser lt ( 1 min , 50 hz ; qiagen , hilden , germany ) , 1.2 g of total rna was isolated with trizol ( sigma - aldrich , steinheim , germany ) according to the manufacture 's protocol and used for reverse transcriptase - polymerase chain reaction ( rt - pcr ; revert aid first strand cdna synthesis kit , thermo fisher scientific , st .
real - time pcr ( taqman ) was performed using applied biosystems 7500 fast real - time pcr system .
probes , primers , and the reporter dyes 6-fam and vic were from life technologies ( darmstadt , germany ) .
the cycling conditions were as follows : 95c for 15 min ( 1 cycle ) , 95c for 15 s , and 60c for 1 min ( 40 cycles ) .
the threshold cycle ( ct ) was calculated by the instrument software ( 7500 fast system sds software version 1.4 ) .
mass spectrometry revealed a reduction of total ceramide levels in the peri - infarct cortex ( figure 1(a ) ) at day 1 after photothrombosis ( 77.19% 15.51 ) compared to the corresponding cortex area in sham - operated mice ( 100% 21.5 , p = 0.02 , n = 810 ) .
however , at day 3 we found a significant increase of total ceramide ( 170% 39.79 versus 100% 24.85 , p = 0.0003 , n = 810 ) , which persisted up to day 7 ( 140% 29.58 versus 100% 23.8 , p = 0.0035 , n = 10 ) .
interestingly , the direct ceramide precursor of the de novo pathway , dihydroceramide ( dhc , figure 1(b ) , supplemental figure 3 ) , was correspondingly increased at day 3 ( 258.5% 85 versus 100% 14.74 , p < 0.0001 , n = 810 ) and day 7 ( 180% 52 versus 100% 12.4 , p = 0.0002 , n = 10 ) . both ceramide and dhc normalized compared to sham at day 28 .
the precursor of dhc is sphinganine ( figure 1(c ) ) , which was increased at day 7 after photothrombosis ( 147% 58.62 versus 100% 19.12 , p = 0.0274 , n = 10 ) .
sphingosine ( figure 1(d ) ) , the precursor as well as derivate of ceramide via the cers or the ceramidases , but present at much lower concentrations than ceramide , was found to be decreased at day 1 ( 78% 16.46 versus 100% 16.26 , p = 0.0115 , n = 810 ) but increased at day 3 ( 119% 17.47 versus 100% 9.4 , n = 810 , p = 0.0083 ) and day 7 ( 191% 95.89 versus 100% 12.3 ,
total glucosylceramides ( figure 1(e ) ) , which can be both a precursor of ceramide via the glucocerebrosidase ( gba ) and a product of the glucosylceramide synthase , was reduced at day 3 ( 63% 28.21 versus 100% 29.09 , n = 810 , p = 0.0146 ) .
total lactosylceramides however ( figure 1(f ) ) were elevated at day 7 ( 232% 92.48 versus 100% 36.05 , n = 10 , p = 0.0005 ) . in the peri - infarct cortex ,
ceramide 18:0 is by far the most abundant ceramide species in the cns and contributed as the major part of the here observed ceramide elevation .
. it was reduced at day 1 compared to sham ( figure 2(a ) , 76% 18.06 versus 100% 23.59 , p = 0.0285 , n = 810 ) and then increased at day 3 ( 181% 46.97 versus 100% 24.68 ,
ceramide 16:0 was decreased at day 1 ( 72% 15.33 versus 100% 23.52 , p = 0.0096 ) then increased at day 3 ( 290% 106 versus 100% 29.02 , p < 0.0001 , n = 810 ) and day 7 , but normalized at day 28 .
the very - long chain ceramides 24:0 and 24:1 however increased only at a later time point at day 7 ( 238.7% 136.1 versus
100% 15.71 , p = 0.0053 , n = 810 , ceramide 24:0 ) .
this resulted in changes of the ratios of ceramides with long chain length to ceramides with very - long chain length ( ceramide 16:0/ceramide 24:0 + ceramide 24:1 , figure 2(b ) ) compared between day 3 and day 7 ( 0.69 0.23 versus 0.47 0.74 , anova , mean difference 0.2095 , 95% ci of diff .
as our hypothesis was relying on the assumption that the sphingomyelinase pathway is upregulated under proinflammatory and hypoxic conditions , we measured sphingomyelinase activity in the peri - infarct cortex .
however , the activity of both asm and the nsm were unchanged ( figure 3 ) ; asm activity was higher compared to nsm activity . in order to investigate a potential transcriptional regulation of the different ceramide generation pathways , we performed taqman pcr of the most relevant enzymes ( supplemental figure 3 ) . against our hypothesis but
consistent with enzyme activity , we found a reduction of asm mrna ( figure 4(a ) ) at day 7 ( 85% 13.21 versus 100% 12.73 , n = 810 , p = 0.0312 ) , and of the neutral sphingomyelinase 2 ( nsm-2 , figure 4(b ) ) at day 3 ( 62% 20.12 versus 100% 21.88 , n = 9 - 10 ,
p = 0.0012 ) and day 7 ( 66% 16.77 versus 100% 24.82 , n = 9 - 10 , p = 0.0026 ) .
nsm-1 mrna ( figure 4(c ) ) , which is present in much lower quantities than the nsm-2 mrna ( data not shown ) was unchanged , as well as the acid ceramidase ( acer ) mrna ( figure 4(d ) ) , the neutral ceramidase ( ncer ) mrna ( figure 4(e ) ) , and the acid glucocerebrosidase 1 ( gba1 ) mrna ( figure 4(f ) ) .
gba2 mrna ( figure 4(g ) ) was reduced at day 1 ( 76% 25 versus 100% 17.59 ,
cers1 ( figure 4(h ) ) is mainly responsible for the de novo synthesis of ceramide 18:0 and 20:0 and is downregulated at day 7 ( 66% 20.73 versus 100% 25.65 , n = 9 , p = 0.026 ) .
cers2 ( figure 4(i ) ) produces ceramide 20:0 to 26:0 and is downregulated at day 1 ( 74% 23.65 versus 100% 24.41 , n = 9 , p = 0.0335 ) .
cers4 ( responsible for ceramide 18:0 and 20:0 ) and cers6 ( ceramide 14:0 , 16:0 and 18:0 ) were unchanged ( figures 4(j ) and 4(l ) ) , whereas cers5 ( ceramide 16:0 ) was upregulated at day 1 ( 132% 30.12 versus 100% 15.71 , n = 9 , p = 0.0120 ) .
nevertheless we anticipated a reduction of ceramide levels by inhibiting the acid sphingomyelinase pathway by treatment with the functional inhibitor fluoxetine , starting at day 3 after photothrombosis .
we found an effect of fluoxetine on stroke / glial scar size at day 28 ( 1.047 mm 0.33 versus 2.778 mm 0.55 , p < 0.0001 , n = 10 ; figure 5(a ) ) but could not observe any effect of fluoxetine on total ceramide levels ( figure 5(d ) ) and asm activity ( figure 5(e ) ) and most importantly on functional outcome ( figure 5(b ) ) . as controls for the validity of our assay as well as the potency of fluoxetine and other antidepressants to inhibit the asm at the concentrations we achieved in our mice , we measured asm activity in vitro ( supplemental figure 2a ) and cortex of asm homozygous and heterozygous knockout mice ( supplemental figure 2b ) ; in all cases , a reduction of asm activity could be observed .
the present study evaluated whether targeting ceramide - metabolism might be of potential therapeutic value in the poststroke reconvalescence period .
we show a reduction of the bioactive sphingolipid ceramide in the subacute phase ( day 1 , figure 1(a ) ) and an increase of ceramide in an intermediate time - window ( day 37 ) within the peri - infarct region .
importantly , in this model , fluoxetine is not able to reduce sphingomyelinase activity , ceramide concentrations or to improve functional outcome . in order to determine other potential therapeutic targets
, we investigated the ceramide synthesis pathways in the peri - infarct cortex and could show that the sphingomyelinase is not the responsible enzyme for the ceramide elevations but possibly changes in ceramide de novo synthesis .
this study has some major differences to previous studies , describing ceramides in experimental stroke , as these studies only investigated ceramide - levels in the infarct zone [ 1315 ] . in ischemic tissue , the proapoptotic mechanism of increased sphingomyelinase activity
has not only been shown in cns , but also in various other cell types . however , in the here investigated photothrombotic peri - infarct zone , apoptosis only takes place in a fine boundary zone and a short time window .
it is therefore unlikely that the elevation of ceramides we observed here , simply reflects mechanisms of cell death , especially as we surprisingly observed a decrease of total ceramide levels at 24 h post stroke , when relatively late penumbral apoptosis is supposed to be present and show only an increase from day 3 to day 7 after stroke .
importantly , we did not find any relevant changes of the acid and neutral sphingomyelinase activity ( figure 4 ) in the peri - infarct tissue compared to sham operated mice .
again , this is not comparable to previous data in experimental stroke , in which the induction of asm - activity was a very early and short - term phenomenon [ 1315 ] . in summary
, we did not detect the very early increase of asm - activity seen by others probably due to the analysis of different tissue and other time points .
interestingly , although we found effects of late - onset fluoxetine treatment on infarct size and/or scar formation ( figure 5(a ) ) , which is consistent with previous publications [ 24 , 25 ] , we did not see any effects of fluoxetine on sphingomyelinase activity , ceramide , or behavioral outcome ( figures 5(b)5(e ) ) . as
this finding is a discrepancy to the previously reported effect of fluoxetine on asm activity in c57/bl6 mice , we performed various controls and could show the inhibition of asm by fluoxetine in cell cultures , as well as a reduced asm - activity in asm homozygous knock - out animals ( supplemental figure 2 ) , validating the specificity and sensitivity of our assay . furthermore , the plasma levels of the very lipophilic and blood - brain barrier penetrable drug fluoxetine were fairly high ( day 7 : 2.25 m ; day 28 : 3.76 m , n = 9 - 10 ) .
unfortunately , we are not able to supply any well - known positive control of fluoxetine action in vivo , such as serotonin reuptake inhibition
. however , the effect of fluoxetine on infarct size indicates that fluoxetine mediated some protective effect within the cns . additionally , our result is line with others , who could not show an effect of long - term treatment of mice with fluoxetine on ceramides in the cns and with previous data showing no effect of fluoxetine on recovery after stroke in rats [ 27 , 28 ] .
our analysis included the direct precursors and derivate of ceramide ( supplemental figure 3 ) , allowing conclusions to be drawn to the involvement of other ceramide synthesis pathways .
exceptions are ceramide-1-phosphate , which is present at a much lower quantity than ceramide and sphingomyelin , whose potential turnover was quantified by sphingomyelinase activity assays . the here observed increase of dihydroceramides ( dhc ) ( figure 1(b ) )
might indicate that instead of the sphingomyelinase pathway , the ceramide de novo pathway is upregulated within the peri - infarct tissue . within this pathway , dihydroceramide ( dhc )
is the direct precursor of ceramide but also has biological signaling functions on its own and importantly is not a derivate of ceramide .
the serine - palmitoyl - coa transferase ( spt ) and the dihydroceramide desaturase ( des ) , both enzymes of the de novo pathway , are regulated by oxidative stress , hypoxia , and inflammation [ 30 , 31 ] . however , the spt is less likely to be the only responsible enzyme in the peri - infarct tissue , as we observed only an effect of stroke on sphinganine concentrations on day 7 ( figure 1(c ) ) . as we show here , a parallel increase of ceramide and dhcs ,
the enzymes distal of the spt and proximal of the des in the de novo pathway and responsible for synthesis of ceramide subspecies with specific chain lengths are the ceramide synthases . considering that our results show that an involvement of the spt and the des is less likely and that the increase of certain ceramide subspecies is responsible for the elevation of total ceramide , it is tempting to speculate that the ceramide synthases are responsible for the here observed elevation of ceramides . on the transcriptional level , most of the enzymes of the different ceramide synthesis pathways appear not to contribute to increased ceramide levels ( figure 4 ) ; only the increase of cers5 mrna ( figure 4(k ) ) at day 1 could explain the upregulation of ceramide 16:0 ceramide at day 37 .
furthermore , the decrease of cers2 ( figure 4(i ) ) , the second most common cers in the cns , could contribute to the decrease of total ceramide at day 1 .
however , it is important to consider , that discrepancies of ceramide synthase activity and transcriptional regulation has been shown previously [ 33 , 34 ] . in the peri - infarct cortex , instead of cell death , events such as axonal sprouting , microglial and astrocytic activation , angio-/neurogenesis , and synaptic plasticity determine neurological outcome
. what could be the pathophysiological role of the observed increase of total ceramide and ceramide subspecies in the peri - infarct cortex ?
one has to keep in mind that most of the previous data about the effect of ceramide on cns cells was determined in cell culture using short chain ceramide ( ceramide 2:06:0 ) , which has very different properties compared to the more abundant long or very - long ceramides ( ceramide 16:024:0 ; ) . concerning neuronal plasticity , pkc can be recruited and activated by ceramide [ 4 , 35 ] and pkc has been shown to be important for long - term potentiation ( ltp ) creation and maintenance .
ceramide - controlled lipid rafts are essential for efficient synaptic transmission , supporting an influence of ceramide levels on synaptic plasticity ; for example , it has been shown that increasing ceramide levels increase nmda receptor - mediated synaptic transmission [ 37 , 38 ] .
the increase of nmda - receptor transmission facilitates long - term - potentiation and memory consolidation but on the other hand has a negative impact in the long - term by increasing excitotoxicity . in the case of recovery from experimental stroke ,
on the other hand , there is a negative influence of ceramide on axonal outgrowth , both by ceramide itself and its metabolites .
importantly , a recent publication shows that lactosylceramide controls astrocytic activation in an autocrine fashion , which indirectly influences microglial activity .
as we observe an increase of lactosylceramide at day 7 ( figure 1(f ) ) , lactosylceramide may also play a role in ( micro)glial activation in the peri - infarct cortex . in multiple sclerosis plaques , total
ceramide has been shown to be reduced , but certain subspecies were increased within reactive astrocytes , contributing to blood - brain barrier damage .
ceramide is an inhibitor of both neuro- and angiogenesis [ 17 , 42 ] , two important mechanisms for recovery after stroke .
additionally , a more general neurotoxic effect of ceramide 16:0 and ceramide 24:0 could be recently shown .
there is some evidence that specific alterations of different ceramide subspecies occur in cns diseases such as alzheimer 's disease .
this indicates that ceramides substantially influence pathophysiological processes in a manner dependent on the chain length .
concerning membrane functions , ceramide 16:0 and ceramide 24:0 have a different ability to form cluster with cholesterol , which is an essential step towards lipid raft formation and clustering as well as activation of various proteins at the cell membrane .
membranes of cers2-ko - mice ( with a lack of ceramide 24:0 ) are more fluid , which indicates that our data could have implications not only for cell membrane function , but also for the functionality of membrane bearing organelles in cells of the peri - infarct cortex . in the peri - infarct cortex
we observed a differential regulation of ceramides with specific chain lengths ( figure 2 ) , indicating a specific pathophysiological role for each ceramide subspecies .
it appears as if the ceramide metabolism compensates the initially increased ratio of long to very long chain length at day 3 by upregulation of ceramide 24:0 and 24:1 leading to a transient , almost normalized ratio at day 7 ( figure 2(b ) ) . in summary ,
our observation of alterations of ceramide , its subspecies and metabolites in the peri - infarct cortex could have both a positive and a negative impact on recovery and function of the peri - infarct tissue after stroke .
unfortunately , the relevance of our observations remains to be proven , as we were not able to reduce ceramide generation by inhibition of sphingomyelinase activity .
future studies should address the potential targets pointed out in this study , that is , the ceramide de novo pathway , by other genetic and pharmacological approaches .
our observation of an elevation of ceramide points to a complex , but well - coordinated pathophysiological role of sphingolipid metabolism in the peri - infarct cortex .
this could have implications for our understanding of recovery from stroke and other acute cns diseases and indicates potential therapeutic targets . | ceramides induce important intracellular signaling pathways , modulating proliferation , migration , apoptosis , and inflammation .
however , the relevance of the ceramide metabolism in the reconvalescence phase after stroke is unclear . besides its well - known property as a selective serotonin reuptake inhibitor
, fluoxetine has been reported to inhibit the acid sphingomyelinase ( asm ) , a key regulator of ceramide levels which derives ceramide from sphingomyelin .
furthermore , fluoxetine has shown therapeutic potential in a randomized controlled rehabilitation trial in stroke patients .
our aim was to investigate and modulate ceramide concentrations in the peri - infarct cortex , whose morphological and functional properties correlate with long - term functional outcome in stroke .
we show that certain ceramide species are modulated after experimental stroke and that these changes do not result from alterations of asm activity , but rather from nontranscriptional induction of the ceramide de novo pathway .
unexpectedly , although reducing lesion size , fluoxetine did not improve functional outcome in our model and had no significant influence on asm activity or the concentration of ceramides . the ceramide metabolism could emerge as a potential therapeutic target in the reconvalescence phase after stroke , as its accumulation in the peri - infarct cortex potentially influences membrane functions as well as signaling events in the tissue essential for neurological recovery . |
a 43-year - old woman underwent neck sonography as part of a routine medical checkup .
six years earlier she had received a renal transplant , and the kidney involved had been functioning well up to the time of the checkup . neck ultrasonography revealed a 2.91.4-cm hypoechoic mass at the inferoposterior aspect of the right lobe of the thyroid ( figs .
the lesion , located outside the thyroid capsule , had an ill - demarcated margin and contained multiple hyperechoic foci which appeared to be small calcifications .
the thyroid gland was normal in echogenicity and size , and no focal lesion was observed .
subsequently , on the basis of the sonographic findings , a tumor of the right parathyroid gland was suspected , and needle aspiration biopsy ( nab ) was planned .
further sonography suggested that the hyperechogenic foci were mobile . to rule out zenker 's diverticulum ,
neck ct scans were obtained , and an unusual air pocket was found on the right side of the trachea .
1c ) , and multiplanar reformatted imaging showed that a slit - like structure linked it with the trachea ( fig .
after reviewing all the above findings , a paratracheal air cyst was diagnosed . a 65-year - old man presented with anterior neck pain .
sonography indicated that the thyroid gland was normal , but at the inferoposterior aspect of its right lobe , an ill - defined hypoechoic mass was discovered ( figs .
esophagography revealed no evidence of esophageal diverticulum , but neck ct demonstrated an ill - defined air pocket , which communicated with the trachea ( figs . 2c ,
chest radiographs revealed mild emphysematous change but did not depict the air pocket in the right lower neck region .
a 43-year - old woman underwent neck sonography as part of a routine medical checkup .
six years earlier she had received a renal transplant , and the kidney involved had been functioning well up to the time of the checkup . neck ultrasonography revealed a 2.91.4-cm hypoechoic mass at the inferoposterior aspect of the right lobe of the thyroid ( figs .
the lesion , located outside the thyroid capsule , had an ill - demarcated margin and contained multiple hyperechoic foci which appeared to be small calcifications .
the thyroid gland was normal in echogenicity and size , and no focal lesion was observed .
subsequently , on the basis of the sonographic findings , a tumor of the right parathyroid gland was suspected , and needle aspiration biopsy ( nab ) was planned .
further sonography suggested that the hyperechogenic foci were mobile . to rule out zenker 's diverticulum ,
neck ct scans were obtained , and an unusual air pocket was found on the right side of the trachea .
1c ) , and multiplanar reformatted imaging showed that a slit - like structure linked it with the trachea ( fig .
sonography indicated that the thyroid gland was normal , but at the inferoposterior aspect of its right lobe , an ill - defined hypoechoic mass was discovered ( figs .
esophagography revealed no evidence of esophageal diverticulum , but neck ct demonstrated an ill - defined air pocket , which communicated with the trachea ( figs . 2c ,
chest radiographs revealed mild emphysematous change but did not depict the air pocket in the right lower neck region .
pathologic diagnoses of these cysts vary ( tracheal diverticulum , or lymphoepithelial or bronchogenic cyst ) , but all are lined by ciliated columnar epithelium and communicate with the trachea ( 1 - 4 ) .
the differential diagnosis of a paratracheal air collection includes pharyngocele , esophageal diverticulum , laryngocele , apical hernia of the lung , and apical paraseptal blebs or bullae ( 1 , 2 ) . because of the reverberation artifact at ultrasonography , zenker 's diverticulum may be seen as a mass with hyperechoic foci , mimicking a thyroid nodule , but the shape of the mass changes as the patient swallows , and the hyperechoic foci are mobile ( 5 , 6 ) . a barium swallow study is used to confirm zenker 's diverticulum and pharyngocele .
laryngocele can be identified at ct as abnormal dilatation of the saccule of the laryngeal ventricle ( 7 ) , and ct also shows that apical hernia of the lung is contiguous with the remainder of the lung . at chest radiography , the hernia tends to enlarge on forced expiration and shrink on inspiration ( 8) .
apical paraseptal blebs or bullae , which are air cysts within the lung , can be recognized on ct scans . in most previously reported cases ,
paratracheal air cysts were identified at routine chest radiography and ct , and were located at the right posterolateral aspect of the trachea at the level of the t1-t2 vertebral body ( 1 - 4 ) .
( 4 ) reported that if a right paratracheal air cyst was observed at ct , this could be a sign of obstructive lung disease , clinically , and of the presence of emphysema , radiologically . at initial ultrasonography
surprisingly , the cyst appeared as a hypoechoic mass - like lesion at ultrasonography , though ct revealed no fluid density within it .
we constructed a paratracheal air cyst model by trapping a balloon between slices of pork ( figs .
3a , b ) , and ultrasonography of the model demonstrated a hypoechoic mass with multiple echogenic foci ( fig .
this outcome was probably due to the strong reflection of the ultrasound beam from the anterior wall of the balloon , and the multiple echogenic foci detected within the mass may be due to reverberation artifact .
this phantom model explains why the paratracheal air cyst was seen as a hypoechoic mass containing hyperechoic foci .
moreover , compression by the sonographic transducer distorts the wall , making it more irregular , and this invokes artifacts from many different directions . as a result ,
when sonography depicts a mass - like lesion containing hyperechoic foci at the right inferoposterior aspect of the thyroid gland and to the right of the trachea , the possibility of a paratracheal air cyst should be considered .
ct may help disclose the nature of the lesion before performing an invasive procedure such as nab . | we report two cases of paratracheal air cyst discovered incidentally at neck ultrasonography and confirmed at ct .
the cysts were located at the inferoposterior aspect of the right lobe of the thyroid .
ultrasonography revealed an ill - defined hypoechoic mass containing hyperechoic foci which mimicked calcifications .
neck ct confirmed the presence of an ill - defined air pocket which communicated with the trachea through a slit . |
in western societies , two out of three people have low - back pain at some point during their life , and in one out of five of these cases , the pain persists for more than 4 weeks .
cases where symptoms persist for more than 712 weeks are diagnosed as chronic low - back pain .
prominent structures that are the source of pain in the spine are the vertebral body , intervertebral discs , ligaments , muscles , roots , and facet joints .
the pain is generally felt 5 cm laterally to the centerline of the spine in paravertebral muscles on both sides .
the application of local pressure increases pain in facet joints that are initially spotted as vulnerable through radiology imaging .
the physical examination shows that the pain decreases when the patient leans forward , and it increases when they lean backwards and rotate . in case of chronic low - back pain , treatment options are divided into nonsurgical and surgical ones .
nonsurgical treatment options include physical exercise ; ultrasound ; physical therapy modalities such as superficial and deep heat applications ; and alternative medical practices such as acupuncture , massage , and traction manipulation .
another treatment option that has become popular in recent years is an imaging - assisted local injection and denervation technique . in recent years
, a multitude of randomized studies were performed , and this subject is popular in some branches like algology , physiotherapy , and interventional radiology .. our aim is to demonstrate that for low - back pain produced by pure facet hypertrophy , steroid injection around the facet joint is an effective treatment .
however , if there is an existing major pathology , it is not as effective .
a total of 94 patients who were admitted to our hospital with complaints of low - back pain were included in the study .
the patients were divided into two diagnosis groups according to their physical examination , x - ray , and magnetic resonance imaging ( mri ) findings .
group b also had 47 patients , but these patients had facet hypertrophy in addition to other condition(s ) such as spondylolisthesis grades 1 and 2 ( 13 patients , 27.6% ) , retrolisthesis ( 1 patient , 2.1% ) , multiple discopathy ( 33 patients , 70.2% , protrusion or more grade ) , scoliosis ( 7 patients , 14.8% , de novo scoliosis ) , and coxarthrosis ( 2 patients , 14.2% idiopathic coxarthrosis ) .
none of the patients from either group had sagittal and coronal balance defects [ > 5 cm deviation in central sacral vertical line ( csvl ) ] .
group a comprised of 41 women and 6 men with mean age of 55.3 years and group b comprised of 39 women and 8 men with mean age of 58.9 years . the age difference and sex difference between the two groups were not significant [ table 1 ] .
patient demographics and sex distribution criteria required for patient inclusion :
low - back pain not responding to medicinal treatment for more than 3 months.a pain locally occurring at or around the lower back , without spreading to the legs.palpation-induced sensitivity on the facet joint upon examination.radiologic confirmation of facet hypertrophy .
a pain locally occurring at or around the lower back , without spreading to the legs .
criteria required for patient exclusion :
central stenosis patients ( > 50% central or foraminal stenosis).patients whose complaints about pain upon spreading to legs and numbing were more prevalent ( radiculopathy).patients who had additional pathologies such as infection or neoplasia.patients who had a body mass index greater than 35.patients with uncontrolled diabetes .
patients whose complaints about pain upon spreading to legs and numbing were more prevalent ( radiculopathy ) .
patients who had a body mass index greater than 35 . patients with uncontrolled diabetes .
the wilcoxon test was also applied when in - group values were not found to be homogenous . statistical package for the social sciences ( spss ) version 20.0 software ( spss - inc .
cross - group differences were compared using mann - whitney u - test , which is a nonparametric two - group test .
the patients were informed about the procedure and signed consent was obtained from them prior to the procedure .
injection levels were decided by using results of mri analysis and examinations made on the operating table .
the patients were placed on the radiolucent operating table in prone position , and their backs were sterilized by povidone - iodine and were covered locally . in the procedure ,
first the needle was inserted into the palpated , tender facet joint following anteroposterior ( ap ) fluoroscopy imaging to confirm the location . after insertion of the needle , a 20 oblique fluoroscopy view was taken for the verification of the needle position [ figure 1 ] .
ap fluoroscopy image of l4 vertebra ; spinal needle seen over the l4 facet initially , the contrast agent was injected using a 22-gauge 10-cm black colored spinal needle . after feeling the contact with the bone and confirming that no bleeding occurred by negative aspiration , 2 ml of 25% bupivacaine and a methylprednisolone mixture were periarticularly injected into the medial side of the facet joint .
soon after the occurrence of the postinjection relaxation at the region , which was a source of pain prior to injection by physical examination , the process was completed . to eliminate any root irritation caused by the injection that might interfere with our study ,
the occurrence of any sensation of electric shock or numbing spreading to the leg was questioned , and the patient was kept under observation for an hour in the clinic in case of any allergic reaction .
the wilcoxon test was also applied when in - group values were not found to be homogenous . statistical package for the social sciences ( spss ) version 20.0 software ( spss - inc . , chicago , il ) was used for the analysis .
cross - group differences were compared using mann - whitney u - test , which is a nonparametric two - group test .
the patients were informed about the procedure and signed consent was obtained from them prior to the procedure .
injection levels were decided by using results of mri analysis and examinations made on the operating table .
the patients were placed on the radiolucent operating table in prone position , and their backs were sterilized by povidone - iodine and were covered locally . in the procedure ,
first the needle was inserted into the palpated , tender facet joint following anteroposterior ( ap ) fluoroscopy imaging to confirm the location .
after insertion of the needle , a 20 oblique fluoroscopy view was taken for the verification of the needle position [ figure 1 ] .
ap fluoroscopy image of l4 vertebra ; spinal needle seen over the l4 facet initially , the contrast agent was injected using a 22-gauge 10-cm black colored spinal needle . after feeling the contact with the bone and confirming that no bleeding occurred by negative aspiration , 2 ml of 25% bupivacaine and a methylprednisolone mixture were periarticularly injected into the medial side of the facet joint .
soon after the occurrence of the postinjection relaxation at the region , which was a source of pain prior to injection by physical examination , the process was completed . to eliminate any root irritation caused by the injection that might interfere with our study ,
the occurrence of any sensation of electric shock or numbing spreading to the leg was questioned , and the patient was kept under observation for an hour in the clinic in case of any allergic reaction .
in the patient evaluation , the lower back specific functional score such as oswestry disability index ( odi ) score and the general pain score such as visual analog scale ( vas ) score were used . in table 2 , pre and postinjection distribution of odi and vas scores for both groups are displayed , .
preinjection odi and vas scores were found to be significantly higher ( p < 0.05 ) compared with the 3- and 6-month postinjection scores .
vas and odi scores comparison of group a and group b in the course of the treatment preinjectional vas scores of patients from groups a and b were found to be significantly higher than the postinjection score at third and sixth months ( p < 0.05 ) . at the twelfth month , group a patients scores was still be significantly lower than preinjectional but for group b patients it was not still significantly lower than preinjectional vas scores ( p > 0.05 ) . when comparing postinjectional change of the vas scores of two groups , group a has a significantly higher change than group b [ table 2 ] .
there was no significant difference in preinjection odi scores between groups a and b ( p > 0.05 ) .
preinjection odi scores were significantly higher in group a patients than postinjectional scores at third , sixth , and twelfth months ( p < 0.05 ) .
preinjectional odi scores of group b were significantly lower at the third and sixth months postinjectionaly ( p < 0.05 ) . at the twelfth month , the difference was not significant ( p > 0.05 ) [ table 2 ] .
odi scores of group a patients were significantly lower compared with the scores of group b patients ( p < 0.05 ) at the third , sixth , and twelfth months after applying the injection [ table 2 ] .
the mean facet levels of injection was 2.42 for group a and 2.12 for group b. nine patients in group a ( 19.1% ) and five patients in group b ( 10.6% ) had sacroiliac injections in addition to facet joint injection . when group a patients were asked if they were satisfied with the treatment and if they would prefer it again , 91.5% of the patients gave positive response , whereas when group b patients were asked the same question , only 8.5% of the patients gave positive response ( p < 0.05 ) . this inadequate decrease in scores of group b patients
the use of medication prior to the treatment for group a patients was 90% and was for group b patients it was 97% . at the third month after applying the injection , these figures dropped to 10% for group a and to 71% for group b. at the sixth month after applying the injection , the figures increased to 31% for group a and 96% for group b [ table 3 ] .
the need for pain killer medication comparison of group a and group b in the course of the treatment
facet joints are the source of low - back pain in 15 - 52% of back pain patients . in the treatment of facet joint pain ,
medical treatment and physiotherapy comprise the first step , and facet injection is involved in the second step of the treatment .
the following injection techniques are applied to the facet joint : injection around the facet joint ( medial branch block ) , intra - articular injection , and neurotomy with radiofrequency are common .
the selection of the patients to be included in our study was made by experienced spinal surgeons .
all patients were given lumbar ap and lateral ( lat ) radiography and lumbar mri .
the patients who had at least one condition such as balance defect in the sagittal and coronal plane ( csvl > 5 cm ) , central stenosis ( > 50% central or foraminal stenosis ) , complaints of pain spreading from the lower back to leg or numbing or more prevalent paraesthesia , body mass index > 35 , and uncontrolled diabetes were excluded from the study .
after the exclusion of other diseases that might be the cause of low - back pain , facet joint injection treatment was suggested to the patients who were unresponsive to the medication therapy .
postinjection vas and odi scores of group a , at the end of third , sixth , and twelfth month followup , were found to be significantly lower than the preinjection levels .
although the decrease of vas and odi scores of group b at the end of the third and sixth months were less than those of group a , but they were still found to be statistically significant from the preinjection levels ( p < 0.05 ) .
the decline in the need of pain medication and overall affirmative answers for the question of repeating the treatment if the pain reoccurs indicated that the treatment yielded much more successful results in patients without an accompanying condition .
there are studies that applied facet injection intra - articularly and pericapsularly , and it was reported that the end results were no different .
we applied the pericapsular injection technique because it is technically easier and less time - consuming compared to other methods .
the ultrasound - assisted injection technique was introduced much earlier , and it has the advantage of being radiation free .
however , difficulties are involved in imaging due to the acoustical impedance of bones , and the method requires experienced users to achieve a reliable image . in our study , we used fluoroscopy , which is the most commonly used imaging device by orthopedic surgeons . it is reported that facet injection was as effective as facet denervation at the first month .
however , the effect of the injection treatment decreased at the end of the third month . due to the patient satisfaction in group a patients , we reached the conclusion that the facet joint injection has continued effects until the end of the twelfth month .
the reason for the unsuccessful treatment in the patients with multiple conditions is not fully understood in our study , the patients who comprised the second group did not experience successful results after applying the facet injection unlike the patients who comprised the first group .
this leads us to the conclusion that the presence of major pathologies in addition to facet joint arthritis reduces the affectivity of the treatment . in our patients ,
the facet injection sustained its effects up to the twelfth month for group a , whereas for group b its effect was found on a medium level at the third and sixth month , but was not effective at the twelfth month . in our opinion , the difference between two groups in terms of the effectiveness of the injection and patient satisfaction was influenced by comorbidities to the facet joint arthritis .
finally , we deduced that it is crucial to be more careful about choosing patients to increase the effectiveness of facet injection .
among various types of low - back pains , facet joint - originated pain is quite common .
our analysis showed that even in these situations , the local anesthetic and steroid injections applied to the facet joint are effective treatment options in the short and medium terms .
to maximize the effect of the treatment , the selection of the patient is a crucial step . by repeating the process every 6 - 12 months under operating room conditions , our opinion is that the patients were spared from risky surgical procedures .
| study design : retrospective cohort study.purpose:facet joints are considered a common source of chronic low - back pain . to determine whether pathogens related to the facet joint arthritis have any effect on treatment failure.materials and methods : facet joint injection
was applied to 94 patients treated at our hospital between 2011 and 2012 ( mean age 59.5 years ; 80 women and 14 men ) . for the purpose of analysis ,
the patients were divided into two groups .
patients who only had facet hypertrophy were placed in group a ( 47 patients , 41 women and 6 men , mean age 55.3 years ) and patients who had any additional major pathology to facet hypertrophy were placed in group b ( 47 patients , 39 women and 8 men , mean age 58.9 years ) .
injections were applied around the facet joint under surgical conditions utilizing fluoroscopy device guidance .
a mixture of methylprednisolone and lidocaine was used as the injection ingredient.results:in terms of oswestry disability index ( odi ) and visual analog scale ( vas ) scores , no significant difference was found between preinjection and immediate postinjection values in both groups , and the scores of group a patients were significantly lower ( p < 0.005 ) compared with that of group b patients at the end of the third , sixth , and twelfth month.conclusion:for low - back pain caused by facet hypertrophy , steroid injection around the facet joint is an effective treatment , but if there is an existing major pathology , it is not as effective . |
hashimoto 's thyroiditis is the combination of autoimmune thyroiditis and goiter ; a positive test result for thyroid auto antibodies ( antithyroglobulin and antiperoxidase ) will confirm the diagnosis.current and previous drug use check for history of thyroid surgery or head and neck irradiation and radioactive iodine therapy for thyrotoxicosis.menstrual and obstetric history check for a history of amenorrhea and menorrhagia.examination of the neck for presence or absence of goiter or a thyroidectomy scar .
also examine for general features of hypothyroidism and associated organ - specific autoimmune diseases such as vitiligo .
hashimoto 's thyroiditis is the combination of autoimmune thyroiditis and goiter ; a positive test result for thyroid auto antibodies ( antithyroglobulin and antiperoxidase ) will confirm the diagnosis .
current and previous drug use check for history of thyroid surgery or head and neck irradiation and radioactive iodine therapy for thyrotoxicosis . menstrual and obstetric history
examination of the neck for presence or absence of goiter or a thyroidectomy scar . also examine for general features of hypothyroidism and associated organ - specific autoimmune diseases such as vitiligo .
the initial dose in old patients with ischemic heart disease should be 25 g daily.monitor treatment with tests of serum tsh concentrations.change the thyroxin dosage by 26 - 50 g daily . then measure the tsh concentration 4 - 6 weeks later until the tsh has normalized.once euthyroidism is achieved ,
patients should be monitored annually by measuring the level of tsh to ensure that thyroxin replacement is adequate.explain that treatment is likely to be lifelong with minimal side effects if administered at the correct dosage and that the prognosis is excellent.tell the patient that it may take a few weeks for thyroxin to begin working and that he / she should not expect all symptoms to disappear within a few days of starting treatment .
the initial dose in old patients with ischemic heart disease should be 25 g daily .
change the thyroxin dosage by 26 - 50 g daily . then measure the tsh concentration 4 - 6 weeks later until the tsh has normalized .
once euthyroidism is achieved , patients should be monitored annually by measuring the level of tsh to ensure that thyroxin replacement is adequate .
explain that treatment is likely to be lifelong with minimal side effects if administered at the correct dosage and that the prognosis is excellent .
tell the patient that it may take a few weeks for thyroxin to begin working and that he / she should not expect all symptoms to disappear within a few days of starting treatment .
poor compliance is the most common reason for continued elevation of the tsh level in patients receiving presumably adequate thyroid hormone replacement .
patients who do not regularly take their replacement medication and then try to catch up just before physician visit may restore their ft4 levels to normal but continue to have an elevated tsh level .
poor compliance is the most common reason for continued elevation of the tsh level in patients receiving presumably adequate thyroid hormone replacement .
patients who do not regularly take their replacement medication and then try to catch up just before physician visit may restore their ft4 levels to normal but continue to have an elevated tsh level .
i ) drugs that reduce thyroid hormone production
lithiumiodine - containing medicationsamiodarone ( cordarone ) drugs that reduce thyroid hormone absorptionsucralfate ( carafate)ferrous sulfate ( slow iron)cholestyramine ( questran)colestipol ( colestid)aluminum - containing antacidscalcium products
iodine - containing medications amiodarone ( cordarone ) drugs that reduce thyroid hormone absorption sucralfate ( carafate ) ferrous sulfate ( slow iron ) cholestyramine ( questran ) colestipol ( colestid ) aluminum - containing antacids i ) drugs that increase metabolism of thyroxine
rifampin ( rifadin)phenobarbitalcarbamazepine ( tegretol)warfarin ( coumadin)oral hypoglycemic agents
carbamazepine ( tegretol ) oral hypoglycemic agents b : - increase thyroxin availability and may decrease replacement requirements i ) drugs that displace thyroid hormone from protein binding
furosemide ( lasix)mefenamic acid ( ponstel)salicylates
mefenamic acid ( ponstel )
diseases causing malabsorption , e.g. , celiac disease , tropical sprue and previous small intestine surgery .
a 36-year - old woman is found to have a serum tsh level of 7 mu / l on routine screening .
her only symptoms are mild fatigue , which has been present for more than 2 years , and difficulty in losing weight .
subclinical hypothyroidism occurs in the clinical setting of a serum tsh level above the upper limit of normal despite a normal serum ft4 concentration.initiating levothyroxine ( lt4 ) replacement therapy is recommended for all patients with a tsh level greater than 10 miu / l , even if the ft4 concentration is within normal laboratory range.however , treatment of patients with serum tsh levels between 5 and 10 miu / l remains controversial .
the strongest arguments for lt4 therapy are the high risk of progression to overt hypothyroidism .
the possible improvement of quality of life , lipid abnormalities , adverse cardiac end points , cardiac dysfunction , adverse fetal effects and pregnancy outcomes , possible contribution to infertility , neuromuscular dysfunction , psychiatric dysfunction , and cognitive dysfunction .
although subtle , the clinical significance is debatable . to date , studies have not shown an association of subclinical hypothyroidism with cardiac events and cardiovascular mortality .
subclinical hypothyroidism occurs in the clinical setting of a serum tsh level above the upper limit of normal despite a normal serum ft4 concentration .
initiating levothyroxine ( lt4 ) replacement therapy is recommended for all patients with a tsh level greater than 10 miu / l , even if the ft4 concentration is within normal laboratory range .
however , treatment of patients with serum tsh levels between 5 and 10 miu / l remains controversial .
the strongest arguments for lt4 therapy are the high risk of progression to overt hypothyroidism .
the possible improvement of quality of life , lipid abnormalities , adverse cardiac end points , cardiac dysfunction , adverse fetal effects and pregnancy outcomes , possible contribution to infertility , neuromuscular dysfunction , psychiatric dysfunction , and cognitive dysfunction .
although subtle , the clinical significance is debatable . to date , studies have not shown an association of subclinical hypothyroidism with cardiac events and cardiovascular mortality .
increased risk of heart attack and atherosclerosis.increased risk of elevated cholesterol and high triglycerides.increased risk of depression , anxiety , and panic attacks.increased risk of miscarriage .
increased risk of heart attack and atherosclerosis . increased risk of elevated cholesterol and high triglycerides . increased risk of depression , anxiety , and panic attacks . increased risk of miscarriage . increased risk of developmental delays in infants born to mothers who were sub .
individuals with serum tsh levels between 5 and 10 miu / l should be treated selectively.thyroxin replacement therapy should be reserved for patients who have goiter , women who are anticipating pregnancy or are pregnant , or patients with depression or bipolar disorder .
individuals with serum tsh levels between 5 and 10 miu / l should be treated selectively .
thyroxin replacement therapy should be reserved for patients who have goiter , women who are anticipating pregnancy or are pregnant , or patients with depression or bipolar disorder .
a 36-year - old woman who was diagnosed with hypothyroidism 3 years ago tells her endocrinologist that she wants to conceive in the next year . she was treated with lt4 , 0.1 mg daily .
she is instructed to notify her endocrinologist as soon as she finds out that she is pregnant so that a serum tsh level can be checked .
her menstrual period is 1 week late , a home pregnancy test is positive , and her serum tsh level is 1.9 miu / l .
the prevalence of hypothyroidism during pregnancy is 2.5% , with the most frequent form being subclinical hypothyroidism .
the most common cause of hypothyroidism in women of reproductive age is aitd ( hashimoto 's hypothyroidism ) .
a history of total or subtotal thyriodoectomy , radioiodine ablation , or transient thyroiditis accounts for most of the remaining cases of hypothyroidism in pregnant women .
preterm delivery has been found to be three - fold more common in hypothyroid pregnant women and has also been associated with an increase in spontaneous abortions , fetal death , placental abruption , preterm delivery , and postpartum hemorrhage.another worrying danger associated with maternal hypothyroidism ( especially when present during the first trimester ) is the adverse consequence to child neuropsychointellectual development .
a seminal study by haddow et al . showed a 7-point reduction in intelligence quotient in children aged 7 to 9 years whose mothers had subclinical hypothyroidism pregnancy compared with the children of euthyroid mothers .
preterm delivery has been found to be three - fold more common in hypothyroid pregnant women and has also been associated with an increase in spontaneous abortions , fetal death , placental abruption , preterm delivery , and postpartum hemorrhage . another worrying danger associated with maternal hypothyroidism ( especially when present during the first trimester ) is the adverse consequence to child neuropsychointellectual development .
a seminal study by haddow et al . showed a 7-point reduction in intelligence quotient in children aged 7 to 9 years whose mothers had subclinical hypothyroidism pregnancy compared with the children of euthyroid mothers .
documentation of an elevated serum tsh level confirms the diagnosis of primary hypothyroidism . the presence of thyroid auto antibodies ( tabs ) is a useful confirmatory finding .
serum tsh>2.5mu / l in pregnant women should be used as a guide for thyroid dysfunction .
if the serum tsh is > 4 mu / l irrespective of the presence ( or absence ) of tabs , there is no doubt about the existence of hypothyroidism during pregnancy .
the american association of clinical endocrinologists advises that all pregnant women be screened for thyroid problems .
they recommend , specifically , the following :
anyone considering becoming pregnant should have her thyroid checked in advance.all pregnant women with a family history or symptoms of a thyroid disease should be tested .
all pregnant women with a family history or symptoms of a thyroid disease should be tested .
a disadvantage of screening during pregnancy is of course that the fetal brain is dependent on maternal t4 from conception and by the time testing is possible ( probably at the booking antenatal visit at around 14 weeks ) , damage may already have occurred .
nevertheless , maternal t4 is still an important source of thyroid hormone for the fetal brain during the rest of the pregnancy .
fertile women with normally functioning thyroid glands should have an average iodine intake of 150 mg / day . during pregnancy and breastfeeding
, women should increase their iodine intake to 250 mg daily.hypothyroid pregnant women already on lt4 replacement therapy will require a dose increase from 25% to 50% on average to maintain desirable tsh level < 2.5
most hypothyroid pregnant women need a dose increase during the first trimester . in the second trimester
, there is generally a plateau in lt4 requirements , but 25 - 40% of women may need a further dose increase during the third trimester .
the increase is at least partly dependent on the thyroid reserve of the patient but also the size of the distribution space and the number of babies .
generally , patients with ongoing hashimoto 's thyroiditis require a 25% increase in lt4 dose , whereas the increase is more likely to be 50% in women with total thyriodctomy .
adjustments of the thyroxin dose are made by increasing lt4 by 25 - 50 mg / day .
serum tsh and ft4 should always be evaluated 3 - 4 weeks after every change of dosage .
possible lt4 interactions with coexisting diseases such as gastritis , or medications such as iron supplements , calcium , vitamins , or omeprazole , may reduce lt4 absorption .
it is best to advise a 4-hour delay between the medications and lt4 and to take the lt4 on empty stomach.postpartum : after delivery , lt4 dosing generally can be returned to pre - pregnancy requirements .
fertile women with normally functioning thyroid glands should have an average iodine intake of 150 mg / day . during pregnancy and breastfeeding
hypothyroid pregnant women already on lt4 replacement therapy will require a dose increase from 25% to 50% on average to maintain desirable tsh level < 2.5
most hypothyroid pregnant women need a dose increase during the first trimester . in the second trimester
, there is generally a plateau in lt4 requirements , but 25 - 40% of women may need a further dose increase during the third trimester .
the increase is at least partly dependent on the thyroid reserve of the patient but also the size of the distribution space and the number of babies .
generally , patients with ongoing hashimoto 's thyroiditis require a 25% increase in lt4 dose , whereas the increase is more likely to be 50% in women with total thyriodctomy .
adjustments of the thyroxin dose are made by increasing lt4 by 25 - 50 mg / day .
serum tsh and ft4 should always be evaluated 3 - 4 weeks after every change of dosage .
possible lt4 interactions with coexisting diseases such as gastritis , or medications such as iron supplements , calcium , vitamins , or omeprazole , may reduce lt4 absorption .
it is best to advise a 4-hour delay between the medications and lt4 and to take the lt4 on empty stomach .
postpartum : after delivery , lt4 dosing generally can be returned to pre - pregnancy requirements .
the quantity of thyroid hormone transferred into human milk is too low to affect plasma thyroid hormone levels in neonates .
the american academy of pediatrics considers lt4 compatible with breastfeeding and has reported that no observable change is seen in nursing infants whose mothers are taking lt4 . | background : hypothyroidism is the most common endocrine disease that was seen in the clinical practice especially for family physicians.methods:this review article covered the important practical clinical issues for managing overt hypothyroidism , subclinical hypothyroidism and hypothyroidism during pregnancy.conclusions:the clinical issues were addressed by clinical scenario followed by questions and stressed on the important clinical points . |
fifty - seven consecutive patients with pathologically - proven hippocampal sclerosis who underwent anterior temporal lobectomy between october 1994 and april 1997 for the treatment of intractable medial temporal lobe epilepsy and were followed - up for over 24 months were included in this study .
thirty - eight were male and 19 were female , and their a mean age 33 ( range , 20 to 55 ) years .
surgical candidates were determined on the basis of concordance among the various noninvasive examinations including clinical evaluation , scalp eeg , mr imaging , ictal video - eeg monitoring using scalp electrodes , neuropsychologic evaluation , interictal and ictal spect , and pet and/or the intracarotid amobarbital ( amytal ) test ( wada 's test ) . in a few selected patients with either ' normal ' mr imaging findings or discordance between mr imaging and pet and/or ictal spect , invasive intracranial subdural eeg study was performed .
a pathologic diagnosis of hippocampal sclerosis was made qualitatively by an experienced neuropathologist without the aid of hippocampal neuronal counting .
standard mr images were obtained using a 1.0 t or a 1.5 t unit , with conventional spin - echo t1-weighted sagittal and t2-weighted axial and coronal imaging procedures .
in addition , 3-mm - thick t2-weighted fast spin - echo imaging and 1.5-mm - thick t1-weighted three - dimensional magnetization preparation rapid acquisition with gradient echo ( mprage ) imaging of the temporal lobes were performed in the oblique coronal plane .
the angle of oblique coronal imaging was perpendicular to the long axis of the hippocampus , resulting in slight variation of angulation from patient to patient .
spatial resolution was approximately 1.0 mm 1.0 mm ( matrix size 256 256 , fov 25 cm ) .
all preoperative mr images were reviewed retrospectively by two neuroradiologists blinded to the postsurgical outcome .
their visual interpretation focused on the presence or absence of hippocampal atrophy and increased t2 signal of the hippocampus .
hippocampal atrophy was deemed to have occurred if one side of the hippocampus was asymmetrically small .
this was best appreciated in oblique coronal images and characterized by a reduction in vertical and horizontal cross - sectional diameters . depending on whether one side of the hippocampus appeared smaller than the opposite side by 50% or more ( fig .
equivocal findings of atrophy and of high t2 signal were resolved by consensus of the two neuroradiologists . at 24 months or more follow - up , postoperative outcome was classified by an epileptologist according to engel 's four categories ( 13 ) .
class i ( seizure - free ) includes those who have been seizure - free since surgery ( or have experienced only auras , atypical generalized seizures occurring when antiepileptic medication is withdrawn ) , as well as those who enjoyed two years of seizure - free remission up to the most recent follow - up .
class ii indicates rare seizures ; that is , a few seizures in a year .
class iii denotes worthwhile improvement , meaning at least a 75% improvement in seizure frequency compared with preoperative status , while class iv indicates no worthwhile improvement .
following analysis of the mr imaging findings and postsurgical outcome , individual mr imaging findings of hippocampal atrophy and high t2 hippocampal signal were correlated with postsurgical outcome .
engel class i and ii were regarded as good outcome , and class iii and iv as poor outcome .
fifty - seven consecutive patients with pathologically - proven hippocampal sclerosis who underwent anterior temporal lobectomy between october 1994 and april 1997 for the treatment of intractable medial temporal lobe epilepsy and were followed - up for over 24 months were included in this study .
thirty - eight were male and 19 were female , and their a mean age 33 ( range , 20 to 55 ) years .
surgical candidates were determined on the basis of concordance among the various noninvasive examinations including clinical evaluation , scalp eeg , mr imaging , ictal video - eeg monitoring using scalp electrodes , neuropsychologic evaluation , interictal and ictal spect , and pet and/or the intracarotid amobarbital ( amytal ) test ( wada 's test ) . in a few selected patients with either ' normal ' mr imaging findings or discordance between mr imaging and pet and/or ictal spect , invasive intracranial subdural eeg study was performed .
a pathologic diagnosis of hippocampal sclerosis was made qualitatively by an experienced neuropathologist without the aid of hippocampal neuronal counting .
standard mr images were obtained using a 1.0 t or a 1.5 t unit , with conventional spin - echo t1-weighted sagittal and t2-weighted axial and coronal imaging procedures .
in addition , 3-mm - thick t2-weighted fast spin - echo imaging and 1.5-mm - thick t1-weighted three - dimensional magnetization preparation rapid acquisition with gradient echo ( mprage ) imaging of the temporal lobes were performed in the oblique coronal plane .
the angle of oblique coronal imaging was perpendicular to the long axis of the hippocampus , resulting in slight variation of angulation from patient to patient .
spatial resolution was approximately 1.0 mm 1.0 mm ( matrix size 256 256 , fov 25 cm ) .
all preoperative mr images were reviewed retrospectively by two neuroradiologists blinded to the postsurgical outcome .
their visual interpretation focused on the presence or absence of hippocampal atrophy and increased t2 signal of the hippocampus .
hippocampal atrophy was deemed to have occurred if one side of the hippocampus was asymmetrically small .
this was best appreciated in oblique coronal images and characterized by a reduction in vertical and horizontal cross - sectional diameters . depending on whether one side of the hippocampus appeared smaller than the opposite side by 50% or more ( fig .
equivocal findings of atrophy and of high t2 signal were resolved by consensus of the two neuroradiologists .
at 24 months or more follow - up , postoperative outcome was classified by an epileptologist according to engel 's four categories ( 13 ) .
class i ( seizure - free ) includes those who have been seizure - free since surgery ( or have experienced only auras , atypical generalized seizures occurring when antiepileptic medication is withdrawn ) , as well as those who enjoyed two years of seizure - free remission up to the most recent follow - up .
class ii indicates rare seizures ; that is , a few seizures in a year .
class iii denotes worthwhile improvement , meaning at least a 75% improvement in seizure frequency compared with preoperative status , while class iv indicates no worthwhile improvement .
following analysis of the mr imaging findings and postsurgical outcome , individual mr imaging findings of hippocampal atrophy and high t2 hippocampal signal were correlated with postsurgical outcome .
engel class i and ii were regarded as good outcome , and class iii and iv as poor outcome . fisher 's exact test provided univariate analysis .
good outcome was found in 93% of patients ( 53/57 ) ; 48 were engel class i and five were class ii .
the remaining 7% ( 4/57 ) were in the poor outcome group ; three were class iii and one was class iv .
hippocampal atrophy was seen in 96% of patients ( 55/57 ) , and was severe in 33 and mild in 22 .
a high t2 hippocampal signal was detected in 61% of patients ( 35/57 ) , all of whom had combined atrophy .
hippocampal atrophy only , without a high t2 signal , was noted in 35% ( 20/57 ) .
no patient showed a high t2 signal only , nor did mr imaging reveal any case of bilateral hippocampal sclerosis .
of 55 patients with hippocampal atrophy , 53 ( 96% ) had a good outcome , while only two ( 4% ) had a poor outcome .
hippocampal atrophy was seen in 100% ( 48/48 ) ( fig . 1 ) and 100% ( 5/5 ) of patients in engel class i and ii groups , respectively , but in only 50% ( 2/4 ) of those with a poor outcome ( engel class iii and iv ) ( fig .
the presence or absence of hippocampal atrophy showed significant correlation with surgical outcome ( p<0.01 ) . in the engel class
i group , severe atrophy was seen in 58% of cases ( 28/48 ) and mild atrophy in 42% ( 20/48 ) . in the engel class
ii group , all five patients showed severe atrophy , but this was observed in neither of the class iii patients ( fig .
all the 33 patients with severe atrophy showed a good outcome ( engel class i and ii ) ; of the 22 with mild atrophy , 20 ( 91% ) showed a good outcome and only two ( 9% ) had a poor outcome
. there was no significant difference in outcome between the severe and mild atrophy groups ( p>0.05 ) .
the relationship between mr imaging findings of hippocampal atrophy and surgical outcome is set out in table 1 .
of 35 patients with high t2 signal intensity , 33 ( 94% ) showed a good outcome and in only two ( 6% ) was the outcome poor .
a high t2 signal was seen in 58% ( 28/48 ) and 100%(5/5 ) of engel class i and ii patients , respectively , but in 50% ( 2/4 ) of the poor outcome group ( engel class iii and iv ) .
of 22 patients who showed no high t2 hippocampal signal , 20 ( 91% ) with only hippocampal atrophy had a good outcome ( engel class i ) , whereas two ( 9% ) with an apparently normal hippocampus had a poor outcome . the presence or absence of a high t2 signal did not significantly affect outcome ( p>0.05 ) .
the relationship between a high t2 hippocampal signal , as revealed by mr imaging , and surgical outcome is seen in table 2 .
of 55 patients with hippocampal atrophy , 53 ( 96% ) had a good outcome , while only two ( 4% ) had a poor outcome .
. 1 ) and 100% ( 5/5 ) of patients in engel class i and ii groups , respectively , but in only 50% ( 2/4 ) of those with a poor outcome ( engel class iii and iv ) ( fig .
the presence or absence of hippocampal atrophy showed significant correlation with surgical outcome ( p<0.01 ) . in the engel class
i group , severe atrophy was seen in 58% of cases ( 28/48 ) and mild atrophy in 42% ( 20/48 ) . in the engel class
ii group , all five patients showed severe atrophy , but this was observed in neither of the class iii patients ( fig .
all the 33 patients with severe atrophy showed a good outcome ( engel class i and ii ) ; of the 22 with mild atrophy , 20 ( 91% ) showed a good outcome and only two ( 9% ) had a poor outcome .
there was no significant difference in outcome between the severe and mild atrophy groups ( p>0.05 ) .
the relationship between mr imaging findings of hippocampal atrophy and surgical outcome is set out in table 1 .
of 35 patients with high t2 signal intensity , 33 ( 94% ) showed a good outcome and in only two ( 6% ) was the outcome poor .
a high t2 signal was seen in 58% ( 28/48 ) and 100%(5/5 ) of engel class i and ii patients , respectively , but in 50% ( 2/4 ) of the poor outcome group ( engel class iii and iv ) .
of 22 patients who showed no high t2 hippocampal signal , 20 ( 91% ) with only hippocampal atrophy had a good outcome ( engel class i ) , whereas two ( 9% ) with an apparently normal hippocampus had a poor outcome . the presence or absence of a high t2 signal did not significantly affect outcome ( p>0.05 ) .
the relationship between a high t2 hippocampal signal , as revealed by mr imaging , and surgical outcome is seen in table 2 .
in hippocampal sclerosis , atrophy of the hippocampus is the most common and consistent mr imaging finding . in such patients , significant correlation between hippocampal size , as determined by mr imaging , and
hippocampal neuronal density has been observed ( 10 , 19 , 21 ) . in surgical specimens of 11 patients with cryptogenic temporal lobe epilepsy ,
bronen et al . ( 19 ) found a statistically significant correlation between hippocampal size , as measured by mr imaging , and neuronal density in ca3 and ca4 of the cornu ammonis and the granular cell layer of the hippocampus .
our results indicated that in the preoperative evaluation of candidates for surgery among patients with hippocampal sclerosis , an mr imaging finding of hippocampal atrophy is the most useful sole prognostic indicator .
although quantitative hippocampal volumetry has been shown to predict postsurgical outcome ( 4 ) , we demonstrated that the interpretation of mr images by visual inspection alone has a similar prognostic value .
specifically , hippocampal atrophy , when apparent on visual inspection , independently predicted a good outcome .
it has been suggested that a finding of hippocampal atrophy is more useful than one of high t2 signal ( 4 ) , and this is the case in the present study .
indeed , we noted hippocampal atrophy more often than high t2 signal ( 97% vs. 61% ) , and 20 patients with hippocampal atrophy but no such signal showed a good outcome .
the severity of atrophy did not , however , show significant correlation with surgical outcome , a finding which disagreed with the conclusions of jack et al .
the reason for this disagreement is uncertain , but might be due to different evaluation methods : qualitative visual inspection in our study and quantitative volumetry in theirs .
( 4 ) reported a statistically significant correlation between computer - assisted measurement of hippocampal volume ( atrophy ) and surgical outcome ( i.e. postoperative seizure control ) in 50 patients . in their study , 34 ( 97% ) of 35 patients in whom hippocampal atrophy and eeg concordantly lateralized the focus of seizure had a satisfactory outcome , whereas in eight ( 53% ) of the remaining 15 with either no hippocampal atrophy or hippocampal atrophy discordant with eeg , the outcome was satisfactory . in their prospective study using visual interpretation , kuzniecky et al .
( 17 ) reported that as indicators of surgical success , abnormal mr images had an 82% predictive value and normal images had a 56% predictive value .
they suggested that the best predictor of favorable surgical outcome was hippocampal atrophy ( p<0.09 ) . increased hippocampal t2 signal , reflecting gliosis , is another important indicator of hippocampal sclerosis ( 7 , 9 , 22 ) .
the degree and extent of hippocampal gliosis also correlate with the t2 signal in the hippocampus ( 22 , 23 ) .
( 22 ) found a high signal in 71% of patients with severe gliosis and in 50% of those with moderate gliosis .
they stated that in most cases the severity of pathologic change corresponded to the intensity of the abnormal signals seen on t2-weighted images . in some cases , however , no agreement was found , and the location of the abnormal signal intensity did not always correlate with the distribution of observed histologic change ( 22 ) .
previous mr imaging studies have described a variable frequency of t2 signal change in the hippocampus : change was observed in 12% to 65% of patients with hippocampal sclerosis ( 6 , 8 , 19 ) . in the present study ,
the increased signal observed on t2-weighted images occurred in 61% of cases . because it detected the high signal intensity of hippocampal sclerosis more frequently than did the usual t2-weighted sequence , jack et al .
( 24 ) recommended the routine use of the fluid - attenuated inversion recovery ( flair ) pulse sequence in patients with temporal lobe epilepsy .
if the flair sequence had been used in this study , a high hippocampal signal would probably have been detected in more patients ; at the time of the study the sequence was not available however .
garcia et al . ( 18 ) reported that in a prospective study involving visual inspection , both ipsilateral hippocampal atrophy and increased ipsilateral hippocampal signal independently predicted a seizure - free outcome . in the present study , however , for reasons which are uncertain , high t2 signal intensity did not significantly correlate with surgical outcome ( p>0.05 ) . in this study ,
the causes of poor outcome seen in four patients are not known ; in two patients whose mr imaging findings appeared normal , pet , ictal eeg and the findings of invasive intracranial eeg suggested a lateralizing focus and led to surgery . in the other two patients , mr imaging findings of mild atrophy and a high t2 hippocampal signal were concordant with the findings of pet and/or ictal eeg .
the poor outcome in these cases might be because postsurgical scierotic tissue remnants were more widespred . in conclusion , of the two primary mr imaging findings of hippocampal sclerosis
, hippocampal atrophy is more common and shows closer correlation with surgical outcome than does a high t2 signal .
it therefore appears to be the more useful predictor of surgical outcome in patients with hippocampal sclerosis , though the reason for the strong correlation between hippocampal atrophy and outcome is not certain . | objectiveatrophy and a high t2 signal of the hippocampus are known to be the principal mr imaging findings of hippocampal sclerosis .
the purpose of this study was to determine whether or not individual mri findings correlate with surgical outcome in patients with this condition.materials and methodspreoperative mr imaging findings in 57 consecutive patients with pathologically - proven hippocampal sclerosis who underwent anterior temporal lobectomy and were followed - up for 24 months or more were retrospectively reviewed , and the results were compared with the postsurgical outcome ( engel classification ) .
the mr images included routine sagittal t1-weighted and axial t2-weighted spin - echo images , and oblique coronal t1-weighted 3d gradient - echo and t2-weighted 2d fast spin - echo images obtained on either a 1.5 t or 1.0 t unit .
the images were visually evaluated by two neuroradiologists blinded to the outcome ; their focus was the presence or absence of atrophy and a high t2 hippocampal signal.resultshippocampal atrophy was seen in 96% of cases ( 55/57 ) [ 100% ( 53/53 ) of the good outcome group ( engel class i and ii ) , and 50% ( 2/4 ) of the poor outcome group ( class iii and iv ) ] .
a high t2 hippocampal signal was seen in 61% of cases ( 35/57 ) [ 62% ( 33/53 ) of the good outcome group and 50% ( 2/4 ) of the poor outcome group ] .
all 35 patients with a high t2 signal had hippocampal atrophy . '
normal ' hippocampus , as revealed by mr imaging , occurred in 4% of patients ( 2/57 ) , both of whom showed a poor outcome ( engel class iii ) .
the presence or absence of hippocampal atrophy correlated well with surgical outcome ( p<0.01 ) .
high t2 signal intensity did not , however , significantly correlate with surgical outcome ( p>0.05).conclusioncompared with a high t2 hippocampal signal , hippocampal atrophy is more common and correlates better with surgical outcome . for the prediction of this , it thus appears to be the more useful indicator . |
post - operative nausea and vomiting ( ponv ) is not only discomforting , but also may result in serious aftermaths such as dehydration , electrolyte disturbances , aspiration , surgical sutures dehiscence , esophageal rupture , subcutaneous emphysema and pneumothorax that in turn would delay patient s recovery and hospital discharge ( 1 ) .
ponv is especially more prevalent after laparoscopic surgeries and 40% to 70% of the patients experience it ( 2 ) .
therefore , it is necessary to take appropriate measures to prevent and treat the complications ( 2 )
. regional anesthesia , some special anesthetic agents such as propofol , and antiemetic drugs are commonly used to prevent ponv ( 2 ) .
ondansetron is also associated with headache , diarrhea , and transient increase in hepatic transaminase level ( 3 ) . to prevent or decrease such side effects ,
ginger is a herb ( 4 , 5 ) native to southeast asia and is now cultivated in all tropical and subtropical regions ( 6 ) .
ginger is effective to treat nausea and vomiting and no significant side effects are reported on it ( 6 ) .
ginger has a swollen underground rhizome , which contains some active ingredients such as 6-shagoal and galanolacton that block serotonin receptors .
galanolacton also inserts an antiemetic effect through a competitive antagonist effect on ht5 receptors in the ileum ( 7 ) .
some studies demonstrated the positive effect of ginger products on the treatment of nausea and vomiting ( 8) .
10 ) reported that ginger capsule decreased the intensity of pregnancy - induced nausea and vomiting ( pinv ) .
a recent study also compared the effect of ginger and vitamin b6 on the treatment of pinv , and reported that ginger capsule was more effective than vitamin b6 ( 11 ) .
( 14 ) also reported that ginger was effective in prevention of nausea and vomiting after gynecological laparoscopy .
also , montazeri showed that ginger was effective in reducing nausea and vomiting after orthopedic , abdominal , urinary , reproductive , and eye , nose and throat surgeries ( 15 ) .
however , eberhart et al . ( 16 ) , and vousooghian and amini ( 17 ) reported that ginger was effective in preventing or treating ponv neither after laparoscopic nor after open gynecological surgeries
. modares et al . ( 18 ) also compared the antiemetic effects of ginger and chamomile capsules on pregnancy induced nausea and vomiting and reported that chamomile was more effective than ginger .
the only study that examined the effect of ginger essential oil on post - operative nausea reported that ginger essence was more effective in reducing nausea after gynecological and gastrointestinal surgeries than isopropyl alcohol and normal saline ( 19 ) .
given the high prevalence of ponv and the side effects of medicinal treatments , and considering the controversies on the effect of ginger on ponv , and also due to the fact that patients are usually not permitted to eat by mouth in the early post - operative hours ; the current study aimed to compare the effect of ginger essential oil on nausea and vomiting after open versus laparoscopic nephrectomies .
this randomized , placebo - controlled , clinical trial was conducted on 100 nephrectomy patients ; 50 open and 50 laparoscopic nephrectomy .
inclusion criteria were age 18 years old and above , ability to read and write in farsi language , no recognized olfactory , hearing and balance problems , and no history of asthma , allergy , respiratory diseases and motion sickness , nil per os ( npo ) for at least eight hours , being at class ii of american society of anesthesiologists , receiving no chemotherapic agent , aspirin , anticoagulants and calcium channel blockers in the last 48 hours , receiving no antiemetic drug in the last 24 hours , having no addiction to alcohol or other substances and having no sensitivity to ginger .
exclusion criteria were deciding to withdraw from the study , developing any allergic reactions or intolerance to ginger , and also developing acute hemodynamic instability during the study .
eligible subjects were recruited sequentially and then randomly assigned to two groups ; therefore half of the subjects in each type of surgery received ginger essence and the other half received placebo . to prevent the probable exposure of the subjects in the placebo group to ginger aroma
, an alternation method was used to randomly assign patients to either the ginger essence or the placebo group .
therefore , the first day of the study was randomly assigned to the ginger essence through a coin - tossing method .
then , the following days were assigned to the placebo or the ginger essence alternately .
therefore , there were four subgroups of subjects ( i.e. open surgery + ginger essence ; laparoscopy + ginger essence ; open surgery + placebo ; laparoscopy + placebo ) . when the number of required subjects in each subgroup was completed , sampling was continued till the other subgroups reached the predetermined size ( figure 1 ) .
the sample size was calculated based on a previous study ( 18 ) , in which 34% of the intervention group and 61% of the control group experienced ponv .
therefore , it was estimated that each group needed 50 subjects with a type one error of 0.05 and a power of 0.80 .
it consisted of a 10 cm column with descriptors at each end ( 10 = the most severe nausea experienced ; 0 = the absence of nausea ) .
subjects were asked to mark an x on the place that corresponded with the severity of nausea they experienced . in the case of vomiting ,
after surgery , subjects were transferred to the recovery room . in the open and laparoscopic nephrectomy subjects allocated to receive ginger essence , two drops of ginger essence ( purchased from zardband pharmaceutical co. tehran , iran )
were applied on 5 5 cm gauze and attached to the collar of the patients gown .
additional drops of ginger essence were then reapplied every 30 minutes for two subsequent hours .
the severity of nausea was assessed every 15 minutes for the first two post - operative hours and also at the end of the sixth post - operative hour .
the frequency of true vomiting was also calculated during the first two post - operation hours and also till the next four hours .
the two placebo subgroups were treated similarly except that normal saline was used instead of ginger essence .
if any of the patients had moderate to severe nausea and vomiting , it was reported to the attending physician and , if prescribed , antiemetic medication was used and the name , dose , and frequency of administration were recorded .
all subjects were anesthetized using the same anesthesia protocol ( i.e. the anesthesia was induced using fentanyl ( 1 /kg ) and midazolam ( 2 mg ) and then was continued through isoflurane 1% and thiopental sodium ( 4 mg / kg ) . the anesthesia procedure and the medication used
the study was approved by the institutional review board and research ethics committee of kashan university of medical sciences .
permissions were also obtained from the authorities in the labbafinejad hospital , tehran , iran .
all of the participants were briefed on the study aims without specifying the exact type of intervention they may receive .
they also were assured of the confidentiality of their personal information and all of them signed a written informed consent before participation .
descriptive statistics ( i.e. mean , standard deviation , frequency , and percentage ) were calculated .
chi - square and fisher s exact tests were used to compare the data in terms of nominal and categorical variables such as gender and type of nephrectomy .
independent samples t - test was used to compare the mean of physiological parameters , medications used , and vomiting episodes in the two groups .
repeated measure analysis of variance was used to evaluate the effect of the intervention on nausea in the nine subsequent measurements .
the study was approved by the institutional review board and research ethics committee of kashan university of medical sciences .
permissions were also obtained from the authorities in the labbafinejad hospital , tehran , iran .
all of the participants were briefed on the study aims without specifying the exact type of intervention they may receive .
they also were assured of the confidentiality of their personal information and all of them signed a written informed consent before participation .
descriptive statistics ( i.e. mean , standard deviation , frequency , and percentage ) were calculated .
chi - square and fisher s exact tests were used to compare the data in terms of nominal and categorical variables such as gender and type of nephrectomy .
independent samples t - test was used to compare the mean of physiological parameters , medications used , and vomiting episodes in the two groups .
repeated measure analysis of variance was used to evaluate the effect of the intervention on nausea in the nine subsequent measurements .
totally , 100 subjects including 65 males and 35 females participated in the study . fifty percent of subjects who underwent each type of surgery received ginger essence while the others received normal saline .
no significant differences were observed between the patients demographics neither in terms of the type of surgery nor in terms of the type of intervention ( i.e. receiving ginger essence or normal saline ) ( table 1 ) .
moreover , no significant differences were observed between the patients physiological and pharmacological parameters neither in terms of the type of surgery nor in terms of the type of intervention except that the amount of ondansetron received , which was significantly higher in the patients who received placebo in both types of the surgeries ( table 2 ) .
the repeated measure analysis of variance showed that the type of surgery and the type of intervention as factors had significant effects on the nausea severity scores in the nine successive measurements ( p < 0.001 ) ( figure 2 ) . in the first two post - operative hours
, the mean vomiting episodes was 2.92 0.70 in the subjects who underwent open surgery and received placebo ; while it was 0.16 0.37 in the subjects with the same surgery type but receiving ginger essence ( p = 0.001 ) . at the same time , the mean vomiting episodes was 6.0 1.33 in the subjects who underwent laparoscopic surgery and received placebo while it was 1.39 0.78 in the subjects with the same surgery but received ginger essence ( p = 0.001 ) .
although the mean vomiting episodes significantly decreased in all the groups in the next four post - operative hours , the mean decreases were significantly evident in the subjects who received ginger essence ( p < 0.001 ) ( table 3 ) .
the current study compared the effects of inhaling the ginger essence on ponv after laparoscopic and open nephrectomy surgeries .
results of the present study showed that in comparison with the placebo , ginger essence could effectively reduce the mean nausea severity in patients who underwent either open or laparoscopic nephrectomy .
moreover , the mean post - operative vomiting episodes were significantly lower in the subjects who received ginger essence than in the ones who received normal saline as placebo .
the beneficial effect of ginger essence on ponv was also visible in the amount of antiemetic medication used for the participants ; so that , the mean dose of ondansetron used was significantly lower in the subjects who received ginger essence than ones who did not .
in addition , the beneficial effect of ginger was considerably visible in the subjects with open nephrectomy .
thus , the severity of vomiting was more in the subjects who underwent laparoscopic nephrectomy with placebo than in the other groups .
then , the dose of antiemetic medication used in this group ( i.e. laparoscopic nephrectomy with placebo ) was considerably more than the other groups . results of the present study were consistent with some of the previous studies .
( 17 ) investigated the effect of ginger on nausea and vomiting after gynecological surgeries and confirmed that ginger was significantly effective on reducing post - operative nausea though it could not significantly affect post - surgical vomiting ( 17 ) .
( 20 ) also compared the antiemetic effects of ginger and metoclopramide in females who underwent day case surgeries .
moreover , the amount of antiemetic medication used was significantly lower in the group who received ginger .
a recent meta - analysis also confirmed the beneficial effects of ginger on prevention of ponv either in open or laparoscopic surgeries ( 21 ) .
( 15 ) reported that though ginger could reduce the nausea in the first two post - operative hours , this effect significantly diminished afterwards .
moreover , ginger showed no effect on post - operative vomiting in comparison with the control group . similarly , apariman et al .
( 14 ) reported that ginger exerts its antiemetic effects mostly in the first two hours after surgery and its effects on ponv would reduce afterwards .
this phenomenon was attributed to the fact that patients are usually transported out of the recovery room approximately after two hours .
( 22 ) conducted two reviews on the effect of ginger on prevention and treatment of ponv and concluded that ginger has no positive effect on prevention or treatment of ponv .
( 16 ) also reported the same finding after reviewing the studies that have been used ginger to prevent ponv in laparoscopic gynecological surgeries .
however , they attributed this finding to the low dose of the ginger used in the reviewed studies ( 16 ) . on the other hand , arfeen et al .
( 24 ) reported that increasing the dose of ginger resulted in a slight increase in the severity of nausea after laparoscopic surgeries .
the inconsistencies in the studies may not only be attributed to the amount and the frequency of the ginger used , but also to the type of the surgeries that ginger was administered in .
as was the case in the present study , ginger may be more effective if can be used through inhalation ( i.e. the ginger essence ) .
in addition , it seems that it would be more effective if used as small frequent doses and this type of application was simply possible when its essence was used .
perhaps , the frequent use of the ginger essence in the present study helped the dosage of the remedy reach its therapeutic effect . on the other hand ,
as it was evident in the present study , ginger essence was more effective in the subjects who underwent open surgeries than the ones who tolerated a laparoscopic surgery . perhaps the co2 used in laparoscopic surgeries and the upward displacement of diaphragm in such operations would delay the elimination of the anesthetics through respiration , then ponv decreased more slightly in such subjects . in conclusion , the present study showed that using ginger essence was effective in reducing nausea and vomiting not only in patient who underwent open nephrectomy , but also in the ones who underwent laparoscopic nephrectomy .
however , it seems that the therapeutic effects of ginger start with a delay of about 30 minutes .
due to the effectiveness of the intervention in the current study , using ginger essence is suggested as a complementary remedy to prevent and treat ponv in patients with nephrectomy .
however , the current study was conducted on a small sample size and therefore further studies with larger sample sizes are suggested .
it is also recommend replicating the same study in patients with cluster and diaphragmatic breathing patterns .
moreover , since ginger essence is an aromatic material , blinding the patients and the evaluators was not possible in the current study and it was a limitation that should be reminded . | background : some studies reported that ginger was effective in prevention or treatment of post - surgical nausea and vomiting ; however , there are controversies . in addition , no study compared the effects of ginger on nausea and vomiting after open and laparoscopic nephrectomies.objectives:the current study aimed to compare the effect of ginger essence on nausea and vomiting after open versus laparoscopic nephrectomies.patients and methods : a randomized , placebo trial was conducted on two groups of patients , 50 open and 50 laparoscopic nephrectomy .
half of the subjects in each group received ginger essence and the other half received placebo . using a visual analogue scale
the severity of nausea was assessed every 15 minutes for the first two post - operative hours and the sixth hour .
frequency of vomiting was counted until the sixth hour .
the placebo subgroups were treated similarly .
descriptive statistics were employed .
chi - square and fisher s exact tests , paired and independent samples t - test and repeated measure analysis of variance were used to analyze the data.results:repeated measure analysis of variance showed that the type of surgery and the type of intervention as factors had significant effects on the nausea severity scores in the nine successive measurements ( p < 0.001 ) .
in the first two post - operative hours , the mean vomiting episodes was 2.92 0.70 in the subjects who underwent open surgery and received placebo while it was 0.16 0.37 in patients with the same surgery but receiving ginger essence ( p = 0.001 ) .
the mean vomiting episodes was 6.0 1.33 in the subjects who underwent laparoscopic surgery and received placebo while it was 1.39 0.78 in patients with the same surgery but receiving ginger essence ( p = 0.001).conclusions : using ginger essence was effective in reducing nausea and vomiting not only in the subjects who underwent open nephrectomy but also in the subjects of laparoscopic nephrectomy . using ginger essence is suggested as a complementary remedy to prevent and treat post - operative nausea and vomiting in patients with nephrectomy . |
entamoeba histolytica , the causative agent of human amoebiasis provokes the second worldwide highest rates of morbidity and mortality due to protozoa .
e. histolytica trophozoites obtain host nutrients from a very active uptake and efficient engulfment of bacteria , red blood cells ( rbc ) , and cell debris , which makes them to be considered as professional phagocytes .
since e. histolytica phagocytosis - deficient mutants have a diminished virulence in vitro and in vivo [ 3 , 4 ] , and nonvirulent e. histolytica strains exhibit reduced rates of phagocytosis , this cellular event has been defined as a key virulence factor .
ehcpadh , an e. histolytica protein complex formed by the ehadh112 adhesin and the ehcp112 cysteine protease , has been widely involved in adherence to , phagocytosis , and destruction of target cells .
bioinformatics analysis revealed that ehadh112 is structurally related to mammalian alix , an evolutionarily conserved , ubiquitously expressed and multifunction scaffold protein , originally identified by its association with proapoptotic signaling partners [ 8 , 9 ] .
additional evidence has established that alix modulates other cellular mechanisms , including receptor downregulation [ 10 , 11 ] , endosomal protein sorting [ 1214 ] , integrin - mediated cell adhesion and extracellular matrix assembly , actin - based cytoskeleton remodeling [ 16 , 17 ] , and membrane invagination and abscission in cytokinesis and retroviral budding .
alix is an abundant cytoplasmic protein with a multimodular architecture containing an n - terminal
banana-shaped bro1 domain , a middle v-shaped domain and a c - terminal proline - rich region .
this tripartite domain organization occurs in the majority of alix orthologues and provides them multiple protein - binding sites for specific roles in several cellular processes , and the possibility of linking proteins into distinct networks , thus acting as scaffold proteins .
much of what is known about alix has stemmed from the characterization of its closest orthologue , yeast bro1 , a crucial component of the endosomal sorting complexes required for transport ( escrt ) pathway [ 23 , 24 ] .
the escrt machinery comprises a set of protein complexes ( escrt-0,-i , -ii , -iii , and -associated proteins ) most of them constituted by the so - called vacuolar protein sorting ( vps ) factors .
the assembly of the escrt apparatus at the endosomal surface is required to selectively transport ubiquitinated receptors and other cargo proteins into late endosomes known as multivesicular bodies ( mvb ) , towards final degradation into the vacuole or lysosome [ 25 , 26 ] . in this process , human alix or yeast bro1 promotes endosomal membrane scission for intraluminal vesicles formation of mvb , drived by the direct association of their n - terminal bro1 domains to the human chmp4 or yeast vps32 ( also named snf7 ) escrt - iii subunits , respectively [ 19 , 20 ] . despite significant advances in the understanding of ehadh112 functions related to parasite virulence ,
its structural relationship with alix and bro1 proteins and recent evidence regarding the existence of most escrt components and mvb - like organelles in e. histolytica , the potential role of ehadh112 in escrt - dependent protein sorting and trafficking along the mvb pathway had not yet been explored .
the bro1 domain occurs in a wide group of eukaryotic proteins that serve as scaffold for linking different cellular networks , including mvb formation dependent on escrt .
in fact , a well - known hallmark for bro1 domain functionality is its ability to bind to escrt - iii subunits . here
, we initiated the characterization of the n - terminal residues comprising the small ehadh112 bro1 domain originally defined by the pfam protein domain database , but later extended by crystallographic experiments .
the tertiary structure modeling of ehadh112 , presented in this study , predicted the spatial conformation needed for putative interaction with escrt - iii subunits via the bro1 domain . to explore
if ehadh112 could be involved in mvb formation during phagocytosis , we generated a trophozoite population ( aneobro1 ) overexpressing the first 166 amino acids of the ehadh112 bro1 domain .
aneobro1 trophozoites dramatically diminished their rates of phagocytosis , possibly due to an impairment of ehadh112 functions , seemingly produced by exogenous bro1 accumulation in cytoplasmic vesicles and aberrant complexes , and its absence in plasma membrane and phagosomes , where ehadh112 exerts its role for target cell adherence and phagocytosis .
electron immunolocation of ehadh112 in structures resembling mvb , together with its finding in both soluble and insoluble subcellular fractions , suggested its participation in mvb formation .
moreover , ehadh112 in vitro binding to a protein homologous to vps32 ( ehvps32 ) , strengthened our hypothesis regarding the ehadh112 contribution to escrt - mediated protein sorting along the mvb pathway by virtue of its bro1 domain .
altogether , our results define ehadh112 as a novel member of bro1 domain - containing proteins present at cellular surface and endosomal compartments with a potential role in the mvb pathway .
the ehadh112 primary sequence was submitted to the phyre server ( http://www.sbg.bio.ic.ac.uk/~phyre/ ) and validated by the swiss model database .
3d modeling was performed with human alix ( 2oev ) and yeast bro1 ( 1z1b ) crystallized sequences as templates .
trophozoites of clone a ( strain hm1 : imss ) were axenically cultured in tyi - s-33 medium at 37c .
medium for transfected trophozoites ( aneo , aneoadh112 and aneobro1 populations ) was supplemented with 40 g / ml geneticin ( g418 ) ( life technologies , gaithesburg , md ) .
trophozoites were harvested in logarithmic growth phase for all experiments and cell viability was monitored by microscopy using trypan blue dye exclusion tests .
a 498 bp fragment from the 5 end of the ehadh112 gene , corresponding to the first 166 amino acids of the ehadh112-bro1 domain was pcr - amplified , using the sense ( 124 ehadh112 nt ) 5-ggggtaccatgaatagacaattcattcctgaa-3 and the antisense ( 477497 ehadh112 nt ) 5- cgggatccttacttatcgtcgtcatccttgtaatcactacctgctgcacatagttgg-3 oligonucleotides , 10 mm dntps , 100 ng of e. histolytica genomic dna as template and 2.5 u of taq dna polymerase ( gibco ) .
pcr was carried out for 30 cycles comprising 1 min at 94c , 30 sec at 59c , and 40 sec at 72c .
the sense oligonucleotide contained a kpni restriction site , whereas the antisense oligonucleotide contained the flag ( dykddddk ) tag - encoding sequence ( underlined ) and a bamh1 restriction site .
oligonucleotides used in this work specifically recognize sequences present in the ehadh112 gene but not those present in the previously reported ehadh112-like genes . the pcr - amplified product ( bro1flag )
was cloned into the bamh1 and kpni sites of the pexehneo ( pneo ) plasmid , which contains e. histolytica - specific transcription signals and the g418 resistance ( neo ) conferring gene as selectable marker , producing the pneobro1flag construct .
both plasmids were purified using the qiagen maxi kit ( chatsworth , ca ) and automatically sequenced .
plasmids ( 200 g ) were transfected by electroporation as previously described into exponentially growing trophozoites of clone a , generating the aneo and aneobro1 trophozoite populations .
cdnas were synthesized using 1 g of dnase - treated total rna , 10 mm dntps , 200 u amv reverse transcriptase ( gibco ) and 0.5 g of oligo dt ( gibco ) in a final volume of 10 l , for 1 h at 42c .
pcr amplifications were carried out using 4 l ( ~330 ng ) of cdna , 1 u of taq polymerase , 2 mm dntps , and 100 ng of the sense ( 124 nt ) and the antisense ( 477497 nt ) oligonucleotides from the ehadh112 gene .
additionally , the sense ( 117 nt ) 5-atgattgaacaagatgg-3 and the antisense ( 780794 nt ) 5-ttagaagaactcgtc-3 primers were used to amplify a 794 bp fragment of the neo gene .
amplified products were separated by 1% agarose gel electrophoresis , ethidium bromide - stained and visualized in a gel doc 1000 apparatus ( biorad ) .
trophozoites grown on coverslips were fixed with 4% paraformaldehyde ( pfa ) ( sigma ) at 37c for 1 h , permeabilized with 0.5% triton x-100 in pbs ( pbs - triton ) for 30 min and incubated with 1% bovine serum albumin ( bsa ) for 40 min at 37c .
trophozoites were incubated with mouse monoclonal antibodies against ehadh112 ( mehadh112 ) ( 1 : 10 ) or rabbit polyclonal anti - flag ( pflag ) ( usbiological ) antibodies ( 1 : 500 ) , overnight ( on ) at 4c , followed by incubation with fluorescein - isothiocyanate ( fitc)-labeled anti - mouse or anti - rabbit secondary antibodies ( 1 : 100 ) ( zymed ) , respectively , for 1 h at 37c . for colocalization experiments
, pfa - fixed trophozoites were incubated on at 4c with mehadh112 and pflag antibodies , followed ( 1 h at 37c ) by fitc - labeled anti - mouse igm and tetramethyl - rhodamine - isothiocyanate-(tritc)-labeled anti - rabbit igg secondary antibodies . for some experiments
, trophozoites were first incubated with fresh rbc ( 1 : 40 ) for different times at 37c , fixed with pfa , contrasted with 3 mm diaminobenzidine ( dab ) and treated for immunofluorescence assays as above .
all preparations were preserved using the antifade reagent vectashield ( vector ) and examined through a nikon inverted microscope attached to a laser confocal scanning system ( leica ) .
trophozoites were incubated for 5 , 10 , and 15 min with freshly obtained human rbc ( 10 cells / ml ) ( 1 : 100 ratio ) at 4c for adherence , or at 37c for phagocytosis experiments .
rbc were contrasted with dab and counted at random from three independent experiments to determine the number of rbc adhered to or ingested by 100 trophozoites .
fast - freeze fixation followed by cryosubstitution was used for ultrastructural location of ehadh112 and the flag - tagged bro1 recombinant polypeptide .
transfected trophozoites were pelleted and placed into the hole of a 7 mm diameter antiadhesive plastic ring positioned on a foam rubber support and frozen on a copper mirror precooled to liquid nitrogen temperature using a reichert kf 80 unit .
freeze substitution was achieved with a reichert cs autosystem in acetone containing 4% osmium tetroxide for 48 h at 80c .
afterwards , samples were brought to room temperature at a rate of 4c / h and embedded in epoxy resins .
for immunogold labeling , thin sections were placed on formvar - coated nickel grids and incubated for 15 min in 0.1 m ammonium chloride .
then , sections were washed twice with pbs ( 5 min each ) , blocked with 1% bsa for 15 min , and incubated with polyclonal rabbit anti - ehadh112 ( pehadh112 ) or monoclonal mouse anti - flag ( mflag ) ( sigma ) antibodies at 1 : 50 or 1 : 20 dilutions , respectively , for 60 min .
then , sections were washed and incubated for 1 h with goat anti - rabbit or anti - mouse igg ( 1 : 20 ) antibodies conjugated to 15 nm colloidal gold ( bbi international , cardiff , uk ) .
finally , sections were washed and treated as above to be observed through a zeiss em 910 electron microscope . for phagocytosis experiments , trophozoites were first incubated with fresh rbc ( 1 : 40 ratio ) at 37c for 15 min and treated for tem as described .
briefly , trophozoites from wild - type clone a ( 40 10 ) were harvested , washed twice with 19 mm potassium phosphate buffer , ph 7.2 , and 0.27 m nacl ( pd solution ) and pooled .
cell pellet was resuspended to 2 10 cells / ml pd solution containing 10 mm mgcl2 and rapidly mixed with an equal volume of 1 mg / ml concanavalin a in the same buffer . after 5 min
, cells were spun at 50 g for 1 min to remove the excess of concanavalin a. the supernatant was discarded and cell pellet was resuspended in 12 ml of 10 mm tris - hcl buffer , ph 7.5 , containing 2 mm phenylmethylsulfonyl fluoride ( pmsf ) and 1 mm mgcl2 .
after 10 min swelling in hypotonic buffer , cells were homogenized by 1820 strokes of a glass dounce homogenizer with a tight - fitting pestle ( wheaton scientific div . ) .
the homogenate was layered over a two - step gradient consisting of 8 ml of 0.5 m mannitol over 4 ml of 0.58 m sucrose , both in tris buffer , and spun at 250 g for 30 min .
material remaining at the top of the 0.5 m mannitol ( sn1 ) was centrifuged at 40 000 g for 1 h to separate soluble molecules ( sn2 ) from small membrane fragments and vesicles ( p2 ) .
large plasma membrane fragments and other heavy debris formed a tight pellet at the bottom of the gradient ( p1 ) .
this pellet was resuspended in 1 ml tris buffer containing 1 m -methyl mannoside and left on ice for 40 min with occasional mixing .
plasma membranes free of concanavalin a were diluted into three volumes of tris buffer , homogenized by 80 strokes with a glass dounce homogenizer , layered on a 20% sucrose tris gradient and spun for 30 min at 250 g . vesiculated plasma membranes floating above the initial sucrose layer ( sn3 ) were collected and then concentrated by centrifugation at 40 000 g for 1 h. the pellet ( p4 ) , enriched in plasma membranes , was resuspended in tris buffer .
samples ( 50 g ) were analyzed by sds - page ( 10% ) and transferred onto nitrocellulose membranes for western blot assays using rabbit polyclonal antibodies against the last c - terminal 243 amino acids of ehadh112 ( pehadh243 ) and peroxidase - labeled anti - rabbit igg secondary antibodies , at 1 : 300 and 1 : 10 000 dilutions , respectively . as a control , mouse monoclonal anti - e .
histolytica actin and peroxidase - labeled anti - igg corresponding secondary antibodies were used at 1 : 1 500 and 1 : 10 000 , respectively . a plasmid encoding glutathione s - transferase ( gst)-ehvps32 was constructed by inserting a pcr fragment containing the ehvps32 coding sequence into the bamh1 site of pgex-5x-1 ( pharmacia ) .
plasmids used for in vitro synthesis of ehadh112 and ehadh112-truncated derivatives were constructed by inserting pcr - amplified or restriction fragments containing the corresponding ehadh112 coding sequences in the polylinker of pgbkt7 ( clontech ) .
cultures ( 50 ml ) were induced at 30c after addition of 0.1 mm isopropyl--d-1-thiogalactopyranoside ( iptg ) and incubated for additional 2.5 h before proceeding with the gst fusion protein purification .
[ s]-ehadh112 and [ s]-ehadh112 truncated derivatives were synthesized in vitro using the promega tnt coupled transcription - translation system in the presence of [ s ] methionine ( 1 000 ci / mmol ) .
labeling reaction ( 2 l ) was added to glutathione beads loaded with gst - ehvps32 or gst proteins and incubated at 4c for 1 h in 500 ml of a 10 mm tris hcl , ph 8.0 , 1 mm edta and 150 mm nacl solution ( ste ) with 1% ( v / v ) triton x-100 .
triton x-100 , beads were boiled in sample buffer and proteins were separated by 10% polyacrylamide sds - page .
bro1 domain - containing proteins are highly conserved among eukaryotes and exhibit distinct functions in several cellular processes ( figure 1(a ) ) , depending on the partners they interact with .
ehadh112 displays 40% homology and 20% identity to human alix and its primary sequence aligns with the portion of alix corresponding to the n - terminal bro1 and the middle v domains .
more divergent relatives of alix only contain the bro1 domain but otherwise , bear little resemblance to the remaining structure [ 36 , 37 ] .
although ehadh112 lacks the proline - rich c - terminal tract that harbors the majority of protein - binding sites linking alix to various functions [ 7 , 22 ] , instead , this protein has a target cell adherence domain , which binds to a 97 kda protein in epithelial cells .
besides ehadh112 , the e. histolytica genome predicts two ehadh112-related genes encoding the ehadh112-like1 ( 898 amino acids ) and ehadh112-like2 ( 919 amino acids ) proteins , both displaying a putative bro1 domain at their n - terminus ( figure 1(a ) ) .
our current predictions for ehadh112 tertiary structure resulted in protein overlapping to alix ( figure 1(b ) ) .
banana-shaped spatial conformation for the n - terminal ehadh112 bro1 domain , mostly made of -helices forming a solenoid , with helices 6 through 11 arranged in a tetratricopeptide repeat - like structure , and a central core arranged in two extended three - helix bundles forming elongated arms that fold back into a v ( figure 1(b ) ) .
domain may act as a hinge , changing in response to ligand binding , as described for escrt and viral proteins interaction with alix .
apparently , ehadh112 conserves the two hydrophobic patches required for alix or bro1 endosomal membrane targeting and association , via direct binding to escrt - iii chmp4 or vps32 subunits , respectively ( figures 1(b ) and 1(c ) ) , or src - tyrosine kinase docking .
since the conserved interaction of alix or bro1 with escrt - iii is necessary for membrane inward budding and mvb biogenesis during protein sorting and trafficking , it is possible that ehadh112 could associate to putative e. histolytica escrt - iii components via its bro1 domain . to initiate the characterization of the ehadh112 bro1 domain , trophozoites of clone a ( hm1:imss )
were transfected with the pneobro1flag plasmid ( figure 1(d ) ) driving the expression of the recombinant bro1 polypeptide and generating the aneobro1 population .
the presence and expression of plasmids in trophozoites was confirmed by rt - pcr amplification of the neo gene .
neo was amplified from aneo ( transfected with empty pneo ) and aneobro1 trophozoites ( figure 1(e ) , lane 3 ) , whereas a transcript corresponding to the bro1flag fragment , was only detected in the aneobro1 population ( figure 1(e ) , lane 4 ) , as expected .
no amplification was detected in the absence of reverse - transcriptase in reaction mixtures or using total rna from wild type clone a trophozoites ( figure 1(e ) , lanes 1 and 2 ) .
as part of the ehcpadh complex , an e. histolytica surface heterodimer involved in target cell adherence , phagocytosis , and destruction , ehadh112 is located at trophozoite plasma membrane and cytoplasmic vacuoles . to determine the location of the bro1 polypeptide overexpressed by aneobro1 trophozoites and to distinguish it from the bro1 domain present in endogenous ehadh112 , immunofluorescence experiments were carried out using polyclonal antibodies against the flag tag ( pflag ) and monoclonal antibodies ( mehadh112 ) against the ehadh112 carboxy terminus adherence epitope ( 444601 amino acids ) .
aneo trophozoites , as well as a trophozoite population named aneoadh112 that overexpresses the ehadh112 full length protein fused to a flag tag ( ehadh112-flag ) , were used here as additional controls . by confocal microscopy
, mehadh112 antibodies revealed the presence of ehadh112 at the plasma membrane of permeabilized aneo , aneobro1 , and aneoadh112 trophozoites ( figure 2(a ) ) , although fluorescence was higher in aneoadh112 population , since these trophozoites express both , endogenous ehadh112 and exogenous ehadh112-flag . as expected , pflag antibodies gave no reaction with aneo trophozoites ( figure 2(b ) ) , but traced flag - tagged bro1 as punctuated structures and patches of different sizes in the cytoplasm of aneobro1 trophozoites .
interestingly , no signals were detected at plasma membrane ( figure 2(b ) ) , suggesting that the ehadh112 carboxy end , absent in the exogenous bro1 recombinant polypeptide , could be participating in ehadh112 targeting to the trophozoite surface . since ehadh112-flag appeared at the plasma membrane ( figure 2(b ) ) and
some cytoplasmic vacuoles ( figure 2(b ) , arrowheads ) of aneoadh112 trophozoites , in a similar pattern to the one exhibited by endogenous ehadh112 in all parasite populations analyzed ( figure 2(a ) ) , we rule out that the flag tag could be causing the defective targeting of recombinant bro1 to the membrane .
negative results were likewise obtained with nontransfected or transfected trophozoites treated only with secondary antibodies . here , we show results obtained by assaying aneo trophozoites ( figures 2(a ) and 2(b ) ) . from these experiments , we can conclude that the bro1 recombinant polypeptide expressed by aneobro1 trophozoites is located at a different site than ehadh112 , and that transfection procedures or expression of flag - tagged proteins did not affect the location of endogenous ehadh112 in trophozoites .
ehadh112 has been previously characterized by the properties conferred by its c - terminus for target cell primary contact , internalization , and phagocytosis [ 6 , 38 ] .
to further understand the bro1 domain contributions to ehadh112 functions in trophozoites , we carried out rbc adherence and erythrophagocytosis assays .
adherence efficiency and erythrophagocytosis rates exhibited by aneo trophozoites at 15 min were taken as 100% in all experiments . again , as an additional control we used aneoadh112 trophozoites .
after 15 min of rbc incubation at 4c , aneo and aneobro1 trophozoites adhered a mean of 5.7 3 and 6.6 2 rbc per trophozoite , respectively ( figures 3(a ) and 3(b ) ) , meanwhile at 10 and 5 min they adhered 4.78 1 and 4.56 2 , and 2.73 2 and 2.8 2 rbc per trophozoite , respectively .
in contrast , aneoadh112 showed an increased avidity to attach rbc , by adhering above twice more rbc than aneo and aneobro1 at 15 , 10 , and 5 min ( 12.5 2 , 8.7 2 and 7 2 rbc per trophozoite , respectively ) ( figures 3(a ) and 3(b ) ) .
these results indicate that exogenous expression of the bro1 recombinant polypeptide did not affect the adherence function of trophozoites and suggest that the ehadh112 n - terminus may not be promoting target cell binding .
aneo trophozoites ingested 14.3 2 rbc per parasite at 15 min , 11.6 2 rbc at 10 min and 9.4 2 rbc at 5 min ( figure 3(c ) ) , whereas aneobro1 trophozoites only ingested 7.1 2 , 5 2 and 2.8 2 rbc per trophozoite at 15 , 10 and 5 min , respectively ( figures 3(c ) and 3(d ) ) .
as previously reported , aneoadh112 trophozoites exhibited augmented phagocytosis rates , by ingesting 76% more rbc than aneo trophozoites at 15 min of erythrophagocytosis ( figures 3(c ) and 3(d ) ) , and 40% and 10% more , at 10 and 5 min , respectively ( figure 3(c ) ) .
these latter experiments indicate that overexpression of bro1 results in a dominant negative effect on phagocytosis .
we hypothesized that this phenomenon may be due to recruitment and association of proteins probably involved in target cell internalization and phagocytosis by the truncated ehadh112 protein instead of the endogenous one , thus producing a competition for protein binding sites and reducing trophozoites rates of ingestion , despite efficient primary cell contact .
otherwise , the bro1 recombinant polypeptide per se , could be producing a conformational change in ehadh112 or preventing ehadh112 accessibility for the interaction with its counterparts , therefore causing a functional impairment .
transfection procedures did not modify ehadh112 location and function , since aneo trophozoites displayed similar results to the ones presented by nontransfected clone a trophozoites ( data not shown ) .
previous work using tem and immunofluorescence experiments determined that the ehadh112 c - terminus mediates target cell adherence but also contributes to phagocytosis activity of e. histolytica trophozoites [ 6 , 38 ] .
the diminished phagocytosis rates exhibited by aneobro1 trophozoites led us to precise the location of ehadh112 and the overexpressed bro1 polypeptide after 5 min of erythrophagocytosis . through confocal microscopy , and in agreement to preceding findings
, ehadh112 was detected at plasma membrane , target cell contact sites , membrane extensions , and phagosomes of nontransfected clone a trophozoites ( data not shown ) .
a similar location was determined for ehadh112 in aneo trophozoites ( data not shown ) , which adhere to and phagocyte rbc in the same way than wild - type trophozoites do .
regarding aneobro1 trophozoites ( figure 4(a ) ) , we observed ehadh112 at the trophozoite plasma membrane , cytoplasmic vacuoles and phagosomes ( figure 4(a ) , top ) .
besides , small phagosome - neighbouring vesicles that may correspond to endosomes or lysosomes were detected ( figure 4(a ) , asterisks ) .
otherwise , the bro1 recombinant polypeptide was found in cytoplasmic punctuated and vesicular structures and , significantly , it was accumulated in vacuolar compartments ( figure 4(a ) , arrows ) that did not overlap to rbc location ( figure 4(a ) ) .
images also evidenced that exogenous bro1 did not reach trophozoites plasma membrane at early stages of phagocytosis and was absent in rbc - containing phagosomes .
the different location of ehadh112 and recombinant bro1 in trophozoites under basal culture conditions , even during phagocytosis , together with the impairment of aneobro1 erythrophagocytosis rates and the presence of aggregates containing exogenous bro1 , suggest that this polypeptide could be interfering with the function of trophozoite proteins present at the plasma membrane , probably participating in membrane remodeling and rbc internalization into phagosomes .
control experiments , omitting primary antibodies gave no signals in trophozoites ( figure 4(a ) , bottom ) .
it has been previously shown that endogenous ehadh112 protein changes its location within trophozoites during rbc phagocytosis .
after target cell contact , this adhesin is translocated from the trophozoite plasma membrane to the phagocytic vacuoles . as the ingestion process advances
, ehadh112 is found in rbc and after 30 min , it comes back to the plasma membrane . to elucidate whether exogenous bro1 localizes at some point to the plasma membrane or to phagosomes and to better understand its fate along the erythrophagocytosis process
, we followed this recombinant polypeptide in aneobro1 trophozoites at different times of rbc ingestion . immediately after rbc interaction ( 0 min ) ,
exogenous bro1 appeared in randomly distributed cytoplasmic vesicles and patches of distinct sizes and morphologies ( figure 4(b ) ) .
as rbc ingestion progressed ( 5 min ) , the exogenous bro1 recombinant polypeptide accumulated in a ring - like structure surrounding rbc - containing compartments probably corresponding to phagosomes or phagolysosomes ( figure 4(b ) ) .
this bro1-enriched large structure achieved a closer proximity to rbc at 10 min of phagocytosis , although no rbc overlapping was observed ( figure 4(b ) ) . at late phagocytosis stages ( 15 and 20 min ) , the bro1 recombinant polypeptide appeared in huge tubular structures ( figure 4(b ) ) .
in yeast , deletion or inactivation of several vps factors , which assemble into the escrt machinery during protein sorting and trafficking through endosomal compartments , induces the formation of enlarged vacuolated and tubulated organelles that fail to mature into mvb [ 40 , 41 ] .
hence , the large vacuoles observed in aneobro1 trophozoites may correspond to aberrant endosomal compartments where the exogenous bro1 polypeptide is stuck , affecting the dynamics of rbc internalization from the membrane to the phagosomes .
work in progress in our laboratory , using specific biochemical markers , will allow us to determine the identity of these structures .
since immunoelectron microscopy is a key technique to place macromolecular functions within a cellular context , we addressed the ultrastructural location of exogenous bro1 in aneobro1 trophozoites under basal culture conditions and at 15 min of erythrophagocytosis .
for these experiments we used mouse monoclonal antibodies against the flag tag ( mflag ) , which resulted to be more sensitive for specific recognition of the flag - tagged bro1 recombinant polypeptide than the pflag ones . in agreement with the immunofluorescence results showed here ( figures 2 , 4(a ) and 4(b ) )
, mflag antibodies did not reveal any signal at the plasma membrane of aneobro1 trophozoites in culture ( data not shown ) , and neither at 15 min of rbc ingestion ( figure 4(c ) , left panel ) .
numerous gold particles associated to fibrillar material were observed within huge vesicles ( figure 4(c ) , middle panel ) that might correspond to the large vacuoles detected in figures 4(a ) and 4(b ) .
moreover , mflag antibodies recognized some vesicles close to rbc ( figure 4(c ) , right panel ) , confirming that recombinant bro1 remains in vacuolar compartments of different sizes , but not in rbc or phagosomes ( figure 4(c ) , right panel ) . taken together , our immunolocation results revealed that under culture conditions , exogenous bro1 is profusely distributed in different - sized cytoplasmic vesicles of aneobro1 trophozoites .
similarly , at initial steps of target cell contact , the bro1 recombinant polypeptide remains in the cytoplasm of aneobro1 trophozoites , which preserve their ability to attach to target cells , but significantly decreased their phagocytosis rates .
location of exogenous bro1 in small structures that gradually come together to transform into exaggerated vacuolar compartments at late stages of phagocytosis suggests that at these sites , recombinant bro1 could also be retaining proteins involved in rbc internalization , targeting , and phagocytosis , some of them even affecting the function of ehadh112 , or that this huge protein complexes may block the recycling of proteins back to the trophozoite membrane , where tentatively they would contribute to the membrane remodeling and protein assembly processes required for phagosome formation .
according to our immunofluorescence assays , the location of endogenous ehadh112 at the plasma membrane of aneobro1 trophozoites was not affected by the overexpression of recombinant bro1 under basal conditions .
in fact , this resulted in rbc adherence efficiencies similar to that displayed by wild - type and aneo trophozoites .
since ehadh112 was also found in cytoplasmic vacuoles that could differ or not from that in which recombinant bro1 accumulated , we assessed the ultrastructural location of ehadh112 in aneobro1 trophozoites by immunogold labeling experiments , using polyclonal rabbit antibodies against ehadh112 ( pehadh112 ) ( figure 5 ) , which gave a better reactivity on frozen ultrathin sections than mehadh112 ones . of note , pehadh112 antibodies do not recognize the ehadh112-like protein sequences previously reported by our group , since western blot assays specifically detect the band corresponding to the predicted molecular weight of ehadh112 ( data not shown ) . through tem , pehadh112 antibodies revealed ehadh112 at the plasma membrane of both , aneo ( data not shown ) and aneobro1 trophozoites ( figure 5(b ) ) .
gold labeling was also observed at external and internal faces of vesicle membranes and inside vesicles , frequently associated to fibrillar and membranous material ( figures 5(c)5(e ) ) .
huge organelles , containing intraluminal vesicles of different sizes and shapes , the majority of them immunolabeled , appeared in many trophozoites ( figure 5(c ) ) . by their morphology
, these compartments may correspond to mvb , which showed a high similarity to the ones described in mammals by denzer et al . .
we also detected numerous whitish ehadh112-carrying vesicles outside electrodense structures with lysosome appearance , which also exhibited ehadh112 signals ( figure 5(d ) ) .
these lysosome - like structures presented a delimiting double membrane labeled with ehadh112 ( figures 5(d ) and 5(e ) ) . strikingly , several vacuolar structures , one contained inside the other , which suppose membrane inward budding of vesicles ( figure 5(e ) , arrows ) , bordered lysosome - like organelles and carried ehadh112 .
recurrent and profuse docking of ehadh112 to the membrane of different - sized vesicles , suggest its possible participation in protein sorting along endosomal compartments and vesicle fusion processes ( figures 5(d ) and 5(e ) ) . at the beginning of erythrophagocytosis ,
not yet well - understood signaling processes occur , allowing the recruitment of molecules with different roles in the uptake and digestion of target cells . in this paper , our immunofluorescence experiments evidenced that overexpression of the bro1 recombinant polypeptide in aneobro1 trophozoites did not affect ehadh112 location at target cell contact sites and phagosomes ( figure 4(a ) ) .
further , tem ultrastructural observations , located ehadh112 near to and at invaginating membranes surrounding rbc in trophozoites of aneo ( data not shown ) and aneobro1 populations ( figure 4(c ) ) . inside trophozoites , in the vicinity of delimiting membranes surrounding rbc ,
several small whitish vesicles were seen ( figure 6(b ) ) , sometimes as if they were being released from huge vesicles . by their appearance
as phagocytosis advanced , more abundant gold particles were found on rbc ( figures 6(b ) and 6(c ) ) .
furthermore , around phagosomes containing rbc , we observed whitish vesicles in arrangements apparently organized , some of them labeled with gold particles ( figure 6(c ) ) .
mammalian alix and yeast bro1 are cytoplasmic proteins that associate with endosomal compartments to function in concert with components of the escrt machinery during mvb formation [ 41 , 43 ] . in the endocytic pathway ,
mvb are formed from early endosomes and then , they fuse to late endosomes or lysosomes [ 12 , 44 ] . here , our findings strengthen the role of ehadh112 not only as an adhesin at the trophozoite surface , but also as a protein whose similarity to other bro1 domain - containing proteins such as alix , could assign it an alternative function in endosome , phagosome , and mvb formation .
the presence of gold labeling at the surface of small vesicles at the proximity of larger vacuoles could mean that ehadh112 is being targeted to these sites to perform a putative function in vesicle formation or that it is per se a conveyor protein which carries other molecules involved in this process .
moreover , the possibility of ehadh112 participation in vesicle biogenesis implies that it could be translocated from the plasma membrane to the delimiting membranes of internal vesicles .
hence , ehadh112 could be a soluble or insoluble membrane - associated protein , depending on its function and the protein or proteins it binds to . to investigate whether native ehadh112 remains as a soluble or insoluble membrane - associated protein in wild - type trophozoites
followed by western blot assays , using rabbit polyclonal antibodies against the last 243 amino acids of ehadh112 ( pehadh243 ) , which detect the carboxy - terminus of the adhesin .
pehdh243 antibodies recognized the expected 78 kda band corresponding to the ehadh112 molecular weight in crude extracts ( tp ) obtained after disruption of trophozoites incubated with concanavalin a in the presence of protease inhibitors ( figure 7(a ) , left panel , lane 1 ) .
after centrifugation at 250 g for 30 min on a mannitol / sucrose gradient , ehadh112 appeared in the supernatant ( sn1 ) , which contains vesicles , small membrane fragments , and soluble proteins ( figure 7(a ) , left panel , lane 2 ) .
we also detected a weak band in the pellet ( p1 ) , which contains large fragments of plasma membranes and cell debris ( figure 7(a ) , left panel , lane 3 ) .
as a control , we used mouse monoclonal antibodies against actin ( mactin ) , which reacted with the corresponding 43 kda protein in all fractions ( figure 7(a ) , left panel , lanes 1 to 3 ) .
then , we ultracentrifuged ( 40 000 g ) the sn1 fraction to obtain the supernatant ( sn2 ) , where soluble components remain , and the pellet ( p2 ) , containing internal vesicles and small membrane fragments .
ehadh112 was only found in p2 ( figure 7(a ) , middle panel , lane 2 ) , suggesting that it could be mostly a membrane - associated protein .
actin was also absent in the sn2 fraction and strongly detected in p2 ( figure 7(a ) , middle panel , lane 2 ) .
the p1 fraction ( figure 7(a ) , left panel , lane 3 ) was homogenized with -methyl mannoside and centrifuged at 250 g on a sucrose cushion to separate vesiculated ( p4 ) from nonvesiculated membranes and debris ( p3 ) .
p3 did not react with pehadh243 antibodies ( figure 7(a ) , right panel , lane 1 ) , indicating that ehadh112 is poorly present in nonvesiculated membranes .
then , we concentrated the supernatant ( sn3 ) by ultracentrifugation at 40 000 g to obtain vesiculated membrane fragments ( p4 ) .
pehadh243 antibodies revealed the presence of ehadh112 in p4 ( figure 7(a ) , right panel , lane 2 ) , thus , confirming that this protein is associated to vesiculated plasma membrane fragments .
meanwhile , actin was localized in p3 and p4 , attached to nonvesiculated and vesiculated plasma membranes ( figure 7(a ) , right panel , lanes 1 and 2 ) .
these data showed the presence of ehadh112 in membrane vesicles , supporting results obtained by microscopy experiments .
they also evidence that ehadh112 could be associated to plasma membrane during the active vesicular traffic exhibited by trophozoites , probably inside small vesicles that eventually fuse to plasma membrane .
most bro1 domain - containing proteins are cytosolic , and it has been noticed that alix is transiently recruited to the plasma membrane to promote membrane fission during budding and release of viral particles , in association to late - acting escrt proteins .
ehadh112 was originally described as a component of the heterodimeric ehcpadh complex , present at trophozoite plasma membrane and cytoplasmic vacuoles under culture conditions .
first , the protein is found at the trophozoite plasma membrane , particularly , at target cell contact sites .
then , this protein is detected together to internalized erythrocytes , in phagosomes and phagolysosomes . at late stages , the ehcpadh complex is detected again at the trophozoite plasma membrane , thus suggesting protein recycling or even , a putative participation of ehadh112 in membrane remodeling .
additional evidence has consistently confirmed the presence of ehadh112 in both , trophozoite plasma membrane and cytoplasmic vesicles . according to our current subcellular fractioning experiments , ehadh112 is mostly present in membrane fractions .
however , as it was shown in figure 7(a ) , ehadh112 is also found in fractions containing soluble proteins .
therefore , we can not discard the possibility that ehadh112 exists in soluble form under particular conditions not yet explored .
since the precise protein location is largely determined by its function in the cell , it must be considered that bro1 domain containing proteins such as alix are ubiquitous in order to serve as scaffold proteins connecting several biological processes .
therefore , additional functions should be investigated for ehadh112 to better understand its subcellular location in trophozoites .
particularly , the presence of ehadh112 in different membrane compartments , strongly supports the hypothesis that ehadh112 could perform a role in the endocytic pathway , although it remains to be established if the previously reported e. histolytica escrt machinery is indeed participating in this process .
one conserved feature of the majority of bro1 domain - containing proteins is their ability to bind the escrt - iii component vps32 or chmp4 .
this interaction allows bro1 or alix targeting to endosomes during mvb formation and virus budding [ 13 , 19 ] . here , we investigated whether ehadh112 interacts with an e. histolytica protein homologous to yeast vps32
. first , we found in the e. histolytica genome database a protein sequence ( ehvps32 ) with an e - value of 2.5 e-12 , displaying 48% homology and 25% identity to yeast vps32 . according to multiple sequence analysis and pfam database predictions
, ehvps32 contains a snf7 domain , present in all members of the snf7 family .
additionally , the predicted ehvps32 secondary structure using the jpred program , suggested that ehvps32 conserves the characteristic five -helices present in the snf7 family protein . to confirm the predicted interaction between ehadh112 and ehvps32 proteins , pull down
gst alone or purified gst - ehvps32 were immobilized on glutathione - sepharose beads ( figure 7(b ) , left panel , lanes 1 and 2 , resp . ) and incubated with [ s]-labeled ehadh112 ( figure 7(b ) , left panel , lane 3 ) or [ s]-ehadh112 ( 1 - 421 amino acids ) ( figure 7(b ) , left panel , lane 4 ) and [ s]-ehadh112 ( 422687 amino acids ) derivatives ( figure 7(b ) , left panel , lane 5 ) , previously synthesized by a coupled transcription - translation system , as described in section 2.10 .
gst - ehvps32 beads retained ehadh112 ( figure 7(b ) , right panel , lane 1 ) , and the ehadh112 ( 1421 ) derivative ( figure 7(b ) , right panel , lane 2 ) , but not the ehadh112 ( 422687 amino acids ) polypeptide ( figure 7(b ) , right panel , lane 3 ) .
as expected , gst alone was unable to bind ehadh112 and ehadh112 derivatives ( figure 7(b ) , right panel , lanes 4 to 6 ) .
proteins present in pull - down reaction mixtures were coomassie blue stained as an additional control ( data not shown ) .
together , these results strongly suggest that ehadh112 binds ehvps32 through the bro1 domain , as it has been reported for other bro1 domain - containing proteins [ 19 , 20 ] .
although we do not know yet the identity of other proteins associated to or transported by ehadh112 in live trophozoites , based on these results , we hypothesized that ehadh112 may interact with escrt proteins in vivo , as it has been reported for alix and bro1 [ 19 , 39 , 46 , 47 ] .
interestingly , ehadh112 seems to be a novel member of a subfamily of bro1 domain - containing proteins present at cellular surface that alternatively could regulate the assembly of proteins at endosomal membranes for mvb biogenesis .
translocation of ehadh112 from the plasma membrane to internal vesicles , endosomes , or phagosomes and back to the surface , could also be related to a scaffold function , as it has been described for its homologues in yeast and mammals .
in this work , we reported for the first time the functional characterization of the n - terminus of ehadh112 , an e. histolytica bro1 domain - containing protein involved in parasite virulence .
a dramatic decrease of phagocytosis rates displayed by trophozoites overexpressing an ehadh112 bro1 recombinant polypeptide , together with an exaggerated accumulation of this protein in aberrant compartments , suggested that the bro1 domain recruits proteins participating in phagocytosis .
moreover , ehadh112 localization at trophozoite plasma membrane , mvb and phagosomes and in both soluble and insoluble subcellular fractions , provided additional support for an alternative role for this protein in the endosomal mvb pathway .
this function is conserved among bro1 domain - containing proteins , which interact with escrt components to associate to endosomes . here
, we also showed the in vitro association of ehadh112 with an e. histolytica protein homologous to the escrt - iii vps32 subunit , as a putative hallmark for ehadh112 bro1 domain function in endosomal protein sorting .
additional efforts should be made to better understand the role of ehadh112 in escrt - mediated mvb biogenesis and other functions also assigned to bro1 domain - containing proteins . | ehadh112 is an entamoeba histolytica bro1 domain - containing protein , structurally related to mammalian alix and yeast bro1 , both involved in the endosomal sorting complexes required for transport ( escrt)-mediated multivesicular bodies ( mvb ) biogenesis . here , we investigated an alternative role for ehadh112 in the mvb protein trafficking pathway by overexpressing 166 amino acids of its n - terminal bro1 domain in trophozoites .
trophozoites displayed diminished phagocytosis rates and accumulated exogenous bro1 at cytoplasmic vesicles which aggregated into aberrant complexes at late stages of phagocytosis , probably preventing ehadh112 function . additionally , the existence of a putative e. histolytica escrt - iii subunit ( ehvps32 ) presumably interacting with ehadh112 , led us to perform pull - down experiments with gst - ehvps32 and [ 35s]-labeled ehadh112 or ehadh112 derivatives , confirming ehvps32 binding to ehadh112 through its bro1 domain .
our overall results define ehadh112 as a novel member of escrt - accessory proteins transiently present at cellular surface and endosomal compartments , probably contributing to mvb formation during phagocytosis . |
root canal treatment is a rather new branch of endodontic dentistry in recent years through , which chemical and mechanical remedies are used to limit pulpal and peri - apical diseases .
this biologically approved technique has helped peri - apical tissues in the process of healing significantly .
the above technique is strongly depended upon the access to the area and identification of all roots as well as the possibility of a perfect chemo - mechanical tooth cleaning to be successful .
three directional shaping and filling of the root canals with neutral materials are important as well.1 the success rate would even be 90 - 95% in controlled conditions in this regard,2 although it usually succeeds in 35 - 60% when no peri - apical problems exist.3,4 relevant errors are usually evaluated in three different areas , which are explained more in methodology1,5 - 15 ( figure 1 ) mukhaimer s work is probably the last research on the errors in the studied field of the current performance , which evaluated 612 radiographies of peri - apical trials by senior dentistry students in 2013.9 out of the total records , 65% had acceptable obturation length and more than 75% had acceptable density of obturation substance in the treated teeth . through a self - report design at the king saud university in riyadh in 2013 , alhekeir et al
. identified 68% error rate in the procedure of root canal treatment by senior students.15 some kinds of iatrogenic errors in root canal treatment .
( a ) ledge ( b ) apical perforation ( c ) underfilling ( d ) overfilling . in malaysia in the same year
, the results of a 2 years study were reported to introduce void as the most common error in this matter like almost the rest of studies.16 a rate of 65.5% for void was highlighted by moradi and gharechahi in mashhad , iran , which was higher in mandible when compared with the maxilla.17
this study used a retrospective chart review design to just get descriptive information on the frequency and kinds of the errors , which usually occurred in the field of root canal procedure .
we focused on senior students at the dentistry school clinic who had worked at the general ward of endodontics at the medical university of qazvin , iran between october 2011 and october 2012 .
patients charts were participated in the study by census , and all of them were evaluated by the research dentists .
two endodontists were responsible to interpret radiographic clichs from the first x - ray studies to the last images of checking through the process of filling the teeth .
all the errors were divided into three major kinds of :
errors during providing access cavity :
gougingfurcal perforation
errors during cleaning and preparation :
ledgetransportationstrip perforationbroken instrumentsapical perforation
errors during canal obturation :
voidoverfillingunder filling
errors during providing access cavity :
gougingfurcal perforation
errors during cleaning and preparation :
ledgetransportationstrip perforationbroken instrumentsapical perforation
errors during canal obturation :
voidoverfillingunder filling
figure 1 explains some of the consequences and errors that were focused by the current work .
after identification of the occurred errors throughout the whole process of canal obturation seen in the charts , findings were entered and analyzed statistically .
regarding 95% confidence interval and type i error of = 0.05 , chi - square test was utilized to find the prevalence of errors by the students using spss 21 for windows .
ethics : no demographic data were recorded by the investigators , and only the students functions were evaluated by the interpreted x - ray radiographies .
this study used a retrospective chart review design to just get descriptive information on the frequency and kinds of the errors , which usually occurred in the field of root canal procedure .
we focused on senior students at the dentistry school clinic who had worked at the general ward of endodontics at the medical university of qazvin , iran between october 2011 and october 2012 .
patients charts were participated in the study by census , and all of them were evaluated by the research dentists .
two endodontists were responsible to interpret radiographic clichs from the first x - ray studies to the last images of checking through the process of filling the teeth .
all the errors were divided into three major kinds of :
errors during providing access cavity :
gougingfurcal perforation
errors during cleaning and preparation :
ledgetransportationstrip perforationbroken instrumentsapical perforation
errors during canal obturation :
voidoverfillingunder filling
errors during providing access cavity :
gougingfurcal perforation
errors during cleaning and preparation :
ledgetransportationstrip perforationbroken instrumentsapical perforation
errors during canal obturation :
voidoverfillingunder filling
figure 1 explains some of the consequences and errors that were focused by the current work .
after identification of the occurred errors throughout the whole process of canal obturation seen in the charts , findings were entered and analyzed statistically .
regarding 95% confidence interval and type i error of = 0.05 , chi - square test was utilized to find the prevalence of errors by the students using spss 21 for windows .
ethics : no demographic data were recorded by the investigators , and only the students functions were evaluated by the interpreted x - ray radiographies .
a total number of 1335 charts of the cases were studied in the field of root canal treatment in a general ward of endodontics at the medical university of qazvin , iran between 2011 through 2012 .
the whole number of charts , which reported errors was 880 ( 66% ) while 455 ( 34% ) error - free ones .
the most frequent error in upper incisors was void with the rate of 50.9% , followed by overfilling ( apical perforation ) in 18.2% .
the same errors were also most common for lower incisors in addition to imperfect cleaning , ( table 1 ) .
canine teeth showed higher rates of iatrogenic errors including void and overfilling when compared with incisors .
overall , 5.4% out of all errors occurred in upper canines while the rate was 1.8 in lower ones . in terms of premolar teeth of the total 41.5%
, void was again the most common error with 48% and 51.6% in maxilla and mandible , respectively .
overfilling was the second common error in the latter but imperfect cleaning in maxilla , and both of the errors were at the same rate of just more than 17% .
upper and lower molars owned 38.1% of the total errors including void followed by overfilling as the most common mistakes , which are visible ( table 1 ) .
kinds of errors occurred in root canal treatments considering all the teeth and their frequencies . as a comparison , upper molars had a lower rate of the total errors ( 15.7% ) while lower molars were responsible for 22.4% of the total mistakes in root canal treatment procedure .
when consider all the patients teeth in three groups , premolars with 86.11% had the most occurrences of errors followed by molars ( 63.2% ) .
otherwise , anterior group of teeth showed errors at the rate of 47.1% . as a whole , void had the most rates of 42.7% followed by overfilling ( 18.9% ) and imperfect cleaning ( 17.2% ) .
maxilla had 64.2% of the total errors whilst mandible with 35.8% as can be checked ( table 2 ) .
a therapist would face a range of undesired and unexpected events and challenges , which could affect obviously on diseases prognosis .
knowledge and skill of doing the procedure are absolutely important to prevent these kinds of problems or to solve them when occurred.5 the current chart review showed that 34% of 1335 cases of dental root canal manipulations were done error - free while the rest had at least one of the evaluated errors such as void , overfilling and imperfect cleaning .
maxilla was more involved by the iatrogenic ( provider - related ) mistakes among which premolars had the most rates .
void - related problems were 42.7% followed by overfilling ( 18.9% ) with a rather huge interval as can be seen by the percentages . other errors like imperfect cleaning and under filling were frequent not too different from overfilling .
this is while zipping and gouging were too scarce and no case of furcal perforation was found .
mukhaimer named under filling as the most frequent procedure - induced error , particularly in maxillary molars .
void was the second error in their study and ledge as well as perforation had higher rates in comparison to our findings.9 like our results , alhekeir et al
. showed that the posterior parts of the maxilla were more frequently involved.15 hard access and imperfect vision , as well as students unskillfulness , help the situation occurred .
anatomical complex affairs in that area are a risk factor as well.15,18 blaming both void and under filling , rasheed et al . showed that , like our study , errors occurred in obturation phase through which much more technical care and strict professional supervision19 is needed .
obturation phase was the most frequent part of errors in another study by khabbaz too .
they reported under filling followed by overfilling and void , respectively , on the contrast side of our work while ledge and other mistake were too rare that would be explained by referring complicated cases to subspecialists in dentistry school.20 the most frequent error in ahmed s study was void , like the current research , but imperfect cleaning was unlikely at the second place.21 however , posterior teeth were more involved like other reports .
perforation had no place of occurrence in our study like ahmed s that would be an example of perfect supervision too .
broken instrument is another kind of errors which was condo native through our study , but did not occurred in ahmed s and mozayeni s conductance.18,21 void , as a very common error in a vast number of researches could be resulted from loss of skills , sealer overuse , and imperfect usage of spreader in packing gutta - percha , displaced accessory gutta - percha in root canals as well as mismatched size of spreaders and accessory gutta - percha 18 .
the current study identified the least mistakes through the process of providing access cavity and instrumentation phase comparing obturation phase , which had the most frequent errors including void , overfilling and imperfect cleaning .
regarding the high rates of errors in root canal treatment , this study advises more practical learning and more strict supervision on students tasks in this matter .
furthermore , radiovisiography would be useful in terms of estimating the frequency of zipping and stripping as endodontic errors in order to get more details during root canal treatment in later trials .
on the other hand , computerized tomography s of extracted teeth or microscopic studies are advised ways to evaluate the job . | background : endodontic procedures such as root canal treatment would be at the risk of failure like other medical interventions due to any unsuitable conditions .
this has a causative effect in making the procedure more complicated to resulting in weak prognosis finally .
technical errors such as ledge , perforation , obstruction , broken instrument , etc .
make infection control too hard or impossible .
the aims of this study are common errors frequency and types of root canal treatments focusing on defined groups of dental students in qazvin , iran.materials and methods : all the errors were divided into three major kinds of:(1 ) during providing access cavity , ( 2 ) cleaning and preparation and ( 3 ) canal obturation.results:a total number of 1335 charts of the cases were studied in the field of root canal treatment .
the whole number of charts , which reported errors was 880 ( 66% ) while 455 ( 34% ) error - free ones .
the most frequent error in upper incisors was void with the rate of 50.9% , followed by overfilling ( apical perforation ) in 18.2% .
the same errors were also most common for lower incisors in addition to imperfect cleaning.conclusions:the current study identified the least mistakes through the process of providing access cavity and instrumentation phase comparing obturation phase , which had the most frequent errors including void , overfilling and imperfect cleaning . |
synovial cell sarcoma ( scs ) of the kidney is a rare tumor entity first described in 1999 and published in 2000 by argani et al .
[ 1 , 2 ] . to date , no more than 50 cases have been described in the literature .
differential diagnosis mainly includes renal sarcomatoid carcinoma , metastatic sarcoma , solitary fibrous tumor of the kidney and retroperitoneal sarcoma involving the kidney .
scs is a malignant mesenchymal tumor which typically affects proximal limbs of young adults , but it can also involve other sites ( head and neck , heart , duodenum , lung , mediastinum , abdominal wall , kidney and prostate ) .
histologically , scs is subclassified into monophasic ( spindle cells ) or biphasic ( spindle cell component mixed with plump epitheloid cells ) as well as poorly differentiated types . at the molecular level
, scs is characterized by a syt - ssx gene fusion caused by the rearrangement between the p11.2 and q11.2 portions of chromosomes x and 18 , respectively , i.e. t(x;18)(p11.2;q11.2 ) and rare variants . here ,
we report the case of a 76-year - old woman who was diagnosed and treated at our institution .
a 76-year - old woman was referred to our hospital because of macrohematuria and right flank pain .
the medical history revealed a slight mitral regurgitation as well as a substituted hypothyroidism due to a total thyroidectomy performed because of a benign pathology 40 years earlier .
blood tests revealed no signs of systemic inflammation or renal insufficiency , only a moderate anemia was noticeable .
we performed a cystoscopy , which brought no evidence of bladder pathology , but we noticed active bleeding from the right ureteral orifice .
sonography and an abdominal ct scan showed a hypodense mass with slow contrast enhancement , 80 mm in diameter and located in the upper pole of the right kidney and involving the pyelon .
1 ) . suspecting an urothelial carcinoma of the right pyelon , we performed a retroperitoneoscopic nephro - ureterectomy .
macroscopic pathological evaluation revealed a right kidney weighing 300 g and measuring 12 6 5 cm .
the upper pole tumor showed a greyish , partly hemorrhagic cut surface and a firm consistency .
it measured 8 5 5 cm and showed a macroscopic infiltration of the renal parenchyma as well as a pedunculated growth into the pyelon , almost completely filling out the latter .
immunohistochemical analysis demonstrated positivity for bcl-2 , cd99 , transducin - like enhancer of split 1 ( tle1 ) , vimentin and focal positivity for cytokeratin ( ck ) 7 .
the other applied markers such as s100 , hmb45 , sma , actin , cd34 , desmin , ck22 and ck19 remained negative .
the immunohistochemical pattern was typical for scs . as the tumor revealed no epithelial component ,
a definitive diagnosis was achieved by the confirmation of a syt gene rearrangement using a syt dual color break apart probe - based ( z-2097 - 50 ; zytovision , bremerhaven , germany ) fish test ( fig .
the interdisciplinary tumor board decided not to perform adjuvant chemotherapy mainly because of the patient 's age .
twenty months after surgery , the patient feels well and shows no clinical or radiological signs of recurrence .
scs is the fourth most common sarcoma , which primarily develops in the limbs of young individuals . scs originating from the kidney is extremely rare and its histogenesis is uncertain .
this rare renal tumor typically affects younger patients of both genders , with a slight predominance in males . to our knowledge
, the presented case has the highest age at time of diagnosis ( 76 years ) described so far .
there are no specific clinical or imaging characteristics for scs : clinical symptoms and ct images do not differ from other malignant renal tumors . for the pathologist
, it may be difficult to differentiate scs from other , more common forms of sarcomatoid tumors originating in the kidney , especially sarcomatoid renal cell carcinoma , metastatic sarcoma , solitary fibrous tumors and retroperitoneal sarcomas involving the kidney .
this particularly applies to monophasic scs , which are more commonly observable in the kidney than biphasic ones .
renal scs are typically positive for bcl-2 , cd99 , cd56 , vimentin and focally for epithelial membrane antigen .
however , this pattern can also be seen in other tumor types ( primitive neuroectodermal tumors and malignant peripheral nerve sheet tumors ) [ 5 , 6 ] .
a promising , more specific marker for scs , like in the present case , appears to be tle1 ( fig .
4 ) , the expression of which is strongly predictive of syt gene rearrangement according to large studies [ 8 , 9 ] , but still needs molecular confirmation according to data from smaller studies .
therefore , definitive diagnosis of a renal scs requires confirmation of rearrangement involving the syt gene by either reverse transcriptase polymerase chain reaction or applying fish testing with properly designed probes .
initial studies , mostly based on anthracycline - only chemotherapy , did not show an improved survival [ 11 , 12 ] .
later studies included anthracycline- and ifosfamide - based chemotherapy and revealed a small gain in survival , which could not be reproduced in a subsequent , large clinical trial .
thus , no consensus has been achieved yet and the debate is still ongoing , with the chemotherapeutic management of sarcomas varying between institutions and countries .
so far , there is no convincing evidence on survival benefits with respect to chemotherapy , which may be due to the heterogeneous inclusion of different histological subtypes in studies as well as the evolution in the quality of treatment and the selection criteria of patients for adjuvant systemic therapy .
therefore , recent studies recommend the use of adjuvant chemotherapy only for younger patients and/or larger tumors where clinical advantages could rather be expected . | synovial cell sarcoma ( scs ) of the kidney is a rare tumor entity with a poor prognosis .
morphologic and immunohistochemical characteristics may overlap with other more common neoplasms of the kidney .
therefore , the diagnosis of primary renal scs not only requires the exclusion of similar tumor types , but also a confirmation of syt - ssx gene fusion using molecular techniques .
the treatment comprises radical surgery , and , depending on age and health status , adjuvant chemotherapy in selected patients . here ,
we present an elderly scs patient in whom straightforward radical surgical treatment resulted in a sustained complete remission ; it allowed us to perform a literature survey focusing on current diagnostic tools for scs . |
venom immunotherapy ( vit ) is an extremely effective form of treatment for individuals at risk of insect sting systemic reactions , i.e. flying hymenoptera , an order of insects comprising honeybees , yellow jackets , hornets , and wasps .
vit reduces the risk of a subsequent systemic sting reaction to as low as 5% compared with the risk of such reactions in untreated patients , for whom the risk might be as high as 60% .
the prevalence of hymenoptera stings in the general population ranges from 56.6% to 94.5% , and can vary according to the location and the climatic conditions , whereas the estimated prevalence of hymenoptera - venom allergy ( hva ) is around 5% .
ige - mediated allergic reactions triggered by hymenoptera stings range from large local reactions ( llr ) , to systemic reactions ( urticaria , angioedema , asthma ) with immediate symptoms , until anaphylaxis , which is often life - threatening .
non - allergic reactions to hymenoptera stings include the well - known local irritative phenomena and , more rarely , toxic systemic reactions .
llr are usually defined by acute wheal and flare , with a diameter > 10 cm , and a duration of > 24 hours .
anaphylactic systemic reactions are serious hypersensitivity events , with signs and symptoms that occur within 2 hours , but usually in a few minutes , after the insect sting . the clinical presentation is characterized by urticaria / angioedema , gastrointestinal symptoms , asthma and/or cardiovascular involvement , variously associated , until shock and loss of consciousness . in europe , the prevalence of llr due to hymenoptera stings is estimated to range between 2.4% and 26.4% , whereas that of systemic reactions vary between 0.3% and 8.9% . despite the available epidemiological data showing in the highly exposed population of beekeepers up to 26% of systemic allergic reactions , few studies investigated hva from an occupational point of view , in other workers exposed to the specific professional risk .
, in a japanese study , reported a 21% and 14% prevalence of systemic reactions in forest rangers and electrical systems technicians , respectively , whereas kochuyt et al . reported a rate of 10% in workers performing pollination with bumblebees in greenhouses .
some cases of hymenoptera - venom anaphylactic reactions , in gardeners , masons and truck drivers have been reported as an occupational risk .
vit is currently considered the only disease - modifying treatment , that can protect against severe reactions at re - sting more than 90% of subjects , when correctly prescribed .
the irccs aou san martino ist teaching hospital of genoa in liguria , italy , is a regional reference center , and for many years has dealt with the preventive , diagnostic , clinical , and therapeutic aspects related to hva , also involving the occupational field . in this context , we performed an observational study in patients with an ascertained diagnosis of hva , and prescribed with vit , with the purpose to describe ( i ) the clinical characteristics of workers , exposed to hymenoptera stings , with an ascertained diagnosis of hva , ( ii ) the specific role of occupational exposure , ( iii ) the effect of vit in reducing the severity of allergic episodes in workers exposed to repeated stings of hymenoptera , and ( iv ) the management of the occupational consequences caused by allergic reactions due to hymenoptera stings .
in addition , indications for proper risk - management in the workplace for subjects at high risk of exposure to hymenoptera stings have been proposed .
we conducted an observational study on patients seen in the period 20002013 at the allergy unit and the clinic of respiratory diseases and allergy , within the irccs aou san martino
202 patients ( 65.8% men ; mean age = 56 years ; standard deviation ( sd ) = 16.2 ; range 990 years ) had a confirmed diagnosis of hva and consequently received a vit prescription .
to better identify and dissect the characteristics of hymenoptera stings during current or previous occupational activities , and to identify the exposure related to work environment , we administered a structured questionnaire .
detailed information concerning the structured questionnaire used in the survey is available in appendix 1 ( supplementary file ) .
the questionnaire was administered to all patients : 184 subjects were eligible for the analysis , since 18 were lost upon follow - up or provided incomplete responses .
out of the 184 patients included in the survey , 145 ( 78.0% ) had been admitted to emergency department ( ed ) and the remaining were referred by their general practitioner .
the characteristics of the study population , also according to their occupational activity and to the occurrence of re - sting , are detailed in figure 1 .
figure 1.disposition of the population according to characteristics of the occupational activity , occurrence of re - sting and venom immunotherapy ( vit ) .
disposition of the population according to characteristics of the occupational activity , occurrence of re - sting and venom immunotherapy ( vit ) .
the clinical features of the allergic reactions at first referral , classified according to the grade of severity , are shown in table 1 , while the types of occupational activity of the patients stung by hymenoptera at work are summarized in table 2 .
the insect involved , when recognized , were the yellow - jacket ( n = 30 , 16.3% ) , polistes ( n = 7 , 3.8% ) , european hornet ( n = 57 , 31.0% ) , honeybee ( n = 27 , 14.7% ) ; in 63 ( 34.2% ) cases the insect was unknown . 114 ( 62.0% ) out of the 184 patients were regularly employed , whereas 70 ( 38.0% ) were not ( i.e. , retired , housewives , students ) . the latter group reported to have been stung by hymenoptera by one or more times , during recreational activities performed outdoor ( i.e. , gardening or sport activities ) .
out of the regularly employed patients , 69 ( 60.5% ) and 45 ( 39.5% ) worked outdoor and indoor , respectively : none of the individuals working indoor reported previous hymenoptera stings .
thirty - two ( 28.0% ) currently employed subjects developed an allergic reaction during work activity .
if we consider only the outdoor population of workers as the denominator , this figure goes up to 46.4% .
table 1.clinical characteristics of the allergic reactions occurred at the first sting including those occurred in patients with access to the emergency department and referred by the general practitioner.severity graden%large local reaction52.7systemic reaction grade i2212.0systemic reaction grade ii3820.7systemic reaction grade iii4524.4systemic reaction grade iv5630.4undefined reaction189.8total184100.0
table 2.types of occupational activity in patients stung during outdoor work activities.occupational activityn%beekeeper721.9construction worker721.9gardener412.5driver39.4technicians39.4police officer26.0farmer26.3professional cyclist13.1fruit and vegetable saleswoman13.1plumber13.1postman13.1total32100.0
clinical characteristics of the allergic reactions occurred at the first sting including those occurred in patients with access to the emergency department and referred by the general practitioner .
the severity of the reaction grade and the access to the ed of the 32 subjects stung during outdoor work activities are shown in table 3 : a high frequency of grade iv severity was reported .
out of 20 ( 62.5% ) patients who accessed the ed , 13 ( 65.0% ) reported systemic reactions classified as grade iii or iv .
table 3.severity grade and need of access to the emergency department ( ed ) in patients stung during outdoor work activities .
access to ed n ( % ) no access to ed n ( % ) total n ( % ) large local reaction1 ( 5.0)2 ( 16.7)3 ( 9.4)grade i systemic reaction1 ( 5.0)4 ( 33.4)5 ( 15.6)grade ii systemic reaction2 ( 10.0)3 ( 25.0)5 ( 15.6)grade iii systemic reaction6 ( 30.0)1 ( 8.3)7 ( 21.9)grade iv systemic reaction7 ( 35.0)1 ( 8.3)8 ( 25.0)unidentified reaction3 ( 15.0)1 ( 8.3)4 ( 12.5)total20 ( 100.0)12 ( 100.0)32 ( 100.0 )
severity grade and need of access to the emergency department ( ed ) in patients stung during outdoor work activities .
nine out of these 20 workers ( 45.0% ) claimed for occupational injury to the italian national institute for injuries at work and professional diseases ( inail ) , being the occupational injury recognized in 2 cases ( grade iii systemic reaction ) .
globally , 23 ( 71.8% ) workers maintained their activity after the allergic reactions : 9 workers had either to change their occupation ( 3 subjects ) or to retire ( 6 subjects ) .
only beekeepers declared to use personal protective equipment ( ppe ) during work activity , although not regularly , and emergency pharmacological kits resulted not to be always available , even in categories usually considered to be at high risk of occupational exposure to hymenoptera stings .
ten ( 31.2% ) workers , all under vit treatment , were re - stung on more than one occasion during occupational activity : none of these individuals had an ed admission and no grade ii - iv systemic allergic reactions occurred .
the clinical characteristics of the hva reactions at the first sting and at re - sting during vit are reported in table 4 : a significant difference ( p - value = 0.031 ) emerged from the inter - group comparison .
table 4.allergic reactions due to hymenoptera stings in workers under venom immunotherapy ( vit ) ( n = 10 ) who were stung on more than one occasion during occupational activity ( pre vs. post - treatment , p - value = 0.031).allergic reactionn of patients with first sting before vit treatmentn of patients with repeated stings after vit treatmentlarge local reaction18grade i systemic reaction12grade ii systemic reaction10grade iii systemic reaction10grade iv systemic reaction50unidentified reaction10total1010
allergic reactions due to hymenoptera stings in workers under venom immunotherapy ( vit ) ( n = 10 ) who were stung on more than one occasion during occupational activity ( pre vs. post - treatment , p - value = 0.031 ) .
hva represents a public health issue due to the estimated prevalence of about 5% in the general population , and the associated risk of serious reactions ( i.e. , anaphylaxis ) reported at values up to 9% in europe .
any effort to improve the knowledge on the clinical burden and proper management of hva is desirable and can be useful to improve its prevention , especially if hva is considered as an occupational problem . in this observational study , performed in a large case series of patients with hva , we focused on the role of occupational exposure , the effects of vit , attempting to provide indications for proper risk - management in the work places for subjects at high risk of exposure to hymenoptera stings .
the clinical relevance of allergic reactions in patients stung by hymenoptera was confirmed in our survey , where 101 ( 55% ) of the overall cases investigated reported systemic reactions classified as grade iii
iv , with 145 ( 79% ) of them requiring admission to the hospital ed . more than 17% of the patients developed at least one allergic reaction at work , unlike indoor workers , among which no cases were reported .
to be mostly affected were beekeepers and masons ( 22% ) , followed by gardeners ( 12.5% ) , drivers and technicians ( 9.4% ) .
all these subjects had an ascertained occupational risk for hymenoptera sting , although at a different grade according to the type of occupational activity .
similar experiences in various populations of workers have been performed in italy : a 5% prevalence of systemic reactions was observed in forest rangers , whereas prevalences of 1% and 27% of systemic reactions and llr were found among firemen , respectively .
, by comparing patients with hva belonging to various work - categories ( farmers , masons , truck drivers , gardeners , beekeepers , and dustmen ) with the general population , found a significant higher frequency ( range p - values = 0.010.05 ) in the first 3 professional categories ; therefore they hypothesized a specific risk of sensitization to hymenoptera venom in specific groups of workers , suggesting that hva needs to be considered an occupational threat among these individuals .
other italian authors studied this phenomenon , confirming this specific occupational risk in farmers and among emergency workers .
to date , according to the italian law , hymenoptera stings during work activities are specifically recognized as an occupational risk only for beekeepers , while they are considered as an increased generic risk in other outdoor workers . in our study
, in addition to beekeepers , also other categories appeared to share the same or similar occupational risks ( construction workers , gardeners , drivers , and technicians ) .
notwithstanding this , we found that , apart from beekeepers , none of other workers who had been stung by hymenoptera used ppe , and life - saving pharmacological kits were occasionally available only for beekeepers , while absent in any other workplace . in literature , risk factors that increase the frequency of sensitization to hymenoptera venom have been investigated : major exposure to risk in the living and working environments , number of stings , short intervals of time between stings .
moreover , previous severe reactions , together with specific individual conditions , such as systemic mastocytosis , cardiovascular diseases , -blocking or ace inhibitor treatments , or both , and high basal serum tryptase levels , can be considered as risk factors that increase the severity of subsequent reactions .
reported that repeated exposure to stings was one of the leading risk factors for the onset of sensitization and allergic reactions , where a merely local reaction escalates to a serious systemic reaction , up to an anaphylaxis : this factor has been extensively proven in beekeepers and their family members .
annila estimated a 26% prevalence of systemic reactions precisely in beekeepers , whereas other authors have reported a prevalence that varied between 14 and 42% .
the goals of vit are to prevent systemic reactions and alleviate patient 's anxiety related to insect stings .
our survey showed the effectiveness of vit in preventing episodes of severe reactions in workers with a proven hva , exposed to the risk of being repeatedly stung by hymenoptera : a significant reduction in the frequency of serious reactions pre- vs. post - treatment was demonstrated . to our knowledge , this is the first time that the positive effect of this preventive practice is reported in the occupational field , and this supports its specific recommendation at least in workers with a high occupational risk .
some studies from the literature have shown how previous reactions to hymenoptera venom can lead to occupational problems , especially when severe reactions occur during work . in our survey
, workers greatly benefited from vit , with more than 70% of them continuing their occupational activity , whereas only less than 30% had to change or cease it .
our data are plausible and in line with the highly effective vit treatment results ( 90% ) in reducing systemic reactions , both in the occupational and in the non - occupational settings .
therefore , vit as well as protecting health in some allergic individuals , could represent a valid tool to recommend in specific categories of outdoor workers recognized at high risk for hva .
recently , also moscato at al . showed how immunotherapy , together with other biological treatments , such as omalizumab , can help people to continue their work in the event exposure is unavoidable .
this study has some limits : the small number of participants , together with a lack of demographic and clinical epidemiological information concerning the patients who did not take part in the survey .
our data suggest that , during routine healthcare surveillance , it could be useful for the occupational physician to conduct an accurate anamnesis in order to identify individuals at risk of developing hva reactions .
these workers should be referred to a specialist in allergy for diagnostic exams and , eventually , start vit as a targeted preventive measure .
finally , it would be crucial to improve worker 's ability to properly manage acute allergic reactions directly at the workplace : this entails the capability to recognize clinical signs and symptoms early , and to administer specific treatments that need to be immediately available ( i.e. , an emergency pharmacological kit , including an antihistaminic and oral steroid , and self - injectable adrenalin for the most serious cases ) .
the provision of specific information and education , also with training courses for workers selected to conduct emergency procedures at the company level , could greatly improve the successful management of acute cases , both llr and systemic reactions : this is of particular meaning especially in companies where there are workers known to be allergic , and who carry out jobs recognized to be at high risk .
the allergy unit and the clinic of respiratory diseases and allergy , within the irccs aou san martino ist teaching hospital of genoa , italy , receive on average 5.500 patients per year , and approximately 1.5% are referred for suspect allergy to insect stings .
we conducted an observational study on patients seen in the period 20002013 , selected according to the following criteria : ( i ) ascertained diagnosis of allergic reaction to hymenoptera sting , and ( ii ) prescribed treatment with vit , according to international guidelines .
we collected demographic data ( race , age , gender ) , information on the type of stinging insect , as well as a detailed clinical information about the type and severity of the reaction through medical charts .
concerning anaphylaxis , several clinical criteria are proposed : for occupational anaphylaxis we adhered to the criteria available in literature .
the structured questionnaire , administered to all patients , included : occupational history ( outdoor high - risk environment / indoor low - risk environment , type of exposure ) , access to an ed , frequency , type and outcome of episodes due to hymenoptera re - stings , type of work ( employee / independent ) , accidents during work , acknowledgment of the accident by the inail , variations in fitness to work by the occupational physician and/or maintaining the occupation , availability and use of ppe , availability and ability to use a pharmacological emergency kit .
the study involved only standard procedures , therefore , according to italian rules , the regional ethics committee was simply notified .
mean , sd and ranges were considered for continuous variables , whereas absolute frequencies and percentages were considered for all the other measurements .
mcnemar 's test was used to compare pre - post frequencies of the grade of allergic reaction in patients with an ascertained re - sting during occupational activity . for the application of the test ,
the category including the systemic reactions of any grade was considered as a whole , and compared versus the category of the llr .
hymenoptera venom allergy italian national institute for injuries at work and professional diseases large local reactions personal protective equipment
giuseppe aleo , phd at the department of health sciences of the university of genoa , italy , who contributed to the english translation of the manuscript .
ist istituto nazionale per la ricerca sul cancro largo rosanna benzi , 10 - 16132 genova an observational study in patients with hymenoptera allergy : role of occupational exposure , allergen immunotherapy , and indications for prevention
i d n |___|___|___| date of birth |___|___| / |___|___| / |___|___|___|___| name initials |___|___| current and former work activities ( i.e. , regular , occasional , other ) :
1 .
have you ever taken medications ( i.e. , antihistamines , cortisone , epinephrine ) to manage a reaction?yesno6 .
did you claim for occupational injury at work in the emergency department?yesno8 . if yes , was the claim recognized by the italian national institute for injuries at work and professional diseases ( inail)?yesno9 . since your first administration of hymenoptera venom
if yes , how was the reaction compare with the first one?more seriousless serious similar to previousplease , describe signs and symptoms:11 .
how do you rate your job in terms of risk of being stung by hymenoptera?low riskmedium risk high risk12 .
do you currently practice or did you practice hobbies , outdoor sports , other recreational activities , and specific work activities with exposure to the risk of hymenoptera stings?yesnoif yes , describe which : 13 .
did you need to change or stop your recreational or work activities after being stung by hymenoptera?yesno14 . during work , have you ever used personal protective equipment to protect yourself against insect bites?yesnoif yes , describe which : 15 . is your occupational physician aware of your allergy?yesno16 .
has your hymenoptera venom allergy ever caused any specific problem with respect to your professional activity ?
( i.e. , critical issues with the employer , variations in fitness to work , etc.)yesnoif yes , provide further details:17 . | abstractobjectives . to describe ( i ) the clinical characteristics of workers , exposed to hymenoptera stings , with an ascertained diagnosis of hymenoptera venom allergy ( hva ) , ( ii ) the specific role of occupational exposure , ( iii ) the effect of venom immunotherapy ( vit ) in reducing the severity of allergic episodes in workers exposed to repeated stings of hymenoptera , and ( iv ) the management of the occupational consequences caused by allergic reactions due to hymenoptera stings.methods . between 2000 and 2013
an observational study , including patients referred to the regional reference hospital of liguria , italy , with an ascertained diagnosis of hva and treated with vit , was performed .
a structured questionnaire was administered to all patients to investigate the occupational features of allergic reactions .
these were graded according to standard systems in patients at the first episode , and after re - stings , during vit.results .
one - hundred and 8four out of the 202 patients referred had a complete data set . in 32 ( 17.4% ) patients ,
the allergic reaction occurred during work activities performed outdoor .
of these , 31.2% previously stung by hymenoptera at work , and receiving vit , were re - stung during occupational activity .
the grades of reaction developed under vit treatment resulted clinically less severe than of those occurred at the first sting ( p - value = 0.031).conclusion .
our findings confirmed the clinical relevance of hva , and described its occupational features in outdoor workers with sensitization , stressing the importance of an early identification and proper management of the professional categories recognized at high risk of hymenoptera stings .
the occupational physician should be supported by other specialists to recommend appropriate diagnostic procedures and the prescription of vit , which resulted an effective treatment for the prevention of episodes of severe reactions in workers with a proven hva . |
peripheral t - cell lymphomas ( ptcl ) are a rare and heterogeneous group of non - hodgkin s lymphomas ( nhl ) deriving from mature , post - thymic t- and natural killer ( nk- ) cells .
ptcl count for approximately 10% of all nhl in europe and north america,13 but present with a higher incidence in east asia and the carib - bean , especially with respect to epstein - barr virus and human t - cell leukemia virus type - i associated entities.46 in contrast to b - cell nhl that are mainly classified into indolent and aggressive subtypes .
ptcl are further subdivided primarily according to their site of manifestation . with regard to the current who classification , leukemic , cutaneous , nodal , and extranodal ptcl
are distinguished.6 in general , cutaneous and leukemic entities show an indolent clinical course and are separated from the nodal and extranodal subtypes . therefore , following a commonly used closer definition of ptcl , also used in this review , ptcl only include nodal and extranodal ptcl .
the most frequent entities are ptcl not otherwise specified ( ptcl , nos ) , angioimmunoblastic t - cell lymphoma ( aitl ) , and anaplastic large cell lymphoma ( alcl ) with or without expression of the anaplastic lymphoma kinase ( alk).7 apart from alk - positive alcl , ptcl have a poor clinical outcome.713 to date , due to the rare incidence and the lack of randomized clinical phase iii trials , there is no consensus on standard therapy either in the upfront setting or for refractory or relapsed ( r / r ) ptcl . as first - line therapy , anthracycline - based conventional ( chop - like ) multi - agent chemotherapy protocols are most commonly used .
however , with this approach , long - term remissions are achieved only in a minority of patients , resulting in a median overall survival ( os ) of 9 to 42 months.1416 several prospective series have shown promising results for a consolidation treatment using myeloablative therapy with autologous stem cell transplantation ( autosct ) in patients responding to induction chemotherapy.1721 therefore , this approach is recommended in many centers ; however , randomized data are not available yet .
salvage treatment for ptcl is often required because most patients have refractory disease or eventually relapse .
several strategies have been investigated to improve the prognosis of patients with r / r ptcl .
however , the data are sparse and available studies lack a randomized control arm . in a recently published retrospective
analysis mak et al could demonstrate that conventional chemotherapy does not impact on os in r / r ptcl and seems not to be superior to best supportive care alone.22 on the other hand , several series on allogeneic stem cell transplantation ( allosct ) can lead to long - term disease - free survival in a subgroup of patients.2331 however , most of the data on allosct are retrospective , and consequently , the results are biased by patient selection . moreover , this approach is associated with a substantial treatment - related morbidity and mortality and is limited to eligible patients .
therefore , with respect to the median age of patients with ptcl , that is , above 60 years , many patients are not candidates for even dose - reduced conditioning regimen - based allosct . in summary , since conventional treatment strategies alone seem to have limited efficacy or are restricted only to subsets of patients , novel targeted agents with a more specific mechanism of action are urgently needed .
following decades without any noteworthy progress in the treatment of r / r ptcl , four drugs have been approved worldwide for the treatment of r / r noncutaneous ptcl in the last 6 years .
pralatrexate , an antifolate , and romidepsin , a histone deacetylase inhibitor ( hdaci ) , have shown significant efficacy in r / r ptcl , and have therefore been approved by the united states food and drug administration ( fda ) in 2009 and 2011 , respectively.3234 brentuximab vedotin , a cd30-targeted immunoconjugate , has shown a high response rate of 85% in a phase ii study of 58 patients with cd30 + alcl who had experienced at least one prior therapy.35 for r / r alcl , expressing the cd30 antigen brentuximab vedotin was approved by the fda and the european medicines agency ( ema ) in 2011 and 2012 , respectively .
this review focuses on belinostat , its current impact on treatment algorithm and its future perspective .
histones are proteins that compact dna in the cell nucleus and are modified by acetylation , methylation , or phosphorylation
. histone deacetylases ( hdac ) are a class of enzymes that allow tight dna wrapping by removing acetyl groups from an -n - acetyl lysine amino acid on a histone , and thereby regulate dna expression . to date , four classes of hdac are known . unlike other hdaci , belinostat , a hydroxamic acid - derived pan - hdaci , targets class i , ii , and iv hdac , showing antitumor and antiangiogenic properties in a wide range of cancer cell lines with sub to low micromolar potency in vitro.36 in general , hdaci targets the hdac , thereby increasing acetylation of different substrates in the nucleus .
however , so far , the exact mechanism of action of hdaci in ptcl is unknown .
this could lead to alterations in gene expression effecting cell growth , cell cycle arrest , cell differentiation , and programmed cell death ( apoptosis ) that can be reconstituted by hdaci.37 furthermore , deacetylation of histones can lead to silencing of tumor suppressor genes.38 therefore , hdaci might re - express epigenetically silenced tumor suppressor genes and have the potential to reactivate the innate tumor control .
the pharmacokinetics data of belinostat have been initially investigated after intravenous or oral administration in rats and dogs .
the drug showed two - compartment kinetics with rapid distribution and an elimination half - life of 12 hours .
following rapid metabolism to several metabolites , main excretion of belinostat was via the bile and/or feces.39 in a pharmacokinetics and pharmacodynamics study in patients with solid tumors belinostat displays three - compartment pharmacokinetics with an elimination half - life ranging from 0.3 to 1.3 hours independent of dose .
with regard to area under the curve ( auc ) and cmax , the drug showed linear ( dose - proportional ) pharmacokinetics without any relevant drug accumulation .
the pharmacodynamics studies revealed a defi - nite increase in histone h4 acetylation at the end of infusion at all doses . at doses
> 150 mg / m , the increased h4 acetylation was sustained and persists above baseline levels up to 24 hours after the end of infusion . furthermore , the authors revealed a dose - related increase in histone h4 acetylation auc up to approximately 900 mg / m.40
belinostat was first investigated in several phase i trials to determine the maximum tolerated dose ( mtd).4042 in the study by steele et al , in 46 patients with advanced solid tumors , the intravenously given dose ranged from 150 mg / m to 1,200 mg / m . during this dose - escalating phase ,
dose - limiting toxicities developed at a dose of 600 mg / m in one patient and at a dose of 1,200 mg / m in three patients . after continuing the study at a dose level of 1,000 mg / m without dose - limiting toxicities in all six patients , an additional 18 patients were treated at this dose level .
given the results of preliminary studies on pharmacokinetics and pharmacodynamics and the observed toxicities , the mtd was determined to be 1,000 mg / m on days 1 to 5 of every 3-week cycle .
dose - limiting toxicities were fatigue , diarrhea , nausea , emesis , and atrial defibrillation.40 in another phase i study in 16 patients with advanced hematologic malignancies , a similar dose of 1,000 mg / m in the same schedule was recommended for future phase ii studies .
the most common treatment - related adverse events of all grades were nausea , vomiting , fatigue , and flushing . besides one case of grade 3 lymphopenia , no grade 3 or 4 hematological toxicity was observed
. two treatment - related grade 4 adverse events of renal failure occurred in two patients with multiple myeloma.41 in the phase i study by lassen et al , belinostat was investigated in combination with carboplatin and paclitaxel in 23 patients with solid tumors . again
grade 3/4 adverse events included leucopenia , neutropenia , thrombocytopenia , anemia , peripheral sensory neuropathy , fatigue , vomiting , and myalgia .
importantly , the pharmacokinetics of belinostat , paclitaxel , and carboplatin were not altered by the concurrent administration.41 oral administration of belinostat has also been evaluated using different regimen in advanced solid tumors and hematologic malignancies.4345 however , taking together the available data , the optimal dosing and scheduling of oral belinostat have not been established yet .
in the first published phase ii study on belinostat in the treatment of patients with t - cell lymphoma , foss et al evaluated safety and efficacy in 53 patients with cutaneous t - cell lymphoma ( n=29 ) and ptcl ( n=24 ) .
this was an open label , international multicenter study conducted in 15 institutions in five countries .
the subgroup of patients with ptcl was heavily pretreated and received a median of three prior systemic therapies .
the ptcl cohort had a median age of 64 years , with a male predominance of 71% .
most subtypes were ptcl , nos ( n=13 , 54% ) , alcl ( n=3 , 13% ) , and aitl ( n=3 , 13% ) .
belinostat was given as a 30-minute infusion of 1,000 mg / m on days 1 to 5 of a 3-week cycle . a dose escalation to 1,200 mg/2 for cycle 2 and 1,400 mg2 for cycle 3 was permitted in the absence of grade 2 treatment - related adverse events .
responding patients who achieved a partial remission ( pr ) or a stabilization of the disease after cycle 2 were allowed to receive six additional courses or could continue belinostat therapy until disease progression .
patients obtaining a complete remission ( cr ) were eligible for retreatment at the time of progression at the investigators discretion .
secondary endpoints were duration of response , time to response , time to progression and safety . for the ptcl group ,
orr was 25% including two complete and four prs . in four patients ( 17% ) ,
the time to response ranged from 33 days to 431 days , the median duration of response was 109 days , and the median time to progression was 82 days.46 final results from the much larger belief trial , a phase ii study on 129 patients with r / r ptcl were presented by oconnor at the asco meeting 2013.47 patients , who had failed at least one prior therapy , were enrolled in this single - arm study at 62 sites in north america , europe , and africa .
further inclusion criteria included measurable lymphoma manifestation , thrombocyte counts of 50,000/l , absence of prior hdaci therapy , adequate organ function , and no relapse following autosct or allosct within 100 days .
secondary endpoints were safety , os , progression - free survival ( pfs ) , duration of response , time to response , time to progression , 1-year progression - free rate , and 1-year survival rate .
patients were treated until disease progression , unmanageable toxicity , death , or successful bridging to stem cell transplantation .
the remaining subtypes included aitl ( n=22 , 18% ) , alcl ( n=15 , 13% ) , and others ( n=6 , 6% ) .
previous chop / chop - like regimen had been given to 125 patients ( 96% ) .
a total of 27 patients ( 21% ) had undergone prior autosct and two patients ( 2% ) had had an allosct .
the median time from first diagnosis to study entry was 12 months and the median time from last disease progression to study entry was 1 month .
the median number of cycles administered was two , and the median duration of treatment was 7 weeks .
the main reasons for treatment discontinuation were progressive disease ( n=82 ) , death ( n=14 ) , patient decision ( n=11 ) , and adverse events ( n=9 ) . a total of 17 patients ( 13% ) required dose reduction mainly to the first level of dose reduction ( 750 mg / m ) . in terms of efficacy ,
13 patients ( 11% ) achieved a cr , 18 patients demonstrated a pr ( 15% ) , resulting in an orr of 26% . in responding patients , the median time to response was 5.6 weeks ( range , 4.350.4 weeks ) .
importantly , nine patients ( 7.5% ) were able to proceed to stem cell transplantation .
for the subgroup of patients ( n=20 ) with a thrombocyte count < 100,000/l , orr , duration of response , median pfs , os , and time to response were considerably worse compared with patients presenting with a baseline platelet count 100,000/l . in a subgroup analysis presented at the lnternational conference on malignant lymphoma in lugano in 2013 , belinostat treatment resulted in a favorable 45% response rate among the subgroup of 22 patients with r / r aitl .
this resulted in a median pfs and os for this cohort of 5.8 and 9.2 , respectively , which seems to be somewhat superior to the results for the entire ptcl group .
table 1 summarizes the efficacy data of the two phase ii studies on belinostat.48 recently , a case report was published documenting high efficacy of belinostat in an elderly female patient with ptcl - nos.49 after failing three different chemotherapy regimens , the patient was treated with belinostat and achieved a cr after two cycles .
the patient received a total of 28 cycles and maintained a cr for 46 months .
the patient relapsed 15 months after the last application of belinostat and died 3 months later due to progressive disease ( personal communication ) .
in the phase ii study by foss et al , 23 treatment - emerged adverse events of all grades were documented in 77% of all patients . these included nausea ( 67% ) , constipation ( 38% ) , and vomiting ( 25% ) with the highest incidence . for the ptcl cohort , five grade-3 nonhematologic events ( pneumonitis , paralytic ileus , cellulitis , and two cases of rash ) and one grade-4 event ( thrombocytopenia ) were reported .
one patient with a history of left anterior hemiblock died of ventricular fibrillation 6 days after the last dose of belinostat in cycle 2 .
however , after assessment of the pre- and post - study ecgs by an independent cardiology review , the fatal arrhythmia was determined unlikely to be related to belinostat exposure .
hematologic toxicities grades 3 and 4 were seen in 15 patients ( 63% ) with ptcl .
three patients discontinued treatment due to therapy - emerged adverse events . in the belief trial , hematologic toxicity of grade 3/4 was seen in 12% of the patients for anemia , 13% for leukopenia , and 15% for thrombocytopenia .
most reported adverse events included dyspnea ( 6% ) , pneumonia ( 5% ) , febrile neutropenia ( 5% ) , and fatigue ( 5% ) .
conventional chemotherapy has very limited value and only a minority of patients is eligible to undergo ( allo ) stem cell transplantation .
belinostat , a pan - hdaci , has shown conclusive effi - cacy in two phase ii trials .
the orr of 26% demonstrated in the belief trial combined with the good safety profile led to an accelerated approval of belinostat for r / r ptcl by the fda in july 2014 .
belinostat has been incorporated in the guidelines of the national comprehensive cancer network as salvage therapy for patients with r / r ptcl .
the response rate of belinostat in the cited studies is in the range of that reported for romidepsin and pralatrexate , but the toxicity profiles of the three drugs differ . to date , given the limited data , a clear advantage of one drug over the other can not be seen .
decision making in favor of one of the drugs should be made on an individual basis , especially considering the differing toxicity profiles .
in addition , belinostat may be considered to serve as bridging therapy to achieve a remission prior to potentially definite stem cell transplantation .
table 2 summarizes the clinical data of all four fda - approved drugs for r / r ptcl .
due to its favorable safety profile and proven efficacy , belinostat seems a very attractive candidate for combination therapies .
a phase i clinical trial in combination with chop chemotherapy has been initiated in newly diagnosed ptcl ( nct01839097 ) .
this approach might lead to a randomized phase iii study in the future comparing this combination therapy with standard chop therapy in the upfront setting .
in addition , belinostat is under investigation in combination strategies and is being evaluated as an oral formulation for solid tumors . | peripheral t - cell lymphomas ( ptcl ) represent a heterogeneous group of rare malignancies that with the exception of anaplastic lymphoma kinase expressing anaplastic large cell lymphoma , share a poor outcome after standard ( eg , anthracycline - based ) chemotherapy .
most patients are either refractory to initial therapy or eventually relapse .
randomized studies for relapsed / refractory ptcl are not available , however , recently published data show that conventional chemotherapy has very limited efficacy in the salvage setting .
thus , novel drugs are urgently needed to improve the outcome in this setting .
belinostat , a pan - histone deacetylase inhibitor , has demonstrated meaningful efficacy and a favorable toxicity profile in two single - arm phase ii trials on 153 patients with relapsed / refractory ptcl .
the conclusive results led to an accelerated approval by the us food and drug administration .
the present review summarizes the clinical data available for belinostat , its current role , and future perspectives . |
although the results of adult and embryonic stem cell therapy for the infracted myocardium have yielded promising results for the enhanced regeneration of myocardial tissue leading to improved ventricular function [ 13 ] , the effectiveness of stem cell therapy is often blurred from the non - survival of the stem cells due to the oxidative stress in the normal tissue . in recent years
, several attempts have been made for the enhancement of the survival and proliferation of stem cells in conjunction with the stem cell therapy .
overexpression of cardiac survival protein pim-1 in cardiac progenitor cells ( cpcs ) has yielded promising results as demonstrated by the enhanced proliferation and functional improvement relative to control progenitor cells after myocardial infarction . in another study ,
intramyocardial injection of hepatocyte growth factor stimulated resident cpcs and potentiated cardiomyocyte regeneration after myocardial infarction by promoting the proliferation and survival of cpcs .
another related study with lipopolysaccharide preconditioning of mesenchymal stem cells before the transplantation surgery , resulted in superior neovascularization resulting in the recovery of cardiac function .
interestingly , reduced oxidative environment and inflammatory response was noticed in the infracted regions of the animals treated with simvastatin and stem cells .
based on these previously published results , we suggested that a reduction of the oxidative stress in the myocardium could improve the results the stem cell therapy . in this study , we examined the effect of resveratrol on the modification of adult cardiac stem cell therapy in the rats .
this study is unique in that we used resveratrol as nutrient to alter the oxidative environment of the myocardium during the stem cell therapy .
our results show that maintaining a reduced tissue environment with resveratrol in rat hearts indeed resulted in the regeneration of infracted heart by adult cardiac stem cells as shown by improved cell survival , differentiation cardiac function .
sprague - dawley male rats weighing between 250 and 300 g were fed ad libitum regular rat chow with free access to water until the experimental procedure .
all animals used in this study received humane care in compliance with the animal welfare act and other federal statutes and regulations relating to animals and experiments involving animals and adheres to principles stated in the guide for the care and use of laboratory animals , nrc publication , 1996 edition .
the rats were randomly assigned to one of the three groups : ( i ) left anterior descending coronary artery ( lad ) occlusion in control group , ( ii ) lad occlusion and stem cell treatment in control group and ( iii ) lad occlusion and stem cell treatment in resveratrol- ( 2.5 mg / kg ) treated group .
the rats were anesthetized with ketamine ( 100 mg / kg ) / xylazine ( 10 mg / kg , ip ) in combination with buprenorphine ( 0.52.5
mg / kg , s / c , bd ) , intubated and ventilated at a rate of 70 breaths / min .
a 60 polypropylene suture was passed under the lad at the level of the left atrial appendage .
then stem cells were delivered directly on the myocardium into the bordering regions of ischemia in the second ( control ) and the third ( resveratrol - treated ) group .
the injection needle was introduced 1 mm into the myocardium at an angle ( 1020 ) in a cranial direction .
after completion of all the surgical procedures , the chest was closed with 40 nylon sutures and the ventilation rate was reduced to 50 breaths / min . till the spontaneous respiration starts .
the rats were then extubated and kept in a temperature - controlled environment to prevent hypothermia where the rats were continuously monitored .
buprenorphine ( 0.1 mg / kg s.c . ) was administered as an analgesic and gentamycin ( 1 mg / kg ) were used as antibiotic to prevent post - surgical infections .
after 28 days of surgery , rats were sedated using isoflurene ( 3% , inhaled ) , shaved and placed on a heated pad .
ultrasound gel was spread over the pericardial region , and ultrasound biomicroscope ( vevo 770 , visual - sonics , inc . ,
transthoracic m - mode echocardiography were performed with a vevo 770 ultrasound system ( agilent technologies , andover , ma , usa ) equipped with a 25 mhz transducer as described by us earlier to visualize the left ventricle . with a 25 mhz transducer was used to visualize the left ventricle .
the left ventricle was analysed in apical , parasternal long axis , and parasternal short axis views for left ventricular inner diameters ( lvids ) both in systole and diastole , and lv functional parameters such as ejection fraction ( ef ) , fractional shortening ( fs ) and cardiac output ( co ) .
two - dimensional directed m - mode images of the lv short axis were taken just below the level of the papillary muscles to analyse ventricular wall thickness and chamber diameter .
all left ventricular parameters were measured according to the modified american society of echocardiography recommended guidelines .
all measurements from different animals were averaged and represented as mentioned earlier . after performing m - mode echocardiography , rats were anesthetized with sodium pentobarbital ( 80 mg / kg , i.p . ) , ( abbott laboratories , north chicago , il , usa ) and with the anticoagulant heparin sodium ( 500 iu / kg .
( elkins - sinn , inc . , cherry hill , nj , usa ) .
after ensuring sufficient depth of anaesthesia , thoracotomy was performed , hearts were isolated and perfused in the retrograde langendorff mode at 37c at a constant perfusion pressure of 100 cm of water ( 10 kpa ) for a 10 min .
henseleit bicarbonate buffer ( in mm : sodium chloride 118 , potassium chloride 4.7 , calcium chloride 1.7 , sodium bicarbonate 25 , potassium biphosphate 0.36 , magnesium sulphate 1.2 and glucose 10 ) .
analysis of variance test followed by bonferoni s correction was first carried out to test for any differences between the mean values of all groups .
if differences were established , the values of the treated groups were compared with those of the control group by a modified t - test .
heart tissue samples collected at the end of experiments were frozen with tissue - tek embedding medium optimal culture temperature o.c.t .
compound and subjected to cryo - sectioning . the obtained specimens ( 5 m cuts ) were processed for immunofluorescence analysis as described previously .
the primary antibodies such as gfp ( cell signaling technology , beverly , ma , usa ; 1:100 dilution ) , c - kit ( cell signaling technology ; 1:100 dilution ) , nuclear factor - e2-related factor-2 ( nrf2 ; cell signaling technology ; 1:50 dilution ) , redox effector factor-1 ( ref-1 ; santa cruz biotechnology , santa cruz , ca , usa ; 1:50 dilution ) , ki67 ( santa cruz biotechnology ; 1:50 dilution ) and cardiac myosin ( abcam , cambridge , ma , usa ; 1:100 dilution ) were incubated overnight at 4c .
this was followed by incubation with alexa - fluor fluorochrome - conjugated secondary antibodies ( molecular probes ; 1:500 dilution ) , and the nuclear staining were performed with topro-3-iodide ( molecular probes , carlsbad , ca , usa ; 1:500 dilution ) .
the slides were washed and covered with mounting medium , and examined under a fluorescence microscope .
confocal microscopic images were obtained using zeiss lsm 510 ( thornwood , ny , usa ) confocal laser scanning microscope by simultaneous recording in the 488 , 530 and/or 560 channels as appropriate .
we monitored the nuclear expression of nrf2 and ref-1 7 days and 28 days after lad occlusion using confocal immunofluorescence microscopy .
our results show that the nuclear expression of nrf2 and ref-1 were significantly increased 7 days after lad occlusion in resveratrol - treated myocardium relative to control ( table 1 ) .
however , the nuclear expression of nrf2 and ref-1 were not significantly increased 28 days after lad occlusion ( data not shown ) .
regeneration of infracted myocardium with resveratrol - modified cardiac stem cells p < 0.05 versus resveratrol .
cellular proliferation was studied by the expression of ki67 28 days after lad occlusion , and our results show that ki67 staining was remarkably increased in resveratrol - treated myocardium compared to control hearts ( table 1 ) .
quantification of gfp staining 28 days after lad occlusion indicate that gfp staining was remarkably increased in resveratrol - treated myocardium compared to control hearts .
confocal microscopic images showed the significant enhancement of c - kit cells 28 days after myocardial infarction in resveratrol - treated samples ( fig .
1a ) , and the co - expression of sdf-1 and gfp in resveratrol - treated hearts ( fig .
1b ) leading to the regeneration of the myocardium in the resveratrol - treated heart ( fig .
m - mode echocardiogram of rats recorded at 28 days after survival surgery reveal that resveratrol treatment enhanced the cardiac stem cell - mediated improvement in cardiac functional parameters such as lvid in systole , ef , lvid in diastole , fs and co ( table 2 ) .
co - expression of sdf-1 and gfp in the resveratrol - treated hearts . ( a ) expression of c - kit ( green channel ) 28 days after myocardial infarction in resveratrol - treated samples , where the blue channel shows the nucleus .
( b ) confocal microscopic images of left ventricular tissue section showing the expression of sdf-1 and gfp 28 days after myocardial infarction in resveratrol - treated samples .
( c ) expression of cardiac stem cell mediated gfp ( green ) in the resveratrol - treated heart .
improvement of cardiac function after resveratrol - modified stem cell therapy lvid - s : left ventricular internal diameter in systole ; lvid - d : left ventricular internal diameter in diastole ; ef : ejection fraction ; fs : fractional shortening ; co : cardiac output .
despite the cell - based therapy for cardiac diseases has yielded promising results for the improvement of cardiac function and regeneration , the stems cells fail to survive for a prolonged time for several factors including the persistence of oxidative environment in the target tissue . in clinical trials for the treatment of acute and chronic myocardial ischemia , a variety of progenitor cells including bone marrow - derived progenitor cells , bone marrow - derived mononuclear circulating progenitor cells , as well as skeletal myoblasts have been used .
even though the results of cell - based therapies are promising , the improvement in cardiac function and myocardial regeneration has not been satisfactory .
several modifications including the reduction of oxidative stress have been made in an attempt to improve the performance of a cell - based therapy by modifying the cells prior to treatment .
we suggested that the stem cell homing and proliferation could also be manipulated by modifying the physiological redox environment by proper nutrition .
thus , we examined the effects of adult cardiac stem cell therapy in animals treated with a definite dosage of resveratrol , a polyphenolic compound present in red wine and grapes , which possesses the ability to enhance myocardial survival by changing the intracellular oxidative environment into a reduced environment .
we also selected this compound because of its well - known ability to enhance the antioxidant defence mechanism .
our results revealed for the first time that it is possible to maintain a safer niche for the stem cells with proper nutrition , which could result in enhanced proliferation , myocardial regeneration and differentiation leading to an improved cardiac function . to achieve this , we pre - treated the rats with resveratrol , in a pre - determined dosage of 2.5 mg / kg / day .
resveratrol has the potential to donate hydrogen or react with superoxide anion , hydroxyl radicals and lipid peroxyl radicals , and has been shown to modulate antioxidant enzymes involved in the phase ii response such as haem oxygenase 1 .
furthermore , resveratrol has been shown to increase plasma antioxidant capacity and decrease lipid peroxidation in vivo . in vitro studies
show that resveratrol prevents myocardial infarction by chelating metal ions as well as by directly scavenging free radicals .
resveratrol induces the activities of catalase and quinone reductase 1 and reduces the amount of reactive oxygen species ( ros ) generated by menadione in the myocardium of guinea pigs .
altogether , these results indicate that resveratrol can suppress pathological oxidative stress in vivo . in this study
, we examined the redox status of the myocardium 7 days after the survival surgery by monitoring nrf2 , a master gene of the endogenous antioxidant defence system , in the heart .
a recent study showed that redox status in the extracellular compartment regulates intracellular ros , which play an important role in the activation of nrf2 and up - regulation of antioxidant and detoxification systems in mouse embryonic fibroblasts .
nrf2 plays a critical role in the protection of the murine heart against pathological cardiac hypertrophy and heart failure via suppressing oxidative stress nrf2 mediated adaptive response has been shown to protect against superoxide anion - induced oxidative damage and cadmium - induced oxidative stress in mouse embryonic fibroblasts . because dietary polyphenols including resveratrol are known to elicit anti - oxidant mechanism via activation of nrf2 , we studied the activation of nrf2 as a redox activation marker in our samples .
the nuclear activation of nrf2 was significantly elevated in resveratrol - treated rats , and a close association between nrf2 activation and gefp stem cells localization was noticed .
further , it is to be noted that endogenous ros are shown to function as signalling molecules for myogenic differentiation via regulation of nrf2 and glutathione redox ape1/ref-1 is a novel redox component of signal transduction processes that regulate eukaryotic gene expression .
ape1/ref-1 activates several transcription factors and facilitates their dna binding via the reduction of a cysteine residue .
three - dimensional molecular structure modelling and virtual screening show that resveratrol docks into a druggable pocket of ref-1 protein .
previously , we have demonstrated that resveratrol possesses the ability to protect the cells at lower doses as observed during pharmacological preconditioning of the heart , whereas at higher doses it causes cell death as found for cancer cells . in the present study , we have found that ref-1 activation was significantly increased in resveratrol - treated hearts . in conclusion
, our results suggest that cell - based therapy in the ischemic myocardium can be enhanced by nutritional modification of intracellular redox environment with resveratrol via enhanced stem cell survival , proliferation and cardiac regeneration and function compared to only stem cell treated rat hearts .
the above effects were shown to be mediated through the ability of resveratrol to enhance the redox potential in the target organ .
| abstractto study the efficiency of maintaining the reduced tissue environment via pre - treatment with natural antioxidant resveratrol in stem cell therapy , we pre - treated male sprague - dawley rats with resveratrol ( 2.5 mg / kg / day gavaged for 2 weeks ) .
after occlusion of the left anterior descending coronary artery ( lad ) , adult cardiac stem cells stably expressing egfp were injected into the border zone of the myocardium .
one week after the lad occlusion , the cardiac reduced environment was confirmed in resveratrol - treated rat hearts by the enhanced expression of nuclear factor - e2-related factor-2 ( nrf2 ) and redox effector factor-1 ( ref-1 ) . in concert , cardiac functional parameters ( left ventricular ejection fraction and fractional shortening )
were significantly improved .
the improvement of cardiac function was accompanied by the enhanced stem cell survival and proliferation as demonstrated by the expression of cell proliferation marker ki67 and differentiation of stem cells towards the regeneration of the myocardium as demonstrated by the enhanced expression of egfp 28 days after lad occlusion in the resveratrol - treated hearts .
our results demonstrate that resveratrol maintained a reduced tissue environment by overexpressing nrf2 and ref-1 in rats resulting in an enhancement of the cardiac regeneration of the adult cardiac stem cells as demonstrated by increased cell survival and differentiation leading to cardiac function . |
immunoglobulin light - chain amyloidosis ( al ) is a rare systemic disease characterized by progressive tissue and organ extracellular fibrillar deposition .
kidney spontaneous rupture is not a recognized complication in amyloidosis or autologous stem cell transplantation ( asct ) .
we report the singular case of a bilateral spontaneous kidney rupture during asct for al with renal rescue .
a 46-year - old caucasian female , affected by nephrotic syndrome , was diagnosed with al amyloidosis by renal biopsy ( figure 1 ) , performed on the left kidney ( maximal longitudinal renal axes 10.9 cm ) , in december 2006 , with an igg- as monoclonal protein .
the data of laboratory examination at the time of diagnosis are listed in table 1 .
a 46-year - old caucasian female , affected by nephrotic syndrome , was diagnosed as al amyloidosis by renal biopsy : ( a ) amyloid deposition ( congo red staining ) viewing by standard light microscopy and ( b ) polarized light microscopy ; apple green birefringence is elicited on polarization ( 100 ) .
( c ) immunofluorescence microscopy for lambda light chains of the same specimen ( frozen tissue ) ( 100 ) .
data of laboratory examinations at december 2006 ( diagnosis of amyloidosis ) and july 2007 ( admission for asct ) scr , serum creatinine ; scys c , serum cystatin c. in july 2007 , she was considered suitable for asct and started the stem - cell mobilization with g - csf 10
g / kg / day , yielding 2.081 10 nc / kg ( 8.323 10 cd34
laboratory parameters showed serum creatinine ( scr ) , serum cystatin c ( scys c ) , urea , haemoglobin ( hb ) and platelets ( plt ) levels in the normal ranges , bence jones proteinuria positive , 24-h proteinuria in nephrotic range ( 4.5 g ) , serum albumin level 2.1 g / dl , and white blood cells ( wbc ) 4050/l ( table 1 ) . just before transplantation
, she was submitted to a conditioning regimen consisting as protocol of melphalan ( 200 mg / m , total dosage 340 mg ) administered at day 3 before transplant .
one day before asct , the patient presented a sudden onset of flank abdominal pain with symptoms and signs of a severe haemorrhagic shock .
an urgent computed tomography ( ct ) scan of the abdomen and pelvis showed a severe right renal capsular bleeding with a voluminous haematoma ( 20 cm ) ( figure 2a ) .
the pathological findings consisted of an ochre normal - dimension kidney ( 10.5 7 4.5 cm ) with large haemorrhagic lesions in medium and apical regions and diffuse subcapsular haemorrhages , with vascular aspect of hilar venous thrombosis .
histologically , there were widespread amyloid deposits in the interstitium and vessel walls with a high intensive congo red - stained positivity ; no findings were found for vasculitis or for neoplastic .
a. ct scan of the abdomen and pelvis showed a severe right renal capsular bleeding with a voluminous haematoma ( 20 cm ) .
two days after surgical intervention , the patient underwent asct , and antimicrobial prophylaxis was started .
however , she developed a sepsis due to pneumonia , in response to broad - spectrum antimicrobial therapy . during this time
the patient presented a second haemorrhagic shock with left abdominal pain and anuria . at the time , coagulation times were within the normal range , while hyperfibrinogenaemia ( fibrinogen 533 mg / dl ) and a low plt count were present ( platelets 14 000/l ) .
a ct abdomen showed a left renal laceration with a vast haemorrhage ( figure 2b ) . due to the high bleeding risk ,
because of the onset of acute renal failure , daily renal replacement therapy ( rrt ) in haemodiafiltration modality was started for a total of 10 sessions .
however , 48 h after the last dialysis session the patient presented a septic shock status with aspergillus pneumonia , plus the onset of acute respiratory distress syndrome and anuria .
she was submitted to non - invasive respiratory support and aggressive antifungal therapy ; cardiocirculatory system was maintained by vasoactive therapy , and new sessions of crrt ( in high - volume haemofiltration modality ) were started .
net ultrafiltration rate was adjusted in each session according to the body weight and the better haemodynamic compliance .
blood pressure and renal and respiratory functions gradually improved , and crrt was stopped . at day + 36 post - transplant ,
the patient was discharged with preserved diuresis , and laboratory tests for renal function were as follows : scr 2 mg / dl , urea 69 mg / dl , 24-h proteinuria 2.2 g , hb 13.4 g / dl , plt 47 000/l , wbc 3410/l , and serum free light chain 9.13 mg / dl in urine .
the follow - up at 24 months showed scr 1.48 mg / dl , urea 76 mg / dl , 24-h proteinuria 196.5 mg , absence of bence jones proteinuria and serum free light chain 2.03 mg / dl .
the deposition of immunoglobulin light - chain fragments damages several organs causing their progressive failure and death .
the kidney is involved in 40% to 73% of patients [ 2,35 ] , and proteinuria is by far the most common manifestation . if on dialysis , these patients have a poor survival rate .
although rare , spontaneous organ ruptures occur [ 68 ] , and seem to be due to the loss of vascular integrity leading to spontaneous bleeding and subsequent rupture .
spontaneous subcapsular or perinephric bleeding of the kidney is described as a rare complication in renal cell carcinoma , angiomyolipoma and vascular diseases such as periarteritis nodosa ; moreover , rarely are spontaneous renal haematomas reported in chronic haemodialysed patients , particularly in those who have acquired renal cystic disease . in our patient ,
the ct scans performed to evaluate the eligibility for asct and then again to explain the rupture of kidneys did not show neoplastic lesions ; moreover , the immunological screening and the renal biopsy showed amyloidosis and excluded any kind of vasculitis or other immunological disorders . therefore , it is possible that the spontaneous renal rupture could be due to amyloidosis or to asct . in the presented case ,
renal vein thrombosis could be explained by nephrotic syndrome , a well - recognized condition associated with a hypercoagulability state .
in fact , despite the underlying causes of the hypercoagulable state in patients with nephrotic syndrome that are not well understood , a variety of haemostatic abnormalities have been described , including decreased levels of antithrombin and plasminogen ( due to urinary losses ) , increased platelet activation , hyperfibrinogenaemia , inhibition of plasminogen activation , and the presence of high - molecular - weight fibrinogen moieties in the circulation .
amyloidosis , however , is characterized by an increased bleeding risk , but adamu et al
nevertheless , renal vein thrombosis is not recognized as a possible cause of renal rupture ; so with regard to the right kidney , we could speculate a spontaneous rupture secondary to vessel amyloidosis leading to venous thrombosis .
a second hypothesis , is that the hilar venous thrombosis , due to nephrotic syndrome , was the possible cause of renal rupture . in the second episode of spontaneous renal rupture ( in which there was no nephrectomy )
first , a renal vein thrombosis can not be excluded due to the same procoagulant mechanisms suggested in the first rupture ; nevertheless , after a few days , diuresis restarted , so we must consider a spontaneous resolution of thrombosis after renal rupture ; moreover , the platelet count was very low because of the bone marrow suppression as a result of chemotherapy , and in this scenario , it is difficult to evoke a thrombotic cause .
second , before the second kidney rupture , the patient was submitted to asct and therefore to granulocyte colony - stimulating factor ( g - csf ) . in the literature ,
organ spontaneous rupture secondary to asct is often related to an increase in organ size as a result of extramedullary haematopoiesis .
the kidney is not a haematopoietic organ , and in the literature , there are extremely rare reports [ 1315 ] about the occurrence of a renal extramedullary haematopoiesis .
in fact , it usually occurs in the reticuloendothelial system , involving the liver , spleen and lymph nodes , in association with some haematological disorders ( in particular myelofibrosis ) , as a response to erythropoiesis failure in bone marrow . in our patient
, we did not report any failure of bone marrow erythropoiesis before chemotherapy , nor did renal histological findings ( for the right nephrectomized kidney or the left kidney ) support this rare possibility .
third , a spontaneous renal rupture attributed to acute tubular necrosis could be considered , but in the literature , this complication is related only to allograft kidneys . finally , without any histological support , we were not able to determine the definitive cause of the second renal rupture , but a loss of vascular integrity leading to spontaneous bleeding and subsequent rupture is suggestive . in any case , suggested therapeutic approaches in kidney rupture are contrasting .
some authors advocate radical nephrectomy due to the possibility of a small clinically unapparent renal cell carcinoma .
in contrast , others have advised a conservative approach when diagnostic studies fail to demonstrate a significant pathology and clinical signs are stabilized .
nevertheless , in many cases , the severe haemorrhage necessitates surgical exploration . in our patient , the first haemorrhagic event required nephrectomy to control the haemodynamic status . in the second event , a conservative approach was chosen because of the single - kidney status and the high bleeding risk .
this strategy allows the patient to maintain a residual renal function without the need for dialysis . in conclusion ,
spontaneous renal rupture is a medical and surgical emergency which needs a rapid diagnosis and prompt treatment , and al amyloidosis should be included in the differential diagnosis .
all the authors have any financial interests or arrangements with a company whose product was used in this study or is referred to in a manuscript , any financial interests of arrangement with a competing company , any direct payment from any source to an author(s ) for the purpose of writing the manuscript , and any other financial connections , direct or indirect , or other situations that might raise the question of bias in the work reported or the conclusions , implications or opinions stated including pertinent commercial or other sources of funding for the individual author(s ) or for the associated department(s ) or organization(s ) , personal relationships , or direct academic competition . | kidney spontaneous rupture is not a recognized complication neither for amyloidosis nor of autologous stem cell transplantation ( asct ) .
a 46-year - old white woman , affected by nephrotic syndrome , was diagnosed as al amyloidosis by renal biopsy .
we report the singular case of a bilateral spontaneous kidney rupture during asct for al with renal rescue . |
trichotillomania ( ttm ) is a type of impulse control disorder , characterized by recurrent pulling of hair , which leads to pleasure and relief of tension .
prevalence rates of this condition range between 1% and 13.3% , with initial mean age of onset between 10 years and 13 years and a notable peak at 12 - 13 .
the disease leads to hair loss , which may sometimes be severe and lead to significant social and functional impairment .
the etiology of the disease is still unknown , although some have suggested a genetic component .
this was based on a limited number of reports on familial hair pulling and one twin concordance study .
we hereby describe a case of familial ttm in three generations , thereby underlining the familial basis for this disorder .
a 13-year - old male presented with 1-year history of focal hair loss in the mid - frontal scalp .
he was previously treated with local steroids for presumed alopecia areata , with no improvement .
examination revealed a patchy area of hair loss , with several short broken hairs of varying lengths [ figure 1a ] . on dermoscopy examination of the scalp
, we found the typical features of ttm , including short hairs with trichoptilosis , broken hair ( different lengths ) and black dots [ figure 1b ] .
histological examination showed trichomalacia with irregularly shaped hair follicles and melanin pigment casts [ figure 1c and d ] . upon further questioning , the father admitted repeated pulling of his beard hairs since puberty , with mild - to - moderate severity of symptoms .
the 60-year - old paternal grandfather also suffers from severe recurrent hair pulling of his beard since puberty , which sometimes precludes him from leaving home .
( a ) patchy area of hair loss on the scalp , with several short broken hairs of varying lengths ; ( b ) dermoscopy of the scalp lesion demonstrating short hairs with trichoptilosis , broken hair ( different lengths ) and black dots ; ( c - d ) low ( c ) and high ( d ) magnification histopathology of the scalp lesion demonstrating the presence of trichomalacia with irregularly shaped hair follicles ( arrows , c ) and melanin pigment casts ( arrows , d )
it is believed that the etiology of ttm is complex , involving biological , psychological and social factors .
this was based on a limited number of reports on familial ttm and one twin concordance study . in this twin study ,
respective concordance rates for monozygotic and dizygotic twin pairs were 38.1% and 0% for diagnostic and statistical manual of mental disorders iv criteria and 58.3% and 20% for non - cosmetic hair - pulling , leading to a heritability estimate of 76.2% .
rare variations in slitrk1 were associated with disorders of the obsessive - compulsive spectrum and among them also ttm .
mouse models also suggested a relationship between mutations in hoxb8 and sapap3 and ttm - like behavior in mice .
although several cases of familial ttm have been reported , to our knowledge , this is the first report of ttm in a three - generation family .
this report strengthens the possibility that ttm is a genetic disease , probably with a complex inheritance pattern .
it also underlines the importance of proper family history taking when examining a ttm patient . | trichotillomania ( ttm ) is a type of impulse control disorder , characterized by recurrent pulling of hair .
the etiology of ttm is complex , but a genetic contribution to this condition was advocated based on a limited number of reports on familial ttm .
we report a 13-year - old male with history of focal hair loss in the scalp .
examination showed a patchy area of hair loss , with several short broken hairs of varying lengths .
dermoscopy and pathology examinations were consistent with ttm .
upon further questioning , his father admitted repeated pulling of his beard .
the paternal grandfather also suffers from severe hair pulling of his beard since puberty . to our knowledge
, this is the first report of ttm in a 3 generation family .
this report strengthens the possibility that ttm is a genetic disease , probably with a complex inheritance pattern .
it also highlights the importance of appropriate family history taking when examining a ttm patient . |
the cystic fibrosis transmembrane conductance regulator ( cftr ) is a chloride channel in the apical membrane of epithelial cells 1 .
mutations in cftr result in impaired chloride conductance across the plasma membrane and are the basis of the genetic disease cystic fibrosis 2 .
almost 90% of patients contain at least one allele with a missing codon for phe508 ( f508del ) located in the first nucleotide binding domain ( nbd1 ) .
cftr is regulated by phosphorylation primarily on its regulatory region ( r region ) , which is an ~200residue , disordered segment of the protein 1 .
while cftr is a chloride channel , it is a member of the abc family of transporters with significant homologies in the transmembrane domains and nbds ; the r region , in contrast , is unique to cftr .
the following minireview is not intended to be a comprehensive summary of the extensive and at times contradictory r region literature .
instead , we focus on specific papers that highlight and enrich a mechanistic understanding of how phosphorylation affects regulation of cftr by the r region .
the nterminal boundary of the r region is not precisely defined , due to lack of clarity for the cterminal boundary of the immediately nterminal nbd1 . split cftr constructs lacking the r region ( 1634 , 8381480 ) traffic to the plasma membrane and conduct chloride , suggesting that they contain a complete functional nbd1 , and thus the nterminal boundary of the r region is ~n635 4 .
this is consistent with nmr data demonstrating that the cterminal residues of an nbd1 construct ending at g646 comprising helix h9 ( 637646 ) are in exchange with unfolded states and that an nbd1 construct ending at residue l636 displays stable folding 5 .
however , alignment of nbd sequences from homologous abc transporters such as hisp and malk to nbd1 suggests that the domain ends at residue s642 for an nterminal r region boundary of ~k643 3 .
the cterminal boundary of the r region is more defined ( about d835 ) , due to confidence in predicting the start of the immediately cterminal membranespanning domain 2 ( msd2 ) 3 .
the approximately 200 residues of the r region spanning these boundaries have an amino acid composition that markedly differs from the rest of cftr , with more hydrophilic and charged residues .
these features led to early recognition that the r region may be an intrinsically disordered region 6 .
since then , cd spectroscopy 6 , small angle xray scattering ( saxs ) 9 and nmr spectroscopy 10 have confirmed that the isolated r region does not have a stable threedimensional fold or even stably formed secondary structure .
disorder prediction software shows definitive disordered segments separated by segments that are on the discrimination limit for folded and disordered segments 9 .
cd data agree on a large fraction of random coil ( 3095% ) 6 with different amounts of helical ( 546% ) and content .
different construct boundaries and experimental conditions contribute to the inherent uncertainty ; constructs with earlier nterminal boundaries have more helical content .
saxs can be used to discriminate between folded , partially folded and random coil structures , and data for the r region indicate a substantial component of random coil with some partial structure 9 , incompatible with totally random coil structure 12 . while the r region is clearly disordered , it has fractional structure and clear functional roles that lead to some degree of sequence conservation among cftr proteins of different species , from fish to human 13 .
disordered protein sequences lacking a threedimensional fold are not under evolutionary pressure to maintain a constrained structure ; consequently disordered regions like the r region are much more variable than folded protein domains such as the nbds . nonetheless , not only are kinase recognition sequences conserved in the r region 3 , but the distances between phosphorylation sites ( i.e. relative positions in the sequence ) are also conserved 11 .
this conservation , together with the identification of a number of cysticfibrosiscausing mutations within the r region ( www.genet.sickkids.on.ca ) , highlight the importance of the r region for cftr function and regulation , including phosphorylation and potential conserved interaction segments .
nmr is the most useful technique for providing residuespecific information on intrinsically disordered proteins 14 .
chemical shifts are sensitive to the local electrochemical environment , with and carbon resonances particularly responsive to secondary structure .
r region secondary structure propensity estimated on the basis of chemical shifts indicates transiently populated secondary structure elements ( fig . 1 ) 10 .
the highest propensities for the helix reach 3040% , suggesting that segments 648670 , 755778 and 801818 sample helical conformation up to 3040% of the time .
the flexible and dynamic features of the r region make crystallization of the r region impossible and no single structural representation can capture the r region conformational ensemble
. however , xray structures of nbd1 containing some nterminal residues of the r region ( called the regulatory extension or re ) provide snapshots of the structural heterogeneity of this portion of the r region 15 and confirm the helical propensity of the nterminal segment observed by secondary structure propensity ( fig . 1 ) .
the orientation of the re with respect to the nbd1 and the helical boundaries differs in the crystal structures ( 1r0x , 1xmi ) ( fig .
key elements of cftr r region in ( a ) the nonphosphorylated and ( b ) the phosphorylated states .
positive values correspond to helical structure sampling , while negative values refer to extended conformations .
the lengths of 1433 interaction segments are set to six residues to match mode i binding to 1433 .
kinase phosphorylation sites of pka ( star ) , pkc ( circle ) and ampk ( triangle ) are marked .
both the secondary structure and binding experiments were carried out on nonphosphorylated ( open symbols ) and pkaphosphorylated ( solid symbols ) isolated r region ( 654838 ) .
heterogeneity of cftr r region : nbd1 interactions . nterminus of the r region ( red , residues 638671 ) in different nbd1 crystal structures ( a , 1r0x ; b , 1xmi ) oriented to show the nbd dimerization interface 15 .
the core nbd1 ( surface representation ) is colored as a gold gradient reflecting the proximity to atoms in the other nbd1 molecule within the nbd1:nbd1 homodimer structure ( 2pze ) . the flexible regulatory insertion ( ri ) of nbd1 that is in different conformations in the two structures
these studies demonstrating disorder in the isolated r region are relevant to understanding the r region within the context of fulllength cftr .
electron microscopy of cftr 17 has no discrete density for elements other than the msds and nbds homologous to sav1866 , a bacterial abc transporter , supporting the disordered nature of the r region .
attempts to computationally model the r region within the context of homology models of cftr have been confounded by its disordered nature .
two published models have completely distinct conformational predictions 18 for the r region . while these structures are potential conformations that the disordered r region might sample , they are unlikely to represent a stable structure populated for a significant fraction of the time
importantly , the sequence characteristics and functional role as a target for posttranslational modification and as a binding partner for multiple intramolecular and intermolecular targets ( see below ) all strongly point to the disordered nature of the r region .
regulatory regions in proteins are often disordered because they can easily adapt to different protein surfaces and are accessible to enzymes carrying out posttranslation modifications 20
. thus they can be sensitive to input from many partners and provide finetuning for signaling 21 . in the case of cftr r region
protein kinases and phosphatases play a crucial role in the regulation of cftr primarily via controlling the level of r region phosphorylation .
there is a significant body of literature on r region phosphorylation , reflecting the critical importance as well as the complexity and lack of thorough understanding of the phosphoregulatory effects , only a small subset of which can be covered here .
several protein kinases , including protein kinase a ( pka ) , protein kinase c ( pkc ) and ampactivated protein kinase ( ampk ) , are known to phosphorylate the r region both in vitro and in vivo .
of the 19 pka recognition sites predicted in the r region , 10 sites were confirmed in vitro ( s660 , s670 , s686 , s700 , s712 , s737 , s753 , s768 , s795 , s813 ) ( fig . 1 ) 1 and six of these sites ( s660 , s700 , s712 , s737 , s795 , s813 ) were found to be phosphorylated on fulllength cftr purified from cells 2 .
most of these phosphorylation sites stimulate channel activity in an additive / synergistic way ; however , s737 and s768 were reported under certain conditions to be inhibitory 24 .
none of these sites individually seems to be essential for cftr regulation and mutating one , two or three of them ( s660 , s737 , s795 , s813 ) has little affect on chloride channel activity .
in contrast , one study showed that mutating these four sites abolishes most of the campdependent response 6 .
other studies showed that more sites had to be mutated to abolish the full response 25 , underscoring the multivalency of binding interactions , either intramolecular or intermolecular , of the r region that are affected by phosphorylation .
there are six pkc consensus sequences located in the r region ( t682 , s686 , s707 , s790 , t791 , s809 ) , of which four have been phosphorylated in the isolated r region in vitro ( s660 , s686 , s700 , s790 ) ( fig . 1 ) and one ( s686 ) was verified on the fulllength protein as well 23 .
pkc phosphorylation on the r region does not stimulate the channel activity but instead enhances the effect of pka phosphorylation .
interestingly , high concentrations of free calcium ( 0.5 mm ) inhibit pkc phosphorylation of the isolated r region 23 , an effect that could be on the enzymatic activity or possibly , indirectly , on the accessibility or structure of the r region itself .
ampk , the cellular energy level activated kinase , phosphorylates the r region on two sites ( s737 , s768 ) ( fig .
1 ) that were previously described as inhibitory sites 24 , of which s768 has much greater impact than s737 28 . phosphorylation of these residues , which may fix cftr in a state that is insensitive to pka or pkc phosphorylation 29 , decreases the open probability of the channel by altering the channel opening but not the closing , resulting in longer interburst intervals but a similar length of each opening 30 .
in contrast , another study found that pka phosphorylation could overcome the ampk inhibitory effect 28 .
no single phosphatase has been demonstrated to be both necessary and sufficient to completely downregulate cftr channel activity , suggesting that cftr can be dephosphorylated by multiple phosphatases , including the protein phosphatase 2 ( pp2 ) isoforms pp2a , pp2b and pp2c and alkaline phosphatase 31 .
exposing cftr to pp2a , pp2c and alkaline phosphatase reduces cftr activity more than 90% 32 ; however , pp2c deactivates the most rapidly .
the various rates suggest that different phosphatases may act on functionally distinct pka sites 33 .
pp2c can dephosphorylate cftr in vitro
34 , can bind directly to the r region and to fulllength cftr and can deactivate cftr chloride channel 33 .
pp2a directly associates with cftr segment 14511476 31 , it can dephosphorylate the r region in vitro and a direct interaction of its regulator subunit ( rp65 ) with the r region segment 672855 has been demonstrated 36 .
cftr , the three kinases pka , pkc and ampk and at least two phosphatases , pp2a and pp2c , are part of a large macromolecular complex anchored to the cytoskeleton at the apical membrane .
the catalytic subunit of ampk tightly interacts with another disordered cftr segment , residues 14201457 , through a region of the kinase that normally binds the two ampk regulator subunits 32 . deleting this cftr cterminal segment
has not been found to affect the biosynthesis of the channel , despite the fact that it contains two important endocytosis motifs 38 required for the interaction with ampk 32 .
the b regulatory subunit of pp2a interacts with cftr residues 14511476 31 , which contain a highly conserved acidic cluster 38 .
the extreme cterminal pdz motif of cftr ( 14771480 ) anchors it within the nherf ( na / h exchanger regulatory factor)ezrin
a fraction of cellular pka is colocalized with cftr via ezrin , an a kinase anchoring protein ( akap ) 39 .
disruption of pka akap interactions dramatically reduced the ability of wildtype ( wt ) cftr to respond to camp modulation .
the rack1 ( receptor for activated c kinase ) scaffold protein colocalizes with cftr , interacting with both the pdz1 domain of nherf1 and the activated pkc on two distinct sites 40 . moreover , rack1 is part of the pkcrack1nherf1 dimer tubulin complex directly connected to the tubulin cytoskeleton .
although cellspecific cftr targeting of pp2b has not been shown , the localization and expression of akap79 , a scaffold protein that binds pp2b , pka and pkc , support the importance of pp2b in cftr regulation 41 .
in addition to ensuring that pka and pkc are in close proximity to cftr , both the nherf1ezrin actin and the rack1nherf1 dimer
investigations by sdspage , fluorescence , cd , ftir and nmr spectroscopy provide evidence for the r region becoming generally more flexible and less structured upon phosphorylation , although conflicting results have been published .
data on the hydrodynamic properties include decreased r region mobility on sdspage following pka phosphorylation 23 interpreted as an apparent molecular weight that is greater than that expected from the addition of the extra phosphates and pointing to a more random and expanded structure .
the r region ( 654838 ) contains almost identical numbers of positively ( 28 k / r / h ) and negatively ( 29 d / e ) charged residues , but phosphorylation increases the number of negative charges and results in charge repulsion by the increased amount of negative charge . the change in the charge balance alone ,
however , does not explain the absence of mobility shift upon pkc phosphorylation 23 or s768 phosphorylation or the major shift in response to s737 phosphorylation 44 .
whilst computational studies 11 and the previously mentioned sdspage data 23 suggest an increase in r region size following phosphorylation , saxs data 9 point to a decrease in the radius of gyration . data on changes in secondary structure include cd experiments demonstrating an increased random coil character for the isolated r region upon pka phosphorylation 45 and ftir measurements indicating no secondary structure change in the context of fulllength cftr 46 .
in contrast , marasini and coworkers showed a reduction in random coil character and highly increased helical content in isolation using cd 7 .
drawing conclusions from the data is complicated by the different kinases and targeted phosphorylation sites on the r region .
the finding that s737 phosphorylation has a very large effect while s768 has no impact on the secondary structure propensity of nearby segments explains the different consequences of phosphorylation of the two sites for sdspage mobility .
likewise , that pkc phosphorylation of s686 and s790 has little effect on the amount of secondary structure is consistent with the comparable cd signals of the nonphosphorylated and pkcphosphorylated r region 45 .
residuespecific and phosphorylationsitespecific information from nmr on the secondary structure of the highly pkaphosphorylated isolated r region indicates an overall reduction in helical structure with an increase in content , potentially due to the repulsion between the phosphate and the partially negatively charged ctermini of helical elements ( fig . 1 ) 10 .
clarification of the consequences on structural propensities and hydrodynamic behavior may rely on future sitespecific structural data from nmr on samples phosphorylated by different kinases at defined sites .
the r region is much longer than required to bridge the distance between nbd1 and msd2 and the absence of a compact fold enables the r region to reach any part of cftr and into the space around the channel to contact other proteins ( fig .
this allows cftr to have a large interactome , with the r region functioning as a protein interaction hub .
the r region has been reported to interact with all intracellular portions of cftr including the nterminus 47 , intracellular domains 48 , nbd1 10 , nbd2 and the cterminus 49 in a phosphorylationdependent manner .
the different phosphorylation states of the r region have distinct functions during channel gating and trafficking .
the nonphosphorylated r region generally acts to inhibit chloride channel activity , probably by sterically blocking nbd heterodimerization 10 .
nmr binding experiments showed that helical segments of the nonphosphorylated r region interact with nbd1 and that phosphorylation drastically reduces the affinity of these interactions 10 .
one site of r region interaction with nbd1 , based on crystal structures of nbd1 containing the re 15 , is across the heterodimer interface ( figs 1 and 2 ) , pointing to phosphorylation being required for unhindered nbd heterodimerization and channel gating .
constructs that lack the r region segment 760783 , which samples helical conformations and contains the s768 phosphorylation site , were constitutively active ( i.e. pka independent ) 50 .
however , the open probability and the chloride current of split channels lacking r region segments 760783 or 708835 are only 3040% of the wt channel 50 , suggesting additional regulatory mechanisms .
schematic models of ( a ) nonphosphorylated / closed channel and ( b ) pkaphosphorylated / open channel states of cftr . shown are the nterminal segment ( blue ) , membranespanning domains ( dark green ) , the intracellular domains ( yellowgreen ) , nbd1 ( yellow ) , nbd2 ( gold ) , r region ( red ) and the cterminal segment ( purple ) .
disordered elements ( nterminus , r region and cterminus ) are shown as a superposition of multiple possible conformations .
helix 9 of nbd1 ( residues 635643 , yellow ) and the cterminal elbow helix ( residues 842855 , green ) are also not in a fixed position to demonstrate that they can sample multiple conformations and may be considered part of the r region . the dashed line ( in b ) schematically illustrates the open channel pore , the membrane is represented as a gray bar and the r region sampled space is colored as a gradient ( red of various intensities ) .
r region sampling in the two phosphorylation states is similar , although the phosphorylated r region samples space farther from the core of cftr as it is excluded from the nbd interface .
nmr studies of nbd1 with the re demonstrated that interactions between the nbd1 core and the regulatory elements , the regulatory insertion ( ri ) and re ( nterminal portion of the r region ) are disrupted upon phosphorylation 51 .
the release of these elements upon phosphorylation for f508del nbd1 with the re , however , is significantly smaller than for wt nbd1 , suggesting aberrant r region interactions in the mutant cftr that are stickier and continue to block heterodimerization 51 .
recent nmr studies of nbd1 demonstrate that the mutant h620q and cfft001 , a dual correctorpotentiator for cftr 5 , both enhance release of helices h8 and h9 from the nbd1 core .
h8 is immediately nterminal to and h9 is arguably the beginning of the r region and both are coupled to r region segments that interact with the heterodimer interface .
release of h8 and h9 by h620q or cfft001 is thus expected to potentiate cftr activity , at least in part , by reducing nbd1:r region interactions to promote nbd dimerization 52 .
in addition to reducing the inhibitory effect of the nonphosphorylated r region on channel gating , phosphorylation of the r region appears to stimulate chloride conductance . the location of the r region within the protein is not critical , as moving it to the cterminus gives the same effect 50 .
phosphorylation strongly increases the interaction of the r region with other parts of cftr , particularly within the portion of the protein cterminal to the r region 52 .
these findings suggest that the mechanism behind the phosphorylated r region stimulatory effect probably involves association of the phosphorylated r region with other parts of cftr , possibly the n or cterminus of cftr , the intracellular domains or all of these regions .
ko and coworkers reported reciprocal regulation between the solute carrier 26a ( slc26a ) family ( a3 , a6 ) and cftr 54 .
slc26a3 , a chloride bicarbonate exchanger , colocalizes with cftr at the apical membrane , markedly increasing cftr channel open probability , in a manner associated with direct interaction between the r region and the stas domain of the slc26a3 . binding of the stas and r region is enhanced by pkamediated phosphorylation of the r domain 54 , pointing to another stimulatory effect of r region phosphorylation .
one possible explanation for the slc26a3mediated increase in cftr activity may be that the presence of the stas domain shifts the r region binding equilibria towards association with stas and away from interactions with cftr nbds that block productive atpdependent gating .
since cftr folding and processing is inefficient , even most wt channels do not reach the plasma membrane .
f508del exacerbates the folding problem , so that most f508del cftr is retained in the endoplasmic reticulum ( er ) and only a small portion of the translated protein reaches the plasma membrane 55 . although the pkaphosphorylated f508del cftr has been reported in one study to have the same open probability , its activation is at least seven times slower and its halflife at the plasma membrane is much shorter than that of wt 52 .
notably , pharmacologically ertrapped wt cftr does not display the same degradation pattern as f508del 57 suggesting different intramolecular and intermolecular interactions , affecting both gating and processing .
the r region interacts with other proteins during transit of the channel from the er to the plasma membrane and the posttranslational maturation of cftr is enhanced by phosphorylation 58 .
cftr plasma membrane levels increase upon pka stimulation and can be blocked by the pka inhibitor h89 .
these effects are associated with pkamediated phosphorylation of the r region and its interactions with 1433 proteins 58 .
although 1433 prefers to bind to short phosphorylated linear motifs , it can also recognize nonphosphorylated substrates .
all r region pka phosphorylation motifs seem to be involved in regulation by 1433 ( fig . 1 ) 58 .
the interaction between 1433 and the phosphorylated r region might also increase heterodimerization of the nbds through competition with the r region binding equilibria , thereby increasing the folding stability of cftr and enhancing processing .
most disordered proteins with a significant role in regulation contain molecular recognition elements ( mores ) , short segments that are important for recognition of binding partners 59 .
mores are enriched in hydrophobic residues ( w , l , f , y ) as well as charged residues , especially arginine and aspartate 59 .
the r region contains many predicted mores with different length distributions , with many related to the phosphorylation sites ( almost all pka sites contain leucines or phenylalanines and arginines ) .
experimental results show that the r region has three long and three short interaction segments for nbd1 and nine short for 1433 ( fig . 1 )
the observation that there are a larger number of r region binding partners than interaction segments suggests interaction hot spots with nonexclusive binding preferences .
different proteins probably compete for the same segments with the phosphorylation status of the r region and the available partners determining the actual interactions .
the r region is much longer than required to bridge the distance between nbd1 and msd2 and the absence of a compact fold enables the r region to reach any part of cftr and into the space around the channel to contact other proteins ( fig .
this allows cftr to have a large interactome , with the r region functioning as a protein interaction hub .
the r region has been reported to interact with all intracellular portions of cftr including the nterminus 47 , intracellular domains 48 , nbd1 10 , nbd2 and the cterminus 49 in a phosphorylationdependent manner .
the different phosphorylation states of the r region have distinct functions during channel gating and trafficking .
the nonphosphorylated r region generally acts to inhibit chloride channel activity , probably by sterically blocking nbd heterodimerization 10 .
nmr binding experiments showed that helical segments of the nonphosphorylated r region interact with nbd1 and that phosphorylation drastically reduces the affinity of these interactions 10 .
one site of r region interaction with nbd1 , based on crystal structures of nbd1 containing the re 15 , is across the heterodimer interface ( figs 1 and 2 ) , pointing to phosphorylation being required for unhindered nbd heterodimerization and channel gating .
constructs that lack the r region segment 760783 , which samples helical conformations and contains the s768 phosphorylation site , were constitutively active ( i.e. pka independent ) 50 .
however , the open probability and the chloride current of split channels lacking r region segments 760783 or 708835 are only 3040% of the wt channel 50 , suggesting additional regulatory mechanisms .
schematic models of ( a ) nonphosphorylated / closed channel and ( b ) pkaphosphorylated / open channel states of cftr . shown are the nterminal segment ( blue ) , membranespanning domains ( dark green ) , the intracellular domains ( yellowgreen ) , nbd1 ( yellow ) , nbd2 ( gold ) , r region ( red ) and the cterminal segment ( purple ) .
disordered elements ( nterminus , r region and cterminus ) are shown as a superposition of multiple possible conformations .
helix 9 of nbd1 ( residues 635643 , yellow ) and the cterminal elbow helix ( residues 842855 , green ) are also not in a fixed position to demonstrate that they can sample multiple conformations and may be considered part of the r region . the dashed line ( in b ) schematically illustrates the open channel pore , the membrane is represented as a gray bar and the r region sampled space is colored as a gradient ( red of various intensities ) .
r region sampling in the two phosphorylation states is similar , although the phosphorylated r region samples space farther from the core of cftr as it is excluded from the nbd interface .
nmr studies of nbd1 with the re demonstrated that interactions between the nbd1 core and the regulatory elements , the regulatory insertion ( ri ) and re ( nterminal portion of the r region ) are disrupted upon phosphorylation 51 .
the release of these elements upon phosphorylation for f508del nbd1 with the re , however , is significantly smaller than for wt nbd1 , suggesting aberrant r region interactions in the mutant cftr that are stickier and continue to block heterodimerization 51 .
recent nmr studies of nbd1 demonstrate that the mutant h620q and cfft001 , a dual correctorpotentiator for cftr 5 , both enhance release of helices h8 and h9 from the nbd1 core .
h8 is immediately nterminal to and h9 is arguably the beginning of the r region and both are coupled to r region segments that interact with the heterodimer interface .
release of h8 and h9 by h620q or cfft001 is thus expected to potentiate cftr activity , at least in part , by reducing nbd1:r region interactions to promote nbd dimerization 52 .
in addition to reducing the inhibitory effect of the nonphosphorylated r region on channel gating , phosphorylation of the r region appears to stimulate chloride conductance . the location of the r region within the protein is not critical , as moving it to the cterminus gives the same effect 50 .
phosphorylation strongly increases the interaction of the r region with other parts of cftr , particularly within the portion of the protein cterminal to the r region 52 .
these findings suggest that the mechanism behind the phosphorylated r region stimulatory effect probably involves association of the phosphorylated r region with other parts of cftr , possibly the n or cterminus of cftr , the intracellular domains or all of these regions .
ko and coworkers reported reciprocal regulation between the solute carrier 26a ( slc26a ) family ( a3 , a6 ) and cftr 54 .
slc26a3 , a chloride bicarbonate exchanger , colocalizes with cftr at the apical membrane , markedly increasing cftr channel open probability , in a manner associated with direct interaction between the r region and the stas domain of the slc26a3 . binding of the stas and r region is enhanced by pkamediated phosphorylation of the r domain 54 , pointing to another stimulatory effect of r region phosphorylation .
one possible explanation for the slc26a3mediated increase in cftr activity may be that the presence of the stas domain shifts the r region binding equilibria towards association with stas and away from interactions with cftr nbds that block productive atpdependent gating . since cftr folding and processing is inefficient , even most wt channels
f508del exacerbates the folding problem , so that most f508del cftr is retained in the endoplasmic reticulum ( er ) and only a small portion of the translated protein reaches the plasma membrane 55 .
although the pkaphosphorylated f508del cftr has been reported in one study to have the same open probability , its activation is at least seven times slower and its halflife at the plasma membrane is much shorter than that of wt 52 .
notably , pharmacologically ertrapped wt cftr does not display the same degradation pattern as f508del 57 suggesting different intramolecular and intermolecular interactions , affecting both gating and processing .
the r region interacts with other proteins during transit of the channel from the er to the plasma membrane and the posttranslational maturation of cftr is enhanced by phosphorylation 58 .
cftr plasma membrane levels increase upon pka stimulation and can be blocked by the pka inhibitor h89 .
these effects are associated with pkamediated phosphorylation of the r region and its interactions with 1433 proteins 58 .
although 1433 prefers to bind to short phosphorylated linear motifs , it can also recognize nonphosphorylated substrates .
all r region pka phosphorylation motifs seem to be involved in regulation by 1433 ( fig . 1 ) 58 . the interaction between 1433 and the phosphorylated r region might also increase heterodimerization of the nbds through competition with the r region binding equilibria , thereby increasing the folding stability of cftr and enhancing processing .
most disordered proteins with a significant role in regulation contain molecular recognition elements ( mores ) , short segments that are important for recognition of binding partners 59 .
mores are enriched in hydrophobic residues ( w , l , f , y ) as well as charged residues , especially arginine and aspartate 59 .
the r region contains many predicted mores with different length distributions , with many related to the phosphorylation sites ( almost all pka sites contain leucines or phenylalanines and arginines ) .
experimental results show that the r region has three long and three short interaction segments for nbd1 and nine short for 1433 ( fig . 1 )
the observation that there are a larger number of r region binding partners than interaction segments suggests interaction hot spots with nonexclusive binding preferences .
different proteins probably compete for the same segments with the phosphorylation status of the r region and the available partners determining the actual interactions .
an emerging picture of the r region is as a disordered hub , sampling multiple conformations rapidly and forming transient interactions with different parts of cftr and with other partners . by doing this
there is likely to be overlap in the conformational space that can be sampled by non , partially or highly phosphorylated r region .
figure 3 demonstrates the conformational heterogeneity of the r region in a model of nonphosphorylated cftr , representing a closed channel state . in this state
the nbds are probably separated ; therefore the nterminus of the r region easily moves between the nbds and samples similar conformations to those found in the nbd1 xray structures ( fig . 2 ) .
this segment can also interact with other parts of the nbds or other partners farther from the dimerization interface .
the rest of the r region also samples a significant volume of space with the ability to make contact points with the nbds .
figure 3 illustrates a model of phosphorylated cftr , representing an open channel state , with the nbds tightly associated . in a highly pkaphosphorylated state , the r region
is expected to sample a similar volume of space as in nonphosphorylated cftr , although it is probably excluded from the nbd dimerization interface and therefore can extend farther away from the core of cftr ( fig .
while this does not agree with hydrodynamic data from saxs for the isolated r region , the increased character observed by nmr , the reduction of its interactions with the nbds and increased binding for the slc26a3/6 stas domains and 1433 suggest that the phosphorylated r region may sample more extended conformations within the context of fulllength cftr . that the r region can sample similar space in either phosphorylation state and that in vivo cftr has some degree of basal phosphorylation suggest that most of the binding partners interact with a variety of phosphorylation states of the r region , but with modulated affinities .
one example is the interaction with 1433 , which interacts more weakly with the nonphosphorylated state and more strongly following phosphorylation 58 .
thus , r region phosphorylation is not a sharp switch but rather functions to precisely tune competing interactions .
many cftr interacting proteins at the plasma membrane are located in the same subcellular compartment as cftr
. moreover , most of these are components of the same macromolecular complex anchored to the cytoskeleton .
activators , inhibitors , modifiers and other members of the complex enable cftr to be readily responsive to different environmental conditions .
the proposed view of the r region as a dynamic hub suggests that it plays a dominant role , scanning the surrounding protein surfaces and making transient interactions with affinities and lifetimes dependent on its phosphorylation state .
the plasticity of this disordered region of cftr is crucial for the complex regulatory control of cftr channel activity and its other biological functions in maintaining ion balance at the cell membrane . | chloride channel gating and trafficking of the cystic fibrosis transmembrane conductance regulator ( cftr ) are regulated by phosphorylation .
intrinsically disordered segments of the protein are responsible for phosphoregulation , particularly the regulatory ( r ) region that is a target for several kinases and phosphatases .
the r region remains disordered following phosphorylation , with different phosphorylation states sampling various conformations .
recent studies have demonstrated the crucial role that intramolecular and intermolecular interactions of the r region play in cftr regulation .
different partners compete for the same binding segment , with the r region containing multiple overlapping binding elements .
the nonphosphorylated r region interacts with the nucleotide binding domains and inhibits channel activity by blocking heterodimerization .
phosphorylation shifts the equilibrium such that the r region is excluded from the dimer interface , facilitating gating and processing by stimulating r region interactions with other domains and proteins .
the dynamic conformational sampling and transient binding of the r region to multiple partners enables complex control of cftr channel activity and trafficking . |
those aged 65 and older represented 35.9 million or 12.3% of the us population in 2003 , and this number will reach 19% by the year 2030 . the great majority of deaths ( 8085% ) occur in this population , and most die from chronic conditions such as heart failure , cancer , obstructive pulmonary disease , diabetes , alzheimer 's disease , and renal failure .
the institute of medicine ( iom ) noted that while technology continues to increase life expectancy , the quality of life of dying patients has not kept the same pace .
studies indicate that patients ' families are still dissatisfied with end of life care [ 47 ] .
advance directives ( ads ) were seen as a way for individuals to decide on and communicate their end of life care wishes to those who care for them to ensure , more in a legal term , that individuals ' wishes for end of life care are followed .
however , more than 2 decades after passage of the 1991 patient self - determination act ( psda ) requiring ad discussion on admission to health care institutions , the rate of completion of ads remains at approximately 29% of the population .
advance care planning is starting to replace the term advance directives to make its slow transitioning from a legal model to a tool to enhance communication .
however , factors learned from those who have completed the advance directives could help us identify factors that might influence end of life discussions [ 912 ] and shed lights on strategies on effective communication on advance care planning .
the intent of this study was to identify and analyze factors influencing ad completion in an older population .
the literature on outcomes of end of life communication is focused on ad completion for this study .
those studies explore the influence of demographic factors such as age , gender , family relationships , and health issues on the completion of ads .
studies indicate that older white women with more education who perceive themselves to be in poor health are more likely to have signed an ad [ 1316 ] .
douglas and brown also reported that women were more likely than men to have completed ads .
however , cooper and colleagues found that gender was not related to ad completion .
study reported that african - americans were significantly more likely to choose aggressive life - saving interventions and less likely than caucasians and asians to complete ads [ 19 , 20 ] .
eleazer and associates also noted that hispanics were more likely to refuse to complete any form of ads . in support of eleazer
's finding , degenholtz et al . also found that african - americans and hispanics were less likely than caucasians to have living wills .
however , morrison and associates reported that race was not significantly related to the signing of a durable power of attorney .
nolan et al . reported that gender , race , and health status are not significantly related to ad completion .
investigators in two studies found that those with higher incomes , health insurance , and more trust in the medical system were more likely to complete ads [ 24 , 25 ] .
findings from other studies note that those with less education were significantly less likely to sign ads and more likely to desire life - sustaining treatment [ 26 , 27 ] .
overall , age , income , health insurance , and more trust in medical system are positively related to ad completion .
however , age - related variables , such as poor health and more physical impairment , could complicate the relationship between age and ad completion . in gerald 's study ,
more widows or widowers had signed an ad than those who were married , single , or divorced .
colenda et al . reported that those who lived close to their children and those who with large social networks had lower ad completion rates .
studies indicated that those had close relationships with their families or have family members living nearby tended to desire less aggressive life - saving interventions than those who did not have close relationships .
although the completion rate for ads is about 15% to 25% in adults , hospitalization or perception of poor self - health may precipitate completion of ads .
studies indicate that those who had a recent hospitalization completed ads more than those who had not been hospitalized [ 25 , 31 ] .
mcauley and associates reported that after a 12-month nursing home admission , ad completion rates increased by 18% from the baseline .
and salmond and david found that poorer self - reported health status was significantly related to ad completion .
hospital admission , suffering an illness , and decline of health status could prompt more ad completion . being informed about ads at admission during a health care crisis could also contribute to more completion upon hospitalization .
the relationships among age , gender , race , education level , family structure , and health factors to ad completion have been studied separately .
variables that influence decision making on ad completion can be analyzed in a contextual model .
how those external and internal factors ( stimuli ) , modes of adaption , and decision - making factors working together to influence ad completion has yet to be examined .
the purpose of this study is to apply roy 's adaptation model to analyze the influence of demographic , family structure , and health status variables on ad completion .
roy 's adaptation model ( ram ) provides a framework for identifying variables that influence individuals ' responses to stressful situations ( figure 1 ) . according to roy
an individual 's ability to adapt to situations varies depending on the nature of the stimuli confronting the person .
contextual stimuli are internal or external factors that influence how the individual reacts to the focal stimuli but do not require direct and immediate attention or energy .
focal stimuli exert a direct and immediate effect on the individual and become the focus of attention for the person .
neural , chemical , and endocrine coping processes ( physiological ) are termed regulator processes , while cognator processes result from cognitive - emotive channels .
the person spends energy to mobilize four adaptive modes : physical , self - concept , rolefunction , and interdependence mode in dealing with the focal stimuli in order to maintain or restore adaptation through stressful event .
the assumption of using this theory is that each individual under any stressful situation would attempt to balance the interrelationship of physical , self - concept , role function , and interdependence mode in order to maintain or restore adaptation . as shown in figure 1 ,
incorporating variables identified by the literature and placing them in the ram provided the framework for this study .
contextual stimuli for this study were health insurance , household income , and satisfaction with health care because those variables have shown relevance to ad completion .
the residual stimuli were age , gender , race , and education level because those variables ' relationships to the ad completion are not consistent .
the contextual and residual stimuli were expected to have direct effects on focal stimuli ( having a stressful event with ad completion status inquiry prompted by each hospitalization is operationalized as number of hospital and nursing home admissions ) and indirect effects on the adaptive modes ( physical , self - concept , role function , and interdependence mode ) and , finally , on the decision - making responses ( having signed ads or not ) .
a model - testing design based on the ram and path analysis was selected for this study . this allowed examination of the predictive effects from one concept to the next one as identified in figure 1 .
secondary data containing information on ad completion were used for the study . noninstitutionalized us citizens aged 55 or older participated in the 1984 longitudinal study of aging ( lsoa ) which included the 1984 national health interview survey , the 1984 health insurance supplement , and the 1984 baseline supplement on aging ( soa ) .
the first follow - up interview was the 1994 second supplement on aging ( soa ii ) , which included those who had participated in the national health interview survey and added a new cohort of those over the age of 70 .
the second follow - up interview ( 1997 - 1998 ) included data on those who had died since 1994 .
information on those who had died ( the decedent interview file ) was collected from family members of the deceased .
data from the 1994 soa ii and the 1998 decedent file were extracted and merged for this study since these data are termed relevant to ad completion and also contain baseline information on demographics , physical function , working status , and family relationships .
focal , contextual , and residual stimuli . the number of admissions to the hospital and the number of nursing home admissions were originally designed to measure the focal stimulus .
these were selected as the focal stimuli because they would reflect the number of times persons were asked about ad completion status .
the low cronbach 's alpha for these two items ( 0.31 ) and the fact that 732 participants had missing data on the number of nursing home admissions led to the decision that only the number of hospital admissions would be used to measure the focal stimulus .
the contextual stimuli were defined as health insurance status , household income , and satisfaction with health care .
health insurance and income were selected because they are closely related and affect both the quality and extent of health care delivery .
satisfaction with health care was chosen as an indicator of trust in the correctness of the healthcare provider 's decisions and advice , and higher scores meant greater satisfaction .
age , gender , race , and education were considered as residual stimuli .
the adaptive modes .
the physical mode was measured by summing up the activities of daily living ( adls ) , the number of falls , and the total number of diseases .
working status and/or doing volunteer work were measuring role function . working or engaging in volunteer activities was assumed to provide more opportunities for social engagement .
a completed ad indicates either having had an end of life discussion with family or a health provider or having given at least some thoughts to end of life care planning . the adaptive response for this study was having signed or not signed either a living will , a durable power of attorney , or both .
as shown in table 1 , the mean age of the 938 participants was 80 years old .
about half were married and lived with their spouses , and about a third lived alone .
roughly half had household incomes below $ 20,000 in 1994 , and 256 participants did not report income .
virtually all had medicare , and about a fourth had some other type of health insurance in addition to medicare .
table 2 shows the mean , standard deviation , possible range , and obtained range for each variable or constructed scale .
a total of 5% had never been hospitalized and 37% had been hospitalized once , with the remainder being two or more times hospitalized from 1994 to 1997 .
only 22% of the sample responded to the item on number of nursing home admissions . of these
, 80% had one nursing home admission , and 16% had more than one nursing home admission .
most ( 93% ) ranked satisfaction with their health care provider as good or excellent .
a total of 78% had a high school education or less . the majority ( 60% ) scored 6 or less on activities of daily living 6 months prior to death , and 53% reported no falls for the four - year period .
the assumptions of normal distribution , homoscedasticity , and linear relationships were met for analyses using multiple regressions .
six endogenous variables ( the focal stimulus ; the physical , self - concept , rolefunction , and interdependence modes ; and ad completion ) along with seven exogenous variables ( insurance , household income , satisfaction with healthcare , age , gender , race , and education level ) were included in the initial model .
first , bivariate correlations were examined to give a sense of which variables might be important .
next , preliminary multiple regressions analyses were done with each of the dependent endogenous variables in turn as predicted by the theoretical model . using results from the preliminary multiple regressions ,
another set of multiple regression analyses were performed with only the significant independent variables as identified in the preliminary regression analyses entered .
the results from that set of analyses provided the path coefficients for the final model .
path analysis results . from the left of the theoretical framework to the right ( figure 2 ) ,
pearson 's correlation coefficients were calculated to assess bivariate relationships between the independent variables ( contextual and residual stimuli ) and the dependent variable ( focal stimulus ) .
only age ( r = 0.09 , p = .01 ) was statistically significantly related to the focal stimulus .
munro stated that r - values less than 0.49 were low and an r - value less than 0.25 indicates that little if any correlation exists .
these showed that the focal stimulus was significantly related to the physical mode ( r = 0.29 , p = 0.00 ) and the self - concept mode ( r = 0.10 , p = 0.01 ) .
the physical mode was also significantly related to the self - concept mode ( r = 0.24 , p = 0.00 ) and the rolefunction mode ( r = 0.16 , p = 0.00 ) .
the self - concept mode was significantly related to both the role function mode ( r = 0.16 , p = 0.00 ) and the interdependence mode ( r = 0.14 , p = 0.00 ) .
the bivariate relationships of the four adaptive modes to ad completion indicated that only the physical mode ( r = 0.17 , p = 0.00 ) and the interdependence mode ( r = 0.15 , p = 0.00 ) were significantly related to ad completion . the preliminary multiple regression analysis , with number of hospitalizations ( the focal stimulus ) as the dependent variable , showed that only age was a significant predictor ( = 0.10 , p = 0.01 ) .
the next set of multiple regressions assessed the predictive ( independent ) effect of the focal stimulus on each of the four adaptive modes and then the paths from one mode to the next mode .
these results showed that the focal stimulus significantly predicted only the physical mode ( = 0.29 , p = 0.00 ) .
the physical mode had a predictive inverse relationship with the self - concept mode ( = 0.24 , p = 0.00 ) .
the role function mode was significantly predicted by the physical ( = 0.13 , p = 0.00 ) , self - concept ( = 0.14 , p = 0.00 ) , and interdependence modes ( = 0.10 , p = 0.00 ) .
the results suggested a potentially significant path between the self - concept and interdependence modes , thus an additional multiple regression was done .
self - concept was identified as a significant predictor to the interdependence mode ( = 0.14 , p = 0.00 ) .
the last set of multiple regressions assessed the predictive effects of the four modes on the decision - making response .
three of the four modes were significant : they are the physical mode ( = 0.19 , p = 0.00 ) , role function mode ( = 0.08 , p = 0.02 ) , and the interdependence mode ( = 0.15 , p = 0.00 ) .
the final path model is presented in figure 2 . the physical , role , and interdependence modes jointly explained 5% of the variance in ad completion ( adjusted r = 0.05 ) .
the physical and self - concept modes together explained 4% of the variance in the rolefunction mode .
the self - concept and rolefunction modes explained 3% of the variance in the interdependence mode .
the focal stimulus explained 7% of the variance in the physical mode , and age explained 1% of the variance in the focal stimulus .
these findings indicate that the variance explained by application of the ram to the study variables was not very strong
. however , the soundness of the final path model was confirmed by decomposition of the bivariate correlations .
the ram helped to put the concepts of the interest of this study into perspective and guided the analysis of how each variable influenced other variables .
however , physical impairment , remaining working , and family structure explained only a small percent of the variance in decision making on ad completion . it might be that the constructed instruments did not completely operationalize the concepts which is a disadvantage to using secondary data sets . or it can also suggest the complexity of the ad completion process . conducting a study with instruments to fully operationalize the concepts would be helpful or an ad completion process could be a decision - making process beyond reasonable decision making .
there was no significant path from contextual stimuli and residual stimuli to the focal stimuli except for age , and age had a very small path coefficient .
contrary to the ram , this suggests a direct path between the contextual and residual stimuli to the adaptive response .
this same proposition was pointed out by a study done by robinson where a direct path from the contextual stimuli to the adaptive response was proposed .
this study supports other reports where hospitalization precipitates ad completion but only where there are decrements in physical function as well .
participants in this study were relatively older and noninstitutionalized , so the ad completion rate of more than 50% suggests that ads are more acceptable to this population .
it is also logical to deduce that hospitalization reflects more physical impairment , and more physical impairment should make individuals more aware of the issues related to end of life care and more receptive to ad information .
the path model showed that the physical mode had the greatest positive influence on decision making on ads .
the paths also indicated that those who stayed connected with society were more likely to have ad completed .
it is possible that those who were connected with society through work had opportunities to discuss a variety of health concerns with others , including end of life care .
it may also be attributed to those who were still working or doing volunteer work wanted to maintain their independence through making their own end of life decisions .
those living in close proximity to their family were less likely to complete an ad .
such individuals may expect family members to decide on end of life care under the assumption that family members know what they would want rather than complete a legal document .
it is also worth noting that those who had discussion on ads with their family and healthcare providers did not necessarily complete ads .
decision making on ad completion is an ensemble of processes and can not be predicted by a single variable or a single process .
this study provided some variables ( such as physical impairment , self - rated health status , family closeness , and social involvement ) that could help to design a motivational interview model for advance care planning discussion .
advance care planning discussions in settings other than hospitals might be more natural and less stressful .
recent study also supports this model of care and stated that early discussion should emphasize managing symptoms , strengthening coping , and cultivating illness understanding .
education programs should encourage patients and families to actively participate in this discussion as early as possible .
those who received health care provider 's personal request on initiating advance care planning have high completion rates on advance directives .
health care workers in any health care setting should assess each individual 's physical function , personal perception of the illness , family , and social factors and determine the right approach to promote adaptation .
further studies are needed to develop reliable instruments to study variables that promote adaptation and improve quality of life at the end of life by introducing a motivational discussion actively participated by patients and family . | purpose .
the purpose of this study was to identify variables that influenced completion of advanced directives in the context of adaptation from national data in older adults .
knowledge gained from this study would help us identify factors that might influence end of life discussions and shed light on strategies on effective communication on advance care planning .
design and method . a model - testing design and path analysis were used to examine secondary data from 938 participants .
items were extracted from the data set to correspond to variables for this study .
scales were constructed and reliabilities were tested . results .
the final path model showed that physical impairment , self - rated health , continuing to work , and family structure had direct and indirect effects on completion of advanced directives .
five percent of the variance was accounted for by the path analysis .
conclusion .
the variance accounted for by the model was small .
this could have been due to the use of secondary data and limitations imposed for measurement .
however , health care providers and families should explore patient 's perception of self - health as well as their family and work situation in order to strategize a motivational discussion on advance directive or end of life care planning . |
in the last ten years , in our country , there has been an increase in the consumption of raw fish due to the introduction of new eating habits from countries outside europe ( sushi , sashimi , herring , pickled anchovies , etc . ) , increasing the risk of contracting parasitic diseases , in particular the anisakiasis ( audicana et al . , 2002 ) .
anisakiasis is a disease caused by nematodes of the genus anisakis , belonging to the anisakidae family , with pseudoterranova , contracaecum and hysterothylacium genus .
human infestation occurs by ingestion of thirdstage anisakis larvae present in raw fish and cephalopods but also undercooked , marinated , pickled , smoked or salted .
these parasites are found , at the adult stage , in the abdomen of marine mammals ( whales , seals , dolphins ) , more precisely in the stomach where they are visible to the naked eye . in fish , which are intermediate hosts , the larval form are normally found in the coelomic cavity where they can found free or encysted or adherent to the various organs and tissues ( mattiucci and nascetti , 2008 ) . in the past
you may encounter traumatic injuries , and fibrinous adhesions due to the presence of the parasite that passes from the gastrointestinal tract to the coelomic cavity to reach the flesh . in humans
the anisakiasis may manifest as an acute form with a predominantly gastric localisation , characterised by nausea , vomiting and epigastric pain that occur after 4 - 6 h after ingestion of fish parasitised .
we distinguish localised forms where you can discover granulomas in the submucosa , with the presence of eosinophils ( eosinophilic granulomas ) and diffuse forms characterised by an edematous infiltration that affects the entire gastric or intestinal wall called eosinophilic phlegmon ( mattiucci et al . ,
it is also an intestinal form that develops after about 7 days post infection with abdominal pain , nausea , vomiting , fever , diarrhea and fecal occult blood .
the parasites , however , introduced into the body , induce an increase in immunoglobulins of class e ( ige ) with ige - mediated reactions such as urticaria , angioedema , anaphylaxis , asthma ( urban et al . , 1992 ) .
the finding of a positive specific ige in a certain percentage of asymptomatic subjects and in patients with urticaria , angioedema or anaphylaxis triggered by foods not parasitised , has led to speculation that there may be an initial sensitisation to anisakis , asymptomatic , with the appearance of new symptoms after exposure to allergens ( mattiucci et al . , 2013 ; audicana and kennedy , 2008 ; daschner et al . , 2012 ) .
because of all these implications on human health , the italian legislation has put in place , in 1992 an initial regulatory approach of the health ministry circular no .
10 of 11/03/1992 and subsequent ordinance 12/05/1992 , which recommended to the fishermen and operators involved in the handling of fresh fish to provide for a timely gutting for fish with size exceeding 18 cm belonging to the species lepidopus caudatus , engraulis encrasicholus , scomber scombrus , merluccius merlucius , sardina pilchardus , bramidae brama .
fish or parts thereof that clearly have parasites should not be placed on the market .
more recently , the european community , with the enactment of the so - called hygiene package and in particular with regulation ( ue ) no .
1276/2011 defines the following : food business operators placing on the market the following fishery products derived from finfish or cephalopod molluscs : ( a ) fishery products intended to be consumed raw ; or ( b ) marinated , salted and any other treated fishery products , if the treatment is insufficient to kill the viable parasite .
must ensure that the raw material or finished product undergo a freezing treatment in order to kill viable parasites that may be a risk to the health of the consumer . for
parasites other than trematodes the freezing treatment must consist of lowering the temperature in all parts of the product to at least : ( a ) -20c for not less than 24 h ; or ( b ) -35c for not less than 15 h ( european commission , 2011 ) .
in addition , with the spread of fashion consumption of raw fish , the ministry of health with prot .
n. 4379 of 17/02/2011 specifies that , as foreseen in the regulation ( ec ) n. 1020/2008 , also in retail must be complied with the specific requirements of parasites and those relating to the visual examination for their research in accordance with the provisions in regulation ( ec ) no 853/2004 . according to the above note
, the food business operator if it were to carry out operations of filleting and/or slicing should submit the same to visual inspection as required by regulation ( ec ) no 2074/2005 .
if the osa would produce raw or almost raw fishery products using chilled , he must demonstrate that the treatments used , whatever they are , ensure the killing of all parasites that may be present in the product ready for consumption . to give support to the emerging problems regarding the presence of anisakis in fish products and to carry out
the monitoring of the italian seas has been activated the national reference centre for anisakiasis ( c.re.na ) at headquarters of institute zooprophilactic sperimental of sicily ( izssi ) . in the present study
larval forms of anisakidae collected in fishing products sampled in sicily were identified by molecular analysis .
this study was conducted on the samples received at the center from october 2012 to february 2013 . in this period
were analysed 231 fish ( lepidopus caudatus , engraulis encrasicolus , merluccius merluccius , sardina pilchardus , scomber scombrus , longing longing , trachurus trachurus , mullus surmuletus ) , sampled caught in sicilian seas ( fishing areas 37 ) , parasitised by a total of 1299 larvae of the family anisakidae .
157 of them ( 67.96% ) were parasitised by larvae of the anisakidae family while 74 ( 32.03% ) were not parasitised . the larvae , taken from viscera ( n. 1296 ) , organs and muscles ( n. 3 ) of fish were counted with the help of the stereo microscope and identified at genus level by light microscopy .
larvae recovered and identified were then preserved in 70% ethanol until molecular analysis based on polymerase chain reaction - restriction fragment length polymorphism ( pcr - rflp ) . in this molecular technique , after the dna extraction , the dna regions of its1 , its2 and 5.8 srrna was amplified by pcr using the primer pair nc5/nc2 ( zhu et al . , 1998 ) and
the amplified was subjected to enzymatic restriction using the enzymes hinf i and hha previously shown to be diagnostic for the species of anisakis .
different species of anisakis give rise to restriction fragments that allow the species identification ( anisakis pegreffii , anisakis physeteris , anisakis typica , anisakis simplex c , anisakis ziphidarum and anisakis simplex sensu stricto ) ( damelio et al . , 2000 ) .
the dna was also purified and subjected to sequencing to confirm the identification through homology with the sequences found in genebank .
several larvae were collected from fish caught in the norwegian sea and morphologically identified at genus level by light microscopy as pseudoterranova .
of the 231 fish received , 1299 larvae were collected and were identificated by microscopic observation and molecular investigations .
the majority of the larvae belonged to the genus anisakis and to the species anisakis pegreffii .
the species anisakis simplex was found only in scomber scombrus caught in the mediterranean sea near the spanish coasts and in the atlantic ocean ( fishing areas 34 and 37 ) according to cavallero et al .
waiting to confirm this data , the species anisakis pegreffii seems to be mainly found in sicilian seas in relation to the presence of cetaceans such as definitive hosts ( mattiucci and nascetti , 2008 ) .
it is known that larvae of different species of anisakis are widespread in several fish species of economic and commercial concern in italian seas an that the consumption of raw fish , expecially marinated anchoves , is locally common .
a. pegreffii is the most common species detected in fish from the mediterranean sea and is a zoonotic agent of a human anisakiasis in italy .
larvae belonging to the genus pseudoterranova were found in samples of wet - salted cod wings of gadus morhua caught in the norwegian sea ( faroe islands ) ( nadolna and podolska , 2013 ) . | one of the parasite diseases associated with the consumption of raw fish that occurs with some frequency is the anisakiasis , a human disease caused by the accidental ingestion of larval nematodes of the genus anisakis , family anisakidae . at the national reference centre for anisakiasis ( c.re.n.a . ) from october 2012 to february 2013 , a number of 231 bony fish ( trichiuridae , engraulidae , scombridae and clupeidae ) were received from different fishing sites in sicily .
anisakis pegreffii is the main species detected in fish , as identified by molecular analysis based on polymerase chain reaction - restriction fragment length polymorphism , while anisakis simplex sensu stricto was found only in scomber scombrus caught in the mediterranean sea ( fishing areas 37 ) , in the spanish coast ( fishing areas 37 ) and in the atlantic ocean ( fishing areas 34 ) .
larvae of the genus pseudoterranova were found only in fish caught in the norwegian sea . |
telepathology refers to the remote practice of pathology via transmitting digital images . since the introduction of telepathology almost 46 years ago
wsi ( virtual microscopy ) refers to the digitization of glass slides by scanners to generate high - resolution digital slides .
operationally , it is often easier to move an image than it is to move a pathologist or patient ( or the glass slides of a patient 's specimen ) . for the purpose of telepathology , digital files
can either be accessed on a remotely shared server or transmitted and/or uploaded to a server hosted by a consulting group or vendor offering storage ( cloud ) services .
telepathology has been reported to improve patient care by offering technology that facilitates access to pathology experts . over the years
an early example of international teleconsultation is ipath , a telepathology platform developed by the university of basel in 2001 .
international telepathology networks have since been created by several academic institutions including the university of pittsburgh medical center ( upmc ) .
in addition , several commercial solutions have become available that offer clients the tools to partake in telepathology and purchase cloud services ( e.g. corista , xifin , proscia ) .
most telepathology publications to date have dealt more with the technology aspects than the clinical experience of this practice .
the aim of this study was to share 3 years worth of experience involving international teleconsultation between upmc and kingmed diagnostics in china .
since 2012 , upmc and kingmed diagnostics in china established a upmc - kingmed international telepathology consultation center in guangzhou kingmed .
the upmc is a tertiary academic medical center located in pittsburgh , pennsylvania in the usa .
the anatomical pathology department within the academic medical centers ( upmc presbyterian , upmc shadyside , upmc magee , children 's hospital of pittsburgh ) is structured using a center of excellence model , where anatomical pathology cases are handled and signed out only by subspecialty pathologists ( e.g. neuropathology , dermatopathology , cytopathology , etc . ) .
kingmed diagnostics is a large network with 27 central pathology laboratories serving 13,600 hospitals and clinics in china .
guangzhou kingmed diagnostics ( guangzhou , china ) is the first pathology laboratory to be fully certified in both anatomic and clinical pathology by the college of american pathologists in china .
guangzhou kingmed diagnostics was also certified by the international organization for standardization ( iso 15189 ) . the diagnosis rendered by expert pathologists from upmc
is regarded as a second opinion and not used for primary diagnosis . since upmc pathologists were not licensed to practice medicine in china , kingmed were legally responsible for final diagnoses on consultation cases .
the pathologists from guangzhou kingmed telepathology consultation center sign out a final report in chinese for each case .
patients receive both an english report from the upmc pathologist and chinese report from kingmed pathologists .
the pathologists at the guangzhou kingmed telepathology consultation center only gave a final diagnosis after slides had been reviewed by upmc pathologists .
the technology employed to support telepathology between upmc and kingmed in china has been previously described . in brief , a customized web - based digital pathology consultation portal was developed [ figure 1 ] .
glass slides were scanned in china using a nanozoomer scanner ( nanozoomer 2.0-ht , hamamatsu ) .
all slides were scanned at 20 , except for hematopathology cases that were scanned at 40. the hematopathologists at upmc requested higher resolution images upfront to facilitate their interpretation of cases .
for the first 2 years , wsi submitted for consultation resided on the client 's server ( hammamatsu ndp.serve ) in china .
pathology consultants from pittsburgh in the usa used the upmc web portal to securely access these images on the client 's server .
workflow ( e.g. , case triage , transcription ) and reporting were incorporated into this web - based application . in the 3 year
, digital slides were transferred without compression to a server in pittsburgh , usa using commercial file transfer software ( aspera ) .
customized university of pittsburgh medical center kingmed teleconsultation web portal in china , each kingmed branch located within different cities nationwide received telepathology consultation cases from local pathologists , clinicians , and/or at the request of patients to be sent to the kingmed consultation center in guangzhou .
tissue sections for routine h & e staining and immunohistochemistry ( ihc ) were cut at 3 m .
although attempts were made to enhance slide and stain quality as much as possible for telepathology purposes , there were still differences in slide quality depending on which kingmed site generated the slides .
for difficult surgical pathology cases requiring consultation , initial glass slides ( h & e and when included immunohistochemical stained slides ) were screened at guangzhou kingmed center before being referred to upmc expert pathologists .
glass slides and tissue blocks were not permitted to be physically mailed to upmc in the usa due to chinese regulations . in other words ,
this also limited glass slides being sent later to pittsburgh for quality assurance , re - review of a proportion of cases after diagnoses were rendered .
upmc and kingmed pathologists had the ability to communicate bidirectionally [ figure 2 ] , which allowed pathologists to request additional information ( e.g. , clinical findings , gross pathology details , flow cytometry data , etc . ) and if necessary even radiology images .
if required , upmc pathologists were allowed to order additional stains including immunostains to further work up cases .
these additional slides were prepared at the guangzhou kingmed center , then digitized and added to the existing consult case . at the outset , both partners established an agreeable stain quality and menu of immunohistochemical stains available in china . at the start of this collaboration , upmc pathologists reviewed 10 cases with glass slides compared to scanned images to confirm quality . participating pathologists at upmc
dedicated information technology ( it ) staff at both partnering institutions maintained the telepathology infrastructure , monitored turnaround time ( tat ) , and were involved in troubleshooting technical issues .
screenshot from the telepathology portal illustrating the value of bidirectional communication a retrospective study using descriptive statistics was performed evaluating the consultation experience and diagnostic results between upmc and kingmed over a 36 month period ( january 2012 - december 2014 ) .
tat was counted as the time when upmc received scanned images to the time when upmc pathologists signed out the case with a final diagnostic interpretation .
when performed , tat included the time needed for additional procedures such as performing ihc stains or molecular analysis .
based on the final diagnosis rendered by upmc expert pathologists , the cases were divided into three groups : those with definitive ( certain ) diagnoses , suggestive ( favored ) diagnoses , and atypical ( indeterminate ) diagnoses .
since 2012 , upmc and kingmed diagnostics in china established a upmc - kingmed international telepathology consultation center in guangzhou kingmed .
the upmc is a tertiary academic medical center located in pittsburgh , pennsylvania in the usa .
the anatomical pathology department within the academic medical centers ( upmc presbyterian , upmc shadyside , upmc magee , children 's hospital of pittsburgh ) is structured using a center of excellence model , where anatomical pathology cases are handled and signed out only by subspecialty pathologists ( e.g. neuropathology , dermatopathology , cytopathology , etc . ) .
kingmed diagnostics is a large network with 27 central pathology laboratories serving 13,600 hospitals and clinics in china .
guangzhou kingmed diagnostics ( guangzhou , china ) is the first pathology laboratory to be fully certified in both anatomic and clinical pathology by the college of american pathologists in china .
guangzhou kingmed diagnostics was also certified by the international organization for standardization ( iso 15189 ) . the diagnosis rendered by expert pathologists from upmc
is regarded as a second opinion and not used for primary diagnosis . since upmc pathologists were not licensed to practice medicine in china , kingmed were legally responsible for final diagnoses on consultation cases .
the pathologists from guangzhou kingmed telepathology consultation center sign out a final report in chinese for each case .
patients receive both an english report from the upmc pathologist and chinese report from kingmed pathologists .
the pathologists at the guangzhou kingmed telepathology consultation center only gave a final diagnosis after slides had been reviewed by upmc pathologists .
the technology employed to support telepathology between upmc and kingmed in china has been previously described . in brief , a customized web - based digital pathology consultation portal was developed [ figure 1 ] .
glass slides were scanned in china using a nanozoomer scanner ( nanozoomer 2.0-ht , hamamatsu ) .
all slides were scanned at 20 , except for hematopathology cases that were scanned at 40. the hematopathologists at upmc requested higher resolution images upfront to facilitate their interpretation of cases .
for the first 2 years , wsi submitted for consultation resided on the client 's server ( hammamatsu ndp.serve ) in china .
pathology consultants from pittsburgh in the usa used the upmc web portal to securely access these images on the client 's server .
workflow ( e.g. , case triage , transcription ) and reporting were incorporated into this web - based application . in the 3 year
, digital slides were transferred without compression to a server in pittsburgh , usa using commercial file transfer software ( aspera ) .
in china , each kingmed branch located within different cities nationwide received telepathology consultation cases from local pathologists , clinicians , and/or at the request of patients to be sent to the kingmed consultation center in guangzhou .
tissue sections for routine h & e staining and immunohistochemistry ( ihc ) were cut at 3 m .
although attempts were made to enhance slide and stain quality as much as possible for telepathology purposes , there were still differences in slide quality depending on which kingmed site generated the slides .
for difficult surgical pathology cases requiring consultation , initial glass slides ( h & e and when included immunohistochemical stained slides ) were screened at guangzhou kingmed center before being referred to upmc expert pathologists .
glass slides and tissue blocks were not permitted to be physically mailed to upmc in the usa due to chinese regulations . in other words ,
this also limited glass slides being sent later to pittsburgh for quality assurance , re - review of a proportion of cases after diagnoses were rendered .
upmc and kingmed pathologists had the ability to communicate bidirectionally [ figure 2 ] , which allowed pathologists to request additional information ( e.g. , clinical findings , gross pathology details , flow cytometry data , etc . ) and if necessary even radiology images .
if required , upmc pathologists were allowed to order additional stains including immunostains to further work up cases .
these additional slides were prepared at the guangzhou kingmed center , then digitized and added to the existing consult case . at the outset
, both partners established an agreeable stain quality and menu of immunohistochemical stains available in china . at the start of this collaboration , upmc pathologists reviewed 10 cases with glass slides compared to scanned images to confirm quality .
dedicated information technology ( it ) staff at both partnering institutions maintained the telepathology infrastructure , monitored turnaround time ( tat ) , and were involved in troubleshooting technical issues .
screenshot from the telepathology portal illustrating the value of bidirectional communication a retrospective study using descriptive statistics was performed evaluating the consultation experience and diagnostic results between upmc and kingmed over a 36 month period ( january 2012 - december 2014 ) .
tat was counted as the time when upmc received scanned images to the time when upmc pathologists signed out the case with a final diagnostic interpretation . when performed
, tat included the time needed for additional procedures such as performing ihc stains or molecular analysis .
based on the final diagnosis rendered by upmc expert pathologists , the cases were divided into three groups : those with definitive ( certain ) diagnoses , suggestive ( favored ) diagnoses , and atypical ( indeterminate ) diagnoses .
during the 3 year study period , there were 1561 cases sent for consultation to upmc including 144 cases in 2012 , 614 in 2013 , and 803 in 2014 .
the distribution of cases among different body systems and the corresponding tat for rendering a final consultation diagnosis is listed in table 1 .
hematopathology received the most cases ( 23.7% ) , followed by bone / soft tissue pathology ( 21.0% ) and gynecologic / breast ( 20.2% ) subspecialties .
the average tat was 6.8 days in 2012 , 5.3 days in 2013 , and 5.0 days in 2014 .
subsequent immunostains were ordered for most of the cases . for certain cases , especially in hematopathology , more than one round of immunostains was needed which increased the tat .
overall , the average tat gradually improved as did user satisfaction with the system based on subjective evaluation .
teleconsultation case distribution and turnaround time in most ( 82.4% ) cases , a definite diagnosis was provided [ table 2 ] .
the main reasons for not providing a definite diagnosis included lack of clinical information , missing gross description , insufficient tissue sections submitted , and/or no material available to perform additional immunostains .
cases sent for consultation in general were either difficult to diagnose or were rare entities [ figures 35 ] .
since kingmed is an independent reference laboratory , information on follow - up surgical resection specimens was not made available to upmc .
final diagnoses rendered by upmc expert pathologists diagnostic entities rendered by upmc expert pathologists examples of challenging soft tissue pathology consultation cases .
( top left ) recurrent acral myxoinflammatory fibroblastic sarcoma . the clinical image shown in this case
( bottom right ) pleomorphic hyalinizing angiectatic tumorwere examples of rare gynecologic and breast pathology consultation cases .
( left panel ) 17-year - old female with an ovarian embryonal carcinoma ( top left h & e ; bottom left positive cd30 immunostain ) .
( right panel ) 45-year - old female with a breast metaplastic carcinoma showing chondroid differentiation ( top right h & e ; bottom right cytokeratin 5/6 immunostain ) examples of challenging lymphoma consultation cases .
( top panel ) anaplastic lymphoma kinase - negative anaplastic large cell lymphoma ( top left h & e ; top right cd30 immunostain ) .
( bottom panel ) classical hodgkin lymphoma ( bottom left h & e ; bottom right cd30 immunostain ) the original diagnoses for cases submitted for consultation were recorded and analyzed .
most cases were referred by pathologists , followed by requests from primary clinicians in china for cases to be sent to the usa for a second opinion [ table 4 ] .
of 1561 consulted cases , 706 cases ( 45.2% ) were sent for consultation without an initial primary diagnosis or diagnostic impression . for the remaining 855 cases ( 54.7% ) where a primary diagnosis or initial impression was made by the primary pathologists in china ,
for cases were a primary diagnosis was submitted , upmc expert pathologists agreed with that primary diagnosis or impression in 25.6% of cases , and completely disagreed or considerably modified the primary diagnosis ( i.e. , the treatment plan was altered , and/or prognosis differed ) in 50.8% of cases [ table 5 ] , which included 278 cases of malignancies / cancers .
the organ distribution for cases with primary diagnoses that had disagreements are listed in table 6 . of note , hematopathology , and bone / soft tissue cases received a lower percentage of cases with a primary diagnosis ( 45.7% and 43.7% ) , indicating the difficulty general pathologists have with pathological evaluation of these organs .
the disagreement rates for hematopathology and bone / soft tissue cases were 53.3% and 55.9% , respectively .
for the 59.5% of gynecology / breast cases that had primary diagnoses , the disagreement rate was 41.5% , which is lower than that seen with hematopathology and bone / soft tissue cases .
surprisingly , 84.6% of head / endocrine cases submitted with a primary diagnosis showed that 72.7% of these cases had disagreement [ table 6 ] .
referral nature of cases submitted for telepathology consultation agreement of diagnoses between upmc expert pathologists and the primary pathologists in china teleconsultation case distribution with significantly modified diagnoses
report of a government supported telepathology consultation and quality control program for cancer diagnosis in china indicated that telepathology could play an important role in improving pathology diagnoses in china . to date , there have been no large studies showing the success of telepathology involving china and other countries .
the results of this study indicate , for the first time , that international telepathology consultation can improve patient care in china by facilitating access to pathology expertise .
the ongoing success and marketing effort of the telepathology collaboration between upmc and kingmed resulted in an increased number of cases being submitted for consultation each year .
teleconsultation , in turn , improved the quality of care for patients since the second opinions modified the primary diagnosis ( i.e. , the treatment plan was likely to be altered , and/or prognosis differed ) in 50.8% of cases . of note ,
the shift in requests for consultation from pathologists at first to treating clinicians and then even to patients themselves later indicates the value placed on obtaining an expert pathology opinion .
similar results were reported in a national telepathology consultation and quality control program in china .
that study showed that 24.2% of cases had expert 's opinion significantly different from submitting pathologists .
for the purposes of this study , significant difference means a change from malignant to benign or from benign to malignant .
the rate increases to 28.8% if cases without a preliminary diagnosis were excluded . based on our experience ,
the highest disagreement rates were seen with head and neck / endocrine cases , hematopathology , bone / soft tissue and then gynecology / breast cases , which may indicate the difficulty general pathologists have with making pathology diagnoses in these cases .
our study was not intended to compare diagnostic capabilities between pathologists in china and the usa , but rather to demonstrate that telepathology is a convenient mechanism to assist those seeking consultation . moreover , there are three general levels of hospitals in china : level 3 are the large hospitals located in big cities , level 2 are mid - sized hospitals located in small - middle cities , and level 1 which are hospitals present in the countryside , suburbs or small cities .
hence , the primary diagnostic accuracy for this study does not fully represent the diagnostic skill of all chinese pathologists .
in addition , immunohistochemical studies requested to subsequently work - up cases submitted for teleconsultation can be helpful in the final diagnosis .
the pathology consultation service through the centers of excellence can offer comprehensive consultations in anatomic pathology , cytology , electron microscopy , ihc , flow cytometry , image analysis , cytogenetics , and molecular diagnostics to all levels of hospitals in the united states and other countries .
indirect benefits of this telepathology partnership include education , skill enhancement for pathologists from both parties , and academic collaboration .
a prior systematic review of general international telemedicine collaborations revealed several factors that were essential to success .
they included low operating costs , use of simple technologies , bi - directional communication , incentive - based programs , locally responsive services , strong team leadership , appropriate training , and user acceptance .
the success of our international digital consultation service was dependent on strong commitment and support from leadership , it expertise , and dedicated pathologists who understood the language and culture on both sides .
in addition , we customized our web portal to satisfy the needs of both the referring site and consulting pathologists .
this included a simple user interface and a built - in mechanism to support bi - directional discussions
. pathologists also received extensive training and consultants were offered a financial incentive to participate .
for any cross - border telemedicine venture , there are likely to be barriers . some of these obstacles include legal / regulatory issues , sustainability factors ( e.g. , high cost , inconsistent use , poor scalability ) , cultural factors ( e.g. , different language , trust issues ) , and contextual factors ( e.g. it infrastructure , network limitations , time zones ) .
indeed , some of the challenges we encountered included internet speed restrictions and overcoming firewalls , differences in culture and health care systems , lack of clinical information and gross pathology descriptions with some cases , insufficient tissue sections submitted for evaluation , and difficulties related to direct communication with chinese clinicians .
in summary , a retrospective review of teleconsultation experience between upmc in the usa and kingmed diagnostics in china shows a successful , sustainable and growing international partnership . leveraging technology to facilitate access to remote pathology experts
has resulted in great improvement of patient care in china . therefore , international telepathology practice for second opinions should be encouraged .
| background : telepathology is increasingly being employed to support diagnostic consultation services .
prior publications have addressed technology aspects for telepathology , whereas this paper will address the clinical telepathology experience of kingmed diagnostics , the largest independent pathology medical laboratory in china . beginning in 2012 the university of pittsburgh medical center ( upmc ) and kingmed diagnostics partnered to establish an international telepathology consultation service.materials and methods : this is a retrospective study that summarizes the telepathology experience and diagnostic consultation results between upmc and kingmed over a period of 3 years from january 2012 to december 2014.results:a total of 1561 cases were submitted for telepathology consultation including 144 cases in 2012 , 614 cases in 2013 , and 803 in 2014 .
most of the cases ( 61.4% ) submitted were referred by pathologists , 36.9% by clinicians , and 1.7% by patients in china .
hematopathology received the most cases ( 23.7% ) , followed by bone / soft tissue ( 21.0% ) and gynecologic / breast ( 20.2% ) subspecialties .
average turnaround time ( tat ) per case was 5.4 days , which decreased from 6.8 days in 2012 to 5.0 days in 2014 .
immunostains were required for most of the cases .
for some difficult cases , more than one round of immunostains was needed , which extended the tat . among 855 cases ( 54.7% ) where a primary diagnosis or impression was provided by the referring local hospitals in china , the final diagnoses rendered by upmc pathologists were identical in 25.6% of cases and significantly modified ( treatment plan altered ) in 50.8% of cases.conclusion:these results indicate that international telepathology consultation can significantly improve patient care by facilitating access to pathology expertise .
the success of this international digital consultation service was dependent on strong commitment and support from leadership , information technology expertise , and dedicated pathologists who understood the language and culture on both sides .
lack of clinical information , missing gross pathology descriptions , and insufficient tissue sections submitted for evaluation were the main reasons for indefinite diagnoses .
the overall experience encourages international telepathology practice for second opinions . |
arthrogryposis multiplex congenita ( amc ) is a multiple joint condition which affects both lower and upper extremities and thus affects ambulation .
the objective of this study is to identify the most critical residual deformity that diminishes the ambulatory status .
the mean age at first surgery was 4.1 years ( range 2 - 16 years ) .
the mean length of followup was 44.0 months ( range 22 - 168 months ) .
type of procedures and number of operations , residual deformity and walking ability were recorded .
residual deformity including hip flexion contracture more than 30 , knee flexion contracture more than 30 , scoliosis , hip dysplasia or dislocation , knee extension contracture or recurvatum , active motion of hips and knees and upper limb involvement were evaluated .
statistical analysis was done to evaluate factors that were statistically significant to affect walking ability in amc patients .
at the latest followup , 31 patients were community ambulators , 3 patients were household ambulators , 3 patients were nonfunctional ambulatory , and 14 patients were nonambulatory .
statistical analysis of all factors was done and the results were significant with a p < 0.037 in knee flexion contracture > 30 degrees with odds ratio of 4.58 .
hip flexion contracture > 30 was a trend toward significant with a p value of 0.058 and odds ratio of 4.53 .
multivariate analysis showed that knee flexion contracture was significant with 4.58 ( 95% ci 1.01 - 20.6 ) .
amc is a rare disease that causes disability , requiring multiple surgeries to correct deformities .
our study showed that residual knee flexion contracture was associated with nonambulatory status of patients with amc .
arthrogryposis multiplex congenita ( amc ) is a rare , nonprogressive congenital disorder which is characterized by multiple joint contractures with normal sensation.12345 diagnosis of amc is usually based on physical examination with characteristic deformities of upper and lower extremities , limited range of motion , clubfoot or hip dislocation .
there are 150 different disorders for syndromes that have joint contractures as a part of their manifestations ; amc is diagnosed by exclusion , and precise diagnosis is very important for the evaluation of results.6 the term amyoplasia refers to the most common arthrogrypotic syndrome , which includes multiple congenital contractures , typical and symmetrical positioning of the limbs and the replacement of muscles by fibrous and fatty tissues .
it is sporadic , with an unknown hereditary pattern.7 the goal of treatment is to obtain the maximum possible function for each child by an early multidisciplinary approach.78 at present the goal of treatment is to improve ambulatory status of patients and patient self - care .
amc patients have multiple problems which can be improved by surgical intervention but the most helpful procedures are still undefined .
this study aims to find residual deformity that affects the ambulatory status of the patient .
residual deformities that are risk factors in this study include hip flexion contracture more than 30 , knee flexion contracture more than 30 , knee extension deformity or recurvatum , severe scoliosis , upper extremity contracture or weakness and development dysplasia of the hip ( ddh ) or hip dislocation .
we feel that our results will guide physicians in decision making regarding treatment to promote ambulation in amc patients .
this study was designed as a retrospective study of amc patients at our institute from january 1995 to december 2010 .
after approval from the ethics committee , chart review was conducted in accordance with the guidelines provided from our institutional review board .
we reviewed all the medical records and included only those children with amc who had a mean followup of 44 months ( range 22 - 168 months ) .
the inclusion criteria were amc patients who underwent surgical procedure or treatment for deformities or dislocations of the joints in the upper or lower limbs and patients or parents who agreed to participate .
the study recruited 53 patients ; two of them were excluded because of incomplete medical data .
we recorded the children 's potential to ambulate at the first visit and at each of the subsequent visits until the last followup .
all clinical assessment was recorded and included age , sex , associated disease , and surgical procedure carried out . ambulatory status and residual deformities which include deformities in both upper and lower extremities , scoliosis ,
degrees of contracture at the hips and knees , active motion of hips and knees and the presence of ddh or hip dislocation were recorded from the clinical and physiotherapy notes .
thirty three patients were in walking age and twenty patients were ambulatory at the start of treatment . walking age in this study was patient age more than 18 months .
all the patients who were ambulatory at the start of treatment remained ambulatory at final followup .
out of thirty one patients who were nonambulatory at the start of treatment , seventeen patients could ambulate at the final followup , fourteen patients were still nonambulatory .
of the thirty one patients who were nonambulatory at the start of treatment , twenty one patients had hips and knee flexion contracture of more than 30 and after proximal femoral extension osteotomy and distal femoral extension osteotomy , seventeen patients who were corrected to less than 30 of hips and knee flexion contractures could walk . for the residual deformities , seven patients had hip flexion contracture more than 30 and nine patients had knee flexion contracture more than 30. forty seven patients were able to do active range of motion of hips and knees .
there were 54 upper extremities procedures and 165 lower extremities procedures [ tables 2 and 3 ] .
bilateral limb surgeries were considered as two procedures , even if they were done during the same anesthesia [ tables 2 and 3 ] .
the final functional outcome was assessed using hoffer 's classification of walking status [ table 4].9 thirty one patients were community ambulatory who were able to walk with aids in the community and did not need a wheel chair , three patients were household ambulatory , able to walk with aids in the house and use a wheel chair in the community whereas three patients were nonfunctional ambulators using a wheel chair and capable of transfer while 14 patients were nonambulators and were not capable of transfer [ table 4 ] . location and type of operations for the upper limbs type of operations for the lower limbs characteristics of walking at latest followup at the last followup , 37 patients were ambulatory and 14 patients were nonwalkers .
there was statistical significance with p value 0.037 for knee flexion contracture more than 30 with odds of 4.58 ( 95% ci 1.01 - 20.6 ) .
hip flexion contracture more than 30 was a trend toward significant with a p value 0.058 and odds ratio of 4.53 .
these children are best managed by multidisciplinary teams that include an experienced geneticist , an orthopedic surgeon , a physical therapist , and a pediatric physical therapist .
it should be recognized that high percentage of these children might be able to achieve some measure of functional ambulatory potential , but many will lose ambutation as they get older .
the need for surgery is high in these children , and often , several procedures will be necessary .
a careful discussion of realistic goals with the parents is very important , as is the ongoing focus on skills necessary for promoting independence in adulthood .
hoffer et al.9 reported functional ambulation in 22 out of 36 severely affected adolescents and young adults with arthrogryposis .
many series have reported varying degrees of functional ambulation in 50 to 78% of patients.1011 sells et al.11 found that 85% of children with amyoplasia were ambulatory by the age of 5 .
these children had an average of 5.7 orthopedic procedures along with multiple casting , splinting of limbs and regular physical and occupational therapy .
ultimately they were able to participate in activities of daily living and attend school . based on our findings
we strongly believe that children with arthrogryposis may have good potential for ambulation if their knee flexion contractures have been adequately and timely corrected .
kroksmark et al . has reported a group of patients with amyoplasia that are indistinguishable in the newborn period and respond dramatically to physical therapy.12 all of these series suggest an optimistic childhood , with peak function occurring by the age of 10 years and some decline in ambulation into the adult years . despite these reports
assessment for this potential can be difficult , with decisions of the extent and timing of surgery hanging in balance .
future multicenter studies by exploring the effects and involvement of residual deformity which affect ambulation in this population are recommended .
longer followup periods should be included to verify the extent to which ambulatory gains are maintained .
knee involvement is commonly seen among children with arthrogryposis , with flexion contracture of the knee being the most frequent knee deformity .
knee flexion contracture in the pediatric population is particularly debilitating as it adversely affects ambulation .
treatment for knee flexion contracture requires numerous orthopedic procedures and extensive followup period . according to most authors ,
knee flexion contracture is more frequent and more difficult to treat with conservative methods than the knee extension contracture.1314 in the literature consensus is to perform early serial casting and physiotherapy , which sometimes is sufficient to correct contracture in flexion or extension . in cases of failure of conservative treatment surgery
is recommended and includes procedures like by posterior capsulotomy in addition to soft - tissue release ( including hamstring tenotomy ) .
del - bello and watts recommended performing a distal femoral extension osteotomy for flexion contracture as a safe procedure even for severe contractures.15 thomas et al . used femoral osteotomies in young patients
because the walking improvement is large and quick ( 32 nonambulators became community or household ambulators in their series).13 brunner et al .
used the ilizarov technique as an efficient tool for knee and foot deformity corrections ; however , he noted a high recurrence rate in children younger than 10 years of age.16 thomas et al . and hoffer et al .
noted the importance of having a flexion contracture less than 20 degrees in order to walk independently.913 our results support this conclusion .
murray and fixsen presented functional results of 22 patients with amyoplasia followed up over an average of 7 years .
patients in this series were treated by initial physiotherapy and splintage , as well as repeated posterior release and bony procedures when necessary .
they reported 14 community walkers in 22 patients.14 herzenberg et al . reported 10 patients with knee flexion contractures of various different etiologies , including 2 patients with arthrogryposis , treated with ilizarov external fixator .
both became community ambulators at the latest followup.17 a study by van bosse et al.18 reported a high rate of improvement in ambulation in all seven children with arthrogryposis with knee flexion contracture after ilizarov correction at latest followup , including five who were initially nonambulatory .
a recent report by fassier et al . indicated that among 11 children with arthrogryposis , 7 were independent ambulators at skeletal maturity.19 however , these children had normal knee mobility or a flexion contracture of less than 15 and most had mild involvement of the hips , spine , or upper extremities .
we agree with these researchers that early aggressive management of children with severe arthrogryposis is justified and recommended . in our series hip flexion contracture
we observed that community ambulators presented with less than 30 degrees of hip flexion contracture .
hoffer et al . also noted that less than 30 of hip flexion contracture in their independently walking patients.9 staheli et al.420 and hoffer et al.9 have categorized children with ambulatory potential as having grade 4 or greater hip extensors ; hip flexion contracture less than 20 ; grade 4 quadriceps function ; grade 3 quadriceps function with knee flexion contracture less than 20 ; and good strength and sitting balance , with shoulder depressor function and only mild upper extremity abnormalities but many studies show progressive muscle activity improvement after the recovery of a passive range of motion in a useful arc .
many studies showed that independent ambulators were able to perform an increase in strength during growth .
the difficulty remaining in identifying prognosis factors is , as with the case of any rare diseases , the small number of patients available to generate data . in our series , poor prognostic factors for independent or community walkers were residual knee flexion contracture more than 30.
hip flexion contracture is less likely to occur in isolation , but if greater than 30 , it may affect ambulation , and if greater than 45 , it will generally require release .
often , the combination of hip flexion , external rotation , and abduction contractures are present.21 in these cases , the hip abductors may function as extensors and if the hip is left in external rotation , the hip can often be adducted to neutral and extend to less than 30 of contracture without soft tissue release while preserving good hip extensor strength for standing .
a distal femoral osteotomy is necessary to bring the knee and foot into alignment for ambulation .
reduction of hip dislocation is recommended for unilateral dislocation in all reports.2021 long term ambulatory status at skeletal maturity is not correlated with the severity of condition at birth.19 therefore , we believe that early aggressive management of children with severe arthrogryposis is warranted and justified .
the ambulatory status in children with arthrogryposis is variable and our findings seem to indicate that although knee flexion contractures have an impact on ambulation , hip flexion contracture may also influence ambulation .
our findings emphasize that residual knee flexion contracture affects the ambulatory status of children with arthrogryposis .
surgical interventions for knee flexion contractures in this population is warranted and support a positive prognosis . | background : arthrogryposis multiplex congenita ( amc ) is a multiple joint condition which affects both lower and upper extremities and thus affects ambulation .
multiple surgeries are needed to correct limb deformity in order to promote walking .
the objective of this study is to identify the most critical residual deformity that diminishes the ambulatory status.materials and methods:51 patients were included in this study , 14 patients were nonambulatory .
the mean age at first surgery was 4.1 years ( range 2 - 16 years ) .
the mean length of followup was 44.0 months ( range 22 - 168 months ) .
type of procedures and number of operations , residual deformity and walking ability were recorded .
residual deformity including hip flexion contracture more than 30 , knee flexion contracture more than 30 , scoliosis , hip dysplasia or dislocation , knee extension contracture or recurvatum , active motion of hips and knees and upper limb involvement were evaluated .
statistical analysis was done to evaluate factors that were statistically significant to affect walking ability in amc patients.results:at the latest followup , 31 patients were community ambulators , 3 patients were household ambulators , 3 patients were nonfunctional ambulatory , and 14 patients were nonambulatory .
there were an average of 4.3 surgeries per patient .
statistical analysis of all factors was done and the results were significant with a p < 0.037 in knee flexion contracture > 30 degrees with odds ratio of 4.58 .
hip flexion contracture > 30 was a trend toward significant with a p value of 0.058 and odds ratio of 4.53 .
multivariate analysis showed that knee flexion contracture was significant with 4.58 ( 95% ci 1.01 - 20.6).conclusion : amc is a rare disease that causes disability , requiring multiple surgeries to correct deformities .
our study showed that residual knee flexion contracture was associated with nonambulatory status of patients with amc . |
we used 2 g of total rna from human umbilical vein ecs ( huvecs ) cultured under normoxic or hypoxic conditions for 24 h and subjected to rna - seq analysis ( n = 3 ) . after extracting the total rna from the samples ,
the left rna was fragmented into short fragments , then the first strand complementary deoxyribonucleic acid was synthesized by random hexamer - primer using the left rna fragments as templates .
buffer , nucleotide triphosphates containing deoxyribose , ribonuclease h , and deoxyribonucleic acid polymerase i were added to synthesize the second strand .
the double - strand complementary deoxyribonucleic acid was purified using the qiaquick polymerase chain reaction extraction kit ( qiagen , venlo , the netherlands ) and washed with elution buffer for end repair and poly(a ) addition .
finally , sequencing adaptors were ligated to the fragments , which were purified by agarose gel electrophoresis and enriched by polymerase chain reaction amplification .
the library products were sequenced using the hiseq 2000 ( illumina , san diego , california ) .
to identify hypoxia - sensitive endothelial lncrnas , huvecs were first subjected to 24 h of hypoxia . in preliminary experiments , we found this time point optimal for identifying regulations of a vast majority of lncrnas ( data not shown ) .
hypoxia - sensitive noncoding rna expression was detected via 2 approaches , microarray- and rna - seq - based techniques .
we first focused on the microarray - derived noncoding rna dataset to search for lncrnas using the following criteria : minimal 4-fold deregulation and intergenic lncrna localization . by this approach , we identified linc00323 ( lnc - dscam-1 ) to be the strongest ( 8-fold ) up - regulated lincrna after hypoxia ( probe uc002yyv ) ( online table 1 ) .
rna - seq data identified 773 ( 403 up , 370 down ) significantly deregulated lncrnas ( figure 1a , online table 2 ) .
the analysis of rna - seq data for protein - coding genes of huvecs cultured under normoxic or hypoxic conditions showed 8,156 ( 4,032 up , 4,124 down ) significantly deregulated mrnas ( figure 1b , online table 2 ) .
the log2-fold expression changes derived from the 2 different technologies were significantly correlated both for lncrnas ( pearson correlation coefficient = 0.43 , p < 2.2 10 ) and for protein - coding genes ( pearson correlation coefficient = 0.74 , p < 2.2 10 ) ( online figure 1 ) .
rna - seq also confirmed enhanced expression of linc00323 ( lnc - dscam-1 ) under hypoxia ( online table 2 ) .
in addition , from the rna - seq data , we identified another hypoxia - sensitive lncrna , mir503hg ( lnc - plac1 - 1 ) , on the basis of the following criteria : 1 ) minimal 4-fold up - regulation ; 2 ) base mean > 1,000 ; and 3 ) intergenic annotation . on the basis of these stringent criteria
, we identified lnc - mst1p9 - 2 and lnc - plac1 - 1 as high propriety candidates but omitted lnc - mst1p9 - 2 from further studies because of potential protein - coding properties .
subsequent validation experiments confirmed the hypoxia - dependent up - regulation of the previous 2 array- or rna - seq - derived lincrnas , linc00323 and mir503hg ( figure 1c and online figure 1 for other linc00323 transcript isoforms ) . cell compartment
specific rna analysis revealed hypoxia - dependent enhanced cytoplasmic linc00323 - 003 expression , whereas mir503hg was increased both in the nuclear and cytoplasmic compartments ( figure 1c ) .
high purity of subcellular compartment preparations was proved by screening expression of the nuclear enriched lncrna xist ( online figure 1 ) .
endothelial up - regulation of these 2 lncrnas by hypoxia was cell - type specific , as this was not seen in human cardiac fibroblasts or human aortic smooth muscle cells exposed to hypoxia ( online figure 1 ) .
the 2 lncrnas were considerably expressed in ecs and vascularized organs , such as kidneys ( data not shown ) .
we next sought to identify potential functional relevance for the identified lncrna candidates in human ecs .
linc00323 is encoded on chromosome 21 and has 3 transcript isoforms 21 , 22 according to the lncrna database lncipedia and the ensembl genome browser ( figure 2a ) .
we focused on linc00323 transcript variant 3 , as a small interfering rna ( sirna ) approach had obvious effects on ec biology to reduce cell number in vitro .
next to proangiogenic hypoxic signaling , endothelial vegf treatment also increased linc00323 - 003 expression ( figure 2b ) .
multiple in vitro assays were performed to clarify the functional relevance of endothelial linc00323 - 003 expression .
because linc00323 - 003 was detectable in nuclear and cytoplasmatic compartments , we used both antisense - mediated sirna ( targeting cytoplasmic lncrnas ) and gapmer ( targeting nuclear lncrnas ) approaches in huvecs . both approaches in a transgenic linc00323 - 003 overexpressing ec line documented potent lncrna silencing ( online figure 2 ) .
fluorescein transfection in ecs led to an accumulation in the nucleus ( online figure 2 ) .
titration experiments for the sirna chemistry showed detrimental effects on ec viability in a range of 1 to 100 nmol / l sirna , whereas application of 100 pmol / l of sirna exhibited no significant effect ( online figure 2 ) .
further sirna experiments were thus performed with 1 nmol / l of sirna to reduce potential off - target effects .
both sirna- and gapmer - mediated linc00323 - 003 silencing led to an inhibition of human ec proliferation ( figure 2c , online figure 2 ) , suggesting cytoplasmic and nuclear linc00323 - 003 expression to be critical for endothelial proliferation . in line , linc00323 - 003 silencing increased the ratio of binucleic to total cells and led to an increase in ec size , suggesting proliferation defects ( online figures 2 and 3 ) .
accordingly , the cell - cycle inhibitors p21 and p27 were up - regulated , whereas cell - cycle progression - relevant cyclin - dependent kinases 1 and 2 were reduced upon endothelial linc00323 - 003 silencing ( figure 2d , online figure 3 ) .
migration capacity was also strongly attenuated by linc00323 - 003 loss ( online figure 3 ) .
angiogenic capacity tested by capillary tube formation assays was significantly deteriorated upon linc00323 - 003 silencing ( figure 2e ) .
this was paralleled by a repression of proangiogenic vegfb and induction of the angiogenesis inhibitor thrombospondin ( online figure 3 ) .
loss of linc00323 - 003 additionally inhibited proliferation - important extracellular signal regulated kinase phosphorylation , and both led to a repression of the key endothelial transcription factor gata2 and proangiogenic sirtuin i ( online figure 3 , figure 2f ) .
indeed , part of the detrimental actions of linc00323 - 003 were mediated through gata2 silencing , as genetic overexpression of a functional gata2 construct attenuated the linc00323 - 003 actions on ecs ( online figure 3 ) .
interestingly , linc00323 - 003 silencing reduced gata2 protein but not mrna levels ( figure 2 g ) , suggesting a post - translational mechanism . using starbase 23 , 24 , a bioinformatic - based identification system , we found potential protein candidates interacting with linc00323 - 003
that are also involved in mrna translation and identified the translation initiation factor eif4a3 .
indeed , we were able to immunoprecipitate eif4a3 in human ecs ( figure 2h ) .
rna immunoprecipitation experiments in a stable linc00323 - 003-overexpression ec line revealed significant enrichment of linc00323 - 003 with immunoprecipitated eif4a3 compared with controls ( figure 2i ) .
in addition , gata2 mrna was found to be associated with eif4a3 ( figure 2j ) .
this suggests a scaffold function of linc00323 - 003 to bind proteins , such as the translation initiation factor eif4a3 ( central illustration ) .
linc00323 - 003 silencing also caused impaired proliferative capacity of human coronary artery ecs , suggesting a broad impact of this lncrna on various types of ecs ( online figure 3 ) .
the rna - seq - derived lincrna mir503hg is located at chromosome x , harbors a coding sequence of mir-503 , and is adjacent to mir-424 ( figure 3a ) .
indeed , analysis of primary mir-503 and mature mir-503 expression after hypoxia showed a similar increase of expression reflecting same regulatory mechanisms for transcriptional activation ( figure 3b ) .
however , both mir-503 and lincrna mir503hg modulations had different effects on ec function ; whereas transfection of mir-503 precursors resulted in negative effects on ec viability ( online figure 4 ) , knockdown of mir503hg suppressed endothelial proliferation independent of alterations of apoptosis ( figures 3c and 3d , online figure 4 ) .
mir503hg silencing via gapmer technology led to reduced mir-503 expression ( online figure 4 ) . in contrast , transfection of mir-503 precursors did not alter mir503hg expression ( online figure 4 ) , suggesting dependency of mir-503 expression on mir503hg but not vice versa . migratory capacity of mir503hg - deficient ecs
the proliferative and migratory functional defects in ecs after mir503hg silencing were paralleled by a strong up - regulation of the cell - cycle inhibitor p21 ( online figure 4 ) . in line with data from linc00323 - 003 loss - of - function experiments , silencing of mir503hg repressed expression of the key angiogenic transcription factor gata2 ( figure 3f ) .
surprisingly , mir503hg repression up - regulated neighboring mir-424 expression ( figure 3 g ) . conclusively
, this observation supports a cis - action of lnc - mir503hg on neighboring mir-424 .
mir-424 was previously described to be antiproliferative in lung arterial ecs ; moreover , its overexpression triggers antiangiogenic effects in human ecs ( 25 ) .
indeed , we were able to validate these findings and found impaired proliferation of human ecs after mir-424 overexpression ( figure 3h ) .
however , no significant effects toward impairment of angiogenesis were observed when analyzing capillary tube formation after mir503hg silencing ( online figure 4 ) .
intrinsic modulation in arterial ecs had only minor effects on cellular behavior , suggesting a different impact of mir503hg in venous and arterial ecs ( online figure 4 ) . to study the role of enhanced lincrna expression in ecs , the hypoxia - sensitive lincrnas linc00323 - 003 and mir503hg were both overexpressed by generation of stable green fluorescent protein ( gfp)-expressing ec lines ( ea.hy926 ) ( online figure 5 ) .
transgenic ea.hy926 constitutively overexpressing linc00323 - 003 revealed improved endothelial healing in the scratch wound assay and showed enhanced cytoprotective hmox1 expression ( online figure 5 ) .
in contrast , no changes in endothelial biology were observed after mir503hg overexpression ( online figure 5 ) . to investigate whether the in vitro findings could be validated in a 3-dimensional ex vivo model
, we generated human induced pluripotent stem cell derived engineered heart tissues ( ehts ) enriched with gfp - overexpressing huvecs for easy identification of ecs in such human ex vivo constructs .
huvecs showed 99% purity after blasticidine selection , as confirmed by flow cytometric analysis ( data not shown ) and gfp fluorescence microscopy ( figure 4a ) .
ehts were transfected with sirna linc00323 - 003 , gapmer mir503hg , or scrambled controls on days 5 , 10 , and 15 of culture , and analyses were performed for eht development and number of ecs .
dystrophin staining of cross - sectioned ehts showed a homogenous distribution and high density of cardiomyocytes ( figure 4b ) , which were similarly observed in all groups ( data not shown ) .
quantification of gfp - expressing huvecs ( figures 4c to 4 g ) identified a significantly smaller number of ecs in linc00323 - 003 and mir503hg loss - of - function ehts compared with control tissue constructs .
these data suggest that silencing linc00323 - 003 and mir503hg , not only in vitro but also in an ex vivo human eht model , impairs endothelial biology and tissue vascularization .
to identify hypoxia - sensitive endothelial lncrnas , huvecs were first subjected to 24 h of hypoxia . in preliminary experiments , we found this time point optimal for identifying regulations of a vast majority of lncrnas ( data not shown ) .
hypoxia - sensitive noncoding rna expression was detected via 2 approaches , microarray- and rna - seq - based techniques .
we first focused on the microarray - derived noncoding rna dataset to search for lncrnas using the following criteria : minimal 4-fold deregulation and intergenic lncrna localization . by this approach , we identified linc00323 ( lnc - dscam-1 ) to be the strongest ( 8-fold ) up - regulated lincrna after hypoxia ( probe uc002yyv ) ( online table 1 ) .
rna - seq data identified 773 ( 403 up , 370 down ) significantly deregulated lncrnas ( figure 1a , online table 2 ) .
the analysis of rna - seq data for protein - coding genes of huvecs cultured under normoxic or hypoxic conditions showed 8,156 ( 4,032 up , 4,124 down ) significantly deregulated mrnas ( figure 1b , online table 2 ) .
the log2-fold expression changes derived from the 2 different technologies were significantly correlated both for lncrnas ( pearson correlation coefficient = 0.43 , p < 2.2 10 ) and for protein - coding genes ( pearson correlation coefficient = 0.74 , p < 2.2 10 ) ( online figure 1 ) .
rna - seq also confirmed enhanced expression of linc00323 ( lnc - dscam-1 ) under hypoxia ( online table 2 ) .
in addition , from the rna - seq data , we identified another hypoxia - sensitive lncrna , mir503hg ( lnc - plac1 - 1 ) , on the basis of the following criteria : 1 ) minimal 4-fold up - regulation ; 2 ) base mean > 1,000 ; and 3 ) intergenic annotation . on the basis of these stringent criteria
, we identified lnc - mst1p9 - 2 and lnc - plac1 - 1 as high propriety candidates but omitted lnc - mst1p9 - 2 from further studies because of potential protein - coding properties .
subsequent validation experiments confirmed the hypoxia - dependent up - regulation of the previous 2 array- or rna - seq - derived lincrnas , linc00323 and mir503hg ( figure 1c and online figure 1 for other linc00323 transcript isoforms ) . cell compartment
specific rna analysis revealed hypoxia - dependent enhanced cytoplasmic linc00323 - 003 expression , whereas mir503hg was increased both in the nuclear and cytoplasmic compartments ( figure 1c ) .
high purity of subcellular compartment preparations was proved by screening expression of the nuclear enriched lncrna xist ( online figure 1 ) .
endothelial up - regulation of these 2 lncrnas by hypoxia was cell - type specific , as this was not seen in human cardiac fibroblasts or human aortic smooth muscle cells exposed to hypoxia ( online figure 1 ) .
the 2 lncrnas were considerably expressed in ecs and vascularized organs , such as kidneys ( data not shown ) .
we next sought to identify potential functional relevance for the identified lncrna candidates in human ecs .
linc00323 is encoded on chromosome 21 and has 3 transcript isoforms 21 , 22 according to the lncrna database lncipedia and the ensembl genome browser ( figure 2a ) .
we focused on linc00323 transcript variant 3 , as a small interfering rna ( sirna ) approach had obvious effects on ec biology to reduce cell number in vitro .
next to proangiogenic hypoxic signaling , endothelial vegf treatment also increased linc00323 - 003 expression ( figure 2b ) .
multiple in vitro assays were performed to clarify the functional relevance of endothelial linc00323 - 003 expression .
because linc00323 - 003 was detectable in nuclear and cytoplasmatic compartments , we used both antisense - mediated sirna ( targeting cytoplasmic lncrnas ) and gapmer ( targeting nuclear lncrnas ) approaches in huvecs . both approaches in a transgenic linc00323 - 003 overexpressing ec line documented potent lncrna silencing ( online figure 2 ) .
fluorescein transfection in ecs led to an accumulation in the nucleus ( online figure 2 ) .
titration experiments for the sirna chemistry showed detrimental effects on ec viability in a range of 1 to 100 nmol / l sirna , whereas application of 100 pmol / l of sirna exhibited no significant effect ( online figure 2 ) .
further sirna experiments were thus performed with 1 nmol / l of sirna to reduce potential off - target effects .
both sirna- and gapmer - mediated linc00323 - 003 silencing led to an inhibition of human ec proliferation ( figure 2c , online figure 2 ) , suggesting cytoplasmic and nuclear linc00323 - 003 expression to be critical for endothelial proliferation . in line , linc00323 - 003 silencing increased the ratio of binucleic to total cells and led to an increase in ec size , suggesting proliferation defects ( online figures 2 and 3 ) . accordingly , the cell - cycle inhibitors p21 and p27 were up - regulated , whereas cell - cycle progression - relevant cyclin - dependent kinases 1 and 2 were reduced upon endothelial linc00323 - 003 silencing ( figure 2d , online figure 3 ) .
migration capacity was also strongly attenuated by linc00323 - 003 loss ( online figure 3 ) .
angiogenic capacity tested by capillary tube formation assays was significantly deteriorated upon linc00323 - 003 silencing ( figure 2e ) .
this was paralleled by a repression of proangiogenic vegfb and induction of the angiogenesis inhibitor thrombospondin ( online figure 3 ) .
loss of linc00323 - 003 additionally inhibited proliferation - important extracellular signal regulated kinase phosphorylation , and both led to a repression of the key endothelial transcription factor gata2 and proangiogenic sirtuin i ( online figure 3 , figure 2f ) .
indeed , part of the detrimental actions of linc00323 - 003 were mediated through gata2 silencing , as genetic overexpression of a functional gata2 construct attenuated the linc00323 - 003 actions on ecs ( online figure 3 ) .
interestingly , linc00323 - 003 silencing reduced gata2 protein but not mrna levels ( figure 2 g ) , suggesting a post - translational mechanism . using starbase 23 , 24 , a bioinformatic - based identification system , we found potential protein candidates interacting with linc00323 - 003
that are also involved in mrna translation and identified the translation initiation factor eif4a3 .
indeed , we were able to immunoprecipitate eif4a3 in human ecs ( figure 2h ) .
rna immunoprecipitation experiments in a stable linc00323 - 003-overexpression ec line revealed significant enrichment of linc00323 - 003 with immunoprecipitated eif4a3 compared with controls ( figure 2i ) .
in addition , gata2 mrna was found to be associated with eif4a3 ( figure 2j ) .
this suggests a scaffold function of linc00323 - 003 to bind proteins , such as the translation initiation factor eif4a3 ( central illustration ) .
linc00323 - 003 silencing also caused impaired proliferative capacity of human coronary artery ecs , suggesting a broad impact of this lncrna on various types of ecs ( online figure 3 ) .
the rna - seq - derived lincrna mir503hg is located at chromosome x , harbors a coding sequence of mir-503 , and is adjacent to mir-424 ( figure 3a ) .
indeed , analysis of primary mir-503 and mature mir-503 expression after hypoxia showed a similar increase of expression reflecting same regulatory mechanisms for transcriptional activation ( figure 3b ) .
however , both mir-503 and lincrna mir503hg modulations had different effects on ec function ; whereas transfection of mir-503 precursors resulted in negative effects on ec viability ( online figure 4 ) , knockdown of mir503hg suppressed endothelial proliferation independent of alterations of apoptosis ( figures 3c and 3d , online figure 4 ) .
mir503hg silencing via gapmer technology led to reduced mir-503 expression ( online figure 4 ) .
in contrast , transfection of mir-503 precursors did not alter mir503hg expression ( online figure 4 ) , suggesting dependency of mir-503 expression on mir503hg but not vice versa .
migratory capacity of mir503hg - deficient ecs was additionally inhibited ( figure 3e ) .
the proliferative and migratory functional defects in ecs after mir503hg silencing were paralleled by a strong up - regulation of the cell - cycle inhibitor p21 ( online figure 4 ) . in line with data from linc00323 - 003 loss - of - function experiments , silencing of mir503hg repressed expression of the key angiogenic transcription factor gata2 ( figure 3f ) .
additionally , we identified another mirna , mir-424 , genetically neighboring upstream to mir503hg . surprisingly , mir503hg repression up - regulated neighboring mir-424 expression ( figure 3 g ) . conclusively , this observation supports a cis - action of lnc - mir503hg on neighboring mir-424 .
mir-424 was previously described to be antiproliferative in lung arterial ecs ; moreover , its overexpression triggers antiangiogenic effects in human ecs ( 25 ) .
indeed , we were able to validate these findings and found impaired proliferation of human ecs after mir-424 overexpression ( figure 3h ) .
however , no significant effects toward impairment of angiogenesis were observed when analyzing capillary tube formation after mir503hg silencing ( online figure 4 ) .
intrinsic modulation in arterial ecs had only minor effects on cellular behavior , suggesting a different impact of mir503hg in venous and arterial ecs ( online figure 4 ) .
to study the role of enhanced lincrna expression in ecs , the hypoxia - sensitive lincrnas linc00323 - 003 and mir503hg were both overexpressed by generation of stable green fluorescent protein ( gfp)-expressing ec lines ( ea.hy926 ) ( online figure 5 ) .
transgenic ea.hy926 constitutively overexpressing linc00323 - 003 revealed improved endothelial healing in the scratch wound assay and showed enhanced cytoprotective hmox1 expression ( online figure 5 ) .
in contrast , no changes in endothelial biology were observed after mir503hg overexpression ( online figure 5 ) .
to investigate whether the in vitro findings could be validated in a 3-dimensional ex vivo model , we generated human induced pluripotent stem cell derived engineered heart tissues ( ehts ) enriched with gfp - overexpressing huvecs for easy identification of ecs in such human ex vivo constructs .
huvecs showed 99% purity after blasticidine selection , as confirmed by flow cytometric analysis ( data not shown ) and gfp fluorescence microscopy ( figure 4a ) .
ehts were transfected with sirna linc00323 - 003 , gapmer mir503hg , or scrambled controls on days 5 , 10 , and 15 of culture , and analyses were performed for eht development and number of ecs .
dystrophin staining of cross - sectioned ehts showed a homogenous distribution and high density of cardiomyocytes ( figure 4b ) , which were similarly observed in all groups ( data not shown ) .
quantification of gfp - expressing huvecs ( figures 4c to 4 g ) identified a significantly smaller number of ecs in linc00323 - 003 and mir503hg loss - of - function ehts compared with control tissue constructs .
these data suggest that silencing linc00323 - 003 and mir503hg , not only in vitro but also in an ex vivo human eht model , impairs endothelial biology and tissue vascularization .
hypoxia is a strong proangiogenic stimulus and induces vegf - mediated signaling in ecs ( 19 ) .
the present study provides evidence that lncrna expression in ecs is strongly altered by hypoxia .
we have identified 2 novel lncrnas , linc00323 - 003 and mir503hg , that are highly sensitive to hypoxia and crucial for endothelial angiogenic characteristics .
the mechanisms leading to the hypoxia - mediated regulation of these lncrnas remain to be determined . to this end , we silenced hif1 during hypoxic cell culture of huvecs and tested effects on linc00323 - 003 and mir503hg expression .
silencing hif1 did not abrogate hypoxia - mediated induction of lncrnas compared with controls ( data not shown ) .
this is suggestive of hif1-independent mechanisms of the 2 hypoxia - induced lncrnas described here and is in line with the encyclopedia of dna elements dataset at the university of california , santa cruz , showing no hif1-binding sites in promoter regions of these lncrnas .
both lncrnas have never been described in endothelial biology , but here we show that they function as crucial factors to control ec behavior .
key experiments for linc00323 - 003 were also validated in arterial ecs , suggesting the importance on ecs in general .
of translational importance , lncrna knockdown also resulted in impaired vascularization in an ex vivo induced pluripotent stem cell
this model was used because of weak conservation at the sequence level in nonhuman species . however
, a potential mouse homologue for mir503hg , gm28730 , with about 70% sequence overlap , could be identified . the choice to investigate linc00323 - 003 and mir503hg was dependent on their high deregulation in either microarray or rna - seq datasets .
it is likely that many other thus far uncharacterized lncrnas also have crucial functions in endothelial biology and should be investigated in future studies ; the database of array- and rna - seq - based lncrna expression profiles reported here will be helpful in this context .
both lncrnas linc00323 - 003 and mir503hg exerted an important functional relevance for ec biology , making them potential attractive molecular targets in vascular diseases .
we have provided initial insight into their interaction partners , such as mirnas and proteins , but we wish to point out that more in - depth mechanistic studies are needed in the future to fully understand the mode of action of the identified lncrnas . in general , lncrnas are less ( sequence ) conserved among species , thus hampering translational approaches in a relevant in vivo vascular disease setting in other species models . to circumvent this limitation , we applied a model of human induced pluripotent stem cell based eht to translate the importance of these 2 lncrnas in endothelial biology in a more realistic translational scenario .
both lncrnas linc00323 - 003 and mir503hg exerted an important functional relevance for ec biology , making them potential attractive molecular targets in vascular diseases .
we have provided initial insight into their interaction partners , such as mirnas and proteins , but we wish to point out that more in - depth mechanistic studies are needed in the future to fully understand the mode of action of the identified lncrnas . in general , lncrnas are less ( sequence ) conserved among species , thus hampering translational approaches in a relevant in vivo vascular disease setting in other species models . to circumvent this limitation ,
we applied a model of human induced pluripotent stem cell based eht to translate the importance of these 2 lncrnas in endothelial biology in a more realistic translational scenario .
we have identified 2 novel hypoxia - sensitive endothelial lncrnas , linc00323 - 003 and mir503hg , by the use of microarray and next - generation rna - seq techniques . functional characterization applying loss- and
gain - of - function approaches in cultured ecs revealed an important role for both of these lncrnas in endothelial biology .
our data enable the future development of novel lncrna - therapeutic approaches to cardiovascular diseases .
more general , our data identify novel strategies based on lncrna modulation to alter tissue vascularization , with the aim of either enhancing ( e.g. , in ischemic tissues ) or blocking ( e.g. , in vessel - dependent cancers ) vascularization.perspectivescompetency in medical knowledge : angiogenesis is a key mechanism by which organs maintain blood supply , and this has therapeutic implications for amelioration of ischemia in organs or inhibition of vessel - dependent cancers .
lncrnas are key regulators of endothelial proliferation and play a role in angiogenesis.translational outlook : future research should examine the potential role of interventions that increase or normalize lncrna expression and cell type specific function to modulate angiogenesis in patients with myocardial infarction , peripheral arterial disease , or ischemic stroke .
competency in medical knowledge : angiogenesis is a key mechanism by which organs maintain blood supply , and this has therapeutic implications for amelioration of ischemia in organs or inhibition of vessel - dependent cancers .
translational outlook : future research should examine the potential role of interventions that increase or normalize lncrna expression and cell type specific function to modulate angiogenesis in patients with myocardial infarction , peripheral arterial disease , or ischemic stroke .
| backgroundlong noncoding ribonucleic acids ( lncrnas ) are a subclass of regulatory noncoding ribonucleic acids for which expression and function in human endothelial cells and angiogenic processes is not well studied.objectivesthe authors discovered hypoxia - sensitive human lncrnas via next - generation ribonucleic acid sequencing and microarray approaches . to address their functional importance in angiogenic processes , several endothelial lncrnas were characterized for their angiogenic characteristics in vitro and ex vivo.methodsribonucleic acid sequencing and microarray - derived data showed specific endothelial lncrna expression changes after hypoxia .
validation experiments confirmed strong hypoxia - dependent activation of 2 intergenic lncrnas : linc00323 and mir503hg.resultssilencing of these lncrna transcripts led to angiogenic defects , including repression of growth factor signaling and/or the key endothelial transcription factor gata2 .
endothelial loss of these hypoxia - driven lncrnas impaired cell - cycle control and inhibited capillary formation .
the potential clinical importance of these endothelial lncrnas to vascular structural integrity was demonstrated in an ex vivo model of human induced pluripotent stem cell based engineered heart tissue.conclusionsthe authors report an expression atlas of human hypoxia - sensitive lncrnas and identified 2 lncrnas with important functions to sustain endothelial cell biology .
lncrnas hold great promise to serve as important future therapeutic targets of cardiovascular disease . |
actin - rich membrane protrusions such as filopodia and lamellipodia can guide the convergence of cells during the formation of complex signaling interfaces in vivo , for example , during synaptogenesis in the nervous system or the merging of epithelial cell sheets during development or wound healing ( mattila and lappalainen , 2008 ) . alternatively ,
extended ( > 40 m ) parallel arrays of filopodia termed cytonemes ( cell threads ) observed in the drosophila embryo wing imaginal disk may function as cellular
antennae that connect cells over large distances to regulate the detection and transport of morphogen ligands that determine tissue patterning ( ramirez - weber and kornberg , 1999 ) . in 2004 ,
pioneering video microscopy studies by the gerdes and davis labs revealed a novel variation on this theme : intercellular nanotubular highways .
gerdes and colleagues described thread - like ( 50-nm diameter ) connections linking cultured rat neuron derived pheochromocytoma 12 ( pc12 ) cells formed after the convergence of dynamic filopodia extending from neighboring cells ( rustom et al .
they called these structures tunneling nanotubes ( tnts ) based on their apparent capacity to create a continuous channel between two cell cytoplasms , in analogy to plasmodesmata in plant tissues .
remarkably , pc12 tnts supported a directional flow of surface - bound molecules , cytoskeletal elements , and even endosomal membranes from cell to cell . soon after , the davis group described similar membrane nanotubes linking cultured primary lymphocytes , including natural killer cells , epstein
unlike tnts , these nanotubes represented residual membrane tethers formed after the disassembly of tight cell
cell contacts ( figure 1a , ( iii ) to ( ii ) ) and were proposed to provide motile lymphocytes with a mechanism for maintaining immune signaling over long distances ( onfelt and davis , 2004 ) .
consistent with this notion , watkins and salter ( 2005 ) demonstrated functional connectivity between primary dendritic cells ( dcs ) in culture , showing that a calcium signal could be propagated through nanotubes among dcs separated by multiple cell lengths .
mechanisms of cell cell nanotube formation , modes of transfer , and proposed roles in tissue homeostasis and the spread of infection .
filopodial interplay ( ( i ) to ( ii ) ) involves the convergence of protruding filopodia from neighboring cells , followed by anchoring .
dislodgement ( ( iii ) to ( ii ) ) involves the formation of residual tethers after the disassembly of tight cell cell contacts .
nanotubes may mediate long - distance signaling or in some instances be precursors to the formation of more complex cell cell interfaces ( ( ii ) to ( iii ) ) .
nanotubular linkages can be synaptic in nature and signal through ligand receptor interactions ( i ) or retain connectivity at a gap junction like interface maintained by connexons ( bow ties ) made up of hexamers of connexin proteins .
gap junctions regulate a gated flow of ions or small molecules from cell to cell ( ii )
. to exchange larger cargoes , nanotube connections must either be open and membrane continuous ( iii ) or use an alternative mechanism of membrane exchange such as membrane engulfment / phagocytosis ( iv ) .
infection and cell stress may signal the up - regulation of adhesive factors at the cell surface , for example , retroviral env glycoproteins ( i ) , that drive the formation of tight cell
cell contacts ( e.g. , virological synapses ) or are extended to form nanotubes or filopodial bridges ( ( ii ) and iv ) ) . alternatively ( or possibly in addition to ) , cell signaling through the exocyst complex ( e.g. , in response to hiv-1 nef expression or cell stress ) can induce the extension of membrane protrusions that reach out to bind neighboring cells ( ( iii ) and ( iv ) ) .
induced nanotubular superhighways may function to promote the rapid intercellular spread of infection but could also promote the transit of cell - sustaining signals or cargoes ( iv ) .
subsequently , tnts and related structures have been described in diverse ex vivo cell culture systems and implicated in the cell cell exchange of a wide variety of cargoes .
attempts have been made to categorize nanotubes based on structure : for example , slender , type i tnts that are < 100 nm in diameter and contain actin versus type ii tnts that are larger ( up to 1-m diameter ) and contain both actin and microtubules ( onfelt et al . , 2006 ) .
however , such categorization is now complicated by the broad heterogeneity of described tnt - like structures ( for excellent reviews see kimura et al . , 2012 ;
we previously argued that an important distinction be made between structures that are tunneling
( i.e. , open ended and capable of transmitting an intracellular signal ) and linkages that are closed ended and more bridge - like or synaptic in nature ( sherer and mothes , 2008 ; see figure 1b ) .
indeed , there is limited ultrastructural evidence that nanotubes are open ended , and a wide - open configuration would pose problems , such as how linked cells prevent cell cell fusion or maintain a cytoskeletal polarity ( cargo transit is frequently unidirectional )
. additional work by the gerdes group may resolve this issue , revealing that tnts formed by dislodgement in cultures of normal rat kidney ( nrk ) cells are , indeed , not open ended but gated ( wang et al . , 2010 ) .
these structures accumulated the gap junction ( gj ) protein connexin 43 ( cx43 ) at their bases and , consistent with gj function , supported the transmission of an electrical signal from cell to cell ( figure 1b , ( ii ) ) . by contrast , classic tnts from pc12 cells formed by filopodial interplay did not contain cx43 and did not support electrical coupling .
therefore neither nrk nor pc12 tnts are constitutively open - ended structures , and it is important to consider that many ( and perhaps the majority ) of described tnt - like linkages represent extensions of either synapse or gj biology ( e.g. , figure 1b , ( i ) and ( ii ) ) . if nanotubes are not open ended , then how do they support the transfer of bulky intracellular cargoes such as mitochondria and endosomes , as is now apparent in numerous studies ( see marzo et al . , 2012 ) ?
indeed , such a process challenges the basic notion of cell autonomy and , if confirmed in vivo , might alter our perception of how tissues are maintained and suggest opportunities to design new cell - based therapeutic strategies .
zhang and colleagues recently showed that oxidative stress or serum starvation can trigger selective nanotube formation between stressed and unstressed astrocytes , and they proposed that a nanotube - mediated directional flow of healthy
intracellular cargoes from unstressed to stressed cells provided a cell - sustaining effect ( wang et al .
while compelling , it is not clear how organelles can successfully breach two apposed plasma membranes .
wang and gerdes ( 2012 ) have suggested three potential scenarios : 1 ) a tunnel and toll booth mechanism in which large cargoes await a transient opening of a fusion pore , 2 ) a carrier mechanism in which vesicles are secreted at the nanotube tip and taken up by target cells , and 3 ) a snatch and grab mechanism in which a portion of the nanotube is engulfed and endocytosed .
mechanisms 1 and 2 would necessarily invoke novel modes of cell cell fusion and vesicle formation , respectively .
mechanism 3 seems most likely , considering the fragile nature of nanotubes , as well as the propensity of cells to pull and tear at tightly apposed membranes ( figure 1b(iv ) ) .
however , a caveat is that endocytosed membrane would have to somehow accomplish back - fusion with the endosome to release its cargo into the cytoplasm .
careful live - cell imaging coupled to electron microscopy will be essential to defining the determinants , as well as the frequency and success , of these organelle transplant operations .
if nanotubular transport plays a role in tissue homeostasis , the corollary is that this mode of transfer can promote the spread of damaging or infectious cargoes , including prions , viruses , and bacteria .
intracellular pathogens often exploit existing cell cell contacts or induce infected cells to form specialized structures in order to favor their cell cell transmission ( figure 1c ) .
for example , we demonstrated that retroviruses , including the murine leukemia virus ( mlv ) and the human immunodeficiency virus type 1 ( hiv-1 ) , drive the formation of nanotube - like filopodial bridges between infected and uninfected fibroblasts that provide for actin - dependent virion trafficking ( surfing ) of virions from cell to cell on the outer surface of membrane ( sherer et al . , 2007 ) .
stable bridge formation required specific , high - avidity interactions between viral envelope ( env ) glycoproteins and receptor molecules on apposed cell surfaces .
hiv-1 infects cd4 t - cells and macrophages in vivo , and several reports have demonstrated nanotubes , related actin - rich structures , and
virological synapses that link infected and uninfected lymphocytes and likely contribute to the rapid spread of infection ( e.g. , sowinski et al . , 2008 ;
rudnicka et al . , 2009 ; reviewed in sattentau , 2010 ) . that env expression is capable of promoting cell cell connectivity in vivo
was emphasized by recent striking intravital multiphoton fluorescence imaging of hiv-1infected t - cells in humanized mice by mempel and colleagues ( murooka et al . , 2012 ) .
infected , motile t - cells in lymph nodes formed dramatic env - dependent membrane extensions connecting cells over distances sometimes > 100 m . moreover , env - dependent connectivity was also recently confirmed for mlv - infected b cells and t - cells in living mice ( sewald et al . , 2012 ) .
although the resolution of multiphoton microscopy did not discern nanotubes , viral surface glycoproteins are clearly capable of stimulating the formation of complex membrane networking in tissues .
therefore the up - regulation of surface adhesion properties may serve as a general mechanism for stimulating nanotube formation during infection or in response to other signaling ( figure 1c , ( ii ) to ( iv ) ) .
alternatively , viral infection or cell stress may promote nanotube formation by directly stimulating the extension of filopodial protrusions .
for example , hiv-1 infection induces the formation of filopodial or lamellipodial extensions in t - cells through the activity of the viral nef accessory protein ( nobile et al . , 2010 ; figure 1c(iii ) )
. of interest , a recent proteomic analysis of nef - associated proteins revealed that nef interacts with several components of the exocyst complex , a cellular machinery that regulates both the secretory pathway and the extension of actin - rich cell surface protrusions ( mukerji et al . , 2012 ) .
these findings have striking overlap to the recent identification of the cellular factor m - sec , the first cellular factor demonstrated to induce the de novo formation of nanotubes when overexpressed in cultured cells ( hase et al . , 2009 ) .
m - sec activates the exocyst complex through ral gtpase signaling and is highly expressed in both dcs and macrophages .
therefore it seems logical to determine whether hiv infection modulates m - sec expression or activity in infected cd4 lymphocytes , as well as to determine the general role of the exocyst pathway to hiv-1 replication in vitro and in vivo . moreover , the extension of nascent filopodia by astrocytes in response to cell stress conditions ( as discussed earlier ) correlated with an up - regulation of m - sec expression and also required signaling through the tumor suppressor p53 and the akt / pi3k / mtor pathway . thus m - sec and the exocyst complex may be a common target of multiple prominent cell signaling pathways associated with infection , cell stress , and possibly cancer .
induced nanotubes in these scenarios could , in theory , serve to rapidly mediate the exchange of either beneficial or detrimental cell cargoes ( figure 1c(iv ) ) .
stress - induced signaling and viral infection should continue to provide tractable systems for dissecting the molecular details underlying filopodial extension , the formation of nanotubular linkages , and how cargoes move from cell to cell .
however , a core question remains : do nanotubes really play important roles in tissues in vivo ?
nanotube - like structures were described in vivo for the first time relatively recently , originating from stromal dcs within the mouse cornea ( chinnery et al . , 2008 ) .
these observations have now been reproduced with additional detail ( seyed - razavi et al . , 2013 ) .
in addition , observations of nanotubes connecting cells in solid tumor explants may support the notion that nanotubes can fuel cancer ( lou et al . , 2012 ) . increased visual resolution in tissue preparations , as well as continuing progress in live - cell intravital systems , will be essential to achieving a realistic picture of nanotube structure and function in vivo .
also , the identification of cellular factors regulating nanotube formation may provide opportunities for animal studies , for example , in p53 , m - sec , or exocyst - deficient mice . finally , it is important to consider that nanotubes may not be working alone either in vivo or in culture .
for example , hiv-1 nef expression also induces the secretion of nef - containing vesicular structures , including exosomes and microvesicles , likely by stimulating alternative functions of the exocyst complex .
indeed , tissues are a sticky proposition ; studies of nanotubular linkages have provided important new concepts toward the goal of understanding the complexity of cell cell signaling in these dynamic environments . | metazoan cells rapidly exchange signals at tight cell cell interfaces , including synapses and gap junctions .
advances in imaging recently exposed a third mode of intercellular cross - talk mediated by thin , actin - containing membrane extensions broadly known as membrane or tunneling nanotubes .
an explosion of research suggests diverse functions for nanotubular superhighways , including cell cell electrical coupling , calcium signaling , small - molecule exchange , and , remarkably , the transfer of bulky cargoes , including organelles or pathogenic agents . despite great enthusiasm for all things nanotubular and their potential roles in cell signaling and pathogenesis ,
key questions remain regarding the mechanisms by which these structures regulate directional cell cell exchange ; how these linkages are formed and between which cells and , critically , whether nanotubes are as prevalent in vivo as they appear to be in the incubator . |
as the aids ( acquired immunodeficiency syndrome ) epidemic enters its fourth decade , hiv transmission in most parts of the world shows no signs of abating despite great progress being made in tackling the epidemic worldwide . it still continues to grow in countries of all incomes with a greater impact on the more vulnerable developing world and
globally , an estimated 35.3 million people were living with hiv , 2.3 million new people became infected , and 1.6 million deaths occurred in the year 2012 . owing to a weakened immune system , the infected person is placed at an increased risk of a wide variety of opportunistic infections [ 4 , 5 ] .
a number of protozoa , fungi , viruses , and bacteria are responsible for such infections [ 6 , 7 ] .
fungal opportunistic infections in patients infected with hiv are a major cause of morbidity and mortality and compromise the quality of life of such individuals . oral candidiasis has been reported as the most common fungal opportunistic infection by some previous studies [ 9 , 10 ] .
the spectrum of candida infection is diverse , ranging from asymptomatic colonization to oropharyngeal candidiasis ( opc ) , esophagitis , onychomycosis , vulvovaginitis , cutaneous candidiasis , and systemic candidiasis or invasive candidiasis including candidemia .
it has been seen that almost all hiv infected people are colonized with candida and up to 9095% develop clinical lesions as the viral disease progresses .
it has also been observed that low cd4 counts and high plasma hiv rna levels significantly correlate with oral candida carriage as well as with oral candidiasis in hiv patients [ 1315 ] .
these data suggest that a decrease in oropharyngeal candida carriage and oral candidiasis in hiv can be achieved by initiating patients on highly active antiretroviral therapy ( haart ) without the need for specific antifungal therapy .
thus a prompt diagnosis of candida infection in hiv patients and assessment of the immune status can have bearing on treatment of such infections and improve the general well - being of the plwha ( people living with hiv / aids ) . though candida albicans is the most frequently isolated species as a colonizer and pathogen of the oral mucosa , other candida species , such as c. tropicalis , c. krusei , c. glabrata , c. dubliniensis , c. guilliermondii , c. parapsilosis , c. kefyr , and c. pelliculosa
, have become a significant cause of infection in patients with hiv infection [ 1618 ] .
the clinical importance of these non - albicans candida species lies in the fact that they are usually less susceptible to the more commonly used azole antifungal drugs , a factor that poses significant difficulties in effective treatment .
thus the modern mycology laboratory has an important role to play in several aspects relating to these organisms , including detection , identification , epidemiological analysis , and therapy in an attempt to better understand these pathogens and provide an effective cure . in view of the above this study
was conducted to determine the prevalence of candidiasis , to identify the various candida species implicated in causation , and to study the relationship of candida infections to the immunological status of hiv positive patients in the biggest tertiary care hospital of new delhi , india .
one hundred and twenty hiv seropositive adult subjects attending the outpatient departments , art clinic , and those admitted in the various wards of lok nayak hospital affiliated to maulana azad medical college , new delhi , india , were recruited for this study irrespective of their antiretroviral therapy status for candida microbial screening .
lok nayak hospital is a 2500-bedded tertiary care facility with over 3000 patients enrolled in the antiretroviral therapy clinic .
only those hiv seropositive subjects who have not received any specific antifungal therapy in the preceding three months were enrolled .
fifty age and sex matched randomly selected adult hiv seronegative subjects were also enrolled from the mycology laboratory of department of microbiology , maulana azad medical college , new delhi .
this was a cross - sectional analysis to determine the clinical , immunological , and microbiological candida profile of hiv seropositive cases and hiv seronegative control subjects . at enrolment
an informed consent was obtained and each study participant was asked to complete a questionnaire which consisted of sociodemographic and personal details , history of present illness , clinical signs and symptoms , and so forth .
subjects were staged as per who staging system which ranges from the asymptomatic stage ( stage i ) to mild symptoms ( stage ii ) , advanced symptoms ( stage iii ) , and severe symptoms ( stage iv ) .
various clinical specimens including blood , oral swabs , expectorated or induced sputum / bronchoalveolar lavage specimens , and urine were collected depending on the patient 's clinical presentation as per our established laboratory protocol using standard precautions .
all specimens were transported to the mycology laboratory as soon as possible without any delay and were processed on the same day of collection .
diagnosis of hiv infection was done by following the standard protocol at our integrated counselling and testing centre that employs pretest and posttest counselling and obtains informed consent before hiv testing .
three different rapid tests were used to detect hiv-1 and hiv-2 antibodies ( combaids ( span diagnostics ltd . ) , retrocheck hiv ( qualpro diagnostics ) , and tri - line ( rapid diagnostics ) ) following the manufacturer 's instructions .
the samples were subjected to direct microscopy using gram staining , koh wet mount , and india ink preparations depending on the type of specimen .
fungal culture was done on sabouraud dextrose agar , with and without chloramphenicol ( 16 g / ml ) and with cycloheximide ( 0.3 g / ml ) plus chloramphenicol ( 16 g / ml ) , brain heart infusion agar , and 5% sheep blood agar .
specimens were streaked in duplicate ; one set of inoculated slants was incubated at 25c and the other was incubated at 37c , and they were examined every other day for growth up to 46 weeks before discarding as negative .
samples inoculated on blood agar were incubated for 2448 h and samples on brain heart infusion agar were incubated for 1 - 2 weeks .
fungal growth was identified by colony morphology , gram staining , lacto phenol cotton blue preparation , and riddle 's slide culture as per standard recommended procedures .
identification and speciation of yeast isolates were done on the basis of germ tube production , morphology on corn meal agar with teen 80 , hicrome candida agar , carbohydrate fermentation test , carbohydrate assimilation test , morphology on staib , and caffeic acid ferric citrate agar as per standard recommended procedures [ 2224 ] .
the cd4 t lymphocyte count of all participants was determined by the facscount system by becton dickinson .
data were statistically described in terms of frequencies and percentages and 95% confidence interval was calculated for all prevalence estimations .
continuous quantitative variables like cd4 counts with an approximately normal distribution were analyzed by calculating the mean , standard deviation , and 95% confidence interval by student 's paired t - test .
all statistical calculations were done using computer program statistical package for the social sciences ( spss ; spss inc . , chicago , il , usa ) version 15 for microsoft windows .
out of the 120 study participants recruited , there were 82 males and 38 females .
the sociodemographic profile of our participants and the control group is shown in table 1 .
ninety - four percent of the study population belonged to the age group of 2145 years which is the sexually active population group .
most of our patients hailed from delhi and the neighbouring states of north india . out of all
the study subjects investigated majority were illiterate or had received education up to high school .
fever , weight loss , and cough were the most common symptoms in hiv seropositive cases .
white oral patches , oral ulcers , burning micturition , and painful swallowing were seen in 28% , 26% , 20% , and 13% of patients , respectively .
majority of our patients ( 72% ) belonged to who clinical stage iii or stage iv .
the mean cd4 t lymphocyte count of our hiv seropositive study participants was 272.3 cells/l at the time of recruitment .
the cd4 counts ranged from 25 to 758 cells/l with 17% exhibiting severe immunosuppression with cd4 counts of less than 100 cells/l .
patients with single complaint , double complaint , three complaints , and four complaints had significantly higher cd4 counts when compared individually to patients with five complaints ( mean and standard deviations are shown in table 3 ; p values < 0.05 ) .
subjects in whom candida infection was detected had significantly lower cd4 counts as compared to subjects in whom candida infection was not detected ( p value < 0.05 ) .
patients in who clinical stage i , stage ii , and stage iii had significantly higher cd4 counts as compared to patients in who clinical stage iv ( p value < 0.05 ) .
out of the 120 hiv seropositive study participants , 42 patients ( 43% ) were on haart , out of which 34 patients were on first - line therapy ( zidovudine + lamivudine + nevirapine ) and 8 patients were on second - line therapy ( stavudine + lamivudine + nevirapine ) , 4 of which had active pulmonary tuberculosis and four exhibited zidovudine induced anaemia after being on first - line therapy .
candida species were isolated in 128 samples from 88 cases , most often from oral swabs ( 82 out of 120 collected ) followed by sputum and urine specimens , as shown in table 4 .
based on germ tube test , morphology on corn meal agar and hicrome agar , carbohydrate fermentation , and carbohydrate assimilation test c. albicans ( 50% ) was the most common species isolated followed by c. glabrata ( 17% ) . c. dubliniensis ( 12.5% )
was identified on the basis of colony morphology and chlamydospore formation on niger seed agar , caffeic acid ferric citrate agar , and heat test at 45c .
other species isolated were c. parapsilosis ( 7.8% ) , c. krusei , c. tropicalis ( 4.6% each ) , and c. kefyr ( 3% ) .
out of 64 c. albicans strains , the maximum number ( 38/64 ) was from oral swabs followed by sputum ( 18/64 ) and urine ( 6/64 ) , while most of c. glabrata strains ( 12/22 ) were isolated from urine samples .
c. dubliniensis , c. parapsilosis , c. krusei , c. tropicalis , and c. kefyr were mainly detected in oral swabs . in 40/120 cases we detected 2 different candida isolates but not from the same clinical specimen
. oral swabs from 60 age and sex matched hiv seronegative healthy adults were processed and candida albicans was isolated from 17 cases by using the identification methods mentioned above .
candida species are ubiquitous fungi causing severe disease in immunocompromised individuals like aids patients with extremely varied clinical manifestations . they may be localized to the mouth , lungs , or the gastrointestinal tract or
management of candidiasis is hampered by delays in diagnosis and lack of reliable diagnostic methods which allow detection up to the species level . to assist the clinician in therapeutic decisions and optimize treatment
, clinical microbiologists should identify candida to species level especially in hiv positive patients in whom non - albicans candida species are being increasingly recognized to cause serious infections . with this view in mind
this study was conducted to establish the profile of candida infections in hiv positive patients and to correlate it with their immunological status as there is paucity of such data from the indian hiv seropositive population .
the mean age of hiv seropositive subjects in our study was 33.4 6.2 years with an age range of 1855 years and the age group of 2145 years was the most commonly affected age group .
there was male preponderance observed in our study with a male - to - female ratio of 2.2 : 1 .
this correlates well with the demographic variables of the hiv positive population in the country and highlights the fact that males are at increased risk in comparison to females because of their jobs and habits which entail them to be more migratory in comparison to females .
a few other investigators who studied the candida profile and spectrum of opportunistic infections in hiv positive patients have also reported similar findings [ 11 , 26 ] .
the most common clinical presenting complaints of our hiv seropositive study participants were fever ( 70% ) , weight loss ( 50% ) , and cough ( 47% ) .
these clinical symptoms of the hiv positive patients from our hospital are representative of the clinical picture of hiv / aids in the country and are very similar to what has been reported by researchers across other parts of india [ 27 , 28 ] .
presence of white oral patches ( 28% ) , oral ulcers ( 26% ) , and painful swallowing ( 13% ) seen in our study patients constitute clinical features of oral thrush and esophageal candidiasis .
these contribute to poor oral intake and weight loss and significantly affect the quality of life of such patients and are considered important markers of clinical disease progression and immunosuppression .
burning micturition seen in 30% of our patients may have been due to urinary candidiasis . as seen with other studies [ 10 , 29 ] , majority ( 79.9% ) of our hiv positive patients presented with more than one clinical symptom and 72% of our patients presented with who clinical stage iii or stage iv events at the time of recruitment .
the mean cd4 t lymphocyte count of our hiv seropositive study population at recruitment was 272.3 cells/l with a range varying from 25 to 758 cells/l .
similar results have been reported by another researcher by his investigations on hiv infected patients in china , wherein the average cd4 cell count was 253.4 cells / mm , with a range from 2 to 1050 cells / mm in all patients . in the present study
the mean cd4 t lymphocyte count in 88 patients with candida infection was 142.6 cells/l , with a range of 25463 cells/l and a standard deviation of 72 .
this was found to be significantly lower than the mean cd4 counts of 32 patients without candida infection ( 412.3 cells/l ; range of 256583 cells/l and standard deviation of 93 ; p value < 0.05 ) .
this observation has been well supported by other investigators who have reported a strong correlation of the occurrence of candidiasis in hiv positive patients with lower cd4 counts [ 3032 ] .
this also reinforces the 2013 who recommendations to initiate treatment in adults living with hiv when their cd4 cell count falls to 500 cells / mm or less in order to maximize the drug benefits and prevent candida related morbidity in plwha . in our study
oral swabs yielded the highest number of candida isolates followed by sputum and urine specimens .
these observations have been documented by a few other studies which have also reported the highest yield of candida spp . from oral swabs and the lowest yield of candida spp . from blood specimens from hiv
irrespective of the art status and the type of specimen processed candida albicans ( 50% of the total isolates ) was the predominant species recovered in our study .
this high isolation rate of candida albicans in hiv positive patients is consistent with many previous published reports from india as well as abroad [ 9 , 31 , 33 , 34 ] .
the most common non - albicans candida species identified in our study population were c. glabrata ( 17.1% of the total isolates ) and c. dubliniensis ( 12.5% of the total isolates ) .
table 5 shows the distribution of candida species isolated from hiv positive patients in india in the last few years by various investigators
. the higher detection rate of c. dubliniensis in our study may be due to the fact that this species was previously misidentified due to its phenotypic resemblance to c. albicans and it is now being increasingly recognized .
another important finding of our study was that the prevalence of candida species was significantly higher ( p value < 0.05 ) in the hiv positive study group ( 88 cases out of 120 recruited ; 73.3% ) as compared to the hiv negative control group ( 17 cases out of 60 recruited ; 28.3% ) , similar to the results of other studies [ 30 , 31 ] .
this study had a few limitations . since the sample size in the present study was small , further studies with a larger sample size
the lack of use of pcr based genotypic methods for identification of candida species may have resulted in some inaccuracies and misdiagnosis of the candida species .
we have not reported here the fungal pathogens other than candida spp . isolated from the clinical samples as this study pertains to the prevalence profile of candida spp . only .
the clinical symptoms reported by patients could have been due to other fungal as well as nonfungal pathogens .
our study gives an insight into the present scenario of candida species prevalence profile of the hiv positive population from new delhi 's busiest and largest tertiary care hospital .
candida species are more frequently isolated in the hiv seropositive population and the cd4 t lymphocyte counts of patients with candida infection are significantly lower than those of individuals without candida infection .
the proportion of candida infections caused by c. albicans in hiv seropositive individuals has fallen and there is a shift in the distribution of candida species in hiv positive patients towards the non - albicans candida species .
these latter species tend to be less susceptible to antifungal agents and this has accounted for their emergence as a significant pathogen .
recurrent fungal infections due to the immunocompromised state and repeated exposure to antifungal agents are responsible for this shift in the spectrum in hiv positive cases .
the use of accurate and reliable diagnostic methods which readily identify the non - albicans species could assist the clinicians in making the right therapeutic choices and check the emergence of antifungal resistant strains . also reserving antifungal drug prophylaxis for only those with severe and frequent recurrences of candidiasis in hiv patients can go a long way in avoiding antifungal resistance . | candida is a common opportunistic pathogen during the course of human immunodeficiency virus ( hiv ) disease progression .
changes in the clinical severity of candidiasis and the candida species prevalence profile may be a reflection of immunological changes in hiv positive patients .
the aim of this study was to document the changing pattern of candida species prevalence profile in hiv seropositive patients from a tertiary care hospital in north india .
one hundred and twenty hiv seropositive subjects were recruited for candida microbial screening .
clinical specimens including blood , oral swabs , expectorated or induced sputum / bronchoalveolar lavage specimens , and urine were collected depending on the patient 's symptoms .
a total of 128 candida isolates were obtained from 88 cases and 7 different candida species were identified . c. albicans ( 50% ) was the most common species isolated followed by c. glabrata ( 17% ) and c. dubliniensis ( 12.5% ) .
other species isolated were c. parapsilosis ( 7.8% ) , c. krusei , c. tropicalis ( 4.6% each ) , and c. kefyr ( 3% ) . strong clinical suspicion along with optimal sampling of an accurate diagnosis of candida species involved would go a long way in decreasing the morbidity associated with non - albicans candida species . |
we studied 20 serum samples from survivors of confirmed hantavirus infection , 11 from chilean patients and 9 from patients in the southwestern united states .
samples were collected from 8 months to 11 years after the patient was hospitalized with hcps .
the neutralizing titer was measured for each sample against snv and andes virus by a focus - reduction neutralization assay in vero e6 cells , as described previously ( 7 ) . in brief , serial 2-fold dilutions of heat - inactivated patient plasma samples were made , from 1:100 to 1:1,600 , and were mixed with equal volume of 50100 focus - forming units per milliliter snv ( isolate sn77734 , titer 2 10/ml ) or andes virus ( chilean strain of human origin , isolate chi-7913 ) and incubated at 37 for 1 hour ( 15 ) . the mixture was then used to infect a confluent monolayer of vero e6 cells ( atcc crl 1586 ) in duplicate wells of a 48-well dish , with a 1.2% methylcellulose overlay in the medium to confine the virus to the foci .
after incubation for 1 week , viral foci were detected with polyclonal rabbit anti - n antibody followed by peroxidase - conjugated goat anti - rabbit immunoglobulin g. foci were enumerated under an inverted light microscope .
nab titers were defined as the reciprocal of the highest serum dilution that resulted in an 80% reduction in the number of foci compared to virus controls in duplicate assays .
the endpoint plasma nab titers against andes virus and snv from chilean and north american survivors of hantavirus infection are shown in the table .
all chilean patients had detectable plasma nab against andes virus , with titers > 1:400 in all but 1 patient .
in contrast , 9 of the 11 samples failed to show nab titers > 1:100 against snv , while the other 2 neutralized snv only at low titers .
similarly , all north american patients had plasma nab against snv at titers > 400 , and only 1 showed some neutralization against andes virus , at low titer .
no relationship was seen between the endpoint nab titers against the homotypic virus and time elapsed from acute disease in either chilean or north american patients , nor did a particularly high homotypic titer predict that neutralizing activity would be present against the heterologous virus .
in survivors of hantavirus disease who reside in chile or the united states , we found high titers of plasma nab against the type of hantavirus that is prevalent in the patient 's own region , while substantial titers against the heterologous agent of hcps were absent . in this small group of participants ,
nab titers did not show any readily detectable decline with time elapsed after infection ; titers as high as 1:1,600 could be detected 11 years after illness .
these results suggest that plasma from patients who survive hantavirus infection is a potential source of nab and could be used as a therapeutic alternative for patients with acute disease or as a prophylactic intervention for persons who may have been exposed to the virus .
the absence of in vitro cross - neutralization makes the alternative of clinically effective cross - protection less likely and discourages the use of convalescent - phase sera to treat patients whose geographic origin is different from that of the plasma donor .
our results suggest that a monovalent vaccine would not elicit protection against different types of hantavirus , even when the viruses are phylogenetically as similar as snv and andes virus .
the positive results of cross - protection studies in hamster models should be interpreted cautiously , since experimental infection in those studies would tend to favor unusually brisk immune responses that go well beyond eliciting nab and likely include potent cell - mediated or innate immune responses that can not be mimicked with passive immunization ( 12 ) .
similarly , some component of the cross- protective efficacy observed with genetic immunizations with hantavirus envelope genes may ultimately be related to t - cell immunity ( 13 ) . from this perspective
, either multivalent or region - specific vaccines may have to be developed to protect persons at high risk from this new , relatively infrequent , but still highly lethal disease . | we evaluated titers of homotypic and heterotypic neutralizing antibodies ( nabs ) to andes and sin nombre hantaviruses in plasma samples from 20 patients from chile and the united states .
all but 1 patient had high titers of nab .
none of the plasma samples showed high titers against the heterologous virus . |
cases of linear peritoneal calcification have been reported in literature , though they occur rarely . in encapsulating peritoneal sclerosis ( eps )
a peritoneal membrane damage develops an inflammatory cascade that results in sclerosis and eventually calcification .
eps has been can be either primary or secondary , being long exposure to peritoneal dialysis solutions , the most common cause of the secondary form .
the incidence of eps has only been studied in patients on peritoneal dialysis and is estimated to be 0.544.4% , although this number can rise considerably with the time on pd .
the symptoms manifest disturbances in intestinal function such as abdominal pain , nausea , vomiting and ultimately anorexia and weight loss . among the imaging techniques available ,
ct is the modality of choice in the diagnosis of eps , demonstrating peritoneal thickening , calcification , bowel wall thickening , bowel tethering , dilation and fluid loculation .
in august 2014 a 39-year - old female presented to the emergency department of our hospital .
she referred a past history of one cesarean followed by a laparoscopic tubal ligation . in october 2013
peritoneal lavage by the peritoneal catheter was performed , but abdominal wall swelling was noticed and a leak within the laparoscopic port was suspected . a ct peritoneography ( fig .
iodinated contrast was injected through the peritoneal catheter and the patient was encouraged to walk , allowing a good diffusion of contrast through the peritoneal cavity . shortly after contrast injection the patient developed intense abdominal pain and hypotension that were attributed to contrast adverse reaction
the ct was obtanied 30 min after contrast injection , revealing a good diffusion of contrast , with no images of leak or abdominal collections .
ten days later the patient was seen for abdominal pain and elevated inflammatory markers ( c - reactive protein = 40 ) and the tenckhoff catheter was removed for a suspected infection .
the patient chose then to start hemodialysis . on the day she visited our emergency department , she reported complaints of lumbar pain and dysuria for the previous few days .
laboratory data were normal , except for : hemoglobin = 8.9 ( normal 1216 g / dl ) , leukocytosis = 14,700 ( 400010,000 ) , leukocyturia > 200/field ( < 5/field ) ; c - reactive protein = 23.5 ( < 1.0 ) , urea = 22.4 ( 2.46.4 mmol / l ) , creatinine = 316 ( 4692 mol / l ) , pth = 324 ( 1687 pg / ml ) , calcium = 2.40 ( 2.102.55 mmol / l ) and phosphorus 1.47 ( 0.411.45
3 ) revealed extensive visceral ( arrows in a ) and parietal peritoneal calcification ( arrowheads in a ) with areas of focal thickening in the pelvic peritoneum ( arrowheads in c ) .
she improved clinically , inflammatory markers decreased and she was then discharged from the hospital with no symptoms .
cases of linear peritoneal calcification have been reported in patients on long - standing peritoneal dialysis and have previously been classified as calcifying peritonitis , .
this term is not currently used but is now included in the spectrum of eps .
long exposure to peritoneal dialysis solutions is the most cited caused , although it can also develop after renal - transplant , with hyperparathyroidism , , with the use of certain beta - blockers or after recurrent episodes of peritonitis , , among others .
the two - hit model has been used to explain the pathophysiology of eps , hypothesizing that a predisposing factor ( injury ) and an initiating factor ( such as an inflammatory stimuli ) are required for eps to develop . from this model
we can assume that , in a susceptible patient , it can develop after any peritoneal inflammatory stimuli .
eisenberg and colleagues reported the development of peritoneal inflammation secondary to iodinated contrast agents in guinea - pigs . to the best of our knowledge no cases of eps secondary to intraperitoneal contrast have been reported .
clinically , patients with eps can be asymptomatic or may present with symptoms caused by modifications of gastrointestinal transit .
nakamoto divided eps into four clinical and pathological progressive stages , ranging from lack of symptoms in stage 1 to complete bowel obstruction and anorexia characterizing the stage 4 .
imaging findings will translate the pathological progression of the disease , with peritoneal calcification predominating in the early stages and the most advanced cases presenting with findings of bowel obstruction such as air - fluid levels , dilated loops or even bowel clustering . on the different imaging techniques
, abdominal radiography shows a low accuracy in this diagnosis , being either normal or revealing peritoneal calcification , air - fluid levels or loop dilations .
contrast studies can reveal proximal small bowel dilatation , delayed transit time and , in advanced cases , cauliflower sign
abdominal ultrasound can show peritoneal thickening , loculated peritoneal fluid , peritoneal calcification , adherences , dilated or diminished peristaltic intestinal loops .
tarzi created a 22-point score , considering peritoneal thickening , peritoneal calcification , bowel wall thickening , bowel tethering ( 04 points each ) , loculation and bowel dilation ( 03 points ) .
the mean score of eps patients was 9 ( 216 ) , comparing to an average score of 1 ( 03 ) in controls patients on peritoneal dialysis .
positron emission tomography can show an increased peritoneal uptake but is not able to distinguish from acute peritonitis . in our case ,
the diagnosis was made by ct , although it could already be suspected by the radiography .
our patient ct score is 5 , inferior to the average obtained by tarzi , but matching an early stage of disease that we expected due to the lack of symptoms ( stage 1 ) .
the focal peritoneal thickening observed in the most dependent portions of the abdomen might be explained by the longer time exposure of these areas to the peritoneal contrast .
laparotomy is indicated in later stages of the disease and shows peritoneal thickening , adhesions , tethering , fibrosis or bowel retraction .
no specific treatment has been developed for eps , being proposed the use of total parenteral nutrition , , corticoids , , tamoxifen , and surgery with enterolysis of intestinal adhesions for advanced cases , .
when presenting with symptoms eps has a high mortality , usually as a result of bowel obstruction , malnutrition and sepsis .
we demonstrated an unusual case of peritoneal calcification , in which there was no history of long exposure to peritoneal dialysis solutions .
we believe that intraperitoneal iodinated contrast exposure combined with alport syndrome have caused the abnormalities seen .
long standing hyperparathyroidism might also have played a role explaining the increased susceptibility of our patient for the development of eps .
the authors wish to confirm that there are no known conflicts of interest associated with this publication and there has been no financial support for this work that could have influenced its outcome . | the peritoneum is the largest serous membrane of the body and can be exposed to several injuries that may cause abnormal findings on imaging exams .
linear peritoneal calcification is remarkably rare , usually secondary to long duration peritoneal dialysis.we report an uncommon case of extensive peritoneal calcification in a 39-year - old female without long exposure to peritoneal dialysis solutions , in which peritoneal calcification could be linked to alport syndrome and previous adverse reaction to intraperitoneal iodinated contrast.radiologist should be aware of this and related imaging findings , know when to search for them as well as understand their clinical value . |
we hypothesize that the type of disaster , and thus the investigation of its unique characteristics , are important for a better understanding of perceived post- and peritraumatic stress levels in survivors .
additionally personal and situational characteristics are also likely to play a role in how survivors think and feel during the event .
therefore , in this exploratory study , a selection of individual characteristics ( gender , education , age ) , event characteristics ( time since event , fatalities , injuries ) , peritraumatic emotional and cognitive factors ( emotional stress , risk perception ) and posttraumatic stress symptoms were assessed across different types of disasters , with data collected from several countries .
the study described in this paper is part of a larger cross - cultural multi - centre research project called besecu ( behaviour , security , culture ) , with the following centres participating : greifswald , germany ; london , uk ; barcelona , spain ; warsaw , poland ; hamburg , germany ; prague , czech republic ; stockholm , sweden and izmir , turkey .
of interest were emergency events that met the following criteria : ( 1 ) occurred within approximately 10 years prior to the research interview , concentrated in a particular time and space ; ( 2 ) concerned an identifiable hazard that posed a physical threat but of a non - infectious kind ( i.e. , excluding emergency events such as epidemics ) ; ( 3 ) the threat was posed to many lives and/or property ; ( 4 ) the emergency services attended the scene ; and ( 5 ) a full or partial evacuation of the affected structure(s ) was attempted , either by the victims or by official agents .
a variety of events occurring in the participating centres countries met the above criteria : i.e. , czech republic floods in 2002 ; collapse of buildings such as the katowice trade hall roof collapse in poland , 2006 and the collapse of a multi - storey residential building in spain , 2006 ; severe fires in multi - storey residential or public buildings across europe such as the gothenburg discotheque fire in sweden , 1998 or a fire in a hamburg hospital in germany , 2007 ; and the 7/7 london bombings in the uk , 2005 .
most injuries ( around half of the participants ) had incurred during terror attacks and collapses of buildings . in fires , about 25% and in floods about 10% of participants were injured .
fatalities during the incidents in the direct surrounding of participants were reported in all cases of terrorist attack and collapse of a building and in nearly half of all fire events .
floods were reported as having caused no fatalities in the surrounding of the interviewed victims .
recruitment was performed in each centre separately , using a combination of word - of - mouth campaigns and advertising campaigns conducted via the media , self - help groups and the emergency services .
adult survivors were invited to contact the researchers if they wished to take part in an interview .
participation was restricted to persons who had directly experienced the emergency event bystanders and relatives of victims were excluded . also excluded were persons who had survived incidents which turned out not to match all of the aforementioned event criteria .
finally , four participants were excluded due to the fact that the respective disasters did not happen in any of the countries of the participating centres .
there was an almost even split of females ( 51.4% ) and males ( 48.6% ) .
concerning education , 25.3% of all participants had a university degree , 21.8% were educated to only primary level and 43.7% to secondary education level .
eleven percent of participants had a migrant background but no significant differences were found between migrants and natives regarding gender , age , education , or event type .
when participants agreed to take part in the study , a comprehensive interview was conducted about emotional , behavioural , and cognitive responses during the disaster ( results of the content of survivors narratives can be found in grimm , hulse , preiss , & schmidt , in press ) . furthermore , a set of psychological instruments were applied and socio - demographic and incident - related characteristics were assessed .
the interview procedure borrowed techniques from the cognitive interview ( fisher & geiselman , 1992 ) to help participants mentally recreate the past event ; the entire interview lasted on average 90 min . after revisiting the event in the interview ,
participants were asked to retrospectively rate their emotional stress and risk perception at the stage when they realized that they were actually experiencing a disaster .
they did this on a 4-point scale with zero indicating no stress/ risk and four indicating high stress/ risk . asking participants to retrospectively rate their emotions and cognitions a few years after they experienced them is not ideal as their current state and beliefs could bias their recollections of past states ( robinson & clore , 2002 ) .
nevertheless , there is research which indicates that memory for emotion - related experiences is more resistant to decaying over time ( e.g. , burke , heuer , & reisberg , 1992 ; ritchey , dolcos , & cabeza , 2008 ) .
furthermore , there is some experimental evidence that retrospective ratings , at least of emotion , might provide reasonable approximations of momentary ratings ( barrett , 1997 ) .
in addition , it was expected that the interview and its context reinstatement memory aids would make the relevant past states more accessible .
thus , while bearing the potential for recall - related biases in mind , the emotional stress and risk ratings were included to explore peritraumatic states .
current posttraumatic stress was assessed with the impact of event scale - revised ( ies - r ; weiss & marmar , 1997 ) which is employed in order to assess current subjective distress for any specific life event . also , the ies - r is a widely used measure of posttraumatic stress with satisfactory psychometric properties ( joseph , 2000 ; sundin & horowitz , 2003 ) .
it was administered prior to the interview , in order to avoid event recall potentially influencing responses about current state , and was provided in nationally validated versions ( baguena et al . , 2001 ; juczyski & ogiska - bulik , 2009 ; maercker & schtzwohl , 1998 ; preiss et al . , 2004 ; sveen et al . , 2010 ) .
missing cases on the ies - r ( four single items ) were calculated using a regression model . in order to detect effects of individual and event characteristics on post- and peritraumatic outcome variables ,
separate multiple regressions with simultaneous inclusion of predictors were run with ies - r total scores , peritraumatic emotional stress and risk perception as outcome variables . where reference categories were required , the group with the largest membership was used as the reference ( i.e. , education2 , fire ) . before including predictors , correlations between variables were calculated . as none of the variables were highly correlated , all could be included as predictors . due to the incidence rates of certain disasters varying in different geographical regions ,
as fires were common across all besecu countries , preliminary analyses of variance were conducted for the ies - r , emotional stress and risk outcomes of fire survivors with culture as the independent variable .
similarly , a series of t - tests were conducted on the outcomes of polish vs. spanish survivors of collapses of buildings .
no significant differences were found on these assessments ( all ps>0.17 ) , therefore culture was omitted as a variable from any further analysis . while the main purpose of the paper was to explore the relationships between the individual and event characteristics and each of the peri- and posttraumatic outcomes , it was nevertheless of interest to also examine the relationship between the three outcomes .
thus , in addition to the regressions , correlations and a mancova were conducted and followed up with discriminant analysis and canonical correlation analysis .
of interest were emergency events that met the following criteria : ( 1 ) occurred within approximately 10 years prior to the research interview , concentrated in a particular time and space ; ( 2 ) concerned an identifiable hazard that posed a physical threat but of a non - infectious kind ( i.e. , excluding emergency events such as epidemics ) ; ( 3 ) the threat was posed to many lives and/or property ; ( 4 ) the emergency services attended the scene ; and ( 5 ) a full or partial evacuation of the affected structure(s ) was attempted , either by the victims or by official agents .
a variety of events occurring in the participating centres countries met the above criteria : i.e. , czech republic floods in 2002 ; collapse of buildings such as the katowice trade hall roof collapse in poland , 2006 and the collapse of a multi - storey residential building in spain , 2006 ; severe fires in multi - storey residential or public buildings across europe such as the gothenburg discotheque fire in sweden , 1998 or a fire in a hamburg hospital in germany , 2007 ; and the 7/7 london bombings in the uk , 2005 .
most injuries ( around half of the participants ) had incurred during terror attacks and collapses of buildings . in fires , about 25% and in floods about 10% of participants were injured .
fatalities during the incidents in the direct surrounding of participants were reported in all cases of terrorist attack and collapse of a building and in nearly half of all fire events .
floods were reported as having caused no fatalities in the surrounding of the interviewed victims .
recruitment was performed in each centre separately , using a combination of word - of - mouth campaigns and advertising campaigns conducted via the media , self - help groups and the emergency services .
adult survivors were invited to contact the researchers if they wished to take part in an interview .
participation was restricted to persons who had directly experienced the emergency event bystanders and relatives of victims were excluded .
also excluded were persons who had survived incidents which turned out not to match all of the aforementioned event criteria .
finally , four participants were excluded due to the fact that the respective disasters did not happen in any of the countries of the participating centres .
there was an almost even split of females ( 51.4% ) and males ( 48.6% ) .
concerning education , 25.3% of all participants had a university degree , 21.8% were educated to only primary level and 43.7% to secondary education level .
eleven percent of participants had a migrant background but no significant differences were found between migrants and natives regarding gender , age , education , or event type .
when participants agreed to take part in the study , a comprehensive interview was conducted about emotional , behavioural , and cognitive responses during the disaster ( results of the content of survivors narratives can be found in grimm , hulse , preiss , & schmidt , in press ) .
furthermore , a set of psychological instruments were applied and socio - demographic and incident - related characteristics were assessed .
the interview procedure borrowed techniques from the cognitive interview ( fisher & geiselman , 1992 ) to help participants mentally recreate the past event ; the entire interview lasted on average 90 min . after revisiting the event in the interview ,
participants were asked to retrospectively rate their emotional stress and risk perception at the stage when they realized that they were actually experiencing a disaster .
they did this on a 4-point scale with zero indicating no stress/ risk and four indicating high stress/ risk . asking participants to retrospectively rate their emotions and cognitions a few years after they experienced them is not ideal as their current state and beliefs could bias their recollections of past states ( robinson & clore , 2002 ) .
nevertheless , there is research which indicates that memory for emotion - related experiences is more resistant to decaying over time ( e.g. , burke , heuer , & reisberg , 1992 ; ritchey , dolcos , & cabeza , 2008 ) .
furthermore , there is some experimental evidence that retrospective ratings , at least of emotion , might provide reasonable approximations of momentary ratings ( barrett , 1997 ) .
in addition , it was expected that the interview and its context reinstatement memory aids would make the relevant past states more accessible .
thus , while bearing the potential for recall - related biases in mind , the emotional stress and risk ratings were included to explore peritraumatic states .
current posttraumatic stress was assessed with the impact of event scale - revised ( ies - r ; weiss & marmar , 1997 ) which is employed in order to assess current subjective distress for any specific life event . also , the ies - r is a widely used measure of posttraumatic stress with satisfactory psychometric properties ( joseph , 2000 ; sundin & horowitz , 2003 ) .
it was administered prior to the interview , in order to avoid event recall potentially influencing responses about current state , and was provided in nationally validated versions ( baguena et al . , 2001 ; juczyski & ogiska - bulik , 2009 ; maercker & schtzwohl , 1998 ; preiss et al . , 2004 ; sveen et al . , 2010 ) .
missing cases on the ies - r ( four single items ) were calculated using a regression model .
in order to detect effects of individual and event characteristics on post- and peritraumatic outcome variables , separate multiple regressions with simultaneous inclusion of predictors were run with ies - r total scores , peritraumatic emotional stress and risk perception as outcome variables . where reference categories were required , the group with the largest membership was used as the reference ( i.e. , education2 , fire ) . before including predictors , correlations between variables were calculated . as none of the variables
were highly correlated , all could be included as predictors . due to the incidence rates of certain disasters varying in different geographical regions ,
as fires were common across all besecu countries , preliminary analyses of variance were conducted for the ies - r , emotional stress and risk outcomes of fire survivors with culture as the independent variable .
similarly , a series of t - tests were conducted on the outcomes of polish vs. spanish survivors of collapses of buildings .
no significant differences were found on these assessments ( all ps>0.17 ) , therefore culture was omitted as a variable from any further analysis . while the main purpose of the paper was to explore the relationships between the individual and event characteristics and each of the peri- and posttraumatic outcomes , it was nevertheless of interest to also examine the relationship between the three outcomes .
thus , in addition to the regressions , correlations and a mancova were conducted and followed up with discriminant analysis and canonical correlation analysis .
mean total ies - r scores plus mean scores of peritraumatic emotional stress and risk perception are shown across different types of disasters in table 1 .
mean ies - r total , peritraumatic emotional stress , and peritraumatic risk perception scores ( and sds ) , all across different types of disasters the individual characteristics gender , age , education and the event characteristics time since event , injuries , fatalities , plus type of event were entered into the regression models simultaneously .
the results for the outcome variables posttraumatic stress , peritraumatic emotional stress and peritraumatic risk perception are shown in tables 2 , 3 and 4 respectively .
the predictors explained most variance in the assessment of posttraumatic stress ( r
= 0.59 [ adjusted r
= 0.54 ] ) , then in the assessment of peritraumatic emotional stress ( r
= 0.56 [ adjusted r
= 0.48 ] ) , followed by the assessment of peritraumatic risk perception ( r
= 0.42 [ adjusted r
= 0.32 ] ) . while type of event was always a significant predictor ,
the variables gender and education only predicted two measures each ( ies - r scores / emotional stress and emotional stress / risk perception respectively ) , and injuries , time since event and fatalities were only significant predictors of single measures ( the first ies - r scores , the latter two emotional stress ) .
regression results showing individual and event characteristic predictors of ies - r total scores gender m(sd ) : female 35.90(23.11 ) ; male 28.00(20.34 ) .
all outcome variables were significantly intercorrelated ; ies - r scores were correlated more highly with peritraumatic emotional stress ( r=0.49 , p=0.000 ) than with risk perception ( r=0.28 , p=0.01 ) .
the highest correlation was between the two peritraumatic variables ( r=0.69 , p=0.000 ) . given these findings , a mancova was run and confirmed that , even when the relationships between ies - r scores , peritraumatic emotional stress and risk perception were taken into account , type of event still had a significant effect on all three outcome variables , pillai 's trace=0.59 , f(9 , 108)=2.91 , p=0.004 .
the mancova was followed up with a discriminant analysis , using type of event as the grouping variable and the post- and peritraumatic outcome variables as independents .
the first function explained 51% of the variance ( canonical r
= 0.36 ) , the second explained 46% ( canonical r
= 0.34 ) , and the third
only 3% ( canonical r
= 0.03 ) . in combination , these three discriminant functions significantly differentiated event types , wilk 's lambda=0.42 , x
( 9)=55.03 , p=0.000 .
when the first function was removed , the second and third functions together were still able to significantly differentiate event types , wilk 's lambda=0.65 , x
( 4)=27.40 , p=0.000 .
however , the third function on its own was not able to significantly differentiate the groups , wilk 's lambda=0.97 , x
( 1)=1.80 , p=0.18 .
the correlations between the outcomes and the discriminant functions revealed the following : ies - r scores loaded extremely highly on the first function ( r=0.95 ) but far less on the second and third functions ( r=0.11 and r=0.28 , respectively ) ; emotional stress loaded very highly on the second function ( r=0.85 ) but more moderately on the first and third functions ( r=0.41 and r=0.33 , respectively ) ; and risk perception loaded very highly on the second function ( r=0.88 ) , moderately on the third function ( r=0.48 ) and almost negligibly on the first function ( r=0.06 ) .
the group centroids demonstrated that the first function discriminated the event flood from the events fire , terror attack and collapse of a building , the second function discriminated the event terror attack from the events fire , flood and collapse of a building , while the third function discriminated the events fire and terror attack from the events flood and collapse of a building .
regression results showing individual and event characteristic predictors of peritraumatic emotional stress gender m(sd ) : female 2.77(1.00 ) ; male 2.16(0.91 ) .
education m(sd ) : primary 2.79(1.12 ) ; secondary 2.28(0.93 ) ; tertiary 2.69(1.03 ) ; further 2.00(0.82 ) .
mean total ies - r scores plus mean scores of peritraumatic emotional stress and risk perception are shown across different types of disasters in table 1 .
mean ies - r total , peritraumatic emotional stress , and peritraumatic risk perception scores ( and sds ) , all across different types of disasters
the individual characteristics gender , age , education and the event characteristics time since event , injuries , fatalities , plus type of event were entered into the regression models simultaneously .
the results for the outcome variables posttraumatic stress , peritraumatic emotional stress and peritraumatic risk perception are shown in tables 2 , 3 and 4 respectively .
the predictors explained most variance in the assessment of posttraumatic stress ( r
= 0.59 [ adjusted r
= 0.54 ] ) , then in the assessment of peritraumatic emotional stress ( r
= 0.56 [ adjusted r
= 0.48 ] ) , followed by the assessment of peritraumatic risk perception ( r
= 0.42 [ adjusted r
= 0.32 ] ) . while type of event was always a significant predictor ,
the variables gender and education only predicted two measures each ( ies - r scores / emotional stress and emotional stress / risk perception respectively ) , and injuries , time since event and fatalities were only significant predictors of single measures ( the first ies - r scores , the latter two emotional stress ) .
regression results showing individual and event characteristic predictors of ies - r total scores gender m(sd ) : female 35.90(23.11 ) ; male 28.00(20.34 ) .
all outcome variables were significantly intercorrelated ; ies - r scores were correlated more highly with peritraumatic emotional stress ( r=0.49 , p=0.000 ) than with risk perception ( r=0.28 , p=0.01 ) .
the highest correlation was between the two peritraumatic variables ( r=0.69 , p=0.000 ) . given these findings , a mancova was run and confirmed that , even when the relationships between ies - r scores , peritraumatic emotional stress and risk perception were taken into account , type of event still had a significant effect on all three outcome variables , pillai 's trace=0.59 , f(9 , 108)=2.91 , p=0.004 .
the mancova was followed up with a discriminant analysis , using type of event as the grouping variable and the post- and peritraumatic outcome variables as independents .
the first function explained 51% of the variance ( canonical r
= 0.36 ) , the second explained 46% ( canonical r
= 0.34 ) , and the third only 3% ( canonical r
= 0.03 ) . in combination , these three discriminant functions significantly differentiated event types , wilk 's lambda=0.42 , x
( 9)=55.03 , p=0.000 .
when the first function was removed , the second and third functions together were still able to significantly differentiate event types , wilk 's lambda=0.65 , x
( 4)=27.40 , p=0.000 .
however , the third function on its own was not able to significantly differentiate the groups , wilk 's lambda=0.97 , x
( 1)=1.80 , p=0.18 . the correlations between the outcomes and the discriminant functions revealed the following : ies - r scores loaded extremely highly on the first function ( r=0.95 ) but far less on the second and third functions ( r=0.11 and r=0.28 , respectively ) ; emotional stress loaded very highly on the second function ( r=0.85 ) but more moderately on the first and third functions ( r=0.41 and r=0.33 , respectively ) ; and risk perception loaded very highly on the second function ( r=0.88 ) , moderately on the third function ( r=0.48 ) and almost negligibly on the first function ( r=0.06 ) .
the group centroids demonstrated that the first function discriminated the event flood from the events fire , terror attack and collapse of a building , the second function discriminated the event terror attack from the events fire , flood and collapse of a building , while the third function discriminated the events fire and terror attack from the events flood and collapse of a building .
regression results showing individual and event characteristic predictors of peritraumatic emotional stress gender m(sd ) : female 2.77(1.00 ) ; male 2.16(0.91 ) .
education m(sd ) : primary 2.79(1.12 ) ; secondary 2.28(0.93 ) ; tertiary 2.69(1.03 ) ; further 2.00(0.82 ) .
the current exploratory study is one of the first to compare perceived post- and peritraumatic stress levels of survivors across different types of disasters .
terror attacks , although rated by the public as a high - impact disaster for survivors ( grimm , hulse , & schmidt , 2009 ) , was not the disaster evoking the highest posttraumatic stress here .
however , unexpectedly high levels of posttraumatic stress were found in this study for collapses of a shopping centre in katowice and a residential building in barcelona , and also for fires in residential and public buildings across a number of locations .
considering peritraumatic responses , participants who experienced terror attacks reported the highest levels of emotional stress and risk perception . at a first glance , the man - made / technological disasters in this sample had a greater post - event influence than did the ( single ) natural disaster , which is consistent with galea et al . 's ( 2005 ) meta - analysis findings .
however , as argued in the introduction , we believe that researchers should take a closer look at event type , beyond this general classification , and that the characteristics of events may better explain these findings .
the natural disaster flood was the only event with a long onset ; victims were warned about the upcoming threat and able to take safety measures which might have resulted in them scoring the lowest in post- and peritraumatic stress .
furthermore , significant differences were found between different types of man - made / technological disasters , which suggest that they might not necessarily have equivalent effects . with regards to the environmental cues of the disaster , we know from the interviews conducted in this study that survivors of disasters with sudden violent cues , such as explosions , reported significantly higher posttraumatic stress ( grimm et al .
as such cues characterized the terror attacks and collapses of buildings , it might also explain their survivors high ratings on the peritraumatic variables . when taking a look at the influence of predictor variables on post- and peritraumatic stress , the type of event significantly explained variance in all three measures .
the moderating effect of time on ptsd is well established ( sundin & horowitz , 2003 ) , therefore our finding that only the rating of peritraumatic emotional stress altered with time passing was unexpected . however , the fact that the score of the peritraumatic measure lowered with time is important to note and suggests that the events were even more stressful originally than was reported here .
the influence of the individual characteristic female gender was related to higher peritraumatic and posttraumatic stress but not to higher risk perception . regarding the influence of gender on ptsd , current research studies have not come to a definite conclusion . in sundin & horowitz ( 2003 ) meta - analysis about the use of the ies - r , gender was , in comparison to the type of traumatic event , relatively insignificant .
however , it needs to be considered that this meta - analysis included all types of traumatic events , not just disasters .
brewin , andrews , and valentine ( 2000 ) found in their meta - analysis that female gender is a modest risk factor for ptsd . when the type of traumatic event was taken into account
, studies of disasters showed the lowest impact of gender in comparison to studies of other non - combat / war events . regarding the present study 's results for other socio - demographic factors ,
age had no significant influence either on post- or on peritraumatic stress , while education had a little influence on both peritraumatic variables .
meta - analysis results have revealed that age and education effects on posttraumatic stress can be smaller or less consistent in certain groups ( brewin et al . , 2000 ) and this may in part account for the results here .
regression results showing individual and event characteristic predictors of peritraumatic risk perception reference category : education2 .
education m(sd ) : primary 2.64(0.78 ) ; secondary 2.25(1.11 ) ; tertiary 2.22(1.26 ) ; further 1.75(0.96 ) .
although koren , hemel , and klein ( 2006 ) suggest in their review article that peritraumatic factors such as perceived threat to one 's life during the trauma are increased by bodily injuries incurred during the traumatic event , being injured did not have a significant effect on the peritraumatic variables here .
however , a significant relationship was established between posttraumatic stress and being injured during a disaster .
2006 ) have concluded that ptsd symptoms increase if survivors are injured during a traumatic event , but that the relationship between ptsd and injuries is a complex one , which can be further explained by the factors pain , disfiguration , social isolation , hospitalization and medical procedures ; factors that were not considered in this study .
other event characteristics , such as fatalities , were related to higher peritraumatic emotional stress but not to posttraumatic stress in the current study . in an investigation of
bloody sunday , shevlin and mcguigan ( 2003 ) found highest ies - r mean scores in the immediate family of victims who lost their lives . in our sample
there were no reports of losing family members , however there were reports of other fatalities occurring during the event .
( 2009 ) found that both types of death exposure , the loss of relatives and seeing many dead bodies , contributed to posttraumatic distress after the tsunami in 2004 .
however , it is likely that the magnitude of exposure to dead bodies was lower in our studied disasters than in the tsunami of 2004 .
previous research has found negative peritraumatic emotional and cognitive states ( e.g. , fear , thinking one 's life is in danger , loss of control , dissociation ) to be good predictors of posttraumatic stress ( basoglu et al . , 2002 ;
basoglu et al . , 2004 ; hollifield et al . , 2008 ; ozer , best , lipsey , & weiss 2003 ; simeon et al . , 2003 ) .
thus , we are left with the question of why in this study events that , according to self - reports , evoked the highest stress and perceived risk at the time did not lead onto the highest level of later stress .
the correlations revealed that the outcome variables were positively related to one another but to differing extents .
while the peritraumatic measures were quite closely related perhaps understandably , given they share a moment in time and
current posttraumatic stress and peritraumatic emotional stress were moderately related , peritraumatic risk perception was not so strongly related to current posttraumatic stress .
these results suggest that some aspect(s ) of the emotional states experienced during the event may carry over and/or be shared with a survivor 's later current state but that the perceived risk at the time of the event may not inevitably induce a stressful state for some time to come afterwards .
it could be argued that a realistic appraisal of risk during the situation , irrespective of whether the risk was perceived as high or low , might help in dealing with the circumstances afterwards .
alternatively , the effect of perceived risk might be moderated by the survivors coping strategies ( or lack of ) .
the discriminant analysis looked into the relationships between the outcome variables further , in the context of their ability to discriminate type of event .
the ies - r loaded the most on the first function while emotional stress loaded more moderately and risk perception barely at all .
in contrast , the two peritraumatic measures loaded highly on the second function ( which accounted for slightly less variance ) and the ies - r made little contribution here .
risk perception was the measure that loaded most on the third function but this function was not good , at least not on its own . of note , each function differentiated event types differently .
these findings then provide further evidence that , despite being related , the three outcome measures are not simply interchangeable .
it appears that when assessing the effects of different types of event on disaster survivors measuring peritraumatic states can be useful as can measuring posttraumatic states , but a better assessment is achieved when the relative contribution of each state is combined .
it has to be remembered that the ies - r , although a good indicator of posttraumatic stress , was not used to diagnose ptsd and several predictors relevant for the psychological outcome of survivors , such as pre - event psychological morbidity and peritraumatic detachment , were therefore not included .
thus , how our findings fit within what is already known about predictors of actual ptsd requires further research .
as commonly reported in disaster research , recruitment strategy and inclusion criteria led to a purposive sample ( stallings , 2007 ) .
this means that the different sample sizes per disaster were affected somewhat by the different incidence rates of each disaster type across europe , which also led to the fact that the variables type of event and culture were somewhat confounded .
one of the strengths of the study , to only include survivors of real life - threatening events , has as a consequence reduced the overall sample size even further and contributed to the uneven sample sizes across events .
both issues have meant a reduction in the power of the study and might prohibit a generalization of the presented findings .
this was not entirely explained by symptoms of ptsd or exposure to terror attacks , instead indicating cultural differences .
although we did not find any influence of culture on perceived post- and peritraumatic stress levels , tendencies for cross - cultural differences in talking about the traumatic event in this sample have been reported elsewhere ( freitag et al . , 2010 ) , and thus evidence would suggest that culture should remain a consideration in this field of research . for future studies with larger ,
more heterogeneous samples it might be worth operationalizing the variable culture not as country of residence but as a function of other cultural aspects such as race ( norris , perilla , ibanez , & murphy , 2001 ) ; many countries in western europe are common in this respect and this might also explain our non - significant findings for culture .
in conclusion , an explorative approach was taken to study post- and peritraumatic reactions to different types of disasters , including a test of the influence of a selection of individual and event characteristics .
the results suggest that the type of event people experience with its specific situational factors has an influence on post- and peritraumatic reactions .
therefore two future research paths are suggested : the first would be to replicate and extend this study with a larger sample , still using a methodology that allows for direct comparisons across different types of disasters .
such a study would benefit from including more individual and event characteristics ( e.g. , being trapped during the event , social affiliation , etc . ) and examining their relative effects on post- and peritraumatic outcomes but also their relative prevalence in each type of event . secondly ,
as our results showed , people 's emotions and cognitions during the event may be influenced by disaster characteristics , just as their emotions and cognitions may be affected afterwards .
therefore we believe that it is worth having a closer look at event characteristics and how these interact with individuals peritraumatic responses . we know from interviews with survivors of disasters that survivors with lower current posttraumatic stress were more often able to actively manage their escape by preparing for evacuation or contacting emergency services in order to plan their rescue or seek information about how to behave ( grimm et al .
social affiliation and the place people are in at the moment of the disaster could be relevant factors in the influence of the type of event .
prati , catufi , and pietrantoni ( 2012 ) showed that persons who were in the company of their families were less likely to flee the endangered place as being in their homes during the disaster was also related to a higher feeling of safety .
therefore we believe that an inclusion of peritraumatic behavioural responses during disasters will further understanding of post- and peritraumatic stress .
there is no conflict of interest in the present study for any of the authors . | backgroundexamination of existing research on posttraumatic adjustment after disasters suggests that survivors posttraumatic stress levels might be better understood by investigating the influence of the characteristics of the event experienced on how people thought and felt , during the event as well as afterwards.objectiveto compare survivors perceived post- and peritraumatic emotional and cognitive reactions across different types of disasters .
additionally , to investigate individual and event characteristics.designin a european multi - centre study , 102 survivors of different disasters terror attack , flood , fire and collapse of a building were interviewed about their responses during the event . survivors
perceived posttraumatic stress levels were assessed with the impact of event scale - revised ( ies - r ) .
peritraumatic emotional stress and risk perception were rated retrospectively .
influences of individual characteristics , such as socio - demographic data , and event characteristics , such as time and exposure factors , on post- and peritraumatic outcomes were analyzed.resultslevels of reported post- and peritraumatic outcomes differed significantly between types of disasters .
type of disaster was a significant predictor of all three outcome variables but the factors gender , education , time since event , injuries and fatalities were only significant for certain outcomes.conclusionresults support the hypothesis that there are differences in perceived post- and peritraumatic emotional and cognitive reactions after experiencing different types of disasters .
however , it should be noted that these findings were not only explained by the type of disaster itself but also by individual and event characteristics . as the study followed an explorative approach ,
further research paths are discussed to better understand the relationships between variables . |
scientific studies play an important role among them ( 1 ) . during the past two decades
, iran has enjoyed considerable expansion of trained individuals in the fields of medicine ( 2 ) for being a developed and industrial country .
therefore , the policy of iranian governors changed in the recent years to provide a good condition for scientists and training researchers and increase science production .
iran has been successful in its agenda to improve its international profile in biomedical sciences by constantly increasing the quantity and quality of articles published in peer - reviewed biomedical journals indexed in pubmed .
however , to date , little is known about contributions of iranian medical researchers and their quality in the field of nephrology and urology . by examining various aspects of such investigations regarding quality and quantity of articles in the field of nephrology and urology
, we would be able to reflect iran 's scientific progress and impact on world science production .
this is one of the earliest studies assessing iran research productivity in the field of urology and nephrology .
moreover , a precise and extensive view of the overall research productivity at regional and international level is presented here .
the aim of this study was to evaluate the quality and quantity of iranian papers in the field of nephrology and urology indexed in pubmed in the past two decades .
this can help scientists and governors to compare this study with other counties and better future planning in nephrology and urology field .
we conducted a retrospective study to determine quality and quantity of nephrology and urology research output in the past two decade by iranian scientists .
two faculty members of baqiyatallah university of medical sciences ( one nephrologist and one urologist ) helped us to find all relevant keywords in the field of nephrology and urology .
we did an online search in abstract / title part of articles with 129 obtained keywords such as kidney , renal , hemodialysis , transplant , nephrology , glomerulonephritis , ureteral , nephrolithiasis , and etc .
endnote software version 7 ( bld 7072 ) was used searching pubmed database from november 1993 to november 2013 .
all articles in which iran was the affiliation of at least one of the authors were selected . after deleting duplicate records ,
two investigators evaluated title and abstracts of searched articles and excluded papers unrelated to nephrology and urology . in case of disagreement between investigators regarding excluding or including an article , final decision was made by the professor of nephrology ( b e ) .
we gathered a total of 4064 relative articles as an offline database for further evaluation .
the final offline database of iranian articles in the field of nephrology and urology was analyzed as follows : 1 ) name of originated institution according to the first author address , 2 ) field of study , categorized as transplantation , hemodialysis , peritoneal dialysis , nephrology , urology , and other issues , 3 ) total number of publications , 4 ) type of study ( retrospective , prospective , clinical trial , case report and etc . ) , 5 ) collaboration rate of iranian nephrologists and urologists for every year and the whole studied period , 6 ) annual publication of iranian articles in five journals with highest impact factor ( if ) regarding nephrology and urology , 6 ) name of journals publishing most iranian papers , 7 ) articles published in journals with if 1 , between 1 and 3 and more than 3 in each five years , and 8) the average of iranian articles if in each five years .
all data were analyzed using spss analytical software version 19.0 ( pasw , spss inc .
we used one - way anova to compare categorized if obtained in each year in case of normality ; otherwise , kruskal - wallis - h test was used .
we conducted a retrospective study to determine quality and quantity of nephrology and urology research output in the past two decade by iranian scientists .
two faculty members of baqiyatallah university of medical sciences ( one nephrologist and one urologist ) helped us to find all relevant keywords in the field of nephrology and urology .
we did an online search in abstract / title part of articles with 129 obtained keywords such as kidney , renal , hemodialysis , transplant , nephrology , glomerulonephritis , ureteral , nephrolithiasis , and etc .
endnote software version 7 ( bld 7072 ) was used searching pubmed database from november 1993 to november 2013 .
all articles in which iran was the affiliation of at least one of the authors were selected . after deleting duplicate records ,
two investigators evaluated title and abstracts of searched articles and excluded papers unrelated to nephrology and urology . in case of disagreement between investigators regarding excluding or including an article , final decision was made by the professor of nephrology ( b e ) .
we gathered a total of 4064 relative articles as an offline database for further evaluation .
the final offline database of iranian articles in the field of nephrology and urology was analyzed as follows : 1 ) name of originated institution according to the first author address , 2 ) field of study , categorized as transplantation , hemodialysis , peritoneal dialysis , nephrology , urology , and other issues , 3 ) total number of publications , 4 ) type of study ( retrospective , prospective , clinical trial , case report and etc . ) , 5 ) collaboration rate of iranian nephrologists and urologists for every year and the whole studied period , 6 ) annual publication of iranian articles in five journals with highest impact factor ( if ) regarding nephrology and urology , 6 ) name of journals publishing most iranian papers , 7 ) articles published in journals with if 1 , between 1 and 3 and more than 3 in each five years , and 8) the average of iranian articles if in each five years .
all data were analyzed using spss analytical software version 19.0 ( pasw , spss inc .
we used one - way anova to compare categorized if obtained in each year in case of normality ; otherwise , kruskal - wallis - h test was used .
our entire search results with 129 keywords were 27,503 articles . deleting duplicate records yielded 8,602 papers .
slightly more than 80% of papers published within seven recent years ( 2007 - 2013 ) .
figure 1 shows the increase in the annual number of iranian articles in the field of nephrology and urology in the past two decades .
the first five journals that published iranian papers in the field of nephrology and urology were as follows : urology journal ( 9.7% ) , iranian journal of kidney disease ( 8.4% ) , saudi journal of kidney disease and transplantation ( 6.5% ) , journal of endourology ( 1.9% ) and experimental and clinical transplantation ( 1.7% ) .
an overall of 1070 ( 28.3% ) iranian articles were published in the mentioned five journals .
there was a significant difference between the mean if of journals published in iranian papers in different years ( p = 0.03 ) .
we also categorized if of journals to less than one , between one and three and more than three and then evaluated them in five years ( 1994 , 1998 , 2003 , 2008 and 2013 ) .
abbreviation : if : impact factor . transplantation ( 44.6% ) , nephrology ( 20.9% ) , hemodialysis ( 16.4% ) , and infertility ( 11.8% ) were the most prevalent topics of papers . however , chronic ambulatory peritoneal dialysis ( 1.7% ) and other topics ( 4.6% ) contributed to a small proportion of publications .
figure 2 demonstrates the institutional affiliation of corresponding authors who published more than ten papers in the past two decades in nephrology and urology .
most iranian nephrology and urology papers were from the capital city , tehran ( 50.03% ) , particularly from tehran university of medical sciences ( ums ; 18% ) , shahid beheshti ums ( 13.3% ) , baqiyatallah ums ( 6.3% ) , iran ums ( 3.1% ) , royan institute for reproductive biomedicine ( 1.8% ) , tarbiat modares university ( 1.4% ) , avicenna research institute ( 0.83 ) , pasteur institute ( 0.4% ) , and other institutes in tehran ( 4.9% ) .
of all papers evaluated in this study , 26.1% were fundamental ( basic science ) and 53.7% were retrospective articles .
iranian publications in the field of nephrology and urology have been increased during the past two decades . as shown in figure 1 ,
the number of iranian indexed publications in pubmed had a considerable increase since 2006 ; publications number increased from less than 200 publications in 2006 to more than 300 publications in 2007 . since that year
, iranian researchers have had a significant growth in science production . in our study , the total number of publications was 3,771 between 1993 and 2013 ( average of 188 papers per year ) . a recent paper ( 3 )
showed the total number of urology and nephrology publications in arab countries ( 21 countries ) for 40 years from 1972 - 2011 as 224,479 in web of science database ( average of 267 papers per year for each country ) .
however , these results are not comparable due to their differences in years and database . during 2000 - 2009 , according to the findings of the present study , the number of articles written by iranians was 1,777 , while at the same time ( in a decade ) , the number of articles in china and saudi arabia were 3,100 and 462 , respectively ( 3 , 4 ) . some studies
proposed that lack of funding may be the cause of low scientific research output in the arab world ( 5 , 6 ) .
it is also , possible that the overall growth of published articles of iranians or some other scientific societies is partly due to increased number of foreign international conferences , which can significantly affect the rate of publication in internationally published journals .
furthermore , nourbala and his coworkers ( 7 ) showed that iran had the maximum number of publications in the field of transplantation after turkey among muslim counties in a period of eight years ( 2000 - 2007 ) .
we also showed that transplantation was the most prevalent topic in nephrology and urology papers ( 44.6% , 1682 papers ) .
some reasons for the rising trend observed in the quantity might be firstly the huge population , secondly funding in the field of nephron - urology , thirdly increased number of researchers and subspecialists in this field and finally publishing articles in domestic journals and fourthly , government overall policies to promote research in iran .
nevertheless , the number of publications derived from medline - indexed journals can not be a good representative of all iranian scientific nephrology and urology population and this amount merely reflects the overall estimation .
we showed that the mean journals impact factor ( if ) within five years decreased slightly .
figure 3 shows a steep decline from 1994 to 2008 in the mean if for journals in which iranian articles were published .
the jumps observed within five years might be due to increasing number of iranian international journals indexed in isi and increase in their impact factor during these years .
it is hoped that this upward trend would be continued . despite the high level of mean impact factor in the past years
however , the mean of impact factor is reduced , the amount of articles published in high impact factor journals are significantly increased . due to the wide variety of nephrology and urology ,
certainly a lot of complex issues in these areas are unknown and remain unknown and require further investigation .
we found that the subject of kidney transplantation has received the most attention in the recent years and most papers topics in our study were about transplantation ( 44.6% ) .
the number of transplant centers and transplanted patients increased during the past two decades in iran ( 8) .
iran has been the most active country in the field of transplantation in the middle east .
the annual rate of kidney transplantation in iran ranks the highest among the middle eastern countries ( 9 ) . regarding the type of articles published in journals , our results were relatively similar to previous studies to a large extent .
most of these studies were retrospective articles , while a few contributed to clinical trial studies .
zhou et al . ( 4 ) reported that based upon a ten year - analysis in china , the most published articles in the field of nephrology and urology were case reports , randomized control trials and clinical trial articles , respectively .
the researcher analyzes patients records and therefore , has lower scientific value than prospective studies .
most sources of error due to confounding factors and bias are more prevalent in retrospective studies than prospective ones ( 10 ) , so , more attention should be paid in these cases .
it can add to our knowledge about the etiology , pathogenesis , natural history and treatment of rare diseases , and is so useful for training junior investigators ( 11 ) .
given less time requirement to write and present this paper and easier publishing process than other types of articles in journals , many researchers are willing to publish case reports ( 12 ) .
however , performing a randomized controlled trial or analytical epidemiological studies requires long time , manpower and high cost ( 13 ) . the results of this study showed that tehran university of medical sciences has the greatest amount of participation , cooperation and contribution in nephrology and urology published - articles among iranian universities and scientific institutes . a study conducted by einollahi et al . in 2007 showed that most iranian biomedical papers ( according to the first author in the field of nephrology ) were from tehran city ( 55.2% ) , particularly from some academic centers such as iran university ( 15.0% ) , shahid beheshti university ( 13.0% ) , tehran university ( 11.2% ) and baqiyatallah university ( 10.2% ) . in the present study , we examined publications of urologists and nephrologists together .
therefore , tehran university with 18% had the highest number of articles and also the highest growth among the universities from 2007 up to now .
iranian universities are very competitive to publish research articles and more important promote medical sciences . some , if not the only , reasons for research activities and positive movement made in iranian research community might be increasing encouragement system for researchers , well - development of research culture , fellowship training in nephrology and urology and also setting up a research phd degree in universities
however , some articles are not included in this database and accordingly were not analyzed in our study . in pubmed ,
only the address of the first author is presented , so it may limit the researcher to understand other centers and affiliations involved in the project . in conclusion , iranian publications in the field of nephrology and urology have had a considerable and significant increase in the recent years in middle eastern countries , but there is a wide distance to be a science exporter country in the world . | context : we performed a bibliometric search to evaluate the number of papers published in the field of nephrology and urology by iranian researchers in the past two decades.evidence acquisition : we did an online search in abstract / title part of articles with 129 keywords such as kidney , renal , hemodialysis , transplant , nephrology , glomerulonephritis , ureteral , nephrolithiasis , and etc .
endnote software version 7 was used to search articles published in pubmed database from november 1993 to november 2013 .
those articles in which iran was the affiliation of at least one of the authors were selected .
these articles in the field of nephrology and urology were analyzed regarding the name of originated institution , field of study , total number of publications , type of study , collaboration rate of iranian nephrologist and urologists for every year , annual sharing of iranian articles in five journals with highest impact factor ( if ) and journal if.results:the total number of publications in the field of nephrology and urology was 3,771 ( average of 189 papers per year ) .
most of the iranian nephrology and urology papers were from the capital city , tehran ( 50.03% ) .
there was an increasing trend in the number of publications over the years .
most papers were about transplantation ( 44.6% ) , nephrology ( 20.9% ) and hemodialysis ( 16.4% ) .
of all , 53.7% were retrospective articles , whereas the proportion of clinical trials was relatively small ( 10.8%).conclusions : although iranian publications in the field of nephrology and urology have had a considerable and significant increase in the recent years amongst the middle eastern countries , there is a wide distance to be a science exporter country . |
spinal canal stenosis is a syndrome of various etiology , whose morphological manifestation is narrowing of the spinal canal , intervertebral foramina , and lateral recesses .
it is the most common cause for surgical treatment in patients over 65 years of age . in the surgical treatment for lumbar stenosis ,
various methods have been applied , which have been described in the literature as plif ( posterior lumbar interbody fusion ) , with or without additional transpedicular stabilization aimed at achieving the right intervertebral space and stabilizing the motor segment under treatment [ 46 ] . however
some authors have investigated the role of ceramic - based grafts that enable large - scale production , biocompatibility , an appropriate safety profile , and the ability to closely mimic physiological bone .
the aim of the study was to compare long - term results of efficacy of plif versus fenestration of patients with lumbar stenosis treated with : decompression of neural structures and interbody fusion with ceramic corundum implants , and fenestration without restoring intervertebral space and gaining stability .
after obtaining approval by the institutional ethics committee , 100 patients with single - level lumbar spinal stenosis due to disc degeneration were surgically treated during the years 19982002 .
all the patients were prospectively qualified for surgery by an experienced spine surgeon who is the chief of the spine surgery department .
all patients had neurological examination followed by radiological imaging ( x - ray , mri , and/or ct ) to confirm the diagnosis .
the criteria for qualification for the groups researched were the following : severe back pain radiating to 1 or both of the legs , neurogenic claudication below 200 m , no improvement despite 3-months of appropriate physiotherapy , and stenosis requiring resection of more than 50% of facet joints .
the criteria for denying the treatment were : lack of patient consent , spondylolisthesis , and other pathological abnormalities ( e.g. , metastasis , infection , or fracture ) .
the sample size had been assumed to be n=50 , based on sample sizes applied in similar studies published before .
the statistical analyses were correct , so we found corrections and enlarging the group were not necessary .
group a consisted of 50 patients treated with decompression of the entrapped neural elements , enlargement of the intervertebral foramina through disc space elevation by us of ceramic corundum implants , and providing immediate motion segment stability supplemented without posterior instrumentation .
group b consisted of 50 patients treated with decompression of neural structures by fenestration with facetectomy of inferior articular processes .
the corundum implants were designed at the department of orthopedic surgery of the center of postgraduate medical education in otwock in cooperation with the glass and ceramic institute .
the porosity of implants is similar to that of the mineral structure of the cancellous bone , and their resilience modules were also similar .
the implant , after it fuses with bone , forms a resistant composite , well visible in x - ray images , as it does not undergo resorption .
the bioceramic corundum implants are made of close - grained aluminium oxide al2o3 and fired at 1730c .
figure 2a and 2b show ap and lateral view of 3d - ct image of the lumbar spine 10 years after surgery .
porous corundum implants are visible in the l4-l5 interbody space . the results were evaluated through 2-factor repeated measures analysis of variance .
the between - subject factor was the type of surgical treatment , and the within - subject factor was the change of results following the treatment .
the between - subject factor was the type of surgical treatment , and the within - subject factor was the change of results following the treatment .
differences between duration of operation , intraoperative blood loss , time to ambulation , and hospitalization were significantly different for p<0.05 in favor for the decompression group .
all the patients were monitored by the operating surgeon at 6 weeks , 6 months , and 1 year after surgery , and then annually .
the subjective scale of disability as expressed by the patients , based on the oswestry disability index , , the rolland- morris disability questionnaire , and the visual analogue scale ( vas 010 ) , were used as the treatment effectiveness criteria .
functional scales were collected from the patients before surgery , 1-year after surgery , and ten years later .
follow - up rate at the evaluation point at 1 year was 99 patients , and 93 at 10 years .
it was impossible to get information from 3 patients belonging to group a ( 2 patients had died and 1 had changed address ) and from 4 patients belonging to group b ( all 4 had changed addresses ) ( figure 3 ) .
the oswestry disability index prior to the treatment revealed serious disability ( 41.01% [ 10.10 ] ) for group a and full disability ( 63.80% [ 12.63 ] ) for group b ; the difference was statistically significant , with p<0.01 .
the rolland - morris disability questionnaire revealed mean disability of 16.07% ( 5.88 ) in group a and 14.15% ( 3.24 ) in group b , but the difference was not statistically significant .
the visual analogue scale ( vas ) revealed a mean pain level of 8.57 ( 1.21 ) in group a and 8.17 ( 0.9 ) in group b , but the difference was not statistically significant .
the oswestry disability index revealed minimal disability at 1 year after surgery in group a , and moderate disability in group b. the difference between the groups was statistically significant , with p<0.01 .
long - term results showed a slight insignificant increase of disability , but the difference between the groups was still statistically significant , with p<0.01 .
the rolland - morris disability questionnaire at 1 year after the operation revealed mean disability of 8.57% ( 5.88 ) and 7.57% ( 5.83 ) after 10 years in group a , and 7.17% ( 4.42 ) after 1 year and 8.17% ( 4.44 ) after 10 years in group b. this difference between the groups was not statistically significant .
the visual analogue scale ( vas ) revealed a mean pain level of 3.98 ( 2.14 ) after 1 year and 4.96 ( 2.13 ) after 10 years in group a , and mean pain level of 4.15 ( 1.59 ) after 1 year and 4.35 ( 1.69 ) after 10 years in group b. this difference between the groups was not statistically significant ( table 3 ) .
the slight insignificant increase of patient disability in odi and rm scales as well as in vas scale were probably connected with aging .
the analysis of variance of the oswestry disability index revealed a significant impact of the within - subject factor ( f1,91=899.97 ; p<0.001 ) .
the improvement 10 years following the surgery evaluated by the oswestry disability index between the groups was statistically important .
also , the interaction of factors was significant ( f1,91=50.126 ; p<0.001 ) ; therefore , the increase in patient health was greater .
the surgical treatment resulted in achieving minimal and moderate disability according to the oswestry disability index in group a ; therefore , the clinical result was good in 44 patients ( 95.7% ) .
the result was unsatisfactory ( disability was moderate ) in 2 patients ( 4.3% ) .
the oswestry disability index revealed that the decompression performed in patients of group b resulted in a good clinical result in 45 patients ( 95.7% ) . like in group
a , there were also 2 patients whose results were unsatisfactory . in the case of the rolland - morris disability questionnaire
, the within - subject factor played an important role ( f1,91=132.46 ; p<0.001 ) , which shows that this questionnaire also revealed a decrease in patient disability .
however , interaction of factors proved irrelevant here , and effectiveness of both methods with this questionnaire should be evaluated as being similar .
the visual analogue scale ( vas ) confirms the abovementioned effects . a significant impact of the within - subject factor ( f1,91=476.97 ; p<0.001 ) was demonstrated , but there is no interaction between this factor and the method of treatment .
the following complications were observed in group a : 1 patient had malposition of the corundum , but did not require reoperation .
one patient in group a needed additional postero - lateral fusion with autologous graft due to instability . in group
b , during 10 years of observation , 3 patients had surgery on this same segment due to recurrence of symptoms .
the hypothesis that fusion of a single segment of the spine causes increased motion that leads to disc prolapse was not observed in the examined group .
we observed adjacent segment lateral stenosis due to degenerative changes in intervertebral joints and ligamentum flavum thickening in : 4 patients ( 8.5% ) from group
a ; they were re - operated at between 6 and 8 years after primary surgery , with a mean of 7.16 ( 0.63 ) years , and 6 patients ( 13.04% ) from group b , who were re - operated on between 3 and 7 years after primary surgery , with a mean of 5.13 ( 1.27 ) years . in both groups
no patients were operated on due to disc extrusion during the follow - up period .
the oswestry disability index prior to the treatment revealed serious disability ( 41.01% [ 10.10 ] ) for group a and full disability ( 63.80% [ 12.63 ] ) for group b ; the difference was statistically significant , with p<0.01 .
the rolland - morris disability questionnaire revealed mean disability of 16.07% ( 5.88 ) in group a and 14.15% ( 3.24 ) in group b , but the difference was not statistically significant .
the visual analogue scale ( vas ) revealed a mean pain level of 8.57 ( 1.21 ) in group a and 8.17 ( 0.9 ) in group b , but the difference was not statistically significant .
the oswestry disability index revealed minimal disability at 1 year after surgery in group a , and moderate disability in group b. the difference between the groups was statistically significant , with p<0.01 .
long - term results showed a slight insignificant increase of disability , but the difference between the groups was still statistically significant , with p<0.01 .
the rolland - morris disability questionnaire at 1 year after the operation revealed mean disability of 8.57% ( 5.88 ) and 7.57% ( 5.83 ) after 10 years in group a , and 7.17% ( 4.42 ) after 1 year and 8.17% ( 4.44 ) after 10 years in group b. this difference between the groups was not statistically significant .
the visual analogue scale ( vas ) revealed a mean pain level of 3.98 ( 2.14 ) after 1 year and 4.96 ( 2.13 ) after 10 years in group a , and mean pain level of 4.15 ( 1.59 ) after 1 year and 4.35 ( 1.69 ) after 10 years in group b. this difference between the groups was not statistically significant ( table 3 ) .
the slight insignificant increase of patient disability in odi and rm scales as well as in vas scale were probably connected with aging .
the analysis of variance of the oswestry disability index revealed a significant impact of the within - subject factor ( f1,91=899.97 ; p<0.001 ) .
the improvement 10 years following the surgery evaluated by the oswestry disability index between the groups was statistically important . also , the interaction of factors was significant ( f1,91=50.126 ; p<0.001 ) ; therefore , the increase in patient health was greater . the surgical treatment resulted in achieving minimal and moderate disability according to the oswestry disability index in group a ; therefore , the clinical result was good in 44 patients ( 95.7% ) .
the result was unsatisfactory ( disability was moderate ) in 2 patients ( 4.3% ) .
the oswestry disability index revealed that the decompression performed in patients of group b resulted in a good clinical result in 45 patients ( 95.7% ) . like in group
a , there were also 2 patients whose results were unsatisfactory . in the case of the rolland - morris disability questionnaire
, the within - subject factor played an important role ( f1,91=132.46 ; p<0.001 ) , which shows that this questionnaire also revealed a decrease in patient disability .
however , interaction of factors proved irrelevant here , and effectiveness of both methods with this questionnaire should be evaluated as being similar .
. a significant impact of the within - subject factor ( f1,91=476.97 ; p<0.001 ) was demonstrated , but there is no interaction between this factor and the method of treatment .
the following complications were observed in group a : 1 patient had malposition of the corundum , but did not require reoperation .
one patient in group a needed additional postero - lateral fusion with autologous graft due to instability . in group
b , during 10 years of observation , 3 patients had surgery on this same segment due to recurrence of symptoms .
the hypothesis that fusion of a single segment of the spine causes increased motion that leads to disc prolapse was not observed in the examined group .
we observed adjacent segment lateral stenosis due to degenerative changes in intervertebral joints and ligamentum flavum thickening in :
4 patients ( 8.5% ) from group a ; they were re - operated at between 6 and 8 years after primary surgery , with a mean of 7.16 ( 0.63 ) years , and 6 patients ( 13.04% ) from group b , who were re - operated on between 3 and 7 years after primary surgery , with a mean of 5.13 ( 1.27 ) years . in both groups
no patients were operated on due to disc extrusion during the follow - up period .
ceramic implants used in the plif surgical treatment have not been widely discussed in the english literature in the last 10 years .
reported the early treatment outcomes of plif with corundum implants evaluated according to the oswestry disability index . in almost 80% of patients , the clinical result achieved was good or satisfactory .
these implants were supposed to be an alternative to metal implants , which are much more expensive . also , the surgical treatment with the use of interbody metal implants is much more extensive , with the risk being much higher than in operations without the use of any implants [ 1214 ] .
corundum implants discussed in this paper were used in 50 patients with clinical symptoms of single - level stenosis .
it was assumed that the interbody fusion would ensure stability and eliminate the cause of the pain , while the reconstruction of the intervertebral space height would prevent or delay the development of secondary stenosis on the reconstructed level .
the long - term results in group a showed that patients treated by interbody fusion with the use of ceramic corundum implants have not exceeded the long - term results of treatment without the interbody fusion .
treatment by decompression was , however , less invasive . in this kind of treatment ,
the justification for this treatment was the conviction that degenerative changes in posterior facet joints and intervertebral discs in their natural process of development lead to a secondary stabilization of the motor segment . additionally , the precise determination of the level of condition through clinical examination , as well as the removal of its cause ( the compression on neural structures ) in the course of the surgical treatment , is a well - documented course of action . during the decompression procedure ,
if the intervertebral joint is retained with a part of inferior articular process , the vertebral arches and processes , together with the anterior wall of the spinal canal and posterior longitudinal ligament , the neurological structure can be decompressed without causing instability on the operated level .
they evaluated short - term results of treatment of lumbar stenosis by 2 different methods of decompression : fenestration and laminectomy .
they advised performing a surgery with minimal intervention because this makes the surgery less expensive .
watanabe et al . reported that they used the plif procedure to implant 31 patients ( 33 segments ) , in combination with segmental pedicle screws , interbody cages , and autogenous local bone graft , achieving excellent clinical outcomes , and in their opinion it was a rational and useful surgical option for treatment of lumbar foraminal stenosis .
weiner et al . treated patients with severe stenotic changes by tlif ( transforaminal lumbar interbody fusion ) and found that this technically demanding procedure could be performed with relatively few complications and offered excellent rates of arthrodesis .
a similar conclusion was reached in a register study of 9051 patients by sigmundsson et al .
they concluded that patients with predominant back pain undergoing decompression and fusion were more satisfied with their treatment at 1-year follow - up and had better outcome in terms of health - related quality of life than patients who underwent decompression only .
promising results combining advantages of both methods minimal approach and fusion were reported by perez - crues et al . , was reported the short- and long - term outcomes from a large cohort ( n=304 ) of patients undergoing minimally invasive transforaminal lumbar interbody fusion ( mitlif ) . similar to our findings , the above - mentioned authors stated that the vas scores decreased significantly ( from 7.0 preoperatively to 3.5 ) and the oswestry disability index scores declined from 43.1 preoperatively to 28.2 at mean 47-month follow - up .
moreover , the long - term benefits observed in this study included a reduced rate of adjacent segment disease requiring reoperation , while providing high rates of fusion and a low rate of complications .
the ideal and long - lasting surgical treatment of lumbar spinal stenosis with associated mild spinal deformity is still debated in the literature and reported results vary .
found that spinal canal decompression improves the functioning of the patients , and reduces back pain and lower limb pain .
conducted a retrospective cohort analysis of 90 consecutive patients ( mean age 70 years ) , with 5-year mean follow - up , treated for stenosis with associated deformity , using 3 different methods : interspinous process spacer ( isp ) device placement , laminectomy alone , or laminectomy and short - segment fusion .
the authors stated that there was a significantly higher rate of same - level recurrence in the isp group ( 33.3% ) than the laminectomy ( 8.3% ) and laminectomy combined with fusion ( 0% ) groups .
deyo et al . , in a retrospective cohort analysis including 99 084 patients who underwent surgery for spinal stenosis , used different methods : an the interspinous process spacer ( isp ) device placement alone , laminectomy and spacer , decompression alone , or decompression with fusion , and reported the revision rates at 2 years to be 16.7% for the isp , 8.5% for decompression alone , and 9.8% for lumbar fusion . .
results of reoperation in decompression alone and in lumbar fusion were comparable at 2 years after surgery .
we have obtained similar results , with 8.5% reoperations in the fusion group , and 13.04% in the decompression group , but our observation period was much longer . another way to evaluate the benefits of
performed surgery is measuring the level of patient pain , functioning , and disability . in our study , at 10-year follow - up , the results were still beneficial , and observed disability was minimal to moderate .
japanese authors in a prospective study evaluated 70 patients in whom laminectomy with or without arthrodesis was performed by vas scale .
they found that the results of the surgery improved steadily for 6 months after the operation , and then remained stable for the next 5 years . in elderly patients , especially women ,
our results showed a decrease in pain level after surgery , from vas 8.57 in the plif group and 8.17 in the decompression group , to 4 and 4.17 after 1 year , and slight increase to 4.96 and 4.35 , respectively , after 10 years .
an important measure of the value of surgery was also the percentage of patients who return to work ( rtw ) .
nguyen et al . analyzed long - term ( 10-year ) results in 725 patients treated with arthrodesis compared to 725 controls who were randomly selected .
they discovered that 26% of fusion cases had rtw , while 67% of nonsurgical controls had rtw .
surgery was connected with a large percentage ( 27% ) of re - operation . in 36% of patients ,
there were complications and a large increase in using opioid drugs when compared to the control group not treated surgically . in this study
, we did not analyze the rate of return to work , but most probably this problem is significant .
a total of 75% of the patients operated on for lumbar spinal stenosis do not return to their preoperative work .
difficulties in returning to work and decreased quality of life are associated with female sex , lower education , hard physical work , and low income .
it is a process which enables the fastest possible patient recovery and helps to achieve optimal activity in a way that is safest for the patient [ 2224 ] .
long - term results evaluated according to the odi , the rolland - morris disability questionnaire , and the vas showed that both methods gave significant reduction in patient disability , which was maintained during the next 10 years .
the less invasive fenestration procedure was only a little less favorable than surgical treatment of stenosis by both plif with corundum implants and decompression . | backgroundthe purpose of this study was to evaluate lumbar spine - related functional disability in individuals 10 years after lumbar decompression and lumbar decompression with posterior lumbar interbody fusion ( plif ) with corundum implants surgery for degenerative stenosis and to compare the long - term outcome of these 2 surgical techniques.material/methodsfrom 1998 to 2002 , 100 patients with single - level lumbar stenosis were surgically treated .
the patients were randomly divided into 2 groups that did not differ in terms of clinical or neurological symptoms .
group a consisted of 50 patients who were treated with plif and the use of porous ceramic corundum implants ; the mean age was 57.74 and bmi was 27.34 .
group b consisted of 50 patients treated with decompression by fenestration ; mean age was 51.28 and the mean bmi was 28.84.resultsthere was no statistical significance regarding age , bmi , and sex .
both treatments revealed significant improvements .
in group a , odi decreased from 41.01% to 14.3% at 1 year and 16.3 at 10 years . in group
b , odi decreased from 63.8% to 18.36% at 1 year and 22.36% at 10 years .
the difference between groups was statistically significant .
there were no differences between the groups regarding the rolland - morris disability questionnaire and vas at 1 and 10 years after surgery.conclusionslong-term results evaluated according to the odi , the rolland - morris disability questionnaire , and the vas showed that the both methods significantly reduce patient disability , and this was maintained during next 10 years .
the less invasive fenestration procedure was only slightly less favorable than surgical treatment of stenosis by both plif with corundum implants and decompression . |
after surgical removal the catecholamines elaborated by the tumor also take time to be washed out of the circulation thus the blood pressure will need careful monitoring .
conventional alpha blockage first and beta blockage later was the algorithm followed but choice of agent was also discussed with nesthethesiologist .
though classically taught phenoxy benzamine is used , in this case it was not used and a combination of prazosin and propranolol
a 32 year old african male presented with history of weight loss , pain in the abdomen and episodes of sweating and palpitations .
he had hypertension which was being treated by multiple drugs over a course of three years .
as a consequence of the episodes of the aforesaid symptoms he had been forced to take extended leave of absence and as a result lost his job as an accounting clerk .
he was evaluated in our hospital as a case of young hypertension and found to have a large palpable mass in the epigastrium that magnetic resonance imaging ( mri ) showed as a large tumor adherent to the great vessels .
he recovered completely and eight months later on follow up had regained some of his weight , was off anti hypertensives and had also been successfully reemployed .
a 32 year old african male an accounting clerk by profession presented with history of weight loss of around 6 kilograms over a period of two years and episodes of palpitations accompanied by headaches .
on several occasions he had been admitted in a local hospital with the above symptoms .
he however had no loss of vision at any time and there was no relief by the intake of sugar .
a few times there was pain in the abdomen during such episodes which though he says was severe but short lasting .
he was taking multiple anti hypertensives and also tab morphine for pain during these episodes . on initial presentation
the patient was a thinly built , anxious looking individual and his palms were moist to touch .
his thyroid was not enlarged and there were no unusual skin findings . the blood pressure recorded both in the ward and by us averaged 150/96mmhg .
on examining his abdomen a vague , ill defined , mildly tender mass was felt in right hypochondrium and extending up to the epigastric region .
based on the symptomatology and general physical examination of this patient ; a battery of investigations were ordered for establishing the cause of the hypertension .
the ecg showed a left ventricular hypertrophy pattern and the echocardiogram revealed a concentric left ventricular hypertrophy consistent with long standing hypertension .
a 24hrs urinary metanephrines and normetanephrines study was ordered and an mri abdomen scheduled . a large mass found indenting the great vessels .
mri scan abdomen coronal view mri scan transverse section abdomen clinically correlating with the symptomatology a catecholamine producing lesion was suspected and the urinary normetanephrines-55217 nmol / l ( normal 72 - 505 ) were grossly elevated .
the urinary metanephrines 698 nmol / l ( normal 9.3 - 122 ) too were very high . to finally confirm that the mass in abdomen was indeed responsible , an meta iodo benzyl guanidine ( mibg )
the mibg scan uses meta - iodobenzylguanidine scintigraphy that has a specificity of almost 100%in localising a pheochromocytoma . as shown above
alpha receptor blockade initiated first with prazosin ( minipres ) a short acting alpha - one blocker .
the patient was given four pints of normal saline per day to prevent volume depletion and minimise the postural hypotension that usually accompanying alpha blockade .
an effective alpha blockade is signalled by > 20 mm fall in bp on upright posture .
beta blockade was then initiated with non - selective agent propranolol to control tachycardia due to catecholamines .
the patient was operated successfully by the oncosurgeon and intra operative pressure managed by the anesthesiologist .
post operatively patient was monitored closely and propranolol restarted to cater for still circulating catecholamines .
the patient made a full and complete recovery and was eventually taken off anti hypertensives on discharge .
on initial presentation the patient was a thinly built , anxious looking individual and his palms were moist to touch .
his thyroid was not enlarged and there were no unusual skin findings . the blood pressure recorded both in the ward and by us averaged 150/96mmhg .
other than that the lungs , central and peripheral nervous system examinations were normal . on examining his abdomen a vague , ill defined
, mildly tender mass was felt in right hypochondrium and extending up to the epigastric region .
based on the symptomatology and general physical examination of this patient ; a battery of investigations were ordered for establishing the cause of the hypertension .
blood sugars serum electrolytes , calcium , phosphorous etc . , all were normal . the liver , kidney parameters were also normal .
the ecg showed a left ventricular hypertrophy pattern and the echocardiogram revealed a concentric left ventricular hypertrophy consistent with long standing hypertension .
mri scan abdomen coronal view mri scan transverse section abdomen clinically correlating with the symptomatology a catecholamine producing lesion was suspected and the urinary normetanephrines-55217 nmol / l ( normal 72 - 505 ) were grossly elevated .
the urinary metanephrines 698 nmol / l ( normal 9.3 - 122 ) too were very high . to finally confirm that the mass in abdomen was indeed responsible , an meta iodo benzyl guanidine ( mibg ) scan
the mibg scan uses meta - iodobenzylguanidine scintigraphy that has a specificity of almost 100%in localising a pheochromocytoma . as shown above the tumor
alpha receptor blockade initiated first with prazosin ( minipres ) a short acting alpha - one blocker .
the patient was given four pints of normal saline per day to prevent volume depletion and minimise the postural hypotension that usually accompanying alpha blockade .
an effective alpha blockade is signalled by > 20 mm fall in bp on upright posture .
beta blockade was then initiated with non - selective agent propranolol to control tachycardia due to catecholamines .
the patient was operated successfully by the oncosurgeon and intra operative pressure managed by the anesthesiologist .
post operatively patient was monitored closely and propranolol restarted to cater for still circulating catecholamines .
the patient made a full and complete recovery and was eventually taken off anti hypertensives on discharge .
a pheochromocytoma classically has the five p 's pressure ( htn ) 90% of cases pain ( headache ) 80% paroxysms ( the sixth p ! ) of the above pain ( headache ) , perspiration , palpitations are quite important and lack of all three virtually excluded diagnosis .
all young hypertensives must be evaluated fully keeping the above facts in mind . as far as the pre - operative preparation of a pheo
is concerned ; the anesthesiologist view point was that prazosin and propranolol was better than using phenoxybenzamine as phenoxybenzamine destroys the beta receptor permanently . in case
the patient goes into shock the resuscitation becomes much more difficult if the inotropic receptors are compromised .
consent written informed consent was obtained from the patient for publication of this case report and accompanying images .
a copy of the written consent is available for review by the editor - in - chief of this journal . | pheochromocytomas or paragangliomas are neroendocrine tumors elaborating catecholamines
. they may not present always in a classic manner and a high degree of suspicion is important in diagnosing them early .
they can grow large enough to impinge on the great vessels and yet symptoms may not indicate the severity until late . a young african 32 year old male presented with occasional headaches , moderate weight loss , abdominal pain and hypertension for three years . on investigation for hypertension a large paraganglioma
was discovered wrapped around the aorta and vena cava .
he was operated successfully after preoperative preparation and was discharged normotensive.conclusion:young hypertensive should always be worked up fully including checking for abdominal masses .
the classic paroxysm was absent in this case .
after surgical removal the catecholamines elaborated by the tumor also take time to be washed out of the circulation thus the blood pressure will need careful monitoring .
conventional alpha blockage first and beta blockage later was the algorithm followed but choice of agent was also discussed with nesthethesiologist .
though classically taught phenoxy benzamine is used , in this case it was not used and a combination of prazosin and propranolol |
house - dust mites ( hdm ) ( dermatophagoides pteronissinus ) allergens are among the most potent stimuli of asthma attacks [ 1 , 2 ] .
hdm excretions contain a plethora of biologically active compounds , which have allergenic potential that prompts ige response in sensitized subjects .
the same hdm compounds also have proinflammatory properties , which are independent of the ige response . in asthma ,
neoangiogenesis of the airway wall is a recently recognized pathology , which contributes to airway wall thickness [ 35 ] .
there is also evidence from animal models that hdm and other allergens can induce neovascularization of the inflamed airway [ 6 , 7 ] .
hdm extracts have been shown to disrupt the tight junctions between epithelial cells and lead to the complete desquamation of the epithelial cell layer , hence facilitating the passage of allergens across the epithelial air - tissue border [ 810 ] .
the major hdm allergen , der p1 , is a cysteine protease [ 1113 ] and may be responsible for the observed epithelial cell desquamation , for the release of cytokines , and facilitates the transport of allergens across cultured epithelial cell layers [ 911 , 1416 ] . in consequence ,
the desquamation of the protective epithelium may allow allergenic compounds to penetrate deeper into the airway wall , thereby facilitating airway hyper - sensitization .
proteases present in hdm excrements also exerted a direct modulatory effect on regulatory proteins in cultured human bronchial smooth muscle cells ( bsmc ) that affect the cell 's ability to proliferate and to secrete cytokines .
in particular , bsmc exposed to hdm extract increased interleukin ( il)-6 production and cell proliferation through the protease - activated receptor 2 .
hence , hdm exposure contributes to inflammation and airway wall remodeling in a mechanism independent of the immune system by direct interaction with bsmc .
furthermore , proteolytic activities present in fungal and bacterial extracts have been shown to specifically and dose - dependently degrade human interleukin ( il)-6 and il-8/cxcl8 , as well as rantes , monocyte chemotactic protein ( mcp)-1 , and epithelial - derived neutrophil attractant ( ena)-78/cxcl5 , hence reducing the bioavailability of these cytokines .
together , these data imply that the exposure of the airways to external factors with intrinsic proteolytic activity affects the relative level of immuno - modulatory cytokines , which may affect inflammation and microvessel formation and airway remodeling . in the present study
, we analyzed the effect of hdm extract on the release and degradation of a panel of cytokines that have proinflammatory and angiogenic activity and are implicated in airway wall remodeling .
our data show that the proteolytic activity present in hdm extract degraded ena-78/cxcl5 and reduced the migration of neutrophils .
these findings imply that hdm allergens may have the capacity to modify the development of an eosinophil dominated inflammatory response in the lung .
bsmc were obtained from endobronchial biopsies obtained by flexible bronchoscopy or from therapeutically resected bronchial tissue obtained from the department of internal medicine and pneumology ( university hospital basel , basel , switzerland ) with the approval of the local ethical committee ( ek : 05/06 ) and written informed consent of all patients .
patients with mild to moderate asthma had reversible airway obstruction documented in the past , with a median fev1 of 70.5% of the predicted value ( ranging from 45.3% to 84.6% ) .
the samples used as nonasthmatic controls participating in this study were either from healthy organ donors whose lungs were deemed unfit for use in a transplant procedure or from the healthy part of lung resection material obtained after lung surgery .
bsmc bundles were dissected from the surrounding tissue by microscopy and pure muscle bundles were plated in a 25 cm - flask prewetted with 1 ml of dulbecco 's modified eagle 's medium ( dmem ) containing glutamax 4.5 g / l glucose ( gibco , bioconcept , allschwil , switzerland ) , 5% fcs , 1x antibiotics - antimycotics , and 1x modified eagle 's medium vitamin mix ( invitrogen , lubio , luzern , switzerland ) .
bsmc were grown in bsmc - growth medium ( gm ) : rpmi 1640 supplemented with 5% fetal calf serum ( fcs ) , 8 mm l - glutamine , 20 mm hydroxyethyl piperazine ethane sulfonic acid , 1x antibiotics - antimycotics , and 1x modified eagle 's medium vitamin mix ( invitrogen , lubio , luzern , switzerland ) under normoxic conditions ( 21% o2 , 5% co2 , and 37c ) .
bsmc were seeded and kept in bsmc - gm for 24 h before they were serum deprived for 24 h prior to stimulation . a stock solution (
1 mg / ml ) of hdm extract ( gift from : peter adler wurtzen , alk abello 's research department , hrsholm , denmark ) was prepared in rpmi 1640 medium and diluted in rpmi 1640 to the final concentration ( 20 , 10 , and 2 g / ml ) , which was then sterilized by filtration ( 0.22 mm ) ( mn sterilizer pes ; macherey - nagel ag , oensingen , switzerland ) .
10 ng / ml of colistin ( roth , arlesheim , switzerland ) was to avoid effects of lipopolysaccharids ( lps ) in hdm extract . to obtain hdm - cm ,
bsmc were incubated for 72 h ( 37c ) with hdm extract ( 2 and 10 g / ml ) or without hdm extract in the presence or absence of 5% fcs .
the human angiogenesis antibody array g 1000 ( raybiotech , lucerna - chem , luzern , switzerland ) was used to detect the release of 20 angiogenesis - related cytokines and growth factors in cm obtained from bsmc stimulated with hdm extract or unstimulated bsmc .
100 l of undiluted cm collected after 72 h was applied to each array and the angiogenesis related factors were evaluated according to the manufacturer instructions .
cy3 fluorescence was measured by a nimblegen ms 200 microarray scanner ( roche , basel , switzerland ) and signal intensity was analyzed by aida software ( raytest , straubenhardt , germany ) .
enzyme linked immunosorbent assay ( elisa ) kits for il-8/cxcl8 ( sensitivity : 7.5 pg / ml ) , ena-78/cxcl5 ( sensitivity : 15 pg / ml ) , and vegf ( sensitivity : 9 pg / ml ) were purchased from r & d ( abingdon , uk ) and elisa was performed according to the manufacturer 's instructions .
100 l of cm obtained from bsmc was measured undiluted ( vegf ) , 1 : 5 diluted ( ena-78/cxcl5 ) , or 1 : 50 diluted ( il-8/cxcl8 ) . to induce mrna , bsmc
were grown in absence and presence of hdm extract ( 20 g / ml ) for 6 h. total rna was extracted from 10 cells ( t = 0 h , and t = 6 h ) by trizol method ( gibco , bioconcept , allschwil , switzerland ) .
semiquantitative pcr ( 94c , 65c , and 72c ) was performed for 28 cycles using a thermo hybaid pcr express ( catalys , wallisellen , switzerland ) as described elsewhere .
the primers for ena-78/cxcl5 were forward : 5-atc tcc gct cct cca ccc agt-3 and reverse : 5-ttc ttg tct tcc ctg ggt-3 generating a pcr fragment of 493 bp .
the primers gapdh were forward : 5-cca aag ggt cat cat ctc tgc-3 and gapdh reverse : 5-att tgg cag gtt ttt cta-3 generating a pcr fragment of 417 bp .
polymorphonuclear cells ( pmnc ) isolation and neutrophil chemotaxis anticoagulated blood was obtained from the local blood bank ( blutspendezentrum , basel , switzerland ) after written informed consent of all donors .
pmnc were isolated using polymorphpreptm separation medium as recommended by the manufacturer ( axis - shield , axonlab , baden , switzerland ) .
chemotaxis was assessed using 96-well boyden chamber ( neuroprobe , gaithersburg , usa ) as previously described .
the lower compartments of the 96-well chamber were filled with either 100 ng / ml recombinant ena-78/cxcl5 , or 10 ng / ml recombinant ena-78/cxcl5 ( stimulated for 24 h with or without 10 g / ml hdm extract ) , or 10 g / ml hdm extract in rpmi 1640 , or rpmi 1640 alone , and then covered with a 5 m pore - sized polycarbonate filter ( neuroprobe , gaithersburg , usa ) .
next , 200 l of neutrophil suspension ( 2 10 cells / ml ) was added to the upper compartments .
after 2 h of incubation ( 37c , 5% co2 ) the upper compartment was removed and the filter was fixed and stained with differential quik staining kit ( polyscience , brunschwig , basel , switzerland ) . the membrane was scanned with a desktop scanner , and the intensity of spots was analyzed using image j software .
after densitometric image analysis ( image j software , national institute of mental health , bethesda , maryland , usa ) .
unpaired student 's t test was performed and p values < 0.05 were considered significant .
to identify proteins that are affected by the addition of hdm extract to bsmc , cm of stimulated and unstimulated bsmc was applied to an antibody array . comparing the protein expression patterns of 2 independent angiogenesis arrays , the expression of ena-78/cxcl5 was consistently reduced in cm collected from bsmc that had been stimulated with hdm extract ( figures 1(a ) and 1(b ) ) .
we then confirmed this finding with an ena-78/cxcl5 elisa in cm collected from bsmc stimulated with hdm extract for 24 and 72 h. as shown in figure 1(d ) , hdm extract ( 10 g / ml ) significantly decreased the concentration of ena-78/cxcl5 in cm of stimulated bsmc ( p < 0.05 ; n = 10 ) .
in contrast , using elisa , we observed that hdm extract ( 10 g / ml ) did not significantly alter the levels of il-8/cxcl8 or vegf protein ( figures 1(e ) and 1(f ) ) . to determine whether the hdm - dependent reduction of ena-78/cxcl5 protein levels were associated with reduced gene transcription rt - pcr
was performed using total rna extracted after 0 and 6 h from bsmc grown in the absence and presence of hdm extract ( 20 g / ml ) .
as shown in figure 2 , exposure to hdm extract did not significantly affect rna levels of ena-78/cxcl5 .
the observation that hdm extract stimulation decreased ena-78/cxcl5 protein levels while ena-78/cxcl5 mrna levels were unchanged indicated that the ena-78/cxcl5 protein may be degraded by proteolytic activities of the hdm extract .
therefore , we incubated bsmc with 5% fcs which has strong antiproteolytic activity in the presence of hdm extract ( 2 and 10 g / ml ) .
as shown in figure 1(d ) , hdm extract reduced the ena-78/cxcl5 protein level in cm collected from bsmc . in the presence of 5% fcs , this effect
was completely abrogated ( figure 3(a ) ) , suggesting a protease - dependent mechanism of ena-78/cxcl5 degradation .
next , we tested the effect of hdm extract on the basal concentration of ena-78/cxcl5 in cm from bsmc ( n = 7 ) grown in the absence of fcs for 24 and 72 h. after collection of the cm , we incubated with either hdm extract alone or a combination of hdm extract + 5% fsc . in the absence of fcs ,
we confirmed the proteolytic activity of hdm extract and the antiproteolytic effect of fcs on ena-78/cxcl5 degradation with recombinant ena-78/cxcl5 .
furthermore , we assessed the effect of the serine protease inhibitor aebsf and the cysteine protease inhibitor e64 on the degradation of recombinant ena-78/cxcl5 by hdm extract .
incubation with e64 ( 0.5 m , 5 m , and 10 m ) did not prevent ena-78/cxcl5 degradation by hdm extract in any of the used concentrations ( data not shown ) .
in contrast , the addition of aebsf led to a significant increase in ena-78/cxcl5 concentration compared to control condition ( without aebsf ) ( figure 3(c ) ) . finally , we tested the effect of hdm extract - dependent ena-78/cxcl5 degradation in regard to the chemotactic capacity of ena-78/cxcl5 .
as shown in figure 4 , ena-78/cxcl5 alone dose - dependently induced neutrophil migration compared to medium only , while hdm extract alone had no significant effect on the induction of migration when combined hdm extract reduced the neutrophil migratory effect of ena-78/cxcl5 .
in our study , we demonstrated for the first time that the cxcr2 ligand ena-78/cxcl5 was degraded upon exposure to hdm extract , whereas a second cxcr2 ligand il-8/cxcl8 was not affected .
cxcr2 ligands have been suggested to play a crucial role in inflammation and angiogenesis , in particular in directing neovascularization in tumors .
we recently showed that angiogenic cxcr2 ligands are produced by human bsmc directing sprout outgrowth from endothelial cell spheroids [ unpublished data , manuscript submitted ] .
several neutrophil attracting chemokines are present in the lung , including il-8/cxcl8 , growth related proteins ( gro / cxcl1- , , ) , and ena-78/cxcl5 [ 27 , 28 ] .
although ena-78/cxcl5 and il-8/cxcl8 share some properties , each cytokine has its own specific effects [ 2933 ] . comparing these studies , ena-78/cxcl5 seems to be more important in chronic than in acute immunological responses .
the observation that fcs completely blocked the degradation of ena-78/cxcl5 protein demonstrated that the degradation was due to the proteolytic activity present in the hdm extract and this was confirmed by the protective effect of the serine protease inhibitor aebsf . in contrast , the cysteine protease inhibitor e64 did not prevent hdm extract - dependent ena-78/cxcl5 degradation ; therefore , we conclude that one mechanism of ena-78/cxcl5 degradation is dependent on serine proteases present in hdm extract .
proteolytic activities present in hdm extracts have been extensively studied and several hdm allergens have been identified as proteases . a major effect of these proteases is the selective reduction of the bioavailability of cytokines , since not all cytokines are equally prone to proteolytic degradation .
diminished bioavailability of cytokines due to proteolytic degradation has been associated with opportunistic fungi , in particular aspergillus fumigatus , as well as with pathogenic bacteria , such as pseudomonas aeruginosa .
characteristic for both organisms is the secretion of a wide range of proteolytic enzymes intended for growth and existence .
present in the lung , these enzymes may help the microorganisms to penetrate into deeper areas of the airway wall .
in addition , their protease - activity may change the relative quantities of cytokines of the airways and skew the immune system .
proteolytic modifications of ena-78/cxcl5 protein have been shown to reduce and to enhance its biological activity .
cleavage of ena-78/cxcl5 by mmp , mmp2 , or the aminopeptidase cd13 has been shown to enhance its activity [ 35 , 36 ] , whereas proteolytic modifications caused by metalloproteases from pseudomonas aeruginosa were accompanied by the loss of chemotactic activity .
we were able to provide evidence that proteolytic modifications by hdm extract abrogate the neutrophil - attracting properties of ena-78/cxcl5 .
our data provide evidence that hdm proteases may directly affect the proinflammatory and proangiogenic cytokine response through proteolytic degradation of ena-78/cxcl5 protein . produced by epithelial cells ,
we have recently reported that not only epithelial cells but also bsmc release high levels of ena-78/cxcl8 . continuous exposure to hdm allergens may reduce the bioavailability of ena-78/cxcl5 due to proteolytic degradation and lower the number of neutrophils that infiltrate the asthmatic airway .
this may alter the immune response in favor of eosinophilic inflammation , as it is often observed in the lungs of asthmatic patients and thought of as the main histopathology of the asthmatic lung [ 3840 ] .
it should be noted , however , that asthma sometimes is associated with neutrophilia . in a sheep model of asthma ,
hdm extracts induced neutrophil infiltration at 6 h , followed by eosinophils and activated lymphocytes into the lung tissue and bal , similar to the late - phase allergic response seen in human asthma .
it is currently unknown whether or not an association exists between exposure to hdm allergens and eosinophilia .
however , selective degradation of ena-78/cxcl5 by proteases present in hdm extract might provide a partial explanation .
our experiments with the boyden chamber showed that chemotactic migration of neutrophils towards ena-78/cxcl5 is reduced in the presence of hdm extract .
the microenvironment such as the presence of serum ( e.g. , due to increased vascular leakage ) , as well as the relative presence of cytokines and chemotactic factors will ultimately determine the immunological response .
a common pathological feature of inflammatory airway diseases is an imbalance of proteases and antiproteases present in the lining fluid of the lungs .
the presence of serum - derived antiproteases may further delineate a balanced equilibrium between proteases and antiproteases , as bystander effects neutralize the protease - activity of inhaled compounds .
an external addition of foreign proteases , which may be derived from fungi , bacteria , or hdm , may distort this intricate balance and lead to irreversible impairment of airway function and disease .
taken together , our data demonstrate that the ena-78/cxcl5 protein is susceptible to degradation by proteases present in hdm extract .
although reduced bioavailability of ena-78/cxcl5 could potentially cause atypical immunological characteristics in vivo , the biological relevance of this observation remains to be established . | background . bronchial smooth muscle cells ( bsmc )
are a major source of proinflammatory and proangiogenic cytokines and chemokines , including vegf and cxc - chemokines .
cxc - chemokines act primarily on neutrophils , mediating their recruitment to and activation at the site of inflammation . in humans , house - dust mite ( hdm )
allergens can cause asthmatic exacerbations and trigger an inflammatory response through protease - dependent mechanisms .
objective .
we investigated the effect hdm extract on the release of pro - angiogenic and proinflammatory cytokines from bsmc .
methods . human primary bsmc were stimulated with hdm extract in the absence or presence of fetal calf serum ( fcs ) .
twenty angiogenic cytokines were detected by a specific antibody array and modified protein levels were confirmed by elisa .
neutrophil migration was measured using a 96-well boyden chamber .
results .
ena-78/cxcl5 protein levels in conditioned medium of bsmc stimulated with hdm extract were significantly reduced ( n = 10 , p < 0.05 ) but restored in the presence of 5% fcs .
hdm extracts did not affect ena-78/cxcl5 mrna levels .
recombinant ena-78/cxcl5 was degraded after incubation with hdm extracts ( n = 7 , p < 0.05 ) but restored after the addition of the serine protease aebsf .
neutrophil migration towards recombinant ena-78/cxcl5 was also reduced in the presence of hdm extract .
conclusion .
hdm proteases degrade ena-78/cxcl5 .
thus exposure to hdm allergens may alter ena-78/cxcl5 levels in the lungs and may affect angiogenesis and the inflammatory response in the airways of asthma patients . |
cladophora glomerata ( cg ) ktzing has been naturally grown in the north of thailand .
local people have traditionally used this alga as an ingredient in several northern thai dishes and believed that it could serve as a medicinal plant for several diseases .
previous in vivo studies have suggested that cg extract ( cge ) exhibited antigastric ulcer , anti - inflammatory , analgesic , hypotensive , and antioxidant activities in vitro and in vivo . despite the wide range of supposed remedies , empirical evidence of an efficacious effect of cge on a particular disease has not been reported .
type 2 diabetes mellitus ( t2 dm ) is a metabolic disorder that can be characterized by hyperglycaemia , insulin resistance , and/or relative insulin deficiency .
prolonged hyperglycaemia can induce mitochondrial dysfunction and results in an enhanced reactive oxygen species ( ros ) or oxidative stress production that could develop diabetic complications such as retinopathy , peripheral neuropathy , and nephropathy .
oxidative stress induced diabetic complications could also similarly be exacerbated by elevated free fatty acids that increased mitochondrial uncoupling and -oxidation , as well as depleted endogenous antioxidants by reducing intracellular glutathione [ 3 , 4 ] .
this adverse oxidative stress was implicated to be a potential factor for vascular and renal tubular damage in diabetic nephropathy by increasing the productions of sorbitol , prostanoids , transforming growth factor- ( tgf- ) , vascular endothelial growth factor ( vegf ) , and advanced glycation end - product ( age ) and also by activating common stress - signaling mediators , nuclear factor-b ( nfb ) , and protein kinase c ( pkc ) [ 46 ] . moreover ,
the molecular mechanism underlying the structural pathogenesis of diabetic nephropathy has also been proposed to be involved with several cellular events .
for instance , hyperglycaemia induced the productions of age , pkc , and nfb and then stimulated the activities of tgf- in both renal tubular and mesangial cells as well as vegf in podocytes , followed by the various extracellular matrix ( ecm ) syntheses including collagen types i and iv and fibronectin [ 5 , 6 ] .
these consequences could then trigger the phenotypic transitions of mesangial and tubular epithelial cells to glomerular and tubulointerstitial fibrosis , respectively , where these have been observed in diabetic nephropathy .
the kidney plays a crucial role in the secretion of endogenous and exogenous compounds and also their metabolites by various membrane transporters .
thus , the changes in expressions and/or functions of renal transporters could also affect their substrate concentrations and pharmacokinetics [ 8 , 9 ] . at present , the renal membrane transporters have been cloned and identified [ 8 , 9 ] , and , among these , organic anion transporters 1 ( oat1 : slc22a6 ) and 3 ( oat3 : slc22a8 ) are the highest expression on the basolateral membrane and play the primary role in organic anion clearance from blood circulation to renal tubular epithelial cells , resulting in excretion of organic anions into tubular lumen .
both oat1 and 3 recognize a broad spectrum of substrates and mediate with high - affinity transport of several organic anion compounds , including endogenous prostaglandin e2 and f2 , antiviral adefovir , nonsteroidal anti - inflammatory drugs , ochratoxin a , indoxyl sulfate , and para - aminohippurate ( pah ) , which is known to be a typical organic anion substrate for oat1 and 3 [ 8 , 11 ] .
recent studies have demonstrated that renal transporter expressions and/or functions could be influenced under certain pathological status , leading to accumulation of these therapeutic drugs or xenobiotic substrates into proximal tubular cells and obliteration of renal secretory function . for examples , the tubular cationic clearance was significantly reduced in streptozotocin- ( stz- ) induced diabetic rats , suggesting that a decrease of tubular cationic clearance was due to downregulation of basolateral organic cation transporters 1 ( oct1 ) , 2 ( oct2 ) , and/or 3 ( oct3 ) expressions . a decreased pah transport mediated by oat1 and 3 transporters
was also shown in type 1 diabetes mellitus ( t1 dm ) rats and mice , and insulin treatment was able to restore their functions [ 13 , 14 ] . moreover
, progressive chronic renal failure ( crf ) mimicked by 5/6 nephrectomy has been extensively reviewed to associate with a decrease of pah clearance and/or oat1 , 2 , and 3 expressions in rats .
more recently , kidney biopsy specimens from patients proved diabetic nephropathy have revealed a marked reduction of oat1 and 3 mrna expressions in parallel with a significant decrease of urinary organic anion metabolite , a homovanillic acid .
this indicated that renal oat1 and 3 in proximal tubules were influenced by certain pathological status and strongly correlated with the progression of diabetic kidney disease .
several studies have also demonstrated that specific protein kinases could differentially modulate oat1 and 3 transports of organic anions .
the activated pkc by angiotensin ii downregulated oat3 function , and g6976 , a specific pkc inhibitor , reversed this inhibitory effect . on the other hand ,
either insulin or egf was able to increase roat1 and 3 transports of organic anions through pkc activation , and a specific pkc inhibitor , namely , pkc pseudosubstrate ( pkc-ps ) , could blunt pkc activation and thereby reduce the effect of insulin or egf on stimulation of roat1 and 3 functions .
more recently , we have also shown that polyphenol - rich spirogyra neglecta alga extract was able to improve renal oxidative stress and maintain renal organic anion transport function mediated by oat3 in t2 dm rats . therefore , improved oat1 and/or 3 functions could delay or prevent the progression of renal diseases .
thus , this study aimed to investigate whether the cge could improve t2 dm condition and restore renal organic anion transport function , which may delay or prevent the progression of diabetic nephropathy .
the chemical constituents of cge and the mechanisms by which cge restored renal organic anion transport function in t2 dm rat model were also identified .
these findings could prove insightful for developing cge into potential nutraceutical or pharmaceutical products for diabetes .
polyclonal rabbit anti - pkc and phosphorylated pkc ( p - pkc ) were purchased from santa cruz ( ca , usa ) while monoclonal mouse anti - lamin b1 and polyclonal rabbit anti - phosphorylated pkc were purchased from cell signaling ( danvers , ma , usa ) .
monoclonal mouse anti- actin was obtained from abcam ( cambridge , ma , usa ) and monoclonal mouse anti - na - k - atpase was obtained from novus biological ( littleton , co , usa ) .
polyclonal rabbit anti - pkc was obtained from zymed ( invitrogen , carlsbad , ca , usa ) .
tritiated para - aminohippurate ( [ h]-pah ; specific activity ( sa ) 1 ci / mmol ) was obtained from perkinelmer life sciences ( boston , ma , usa ) .
streptozotocin ( stz ) and cellytic mt mammalian tissue lysis / extraction reagent were purchased from sigma aldrich ( st . louis , mo , usa ) .
insulin was obtained from biocon ( bangkok , thailand ) , and protease inhibitor was purchased from roche diagnostics ( indianapolis , in , usa ) .
phorbol 12-myristate 13-acetate ( pma ) , g6976 , and pkc pseudosubstrate ( pkc-ps ) were purchased from calbiochem ( emd millipore , ma , usa ) .
the identification of species of cladophora glomerata extract ( cge ) was confirmed and kindly provided by dr .
a voucher specimen ( number aarl g048 ) has been deposited at the herbarium of the applied algal research laboratory , department of biology , faculty of science , chiang mai university , chiang mai , thailand .
dried cge was weighed and blended thoroughly followed by boiling at 100c for 1 hr .
the extract was then filtered through filter paper number 1 ( whatman , kent , uk ) with negative pressure pump ( hicovac , kln , germany ) .
the filtrate was subsequently evaporated using lyophilizer ( gea process engineering inc . , sc , usa ) .
the cge was standardized by determination of total phenolic content using folin - ciocalteu reagent similar to that recently described in rattanapot et al . .
the chemical constituents of cge were further quantitated by high - performance liquid chromatography ( hplc ) with diode array detection and mass spectrometry ( hplc - dad / msd ) method on agilent technologies 1100 series ( waldbronn , germany ) equipped with a zorbax sb c18 column ( 4.6 mm 150 mm 5 m ) and diode array detector recording at 270 , 330 , 350 , and 370 nm .
the mobile phase was a binary solvent system consisting of acetonitrile ( solvent a ) and 10 mm ammonium formate ( ph 4 with formic acid ) ( solvent b ) , with a gradient starting at 0 : 100 ( a : b ) for 5 min and 20 : 80 for 15 min , and the composition was changed to 40 : 60 over 40 min .
nitrogen was used as nebulizing gas with a flow rate of 13 l / min at 320c .
the capillary voltages were set at 4 kv ( positive ) and 3 kv ( negative ) .
the scan time of 0.2 sec with the range of 100700 m / z was used .
the chromatographic and spectral features of the cge were quantitatively analyzed by retention time and peak area under the curve relative to standard of each identified compound .
this experiment was to first address the effective dose of cge on blood glucose levels with an oral glucose challenge .
blood samples of each group were initially collected via tail vein and designated as control base line of blood glucose .
the animals were then pretreated with either vehicle ( sterile water ) , cge dissolved in sterile water at the dose of 0.25 , 0.5 , and 1.0 g / kg bw , or metformin dissolved in sterile water ( 20 mg / kg bw ) for 30 min .
subsequently , 2.0 g / kg bw of glucose was given in each animal and blood samples were collected every 30 min for 120 min .
blood glucose levels were determined using commercial enzymatic colorimetric assay ( erba diagnostics mannheim gmbh , mannheim , germany ) .
male wistar rats each weighing 120150 g were obtained from the national laboratory animal center , mahidol university , salaya , thailand . the animal facilities and protocols
were approved by the laboratory animal care and use committee at faculty of medicine , chiang mai university , chiang mai , thailand .
all experimental rats were housed in a room maintained at 25 1c on a 12 : 12 h dark light cycle .
the animals were randomized and divided into 5 groups : normal control ( nd ) , normal supplemented with cge at the dose of 1.0 g / kg bw ( nd + cge ) , t2 dm ( dm ) , t2 dm supplemented with cge at the dose of 1.0 g / kg bw ( dm + cge ) , and t2 dm treated with antihyperglycemic drug , metformin , at the dose of 30 mg / kg bw ( dm + metformin ) modified from previous study .
for induction condition , the animals were fed with either commercially normal ( 20% calories as fat ) or high fat ( 58% calories as fat ) diets for 2 weeks .
thereafter , rats belonging to dm group were intraperitoneally injected by low - single dose of stz ( 40 mg / kg bw ) dissolved in 0.1 m citrate buffer while rats in nd group were given citrate buffer as a vehicle as previously described .
ten days after the injection , the overnight fasting blood glucose of all animals was measured from whole blood collected from tail vein by a portable glucometer ( roche diagnostics limited , in , usa ) and rats in nd group with fasting blood glucose levels less than 150 mg / dl were designated as nd .
rats belonging to dm group with fasting blood glucose levels exceeding 250 mg / dl were designated as t2 dm , while those with the glucose levels below 250 mg / dl were excluded from the study .
subsequently , normal and t2 dm rats supplemented with cge dissolved in sterile water ( 50 mg / ml ) were orally gavage fed 24 times daily ( at 9 a.m. , 12 p.m. , 3 p.m. , and 6 p.m. ) with a maximum volume of 3 ml each time for the subsequent 12 weeks . to prevent any stress to rat caused by gavage feeding ,
depending on the body weight of the rat , nonetheless , our experiment had only allowed for a maximum total volume of 11 ml for 4 times a day , as the optimal range of a single gavage feeding should not exceed 10 ml / kg as suggested by brown et al . .
in addition , rats in nd , dm , and dm + metformin ( 30 mg / kg bw ) groups which had the same body weight as cge supplemented rats were additionally dosed with sterile water daily at an equivalent volume for comparable gastric distention in all experimental animals . at the end of study ,
the animals were sacrificed ; blood and tissue samples were collected for subsequent experiments . to determine hyperglycaemia , hyperlipidemia , and insulin concentration , the quantitative total plasma glucose and triglyceride ( biotech reagent , bangkok , thailand ) were determined by commercial enzymatic colorimetric assays .
the plasma insulin concentration assay was obtained using a sandwich elisa assay kit from linco research ( millipore , ma , usa ) .
insulin resistance index was estimated using the homeostasis assessment of insulin resistance ( homa index ) that was calculated by the following formula : fasting plasma insulin ( u / ml ) fasting plasma glucose ( mmol / l)/(22.5 ) . to assess renal morphology ,
the kidneys were cut and one - half of the kidney was fixed in 10% neutral formalin buffer for 1224 h and then embedded in paraffin .
each slide was cut into 57 m thick sections and stained by hematoxylin and eosin ( h&e ) and the lesions were confirmed by periodic acid - schiff ( pas ) base , which are appropriate standard methods for renal biopsy as previously described .
the semiquantitative determination of glomerular size , mesangial matrix , and tubular lesions was assessed by a modification method from previous studies [ 24 , 25 ] .
the severity was graded to mild , moderate , and severe for focal changes with less than 25% , 2550% , and greater than 50% of lesion , respectively . to determine renal secretory process , the pah uptake mediated roat1 and 3 in renal cortical slices
rat kidneys were removed and placed in oxygenated saline buffer , and renal cortical slices ( 0.5 mm ; 515 mg , wet weight ) were cut with a stadie - riggs microtome and maintained in ice - cold oxygenated modified cross and taggart buffer containing ( mm ) 95 nacl , 80 mannitol , 5 kcl , 0.74 cacl2 , and 9.5 na2hpo4 ( ph 7.4 ) .
the renal slices were incubated in 0.25 ml of modified cross and taggart buffer containing 5 m [ h]-pah for 30 min at room temperature .
for upregulation of roat1 and 3 function by insulin stimulation , the slices were preincubated in 0.5 ml of buffer in the absence or presence of 30 g / ml insulin or other tested compounds ( see figure legends in detail ) for 30 min and then incubated in 0.25 ml of buffer containing 5 m [ h]-pah for 30 min at rt .
the uptake was stopped by the addition of 1 ml of ice - cold buffer .
slices were then washed , blotted , weighed , dissolved in 0.5 ml of 1 n naoh , and neutralized with 0.5 ml of 1 n hcl .
scintillation fluid of 9 ml was added and the radioactivity was measured using a liquid scintillation analyzer ( perkinelmer life sciences , ma , usa ) .
the uptake of [ h]-pah was calculated as tissue to medium ( t / m ) ratio , that is , ( dpm / g tissue)/(dpm ml medium ) . total rna was purified from freshly isolated rat renal cortical tissues using total rna extraction kit ( amresco , oh , usa ) , according to the manufacturer 's instruction .
the first strand cdna was obtained using iscript cdna synthesis kit ( bio - rad , ca , usa ) and qpcr was performed using sybr real - time pcr master mix ( toyobo , osaka , japan ) on abi 7500 ( life technologies , ny , usa ) .
primers were designed according to published sequences ( table 1 ) and were purchased from biobasic inc .
gene expressions were normalized to actin mrna levels and reported as relative fold changes ( rfc ) .
to determine target protein expressions in each cellular compartment , subcellular fractions were extracted from renal cortical tissues using differential centrifugation as previously described . in brief ,
renal cortical tissues were cut and suspended in cellytic mt mammalian tissue lysis / extraction reagent ( sigma aldrich , mo , usa ) containing 1% complete protease inhibitor cocktail ( roche applied science , in , usa ) .
the samples were subsequently centrifuged at 5,000 g for 10 min at 4c .
the supernatant was specified as whole cell lysate and the pellet was re - suspended in the same buffer and centrifuged at 10,000 g for 10 min at 4c .
whole cell lysate fraction was subsequently centrifuged at 100,000 g for 2 h at 4c and supernatant from the spin was specified as the cytosolic fraction .
the crude membrane pellets were resuspended in the same solution and specified as membrane - rich fraction .
the total protein concentration of each sample was measured using commercial bradford 's assay ( bio - rad , ca , usa ) and stored at 80c prior to use in subsequent experiments . for western blotting ,
the protein samples ( 50 g / lane for membrane and cytosolic samples and 100 g / lane for whole cell lysate and nuclei samples ) were resolved in 2x laemmli solution and separated on 10% sodium dodecyl sulfate polyacrylamide gel .
the proteins were subsequently transferred onto polyvinylidene difluoride membrane ( ge healthcare , wi , usa ) using bio - rad system ( ca , usa ) .
nonspecific bindings on the membrane were then eliminated by blocking with 5% nonfat dry milk in 0.05% tween 20 in tris - buffered saline ( tbs - t ) for 1 h at 4c and subsequently incubated overnight with desired specific primary antibody against pkc , p - pkc , pkc , and p - pkc ( see figure captions ) . to confirm the enrichment of the fraction , anti - na - k - atpase and anti - lamin b1 antibodies were also applied for presenting membrane and nuclei fractions , respectively .
the membranes were washed with tbs - t and incubated with goat - anti mouse or rabbit igg horseradish peroxidase - conjugated secondary antibody ( santa cruz , ca , usa ) for 1 h at 4c . the target proteins were then detected by enhanced chemiluminescent kit ( ge healthcare , buckinghamshire , uk ) and quantitatively analyzed by image j program from research services branch ( rsb ) of the national institute of mental health ( nimh , md , usa ) .
statistical differences were assessed using one - way analysis of variance followed by tukey - kramer test .
insulin stimulation experiment was analyzed using unpaired , two - tailed student 's t - test .
statistical analyses were conducted using statistical package for the social sciences ( spss ) version 11.5 ( spss inc .
to determine whether cge has a potential antidiabetic effect , oral glucose tolerance test was addressed in normal rats . as shown in figure 1 ,
blood glucose level in control group was significantly increased at 30 and 60 min and tended to return to normal level at 120 min after 2 g / kg bw of glucose loading similarly to that of the animals from pretreatment with cge at the doses of 0.25 and 0.5 g / kg bw .
however , blood glucose levels of the rats pretreated with cge at a dose of 1.0 g / kg bw or 20 mg / kg bw of metformin did not change at any time after glucose loading , indicating that cge at 1.0 g / kg bw was able to reduce blood glucose level similarly to that of metformin , an antihyperglycemic drug .
therefore , cge at the highest dose ( 1.0 g / kg bw ) was applied to the subsequent experiments .
the general characteristics of t2 dm rats and the effect of cge on t2 dm characteristics were determined . as shown in table 2 ,
the body weight ( bw ) and kidney weight per body weight ratio ( kw / bw ) were not different among experimental groups .
the levels of fasting plasma glucose and triglyceride had significantly increased in t2 dm rats compared to that of control .
in contrast , these plasma parameters were markedly reduced in dm + cge and dm + metformin compared to that of t2 dm rats .
although there was no significant difference in plasma insulin among experimental groups , the homa index that indicates insulin resistance had significantly increased in t2 dm rats compared to that of control .
these homa indices were significantly decreased by cge or metformin treatment relative to that of t2 dm .
this result suggested that cge was able to reduce blood glucose and triglycerides and restore insulin resistance after diabetic condition .
moreover , plasma parameters were not altered in nd + cge compared to that of control , indicating that cge at the dose of 1.0 g / kg bw / day did not alter plasma glucose and lipid profiles in normal rats . to evaluate the effect of cge on renal structural changes in t2 dm rat model , renal morphological analysis
was semiquantitatively assessed using standard methods for renal biopsy , hematoxylin and eosin ( h&e ; figure 2 ) , and periodic acid - schiff ( pas ; figure 3 ) base stains . as shown in figure 2(a ) , normal diet fed rats ( nd ) had normal renal structures including glomerulus , bowman 's capsule space , and proximal convoluted tubules similar to that of nd + cge rat kidneys ( figure 2(b ) ) . on the other hand ,
t2 dm rat kidney markedly exhibited the diffused white blood cell infiltration in the interstitial space and a glomerular hypertrophic formation with a narrowing of bowman 's capsule space ( figure 2(c ) , black arrow ) .
in addition , the interstitial space was densely infiltrated with lymphocytes and blood cells , and mild arteriolar hypertrophy was observed .
the similar pattern of infiltration was also seen in the tubulointerstital area ( figure 2(c ) , asterisk ) .
the histological changes of dm + metformin appeared to have recovered since they closely matched normal control , as seen by a decrease of glomerular capillaries and tubular hypertrophy .
nevertheless , there was a mild infiltration of red blood cells and lymphocytes in the tubulointerstitium .
in addition , bowman 's capsule space and tubular lumen of dm + metformin were wider than t2 dm alone ( figure 2(d ) versus figure 2(c ) ) .
in contrast , the glomeruli and tubular cells of dm + cge showed progressively reduced infiltration and mild arteriolar changes ( figures 2(e ) and 2(f ) ) .
compared to t2 dm , the glomeruli structures in dm + cge were recovered , as evidenced by the presence of bowman 's capsule and tubular luminal spaces similarly to that of dm + metformin .
therefore , this result indicated that cge improved in both glomerular infiltration and tubular hypertrophy in renal tissues similarly to that of metformin treatment . in the pas staining
, t2 dm rat kidneys demonstrated the moderate lesion of mesangium , glomerular basement membrane thickening , and a narrow renal tubular lumen ( figure 3(c ) ) compared to that of nd and nd + cge ( figures 3(a ) and 3(b ) ) .
moreover , bowman 's capsule of t2 dm rat kidneys was intensively stained , implying that basement membranes were thickening and the production of extracellular matrix was increased in t2 dm . in contrast , the kidney morphology of dm + cge was very similarly to that of control ( nd ; figure 3(a ) ) , including the reduction in the extent of the glomerular hypertrophy and mesangial expansion ( figure 3(d ) ) . as a result ,
the tubular lumen and bowman 's capsule spaces were seen ( figure 3(d ) , arrow p and b ) .
similar to dm + cge , renal tissues of dm + metformin displayed the improvement of mesangial and tubular hypertrophy .
hence , this study clearly demonstrated that t2 dm rats supplemented with cge at the dose of 1.0 g / kg bw manifested reduced adverse morphological changes , and there was no deleterious effect in kidneys in normal animals dosed with cge ( nd + cge ) .
as mentioned earlier , renal oat1 and 3 were influenced by certain pathological status and strongly correlated with the progression of diabetic kidney diseases and para - aminohippurate ( pah ) is a prototypical substrate for roat1 and 3 transporters that are mainly localized on the basolateral membrane of renal proximal tubules [ 8 , 9 , 11 ] .
we subsequently investigate the impact of t2 dm on renal organic anion transport function using renal cortical slices .
thus , we conducted functional transport assay using [ h]-pah uptake into renal cortical slices .
as shown in figure 4(a ) , pah uptake in renal cortical slices was not different among experimental groups .
this result indicated that t2 dm status and t2 dm supplemented with cge in rats had no effect on basal renal organic anion transport function mediated by roat1 and 3 . since the basal physiological roat1 and 3 functions did not change by t2 dm status and cge supplementation , we further addressed whether cge had any effects on the regulatory proteins for roat1 and 3 functions .
a study by barros et al . had shown that roat1 and 3 functions were upregulated after insulin preincubation .
we , therefore , determined the regulatory function of roat1 and 3 using [ h]-pah uptake in rat renal cortical slices in the presence or absence of 30 g / ml of insulin preincubation . as shown in figure 4(b ) , the slices from nd rats that were preincubated with the insulin had almost two - fold significant increase in [ h]-pah transport compared to that of slices without insulin , indicating that upregulated roat1 and 3 functions by insulin were reproducible similar to that of the previous study . on the other hand , the effect of insulin on [ h]-pah uptake was blunted in renal slices of t2 dm rats , suggesting that t2 dm rat kidneys had significantly impaired insulin - stimulated roat1 and 3 functions .
interestingly , the effect of insulin stimulation on the increase of pah transport remained present in the renal slices from nd + cge , dm + cge and dm + metformin similarly to the slices from control , implying that 1 g / kg bw of cge was able to improve regulatory function of roat1 and 3 similarly to that of metformin treatment in t2 dm rats . to further clarify the mechanism by which cge improved upregulation of roat1 and 3 functions , we investigated whether gene transcripts for these transporters were modulated by cge under diabetic condition , leading to a restoration of roat1 and 3 functions .
genes encoding for roat1 and 3 mrna were subsequently determined . as shown in figure 4(c ) , roat1 and 3 mrna expressions were not different among experimental groups .
therefore , this result indicated that the restoration of regulatory mechanism of roat1 and 3 after cge supplementation in t2 dm rats was not the result of changes of roat1 and 3 gene expressions but involves other mechanisms .
activation of classical pkcs isoforms has previously shown to be a predominant signaling mediator in progressive development of diabetic nephropathy [ 4 , 5 ] .
in addition , roat3 function was downregulated by pkc activation , and its function was reversed by g6976 , a specific pkc inhibitor .
thus , we then identified whether cge improved roat1 and 3 functions through specific pkc expression and function .
subcellular fractions extracted from renal cortical tissues and western blotting analysis were subsequently carried out .
the detection of pkc and p - pkc proteins was analyzed by densitometry and the amount of each target protein in each sample was normalized by the amount of -actin present in each respective fraction .
as shown in figures 5(a ) and 5(b ) , nak - atpase , a basolateral membrane marker , was detected only in membrane fraction of each experimental group . despite that , total pkc expressions were not significantly different in whole cell lysate , membrane , and cytosolic fractions among experimental groups ( figure 5(a ) ) .
in contrast to total pkc , activated pkc ( p - pkc ) were markedly increased in both whole cell and membrane fractions in t2 dm rat kidneys while it was significantly reduced in cytosolic fraction , indicating that t2 dm status resulted in the activation and translocation of pkc to the plasma membrane ( figure 5(b ) ) .
interestingly , p - pkc were significantly reduced in both whole cell and membrane fractions in dm + cge and dm + metformin rat kidneys relative to that of t2 dm , suggesting that cge and metformin partially prevented pkc activation and translocation to the membrane under t2 dm condition ( figure 5(b ) ) .
moreover , there was no significant difference of p - pkc in any fraction of nd + cge rat kidneys compared to that of nd , indicating that cge did not alter intracellular pkc protein expression and activation under normal condition .
our previous data demonstrated that cge prevented pkc activation and membrane translocation under t2 dm status , which resulted in partially restored insulin - stimulated pah transport mediated by roat1 and 3 ( figure 5 ) .
we also addressed whether cge improved roat1 and 3 regulatory functions by directly modulating their stimulatory proteins , pkc , using western blotting analysis .
the detection of pkc and p - pkc proteins was analyzed by densitometry and the amount of each target protein in each sample was normalized by the amount of -actin present in each respective fraction as shown in figure 6 .
consistently , nak - atpase was detected only in membrane samples of each experimental group , and total pkc was not significantly different in any fraction of experimental groups ( figure 6(a ) ) .
however , activated pkc ( p - pkc ) in whole cell lysate , membrane , and cytosolic fractions were significantly increased in t2 dm relative to control , suggesting that diabetic condition partially influenced pkc activity ( figure 6(b ) ) .
in addition , p - pkc also significantly increased in whole cells and membrane fractions in both nd + cge and dm + cge rat kidneys compared to that of nd , which strongly indicated that , besides diabetic status , cge supplementation also induced pkc activation and its membrane translocation while the direct effect of metformin on p - pkc expression was not observed .
interestingly , the significant increase of p - pkc in membrane fraction of dm + cge was higher than t2 dm , suggesting that not only was there diabetic status , but cge also exerted pkc activity , too .
nonetheless , a decrease of p - pkc in cytosolic fraction of dm + cge was only seen relative to t2 dm .
this data suggested that cge stimulated pkc and subsequently induced membrane translocation of p - pkc , resulting in restoration of roa1 and 3 regulatory functions under the t2 dm status ( figure 6(b ) ) . according to the above findings
, previous study indicated that angiotensin ii activated specific pkc , leading to downregulation of oat3 function , but g6976 , the pkc inhibitor , specifically reversed its effect .
in addition , insulin stimulated pkc , resulting in upregulated oat1 and 3 functions , and a pkc inhibitor , pkc-ps , significantly reverted insulin 's effect .
therefore , we further clarified if cge could act directly through both pkc and pkc activities mediated roat1 and 3 signaling pathway using renal slices from nd and nd + cge rats .
preincubation of pma , a classical pkc activator , inhibited pah transport mediated by roat1 and 3 in the slices from nd , whereas g6976 restored this inhibitory effect ( figure 7(a ) ) .
interestingly , the slices from nd + cge displayed no difference in pah uptake after pma preincubation in any condition , suggesting that cge directly prevented the activation of pkc activity , resulting in maintaining the functional transport of pah mediated by roat1 and 3 .
unlike pkc activity , preincubation of insulin significantly stimulated pah uptake in nd rat renal slices while pkc-ps inhibited the insulin effect ( figure 7(b ) ) .
again , the slices from nd + cge showed an insulin - activated pkc activity and an increase in pah uptake .
pkc-ps was also able to inhibit pah uptake after insulin stimulation similarly to that of the slices from nd ( figure 7(b ) ) .
hence , this result strongly indicated that cge directly enhanced pkc activity , leading to continuation of the insulin - stimulated roat1 and 3 functions .
the data showed that the total phenolic content was 8.36 0.13 mg gallic acid equivalent / g of extract .
in addition , the major chemical constituents of cge were also quantitated by hplc - dad / msd ( figure 8) .
several phenolic contents including catechin , tannic acid , hydroquinin , quercetin , rutin , gallic acid , and kaempferol were found at the amount of 2.2 , 1.3 , 1.1 , 1.0 , 0.63 , 0.58 , and 0.14 g / kg of extract compared to that of each respective standard . among these , isoquercetin ( 7.9 g / kg of extract ) was shown to be the highest constituent compared to that of respective standards .
cladophora glomerata ( cg ) ktzing has been widely grown in nan river , north of thailand .
this alga contains high amount of carbohydrate , fat , proteins , multivitamins , and minerals .
a recent study has demonstrated that the aqueous extract of cg ( cge ) contains phenolic contents that exhibited antigastric ulcer , analgesic , hypotensive , anti - inflammatory , and antioxidant activities both in vivo and in vitro , suggesting that cge has potential to be developed as nutraceutical products . moreover ,
neither a high dose ( 25 g / kg bw ) nor subchronic ( up to 1 g / kg bw for 60 days ) administration of cge showed toxicity in any organs in rats . yet
, the therapeutic effects of cge on a particular disease have not been reported previously . to address the potential use of cge , this study investigated the pharmacological effects of cge under diabetes status and clearly demonstrated that cge has antihyperglycaemia , antihypertriglyceridemia , anti - insulin resistance , and renoprotective effects in an experimental model of type 2 diabetes in rats .
as summarized in table 2 , the significant increase in the levels of fasting plasma glucose , triglyceride , and homa index found in our experimental t2 dm rat model was similar to those observed in human .
in addition , the crude cge at the dose of 1 g / kg bw had antidiabetic activities similar to treatment by an antihyperglycemic drug , metformin .
nevertheless , further studies on its purified potential constituents are required for future development of cge into a pharmaceutical or nutraceutical product for diabetes . similarly to cge , spirogyra neglecta ktzing extract , one of the macroalgae , had recently shown antihyperglycaemia , antihyperlipidemia , and improved insulin resistance in t2 dm rats [ 18 , 27 ] . moreover , aloe vera leaves extract has also demonstrated hypoglycemic effect in both t1 dm and t2 dm rats , and the quercetin - rich onion peel extract had shown to improve hyperglycaemia and insulin sensitivity by upregulation of insulin receptor and glucose transporter 4 mrna expressions .
hence , the precise mechanism by which cge ameliorated hyperglycaemia and hypertriglyceridemia and restored the whole body insulin sensitivity in t2 dm requires further investigation .
diabetic nephropathy is a major cause of end - stage renal disease , and its progression can not always be completely accurately predicted by clinical parameters , especially in early stages [ 24 , 25 ] .
renal pathological classifications and diagnoses , as performed in this study , allowed us to predict the changes in renal morphology in our t2 dm rat model . as shown in pas staining
, the thickening of glomerular and tubular basement membrane of t2 dm rat kidneys indicated the impairment in
in addition , the presence of mesangial expansion in t2 dm rat kidney might also influence membrane permeability , which then resulted in a migration of white blood cells from capillary endothelium to tubular interstitial as previously shown [ 24 , 25 ] . taking these into account
, we have shown that cge was able to completely reverse the progressive loss of glomerular and tubular permeability and functions . similarly to cge , traditional chinese medicine xiao - chai - hu - tang was found to restore mesangial expansion , basement membrane thickening , glomerular hypertrophy , and tubular damage in t1 dm rats while quinapril , the angiotensin - converting enzyme inhibitor , was also able to restore defective glomerular albumin permeability in experimental diabetic nephropathy rats .
the modulations of membrane protein expressions and activities have been extensively shown in several pathological conditions .
for example , decreases of nak - atpase and glucose transporter in liver , brain , and heart tissues were observed , whereas the expressions of these two transporters were increased in the kidneys in experimental t1 dm rats .
moreover , oxonic and uric acids induced hyperuricemia in rats had shown a decrease in renal basolateral pah uptake , corresponding to the reduction of roat1 and 3 mrna and protein expressions .
furthermore , a recent study showed the reduction of oat1 expression with a decrease of renal organic anion secretion in crf in rats which altered renal organic anion drug clearances and might exert the accumulation of uremic toxins as seen in crf in human .
likewise , our recent study indicated that expression of moat3 , but not moat1 , was decreased in parallel with its function in t1 dm models , and insulin treatment was able to improve their functions .
in addition , previous study suggested that oat1 and 3 play important role in renal tubular uptake of the retention of waste products , the uremic toxins , for example , indoxyl sulfate , hippurate , indoleacetate , and 3-carboxy-4-methyl-5-propyl-2-furanpropionate , and aggravated tubular damage in renal failure .
hence , the certain levels of oat1 and 3 expressions and transport activities are required under the progression of renal diseases .
more recently , patients with kidney biopsy - proven diabetic nephropathy have demonstrated a 50% downregulation of proximal tubular oat1 and 3 mrna expressions . using metabolomics analysis , this evidence correlated with
a decrease in urinary organic anion metabolite makers seen in patients with diabetic kidney disease including homovallinic acid and 4-oh hippurate , supporting that the transport function of oat1 and 3 was the rate - limiting step and has contributed to the urine metabolomics that could serve as novel biomarkers for diabetes with chronic kidney disease .
although there was no difference in the basal uptake of pah mediated by roat1 and 3 in renal cortical slices from t2 dm rats in our study , we have shown that insulin - stimulated pah transport was blunted and might possibly alter other organic anion clearances , and cge was able to restore insulin effect on pah transport to levels of normal rat kidneys , implicating that cge could certainly preserve anionic secretory process in t2 dm condition ( figure 4 ) .
indeed , we have primarily shown that neither renal roat1 nor roat3 mrna levels were directly altered by either t2 dm or cge .
hence , modulation of roat1 and 3 activities through intracellular signaling proteins could be the potential mechanism for cge - improved organic anion transport in t2 dm condition .
several molecular mechanisms involving hyperglycaemia - induced diabetic nephropathy have been proposed [ 5 , 36 ] .
for instance , hyperglycaemia - induced reactive oxygen species production resulted in activation of pkc and nfb which , in turn , induced proinflammatory cytokines , tnf and il1 [ 5 , 36 , 37 ] .
in addition , the activation of specific pkc , , and isoforms contributed in diabetic nephropathy rats [ 3840 ] while a high glucose - stimulated pkc was linked with nfb activation in rat glomerular mesangial cultured cells . compared to t2 dm , our data demonstrated that cge prevented pkc and induced pkc activations and translocation to the plasma membrane of renal epithelial cells ( figures 5 and 6 ) .
certainly , this data can not preclude the initial biological effects of cge , the antihyperglycaemia , antihypertriglyceridemia , and anti - insulin resistance , which exerted the subsequent inhibitory and stimulatory effects on pkcs in t2 dm rat kidneys .
since pkc comprises of several isoforms and plays a crucial role in several cellular events , their contribution in organic anion transporter functions has been also specified .
a previous study also found that oat3 was downregulated through the activation of specific pkc , and g6976 , a specific pkc inhibitor , reversed this consequence .
in addition , recent study indicated that roat1 and 3 were upregulated by insulin - activated pkc isoform , and insulin effect was blunted by pkc-ps .
we then addressed the possibility of whether the improved regulatory functions of roat1 and 3 by cge were directly associated with the activation of either pkc , , or both isoforms without influence of t2 dm condition .
consistently , the present data strongly demonstrated that cge directly inhibits pkc and stimulates pkc , resulting in restoration of insulin - stimulated roat1 and 3 functions in renal cortical slices similarly to normal rat kidneys ( figure 7 ) .
thus , cge might also delay or prevent progressive renal structural and functional changes by pkc activities in t2 dm rats .
however , a thorough understanding of the molecular consequences of cge actions on renal organic anion transport function in t2 dm should be further investigated . in this study ,
the major phenolic contents included catechin , tannic acid , hydroquinin , quercetin , rutin , gallic acid , kaempferol , and particularly isoquercetin and were identified in cge .
thus , these constituents might exert or play role as antidiabetic and renoprotective effects in t2 dm rats through regulation of pkcs .
likewise , quercetin - rich onion peel extract exhibited antihyperglycaemia and antihyperlipidemia in t2 dm rats while isoquercetin demonstrated antidiabetic effect in noninsulin - dependent diabetic or diabetic kk - a mice .
indeed , polyphenol - rich extracts from solanum nigrum inhibited hepg2 cell migration by reducing pkc expression and activation , and isoquercetin has shown to inhibit liver cancer cell proliferation via direct downregulation of pkc mrna and protein expressions . in conclusion
, the present study demonstrated that cge has antidiabetic and renoprotective effects in t2 dm by restoration of pathogenic consequences , including antihyperglycaemia , antihypertriglyceridemia , anti - insulin resistance , and restoration of insulin stimulated renal roat1 and 3 functions .
the mechanisms by which cge - enriched polyphenols improved insulin - stimulated roat1 and 3 functions were initially associated with antidiabetic effects and directly linked with the inhibition of pkc and stimulation of pkc , which are responsible for roat1 and 3 functions . while promising , further data is needed for development of cge into either a nutraceutical or pharmaceutical product for the prevention of diabetic nephropathy . | cladophora glomerata extract ( cge ) has been shown to exhibit antigastric ulcer , anti - inflammatory , analgesic , hypotensive , and antioxidant activities .
the present study investigated antidiabetic and renoprotective effects of cge in type 2 diabetes mellitus ( t2 dm ) rats .
the rats were induced by high - fat diet and streptozotocin and supplemented daily with 1 g / kg bw of cge for 12 weeks .
the renal transport function was assessed by the uptake of para - aminohippurate mediated organic anion transporters 1 ( oat1 ) and 3 ( oat3 ) , using renal cortical slices .
these two transporters were known to be upregulated by insulin and pkc while they were downregulated by pkc activation . compared to t2 dm , cge supplemented rats had significantly improved hyperglycaemia , hypertriglyceridemia , insulin resistance , and renal morphology .
the baseline uptake of para - aminohippurate was not different among experimental groups and was correlated with oat1 and 3 mrna expressions .
nevertheless , while insulin - stimulated oat1 and 3 functions in renal slices were blunted in t2 dm rats , they were improved by cge supplementation .
the mechanism of cge - restored insulin - stimulated oat1 and 3 functions was clearly shown to be associated with upregulated pkc and downregulated pkc expressions and activations .
these findings indicate that cge has antidiabetic effect and suggest it may prevent diabetic nephropathy through pkcs in a t2 dm rat model . |
schwartz ( 1952 ) coined the term atrophia idiopathica mucosa oris to describe an oral fibrosing disease . in 1953 , joshi subsequently termed the condition oral submucous fibrosis ( osf ) .
osf is an insidious chronic disease affecting any part of the oral cavity and may extend to pharynx and esophagus , and may be preceded or associated with vesicle formation .
it is always associated with juxtaepithelial inflammatory reaction followed by fibro - elastic change of the lamina propria with epithelial atrophy leading to stiffness of the oral mucosa and causing trismus .
this is a disease of unknown cause that occurs mainly in the indian subcontinent and is associated with a genetic predisposition and alteration , infection and viral agents , carcinogens , nutrition , and immunological factors .
it is most commonly related to the habit of chewing areca nut ( areca catechu ) .
consumption of chillies , deficiency of iron and vitamin b - complex , smoking , alcohol and tobacco play a synergistic role in the initiation of disease .
the stiffness of the oral mucosa in such patients leads to limited mouth opening . for such patients ,
a prosthodontist encounters certain problems during treatment such as : difficulty in insertion of full - size stock trays , trauma to peri - oral tissue due to lack of flexibility of oral tissue , and improper tissue manipulation due to fibrous bands . during impression making ,
the loaded tray requires wide mouth opening for proper tray insertion , alignment , and retrieval .
maximum wide opening is required for retrieval of set impression if the patient has a high palatal vault . as this is not possible in patients with restricted opening ability ,
this article describes an innovative dual impression technique for partially edentulous patients requiring removable dental prosthesis with limited oral opening and a high palatal vault .
preliminary impression of palate [ figure 1 ] is made with impression compound ( dpi pinnacle , the bombay burmah trading corporation , mumbai , india ) by adapting the kneaded material with fingers and supporting the same till it hardens and poured with dental plaster [ figure 2 ]
custom tray ( rapid repair powder ; dentsply india , gurgaon , india ) with a wax spacer and tissue stops will be fabricated on this plaster cast . on external surface of the tray , four metal balls palatal to one on each canine region and one on each molar region were embedded so that 1/4 of the metal ball will be inside the tray with 3/4 of the ball remaining outside [ figure 3 ] .
this will help to orient the putty impressionwith custom tray in place , silicon putty ( aquasil , soft putty / regular set , dentsply de trey , germany ) was mixed and adapted to the dentulous as well as to the edentulous part that engages the metal balls along with slopes of acrylic tray adapted to the palatethis completes preliminary impression that can be disassembled intraorally for the ease of removal of impression from the mouth [ figure 4 ] and can be reassembled [ figure 5 ] .
scrape the silicon putty impression in dentulous and edentulous areas so as to provide space for light body wash impressionmake final impression of palate with zinc oxide eugenol impression paste ( dpi impression paste , the bombay burmah trading corporation , mumbai , india ) in a custom tray after removing the wax spacer .
after palatal impression is set , the silicon putty impression will be loaded with light body wash impression to make an impression of dentulous area .
metal balls on the palatal surface of custom tray help to orient the impression accuratelywhen set , this final impression can be disassembled intraorally and removed in two parts [ figure 6 ] .
one part contains the putty impression that recorded dentulous , edentulous area , and part of the external surface of the special tray with metal balls .
other part involves the impression of palate onlythis disassembled impression will be assembled extraorally to obtain a single piece full arch impression [ figure 7 ] .
preliminary impression of palate [ figure 1 ] is made with impression compound ( dpi pinnacle , the bombay burmah trading corporation , mumbai , india ) by adapting the kneaded material with fingers and supporting the same till it hardens and poured with dental plaster [ figure 2 ]
custom tray ( rapid repair powder ; dentsply india , gurgaon , india ) with a wax spacer and tissue stops will be fabricated on this plaster cast . on external surface of the tray ,
four metal balls palatal to one on each canine region and one on each molar region were embedded so that 1/4 of the metal ball will be inside the tray with 3/4 of the ball remaining outside [ figure 3 ] .
this will help to orient the putty impression with custom tray in place , silicon putty ( aquasil , soft putty / regular set , dentsply de trey , germany ) was mixed and adapted to the dentulous as well as to the edentulous part that engages the metal balls along with slopes of acrylic tray adapted to the palate this completes preliminary impression that can be disassembled intraorally for the ease of removal of impression from the mouth [ figure 4 ] and can be reassembled [ figure 5 ] .
scrape the silicon putty impression in dentulous and edentulous areas so as to provide space for light body wash impression make final impression of palate with zinc oxide eugenol impression paste ( dpi impression paste , the bombay burmah trading corporation , mumbai , india ) in a custom tray after removing the wax spacer .
after palatal impression is set , the silicon putty impression will be loaded with light body wash impression to make an impression of dentulous area .
metal balls on the palatal surface of custom tray help to orient the impression accurately when set , this final impression can be disassembled intraorally and removed in two parts [ figure 6 ] .
one part contains the putty impression that recorded dentulous , edentulous area , and part of the external surface of the special tray with metal balls .
other part involves the impression of palate only this disassembled impression will be assembled extraorally to obtain a single piece full arch impression [ figure 7 ] .
impression of palate with impression compound preliminary cast of palate for fabricating custom tray custom tray with metallic balls on palatal cast disassembled preliminary impression reassembled preliminary impression extraorally disassembled final impressions reassembled final impressions extraorally to obtain a single piece full arch impression
the rehabilitation of a patient suffering from limited mouth opening with high palatal vault is challenging to a prosthodontist because of the patient 's clinical condition and difficulties encountered in impression making .
literature describes a number of sectional impression techniques using split custom made impression tray for both primary and secondary impression .
various pins , bolts , and lego pieces have been used for the locking mechanism of sectional impression trays fabricated for patients with limited oral opening .
the technique described here is simplified and cost - effective as compared to leubkes method by utilizing lego plastic building block for joining the two halves .
this technique does not require the modification of sectional trays as previously done by leukbe , cura , and many more .
silicon putty is adapted to the dentulous area by fingers as the mouth opening was very minimal and was stabilized till it sets . wash with light body on this putty impression would enhance dimensional stability and captures minute details .
impression compound and silicon putty are easily moldable , sufficiently hard , stable to support during the time of impression .
metal balls used on the custom tray of the palate help disassembled impression to assemble accurately intraorally as well as extraorally . furthermore
, this technique does not require tray manipulation and impression making is simpler as compared to the al - hadi technique in which three sections of trays were made for preliminary impression and final impression . with this proposed technique ,
the buccal mucosa is not traumatized , and the patient will be comfortable during impression making and at the time of retrieval from the mouth .
the technique uses the versatility of different impression materials ( trayless technique ) instead of taking sectional trays for making preliminary impression in patients with limited mouth opening .
principles of engineering assemble , disassemble , and reassemble has been innovatively utilized for making impression that can be assembled , disassembled intraorally , and reassembled extra orally to obtain a single piece accurate cast . | atrophia idiopathica mucosa oris is an oral fibrosing disease resulting in marked rigidity and an eventual inability to open the mouth or had limited mouth opening .
patients with limited mouth opening are a common occurrence in prosthodontic practice .
the majority of these patients can be treated with exercise and stretching movements before impressions are made .
some will not respond to these procedures because of facial scarring and surgical manipulation of the facial muscles .
this article presents an impression procedure for overcoming difficulties encountered in such reduced mouth opening patients that can be assembled intraorally , disassembled intraorally , and reassembled extraorally . |
exposure to asbestos fibers increases the risk of disease and death for different causes , but its impact on health is not properly reflected in statistics on occupational disease and must be quantified in specific studies .
there have been some local studies of this type1 and in relation to specific diseases in spain2 , 3 , but none in which all asbestos - related diseases ( ards ) were considered .
exposure to asbestos has specific pathological effects , including asbestosis , the formation of pleural plaques on the parietal pleura with or without calcification , visceral pleura thickening ; benign pleural effusion , and malignant mesothelioma ( involving pleura , peritoneum , pericardium , and tunica vaginalis of the testes)4 .
exposure can also increase the risk of other cancers , notably lung cancer5 . in 2012 ,
the international agency for research on cancer added the larynx and ovaries as two further cancer sites related to asbestos exposure6 .
in addition , positive associations have been observed between exposure to all forms of asbestos and cancer of the pharynx , stomach , and colorectum6 .
the who has estimated that more than 107,000 people die annually from asbestos - related mesothelioma , lung cancer and asbestosis7 . in spain
, 2,514,346 tons of asbestos were imported between 1906 and 2001 , the year in which the utilization , production , and sale of asbestos fibers and associated products were prohibited8 . a large proportion of the imported asbestos
was used in buildings , pipes , and roofs constructed between the 1960s and 1990s ; hence , the mortality and morbidity burden due to asbestos exposure will continue to rise over the next few years , given the usually long latency period before the appearance of these diseases ( e.g. , up to 4050 years for mesothelioma)9 .
an account was recently published of the asbestos - related occupational diseases recognized by the spanish national insurance system between 1961 ( when asbestosis was first acknowledged as an occupational disease ) and 2010 , recording 815 cases of asbestosis10 .
in addition , 164 asbestos - related occupational cancers were recorded between 1978 , when asbestos - related bronchopulmonary cancers and mesothelioma were first recognized as occupational diseases , and 201111 .
these data contrast with the more conservative estimates published in other studies , suggesting that an accurate picture of the true impact of asbestos on health requires the integration of information on patients with asbestosis , pleural plaques , or mesotheliomas treated in the spanish national health service ( nhs ) and on the population - attributable fraction of tumors known to be associated with asbestos exposure , i.e. , in lung , larynx , ovary , colon , and rectum6 .
the objective of this study was to estimate the burden of malignant ards to the spanish nhs between 2004 and 2011 , calculating the direct medical costs of its treatment .
estimation of the burden of a disease and its costs is essential for taking optimal public health decisions in relation to risk reduction / control measures and the planning of human and material healthcare resources .
the burden ( number ) of ards in spain between 2004 and 2011 was estimated by identifying all cases due to asbestosis , almost all cases due to mesothelioma , and the proportion ( and therefore number ) of cases of lung , laryngeal , ovarian , colon and rectum cancers attributable to asbestos exposure .
table 1 provides a matrix of disease categories [ with international classification of diseases-9 revision ( icd-9 ) codes ] and the population - attributable fraction by sex12 , 13 , 14 , 15 .
these data were combined with healthcare and associated costs obtained from the different nhs care levels .
the study period begins in 2004 , the first year with available data on specialist outpatient care , and ends in 2011 , the latest year for which data are available on each disease type.table 1 .
matrix of diseases , icd codes , and attributable fractions due to occupational asbestos exposure by sexdiseasecie-9cie-10attributable fraction ( % ) ( 95% confidence interval)sourcemalesfemalestotalasbestosis501j61100100100who12mesothelioma158 , 163c4597(96.098.0)82.5(75.090.0)94.9(93.096.9)rushton et al.13lung162c33-c34140.6nurminen , karjalainen14laryngeal161c328.30.3nurminen , karjalainen14ovarian183.0c560.20.50.3driscoll15colon153c182.30nurminen , karjalainen14rectum154c202.90nurminen , karjalainen14 the spanish nhs uses the icd-9 classification system , which has no specific code for mesothelioma .
therefore , we applied a multiplier obtained in a previous study on the proportion of pleural and peritoneal cancers estimated to be mesotheliomas in spain between 2004 and 20069 , in which 362 out of 496 deaths coded as cancer of the pleura were pleural mesotheliomas , and 51 out of 673 coded as cancer of the peritoneum were peritoneal mesotheliomas . hence , the number of cases due to pleural mesothelioma was estimated by multiplying the number of pleural cancer cases by 0.68 ( 0.73 in men and 0.55 in women ) , and the number due to peritoneal mesothelioma was estimated by multiplying the number of peritoneal cancer cases by 0.08 ( 0.1 in men and 0.05 in women ) .
two types of analysis were performed : a ) using nhs data on the cost of specialist ( hospital and outpatient ) care to compute the cost of cases treated at nhs hospitals ; and b ) mining secondary data sources to estimate the costs of primary healthcare and prescription drugs .
data in the information system of the nhs was accessed using the nhs interactive consultation program , selecting the registry of hospital discharges ( cmbd - h ) and registry of specialist outpatient care ( cmbd - aae)16 .
the study variables and inclusion criteria were as follows : years : from 2004 through 2011 ; age and sex : males or females aged 25 years or older for asbestosis , 40 years or older for mesotheliomas , and 25 years or older for other asbestos - related cancers ; diagnosis : main diagnosis coded using the icd-9 system ( 5 digits ) ; subjects in the cmbd - h database : patients discharged from a spanish public hospital , excluding those with discharge date unavailable or outside the study period , those with admission and discharge on the same day ( non - hospitalized ) , and discarding duplicate records ; subjects in the cmbd - aae database : patients receiving specialist outpatient care ( sessions , visits , contacts ) in day hospital , outpatient department , or at home , excluding those with discharge date unavailable or outside the study period and discarding duplicate records ; mean length of hospital stay ; cost : mean estimated cost of treating these patients in a representative sample of nhs hospitals for each year studied ; weighted activity unit ( wau ) : the unit cost of specialist outpatient care in the years under study , based on the official measure wau ( known in spain as the unidad ponderada asistencial upa)17 , 18 . estimations of primary healthcare and pharmaceutical costs were based on data from a catalonian health district ( baix empord ) for 2004 , 2005 , 2006 , 2007 and 2011 , the years for which cost data were available by clinical risk group .
we calculated the costs for primary care and pharmaceutical care as a proportion of costs for specialist care .
primary care included the total use of primary healthcare resources ( family doctor , nursing staff or emergencies ) , pharmaceutical care included all expenditure on prescription drugs , and specialist care included inpatient care , specialist outpatient care and also the hospital pharmaceutical costs , which are included in the cmbd and wau databases .
information on costs related to long - stay hospitals was not considered because these data are not included in the cmbd database . because the baix empord district covers a relatively small population ( around 134,000 in 2013 ) , only a small number of patients were recorded in each diagnostic group under study
. it would therefore have been inappropriate to calculate the mean cost of each disease per year , which may be heavily influenced by the severity of a given patient . for this reason
, we computed the mean cost of each disease over the entire study period and for the whole population ( males and females ) .
the ratios obtained were applied to the time - series data on specialist care costs in order to obtain the primary care and pharmaceutical care expenditure .
table 2 exhibits these calculations , in which the cost factor for primary care is the primary care expenditure divided by the specialist care expenditure , and the cost factor for pharmaceutical care is the pharmaceutical care expenditure divided by the specialist care expenditure.table 2 .
distribution of number of patients and public healthcare budget across disease categories and types of service in baix empord ( euros ) and cost factors ( relative weights ) for primary healthcare and pharmaceutical carelunglarynxovarycolon / rectumnmean costnmean costnmean costnmean costprimary care349345.8461345.887322.3495259.9pharmaceutical care3491,302.64611,302.687710.54951,418.5specialized care3491,652.24611,652.2871,777.64951,826.7cost factor for pc ( pc / sc)0.210.220.180.14cost factor for phc ( phc / sc)0.790.600.400.78pc = primary care , sc = specialist care , phc = pharmaceutical caresource : prepared by the authors from primary data provided by serveis de salut integrats baix empord .
pc = primary care , sc = specialist care , phc = pharmaceutical care source : prepared by the authors from primary data provided by serveis de salut integrats baix empord .
the cost factors for primary care and pharmaceutical care were not available for asbestosis or mesothelioma , because there were no records of patients with these diseases in baix empord during the analyzed period .
therefore , the cost factor obtained for lung cancer was used for these diseases , on the grounds that their medical costs would be relatively similar .
the spanish nhs uses the icd-9 classification system , which has no specific code for mesothelioma .
therefore , we applied a multiplier obtained in a previous study on the proportion of pleural and peritoneal cancers estimated to be mesotheliomas in spain between 2004 and 20069 , in which 362 out of 496 deaths coded as cancer of the pleura were pleural mesotheliomas , and 51 out of 673 coded as cancer of the peritoneum were peritoneal mesotheliomas . hence , the number of cases due to pleural mesothelioma was estimated by multiplying the number of pleural cancer cases by 0.68 ( 0.73 in men and 0.55 in women ) , and the number due to peritoneal mesothelioma was estimated by multiplying the number of peritoneal cancer cases by 0.08 ( 0.1 in men and 0.05 in women ) .
two types of analysis were performed : a ) using nhs data on the cost of specialist ( hospital and outpatient ) care to compute the cost of cases treated at nhs hospitals ; and b ) mining secondary data sources to estimate the costs of primary healthcare and prescription drugs .
data in the information system of the nhs was accessed using the nhs interactive consultation program , selecting the registry of hospital discharges ( cmbd - h ) and registry of specialist outpatient care ( cmbd - aae)16 .
the study variables and inclusion criteria were as follows : years : from 2004 through 2011 ; age and sex : males or females aged 25 years or older for asbestosis , 40 years or older for mesotheliomas , and 25 years or older for other asbestos - related cancers ; diagnosis : main diagnosis coded using the icd-9 system ( 5 digits ) ; subjects in the cmbd - h database : patients discharged from a spanish public hospital , excluding those with discharge date unavailable or outside the study period , those with admission and discharge on the same day ( non - hospitalized ) , and discarding duplicate records ; subjects in the cmbd - aae database : patients receiving specialist outpatient care ( sessions , visits , contacts ) in day hospital , outpatient department , or at home , excluding those with discharge date unavailable or outside the study period and discarding duplicate records ; mean length of hospital stay ; cost : mean estimated cost of treating these patients in a representative sample of nhs hospitals for each year studied ; weighted activity unit ( wau ) : the unit cost of specialist outpatient care in the years under study , based on the official measure wau ( known in spain as the unidad ponderada asistencial upa)17 , 18 .
estimations of primary healthcare and pharmaceutical costs were based on data from a catalonian health district ( baix empord ) for 2004 , 2005 , 2006 , 2007 and 2011 , the years for which cost data were available by clinical risk group .
we calculated the costs for primary care and pharmaceutical care as a proportion of costs for specialist care .
primary care included the total use of primary healthcare resources ( family doctor , nursing staff or emergencies ) , pharmaceutical care included all expenditure on prescription drugs , and specialist care included inpatient care , specialist outpatient care and also the hospital pharmaceutical costs , which are included in the cmbd and wau databases .
information on costs related to long - stay hospitals was not considered because these data are not included in the cmbd database .
because the baix empord district covers a relatively small population ( around 134,000 in 2013 ) , only a small number of patients were recorded in each diagnostic group under study .
it would therefore have been inappropriate to calculate the mean cost of each disease per year , which may be heavily influenced by the severity of a given patient . for this reason
, we computed the mean cost of each disease over the entire study period and for the whole population ( males and females ) .
the ratios obtained were applied to the time - series data on specialist care costs in order to obtain the primary care and pharmaceutical care expenditure .
table 2 exhibits these calculations , in which the cost factor for primary care is the primary care expenditure divided by the specialist care expenditure , and the cost factor for pharmaceutical care is the pharmaceutical care expenditure divided by the specialist care expenditure.table 2 .
distribution of number of patients and public healthcare budget across disease categories and types of service in baix empord ( euros ) and cost factors ( relative weights ) for primary healthcare and pharmaceutical carelunglarynxovarycolon / rectumnmean costnmean costnmean costnmean costprimary care349345.8461345.887322.3495259.9pharmaceutical care3491,302.64611,302.687710.54951,418.5specialized care3491,652.24611,652.2871,777.64951,826.7cost factor for pc ( pc / sc)0.210.220.180.14cost factor for phc ( phc / sc)0.790.600.400.78pc = primary care , sc = specialist care , phc = pharmaceutical caresource : prepared by the authors from primary data provided by serveis de salut integrats baix empord .
pc = primary care , sc = specialist care , phc = pharmaceutical care source : prepared by the authors from primary data provided by serveis de salut integrats baix empord .
the cost factors for primary care and pharmaceutical care were not available for asbestosis or mesothelioma , because there were no records of patients with these diseases in baix empord during the analyzed period .
therefore , the cost factor obtained for lung cancer was used for these diseases , on the grounds that their medical costs would be relatively similar .
between 2004 and 2011 , there were 37,557 admissions for ards to spanish public hospitals of individuals over the age of 25 years ( > 40 years in the case of mesothelioma ) , 97.1% of whom were male and 2.9% female .
the rate of hospital discharges for ards per 100,000 social security - affiliated employees was 43.9 in males and 1.9 in females . over this period
, men showed a slight increase in this rate ( 43.9 in 2004 vs. 49.2 in 2011 ) , while women evidenced stability ( 1.8 in 2004 vs. 1.9 in 2011 ) .
hospital admissions for mesothelioma increased , especially among males ( 350 occupational - related cases in 2004 vs. 449 in 2011 ) , while admissions for asbestosis decreased ( 39 in 2004 vs. 31 in 2011 ) ( table 3).table 3 .
spain 20042011asbestos - related disease(ard)number of hospital dischargesmean length of stay(days)cost per process(in euros)cases attributable to occupational exposurehospital cost per ard(in euros)mfmfmfmfmfasbestosis200436311.925.334,093.893,434.31363147,379.9410,302.9220112838.61124,128.486,344.86283115,597.4519,034.5720042011268219.877.484,110.274,290.10268211,101,552.1590,091.99mesothelioma200436110714.2413.975,832.205,907.79350882,041,270.00519,885.52201146312311.2512.138,093.188,481.004491023,633,837.82865,062.00200420113,16596012.9613.946,815.737,228.293,0779120,924,690.935,719,074.03malignant neoplasm of trachea , bronchus and lung200423,0413,06011.7812.405,092.205,072.773,2261816,427,451.1491,309.94201122,8684,7769.9210.135,621.335,405.073,2022917,999,483.46156,747.1720042011182,47630,52711.1311.395,411.895,436.9225,547183138,257,940.44995,173.44malignant neoplasm of larynx20045,15226315.0714.207,056.816,753.1442813,020,313.56,753.1420114,74232312.8412.768,704.338,864.7639413,429,504.728,864.762004201139,9362,23414.4613.568,329.038,318.363,314827,601,055.3866,140.42malignant neoplasm of ovary20043,70413.225,506.381160,570.1420114,04610.748,077.141296,925.732004201131,19112.126,313.9993586,988.37malignant neoplasm of colon200410,7657,84316.7916.687,614.877,209.0424801,888,488.060201114,51910,02913.7513.0610,932.3110,125.4333403,651,392.64020042011100,49172,38115.3714.929,490.838,840.002,311021,933,092.350malignant neoplasm of rectum20047,7154,50416.5116.556,831.676,594.4222401,530,293.27020118,8684,94913.7313.1710,030.189,441.1725702,577,757.2402004201167,27038,20515.5414.938,651.768,158.301,951016,877,571.210total ard200447,07015,78014.0818.856,174.197,894.714,51212125,055,195.91688,821.66201151,48820,20311.9414.538,183.6810,428.774,66414731,407,573.331,146,634.2320042011393,606144,32813.3216.777,313.389,284.8336,4611,096226,695,902.467,457,468.25source : prepared by the authors from data provided by the national health system consulta interactiva
instituto de informacin sanitaria ( 2013)16 source : prepared by the authors from data provided by the national health system consulta interactiva
instituto de informacin sanitaria ( 2013)16 between 2004 and 2011 there were 5,253 specialist outpatient visits for the diseases under study , 97.4% by men and 2.6% by women ( table 4 ) .
although the male - female ratio differed among the diseases , there was always a predominance of males .
cases attended in day hospitals were 6-fold higher in 2011 than in 2004 , with a 14-fold increase for females , and an increase was observed in both sexes for all diseases under study with the exception of asbestosis.table 4 .
spain 20042011asbestos - related disease(ard)number of consultations in specialist outpatient careweighted activity unit cost(in euros)specialist outpatient care consultations attributable to occupational exposurespecialist outpatient care cost per ard(in euros)mfmfmfmfasbestosis200400000000201120359.74020719.49020042011154308.61481.361544,629.201,925.43mesothelioma200452295.85299.52511,479.23299.5220116235472.20416.07602828,331.9611,649.872004201119693396.28369.591917575,595.2627,703.06malignant neoplasm of trachea , bronchus and lung2004852190324.25306.87119138,585.41306.8720114,5071,399424.91400.206318268,117.363,201.622004201122,7655,438379.94373.613,188331,211,236.4812,325.12malignant neoplasm of larynx200436323351.23356.7430010,536.81020111,17568508.62520.8698049,844.410200420115,990370454.05494.744980226,139.290malignant neoplasm of ovary2004393312.451312.4520111,516564.2052,821.01200420117,290426.55229,548.98malignant neoplasm of colon2004545389340.18324.101304,422.40020116,0463,697596.40552.38139047,285.6802004201130,59919,699499.10464.887050239,830.240malignant neoplasm of rectum2004289202310.37298.78802,482.95020113,4331,865548.04515.86100054,804.4802004201117,94710,121453.21449.675220236,610.880total ard20042,0541,199331.22313.87175357,506.80918.84201115,2258,580527.42375.361,03041449,103.3817,672.52004201177,51243,015449.70344.785,1191341,994,041.3551,502.59source : prepared by the authors from data provided by the national health system consulta interactiva , ministerio de sanidad , servicios sociales e igualdad .
instituto de informacin sanitaria ( 2013)16 source : prepared by the authors from data provided by the national health system consulta interactiva
instituto de informacin sanitaria ( 2013)16 hospital cost per disease was highest for colon and rectum cancers , which also required a longer hospital stay .
the mean length of hospital stay tended to decrease over the study period for all diseases in both sexes except for asbestosis in women .
the total public hospital cost for the eight - year study period was 234,153,370.71 , of which 96.8% corresponded to male patients . between 2004 and 2011 , these costs rose by 25.3% for men and by 66.5% for women .
the total cost of specialist outpatient care for these diseases was 2,045,543.95 over the same period ( table 4 ) and evidenced the greatest rise in costs between 2004 and 2011 , with a 19.2-fold increase in females and 7.8-fold increase in males .
table 5 displays the annual costs of healthcare services and prescriptions for the seven ards studied between 2004 and 2011 .
the total cost over the 8-year period was 463,983,511 , being 30.4-fold higher for male vs. female cases .
this total cost began to rise after 2006 , increasing by 27.8% between 2004 and 2011 ( 26.7% for males vs. 68.9% for females ) .
this increase was not uniform over the period and even decreased slightly in 2005 and 2010 . among the years showing an inter - annual increase , this ranged from 2.5% between 2008 and 2009 to 8.9% between 2006 and 2007 .
the only ard evidencing a reduction in total costs over the study period was asbestosis in men .
these inter - annual changes were relatively similar among the three types of healthcare considered .
the highest costs incurred over the period were for tracheal and bronchopulmonary cancers , both globally ( 60.5% ) and among the men ( 62.1% ) , whereas mesothelioma incurred the highest costs among the women ( 77.9% of total for females ) .
the next highest cost was that for pharmaceutical care , which represented 38.95% of the total , while primary healthcare was responsible for 10.15% of the total costs.table 5 .
total healthcare cost per asbestos - related disease by type of service and sex ( euros ) .
spain 20042011asbestos - related disease(ard)specialist care costprimary care costpharmaceutical care costhealthcare cost per ardmfmfmfmfasbestosis2004147,379.9410,302.9230,949.792,163.61116,430.158,139.31294,759.8820,605.842011116,316.9319,034.5724,426.563,997.2691,890.3715,037.31232,633.8638,069.14200420111,106,181.3592,017.41232,298.0819,323.66873,883.2772,693.752,212,362.70184,034.82mesothelioma20042,042,748.22520,184.67428,977.13109,238.781,613,771.09410,945.894,085,496.441,040,369.3420113,662,168.71876,712.17769,055.43184,109.562,893,113.28692,602.617,324,337.421,753,424.342004201121,000,285.215,746,776.184,410,059.891,206,822.0016,590,225.324,539,953.1842,000,570.4211,493,552.36malignant neoplasm of trachea bronchus , and lung200416,466,036.5591,616.813,457,867.6819,239.5313,008,168.8772,377.2832,932,073.10183,233.62201118,267,600.82159,948.793,836,196.1733,589.2514,431,404.65126,359.5436,535,201.64319,897.5820042011139,469,176.911,007,498.5729,288,527.15211,574.70110,180,649.76795,923.87278,938,353.822,014,997.14malignant neoplasm of larynx20043,030,850.316,753.14666,787.071,485.691,818,510.194,051.885,516,147.5612,290.7120113,479,349.138,864.76765,456.811,950.252,087,609.485,318.866,332,415.4216,133.862004201127,827,194.6666,140.426,121,982.8314,550.8916,696,316.8039,684.2550,645,494.28120,375.56malignant neoplasm of ovary200460,882.5910,958.8724,353.0496,194.49201199,746.7417,954.4139,898.70157,599.8520042011596,537.34107,376.72238,614.94942,528.00malignant neoplasm of colon20041,892,910.460265,007.4601,476,470.1603,634,388.08020113,698,678.310517,814.9602,884,969.0807,101,462.3602004201122,172,922.5803,104,209.16017,294,879.61042,572,011.350malignant neoplasm of rectum20041,532,776.220214,588.6701,195,565.4502,942,930.34020112,632,561.720368,558.6402,053,398.1405,054,518.5002004201117,114,182.1102,395,985.50013,349,062.05032,859,229.650total ard200425,112,701.70689,740.135,064,177.79143,086.4819,228,915.92519,867.4049,405,795.411,352,694.01201131,856,675.621,164,307.036,281,508.57241,600.7224,442,385.00879,217.0262,580,569.192,285,124.7720042011228,689,942.827,508,969.9245,553,062.611,559,648.97174,985,016.805,686,869.99449,228,022.2314,755,488.88source : prepared by the authors from tables 1 , 2 , 3 , 4 .
source : prepared by the authors from tables 1 , 2 , 3 , 4 .
finally , table 6 lists the mean costs per case for each ard in 2004 and 2011 and in the whole period under study ( 20042011 ) as well as the mean age ( sd ) of hospital inpatients , the only patients for whom these data are available.table 6 .
mean age ( sd ) and mean healthcare cost per asbestos - related disease by sex ( euros ) .
spain 20042011asbestos - related disease ( ard)mean age ( sd)mean healthcare cost per ard ( in euros)mfmfasbestosis200472.8 ( 7.4)80.3 ( 2.9)8,187.776,868.61201173 ( 10.2)73.6 ( 10.4)8,308.3512,689.712004201172.6 ( 8.9)74.3 ( 13.1)8,307.789,057.85mesothelioma200467.5 ( 10.7)67.2 ( 13.2)11,672.8511,822.38201169.4 ( 10.6)69.1 ( 11.6)16,312.5617,190.432004201168.6 ( 10.3)68.9 ( 12.1)13,571.9214,444.55malignant neoplasm of trachea , bronchus , and lung200466.2 ( 11)62.5 ( 13.8)10,208.3310,179.65201167.5 ( 10.7)64 ( 12.9)11,410.1211,030.952004201166.8 ( 10.9)63.2 ( 13.3)10,914.8910,935.89malignant neoplasm of larynx200462.7 ( 10.8)57.4 ( 13.5)12,888.2012,290.71201164.1 ( 10.6)61.5 ( 12.6)16,072.1216,133.862004201163.4 ( 10.8)60 ( 12.8)15,294.4515,046.94malignant neoplasm of ovary200461.5 ( 14.1)8,744.95201161.3 ( 14.3)13,133.322004201161.1 ( 14.3)10,086.77malignant neoplasm of colon200469.5 ( 11.1)14,654.790.00201170.4 ( 11.2)21,261.860.002004201170.1 ( 11.2)18,199.750.00malignant neoplasm of rectum200468.5 ( 11.2)13,138.080.00201168.6 ( 11.6)19,667.390.002004201168.6 ( 11.4)16,720.290.00source : prepared by the authors from data provided by ministerio de sanidad , servicios sociales e igualdad ( 2013)16 and table 5 source : prepared by the authors from data provided by ministerio de sanidad , servicios sociales e igualdad ( 2013)16 and table 5
the historic use and handling of asbestos in spain continue to evidence a major impact on health .
ards produce around 4,700 hospital admissions and over 650 specialist outpatient consultancies per year , and their direct annual cost to the spanish nhs is estimated to be around 58 million euros .
in fact , this is an underestimation of the global expenditure by the nhs on ards , given that the fraction of pharynx and stomach cancers attributable to asbestos has not been considered . in industrialized countries , occupational exposure is responsible for 100% of asbestosis cases , at least 85% of mesothelioma cases , and a variable proportion of the other diseases studied . between 2004 and 2011 , 37,557 public hospital admissions were for ards in individuals aged 25 years or more ( > 40 yrs for cases of mesothelioma ) , mainly for lung cancer , mesothelioma , or laryngeal cancer .
furthermore , 2,611 individuals aged 40 years or older ( 1,952 men and 659 women ) died from pleural mesothelioma over the eight - year study period16 .
in contrast , only 490 cases of ards were recognized as occupational diseases under the spanish national insurance system over the same period : 81 cases of mesotheliomas , 66 of bronchopulmonary cancer , 280 of asbestosis , and 63 of pleural plaques10 , 11 .
evaluating the costs of ards based on workers compensation can lead to gross underestimations and hinder comparison between countries , because of differences in national legislative frameworks , insurance systems , and recognition rates .
thus , compensation schemes cover 35% of mesothelioma cases in italy and between 16% and 25% of those in france , depending on the region19 , whereas only 6.4% of mesothelioma cases in men and 0.3% of those in women are considered as occupational diseases in spain11 .
the gross under - recognition of ards in spain not only reveals the deficiencies of the spanish national insurance system but also has a negative economic impact on the nhs , which is estimated to incur healthcare costs of 58 million euros every year that should be paid under the compensation scheme for occupational ards victims .
it is estimated that over a thousand individuals will die from pleural mesothelioma in spain between 2016 and 2020 , and asbestos - related deaths are expected to continue until at least 20409 .
for this reason , the gathering , analysis , and diffusion of data on these diseases and on their relationship with occupational exposure is crucial for planning prevention and healthcare programs and for the appropriate compensation of victims .
the calculations and analysis of the healthcare burden of ards in our study represent useful tools for informing decisions and redefining health policies and the human and material resources required .
more than half ( 68.5% ) of hospital admissions for ards were for bronchopulmonary cancers , followed by mesothelioma ( 10.3% ) and laryngeal cancer ( 8.8% ) , while the smallest number was for asbestosis ( 0.8% ) , similar to previous findings in europe20 .
we highlight the marked increase in specialist outpatient consultancies for ards from 178 in 2004 to 1,071 in 2011 , which may be attributable to a trend for the outpatient rather than in - hospital treatment of these diseases . it should be borne in mind that the coverage of the information system is complete for hospitalizations and for specialist outpatient surgery but is only 46.7% for the medical activity of the outpatient day hospital21 .
a further potential limitation is that our utilization of ratios for the whole period as a proxy of primary , specialist , and pharmaceutical care costs assumes that there was no substantial variation in the treatment of these diseases between 2004 and 2011 .
this appears to be a reasonable assumption , but a certain degree of bias can not be ruled out .
there was an increase in consultancies for all ards with the exception of asbestosis , responsible for the smallest number of consultancies , which rose until 2006 and then declined , consistent with published evidence on the decline in the morbidity and mortality of this disease in spain and europe10 , 20 .
previous studies on the attribution of ards to occupational exposure concluded that this approach is highly unlikely to overestimate the true impact of this exposure on morbidity and mortality22 , 23 , 24 .
in fact , as noted above , our data likely represent an underestimation , because no account was taken of pharyngeal or stomach cancers , as the proportion due to asbestos exposure has not yet been elucidated .
the who concluded that occupational exposure to asbestos remains a major cause of death and disability in europe , despite the conservative assumptions that underlie published estimates12 .
all studies have found that more than half of occupational cancers involve the lung , and that asbestos is the main occupational carcinogen25 .
we calculated the direct costs to the nhs of the diagnosis and treatment of the disease but took no account of indirect costs , such as the loss of productivity caused by the temporary / permanent disability and premature death of workers or the cost of carers , etc .
even though our estimate of the total costs generated by these conditions is therefore at the lower end , it indicates an expenditure of more than 463 million euros between 2004 and 2011 ( 51 in 2004 and 65 in 2011 ) , with a mean annual increase of 3.5% .
it has been reported that 66%85% of the total health costs of cancer are indirect costs , including sick leave and early retirement , and especially the cost of mortality in people of working age12 , 26 , 27 , 28 .
evaluation of the full economic impact of ards in spain requires an assessment of the indirect costs and their addition to the direct costs calculated in the present study .
the greatest proportion of direct healthcare costs were for specialist care services ( around 51% ) , followed by pharmaceutical prescriptions ( 39% ) .
it was previously reported that 50% of the cost of cancer in spain was for the hospitalization of patients , and that 15% was for pharmacologic treatments . over the period from 2004 through 2011 , there was no difference in the time course of costs among the components of specialist care with the exception of day hospital costs , which showed a mean annual increase of more than 100% ( 10-fold higher in 2011 than in 2004 ) , whereas the average annual increase in hospitalization was only 2.9% .
comparison of our findings is hampered by the different methods used in research on medical costs as a function of the specific objectives and resources available , as affirmed at the who meeting in bonn in 201212 .
the annual global cost of medical treatment for ards has been estimated at 4.34 billion usd29 . at the aforementioned who meeting in bonn
, it was stated that the mean acute treatment cost per case of mesothelioma was 15,899.34 in the united kingdom12 , compared with previous estimates of 15,000 in scotland in 200630 , 24,000 in italy in 201119 , and 20,218 for males in 2011 ( present study ) .
lifetime healthcare costs of pleural mesothelioma in taiwan were estimated to be 14,900 usd in 1997200531 .
an investigation of the direct healthcare sources of occupational lung and bladder cancers in spain in 200824 estimated a cost per lung cancer patient of 9,277 , lower than the cost of 11,566 estimated in the present study . in canada ,
the median cost per case in the 2000s of non - small cell lung cancer and small cell lung cancer were 10,928 ( range 9,23411,047 ) and 15,350 ( range 13,03321,436 ) respectively12 . the aforementioned study on cancer costs in spain found a cost of 19,535 per case of colon cancer27 , similar to the present finding although different computational methods were used .
our calculation of the direct healthcare costs of occupational ards in spain should be considered the lower limit for the reasons noted above , but it is not possible to calculate the degree of underestimation from the information available .
the assumptions used to calculate the components of healthcare also represent a bias , especially with respect to the costs of prescriptions and primary care , whose estimation was derived from a geographic area that can not be considered representative of the nation as a whole , given the variability in disease prevalence and in the offer of medical services among regions
. nevertheless , there can be no doubt about the high healthcare costs of ards in spain , especially given the potentially preventable nature of these diseases .
the elevated economic burden of ards underlines the need to increase their prevention and their early diagnosis and treatment . as declared by the who european region at its latest meeting12 , asbestos continues to present a public health threat , despite bans on its import and use , due to wide exposure in the past .
however , estimation of their costs is of particular importance at a time of economic pressures on the health service .
the proper demarcation of financial responsibilities between the national insurance system ( including work accidents and occupational diseases insurance institutes ) and the national health system is a highly relevant issue .
costs of occupational diseases should be funded by social contributions from employers and employees under the national insurance system rather than by the tax - funded national health system . | the objective of this article was to estimate the medical costs derived from malignant ard treatment in the spanish national health system ( nhs ) between 2004 and 2011 .
estimation of direct healthcare costs was based on national primary data on the cost of specialized care for inpatients and outpatients treated at nhs hospitals and on national and regional secondary data on costs of primary healthcare and pharmaceutical prescriptions .
a prevalence approach was used to estimate the overall burden of ards .
direct medical costs of 37,557 ards attended in spanish nhs facilities in 20042011 were estimated at 464 million euros ; specialist care accounted for 50.9% of total costs , primary healthcare 10.15% , and drug prescription 38.9% .
the cost was 27.8-fold higher in males than in females .
bronchopulmonary cancers represented the greatest healthcare cost , 281 million euros .
the cost of delivering healthcare to ards victims in spain has a negative economic impact on the nhs due to the gross under - recognition of occupational victims under the spanish national insurance system . |
acinetobacter baumannii is microbiologically characterized as a rod - shaped , aerobic , pleomorphic , and nonmotile gram - negative bacterium .
a. baumannii can survive in natural environments such as soil and water for a prolonged period and mainly infect immunocompromised patients .
this opportunistic organism is also known to be resistant to disinfectants and persist in hospital and health care facilities . as a consequence ,
a. baumannii has emerged as a major pathogen causing both community - acquired and nosocomial infections .
a. baumannii presents as an infection of the skin and soft tissue and causes pneumonia .
this pathogen has been strongly associated with wound infections of soldiers serving in iraq and afghanistan .
a. baumannii isolates were recovered from various tissues including respiratory tract , blood , flesh wounds , and urinary tract .
many infections were caused by multidrug- and pandrug - resistant strains ; this calls for the urgent need of new preventive and therapeutic options against this emerging threat . owing to drug resistance to
all commonly used gram - negative antibiotics , a. baumannii has generated an increase in research interest [ 5 , 6 ] .
genomic analyses of multidrug - resistant isolates suggest that these drug resistance genes could be acquired from other gram - negative species .
these studies have revealed that the major drug - resistant mechanisms are through several genes including -lactamases , carbapenemases , dna gyrase , dihydropteroate synthase / reductase , and efflux pumps .
this list is expected to become longer with the current abuse of antibiotics in clinical settings .
thus , the concept of therapeutic approaches that target host responses including the immune response has become more appealing .
although our understanding of the epidemiology , mechanisms of antibiotic resistance , and persistence of a. baumannii in various environments has advanced , the pathological characteristics are much less studied .
specifically , the immune pathways that are critical to host defense against a. baumannii are far from being well understood .
since a. baumannii is a gram - negative bacterium , it is not surprising that lipopolysaccharide ( lps ) , a highly immunostimulatory molecule on its surface , induces strong responses from mouse splenocytes and engineered human cells including the human monocytic cell line , thp-1 cells [ 8 , 9 ] .
lps is recognized by tlr4 and activates nf-b , which leads to the secretion of mip-2 and kc / il-8 and subsequent neutrophil recruitment [ 9 , 10 ] .
tlr2 also seemed to contribute to the inflammatory response to a. baumannii , but the results are conflicting : in one report , tlr2-deficient mice exhibit accelerated neutrophil influx to the lungs , improved elimination of a. baumannii , and reduced proinflammatory responses .
other studies have shown that purified tlr2 ligands from a. baumannii are immunostimulatory and result in the activation of nf-b and secretion of il-8 [ 9 , 11 ] .
variability in mouse versus human models could potentially explain the conflicting observations but could also be explained by contamination in the tlr ligands during purification . depletion of complement , macrophages , or neutrophils separately increased bacterial burden in an infection model with a hypovirulent strain but depletion of these compartments of immune system was insufficient to change lethality .
although the mechanism is not clear , the loss of fus1 , a tumor suppressor protein , in mice significantly increased resistance to a. baumannii pneumonia
. however , depletion of neutrophils eliminates the enhanced antibacterial clearance of the fus1 mice , further underscoring the importance of neutrophils in the host response to a. baumannii pneumonia .
these data collectively suggest that neutrophils are an important cellular compartment that is involved in the controlling of a. baumannii infection .
based on the compelling evidence on the regulation of neutrophil recruitment by the il-17 pathway , we hypothesize that the il-17 producing t helper cells ( th17 ) play a role in mediating a. baumannii clearance .
effector cd4 + t cells differ in their phenotypes depending on differentiating conditions and can be categorized into various lineages .
th1 cells make ifn- as their signature cytokine , are potent il-2 producers , and frequently coexpress tnf-. by contrast , th2 cells do not produce ifn- but are specialized in making cytokines il-4 , il-5 , and il-13 .
the th1/th2 paradigm was a dominating theory in the field of t - cell immunology for more than 15 years until 2003 , when a series of publications demonstrated a third distinctive effector lineage of cd4 + t cells , th17 cells , discovered in mouse models of autoimmune encephalitis [ 1520 ] .
most th17 cells were found to reside in barrier tissues , including respiratory and intestinal tracts as well as the skin .
signature cytokines of th17 cells include il-17a , il-17f , il-22 , and il-26 ( specific for humans ) and these canonical cytokines produced by the classical th17 ( cd4 + il-17 producing cells ) and non - th17 cells including -t cells and innate lymphoid cells play critical roles in regulating tissue homeostasis and inflammation as well as antimicrobial responses upon infections caused by pathogens .
detailed roles and functions of il-17 in host defense at three different mucosal sites including lung , digestive tract , and skin will be discussed below .
the pivotal roles of il-17/il-17 receptor signaling in the context of host defense against bacterial and fungal pathogens are very well recognized and appreciated even before the discovery of the th17 lineage . in pulmonary infection models ,
mice deficient in either il-17 or il-17ra have increased susceptibility to gram - negative bacteria , such as klebsiella pneumoniae and mycoplasma pneumonia . during primary infection ,
il-17 signals through the heterodimeric receptor il-17ra / il-17rc and promotes the production of cxc chemokines such as cxcl1 , cxcl2 , and cxcl5 .
il-17 is also critical for the optimal production of g - csf , an important cytokine that not only prolongs the survival of neutrophils but also improves the function of neutrophils .
th17 cells are also known for their ability to mediate serotype - independent protection in mouse models of k. pneumoniae , streptococcus pneumoniae , and pseudomonas aeruginosa . in these models ,
th17 cells have been shown to recognize antigens that are conserved among different bacterial species and provide broader protection upon secondary infection .
it has been hypothesized that antigen - specific memory th17 cells confer a host advantage by providing heterologous mucosal immunity through recognition of conserved antigens among different species of pathogens .
the expression of il-17 and il-22 increases at other mucosal sites after infection with a number of pathogens including intestinal infections with citrobacter rodentium [ 2628 ] or salmonella typhimurium [ 29 , 30 ] .
the primary roles of il-17 and/or il-22 in these models are to control the infection within the mucosa and prevent the dissemination of these pathogens . in the citrobacter rodentium infection model , which mimics infections by attaching and effacing ( a / e ) bacterial pathogens in humans
, il-22 is required for the colonic epithelial production of antimicrobial proteins , including regiiibeta and regiiigamma .
the il-22 dependent antimicrobial proteins are crucial in reducing intestinal epithelial damage and decreasing bacterial burden .
th17 cells and il-17 receptor signaling are also essential for host defense against oral candidiasis caused by candida albicans . upon oral candida infection , th17
signature genes including cxc chemokines and beta defensin-3 are strongly induced while il-17ra deficient mice have more severe oropharyngeal candidiasis as compared to wild type mice . in humans
, skin is another important anatomical barrier from pathogens and staphylococcus aureus is the most common cause of infection at skin .
il-17 has been shown to be critical in recruiting neutrophils in a skin infection model although the primary cellular source appeared to be epidermal -t cells . in this mouse model of s. aureus skin infection , neutrophil recruitment to the infection sites was dependent on epidermal -t - cell production of il-17 and this il-17 induction is controlled by signals from il-1 , tlr2 , and il-23 as il-17 production upon s. aureus infection is diminished in the il1r1 , tlr2 , and il23a mice but not il12a mice .
emerging evidence shows that the il-17 pathway is critical in the host defense against various bacterial pathogens ; however , very little is known on the exact role of this pathway in a. baumannii infection . a recent study examined this in il-17a ko mice as well as anti - il-17 neutralization antibody and concluded that il-17a is not required in primary infection ; however
, this did not rule out the possibility of a compensatory role of il-17f , an il-17 family member that shares the most homology with il-17a and signals through il-17ra and il-17rc complex .
existing literature also suggested that th17 cells play a role in vaccine - mediated immunity against a. baumannii .
the rompa vaccine has shown efficacy in animal models through generating antibodies and inducing th1 , th2 , and th17 responses . however , the roles of each of these specific t helper lineages have not been thoroughly investigated .
furthermore , this study did not measure t follicular helper ( tfh ) cell cytokines and markers that are critical in the formation and maintenance of b - cell germinal centers . nonetheless , immune serum is capable of providing protection upon adoptive transfer , suggesting that a passive immunization strategy can be used in preventing and/or controlling a. baumannii infection .
future investigation focusing on the development of monoclonal antibodies against ompa or other essential proteins from a. baumannii should be strongly considered for therapy .
studies using whole cell a. baumannii antigen for immunization demonstrated that elevated levels of th17 polarizing cytokines such as il-1 and il-6 were observed in nonimmunized mice , which correlates with elevated bacterial burden .
it could be assumed that these cytokines are also induced by the immunization to promote th17 responses .
the role of such responses should be investigated using ko mice that are deficient in these pathways .
a list of commercially available genetic ko mice for studying t helper responses in a. baumannii infection is summarized in table 1 .
antimicrobial peptides ( amps ) are another attractive solution in combating a. baumannii infection and several amps have been shown to have in vitro activities against a. baumannii including mastoparan and ll37 .
th17 cytokines including il-17 and il-22 are inducers of many amps such as -defensin-2 , lipocalin 2 , and the s100 family proteins from barrier tissues such as gut , skin , and lung .
the activities of these amps on a. baumannii have not been carefully examined . however , th17 cytokine inducible amps could potentially be used in treating antibiotic resistant infections .
indeed , reg3 , regulated by il-22 , has been shown to be highly effective in killing methicillin - resistant staphylococcus aureus .
the potential role of the il-17 pathway in a. baumannii infections is summarized in figure 1 .
the increasing public threat posed by a. baumannii infections has greatly intensified clinical and research interest .
significant advances have been made towards understanding the mechanisms of its resistance to antibiotics and hospital hygiene procedures .
accumulating evidence on host - bacterial interactions and the host immune responses could impact available disease treatment .
th17 cells are a critical t - cell subset in controlling gram - negative bacteria at mucosal barriers and could play a significant role in a. baumannii infection . identifying exact host immune pathways induced by a. baumannii infection or immunization will facilitate the discovery of new pharmacological and immunological drug targets to help combat this emerging public health crisis . | acinetobacter baumannii is a significant cause of severe hospital - acquired infections with a recent rise in multidrug - resistant infections involving traumatic wounds of military personnel .
the interleukin-17 ( il-17 ) pathway is essential for neutrophil recruitment in response to a variety of pathogens , while the control of a. baumannii infection is known to be dependent on neutrophils .
this suggests that il-17 may play an important role in a. baumannii infection ; however , this has yet to be studied . here ,
we summarize the recent advances in understanding the host - pathogen interaction of a. baumannii and propose a potential role of the il-17 pathway in generating a protective immune response . |
idiopathic pulmonary fibrosis ( ipf ) is a specific form of chronic , progressive , fibrosing interstitial pneumonia of unknown cause that occurs primarily in older adults .
pulmonary hypertension ( ph ) describes a group of devastating diseases causing breathlessness , loss of exercise capacity , and death due to right heart failure .
data regarding the presence and significance of ph mainly came from ipf patients who were evaluated for lung transplantation .
the incidence of ph in ipf patients ranged from 8.1% to 86.4% , due to different measurement time of ph during the course of the disease , diverse diagnosis method and criteria used to define ph .
previous studies demonstrated that reduced diffusing capacity of the lung for carbon monoxide ( dlco ) or supplemental oxygen requirement or impaired exercise capacity might better reflect coexistence of ph in ipf patients .
found that pulmonary function parameters such as forced vital capacity ( fvc ) and total lung capacity ( tlc ) had a poor relationship with ph .
in addition , studies showed that plasma brain natriuretic peptide ( bnp ) correlated with systolic pulmonary artery pressure ( spap ) in ipf patients and could be used as a biomarker to assess the prognosis of ipf patients with ph .
all of these studies indicated that ph might not be the rare event in ipf patients and contribute to the pathophysiological and clinical features of ipf .
the aim of this study was to investigate the incidence of ph in ipf patients and to evaluate the correlation between spap and clinical parameters in a single center in china .
the study population was selected from the database of beijing institute of respiratory medicine interstitial lung disease group , beijing chao - yang hospital , capital medical university , china .
diagnosis of ipf was based on the criteria of the american thoracic society and european respiratory society ( ats / ers ) consensus classification of idiopathic interstitial pneumonias ( iips ) .
all the patients fulfilled the criteria : ( 1 ) compatible clinical manifestations such as progressive dyspnea and bilateral predominantly basal crackles ; ( 2 ) restrictive lung functional defect and gas exchange impairment ; ( 3 ) typical abnormalities indicative of usual interstitial pneumonitis ( uip ) on chest high resolution computerized tomography ( hrct ) including bilateral lung reticular abnormality with predominantly basal / subpleural honeycombing and/or traction bronchiectasis ; ( 4 ) bronchoalveolar lavage fluid profiles in accordance with uip or / and pathological features indicative of uip on surgical lung biopsy ; ( 5 ) no evidence of known causes of pulmonary fibrosis .
patients who fulfilled the following criteria were excluded : ( 1 ) other types of interstitial lung disease ( ild ) , such as connective tissue disease - ild , drug - induced ild , or other types of iip ; ( 2 ) acute pulmonary embolism or chronic thromboembolic ph ; ( 3 ) left heart function failure and other heart diseases ; ( 4 ) chest hrct , pulmonary function , blood gas analysis and echocardiography data were missing . the flow chart of the patient enrollment in the study is represented in figure 1 . flow chart of the study population enrollment .
ild : interstitial lung disease ; ctd : connective tissue disease ; ipf : idiopathic pulmonary fibrosis .
the study protocol was approved by the human ethics review committee of the beijing chao - yang hospital , capital medical university , china . written informed consent was obtained from all the patients .
smoking status was defined as current smokers ( a minimum of one cigarette a day for a minimum of 1-year without cessation , or stopped smoking < 12 months before clinical presentation ) , ex - smokers ( a minimum of one cigarette a day for a minimum of 1-year but had stopped smoking for at least 12 months before clinical presentation ) and nonsmokers .
dyspnea was evaluated by self - assessment according to the modified borg dyspnea scale and graded from 0 ( no dyspnea ) to 10 ( maximal imaginable dyspnea ) .
lung volumes and dlco were measured by master screen ( jaeger , wrzburg , germany ) using the routine method .
the parameters included the predicted percentage of maximal vc , the predicted percentage of fvc , the predicted percentage of tlc , and predicted percentage of dlco ( dlco % pred ) .
arterial blood gas analysis was measured by alb 700 ( radiometer medical bronshoj , denmark ) .
arterial partial pressure of oxygen ( pao2 ) , oxygen saturation ( sao2 ) and the inspired oxygen concentration ( fio2 ) were recorded .
doppler transthoracic echocardiography ( philips ie33 , washington , usa ) was routinely made according to the diagnostic evaluation protocol of ild .
the tricuspid regurgitation pressure gradient ( trpg ) was calculated according to the modified bernoulli equation : trpg = 4 ( trv ) and spap was calculated from the equation : spap = trpg + estimated right atrial pressure .
ph was defined as an estimated spap > 50 mmhg by doppler echocardiography based on the 2009 european society of cardiology ( esc)/ers ph guideline and was divided into three grades : ( 1 ) ph unlikely : trv 2.8 m / s , spap 36 mmhg .
( 2 ) ph possible : trv 2.93.4 m / s , spap 3750 mmhg . ( 3 )
plasma n - terminal fragment of pro - bnp ( nt - pro bnp ) was detected by using rapid detection kit ( colloidal gold method ) in fia-8000 immunoassay analyzer ( pulang nanjing medical equipment limited company , jiangsu , china ) .
the range of normal value is 0228 pg / ml . statistical analysis was performed with spss 17.0 software package ( spss inc . ,
categorical data were reported as frequencies and percentages , and continuous variables were expressed as mean standard deviation or as median and interquartile range unless stated otherwise .
nonparametric test and analysis of variance were used to compare the difference of clinical parameters among groups .
multiple linear regression analysis was used to find potential factors affecting the outcome of patients .
the correlation between clinical parameters and spap was analyzed with pearson correlation if continuous variables were in the normal distribution and with the spearman rank correlation if continuous variables were not in the normal distribution , respectively .
the study population was selected from the database of beijing institute of respiratory medicine interstitial lung disease group , beijing chao - yang hospital , capital medical university , china .
diagnosis of ipf was based on the criteria of the american thoracic society and european respiratory society ( ats / ers ) consensus classification of idiopathic interstitial pneumonias ( iips ) .
all the patients fulfilled the criteria : ( 1 ) compatible clinical manifestations such as progressive dyspnea and bilateral predominantly basal crackles ; ( 2 ) restrictive lung functional defect and gas exchange impairment ; ( 3 ) typical abnormalities indicative of usual interstitial pneumonitis ( uip ) on chest high resolution computerized tomography ( hrct ) including bilateral lung reticular abnormality with predominantly basal / subpleural honeycombing and/or traction bronchiectasis ; ( 4 ) bronchoalveolar lavage fluid profiles in accordance with uip or / and pathological features indicative of uip on surgical lung biopsy ; ( 5 ) no evidence of known causes of pulmonary fibrosis .
patients who fulfilled the following criteria were excluded : ( 1 ) other types of interstitial lung disease ( ild ) , such as connective tissue disease - ild , drug - induced ild , or other types of iip ; ( 2 ) acute pulmonary embolism or chronic thromboembolic ph ; ( 3 ) left heart function failure and other heart diseases ; ( 4 ) chest hrct , pulmonary function , blood gas analysis and echocardiography data were missing . the flow chart of the patient enrollment in the study is represented in figure 1 . flow chart of the study population enrollment .
ild : interstitial lung disease ; ctd : connective tissue disease ; ipf : idiopathic pulmonary fibrosis .
the study protocol was approved by the human ethics review committee of the beijing chao - yang hospital , capital medical university , china . written informed consent was obtained from all the patients .
smoking status was defined as current smokers ( a minimum of one cigarette a day for a minimum of 1-year without cessation , or stopped smoking < 12 months before clinical presentation ) , ex - smokers ( a minimum of one cigarette a day for a minimum of 1-year but had stopped smoking for at least 12 months before clinical presentation ) and nonsmokers .
dyspnea was evaluated by self - assessment according to the modified borg dyspnea scale and graded from 0 ( no dyspnea ) to 10 ( maximal imaginable dyspnea ) .
lung volumes and dlco were measured by master screen ( jaeger , wrzburg , germany ) using the routine method .
the parameters included the predicted percentage of maximal vc , the predicted percentage of fvc , the predicted percentage of tlc , and predicted percentage of dlco ( dlco % pred ) .
arterial blood gas analysis was measured by alb 700 ( radiometer medical bronshoj , denmark ) .
arterial partial pressure of oxygen ( pao2 ) , oxygen saturation ( sao2 ) and the inspired oxygen concentration ( fio2 ) were recorded .
doppler transthoracic echocardiography ( philips ie33 , washington , usa ) was routinely made according to the diagnostic evaluation protocol of ild .
the tricuspid regurgitation pressure gradient ( trpg ) was calculated according to the modified bernoulli equation : trpg = 4 ( trv ) and spap was calculated from the equation : spap = trpg + estimated right atrial pressure .
ph was defined as an estimated spap > 50 mmhg by doppler echocardiography based on the 2009 european society of cardiology ( esc)/ers ph guideline and was divided into three grades : ( 1 ) ph unlikely : trv 2.8 m / s , spap 36 mmhg .
( 2 ) ph possible : trv 2.93.4 m / s , spap 3750 mmhg . ( 3 )
plasma n - terminal fragment of pro - bnp ( nt - pro bnp ) was detected by using rapid detection kit ( colloidal gold method ) in fia-8000 immunoassay analyzer ( pulang nanjing medical equipment limited company , jiangsu , china ) .
categorical data were reported as frequencies and percentages , and continuous variables were expressed as mean standard deviation or as median and interquartile range unless stated otherwise .
nonparametric test and analysis of variance were used to compare the difference of clinical parameters among groups .
multiple linear regression analysis was used to find potential factors affecting the outcome of patients .
the correlation between clinical parameters and spap was analyzed with pearson correlation if continuous variables were in the normal distribution and with the spearman rank correlation if continuous variables were not in the normal distribution , respectively .
of 119 ipf patients involved in this study , 101 were males and 18 females .
the average age at initial diagnosis as ipf was 68 ( 57 , 73 ) years .
89 patients ( 75% ) had a history of smoking , of which 20 patients ( 17% ) were current smokers .
one hundred and nineteen ipf patients were evaluated for spap by echocardiography and were diagnosed as : ph likely ( n = 28 , 23.5% ) , ph possible ( n = 20 , 16.8% ) , ph unlikely ( n = 71 , 59.7% ) , respectively .
the incidence of ph in ipf was 23.5% ( 28/119 ) when only likely ph was definite and the incidence of ph in ipf was 40.3% ( 48/119 ) when likely ph and possible ph were taken together .
as shown in table 1 , there was no statistically significant difference in age , gender , disease duration among ipf patients with different spap . however , there was statistically significant difference in borg dyspnea score , sao2 , oi , the width of pulmonary artery and nt - pro bnp ( p < 0.05 ) .
the width of pulmonary artery and nt - pro bnp would be analyzed additionally , for the reason that they might not be the cause of inducing ph . by using multiple linear regression , there was a correlation between borg dyspnea score , sao2 and spap ( p < 0.05 ) .
y is spap , x1 is borg dyspnea score , and x2 is sao2 . in the case of constant sao2 ,
when the borg dyspnea score is constant , the risk of spap decreases by 0.023 when the sao2 increases by 1% .
clinical and physiological parameters related to ph in ipf patients data were presented as mean sd / medians and iqr or number ( % ) unless otherwise indicated . *
p1 value was obtained by using different statistical method to compare the difference of clinical parameters among ipf patients with different spap ; p2 value was obtained using multiple linear regression ; data on 53 patients were available .
ph : pulmonary hypertension ; sao2 : oxygen saturation ; oi : oxygen index ; fvc : forced vital capacity ; fev1 : forced expiratory volume in 1 s ; tlc : total lung capacity ; rv : residual volume ; dlco : diffusing capacity of the lung for carbon monoxide ; va : alveolar ventilation ; pa : pulmonary artery ; nt - pro bnp : n - terminal fragment of pro - brain natriuretic peptide ; sd : standard deviation ; iqr : interquartile range ; ipf : idiopathic pulmonary fibrosis .
similarly , a statistically significant difference was found in dlco % pred and dlco / alveolar ventilation(va ) % pred ( p < 0.05 ) .
no significant difference existed in fvc , forced expiratory volume in 1 s ( fev1 ) , tlc , fev1/fvc and residual volume ( rv)/tlc . by using multiple linear regression , there was a relationship between dlco % pred and spap ( p = 0.002 ) .
borg dyspnea score showed a significantly positive correlation with spap ( r = 0.467 , p < 0.001 ) .
conversely , sao2 showed a significantly negative correlation with spap ( r = 0.416 , p < 0.001 ) .
dlco % pred also showed a significantly negative correlation with spap ( r = 0.424 , p = 0.003 ) .
as shown in figure 2 , the pulmonary artery width and nt - pro bnp showed a significantly positive correlation with spap ( r = 0.513 , p < 0.001 ; r = 0.452 , p = 0.011 [ figure 2a and b ] ) .
correlation analysis between the pulmonary artery width and nt - pro bnp with spap in ipf patients , respectively .
( a ) a positive correlation was found between the pulmonary artery width and spap in subjects with ipf ( r = 0.513 , p < 0.001 ) ; ( b ) a positive correlation was found between nt - pro bnp and spap in subjects with ipf ( r = 0.452 , p = 0.011 ) .
spap : systolic pulmonary artery pressure ; nt - pro bnp : n - terminal fragment of pro - bnp ; ipf : idiopathic pulmonary fibrosis .
of 119 ipf patients involved in this study , 101 were males and 18 females .
the average age at initial diagnosis as ipf was 68 ( 57 , 73 ) years .
89 patients ( 75% ) had a history of smoking , of which 20 patients ( 17% ) were current smokers .
one hundred and nineteen ipf patients were evaluated for spap by echocardiography and were diagnosed as : ph likely ( n = 28 , 23.5% ) , ph possible ( n = 20 , 16.8% ) , ph unlikely ( n = 71 , 59.7% ) , respectively . the incidence of ph in ipf was 23.5% ( 28/119 ) when only likely ph was definite and the incidence of ph in ipf was 40.3% ( 48/119 ) when likely ph and possible ph were taken together .
as shown in table 1 , there was no statistically significant difference in age , gender , disease duration among ipf patients with different spap . however , there was statistically significant difference in borg dyspnea score , sao2 , oi , the width of pulmonary artery and nt - pro bnp ( p < 0.05 ) .
the width of pulmonary artery and nt - pro bnp would be analyzed additionally , for the reason that they might not be the cause of inducing ph . by using multiple linear regression , there was a correlation between borg dyspnea score , sao2 and spap ( p < 0.05 ) .
y is spap , x1 is borg dyspnea score , and x2 is sao2 . in the case of constant sao2 ,
when the borg dyspnea score is constant , the risk of spap decreases by 0.023 when the sao2 increases by 1% .
clinical and physiological parameters related to ph in ipf patients data were presented as mean sd / medians and iqr or number ( % ) unless otherwise indicated .
* p1 value was obtained by using different statistical method to compare the difference of clinical parameters among ipf patients with different spap ; p2 value was obtained using multiple linear regression ; data on 53 patients were available .
ph : pulmonary hypertension ; sao2 : oxygen saturation ; oi : oxygen index ; fvc : forced vital capacity ; fev1 : forced expiratory volume in 1 s ; tlc : total lung capacity ; rv : residual volume ; dlco : diffusing capacity of the lung for carbon monoxide ; va : alveolar ventilation ; pa : pulmonary artery ; nt - pro bnp : n - terminal fragment of pro - brain natriuretic peptide ; sd : standard deviation ; iqr : interquartile range ; ipf : idiopathic pulmonary fibrosis .
similarly , a statistically significant difference was found in dlco % pred and dlco / alveolar ventilation(va ) % pred ( p < 0.05 ) .
no significant difference existed in fvc , forced expiratory volume in 1 s ( fev1 ) , tlc , fev1/fvc and residual volume ( rv)/tlc . by using multiple linear regression , there was a relationship between dlco % pred and spap ( p = 0.002 ) .
borg dyspnea score showed a significantly positive correlation with spap ( r = 0.467 , p < 0.001 ) .
conversely , sao2 showed a significantly negative correlation with spap ( r = 0.416 , p < 0.001 ) .
dlco % pred also showed a significantly negative correlation with spap ( r = 0.424 , p = 0.003 ) .
as shown in figure 2 , the pulmonary artery width and nt - pro bnp showed a significantly positive correlation with spap ( r = 0.513 , p < 0.001 ; r = 0.452 , p = 0.011 [ figure 2a and b ] ) .
correlation analysis between the pulmonary artery width and nt - pro bnp with spap in ipf patients , respectively .
( a ) a positive correlation was found between the pulmonary artery width and spap in subjects with ipf ( r = 0.513 , p < 0.001 ) ; ( b ) a positive correlation was found between nt - pro bnp and spap in subjects with ipf ( r = 0.452 , p = 0.011 ) .
spap : systolic pulmonary artery pressure ; nt - pro bnp : n - terminal fragment of pro - bnp ; ipf : idiopathic pulmonary fibrosis .
recently , awareness of complications and comorbid conditions associated with ipf is increasing because they can affect disease outcome and survival . the gold standard for diagnosis of ph
is mean pap above 25 mmhg at rest as assessed by right heart catheterization ( rhc ) .
noninvasive doppler transthoracic echocardiography is done clinically as an alternative approach for the detection of ph .
however , no consistent and reliable spap cut - off value was used for echocardiographic diagnosis of ph until recently .
we conducted an investigation of ph in ipf patients by using doppler echocardiography to evaluate spap .
ph was diagnosed by spap > 50 mmhg based on the echocardiographic diagnosis criteria described in 2009 esc / ers ph guidelines in a single center of china .
the main findings in our study were : ( 1 ) the incidence of ph in ipf patients was 23.5% .
( 2 ) in ipf patients with ph , borg dyspnea score was positively while sao2 and dlco % pred was negatively correlated with spap .
( 3 ) nt - pro bnp and the pulmonary artery width were positively correlated with spap .
the presence of ph has been associated with increased risk of mortality for patients with ipf .
the incidence of ph in ipf patients was variable depending on the measuring methods of spap or diagnostic criteria of ph as well as study population .
the reported incidence of ph in ipf patients was mostly gained during the end stage recommended for lung transplantation .
however , ph is a common complication in patients with ipf assessed by echocardiography and is not limited in patients with advanced disease .
defined ph as spap 40 mmhg by doppler echocardiography and showed that the incidence of ph in ipf patients was 36% .
recently , another two studies reported a higher incidence of ph ( 39.7 55.0% ) in ipf patients , based on spap > 36 mmhg by echocardiography . the 23.5% incidence of ph in ipf in the current study is lower than the aforementioned report because of the use of more strict criteria of spap > 50 mmhg
however , the incidence of ph in ipf patients was 40.3% if likely ph and possible ph were pooled up , or ph was defined as spap > 36 mmhg .
nadrous et al . reported that the incidence of ph in ipf patients was 84.1% when ph was defined as spap 36 mmhg by doppler echocardiography , but the incidence was 30.7% if ph was defined as spap > 50 mmhg , which is still higher than our outcomes .
it is possible that the lower incidence of ph in our current study might be due to the fact that every patient was initially diagnosed as ipf .
it was a pity that we could not evaluate the extent of the disease by chest hrct and pulmonary function parameters . in our study
, we found that there was statistically significant difference in borg dyspnea score , sao2 , and dlco % pred among ipf patients with different degree of ph .
borg dyspnea score showed a significant positive c orrelation with spap and sao2 or dlco % pred showed a significant negative correlation with spap , which suggests that borg dyspnea score , sao2 , and dlco % pred may be predictors of spap .
borg dyspnea score , sao2 , and dlco % pred may reflect hypoxic condition of ipf patients .
therefore , hypoxemia would be one of the mechanisms , which induces the development of ph in ipf patients .
studies reported that spap elevations had a significant association with oxygen requirements in ipf patients .
also confirmed that patients with signs of ph also seemed to benefit from pulmonary rehabilitation ( pr ) .
therefore , long - term oxygen therapy to improve the anoxic condition and pr to improve respiratory function should be recommended to ipf patients with hp .
survival of patients with ph is closely related to right ventricular ( rv ) function .
both pulmonary artery width and nt - pro bnp are the markers of reflecting right heart function .
studies confirmed that the plasma level of bnp correlated with the elevation of spap and was a predictor to prognosis of ipf .
moreover , nt - pro bnp correlates with spap better than bnp and shows less variability .
our study showed that both nt - pro bnp and pulmonary artery width were positively correlated with spap in ipf patients .
echocardiography and nt - pro bnp measurement , as the noninvasive , repeatable , and inexpensive methods , can be used widely to detect rv dysfunction in ipf patients .
first , the lack of rhc to confirm the presence and degree of ph might result in false estimation of the incidence of ph .
second , the outcome might be influenced by the potential patients selecting biases from a single center .
on the other hand , the protocols for ipf and ph diagnosis were relatively consistent . in spite of the above - mentioned limitations , the current study has its peculiar clinical value .
rhc is not used as a routine tool because it is an invasive procedure and could cause some morbidity ( 1.1% ) and mortality ( 0.055% ) even when performed at experienced centers .
doppler echocardiography is noninvasive , convenient , inexpensive , widely available and even relatively reliable for evaluating ph .
a meta - analysis summarized that the correlation coefficient of spap estimated by echocardiography versus rhc was 0.70 , and the sensitivity and specificity of echocardiography in diagnosing ph are 83% and 72% , respectively . in conclusion , the present study showed that the incidence of ph in ipf patients was 23.5% at a tertiary referral center in china .
the increased borg dyspnea score , decreased sao2 , and reduced dlco % pred were all associated with an elevation of spap in ipf patients .
therefore , in patients with ipf , evaluating the presence of ph may be useful in determining disease prognosis and evolution .
well - designed , prospective , longitudinal , multicenter studies are needed in the future . | background : pulmonary hypertension ( ph ) frequently complicates the course of idiopathic pulmonary fibrosis ( ipf ) patients and is associated with significantly worse outcomes .
the aim of the present study was to investigate the incidence of ph in ipf patients and evaluate the correlation between clinical parameters and systolic pulmonary artery pressure ( spap).methods : hospitalized patients with ipf , who were evaluated for spap by doppler echocardiography from january 2004 to december 2011 , were enrolled in our study .
patients were defined as ph by an estimated spap > 50 mmhg and graded as ph likely , ph possible and ph unlikely , based on the 2009 european society of cardiology / european respiratory society ph guidelines .
the correlations between clinical parameters and spap were analyzed by multiple linear regression.results:totally , 119 ipf patients were enrolled in our study and 28 ( 23.5% ) , 20 ( 16.8% ) and 71 ( 59.7% ) patients were ph likely , ph possible and ph unlikely , respectively .
borg dyspnea score was positively correlated with spap , r = 0.467 , p < 0.001 .
oxygen saturation was negatively correlated with spap , r = 0.416 , p < 0.001 . diffusing capacity of the lung for carbon monoxide percentage predicted was negatively correlated with spap , r = 0.424 , p = 0.003 .
n - terminal fragment of pro - brain natriuretic peptide and pulmonary artery width was positively correlated with spap , r = 0.452 , p = 0.011 and r = 0.513 , p < 0.001 , respectively.conclusions:the incidence of ph in ipf patients was 23.5% in a single center of china .
ph may worsen the dyspnea , right heart dysfunction and decrease the life quality of the patients with ipf . |
neoadjuvant chemotherapy ( nac ) treatment for women diagnosed with local - regional disease has been shown to reduce the tumor size of most breast tumors and decrease the incidence of positive nodes .
the 5- and 9-year follow - up results from the national surgical adjuvant breast and bowel project b-18 indicate overall survival and disease - free survival were not statistically different between nac and postoperative adjuvant therapy .
overall survival , disease - free survival , and relapse - free survival are statistically correlated with the pathologic primary tumor response .
physical examination , ultrasound , and mammography are of limited value for predicting pathologic residual tumor size after nac .
the use of fluorodeoxyglucose positron emission tomography ( fdg - pet ) to provide a functional measure of nac response has been reported .
breast magnetic resonance imaging ( mri ) is increasingly considered as the preferred imaging modality for predicting pathologic response .
the translational breast cancer research consortium trial 017 observed that the tumor size from mri had an overall accuracy of 74% in predicting complete pathologic response and it varied substantially among tumor subtypes .
another study using mri observed that changes in tumor volume provided a more sensitive assessment than changes in tumor size . the american college of radiology imaging network 6657 trial noted that tumor volume changes assessed using mri early in the nac cycle had an accuracy of 0.7 for predicting pathologic response .
the study reported that the in - plane spatial resolution for contrast - enhanced mri was 1 mm or less and that the slice thickness was 2.5 mm or less .
prior studies with dedicated breast computed tomography ( bct ) have shown the ability to provide isotropic voxel dimensions of 0.273 mm or less .
even without contrast enhancement , desmoplastic reaction and density changes can be discerned with bct and clinical studies have shown an improvement in visualizing soft - tissue abnormalities with bct compared to mammography . to our knowledge , there have been no prior reports investigating the use of dedicated bct for monitoring nac response .
hence , this prospective pilot study was conducted to determine the feasibility of non - contrast dedicated bct as an imaging tool to determine primary tumor volume and monitor its changes during nac .
this prospective study was conducted in adherence to a health insurance portability and accountability act - compliant , institutional review board - approved protocol .
twelve women consented to participate in this pilot feasibility study , which is closed for accrual , of which one participant elected to undergo mastectomy in lieu of nac and was excluded . prior to initiation of nac , 10 of the 11 study participants had a breast mri exam ( one subject had a fdg - pet exam ) for extent - of - disease evaluation as part of standard - of - care .
the tumor size from breast mri , breast density from mammography assessed as per the american college of radiology bi - rads criteria , receptor status , diagnosis from histopathology , and the drug combination used for nac are summarized in table 1 .
summary of study participants data all study participants were imaged using a clinical prototype dedicated bct system ( koning corporation , west henrietta ,
the system uses a tungsten - anode x - ray tube operating at 49 kvp , an amorphous silicon flat - panel detector , and acquires 300 projections covering 360 in 10 s. the mean glandular dose ( mgd ) from a bct scan is similar to and within the range from diagnostic mammography .
the study participant was positioned prone on the patient support table with slight oblique rotation to facilitate inclusion of the axillary region and the breast was pendant through the aperture in the table .
the manufacturer - provided filtered - back projection algorithm was used to reconstruct the breast at isotropic voxel size of 0.273 mm .
all studies were performed without administration of contrast media . the imaging protocol called for each study participant to undergo non - contrast bct exams of the ipsilateral breast containing the index lesion at three time - points : pre - treatment- before starting nac ; mid - treatment- after 4 cycles of doxorubicin ( adriamycin ) and cyclophosphamide ( cytoxan ) and before 4 cycles of either paclitaxel ( taxol ) or the combination of 12 weekly cycles of paclitaxel ( taxol ) and trastuzumab ( herceptin ) for those who were her2-neu positive ; and , post - treatment- after completion of nac .
of the 11 women who were enrolled in the study and underwent nac , 2 study participants did not appear for their mid - treatment bct exam . where analysis permitted , bct volumes from these two study participants were included .
the reconstructed breast volumes were displayed on a 3-d workstation ( visage 7 ; visage imaging inc . , san diego , ca , usa ) provided with the bct system .
the workstation facilitates viewing of the breast volume in any desired orientation and includes tools for image manipulation and quantitative analysis . a single radiologist ( study author )
marked the tumor boundary in multiple coronal views , from which the workstation computed the tumor volume [ figure 1 ] .
the tumor volume from radiologist 's manual segmentation served as the reference for comparison with the estimate from automated segmentation .
volume - rendered ( 3-d ) breast ct images show the tumor volume obtained at ( a ) pre - treatment , ( b ) mid - treatment , and ( c ) post - treatment .
natick , ma , usa ) was developed [ figure 2 ] by partly utilizing techniques for segmenting breast tissue in tomographic images .
the skin layer was removed so as to minimize the possibility of skin being classified as tumor , when the tumor is at breast periphery . for the pre - treatment bct exam ,
after excluding the coronal slices that contained the biopsy clip to mitigate beam - hardening artifacts , the breast volume was divided into regions posterior and anterior to the clip .
since the biopsy clip was 3 mm in size , a total of 11 slices , each 0.273 mm thick , were excluded .
a bilateral filter was applied to each region for edge - preserving noise reduction prior to segmentation .
each region was segmented using two iterations of kernel - based fuzzy c - means algorithm .
the first iteration classified the breast volume into adipose and non - adipose tissues , and the second iteration used the non - adipose tissue volume to classify it into fibroglandular and cancerous tissues .
the biopsy clip location was translated to the boundary of the posterior and anterior regions and served as a location - seed for a volume - growing algorithm applied to the cancerous tissue .
the tumor volume was determined after interpolating for the slices that were excluded due to the clip .
the mid - treatment and post - treatment bct exams were registered with the pre - treatment bct exam using 3d slicer , as the biopsy clip may migrate over time .
the tumor from mid - treatment and post - treatment bct exams was segmented in a similar manner as the pre - treatment bct exam .
once the tumor was segmented , an automated algorithm was used to determine the largest extent of tumor ( size ) in the sagittal plane that corresponds to the manner in which the specimen is sectioned by pathology to determine concordancy with pathology .
the automated algorithm with two iterations of kernel - based fuzzy c - means ( kfcm ) segmentation .
( a d ) cross - sectional ( coronal ) slices from post - treatment bct exam performed prior to surgery show the contour ( red ) of the tumor segmented using the developed algorithm .
the largest tumor dimension ( size ) was estimated over all sagittal planes that correspond to the manner in which the surgical specimen is sectioned by pathology .
parametric or non - parametric tests ( sas 9.3 ; sas institute inc . , cary , nc , usa ) , depending on the results from normality test ( shapiro wilk test ) , were used to analyze the correlation in tumor volumes between the modalities ( mri and bct ) and between the segmentation methods ( automated and manual ) .
if the data did not satisfy the normality assumption , then logarithmic transform was attempted .
the correlation between the tumor sizes obtained from post - treatment bct and from pathology was determined .
this prospective study was conducted in adherence to a health insurance portability and accountability act - compliant , institutional review board - approved protocol .
twelve women consented to participate in this pilot feasibility study , which is closed for accrual , of which one participant elected to undergo mastectomy in lieu of nac and was excluded . prior to initiation of nac , 10 of the 11 study participants had a breast mri exam ( one subject had a fdg - pet exam ) for extent - of - disease evaluation as part of standard - of - care .
the tumor size from breast mri , breast density from mammography assessed as per the american college of radiology bi - rads criteria , receptor status , diagnosis from histopathology , and the drug combination used for nac are summarized in table 1 .
all study participants were imaged using a clinical prototype dedicated bct system ( koning corporation , west henrietta , ny , usa ) .
the system uses a tungsten - anode x - ray tube operating at 49 kvp , an amorphous silicon flat - panel detector , and acquires 300 projections covering 360 in 10 s. the mean glandular dose ( mgd ) from a bct scan is similar to and within the range from diagnostic mammography .
the study participant was positioned prone on the patient support table with slight oblique rotation to facilitate inclusion of the axillary region and the breast was pendant through the aperture in the table .
the manufacturer - provided filtered - back projection algorithm was used to reconstruct the breast at isotropic voxel size of 0.273 mm .
the imaging protocol called for each study participant to undergo non - contrast bct exams of the ipsilateral breast containing the index lesion at three time - points : pre - treatment- before starting nac ; mid - treatment- after 4 cycles of doxorubicin ( adriamycin ) and cyclophosphamide ( cytoxan ) and before 4 cycles of either paclitaxel ( taxol ) or the combination of 12 weekly cycles of paclitaxel ( taxol ) and trastuzumab ( herceptin ) for those who were her2-neu positive ; and , post - treatment- after completion of nac . of the 11 women who were enrolled in the study and underwent nac
the reconstructed breast volumes were displayed on a 3-d workstation ( visage 7 ; visage imaging inc . , san diego , ca , usa ) provided with the bct system .
the workstation facilitates viewing of the breast volume in any desired orientation and includes tools for image manipulation and quantitative analysis . a single radiologist ( study author )
marked the tumor boundary in multiple coronal views , from which the workstation computed the tumor volume [ figure 1 ] .
the tumor volume from radiologist 's manual segmentation served as the reference for comparison with the estimate from automated segmentation .
volume - rendered ( 3-d ) breast ct images show the tumor volume obtained at ( a ) pre - treatment , ( b ) mid - treatment , and ( c ) post - treatment .
an automated segmentation algorithm ( matlab version 8.1 , the mathworks inc . , natick ,
ma , usa ) was developed [ figure 2 ] by partly utilizing techniques for segmenting breast tissue in tomographic images .
the skin layer was removed so as to minimize the possibility of skin being classified as tumor , when the tumor is at breast periphery . for the pre - treatment bct exam ,
the algorithm leveraged the tumor location indicated by the biopsy clip . after excluding the coronal slices that contained the biopsy clip to mitigate beam - hardening artifacts , the breast volume was divided into regions posterior and anterior to the clip .
since the biopsy clip was 3 mm in size , a total of 11 slices , each 0.273 mm thick , were excluded .
a bilateral filter was applied to each region for edge - preserving noise reduction prior to segmentation .
each region was segmented using two iterations of kernel - based fuzzy c - means algorithm .
the first iteration classified the breast volume into adipose and non - adipose tissues , and the second iteration used the non - adipose tissue volume to classify it into fibroglandular and cancerous tissues .
the biopsy clip location was translated to the boundary of the posterior and anterior regions and served as a location - seed for a volume - growing algorithm applied to the cancerous tissue .
the tumor volume was determined after interpolating for the slices that were excluded due to the clip .
the mid - treatment and post - treatment bct exams were registered with the pre - treatment bct exam using 3d slicer , as the biopsy clip may migrate over time .
the tumor from mid - treatment and post - treatment bct exams was segmented in a similar manner as the pre - treatment bct exam .
once the tumor was segmented , an automated algorithm was used to determine the largest extent of tumor ( size ) in the sagittal plane that corresponds to the manner in which the specimen is sectioned by pathology to determine concordancy with pathology .
the automated algorithm with two iterations of kernel - based fuzzy c - means ( kfcm ) segmentation .
( a d ) cross - sectional ( coronal ) slices from post - treatment bct exam performed prior to surgery show the contour ( red ) of the tumor segmented using the developed algorithm .
the largest tumor dimension ( size ) was estimated over all sagittal planes that correspond to the manner in which the surgical specimen is sectioned by pathology .
, cary , nc , usa ) , depending on the results from normality test ( shapiro wilk test ) , were used to analyze the correlation in tumor volumes between the modalities ( mri and bct ) and between the segmentation methods ( automated and manual ) .
if the data did not satisfy the normality assumption , then logarithmic transform was attempted .
altman plots . the influence of breast density on the estimated tumor volume was also investigated .
the correlation between the tumor sizes obtained from post - treatment bct and from pathology was determined .
the distribution of the difference in tumor volumes between manual and automated segmentations after grouping over all three time points ( pre- , mid- , and post - treatment ) did not satisfy the normality assumption ( shapiro wilk test , p = 0.043 ) and needed logarithmic transformation .
tumor volumes from automated and manual segmentations ( n = 31 bct scans ) were correlated ( pearson 's r = 0.935 , p < 0.001 ) . result from the linear regression analysis is shown in figure 4a , along with the identity line ( dashes ) .
the analysis showed high coefficient of determination ( r = 0.875 ) , and the fit - parameters indicated a non - zero intercept and a slope less than unity .
altman plot [ figure 4b ] was generated which showed good agreement with most of the data points located within the limits of agreement ( 1.96 standard deviation ) and a mean difference close to zero .
the possibility that breast density could influence the automated segmentation was investigated . the percent difference in tumor volume
was computed as , [ ( vmbct vabct)/vmbct ] 100% , where vmbct and vabct are the log - transformed tumor volumes from manual and automated segmentations , respectively .
this metric was not statistically different among the breast density categories ( kruskal wallis test , p = 0.169 ) .
repeated measures analysis of variance ( anova ) indicated that the segmentation methods ( automated or manual ) did not have a statistically significant effect on the tumor volumes ( p = 0.808 ) and that the changes in tumor volume over time were not dependent on the segmentation method ( wilk 's lambda , p = 0.316 ) . as expected , changes in tumor volume over the course of nac were statistically significant ( p < 0.001 ) .
( a ) linear regression analysis of tumor volumes from automated and radiologist 's manual segmentation .
( b ) bland altman plot showing the agreement in tumor volumes between automated and manual segmentation .
the tumor size from the pre - treatment breast mri ( n = 10 subjects ) interpretation report [ table 1 ] was used to estimate the tumor volume based either on ellipsoidal approximation for tumor shape when two or more dimensions were reported or on spherical approximation when only one dimension was reported . the pre - treatment tumor volume from mri
was compared with the pre - treatment tumor volume from bct that was obtained by averaging the estimates from automated and manual segmentations .
after logarithmic transformation , the tumor volumes satisfied the normality assumption ( shapiro wilk test , p > 0.316 ) .
log - transformed tumor volumes from mri and bct were statistically correlated ( pearson 's r = 0.905 , p < 0.001 )
. linear regression analysis [ figure 5a ] showed high coefficient of determination ( r = 0.819 ) , slope approaching unity ( 0.933 ) , and a non - zero intercept ( 0.124 ) .
altman plot [ figure 5b ] showed good agreement with all the data points located within the limits of agreement ( 1.96 standard deviation ) .
however , the mean difference was substantially different from zero . hence , the influence of mammographic breast density was investigated . the percent difference in tumor volumes between mri and bct
was calculated in a manner similar to above and did not exhibit a statistical difference among the breast density categories ( kruskal wallis test , p = 0.312 ) .
( a ) linear regression analysis of pre - treatment tumor volumes from mri and bct .
the tumor volumes from bct are represented by the mean and 1 standard deviation of the estimates from automated and radiologist 's segmentations .
( b ) bland altman plot showing the agreement in tumor volumes between mri and bct .
histopathology results indicated that three subjects had no residual invasive tumor , one subject had invasive ductal carcinoma ( idc ) with microscopic foci of 0.8 and 1 mm , and one subject had a 4 mm residual idc .
the presence of biopsy clip ( 3 mm ) in all subjects and associated beam - hardening artifacts in bct limited the ability to measure tumors of size approaching that of the biopsy clip .
hence , tumors smaller than 5 mm , which correspond to the upper bound for pt1 , a primary tumor classification , were excluded from the analysis .
also , pathology report indicated that one subject had scattered foci of residual invasive lobular carcinoma ( ilc ) in three quadrants spanning approximately 16 cm , of which the largest focus was 8 mm .
the tumor size determined from bct for this subject was 9.5 cm . limiting the analysis to idc of size larger than 5 mm ( n = 5 subjects )
, tumor size from post - treatment bct was statistically correlated with pathology ( pearson 's r = 0.987 , p = 0.002 ) .
also , the post - treatment tumor volume ( log - transformed ) from bct was statistically correlated with tumor size from pathology ( pearson 's r = 0.908 , p = 0.033 ) for this sub - group .
prior studies investigating concordance in tumor size between pathology and imaging modalities have used thresholds of 0.5 , 1 , and 2 cm . applying the median threshold from these studies ( 1 cm ) , all subjects in this sub - group ( ilc and pt1a or
smaller excluded ) were concordant [ figure 6 ] and the maximum difference in tumor size between pathology and post - treatment bct was 0.57 cm for a subject assigned pt1b with 0.8 cm idc . the absolute difference in tumor size between post - treatment bct and pathology
is plotted as a function of tumor size from pathology . for invasive ductal carcinoma ( idc ) and for tumors larger than 0.5 cm ( upper bound of pt1a primary tumor classification ) ,
temporal changes in tumor volume ( log - transformed ) determined using bct from pre - treatment to mid - treatment and from mid - treatment to post - treatment are shown in figure 7a and b , respectively . the tumor volumes from bct at each time point were obtained by averaging the estimates from automated and manual segmentations .
reduction in tumor volume was observed at mid - treatment [ figure 7a ] and was statistically different from pre - treatment tumor volume ( paired t - test , p = 0.0003 ) .
the intercept from the linear regression analysis indicates that the tumor volume reduction averaged across all nine subjects who appeared for mid - treatment bct was 47% ( 110 ) .
adapting the response evaluation criteria in solid tumors ( recist 1.1 ) which is intended for tumor size , all study participants who appeared for the mid - treatment bct exam experienced at least a 30% reduction in tumor volume from pre - treatment . a further reduction in tumor volume from mid - treatment to post - treatment ( paired t - test , p = 0.002 )
comparison of the largest tumor dimension from pre - treatment mri with the tumor size from pathology showed a reduction in tumor size for all subjects , indicating qualitative agreement with the temporal volume changes observed with bct .
pathology confirmed partial ( n = 8 subjects ) or complete ( n = 3 subjects ) response for invasive tumor .
the proportion of subjects with pathologic complete response was 27.3% ( 3/11 ) for subjects treated with doxorubicin ( adriamycin ) , cyclophosphamide ( cytoxan ) , paclitaxel ( taxol ) ( act ) drug combination [ table 1 ] and is similar to the 26% reported in nsabp - b27 trial .
temporal changes in tumor volume determined using bct ( a ) from pre - treatment to mid - treatment and ( b ) from mid - treatment to post - treatment .
the distribution of the difference in tumor volumes between manual and automated segmentations after grouping over all three time points ( pre- , mid- , and post - treatment ) did not satisfy the normality assumption ( shapiro wilk test , p = 0.043 ) and needed logarithmic transformation .
tumor volumes from automated and manual segmentations ( n = 31 bct scans ) were correlated ( pearson 's r = 0.935 , p < 0.001 ) . result from the linear regression analysis is shown in figure 4a , along with the identity line ( dashes ) .
the analysis showed high coefficient of determination ( r = 0.875 ) , and the fit - parameters indicated a non - zero intercept and a slope less than unity .
altman plot [ figure 4b ] was generated which showed good agreement with most of the data points located within the limits of agreement ( 1.96 standard deviation ) and a mean difference close to zero .
the possibility that breast density could influence the automated segmentation was investigated . the percent difference in tumor volume
was computed as , [ ( vmbct vabct)/vmbct ] 100% , where vmbct and vabct are the log - transformed tumor volumes from manual and automated segmentations , respectively .
this metric was not statistically different among the breast density categories ( kruskal wallis test , p = 0.169 ) .
repeated measures analysis of variance ( anova ) indicated that the segmentation methods ( automated or manual ) did not have a statistically significant effect on the tumor volumes ( p = 0.808 ) and that the changes in tumor volume over time were not dependent on the segmentation method ( wilk 's lambda , p = 0.316 ) . as expected , changes in tumor volume over the course of nac were statistically significant ( p < 0.001 ) .
( a ) linear regression analysis of tumor volumes from automated and radiologist 's manual segmentation .
( b ) bland altman plot showing the agreement in tumor volumes between automated and manual segmentation .
the tumor size from the pre - treatment breast mri ( n = 10 subjects ) interpretation report [ table 1 ] was used to estimate the tumor volume based either on ellipsoidal approximation for tumor shape when two or more dimensions were reported or on spherical approximation when only one dimension was reported . the pre - treatment tumor volume from mri
was compared with the pre - treatment tumor volume from bct that was obtained by averaging the estimates from automated and manual segmentations .
after logarithmic transformation , the tumor volumes satisfied the normality assumption ( shapiro wilk test , p > 0.316 ) .
log - transformed tumor volumes from mri and bct were statistically correlated ( pearson 's r = 0.905 , p < 0.001 ) .
linear regression analysis [ figure 5a ] showed high coefficient of determination ( r = 0.819 ) , slope approaching unity ( 0.933 ) , and a non - zero intercept ( 0.124 ) .
altman plot [ figure 5b ] showed good agreement with all the data points located within the limits of agreement ( 1.96 standard deviation ) .
hence , the influence of mammographic breast density was investigated . the percent difference in tumor volumes between mri and bct
was calculated in a manner similar to above and did not exhibit a statistical difference among the breast density categories ( kruskal wallis test , p = 0.312 ) .
( a ) linear regression analysis of pre - treatment tumor volumes from mri and bct .
the tumor volumes from bct are represented by the mean and 1 standard deviation of the estimates from automated and radiologist 's segmentations .
( b ) bland altman plot showing the agreement in tumor volumes between mri and bct .
histopathology results indicated that three subjects had no residual invasive tumor , one subject had invasive ductal carcinoma ( idc ) with microscopic foci of 0.8 and 1 mm , and one subject had a 4 mm residual idc .
the presence of biopsy clip ( 3 mm ) in all subjects and associated beam - hardening artifacts in bct limited the ability to measure tumors of size approaching that of the biopsy clip .
hence , tumors smaller than 5 mm , which correspond to the upper bound for pt1 , a primary tumor classification , were excluded from the analysis .
also , pathology report indicated that one subject had scattered foci of residual invasive lobular carcinoma ( ilc ) in three quadrants spanning approximately 16 cm , of which the largest focus was 8 mm .
the tumor size determined from bct for this subject was 9.5 cm . limiting the analysis to idc of size larger than 5 mm ( n = 5 subjects )
, tumor size from post - treatment bct was statistically correlated with pathology ( pearson 's r = 0.987 , p = 0.002 ) .
also , the post - treatment tumor volume ( log - transformed ) from bct was statistically correlated with tumor size from pathology ( pearson 's r = 0.908 , p = 0.033 ) for this sub - group .
prior studies investigating concordance in tumor size between pathology and imaging modalities have used thresholds of 0.5 , 1 , and 2 cm . applying the median threshold from these studies ( 1 cm ) , all subjects in this sub - group ( ilc and pt1a or smaller excluded ) were concordant [ figure 6 ] and the maximum difference in tumor size between pathology and post - treatment bct was 0.57 cm for a subject assigned pt1b with 0.8 cm idc . the absolute difference in tumor size between post - treatment bct and pathology
for invasive ductal carcinoma ( idc ) and for tumors larger than 0.5 cm ( upper bound of pt1a primary tumor classification ) , tumor size from bct was concordant with pathology at 1 cm threshold .
temporal changes in tumor volume ( log - transformed ) determined using bct from pre - treatment to mid - treatment and from mid - treatment to post - treatment are shown in figure 7a and b , respectively . the tumor volumes from bct at each time point were obtained by averaging the estimates from automated and manual segmentations . the identity line is included for visual analysis .
reduction in tumor volume was observed at mid - treatment [ figure 7a ] and was statistically different from pre - treatment tumor volume ( paired t - test , p = 0.0003 ) .
the intercept from the linear regression analysis indicates that the tumor volume reduction averaged across all nine subjects who appeared for mid - treatment bct was 47% ( 110 ) .
adapting the response evaluation criteria in solid tumors ( recist 1.1 ) which is intended for tumor size , all study participants who appeared for the mid - treatment bct exam experienced at least a 30% reduction in tumor volume from pre - treatment . a further reduction in tumor volume from mid - treatment to post - treatment ( paired t - test , p = 0.002 )
comparison of the largest tumor dimension from pre - treatment mri with the tumor size from pathology showed a reduction in tumor size for all subjects , indicating qualitative agreement with the temporal volume changes observed with bct .
pathology confirmed partial ( n = 8 subjects ) or complete ( n = 3 subjects ) response for invasive tumor .
the proportion of subjects with pathologic complete response was 27.3% ( 3/11 ) for subjects treated with doxorubicin ( adriamycin ) , cyclophosphamide ( cytoxan ) , paclitaxel ( taxol ) ( act ) drug combination [ table 1 ] and is similar to the 26% reported in nsabp - b27 trial .
temporal changes in tumor volume determined using bct ( a ) from pre - treatment to mid - treatment and ( b ) from mid - treatment to post - treatment .
prior studies have used fuzzy c - means based approach for segmenting bct images to skin , adipose , and fibroglandular tissue .
it has been shown to be accurate to within 1.9% in estimating the volume of an irregular shaped object .
however , the presence of biopsy clip in all subjects limits the ability of the algorithm to determine tumor volume approaching the size of the clip .
this results in slope less than unity in the linear regression analysis [ figure 4a ] . excluding the three smallest tumors and repeating the linear regression analysis
the tumor volume from automated segmentation was higher than the manual ( radiologist 's ) segmentation for the three smallest tumors , suggesting that the beam - hardening artifacts from the biopsy clip had less influence on radiologist 's segmentation .
the beam - hardening artifacts from the biopsy clip can be suppressed by metal - artifact reduction algorithms .
this could potentially improve the accuracy for estimating the volume of smaller tumors and will be investigated in future . in the absence of multifocal or multicentric disease ,
ultrasound is often used for extent - of - disease evaluation . however , ultrasound has lower sensitivity than mri and underestimates the tumor size compared to mri
. a recent study of 149 cancers reported that the concordance and correlation with pathology was highest for mri and was better than mammography , ultrasound , or digital breast tomosynthesis .
hence , the choice of mri as reference standard for comparison with bct for extent - of - disease evaluation is appropriate .
comparison of tumor volumes from pre - treatment breast mri and bct indicated a negative intercept in the linear regression analysis [ figure 4a ] and a mean difference of 0.23 in the bland
it has also been noted that the contrast ( gd ) enhancement of the in situ component associated with the invasive tumor could be the source of overestimation with breast mri .
also , the tumor volume from mri was based on ellipsoidal or spherical approximation of tumor size from interpretation reports , as 3/10 subjects underwent breast mri at institutions not associated with the study .
a search of the pubmed database did not identify any prior reports investigating the use of dedicated bct for monitoring nac response or for evaluating tumor size .
however , there have been several studies using contrast - enhanced conventional ( chest ) ct to assess nac response for breast cancer and to determine the tumor size . in a study of 285 patients with unifocal invasive breast carcinoma , 80% concordance with pathology at 5 mm threshold
one study comparing contrast - enhanced and non - contrast chest ct for visualization of known breast tumors concluded that contrast enhancement is not needed to visualize known tumors in most patients .
one major advantage with dedicated bct compared to conventional ct is that the radiation dose is limited primarily to the breast with the rest of the body receiving minimal dose .
this is of particular importance if contrast enhancement and the determination of perfusion parameters were to be pursued , which seem to be of value in predicting the response to nac with conventional chest ct .
it is also important to consider the radiation dose from bct in the context of subsequent treatment .
post nac , patients undergo either mastectomy or breast conserving surgery followed by whole breast radiation therapy depending on the effectiveness of nac and other factors . for patients who undergo mastectomy ,
the radiation - associated risk from bct is negligible . for patients who undergo breast conserving surgery
this is 2 orders of magnitude higher or more than the cumulative dose from the three bct scans .
it is also relevant to note that the consensus statement on the use of accelerated partial breast irradiation ( apbi ) recommended that patients who underwent nac should not receive apbi outside of a clinical trial due to lack of sufficient data .
thus , the radiation - associated risk from dedicated bct for monitoring nac response is minimal .
this pilot study with a small number of study participants was intended to demonstrate the feasibility of non - contrast bct to measure tumor volume ( size ) and monitor its changes during nac .
the results from this feasibility study show promise and indicate that a larger study is warranted .
additional limitations of the study were that the tumor volume was determined by a single radiologist and that the tumor volume from mri was based solely on the radiologist 's report and not from segmentation .
a larger study is planned that would include concurrent breast mri and dedicated bct at each time point and measurements of tumor volume ( size ) by multiple radiologists to determine inter - observer variability .
this pilot study with a small number of study participants was intended to demonstrate the feasibility of non - contrast bct to measure tumor volume ( size ) and monitor its changes during nac .
the results from this feasibility study show promise and indicate that a larger study is warranted .
additional limitations of the study were that the tumor volume was determined by a single radiologist and that the tumor volume from mri was based solely on the radiologist 's report and not from segmentation .
a larger study is planned that would include concurrent breast mri and dedicated bct at each time point and measurements of tumor volume ( size ) by multiple radiologists to determine inter - observer variability .
in summary , this prospective study investigated the feasibility of non - contrast bct as an imaging tool to determine primary tumor volume and monitor its changes during nac .
an automated segmentation algorithm was developed and tumor volumes from the automated segmentation were correlated with radiologist 's segmentation . considering the study did not use contrast enhancement , the observations of reduction in tumor volume at mid - treatment in pathology - assessed responders , and statistical correlation and concordance in tumor size between bct and pathology at post - treatment for tumors ( idc ) larger than 5 mm are suggestive of potential benefits .
this suggests that contrast enhancement may not be necessary for all subjects and needs further validation .
also , the observation that a larger reduction in tumor volume occurred between pre - treatment and mid - treatment than between mid - treatment and post - treatment suggests that bct may be of value in predicting nac response by mid - treatment .
a larger study is needed to determine if tumor volume changes observed with bct are predictive of pathologic response .
the data also indicate that correction for beam - hardening effects from biopsy clip ( if present ) is needed to evaluate the size of smaller tumors .
while this study investigated the feasibility of bct for monitoring nac response , some of the observations may also be applicable for evaluating tumor size for diagnostic imaging and surgical planning .
the encouraging results from this feasibility study indicate that it would be of value to pursue larger studies . | objectives : in this prospective pilot study , the feasibility of non - contrast dedicated breast computed tomography ( bct ) to determine primary tumor volume and monitor its changes during neoadjuvant chemotherapy ( nac ) treatment was investigated.materials and methods : eleven women who underwent nac were imaged with a clinical prototype dedicated bct system at three time points pre- , mid- , and post - treatment .
the study radiologist marked the boundary of the primary tumor from which the tumor volume was quantified .
an automated algorithm was developed to quantify the primary tumor volume for comparison with radiologist 's segmentation .
the correlation between pre - treatment tumor volumes from bct and mri , and the correlation and concordance in tumor size between post - treatment bct and pathology were determined.results:tumor volumes from automated and radiologist 's segmentations were correlated ( pearson 's r = 0.935 , p < 0.001 ) and were not different over all time points [ p = 0.808 , repeated measures analysis of variance ( anova ) ] .
pre - treatment tumor volumes from mri and bct were correlated ( r = 0.905 , p < 0.001 ) .
tumor size from post - treatment bct was correlated with pathology ( r = 0.987 , p = 0.002 ) for invasive ductal carcinoma larger than 5 mm and the maximum difference in tumor size was 0.57 cm .
the presence of biopsy clip ( 3 mm ) limited the ability to accurately measure tumors smaller than 5 mm .
all study participants were pathologically assessed to be responders , with three subjects experiencing complete pathologic response for invasive cancer and the reminder experiencing partial response .
compared to pre - treatment tumor volume , there was a statistically significant ( p = 0.0003 , paired t - test ) reduction in tumor volume at mid - treatment observed with bct , with an average tumor volume reduction of 47%.conclusions : this pilot study suggests that dedicated non - contrast bct has the potential to serve as an expedient imaging tool for monitoring tumor volume changes during nac .
larger studies are needed in future . |
glucose-6-phosphate dehydrogenase ( g6pd ) ( e.c.1.1.1.49 ) is the key regulatory enzyme in the hexosemonophosphate shunt that catalyzes the oxidation of glucose 6- phosphate to 6-phosphogluconolactone ( 1 , 2 ) .
this first and rate - limiting step of shunt is associated with production of nicotinamide adenine dinucleotide ( nadph ) that is required for the generation of reduced glutathione , which is important for the protection against oxidative damages ( 3 ) .
more than 442 variants of human g6pd are known ( 4 ) ; many of them are associated with anemia resulting from the impaired ability of the erythrocyte to respond to toxic stress ( 2 , 5 ) .
precise molecular characterization of the g6pd gene showed that these 442 variants correspond to only 140 mutations .
these mutations cause g6pd deficiency , a common enzymopathy affecting over 400 million people worldwide ( 6 , 7 ) .
the disease can cause neonatal jaundice , drug- or infection - induced hemolytic crisis , favism , and nonspherocytic hemolytic anemia ( 4 , 8) . according to the level of enzyme activity , world health organization classified variants of g6pd to five groups ( 9 ) .
mediterranean variant with an estimated prevalence of 5% is the most common variant in southern europe , middle east and india .
rate of incidence of mediterranean mutation in turkey , iran , and india are 80% , 69% and 60.4% respectively ; in pakistan and saudi arabia the mediterranean mutation is the prevalent variant ( 10 , 11 ) .
this variant of g6pd is often associated with favism , an acute hemolytic crisis induced by ingestion of fava beans ( vicia faba ) by individuals deficient in glucose-6-phosphate dehydrogenase ( 12 ) .
vicine and convicine as natural occurring toxic compounds in vicia faba are involved in the formation of hemolytic anemia ( 13 ) .
clinical symptoms of favism are pallor , jaundice , hematuria , and acute hemolytic anemia that occurs suddenly 24 to 48 hours after consumption of fava beans .
depletion of reduced glutathione and impairment of some important enzymes induce oxidative stress in g6pd - deficient red blood cells and lead to acute hemolytic anemia ( 1419 ) .
although the typical presentation of the disease is extravascular hemolysis , intravascular hemolysis also occurs ( 2022 ) .
intravascular hemolysis is the destruction of red blood cells in the circulation with the release of cell contents such as hemoglobin into plasma ( 23 , 24 ) .
then free plasma hemoglobin is filtered through the kidney and cause hemoglobinuria that is one of the most prominent clinical signs of excessive intravascular hemolysis and can cause renal failure ( 2527 ) . in the other hand , extravascular hemolysis in favism
occurs when altered rbcs during oxidative damage are phagocytized by macrophages in the spleen , liver and bone marrow ; therefore , free hemoglobin is not released into plasma ( 20 , 22 , 28 ) .
eventhough some believe that the breakdown of hemoglobin by the reticuloendo- thelial system causes increase in plasma bilirubin , others say that this increase , is largely the result of an impairment of liver function caused by g6pd deficiency in the liver ( 29 , 30 ) . in spite of high prevalence of favism in many regions of iran
, fava is planted as a rich source of protein in these areas and since ingestion of fresh , dried or frozen forms of beans and even inhaling of its pollen can be associated with hemolytic events , favism patients can experience these episodes during the entire year .
it seems that frequent experience of these hemolytic episodes can have adverse effects on kidney and liver as the main organs involved in the hemolytic processes .
thus the purpose of the present investigation is to evaluate the kidney and liver functions in favism patients by assessment of serum parameters implicate these organs status .
this study was performed on 55 blood samples taken from individuals referring to iranshahr central hospital between january 2012 and september 2012 and their g6pd deficiency tests were positive by fluorescent spot method ( kimia pagouhan lot no 90607 ) .
short draw or hemolyzed samples and also sample of patients with history of liver and kidney disorders were excluded from the study and on remained samples , deficiency was subsequently confirmed by quantitative enzyme assays according to the manufacturer instructions ( biolabo - france )
. 90009 ) and blood urea nitrogen ( bun ) ( pars azmun lot no .
90009 ) for evaluation of kidney function were performed by mindray chemistry analayzer ( bs-200 china ) .
tests were also performed on an additional 60 random g6pd non- deficient individuals as control .
obtained data of study was analyzed by statistical package for social science ( spss ) software .
statistical independent t test was used to evaluate the significance of differences between two groups in mean of continuous variables .
obtained data of study was analyzed by statistical package for social science ( spss ) software .
statistical independent t test was used to evaluate the significance of differences between two groups in mean of continuous variables .
in the study group of 55 patients , 44 were men and 11 were women , with an average age of 25 ( sd = 12 ) years ( range 1 - 47 ) . in the control group of 60 patients , 46 were men and 14 were women , with an average age of 28 ( sd = 11 ) years ( range 3 - 51 ) .
comparison among mean of some liver function tests in g6pd deficient and control groups showed statistically significant difference ( p < 0.05 ) .
serum ast , alt and alp were significantly elevated in patients than control group ( fig 1 ) .
comparison among mean of some liver function tests in g6pd deficient and control groups , represents significance at the p = 0.0001 level for ast(u / l ) , significance at the p = 0.001 level for alt ( u / l ) and significance at the p < 0.05 level for alp ( u / l)test . comparison between mean of kidney function tests in these two groups did not show any statistically significant difference ( p > 0.05 ) ( fig 2 ) .
comparison between mean of kidney tests in g6pd deficient and control groups represents no statistically significance different ( p > 0.05 ) .
favism is a disease prevalent in mediterranean countries and characterized by acute hemolytic anemia following ingestion of fava beans .
the typical features of the disease are jaundice , hematuria and hemolytic anemia ( 14 ) .
the fava beans are also common cultigens of mediterranean area that can aggravate the disease in the g6pd deficient patients in this area .
since all types of fava beans can induce hemolytic episodes , favism patients can experience these episodes during the entire year ( 31 , 32 ) .
occurrence of these frequent mild or severe episodes of hemolysis can , over time , lead to more serious complications , particularly in liver and kidney as the two main organs involved in the hemolytic process ( 25 , 26 , 33 ) .
this study hypothesizes that in areas with endemic culture of fava beans , favism patients may be impaired in the performance of these two organs .
the results of this study partly confirmed this theory about liver , because means of liver function tests , ast , alt and alp were significantly higher in the case group than in the control group ( 64.2
although mean of alt in patient group located in the normal range ( table 1 ) .
these elevated liver enzymes can be resulted from occurrence of recurrent hemolytic episodes that involve liver because a part of this hemolytic process can be extravascular .
moreover g6pd deficiency in liver can be a probable cause of liver complication in these patients but this claim require more investigations .
we did not observe any significant correlation between age and liver function enzyme levels ( p > 0.05 ) . on the other hand , bun and creatinine as renal tests
did n't show statistically significant difference between patient and control groups ( 19.4 vs 19.8 , p > 0.05 and 0.75 vs 0.79 , p > 0.05 ) ( table 1 )
all liver function tests showed statistically significant difference between these two groups(p < 0.05 ) , while kidney tests did not show any significant difference(p > 0.05 ) .
our observations about liver function tests are in accordance with some other studies such as alavis et al that reported elevated levels of ast in majority and alt in some favism patients ( 34 ) .
muhammad anees et al in a case report study showed high levels of ast and alt in a g6pd deficient patient ( 35 ) .
but our results was incompatible with findings of those studies that claimed that tests are normal in these patients ( 36 ) .
it seems that this incompatibility originates from some features of their studies such as sampling time or study region .
our study was performed in an endemic region with 24% frequency of g6pd deficiency and high cultivation of fava bean that can lead to induction of frequent hemolytic episodes in the patients ( 37 ) .
moreover we found significant increase in serum alp in case than control group that may implicate effects of hemolytic episodes on liver or gallbladder . in this study we found non - significant disparity in kidney function tests between case and control group that is incompatible with some studies showed elevated levels of these elements ( 35 )
this is due to their samples that were collected during hemolytic crisis whereas our sampling was not in this situation .
according to the results of this study and life style in these regions about consumption of beans as a traditional cheap and rich source of protein , we suggest that liver function tests be regularly performed for favism patients who constantly were exposed to fava bean or other oxidant agents and their hemolytic complications were recognized . with early diagnosis of liver complication and use of extensive and regular medical cares , development of liver dysfunction can be prevented .
moreover vicine and convicine can be eliminated from the fava bean substrate by microbial and fungal enzymes or other available methods to facilitate use of this source of protein ( 38 ) . | backgroundg6pd deficiency is the most common enzymopathy of red blood cells .
the clinical symptoms of favism are jaundice , hematuria and haemolytic anaemia that seem to affect liver and kidney in long term .
thus we evaluate kidney and liver function of favism patients in an endemic area of the disease with a high rate of fava beans cultivation.methodsthis study was performed on favism patients and healthy controls referring to iranshahr central hospital .
liver and kidney function tests were performed.resultsthe results showed a statistically significant difference between these two groups ( p < 0.05 ) for liver function tests , ( ast , alt and alp ) , but not for renal tests ( bun and creatinine ) ( p > 0.05).conclusiondue to abnormalities were seen in the liver function tests of these patients , we suggest that these tests be regularly performed for favism patients who are constantly exposed to oxidant agents . |
intravenous immunoglobulin [ ivig ] is used for treatment of a variety of autoimmune , rheumatologic , and immunodeficiency [ both primary and secondary ] disorders and can be life - saving in several of these conditions .
although it has good safety profile , it can be rarely associated with serious adverse events .
thrombotic complications , both arterial and venous , are uncommon adverse events associated with ivig use . here
, we report a case of acute st elevation anterior wall myocardial infarction [ mi ] associated with high dose [ 2 g / kg ] ivig administration in a previously healthy 69-year - old male patient of guillain barre syndrome [ gbs ] .
the case is being reported to draw the attention of treating physicians to this uncommon , but serious adverse event associated with ivig administration .
we have reviewed the literature on thrombotic complications associated with ivig in brief and measures to reduce them are discussed .
a previously healthy , 69-year - old male manual laborer without addictions was admitted with complaints of progressive weakness of all the 4 limbs for 3 days .
the weakness initially started in the lower limbs and then ascended rapidly to involve the upper limbs and neck muscles , forcing him to confine himself to bed .
there was no history of preceding diarrheal illness , upper respiratory tract infection , or exposure to organophosphate insecticides .
on admission to our hospital [ day-4 of illness ] , he was found to have symmetric areflexic quadriparesis with weakness of neck flexors [ power in lower limbs : grade 1/5 , upper limbs : grade 2/5 , neck flexors : grade 2/5 ] but extraocular and facial muscles , sensations , bowel and bladder were not affected .
the patient was started on intravenous immunoglobulin [ norglobin ( 5 g/100 ml ) , containing maltose as excipient , marketed by claris lifesciences , ahmedabad ( india ) , dose :
0.4 g / kg / day 5 days ] , along with venous thrombosis prophylaxis [ enoxaparin ] from day-4 .
he later had progressive paralysis with involvement of lower cranial nerves and respiratory muscles , needing endotracheal intubation , mechanical ventilation and nasogastric tube feeding in the intensive care unit from day-5 .
the patient had autonomic dysfunction with episodes of hypertension and tachycardia on days- 4 and 5 , which resolved by day-6 .
on day-8 , when the last dose of ivig was just about to be completed , patient had sudden unexplained episode of hypotension [ systolic blood pressure : 70 mm hg ] with profuse sweating and restlessness . an electrocardiogram [ figures 1 - 3 ] showed st segment elevation in leads v1 to v4 , suggesting acute anterior wall st elevation mi .
patient 's blood pressure rose with inotropes [ norepinephrine and dopamine ] , and he received thrombolytic therapy [ streptokinase-15,00,000 units ] within 1 hour .
echocardiography revealed hypokinesia of the interventricular septum and anterior wall of left ventricle with an ejection fraction of 40% .
ecg on admission [ day 4 of illness ] , showing normal pattern ecg on day 8 , when the patient developed sudden hypotension , showing q waves with st elevation in v1-v3 , t inversions in all other leads suggesting anterior wall st elevation mi ecg 30 minutes after thrombolysis with streptokinase [ 15,00,000 units ] laboratory evaluation on admission [ day-4 ] had revealed normal plasma glucose levels , hba1c [ 5.8% ] , serum electrolytes , lipid profile , renal and liver functions .
elisa for hiv [ human immunodeficiency virus ] , hbsag [ hepatitis b surface antigen ] and hcv [ hepatitis c virus ] was negative .
he was discharged on day-20 with partial recovery of muscle power [ grade 2/5 in all 4 limbs ] on oral hematinics .
ivig comprises of gamma globulins derived from purified pooled plasma of thousands of donors , consisting mainly of polyspecific igg .
its immunomodulatory and anti - inflammatory actions have enabled its effective use in several autoimmune and inflammatory clinical conditions .
adverse reactions are reported in 24 - 36% of patients after high dose [ 2 g / kg ] ivig , most being mild and transient such as headaches , flushing , fever , chills , fatigue , nausea , diarrhea , blood pressure changes and tachycardia .
more serious adverse effects like acute renal failure , thrombotic events , aseptic meningitis , hematologic complications and anaphylactic reactions are much rarer .
thrombotic complications reported in association with high dose ivig include both venous [ deep venous thrombosis , pulmonary embolism , hepatic veno - occlusive disease ] and arterial events [ acute myocardial infarction , ischemic stroke , thrombosis of arteriovenous fistulae created for hemodialysis , spinal cord ischemia ] , the latter being 4 times more common than the former .
thrombotic events are reported in most clinical conditions where ivig has been used , with an estimated incidence of 0.15 - 1.2% per treatment course .
arterial thromboses are more commonly associated with atherosclerotic risk factors such as advanced age , smoking , obesity , dyslipidemia , diabetes mellitus , hypertension , renal dysfunction , and prior coronary or cerebrovascular disease and occur early ( 77% within 24 hours ) after ivig administration .
venous thromboses occur later ( 54% more than 24 hours after ivig administration ) and are associated with risk factors such as obesity and immobility .
autonomic dysfunction [ ad ] in gbs patients per se has been reported anecdotally to cause mi by catecholamine surge and coronary spasm . in our patient , mi followed few days after the initial ad subsided .
our patient , unlike other reported cases of mi with multiple atherosclerotic risk factors , did not have smoking , obesity , dyslipidemia , diabetes mellitus , hypertension , renal dysfunction and prior coronary or cerebrovascular disease as risk factors .
mi occurred during the fifth day of ivig infusion , in concert with reported timing of occurrence .
the infarction was confirmed by electrocardiography , echocardiography and elevated troponin t. proposed mechanisms for thrombosis include some of the following- platelet activation , increased blood viscosity , contamination of ivig with activated coagulation factors , induced arterial vasospasm , production of vasoconstrictive cytokines and vasculitis .
ivig products from different manufacturers might differ considerably , and factors such as osmolality , ph and excipient used [ sodium or sugar ] , along with volume load and infusion rates determine the adverse effects .
it is thought that salt - based high viscosity products might be responsible for initiation of thrombosis and mi .
it is recommended to assess carefully , the overall risk of mi , stroke and venous thromboembolism , along with risk benefit ratio before ivig use .
maintenance of hydration , a slower rate of infusion [ 100 mg / kg / hour ] , combined with antiplatelet therapy [ aspirin-300 mg / day ] and anticoagulation [ enoxaparin-1 mg / kg / day ] have been suggested during ivig infusion to reduce ivig - related thrombosis . to conclude , ivig administration in high doses can be rarely associated with thrombotic complications such as acute mi .
adequate hydration and slower rate of infusion , along with careful patient selection based on the risk - benefit assessment may reduce this complication . | intravenous immunoglobulin [ ivig ] is useful for treating several clinical conditions and is largely considered safe , without major adverse events . here
we report a case of acute st elevation myocardial infarction associated with high dose ivig administration in a previously healthy 69-year - old male patient of guillain barre syndrome .
the case is being reported to emphasize the need for treating physicians to be aware of thrombotic complications associated with ivig .
the thrombotic complications associated with ivig are reviewed in brief , and the measures to reduce them are discussed . |
age - related changes in skeletal muscle result in loss of muscle mass and weakness .
this
leads to a decrease in daily physical activity in older adults , and can result in poor
health and a need for professional care .
muscle loss and weakness cause serious health
problems , such as decreased strength and aerobic capacity1 .
the world health organization ( who ) ranked lack of physical
activity as the fourth leading cause of mortality worldwide2 . according to who recommendations
, older adults should aim to
maintain or increase their daily amount of moderately or vigorously intense physical
activity3 .
many older people ,
particularly those 65 years of age or older , who are interested in enhancing their health do
perform some kind of exercise training4 ;
however , the chosen exercise often has a low intensity level ( e.g. , walking ) .
this is not
strenuous enough to effectively improve either muscle strength and mass or aerobic
capacity5,6,7,8 .
hatamoto et al.9 showed that turning
during sports increased the energy cost of running and that the magnitude of the increase
depended on both the turn frequency and running velocity . in this study
, we examined a new
exercise pattern called slow walking with turns ( swt ) , which incorporates turns to increase
the work load of walking .
we have already shown that swt increases the exercise intensity
relative to normal walking at the same velocity and hypothesized that the reason for this
increase was extra muscle contraction resulting from the turns . the walking velocity and
turn frequency
is easily adjusted to provide an exercise intensity of 3 to 10 metabolic
equivalents ( mets ) over a 3-m distance , and it is thus easy to prescribe an exercise program
tailored to individual needs10 . in the
current study , the swt ( tempo , turn frequency , and method of turning ) was adjusted to reduce
individual differences and make it easy to perform even for older people .
the purpose of
this study was to confirm the exercise intensity of swt and examine the muscle activity
during turns .
eight recreationally active volunteers participated in order to confirm the exercise
intensity of swt .
the participants mean age was 24.9 ( standard deviation ( sd ) , 5.0 ) years ,
mean stature was 1.66 ( 0.10 ) m , and mean mass was 58.0 ( 6.8 ) kg .
none of the participants
had any injury that might have influenced their athletic performance .
all participants
performed swt over five fixed distances and treadmill walking ( tw ) at five different
velocities in random order .
oxygen consumption ( vo2 ) , rating of perceived
exertion ( rpe ) , and heart rate ( hr ) were measured during each exercise . during swt
, the participants walked back and forth over several fixed distances and
performed 20 turns per minute .
the distances were 1.5 , 2.0 , 2.5 , 3.0 , and 3.5 m ; the average
velocities for walking back and forth were 2.7 , 3.6 , 4.5 , 5.4 , and 6.3 km / h ; and the cadence
was 180 steps per minute .
the participants took six steps for each distance during walking
and three steps per turn .
the tw velocities were set at 2.7 , 3.6 , 4.5 , 5.4 , and 6.3 km / h ,
which were the same velocities as during the walking portion of the swt .
all sessions consisted of 4 minutes
of exercise at each velocity with 1 minute of rest between different velocities ( fig . 1fig .
swt involved
shuttle walking for a short distance , including 20 turns per minute .
the distance in
each stage was 1.5 , 2.0 , 2.5 , 3.0 and 3.5 m. ) .
when participants
could not maintain the cadence , the trials were stopped and restarted .
swt involved
shuttle walking for a short distance , including 20 turns per minute .
the distance in
each stage was 1.5 , 2.0 , 2.5 , 3.0 and 3.5 m. all participants completed a familiarization session prior to the actual trial session .
the
experiments were conducted in an indoor facility with hard flooring , and the participants
were instructed to wear the same indoor sports shoes for all trials . turning consisted of
three steps , a deceleration step , a change of direction step , and an acceleration step out
of the turn .
the turning technique was adapted from the cross - step turn , and participants
turned towards the striding foot during the deceleration step .
the participants practiced
the cross - step turn technique until they could repeat it consistently .
all participants were
instructed to avoid food , caffeine , tobacco products , and alcohol for 3 hours prior to the
exercise sessions . during the exercise
, the participants wore a face mask to collect exhaled gas , which was
measured at 12-second intervals using an mass spectrometer ( arco 2000 ; arco system , chiba ,
japan ) .
the mean vo2 of the last minute of each stage was used in the data
analysis .
the hr ( polar ce0537 hr monitor ; polar electro , kempele , finland ) was measured
just before the end of each 4-minute stage , and subjective exercise intensity was assessed
using the borg rpe scale11 .
measured
vo2 was converted into mets ( 1 met=3.5 ml / kg / min ) .
second , the participants for measurement of muscle activity were six healthy men with a
mean age of 25.0 ( 4.4 ) years , mean stature of 1.74 ( 0.05 ) m , and mean mass of 68.3 ( 5.0 ) kg .
the swt protocol was the same as
above - mentioned , except the walking distances were 1.5 , 2.0 , and 2.5 m. the tw velocities
were 2.7 , 3.6 , and 4.5 km / h ; these were chosen to be the same as the walking velocities
during swt .
the activity of 11 muscles during swt , tw , and isometric maximum voluntary
contractions ( mvc ) was measured using electromyography ( emg ) ( lp - ws1221 ; logical product
corp . , fukuoka , japan ) to compare muscle activity during the stance phase of tw and the
turning phase of swt .
the 11 muscles selected for emg were the rectus abdominis ( ra ) , erector spinae ( es ) ,
gluteus maximus ( gmax ) , gluteus medius ( gmed ) , hip adductor ( ha ) , vastus lateralis ( vl ) ,
rectus femoris ( rf ) , vastus medialis ( vm ) , biceps femoris ( bf ) , tibialis anterior ( ta ) and
soleus ( sol ) .
all measurements were taken on the right side using wireless emg sensors
attached over the muscle belly .
a foot sensor was attached to the right heel . before
application of the sensors ,
the skin area was shaved , cleaned with alcohol , and abraded with
coarse tape to reduce skin impedance and ensure good adhesion of the sensors .
the researcher manually fixed
the posture of the participant , applying resistance against the direction of mvc .
the
participant then exerted an isometric mvc against the resistance while emg was performed on
the muscle being tested .
the mvc for each muscle was measured as follows : ra : the participant lay in a supine position with his knees positioned at 90 flexion and
ankles restrained by an assistant .
he then raised his shoulders and exerted enough force to
further elevate their upper body while the researcher applied resistance against the
direction of force .
es : the participant lay face down with his hands on the back of his head and raised his
upper body ( trunk extension ) .
gmax : the participant lay face down with his knee flexed to 90 and extended his hip joint .
gmed : the participant lay on his side with the test leg uppermost and abducted his mildly
extended hip joint .
ha : the participant lay on his side with the test leg down and resting on the bed .
the researcher then applied
resistance while the participant attempted to elevate ( adduct ) the test leg .
vl , rf , and vm : the participant sat on a chair with back support .
his trunk was secured
with a belt and his feet did not touch the floor .
his hip and knee joints were fixed at 90
angles by fastening a belt around his lower legs .
he then extended his knees against the
resistance of the belt to allow for measurement of the mvc .
bf : the participant lay face down on the floor with his lower legs held in an upright
position perpendicular to the floor , knees flexed at 90 and hips flexed at 0. he then
tried to further flex his knees against resistance applied by the researcher .
ta and sol : the participant sat horizontally on a tilt table with his knees fixed to the
table and his ankles in a neutral position ( 0 dorsi / plantar flexion ) and his feet fastened
to a foot cradle with a belt .
he then made maximal attempts to dorsiflex and plantar flex
his ankle against the resistance of the belt .
two trials were conducted for each muscle ,
with a rest of 2 minutes or more between trials .
after the trials , the emg data were downloaded onto personal computer ( vaio ; sony , tokyo ,
japan ) .
the emg data were full - wave rectified , and the integrated emgs data were averaged
during mvc over 1 second including the point at which the torque was maximal .
the muscle activities
during the stance phase of tw and the turn phase of swt were calculated by integrating the
emg value in the reaction time of the foot sensor .
each emg level was averaged for five
times of turns in swt and five steps in tw .
the emg data in swt were adopted from five turns
at the beginning of the exercise . in tw ,
the measurement was started after walking had
become stable , and the data were adopted from first five steps .
the averaged integrated emg
data during the actions were quantified and normalized as the values relative to those
during mvc ( i.e. , % mvc ) .
all statistical analyses were conducted using spss software ( v21 ;
ibm corporation , armonk , ny , usa ) .
differences between swt and tw were assessed using
t - tests in experiment 1 and one - way analysis of variance in experiment 2 .
this study was approved by the ethical committee of fukuoka university , fukuoka , japan
( number 10 - 02 - 02 ) , and informed consent was obtained from all participants .
this study
followed the guidelines of the world medical association declaration of helsinki : ethical
principles for medical research involving human subjects , as well as the ethical guidelines
for epidemiological research outlined by the ministry of education , culture , sports , science
and technology and the ministry of health , labour and welfare , japan .
oxygen consumption during the last minute of each stage remained in a steady state with no
difference between the 3rd and 4th minute from the start of the exercise .
the results of
mets , hr and rpe were shown in table
1table 1.mets , rpe and hr for swt and twtwswt2.7 km / h3.6 km / h4.5 km / h5.4 km / h6.3 km / h1.5 m2.0 m2.5 m3.0 m3.5 mmets2.6 0.23.0 0.23.5 0.24.2 0.35.2 0.24.0 0.4***4.4 0.5***4.8 0.4***5.3 0.6**6.3 0.6**rpe7.8 1.08.1 1.09.3 0.910.4 0.711.6 0.78.5 1.69.0 1.59.4 1.510.5 1.311.6 1.1hr84 1689 1493 12102 8112 1089 1598 17 * 102 18 * 107 22119 19mean sd .
distances of 1.5 , 2.0 , 2.5 , 3.0 and 3.5 m during swt correspond to average walking
velocities of 2.7 , 3.6 , 4.5 , 5.4 , and 6.3 km / h , respectively .
* p<0.05 , * * p<0.01 and * * * p<0.001 , comparison between swt and tw at a
velocity corresponding to walking of swt .. the mets of swt were significantly higher than those of tw at a velocity
corresponding to walking of swt ( p<0.01 ) .
the difference in mets between swt and tw
appeared to be larger at slower speeds , but not significantly .
the hr and rpe values were
measured just before the end of each stage .
there was no significant difference in hr and
rpe except for the hr at distances of 3.6 and 4.5 km / h ( p<0.05 ) , despite the
significantly higher exercise intensity in the swt .
mean sd . distances of 1.5 , 2.0 , 2.5 , 3.0 and 3.5 m during swt correspond to average walking
velocities of 2.7 , 3.6 , 4.5 , 5.4 , and 6.3 km / h , respectively .
* p<0.05 , * * p<0.01 and * * * p<0.001 , comparison between swt and tw at a
velocity corresponding to walking of swt .
muscle activity was significantly greater in the es , vl and vm during the turn phase of swt
relative to the stance phase of tw at all stages ( table
2table 2.% mvc at the turn phase in swt and the stance phase in tw of each muscletwswt2.7 km / h3.6 km / h4.5 km / h1.5 m2.0 m2.5 mra6.86.87.28.79.09.5es5.56.27.514.5**17.7**15.5*gmax5.57.210.18.5 * 9.39.3gmed10.710.611.311.512.712.6ha10.910.811.313.013.213.9*vl7.29.410.913.5**13.5**13.7**rf9.39.410.610.411.011.5vm4.75.05.710.3**9.9**10.9**bf11.312.312.415.9 * 16.618.0ta10.011.813.714.213.313.6sol13.315.517.517.620.321.9*p<0.05 , * * p<0.01 , comparison of muscle activity levels for swt and tw at a
velocity corresponding to walking of swt . ) .
the activity of the es , vl , and vm during the turn phase of swt was about
twice the activity level during the stance phase of tw .
further , the activity of gmax and bf
at 1.5 m and ha at 2.5 m during the turn phase of swt was significantly greater than during
the stance phase of tw .
increases in walking velocity in tw did not increase the activity
levels of any of the assessed muscles .
* p<0.05 , * * p<0.01 , comparison of muscle activity levels for swt and tw at a
velocity corresponding to walking of swt .
the primary findings of this study were that swt training increased vo2 and the
activity of the quadriceps and es muscles relative to tw at the same velocity .
the addition of
turns caused more muscle contraction due to the acceleration and deceleration associated
with the change of direction .
we previously reported that vo2 was increased by
turns10 , and our current results
confirm the results of our previous study .
a turn involves deceleration , a change of
direction , and acceleration , and this can be difficult for older adults who often suffer
from balance disorders .
therefore , in this study we divided the turn phase into three
separate steps ( acceleration , change of direction , and deceleration ) to make swt a simpler
and easier exercise . this prolonged the turn time and reduced the walking distance per hour ;
however , the oxygen consumption during swt was still significantly higher than during tw at
the same velocity . because of this , performing swt at the fastest natural walking pace
resulted in an exercise intensity of up to 6 mets .
the physical activity of older people is significantly lower than the recommended
amount12 , which results in decreased
aerobic capacity , muscle mass and muscle strength , further reducing the amount of physical
activity1 .
because muscle weakness and
loss are associated with physical disability13,14,15 ,
older adults must perform adequate physical activity to maintain or improve aerobic capacity
and muscle mass and strength .
the popularity of walking is due
to its safety and simplicity , the fact that it does not generally cause hemodynamic stress
and the lack of requirement for special equipment .
however , it is known that walking
training ( excluding race walking ) has little effect on aerobic capacity or muscle strength
and volume5,6,7,8 .
the regular walking speed of older adults is reportedly slow16 , 17 , and thus walking is not a sufficiently intense exercise to result in
aerobic or strength improvements .
however , the exercise intensity required to maintain and improve physical fitness in
older adults is 3.0 to 6.0 mets18 . adding
turns while walking , as in swt , increases the exercise intensity from light to moderate .
furthermore , because swt did not result in significant increases in hr or rpe relative to tw
in the present study , many older people should be able to perform swt easily and safely .
we focused on muscle activity during the turn phase of swt and compared it with the muscle
activity during the stance phase of tw .
the activity levels of the es , vl , and vm were
significantly greater while turning during swt than during tw .
this indicates that it is
possible to increase the stimulation provided by regular walking by adding turns . performing
swt instead of tw or simple straight walking may increase the strength of the knee and trunk
extensors and muscle mass in the thigh and back .
only a few studies have examined the effect of aerobic training on muscle strength and mass
in older adults .
several cross - sectional studies have reported no significant differences
between the leg strength and power of chronically aerobically trained and sedentary older
people19 , 20 .
longitudinal studies have shown no effect of regular walking
training on leg strength and muscle mass5,6,7,8 .
the few studies that have shown positive
effects of exercise on the mass and strength of the thigh muscles used brisk walking ,
jogging at 85% hr reserve21 , or interval
training at 70% to 85% vo2 peak6 , 22 as exercises .
cycling at 70%
vo2 max or 80% hr reserve has been shown to increase quadriceps muscle strength
and power and thigh muscle volume23 , 24 .
aerobic exercise can increase muscle
strength and mass depending on the intensity , frequency , and duration of the exercise .
importantly , to facilitate the development of a training habit , it is better that exercisers
do not feel fatigue .
muscle strength significantly decreases when training is stopped ; if
training is resumed , its muscle strengthening effects are then less than they were
previously24 .
however , no studies have examined the
effects of moderate endurance training ( except for the bench step exercise25 ) on muscle strength .
the muscle activity of the vm during the turn phase of swt was twice that seen during
regular walking .
gazendam and hof26
reported the emg profile during walking and jogging at 4.5 to 8.1 km / h ; the emg amplitude of
the vm during the turn phase of swt at 2.5 to 4.5 km / h in the current study was equal to
what they reported during jogging at 8.1 km / h and brisk walking at 5.2 km / h .
thus , muscle
activity that occurs while turning during swt is equal to or greater than that seen during
brisk walking or jogging . because brisk walking and jogging
have been confirmed to increase
the muscle mass and strength of the thigh , our results suggest that swt may also increase
muscle mass and strength . additionally , in a study comparing running and soccer in young and
middle - aged subjects , the vl cross - sectional area and knee extensor strength were increased
only by soccer27 , 28 .
training consisting of varying intensities and motions , such as
swt , has the potential to result in muscle hypertrophy and strength gains . at present
, the
research on muscle hypertrophy and strength gains caused by aerobic exercise has been
limited to the lower limbs ; further studies clarifying the effects of aerobic exercise on
the muscles of other regions of the body , including the trunk , are needed .
the purpose of this study was to investigate whether swt is useful for older people ;
however , we chose , young people as subjects .
the characteristics of walking in older people
are a decreased : stride caused by a reduced range of motion of the hip and ankle , a lower
walking speed cause by the decreased stride , and extension of the two - leg supporting moment .
however , walking adjusted to 180 strides per minute is unlikely to be affected by the
characteristics , showing an operation pattern similar to that of young people29 . in future work
we will examine the
effects of swt on the physical function of the older adults in terms of increased aerobic
capacity , prevention of muscle ageing , and improvement in balance .
our findings suggest that swt may help to preserve the muscle strength and mass of the
trunk and lower limbs that is needed to maintain an independent lifestyle . even slow
walking
can be performed easily by older people , and the exercise intensity can be adjusted as
required for each individual .
furthermore , swt requires the participant to have greater
control of their center of gravity during lateral , sagittal , and up and down movements than
during regular walking .
complex exercise training consisting of strength , balance , and
walking training for older adults has been expected to effectively prevent falls30 .
swt is done over short distances ( maximum
of 3.5 m ) , which allows its performance in a small indoor space and eliminates the need for
supervision or equipment . | [ purpose ] to maintain an independent lifestyle , older adults should improve muscle
strength and mass , or aerobic capacity . a new exercise pattern , called slow walking with
turns , which incorporates turning as an extra load additional to walking . the purpose of
this study was to measure oxygen consumption during exercise and muscle activity while
turning .
[ subjects and methods ] recreationally active volunteers participated .
the
participants performed 20 turns per minute while walking back and forth over distances of
1.5 to 3.5 m. we measured oxygen consumption , heart rate , and rating of perceived exertion
and performed electromyography during the exercise .
[ results ] the metabolic equivalents of
the exercise were 4.0 0.4 to 6.3 4.0 mets .
activity was significantly greater in the
vastus medialis , vastus lateralis , and erector spinae during the turn phase of slow
walking with turns than during the stance phase of treadmill walking . [ conclusion ]
these
findings suggest that slow walking with turns may help to preserve the muscle strength and
mass of the trunk and lower limbs that are needed to maintain an independent lifestyle .
slow walking can be performed easily by older people , and in slow walking with turns , the
exercise intensity can be adjusted as required for each individual . |
clostridium difficile , a gram - positive and spore - forming anaerobic bacillus , is a leading cause of healthcare - associated diarrhoea in industrialized countries .
transmission occurs primarily in healthcare facilities , where exposure to antibiotics and environmental contamination by c. difficile spores are common .
antibiotic treatment , advanced age ( > 65 years ) , comorbidities and hospitalization have been identified as major risk factors for c. difficile infection ( cdi ) . however , antimicrobial therapy is the single most important risk factor for cdi .
it leads to the disruption of the normal intestinal flora , creating favourable conditions for acquisition and proliferation of c. difficile
.
clindamycin , amoxicillin , third - generation cephalosporins and more recently fluoroquinolones have been shown to be associated with a particularly high risk of developing cdi .
the first whole genome sequence of c. difficile was obtained in 2006 ; sequencing revealed a large circular chromosome of 4 290 252 bp likely coding for 3776 proteins and an extracircular plasmid 7881 bp in size .
these studies have shown that the c. difficile genome contains a high proportion ( over 10% ) of mobile genetic elements including bacteriophages , repeat elements and genomic islands , as well as transposable and conjugative elements .
several typing methods have been used to study the epidemiology , genetic diversity and evolution of c. difficile . in europe pcr ribotyping
has been one of the most widely adopted methods , and over 600 c. difficile ribotypes have been identified .
a particular subtype , c. difficile ribotype 027 , has been associated with severe disease and hospital outbreaks in north america and europe , , .
global emergence of this moxifloxacin - resistant c. difficile type 027 prompted establishment of national surveillance programs in several european countries , , .
as a result of national surveillance , a clonal aggregation of a newly emerging , moxifloxacin - resistant c. difficile ribotype 231 ( rt231 ) was uncovered in sweden in 2008 .
this type was initially geographically limited to the stockholm area , where over 70% of all moxifloxacin - resistant c. difficile strains were characterized as rt231 in 2008 ( 125/144 ) . despite an increasing awareness of cdi and enhanced infection control policies , rt231 has continued to spread in sweden ; by the end of the year 2015 it had been identified in 13 of 21 counties , suggesting interhospital transmission and possible local outbreaks . although no studies have shown whether moxifloxacin use implies higher risk for cdi than other commonly used antibiotics , the restriction of moxifloxacin use has been associated with a reduction in the number of cdis in northern ireland and england , .
similarly , a study from vienna demonstrated that enhanced antibiotic stewardship , including restriction of moxifloxacin use , was associated with a reduction in the number of cdi in population with a high rate of multidrug - resistant c. difficile
.
we used whole genome sequencing ( wgs ) and phylogenetic analysis to investigate the spread of this newly emerging moxifloxacin - resistant c. difficile rt231 in sweden between 2006 and 2015 .
we also evaluated the potential association between the extent of moxifloxacin prescription rates and the epidemiology of rt231 .
all 189 c. difficile rt231 isolates identified in sweden between 2006 and 2015 were included in this study ( table 1 ) .
the strains collected between 2009 and 2015 were obtained through the national surveillance program for c. difficile ; before 2009 samples were obtained via a nationwide surveillance study .
pcr ribotyping between 2006 and 2012 was performed by a gel - based method and between 2013 and 2015 by capillary - gel electrophoresis .
all moxifloxacin - sensitive strains were included , and moxifloxacin - resistant isolates were selected to cover each isolation region per year to obtain a geographically and temporally representative sample collection .
isolates were grown on mueller - hinton fastidious agar , and minimum inhibitory concentration ( mic ) values for moxifloxacin , erythromycin , clindamycin , metronidazole and vancomycin were determined using etests ( biomrieux , marcy letoile , france ) as described previously .
the epidemiologic cutoff breakpoints for resistance were as follows : metronidazole mic > 2 mg / l , vancomycin mic > 2 mg / l , erythromycin mic > 2 mg / l , clindamycin mic > 16 mg / l and moxifloxacin mic > 4 mg / l , according to the european committee on antimicrobial susceptibility testing ( eucast ) .
isolates were recultured on blood agar plates , inoculated into sterile peptone yeast liquid medium with 0.5 mg / ml cysteine and grown overnight anaerobically at 35c .
cells were pelleted , suspended into lysis buffer ( 1 mm tris , 0.1 mm edta , 0.1% triton - x and 20 mg / ml lysozyme ) with proteinase k ( 180 l of buffer and 20 l of proteinase k ( 20 l / ml ) ) and incubated for 18 hours at 56c .
genomic dna was extracted using magattract dna mini m48 kit and biorobot m48 according to the manufacturer 's recommendations ( qiagen , sollentuna , sweden ) .
wgs was performed using the ion torrent platform , aiming to read lengths of 200 bp and coverage of 30. the sequence data were analysed by clc assembly cell 4.4.2 software .
sequence type ( st ) was determined for comparison using mapping and the basic local alignment search tool ( blast ) against the c. difficile multilocus sequence typing ( mlst ) database ( http://pubmlst.org/cdifficile/ ) .
strain mx213 was used as the reference genome for single nucleotide polymorphism ( snp ) analysis .
positions with low coverage ( < 10 ) or ambiguous calls ( < 90% ) in one or more samples were filtered out .
snps within 500 bp of each other were filtered out as single events from the snps in the phylogenetic analysis to remove nonrandomly distributed mutations ; these are collectively termed recombination events .
the analysis was repeated excluding the four nonrelated strains ; the remaining individual snp positions were compiled into an alignment and used for phylogenetic analysis .
neighbour - joining phylogenetic trees were constructed on the basis of the snp alignments using mega 6.0 and 100 bootstrap replicates .
the genomic relatedness of isolates was assessed by snp analysis : up to three individual snps per genome was expected to be seen between related isolates collected up to 1 year apart , whereas strains which differed more than ten individual snps were classified as unrelated .
data on moxifloxacin prescriptions were obtained from apotekens service ab ( 20032013 ) and from the swedish ehealth agency ( 20142015 ) .
the data include moxifloxacin prescribed to patients as well as sales to hospitals and other healthcare providers .
a total of 51 of 189 c. difficile rt231 isolates selected for wgs were geographically and temporally representative ; they included isolates from all 13 counties where rt231 strains had been isolated over a 10-year period ( table 1 , table 2 ) .
an average minimum coverage of 60.07 ( range 20.52120.13 ) reads per nucleotide and an average genome length of 4.14 ( range 3.924.30 ) mbp were obtained for all samples .
no previous wgs data were available for c. difficile rt231 , and thus the first whole genome sequence of rt231 was obtained by a de novo assembly of strain mox213 ( 3.92 mbp ) .
mlst data obtained from whole genome sequence representing approximately 0.09% of the whole genome ( 3501 nt ) were almost consistent with ribotyping data ; all studied isolates belonged to st133 .
one isolate ( nt949 ) , determined to be pcr rt231 by a gel - based method , belonged to st133 , but pcr ribotyping analysis by capillary - gel electrophoresis with higher resolution suggested a new , unknown ribotype .
a total of 4091 nucleotide differences were identified within the 51 isolates ; 3225 nucleotide differences were classified as recombination events , whereas the remaining 866 nucleotide differences were classed as individual snps .
the results are presented in a minimal spanning tree in fig . 1 ( 88.56% of the genome was used as the dynamic core genome ) .
a total of 3496 nucleotide differences distinguished four single isolates ( three moxifloxacin - sensitive isolates nt049/jnkping_2009 , nt513/vstragtaland_2010 and nt1619/skne_2012 and one moxifloxacin - resistant isolate nt949/norrbotten_2011 ) from the remaining 47 isolates ( all moxifloxacin - resistant isolates ) .
a total of 2681 nucleotide differences out of 3496 were filtered as 447 recombination events . within the remaining 47 isolates , five strains ( mx405/stockholm_2008 , mx381/stockholm_2008 , nt422/gotland_2009 , nt116/stockholm_2009 and nt099/stockholm_2009 ) differed by 554 nucleotides from the closest main cluster of 42 isolates .
a total of 544 nucleotide differences out of 554 were filtered as three recombination events . in order to study potential transmission of moxifloxacin - resistant c. difficile rt231 between different counties during the 10-year study period ,
a phylogenetic comparison of 47 strains based on the core genome snp analysis was performed ( excluding the unrelated isolates nt049 , nt513 , nt949 and nt1619 ) .
a total of 93.2% of the genome was used in the analysis as the dynamic core genome .
a total of 566 nucleotide differences were identified , of which 510 were classified as recombination events .
seventeen isolates collected between 2007 and 2012 in the counties of stockholm , uppsala and blekinge formed the first cluster , with only 3 snps ' difference between them ( cluster 1 , fig . 2 ) .
a clonal strain ( defined as 1 snp difference ) was identified in five different hospitals in the counties of stockholm and uppsala during 2008 and 2009 .
the remaining stockholm isolates from 2008 and 2009 ( n = 4 ; all from the same hospital ) formed their own bootstrap supported cluster together with a single isolate identified in gotland during the same time period ( cluster 2 , fig . 2 ) .
the third cluster was composed of the oldest isolate identified in stockholm in 2006 , another stockholm isolate from 2008 and all the other isolates collected in uppsala ( n = 7 ) , vstmanland ( n
= 5 ) , sdermanland ( n = 8) , rebro ( n = 2 ) and dalarna ( n = 1 ) , with a maximum difference of 3 snps between the isolates ( cluster 3 , fig . 2 ) .
a second clonal strain was circulating in the counties of uppsala , sdermanland , vstmanland and rebro between 2009 and 2015 . in total , 48 of the 51 c. difficile rt231 isolates were resistant to moxifloxacin according to eucast epidemiologic cutoff mic breakpoints .
all moxifloxacin - resistant c. difficile rt231 isolates identified between 2009 and 2015 were also resistant to clindamycin and erythromycin .
all moxifloxacin - resistant strains harboured an amino acid substitution in the gyra gene ( thr82 > ile ) ; the unrelated moxifloxacin - resistant nt949 strain had an additional amino acid substitution in the gyrb gene ( asp426 > asn ) .
we screened the isolates for the presence of the ermb gene known to confer macrolide and lincosamide resistance .
interestingly all isolates carried most of the tn5398 transposon with a deletion of the ermb locus ( fig .
all isolates were also negative for the other predominant erm genes found in anaerobes ( a , c , e , f and q ) .
both sensitive and resistant strains carried the cme gene , which encodes an efflux pump similar to mefa , shown to confer erythromycin resistance .
furthermore , the 23s rrna sequences were analysed , but no differences were found between sensitive and resistant strains . a mutation in the rpld gene ( g211a , ala71 > thr ) , encoding the l4 protein of the 50s ribosomal subunit , was found in 25 of 47 resistant isolates , with all isolates belonging to cluster 3 .
all five isolates in cluster 2 , on the other hand , carried a mutation in the rplv gene ( g313a , val105 > ile ) encoding the l22 protein of the 50s ribosomal subunit . to evaluate a possible link between moxifloxacin consumption and the spread of rt231 , we analysed the county - specific consumption rates for moxifloxacin
. the mean community prescription rate of moxifloxacin in sweden decreased from 9.2 defined daily doses ( ddd ) per 1000 inhabitants per year in 2003 to 4.46 in 2015 , whereas the mean hospital prescription rates increased from 1.17 ddd per 1000 inhabitants per year in 2003 to 2.59 in 2015 .
the differences in the community moxifloxacin prescription between counties became smaller over time ( range in community 0.2423.26 ( 2003 ) and 0.5411.53 ( 2014 ) ddd per 1000 inhabitants per year ) , whereas the opposite was seen in the hospital prescription rates between counties ( range in hospital 0.133.25 ( 2003 ) and 0.189.13 ( 2014 ) ddd per 1000 inhabitants per year ) . in 2014 the highest prescription rates , both in community and hospital settings , were identified in uppsala county ( 11.53 and 9.13 ddd per 1000 inhabitants per year , respectively ) ( fig .
hospital use of moxifloxacin was also high in sdermanland county in 2014 ( 9.02 ddd per 1000 inhabitants per year ) .
two other counties , jnkping and kronoberg , were noted also to have had high overall prescription rates of moxifloxacin in both community and hospital settings .
we investigated the emergence and epidemiology of moxifloxacin - resistant c. difficile rt231 in sweden between 2006 and 2015 by wgs and compared the geographical spread of this moxifloxacin - resistant type to county - specific moxifloxacin prescription rates .
a majority of rt231 isolates identified in sweden since 2006 have been moxifloxacin resistant ( 98% , 186/189 ) .
the proportion of moxifloxacin resistance among all c. difficile isolates has been around 15% in sweden between 2009 and 2015 ( range , 1021% ) , which is less than previously reported : 40% in europe .
the amino acid substitution ( thr82 > ile in gyra gene ) is the most frequently described mutation associated with fluoroquinolone - resistant c. difficile , including the hypervirulent ribotype 027 ; it was also present in all moxifloxacin - resistant rt231 isolates studied .
although association between multiple substitutions and high - level moxifloxacin resistance have been previously demonstrated , all resistant isolates of rt231 included in our study harboured only a single mutation and showed high - level resistance ( mic > 32
interestingly , most of the tn5398 transposon was detected , but with a deletion of the ermb gene locus , known to confer macrolide and lincosamide resistance .
macrolide and lincosamide resistance is thus most likely conferred by an as - yet unknown mechanism .
although isolates belonging to clusters 2 and 3 carried mutations in the l4 or l22 proteins of the 50s ribosomal subunit
proteins associated with macrolide resistance , the closely related isolates in cluster 1 have l4 and l22 proteins identical to the erythromycin - sensitive strains , and we believe that an evolution of separate resistance mechanisms is unlikely .
although c. difficile rt231 was first identified in a stockholm hospital as early as in 1999 , it remained a rare type until the outbreak was identified in stockholm county in 2008 , . on the basis of the previously estimated evolutionary rate of 0.74 snp per year for c. difficile ,
up to 3 snps per genome would be expected to be seen between related isolates collected up to 365 days apart . by using these previous estimates of c. difficile evolution
, we concluded that the first two rt231 strains are likely related and originated from a common ancestor .
these isolates were isolated almost by a 2-year gap in stockholm ( cd901 , cluster 2 ; mx3 , cluster 1 ) and harbour 6 snp differences in between .
in contrast , two genetically distinct c. difficile genotypes were also shown to be circulating in stockholm in 2008 , as demonstrated by more than 10 snps ' difference between the isolates ( mx70 and mx381 ) .
interestingly , a third genetically distinct c. difficile genotype ( mx165 ) differing from mx70 by five nucleotides was also identified in stockholm during the same year .
this shows that at least two divergent sublineages of moxifloxacin - resistant c. difficile rt231 were already circulating in the stockholm area when the outbreak was found in 2008 , and other strains related to these outbreak strains had likely been circulating in the area years before that .
the continued circulation of a clonal strain , demonstrated both in the stockholm and uppsala rebro healthcare regions , suggests that rt231 strains can persist for a long time in healthcare settings .
because the spread of clonal strains ( defined as 1 snp difference ) occurred mainly within a healthcare region , patient movement through hospitals with specialized care is presumably the main transmission route for spreading c. difficile rt231 .
it is therefore important to implement strict cleaning procedures and isolation routines for all patients infected with moxifloxacin - resistant strains to stop further transmission .
spread of rt231 was noted in stockholm county in 2008 , but the emergence had likely already occurred few years before that .
it is unclear why it emerged particularly in the stockholm area , where the prescription rate of moxifloxacin has not been the highest in sweden .
however , it is important to note that the reduced use of moxifloxacin in stockholm county has coincided with a reduction in the spread of rt231 in the area and the increased moxifloxacin use in uppsala county with the increased spread of this moxifloxacin - resistant type .
similarly , the counties of jnkping and kronoberg , which had high prescription rates of moxifloxacin between 2005 and 2010 , were affected by outbreaks of moxifloxacin - resistant c. difficile other than rt231 : rt046 and rt027 respectively , . in the county of jnkping , as prescription rates dropped and infection control was implemented , rt046 has virtually been eliminated from the area .
interestingly , in a case control study in stockholm county , fluoroquinolones were identified as a statistically significant risk factor for acquiring rt231 cdi , but only a small proportion of individuals infected with this strain had actually received moxifloxacin ( zomer et al . , unpublished data ) .
this is keeping with the idea that general antibiotic pressure in the community plays a major role in driving the emergence of resistant strains of c. difficile , and , as in the case of moxifloxacin - resistant rt231 , further use of any fluoroquinolone will likely lead to cdi problems in infected individuals .
a qualitative goal for limiting fluoroquinolone prescribing in outpatient care in sweden was set in 2007 , but none of the counties has reached the target set ( https://www.folkhalsomyndigheten.se/pagefiles/24127/swedres-svarm-2015-15099.pdf ) . a limitation of this study is the lack of information regarding the number of cases and patient hospitalizations ( i.e. a move to another hospital ) .
this study may also contain multiple isolates from the same individuals , so the real number of cases can not be determined .
in addition , because routine surveillance was established in sweden in 2009 , isolates collected before 2009 were not systematically collected . as a further limitation ,
age - specific moxifloxacin and general fluoroquinolone consumption rates were unavailable for study . in conclusion , we used snp analysis based on wgs to investigate the emergence and spread of moxifloxacin - resistant c. difficile rt231 in sweden over a 10-year study period .
we demonstrated the continued transmission of rt231 within and between different close - proximity counties .
the outbreak emerged first in the stockholm area and spread to surrounding counties in the uppsala rebro healthcare region .
our results support the need for careful monitoring of hospitalized individuals infected with moxifloxacin - resistant c. difficile types as well as for stricter limits on fluoroquinolone prescriptions in sweden .
although rt231 has only been described in sweden so far , it can potentially spread to countries where other moxifloxacin - resistant c. difficile types have also recently emerged .
the factors associated with the emergence of new ribotypes within a certain country remain largely unexplored . | an aggregation of moxifloxacin - resistant clostridium difficile ribotype 231 ( rt231 ) isolates was first identified in the county of stockholm in 2008 , and by the end of 2015 isolates of rt231 had spread to 13 of 21 swedish counties .
we investigated the epidemiology of c. difficile rt231 in sweden between 2006 and 2015 using whole genome sequencing ( wgs ) and evaluated whether its emergence could be associated with extended moxifloxacin use .
we performed wgs and phylogenetic analysis of 51 c. difficile rt231 strains isolated in sweden over a 10-year period .
we also calculated the county - specific prescription rates for moxifloxacin between 2005 and 2015 .
using wgs and detailed single nucleotide polymorphism analysis , we demonstrated three divergent sublineages of moxifloxacin - resistant c. difficile rt231 in sweden from 2008 to 2015 .
a set of closely related rt231 was identified in hospitals located in the counties of stockholm and uppsala in 2008 .
another set of rt231 isolates was found in four different counties in the uppsala rebro health care region .
a gradual drop in moxifloxacin use in the county of stockholm coincided with a reduction of rt231 in the area .
however , rt231 continued to be frequent in surrounding counties including uppsala , a county that also had the highest moxifloxacin prescription rates .
we demonstrated frequent transmission of c. difficile rt231 within and between counties , indicating the importance of careful monitoring of hospitalized individuals infected with moxifloxacin - resistant c. difficile as well as the need for a strict moxifloxacin prescription policy . |
primary osteoarthritis ( oa ) is an idiopathic phenomenon , occurring in previously intact joints , with no apparent initiating factor such as joint injury or developmental abnormalities .
it is characterized by the progressive failure of the extracellular cartilage matrix leading to articular cartilage destruction.1 - 3 it is widely believed that oa develops from an imbalance between anabolic and catabolic processes or homeostasis of cartilage metabolism.4 - 5 although the detailed aetiology is not currently fully understood , it has been suggested that oa resulted from the combination of aging , hormonal , environmental , and genetic factors.6 - 7 it is well known that genetic factors contribute to the susceptibility for oa .
several studies have demonstrated that polymorphisms in many genes might be related to the pathogenesis of oa.8 - 18 growth differentiation factor 5 ( gdf5 ) , also known as cartilage - derived morphogenetic protein 1 or bone morphogenetic protein ( bmp ) 14 , is a member of tgf - beta superfamily.19 a number of studies have demonstrated that gdf5 plays important roles in musculoskeletal processes , affecting endochondral ossification , synovial joint formation , tendon maintenance , and bone formation.20 - 21 defects of this gene was shown to be correlated to abnormal joint development or skeletal disorders in humans and mice.22 - 25 moreover , it has been reported that the polymorphism in gdf5 gene is related with low expression of the gdf5 protein in knee joint.26 in addition , gdf5 deficient mice exhibited biomechanical abnormalities in the tendon , which may be associated with altered type i collagen and skeletal abnormalities , one hypothesis of the mechanism behind that was gdf5 might modulate the rate of endochondral bone growth by affecting the duration of the hypertrophic phase in growth plate chondrocytes.27 several studies have shown that the association of rs143383 polymorphism in the promoter region might be a risk factor of oa,26,28 - 33 but other groups did not confirm these results.34 to deal with the ambiguities raised by inconsistent results among molecular genetic studies , rice suggested that the statistical method of meta - analysis could be used to reconcile conflicting findings.35 this method is used to examine whether the aggregate evidence across all available studies provides evidence of statistical significance .
thus , to examine the putative association between oa and the gdf5 , we applied this comprehensive meta - analysis to all available case - control association studies .
the search strategy was based on combinations of the terms ' ' gdf5 '' ' ' growth and differentiation factor 5 '' ' ' bmp14 ' ' 1104t / c '' ' ' rs143383 '' and ' ' oa '' , and ' ' osteoarthritis . ''
all the studies included satisfied all the following criteria : they ( 1 ) were association studies between the rs143383 polymorphisms in the gdf5 gene and oa ; ( 2 ) used disease - free people as controls ; ( 3 ) provided genotypes or alleles distribution in both case and control groups ; ( 4 ) were independent studies and the subject groups investigated in each studies did not overlap with other 's ; ( 5 ) were published in peer - reviewed journals and were indexed by pubmed or cited by articles indexed by pubmed .
1 ) for the clinical criteria , the american college of rheumatology ( acr ; formerly , the american rheumatism association ) criteria was used 36 - 38 but also accepted other definitions that may have been preferred by local investigators , if information on acr criteria was not available .
2 ) for the radiographic criteria , we used the kellgren / lawrence ( k / l ) classification system ( grades 0 - 4 , with 0 representing normal findings and 4 representing severe oa ) 39 , which is the most widely used scale for identifying and grading oa.28 a cutoff of k / l grade 2 was used to classify oa , unless the data had been generated with another cutoff and the definition could not be revisited .
nonfamilial case - control studies were eligible if the researchers had determined the distribution of genotypes for the polymorphism in oa cases and disease - free controls .
we excluded studies with family - based designs in which the analysis was based on linkage considerations . only studies published in english were included .
studies presenting non - original data were excluded , such as reviews , editorials , opinion papers , or letters to the editor .
studies in which rheumatoid , inflammatory , or other forms of arthritis were incorporated in the oa datasets were excluded .
studies with no extractable , numerical data were excluded . only those articles which had some measure of diagnostic performance
the following data was extracted from all identified studies , by two independent investigators : 1 ) first author , 2 ) journal , 3 ) year of publication , 4 ) study design , 5 ) ethnicity of the study population , 6 ) gender , 7 ) clinical characteristics , 8) genotyping method , 9 ) the number of cases and controls or or and 95%ci ( odds ratio and 95 percent confidence interval ) , 10 ) country in which the study was conducted and confirmation of diagnosis .
we used a comprehensive meta - analysis to analyze the odds ratios by using the method of carlin.40 to determine whether the results of the meta - analysis were unduly influenced by any one study , we recomputed the meta - analysis statistic after deleting each study one at a time .
we assessed publication bias by using the method of egger et al.41 this method is based on the fact that the precision of the odds ratio increases with larger study groups .
the method regresses the standard normal deviate of the odds ratio ( the odds ratio divided by its standard error ) against the precision of the odds ratio ( the inverse of its standard error ) . in the absence of bias , egger et al
. showed that the regression of the standard normal deviate on precision of the odds ratio should run through the origin ( i.e. , small study groups with low precision have large standard errors and therefore small standard normal deviates ; large study groups have higher precision , smaller standard errors , and large standard normal deviates ) .
the publication bias statistic of egger et al . is the intercept of the regression , which will be significantly greater than zero in the presence of publication bias .
the effect size was represented by an odds ratio ( or ) with 95% confidence interval ( ci ) .
sensitivity analysis was conducted by removing each study and analyzing the others to ensure no single study was totally responsible for overall results .
the significance level was set at 0.05 , and all p values were two - tailed . between - study heterogeneity
was tested using cochran 's q statistic , which is considered significant at p < 0.10 42 .
the i ranges between 0 and 100% . for operational purposes , values of 0 - 24% , 25 - 50% , 50 - 75% , and > 75%
when there was very large or large ( > 50% ) between - study heterogeneity , we used a simulation algorithm to evaluate how many studies had to be removed for the i to reach < 25% 45 .
the comprehensive meta - analysis was performed using comprehensive meta - analysis software ( version 2.2.046 , biostat , englewood , nj , usa ) .
the combined search yielded at least 53 references . after discarding overlapping references and those that clearly did not meet the criteria , 37 references were retained .
21 references were discarded for insufficient and equivocal data ( although we tried unsuccessfully to obtain further information from the authors ) , 7 references were excluded because they were not about the researches of snps , and 1 reference was excluded because its data were about lumbar disc degeneration . in total , 15 studies ( 8 references ) met our inclusion criteria , altogether consisting of a total of 7881 cases and 12019 controls.26 , 28 - 34 the main characteristics of these studies are described in table 1 .
the eligible studies for analysis included a total of 7881 cases with oa and 12019 controls ( table 1 ) .
the meta - analysis of all the studies about rs143383 polymorphism was significantly associated with oa [ fixed : odds ratio and 95 percent confidence interval ( ci ) : 1.193 ( 1.139 - 1.249 ) , p<0.001 ; random : odds ratio and 95 percent confidence interval ( ci ) : 1.204 ( 1.135 - 1.276 ) , p<0.001 ] ( fig . 2 and fig .
the sensitivity analysis showed that when any one of the studies was removed , the heterogeneity of the population was not changed deeply .
in other words , when one study was removed , the result also showed significant ( fig .
there was no evidence that the magnitude of the overall odds ratio estimates changed in the same direction over time . and
the egger 's funnel plots of publication bias analysis for the rs143383 polymorphism was shown in fig .
the pathogenesis of the development and progression of oa is far from being clear at present .
several studies indicated that variants of the gdf5 gene may contribute to the disease , but the results of genetic association studies were confusing because of the difficulty in replicating significant associations .
different characteristics among studies such as ethnicities , definition of case and control , introduced heterogeneity and made the results of association studies hard to be interpreted . a meta - analysis aiming at finding out the origin of heterogeneity and assessing overall effects of these variants on oa was performed .
this comprehensive meta - analysis included data from 8 references including 15 studies with approximately 19900 oa cases and controls .
it revealed highly significant evidence of association between the rs143383 polymorphism of gdf5 gene and oa .
gdf5 is an extracellular signaling molecule that participates in bone and cartilage morphogenesis as well as in joint formation.46 mutations in human gdf5 gene results in a broad spectrum of skeletal disorders.47 based on this functional knowledge , miyamoto et al .
genotyped a number of common gdf5 polymorphisms and demonstrated that rs143383 , a t to c transition located in the 5 ' untranslated region ( 5'utr ) of the gene , was significantly associated with oa.26 further studies have revealed that rs143383 is functional , the oa - associated t - allele mediating reduced gdf5 transcription relative to the c - allele in all of the joint tissues.47 - 48 moreover , the a - allele of -41c / a polymorphism is able to compensate for the reduced expression mediated by the t - allele of rs143383.49 in some other studies , rs143383 has also been shown to be associate with other phenotypes such as variation in normal height , achilles tendon pathology , fracture risk and congenital dysplasia of the hip.50 - 54 as loughlin described , this highlights the tendency of a common genotype to influence multiple phenotypes ( pleiotropy ) , and indicates that developmental factors may play an important role on conditions that manifest in the mature individual.55 functional study has demonstrated that t allele of rs143383 was associated with the decrease of gdf5 molecule expression and might increase susceptibility to oa.26 the differential binding of deformed epidermal autoregulatory factor 1 ( deaf-1 ) could modulate the expression of gdf5 via this polymorphism.48 these evidences indicated that the functional polymorphism of gdf5 gene plays critical roles in the etiology of oa .
mouse models have provided a basis for better understanding of the role of gdf5 in skeletogenesis and joint maintenance.22 - 24 the brachypodism ( bp ) mice which carry a functional null allele of gdf5 caused by a frame - shift mutation , exhibited abnormal skeletal and bone development.56 - 57 however , gdf5bp - j/+ mice appeared phenotypically normal , but does show an increased propensity of developing an oa phenotype when challenged.58 this model suggested that decreased gdf5 levels in mice contribute to osteoarthritis development , and it is supportive of the genetic data indicating the association between rs143383 polymorphism of gdf5 and human osteoarthritis . in the present study , we assessed all available literature . this effort to take a comprehensive and even - handed approach to the literature inclusion
may have strengthened the robustness of the findings while it avoided publication bias and minimized heterogeneity.59 compared with previous study 30 , the current meta - analysis pooled larger sample sizes , analyzed them both combined and separately , generated even more significant results with systematic design types and analysis approaches and included tests of heterogeneity , as well as sensitivity analyses . the current results showed that there is a potential association between the rs143383 allele of gdf5 and oa .
for greater insight into oa 's genetic component , more work is required to confirm the role of other genes that may have a small effect , and to identify new genetic risk factors .
the large samples required will necessitate multi - site projects and meta - analyses on the basis of national and international collaboration . in summary , this meta - analysis supports significant association of marker in the gdf5 gene with oa .
all authors critically revised the manuscript and gave final approval of the article for submission . | family , twin , adoption studies show osteoarthritis ( oa ) has a substantial genetic component .
several studies have shown an association between oa and growth differentiation factor 5 ( gdf5 ) , some others have not .
thus , the status of the oa - gdf5 association is uncertain .
this meta - analysis was applied to case - control studies of the association between oa and gdf5 to assess the joint evidence for the association , the influence of individual studies , and evidence for publication bias .
relevant studies were identified from the following electronic databases : medline and current contents before feb .
2012.for the case - control studies , the authors found 1 ) support for the association between oa and gdf5 .
the rs143383 polymorphism was significantly associated with oa [ fixed : or and 95%ci : 1.193 ( 1.139 - 1.249 ) , p<0.001 ; random : or and 95%ci : 1.204 ( 1.135 - 1.276 ) , p<0.001 ] , 2 ) no evidence that this association was accounted for by any one study , and 3 ) no evidence for publication bias . although the effect size of the association between oa and gdf5 is small , there is suggestive evidence for an association .
further studies are needed to clarify what variant of gdf5 ( or some nearby gene ) accounts for this association . |
dengue viruses , single - stranded positive polarity ribonucleic acid ( rna ) viruses of the family flaviviridae , are the most common cause of arboviral disease in the world .
dengue viruses have four serotypes , designated dengue types 1 - 4 ; and are transmitted mainly by bite of aedes aegypti mosquito and also by aedes albopictus . more than two - fifths of the world 's population ( 2.5 billion )
live in areas potentially at risk for dengue.(12 ) the global incidence of dengue fever ( df ) and dengue hemorrhagic fever ( dhf ) has increased dramatically in recent decades , and has turned this disease into a serious public health problem , especially in the tropical and sub - tropical countries.(345 ) dengue infection is endemic in many parts of india . in india ,
the first epidemic of clinical dengue - like illness was recorded in madras ( now chennai ) in 1780 .
the first virologically proven epidemic of df in india occurred in 1963 - 1964 , outbreaks have been reported from different parts of the country at regular intervals.(6789101112 ) delhi , a city in north india , is endemic for dengue infection and has experienced eight outbreaks of dengue virus infection since 1967 ; with the last reported in 2006.(111213 ) we report the experience of all india institute of medical sciences ( aiims ) , a tertiary care hospital in delhi city , in the 2010 dengue outbreak .
the objectives of the study were to know the incidence of laboratory confirmed dengue cases among the clinically suspected patients , to study the clinical profile of dengue - positive cases , and to co - relate the above with the prevalent serotype and environmental conditions .
the study included clotted blood specimens received in virology laboratory , from clinically suspected cases of dengue infection , from 1st may 2010 to 31st december 2010 .
serum was separated aseptically and was stored at -70c until further processing . for the identification of serotype , virus isolation followed by indirect fluorescent antibody assay ( ifa ) was done . as isolation could be done only in the acute phase samples for which proper cold chain was maintained throughout the transport , it was done in only 55 samples which were collected within 6 days of fever from the suspected dengue cases and were transported to the virology laboratory in ice . virus isolation was carried out in the c6/36 clone of aedes albopictus cell lines as described earlier.(11 ) ifa was performed using specific monoclonal antibodies to dengue virus types 1 - 4 ( provided by dr .
gubler , then at cdc , atlanta , during the 1996 outbreak).(14 ) the serum samples from patients having 5 days of fever ( n = 4370 ) were tested for dengue - specific igm antibodies .
-capture dengue igm enzyme - linked immunosorbent assay ( elisa ) kit was used ( supplied by the national institute of virology , pune ; under the national vector borne disease control program ) .
manufacturer 's instructions were strictly followed for performing the test and interpreting the results . optical density ( o.d ) was measured at 450 nm using elisa reader ( biotek , winooski , united states ) .
clinical and demographic details of the patients were obtained from the patients requisition forms , or from treating clinicians if required .
the details were recorded in microsoft - excel sheets and those of dengue igm elisa - positive patients were analyzed to discern the pattern .
for the identification of serotype , virus isolation followed by indirect fluorescent antibody assay ( ifa ) was done .
as isolation could be done only in the acute phase samples for which proper cold chain was maintained throughout the transport , it was done in only 55 samples which were collected within 6 days of fever from the suspected dengue cases and were transported to the virology laboratory in ice .
virus isolation was carried out in the c6/36 clone of aedes albopictus cell lines as described earlier.(11 ) ifa was performed using specific monoclonal antibodies to dengue virus types 1 - 4 ( provided by dr .
the serum samples from patients having 5 days of fever ( n = 4370 ) were tested for dengue - specific igm antibodies .
-capture dengue igm enzyme - linked immunosorbent assay ( elisa ) kit was used ( supplied by the national institute of virology , pune ; under the national vector borne disease control program ) .
manufacturer 's instructions were strictly followed for performing the test and interpreting the results . optical density ( o.d ) was measured at 450 nm using elisa reader ( biotek , winooski , united states ) .
clinical and demographic details of the patients were obtained from the patients requisition forms , or from treating clinicians if required .
the details were recorded in microsoft - excel sheets and those of dengue igm elisa - positive patients were analyzed to discern the pattern .
out of 55 specimens subjected to virus isolation , 33 ( 60.0% ) were positive for dengue-1 , while one specimen ( 1.8% ) was positive for dengue-2 .
thus , the prevalent serotype ( 97.1% of the 34 culture - positive df cases ) was dengue virus ( denv ) serotype-1 .
dengue igm antibody test was done on a total of 4,370 samples , of which 1,700 were positive for denv - specific igm antibodies ( 38.9% ) . in the 1,700 serologically confirmed dengue cases , male - to - female ratio was 1.6:1 .
the largest number of positive samples ( 30.8% ) was from the age - group 21 - 30 years [ table 1 ] .
the youngest patient was a 1-month - old male child and the oldest was an 87-year - old male patient .
age - wise distribution of dengue - positive patients clinical profile and month - wise distribution of dengue - positive patients in 2010 out of 1,700 serologically confirmed dengue cases , 175 ( 10.3% ) were dhf patients , of which 158 ( 9.3% ) were dhf grade i / ii , and 17 ( 1.0% ) were dhf grade iii / iv ( dengue shock syndrome ) .
thrombocytopenia ( platelet count < 100,000 cells per microliter of blood ) was seen in 393 ( 23.1% ) dengue igm - positive patients and 311 ( 18.3% ) patients presented with myalgia .
the first dengue igm sero - positive case was in the last week of may , a 5-year - old male child from jharkhand - a state in east - central india .
maximum number of specimens was received in september ( n = 1745 ; 39.9% of 4,370 ) , followed by october ( n = 1330 ; 30.4% of 4,370 ) .
the maximum cases diagnosed were also in september ( n = 782 ; 46.0% of 1,700 ) , followed by october ( n = 448 ; 26.4% of 1,700 ) . percentage positives of the suspected cases peaked in september and august ( 44.8% and 44.2% , respectively ) .
out of 55 specimens subjected to virus isolation , 33 ( 60.0% ) were positive for dengue-1 , while one specimen ( 1.8% ) was positive for dengue-2 .
thus , the prevalent serotype ( 97.1% of the 34 culture - positive df cases ) was dengue virus ( denv ) serotype-1 .
dengue igm antibody test was done on a total of 4,370 samples , of which 1,700 were positive for denv - specific igm antibodies ( 38.9% ) . in the 1,700 serologically
the largest number of positive samples ( 30.8% ) was from the age - group 21 - 30 years [ table 1 ] .
the youngest patient was a 1-month - old male child and the oldest was an 87-year - old male patient .
clinical profile and month - wise distribution of dengue - positive patients in 2010 out of 1,700 serologically confirmed dengue cases , 175 ( 10.3% ) were dhf patients , of which 158 ( 9.3% ) were dhf grade i / ii , and 17 ( 1.0% ) were dhf grade iii / iv ( dengue shock syndrome ) . only one serologically confirmed dengue patient died ( 0.06% ) .
thrombocytopenia ( platelet count < 100,000 cells per microliter of blood ) was seen in 393 ( 23.1% ) dengue igm - positive patients and 311 ( 18.3% ) patients presented with myalgia .
the first dengue igm sero - positive case was in the last week of may , a 5-year - old male child from jharkhand - a state in east - central india .
maximum number of specimens was received in september ( n = 1745 ; 39.9% of 4,370 ) , followed by october ( n = 1330 ; 30.4% of 4,370 ) .
the maximum cases diagnosed were also in september ( n = 782 ; 46.0% of 1,700 ) , followed by october ( n = 448 ; 26.4% of 1,700 ) . percentage positives of the suspected cases peaked in september and august ( 44.8% and 44.2% , respectively ) .
in the year 2010 , four years after the last epidemic of 2006 , india witnessed a massive wave of dengue fever , involving almost all states , except those in the extreme north and extreme north - east .
the total number of serologically confirmed dengue cases from all over india in 2010 was 28,066 , the highest on records .
total dengue igm - positive cases from delhi were 6,259 ( 22.8% of 28,066 ) , considerably higher than those reported in the previous years ( 548 , 1312 , and 1153 in 2007 , 2008 , and 2009 , respectively).(15 ) as per the epidemiological definition , as the number of dengue fever cases clearly exceeded all previous records , which was definitely greater than expected , it constituted an outbreak .
over the last one and half decades , outbreaks and sporadic cases have been ascribed to different serotypes of dengue virus .
the 1996 epidemic was mainly due to dengue-2 virus.(1112 ) in 2003 outbreak , all four denv serotypes were found to be co - circulating.(13 ) in 2005 , dengue-3 was identified as the predominant serotype in delhi.(16 ) in the year 2010 , the predominant serotype found was dengue-1 , which seemed to have replaced the previous circulating serotype .
it is known that infection with one dengue serotype provides lifelong homologous immunity , but only transient cross - protection against other serotypes .
the change in prevalent serotype is the major factor responsible for the enormous number of dengue cases witnessed , as the exposed population was by and large non - immune and thus susceptible to serotype-1 .
maximum number of cases was in the 5 - 20 year age - group , while in 2003 , maximum number of positive cases was in 21 - 30 year age - group.(111213 ) in our study , maximum dengue cases ( 524 ; 30.8% of 1,700 ) were from the age group 21 - 30 years .
the shift from pediatric / adolescent population to young adults getting affected reflects the presence of non - immune adult population falling prey to the circulating serotype of dengue virus .
classical df is characterized by sudden onset of high grade fever , accompanied by headache , retro - orbital pain , myalgia , and thrombocytopenia . in our study , myalgia was seen in 18.3% and thrombocytopenia in 23.1% cases .
thus , most of dengue cases were clinically indistinguishable from other febrile illnesses , and could be missed lacking the clinical suspicion and timely diagnosis .
the risk of developing dhf / dss is greatest following an anamnestic dengue infection , particularly if the most recent infection was with dengue-2 virus.(1718 ) dengue-2 virus was the predominant serotype in 1996 outbreak of df / dhf / dss , and was responsible for the witnessed severity and mortality ( 10.8% ) . in 2003 , a mortality of 1.3%was reported from aiims ; and in 2006 , 1.5% mortality was reported from india.(11131920 ) in 2010 , total number of deaths was 110 all over india ( mortality 0.4% of 28,066 cases ) , with 8 from delhi ( mortality 0.13% of 6,259 cases).(15 ) at aiims , with only one death , the mortality was even lower ( 0.06% ) . and ,
this suggests that the present dengue outbreak was larger in scale , but lesser in severity .
the role of environmental factors in infectious diseases is well - known . in most countries ,
dengue epidemics are reported to occur , during the warm , humid , and rainy seasons , which favor abundant mosquito growth and shorten the extrinsic incubation period as well.(212223 ) in our study , the largest proportion of serologically positive cases was recorded in the post - monsoon period , which is in agreement with previous studies.(2224 ) the reason for large number of df cases can also be related to the fact that in 2010 , delhi witnessed one of the wettest monsoons recorded .
delhi obtained 997.2 millimeters ( mm ) of rainfall between july 1 and september 30 .
the total rainfall in these three months in 2010 was not only notably higher than that of the previous 4 years ( 412.1 mm , 408.2 mm , 268.3 mm , and 468.2 mm in 2006 , 2007 , 2008 , and 2009 , respectively ) but also appreciably exceeded the 25-year average of 530.8 mm ( 1981 - 2005).(25 ) the prolonged and heavy rains led to a rise in mosquito growth , thus increasing transmission of mosquito - borne infections .
the huge amount of infrastructure development which took place prior to commonwealth games ( october 2010 ) , may also have made growth environment more conducive for mosquitoes .
another factor which would have contributed to the number of dengue cases could be an increase in the reporting of cases due to improvement in diagnostic settings .
the event was of a large magnitude , but was comparatively less severe . a change in the predominant circulating serotype , unprecedented rains , enormous infrastructure development , and increased reporting due to improved diagnostic facilities all accounted for the observed multitude of people affected . | background : dengue viruses , single - stranded positive polarity ribonucleic acid ( rna ) viruses of the family flaviviridae , are the most common cause of arboviral disease in the world .
we report a clinico - epidemiological study of the dengue fever outbreak of 2010 from a tertiary care hospital in delhi , north india.objectives:objectives of the study were to know the incidence of laboratory - confirmed dengue cases among the clinically suspected patients ; to study the clinical profile of dengue - positive cases ; and to co - relate the above with the prevalent serotype and environmental conditions.materials and methods : four thousand three hundred and seventy serum samples from clinically suspected cases of dengue infection were subjected to -capture enzyme - linked immunosorbent assay ( elisa ) for detection of dengue - virus - specific igm antibodies .
virus isolation was done in 55 samples on c6/36 cell mono - layers .
clinical and demographic details of the patients were obtained from requisition forms of the patients or from treating clinicians.results:out of the 4,370 serum samples , 1,700 were positive for dengue - virus - specific igm antibodies ( 38.9% ) .
prevalent serotype was dengue virus type-1 .
thrombocytopenia and myalgia was seen in 23.1% and 18.3% of the 1,700 dengue igm - positive patients , respectively .
also , 10.3% of 1,700 were dengue hemorrhagic fever ( dhf ) patients ; and the mortality in serologically confirmed dengue fever cases was 0.06%.conclusions : a change in the predominant circulating serotype , unprecedented rains , enormous infrastructure development , and increased reporting due to improved diagnostic facilities were the factors responsible for the unexpected number of dengue fever cases confronted in 2010 . |
schizophrenia is a chronic mental disorder that affects approximately 1% of the world population and is characterized by a relapsing course with significant burden for patients , families , and society.13 although many patients receiving chronic antipsychotic therapy can be considered clinically stable , a subgroup of patients will eventually have poor outcomes , not achieving optimal symptom relief.4 premature discontinuation and poor prescription compliance are well established reasons for suboptimal effectiveness in clinical practice,512 and 40%50% of schizophrenic patients are believed to be only partially compliant.8,12 nonadherence to oral antipsychotic therapy is associated with potential symptom re - emergence and a higher risk of relapse.1318 relapses are responsible for frequent inpatient admissions , and account for 80% of overall schizophrenia treatment costs.19,20 their consequences include social and overall productivity impairment , increased risk of a poor prognosis , and prolonged recovery in subsequent episodes.21,22 in this setting , alongside symptom remission , relapse prevention is a major therapeutic goal for schizophrenic patients .
atypical antipsychotics are currently a critical part of schizophrenia management worldwide , and several studies have demonstrated their efficacy and a better tolerability profile relative to conventional agents , with reduced risk of extrapyramidal side effects.2325 risperidone long - acting injection was the first injectable , long - acting , second - generation agent to become available , providing continuous medication delivery and reducing plasma level fluctuations.26,27 a robust set of evidence has shown that risperidone long - acting injection administered intramuscularly every 2 weeks improves symptom control , prevents relapses , positively impacts patients health - related quality of life , and reduces hospitalizations.13,21,2832 because compliance monitoring is a critical issue for patients with schizophrenia , risperidone long - acting injection can potentially minimize the risk of intermittent or interrupted treatment , by ensuring more stable drug levels through slow and steady release of risperidone over several weeks.13,29,30 individuals with a previous history of nonadherence or partial adherence are a subset of patients of special concern for clinicians regarding future compliance behavior .
the purpose of the present study was to assess the efficacy , safety , and tolerability of switching clinically stable patients with schizophrenia and a history of nonadherence on oral antipsychotic therapy to long - acting risperidone .
this was a 50-week , multicenter , open - label , noncomparative trial of risperidone long - acting injection ( risperdal consta ; janssen pharmaceutical companies , johnson and johnson , sao paolo , brazil ) in stable patients with schizophrenia attending seven brazilian centers who were switched from oral treatment .
a 50-week study duration was chosen to provide information relevant to clinical decision - making in the real - world setting , given that long - term follow - up is essential for schizophrenia patients . as required in multicenter studies , raters from each of the seven sites went through a training process on all clinical assessment scales to be used before initiating the trial .
all raters were required to have prior clinical experience with schizophrenic patients and documented experience administering at least the positive and negative syndrome scale ( panss ) , which was the primary outcome measure in the trial .
the study was approved by the ethics committee at each participating site and written consent was obtained from each patient or their legal representative before enrollment .
patients were recruited for the study if they met the following inclusion criteria : diagnostic and statistical manual of mental disorders fourth edition text revision ( dsm - iv ) criteria for schizophrenia ; age 1850 years ; current treatment with oral antipsychotics ( both first- and second - generation ) ; history of nonadherence to antipsychotic treatment within the previous 12 months ; and panss 90 and a panss 4 for conceptual disorganization , hallucinatory behavior , suspiciousness , and unusual thought content .
nonadherent patients were those fulfilling at least one of the following criteria : hospitalization due to interruption or irregular use of medication within the previous 12 months ; clinical worsening due to irregular use of medication ; patient refusal to take medication , as reported by family members ; difficulty convincing patient to accept medication , as reported by family members ; and at least one treatment interruption with worsening of symptoms .
exclusion criteria included a history of refractoriness to antipsychotic treatment , previous use of clozapine , use of another depot antipsychotic within the previous 12 months , another major axis disorder , and risk of suicide .
women of childbearing age not using an approved method of birth control were also excluded .
patients continued their outgoing antipsychotic for the first 3 weeks to ensure adequate drug coverage , and the previous medication was interrupted thereafter . at the first study visit ,
all eligible patients were prescribed oral risperidone1 mg for 3 days as a sensitivity and tolerability test .
patients received intramuscular injections of risperidone long - acting injection at an initial dose of 25 mg every 2 weeks .
the dose could be increased to up to 50 mg at the investigator s discretion .
biperidene for extrapyramidal symptoms and clonazepam for anxiety and insomnia were allowed as concomitant medications .
the primary efficacy measure was the change from baseline to endpoint for the total score on panss.33 secondary efficacy measures included the change from baseline in panss subscales ( negative symptoms , positive symptoms , general psychopathology ) , clinical global impression ( cgi),34 and personal and social performance scale ( psp).35 the drug attitude inventory ( dai-10 ) was employed to assess patients attitudes towards psychiatric medication.36 psp is a 100-point classification scale that measures personal and social activity in four behavioral domains ( socially useful activities , personal and social relationships , self - care , and disturbing and aggressive behaviors ) .
the final scale score is obtained summing the scores of all four domains , and ranges from 1 to 100 .
dai-10 is a 10-item dichotomous ( true or false ) answer scale that enables classification of patients based upon their attitudes towards medication .
a positive final total score means a positive subjective response ( compliant ) and a negative total score means a negative subjective response ( noncompliant ) .
answers are coded as positive ( + 1 point ) or negative ( 1 point ) , and the final score is the sum of all points
. spontaneously reported adverse events were recorded by the investigator at all visits ( weeks 2 , 4 , 8 , 12 , 16 , 20 , 24 , 38 , and 50 ) , and severity of movement disorders was evaluated using the extrapyramidal symptom rating scale ( esrs).37 electrocardiograms and blood samples for laboratory analysis were obtained at screening , week 24 , and endpoint .
the sample size required to provide the desired 80% power at a two - sided alpha of 0.05 was 60 patients , considering the mean reduction in panss scores reported in two previously published clinical studies of risperdal consta.30,38 all patients who received at least one injection of risperidone long - acting injection and had at least one postbaseline efficacy assessment ( intention - to - treat population ) were included in the efficacy analysis .
the safety population comprised patients who received at least one injection , regardless of efficacy measurement status .
changes in efficacy measures from baseline to endpoint ( week 50 ) were analyzed by the paired t - test and the wilcoxon signed - rank test for normal and asymmetric continuous variables as appropriate .
scores measured over time ( panss , cgi , psp , dai , and esrs ) were compared by repeated - measures analysis of variance using a mixed linear model for time effect ( within - group factors ) .
statistical analyses were carried out using sas ( v 9.1.3 ; sas institute , cary , nc )
patients were recruited for the study if they met the following inclusion criteria : diagnostic and statistical manual of mental disorders fourth edition text revision ( dsm - iv ) criteria for schizophrenia ; age 1850 years ; current treatment with oral antipsychotics ( both first- and second - generation ) ; history of nonadherence to antipsychotic treatment within the previous 12 months ; and panss 90 and a panss 4 for conceptual disorganization , hallucinatory behavior , suspiciousness , and unusual thought content .
nonadherent patients were those fulfilling at least one of the following criteria : hospitalization due to interruption or irregular use of medication within the previous 12 months ; clinical worsening due to irregular use of medication ; patient refusal to take medication , as reported by family members ; difficulty convincing patient to accept medication , as reported by family members ; and at least one treatment interruption with worsening of symptoms .
exclusion criteria included a history of refractoriness to antipsychotic treatment , previous use of clozapine , use of another depot antipsychotic within the previous 12 months , another major axis disorder , and risk of suicide .
women of childbearing age not using an approved method of birth control were also excluded .
patients continued their outgoing antipsychotic for the first 3 weeks to ensure adequate drug coverage , and the previous medication was interrupted thereafter . at the first study visit ,
all eligible patients were prescribed oral risperidone1 mg for 3 days as a sensitivity and tolerability test .
patients received intramuscular injections of risperidone long - acting injection at an initial dose of 25 mg every 2 weeks .
the dose could be increased to up to 50 mg at the investigator s discretion .
biperidene for extrapyramidal symptoms and clonazepam for anxiety and insomnia were allowed as concomitant medications .
the primary efficacy measure was the change from baseline to endpoint for the total score on panss.33 secondary efficacy measures included the change from baseline in panss subscales ( negative symptoms , positive symptoms , general psychopathology ) , clinical global impression ( cgi),34 and personal and social performance scale ( psp).35 the drug attitude inventory ( dai-10 ) was employed to assess patients attitudes towards psychiatric medication.36 psp is a 100-point classification scale that measures personal and social activity in four behavioral domains ( socially useful activities , personal and social relationships , self - care , and disturbing and aggressive behaviors ) .
the final scale score is obtained summing the scores of all four domains , and ranges from 1 to 100 .
dai-10 is a 10-item dichotomous ( true or false ) answer scale that enables classification of patients based upon their attitudes towards medication .
a positive final total score means a positive subjective response ( compliant ) and a negative total score means a negative subjective response ( noncompliant ) .
answers are coded as positive ( + 1 point ) or negative ( 1 point ) , and the final score is the sum of all points . spontaneously reported adverse events were recorded by the investigator at all visits ( weeks 2 , 4 , 8 , 12 , 16 , 20 , 24 , 38 , and 50 ) , and severity of movement disorders was evaluated using the extrapyramidal symptom rating scale ( esrs).37 electrocardiograms and blood samples for laboratory analysis were obtained at screening , week 24 , and endpoint .
the sample size required to provide the desired 80% power at a two - sided alpha of 0.05 was 60 patients , considering the mean reduction in panss scores reported in two previously published clinical studies of risperdal consta.30,38 all patients who received at least one injection of risperidone long - acting injection and had at least one postbaseline efficacy assessment ( intention - to - treat population ) were included in the efficacy analysis .
the safety population comprised patients who received at least one injection , regardless of efficacy measurement status .
changes in efficacy measures from baseline to endpoint ( week 50 ) were analyzed by the paired t - test and the wilcoxon signed - rank test for normal and asymmetric continuous variables as appropriate .
scores measured over time ( panss , cgi , psp , dai , and esrs ) were compared by repeated - measures analysis of variance using a mixed linear model for time effect ( within - group factors ) .
statistical analyses were carried out using sas ( v 9.1.3 ; sas institute , cary , nc )
of the 60 patients who were screened , seven patients could not be enrolled in the study for the following reasons : injectable depot antipsychotic use within the previous 12 months ( n = 1 ) ; a clinically significant abnormality in the screening tests ( n = 2 , one electrocardiographic abnormality and one anemia ) ; self - withdrawal ( n = 2 ) ; and loss to follow - up ( n = 2 , both before receiving the study medication .
fifty - three patients received at least one dose of risperidone long - acting injection ( safety population , n = 53 ) ; of these , two were excluded from the efficacy analysis for not undergoing any postbaseline assessment ( intention - to - treat efficacy population , n = 51 ) .
most dropouts were due to patient s request for withdrawal ( 62.5% ) ; 16.7% were adverse event - related , and none were due to lack of efficacy .
clinical and demographic characteristics of the total sample and the subsample of study completers are summarized in table 1 .
the study group was predominantly male ( 73.6% ) with a mean age of 33.6 years .
the median disease duration was 5.5 years ( mean standard deviation 9.2 9.9 years ) .
most patients were switched from oral risperidone ( 41.5% ) , followed by haloperidol ( 22.6% ) and chlorpromazine ( 11.3% ) .
final doses ( week 48 ) of risperidone long - acting injection were 25 mg in 38.1% , 37.5 mg in 38.1% , and 50 mg in 23.8% of patients . regarding concomitant medication , 15 ( 28.3% ) patients received clonazepam , 10 ( 18.9% ) received biperidene , 17 ( 32.1% ) received risperidone , and 14 ( 26.4% ) received haloperidol .
it was not possible to identify clinically relevant differences between study completers and the initial sample . over a 50-week period ,
there were significant reductions in total panss score and also in the panss positive , negative , and general psychopathology subscales ( table 2 ) .
the mean panss total score was significantly reduced from baseline to endpoint ( 58.8 1.82 vs 49.72 2.32 ; p = 0.0002 ) .
a significant improvement was seen at week 4 , and this effect was maintained throughout the study .
in addition , significant improvements were observed from baseline to endpoint and during the study in all panss subscales .
mean cgi also significantly improved from baseline to endpoint ( mean standard error of the mean = 3.55 0.13 vs 3.19 0.16 ; p = 0.0131 ) .
the factor week of treatment had a statistically significant effect from week 4 ( p < 0.01 ) and these clinical benefits remained stable until the final visit ( table 3 ) . for the psp scale ,
the time factor also had a positive impact on mean performance scores , which improved from 60.0 ( 95% confidence interval [ ci ] : 54.265.7 ) at baseline to 69.1 ( 95% ci : 64.873.4 ) at week 50 ( p = 0.0002 , table 3 ) .
dai-10 scores were measured at four different visits from baseline to endpoint . at all visits ,
significant improvements were observed and the mean ( standard error of the mean ) scores rose from 2.78 0.68 to 5.07 0.77 ( p = 0.0062 ) .
there was a progressive and sustained increase in dai-10 scores , showing positive attitudes towards risperidone long - acting injection throughout the study , as shown in table 3 .
adverse events reported in more than 10% of patients were insomnia ( 22.6% ) , increased prolactin levels ( 17.0% ) , and weight gain ( 13.2% ) .
investigators categorized 22 ( 41.5% ) adverse events as likely or very likely related to the study drug ( table 4 ) .
three serious adverse events were reported by the investigators , ie , psychomotor agitation , worsening of symptoms , and worsening of psychotic symptoms .
there were three ( 5.7% ) early discontinuations due to adverse events ( sexual dysfunction , decreased libido , psychomotor agitation , and worsening of pre - existing symptoms ) .
severity of movement disorders was significantly reduced during treatment with risperidone long - acting injection ( table 5 ) .
significant improvements were noted on the esrs overall scale , subjective evaluation , and extrapyramidal symptoms item from week 4 ( p < 0.0001 ) .
changes in laboratory findings other than serum prolactin were not clinically significant , although high - density lipoprotein and creatinine changes reached statistical significance ( table 6 ) .
the 29 patients for whom weight data at baseline and endpoint were available showed a mean weight gain of 2.8 4.6 kg ( p < 0.001 ) .
the findings of this open - label study demonstrate that risperidone long - acting injection was an effective treatment in a real - world setting for clinically stable brazilian patients with schizophrenia who were switched from other antipsychotic agents due to poor compliance , as assessed by change in scores on panss measures and cgi - s .
patients achieved significant clinical improvements in terms of symptom control when switched directly to risperidone long - acting injection from their current antipsychotic therapy .
most patients maintained the lower doses of risperidone long - acting injection , ie , 25 mg and 37.5 mg , during the trial .
the mean panss total score was significantly reduced from baseline to endpoint , and patients remained stable , not showing any worsening of symptoms .
results from a number of other clinical studies have also reported significant and sustained clinical improvement in patients directly switched to risperidone long - acting injection from their previous antipsychotic agents.29,38,39 in a 12-week , randomized , placebo - controlled trial by kane et al , risperidone long - acting injection was associated with significantly greater improvements in panss and cgi - s scores at endpoint compared with placebo.30 significant improvements in total panss scores ( p < 0.01 ) , positive symptoms ( p < 0.01 ) , and negative symptoms ( p
< 0.001 ) were also observed during an international , open - label , 12-month study conducted by fleischhacker et al in patients with schizophrenia who were switched to risperidone long - acting injection from oral or long - acting conventional or oral atypical antipsychotics.29 risperidone long - acting injection was well - tolerated , with minimal weight change and an overall favorable safety profile .
although of minimum magnitude in clinical terms , the statistically significant change in high - density lipoprotein could potentially raise concern about metabolic side effects .
however , the observed decrease was not accompanied by consistent changes in total cholesterol , low - density lipoprotein , very low - density lipoprotein , triglycerides , and fasting glycemia , reinforcing the absence of clinically sound metabolic effects of risperidone long - acting injection in this sample . the creatinine increase , although statistically significant , was considered clinically irrelevant .
the incidence of adverse events was comparable with those reported in previous studies . according to the report by kane et al ,
risperidone long - acting injection was generally well - tolerated , with an overall incidence of adverse events similar to that with placebo in comparative trials.30 in that study , similar proportions of patients reported adverse events in the active and control group , while serious adverse events were more frequent in the placebo group ( 23.5% ) than in the 25 , 50 , and 75 mg risperidone long - acting injection groups ( 13% , 14% , and 15% , respectively).30 results from other studies have also reported that patients can be safely switched from oral conventional or atypical therapy and conventional long - acting agents to risperidone long - acting injection.38,4042 these findings confirm the effectiveness of switching stable patients with schizophrenia from other antipsychotics to risperidone long - acting injection in a brazilian real - world setting .
following a switch to risperidone long - acting injection , stable patients showed further significant improvements in symptom control over the treatment period , reducing their panss total score and subscales and cgi - s scores .
some of the limitations of the study were its small sample size , a relatively high dropout rate ( 42.5% ) , and the open - label design . in absolute terms , the observed dropout rate was not significantly greater in magnitude than that observed in previous atypical antipsychotic trials ( 33.5% in fixed - dose studies and 45.0% in flexible - dose studies).43 this study enrolled only patients with a previous history of compliance issues , which could also be a factor explaining the higher dropout rates , especially those due to patient request .
another limitation is the lack of inter - rater reliability assessments as part of the trial .
rater training was performed to improve raters clinical skills and to ensure standardized clinical assessments before the study initiation , but statistical evaluation of inter - rater reliability was not conducted .
nevertheless , this study yielded useful knowledge on the effectiveness and safety of risperidone long - acting injection in a brazilian population over a 12-month study period , and observed significant clinical improvements after switching from oral antipsychotics to risperidone long - acting injection .
long - acting injectable risperidone is an effective and safe treatment alternative for patients with schizophrenia and a history of poor adherence to oral treatment .
the study indicates a favorable tolerability profile , a positive effect on personal and social functioning , and adequate patient treatment acceptance .
these findings reinforce long - acting injectable risperidone as a reasonable alternative for long - term care of stable schizophrenia patients in whom compliance issues are anticipated . | background : long - acting injectable antipsychotics may improve medication adherence , thereby improving overall treatment effectiveness .
this study aimed to evaluate the effectiveness , safety , and tolerability of risperidone long - acting injection in schizophrenic patients switched from oral antipsychotic medication.methods:in a 12-month , multicenter , open - label , noncomparative study , symptomatically stable patients on oral antipsychotic medication with poor treatment adherence during the previous 12 months received intramuscular injections of risperidone long - acting injection ( 25 mg starting dose ) every 2 weeks .
the primary endpoint was the change in positive and negative syndrome scale ( panss ) total score.results:of the 60 patients who were screened , 53 received at least one injection ( safety population ) , and 51 provided at least one postbaseline assessment .
mean panss total scores improved significantly throughout the study and at endpoint .
significant improvements were also observed in clinical global impression of severity , personal and social performance , and drug attitude inventory scales .
risperidone long - acting injection was safe and well - tolerated .
severity of movement disorders on the extrapyramidal symptom rating scale was reduced significantly .
the most frequently reported adverse events were insomnia ( 22.6% ) , increased prolactin ( 17.0% ) , and weight gain ( 13.2%).conclusion : risperidone long - acting injection was associated with significant symptomatic improvements in stable patients with schizophrenia following a switch from previous antipsychotic medications . |
tobacco use is a leading public health problem all over the world with 82% of the world 's 1.1 billion smokers residing in low and middle income countries and where , in contrast to the declining consumption in high - income countries , tobacco consumption is on the rise .
tobacco consumption has overall been a major contributor to deaths due to circulatory diseases , pulmonary and malignant diseases in india .
smoking also increases the incidence of clinical tuberculosis , is a cause of half the male tuberculosis deaths in india , and of a quarter of all male deaths in middle age .
information on prevalence of tobacco use in india is available from surveys carried out in general community . according to the national cross - sectional household survey
, india has more than 200 million tobacco consumers ; however , prevalence of smoking and tobacco chewing varies widely between different states , and has a strong association with individual 's socio - cultural characteristics .
a recent nationwide study on smoking and mortality in india estimated that smoking in persons between the ages of 30 and 69 years is responsible for about 1 in 20 deaths of women and 1 in 5 deaths of men , totaling to 1 million deaths per year .
study of smoking pattern among middle age and elderly has received poor attention despite its proven implications on health .
the present study was thus carried out to determine :
prevalence and correlates of tobacco smoking among persons aged 30 years and above in a resettlement colony of delhi.level of awareness regarding hazards of tobacco smoking.quitting behavior among smokers and factors influencing such behavior .
prevalence and correlates of tobacco smoking among persons aged 30 years and above in a resettlement colony of delhi .
from previous study , the prevalence of current smoking in delhi was 23.2% , which would require a sample size of at least 595 subjects to estimate the prevalence of current smoking with 15% relative precision and with 95% confidence .
this cross - sectional study was conducted in gokulpuri , a resettlement colony in new delhi , india during may 2007 - april 2008 .
the study included persons aged 30 years and above residing in the study area at the time of survey .
the area has 4 blocks a , b , c , d with a total population of 22100 ( 5402 , 5222 , 5792 , 5684 respectively in the 4 blocks ) .
there are 4041 households and 2404 houses ( 568 , 576 , 643 , and 617 houses , respectively , in blocks a , b , c , d ) .
every 4 house was selected by the systematic random sampling method in each of the 4 blocks of the area . from each of the selected houses , one household having person(s ) 30 years and above age
if the house had more than one household with persons above 30 , lottery was drawn to select the household .
if there was no person above 30 in house visited , the immediate next house was chosen . in the selected household ,
all the persons above 30 years who were willing to participate and giving written informed consent were included in the study .
a total of 600 households ( 142 , 144 , 160 , and 154 , respectively , in the 4 blocks ) were selected , and 955 individuals were approached . out of these , 911 persons were interviewed ( 211 , 227 , 238 , and 235 persons in 4 blocks , respectively ) .
the socio - demographic variables collected were age , sex , educational attainment , and occupation of the participant and income of the family .
they were classified as current smokers : smoked regularly for within 1 month prior to examination ; non smokers : never smoked or occasionally smoking ; ex - smokers : stopped more than 1 month prior to examination ; and ever smokers comprising of current and ex - smokers .
details on the different forms of smoking used , including cigarette and bidi and hukkah as well as on the numbers smoked per day , were obtained from the smokers .
pack years were calculated from the average number of cigarettes and/or bidis smoked per day ; 1 pack year taken as smoking 20 cigarettes or 80 bidis for 1 year .
participants were asked to stand still on scale with face forward , and place arms on the sides of the body .
before the reading was taken , the participant was requested to have feet together , heels against the wall , knees straight , and look straight ahead and a point corresponding to height was marked on the wall using a hard cardboard . the distance between floor and the point
data was coded , analyzed , and statistically evaluated using spss ( statistical package for social sciences , version 16.0 ) .
odds ratios ( or ) , 95% confidence interval ( 95% ci ) , and p - values were calculated for each predictor variable .
multivariate logistic regression was performed to determine the independent predictors of current smoking by including variables significant at a level p 0.2 in univariate analysis .
further information was given to persons who consented to take part in the study , and the participants were free to leave the study any time if they desired to do so .
out of the 955 people approached , 911 consented to participate in the study giving a response rate of 95.3% .
a total of 911 individuals participated in the study with equal representation of both males and females .
the age of the participants varied from 30 to 90 years ( range - 60 years ) .
participants aged 30 - 59 years constituted 83.8% of the study population . there was no difference in the age - wise distribution of males and females up to age of 69 years ( = 2.40 , p = 0.49 ) .
more than half the population was either illiterate or only primary school pass [ table 1 ] .
socio - demographic characteristics of the study population in all , 224 participants were found to be currently smoking , giving an overall prevalence of current smoking to be 24.6% ( 95% ci 21.90 - 27.49 ) in the study population .
history of ever smoking was reported by 287 ( 31.5% ) participants ( 95% ci 28.57 - 34.59 ) [ table 2 ] .
distribution of study participants according to smoking status among current smokers , majority 198 ( 88.4% ) smoked bidi exclusively , 18 ( 8% ) smoked cigarette exclusively , and 8 ( 3.6% ) smoked a combination of bidi and hookah / cigarette .
with respect to the amount of tobacco smoke exposure in ever smokers , most 116 ( 40.4% ) had less than 2.5 pack year exposure , 78 ( 27.2% ) had an exposure between 2.51 - 6.25 pack years , 66 ( 23% ) between 6.26 - 13.50 pack years , whereas 27 ( 9.4% ) had more than 13.5 pack year exposure . on an average
more male participants were found to be currently smoking 184 ( 40.1% ) in comparison to females ( 8.8% ) , and the association between tobacco smoking and gender was statistically significant ( p < 0.001 ) [ table 2 ] .
smoking showed an increasing trend with an advancing age in both males and females [ table 3 ] .
on univariate analysis , smoking was found to be significantly associated with advancing age , primary and middle education , lower socio - economic status , unskilled semi - skilled and skilled occupation , and lower bmi . on multivariate analysis , the factors , which were found to be significantly associated with current smoking , were : male sex ( or = 5.74 ( 95% ci 2.86 - 11.49 ) ) , advancing age ( or = 1.99 ( 95% ci 1.25 - 3.17 ) for age 40 49 years , ( or = 2.57 ( 95% ci 1.66 - 3.99 ) for 50 years and above ) , lower education ( or = 2.07 ( 95% ci 1.27 - 3.38 ) ) for up to middle school , ( or = 2.36 ( 95% ci 1.30 - 4.27 ) for illiterate ) , skilled occupation ( or = 2.54 ( 95% ci 1.23 - 5.24 ) ) , lower socio - economic status ( or = 2.83 ( 95% ci 1.49 - 5.36 ) ) , and low bmi ( or = 2.10 ( 95% ci 1.33 - 3.32 ) ) [ table 4 ] .
there was an increasing trend of smoking with increasing age ( 2tr = 22.9 , p < 0.001 ) , decreasing bmi ( 2tr = 23.68 , p < 0.001 ) , and low socio - economic status ( 2tr = 9.82 , p = 0.0017 ) .
prevalence of current smoking among males and females according to socio - demographic factors and bmi multiple logistic regression analysis to evaluate factors associated with smoking of all participants in the study , 585 ( 64.2% ) were aware of the hazards of tobacco smoking .
current smokers 69.6% ( 156 out of 224 ) had better knowledge than non - smokers ( 62.4% ) .
most of the respondents believed that smoking increased the chances of tuberculosis , respiratory problems , and cancer [ table 5 ] .
participants awareness regarding hazards of tobacco smoking of the 287 ever smokers , 63 ( 21.9% ) had quit smoking in the past due to some reason .
17 ( 5.9% ) participants stopped smoking for less than a year , whereas majority 46 ( 16% ) had quit for more than a year . among the 63 successful quitters , 17 ( 27% )
did not have a specific reason to quit and did so by self offered vow to quit .
majority 35 ( 55.5% ) , however , quit smoking due to the initiation of health problems , which included respiratory problems ( 36.5% ) like diagnosed cases of chronic obstructive pulmonary disease , exacerbation of asthma , chronic cough , and breathlessness ; heart disease ( 3.17% ) and other illnesses ( 15.8% ) . apart from these , other factors contributing to quitting were social or familial pressure , either by spouse / other family member(s ) in 8 ( 12.6% ) cases and awareness regarding hazards of smoking in 3 ( 4.7% ) cases .
literate smokers were more likely to quit than illiterate smokers ( 60.3% vs 39.7% ) .
the purposes of this population - based study were to estimate the prevalence and correlates of current smoking among middle - aged and elderly people and to assess their knowledge and quitting behavior .
only few surveys have been conducted in delhi with the objective of estimating the prevalence of tobacco smoking , especially among these age groups .
national survey on smoking has shown wide variations between urban and rural areas , age , gender , education , and other socio - demographic variables across the country . in the present study ,
the prevalence of current smoking among people aged 30 years and above in an urban resettlement colony of delhi was estimated to be 24.6% , and this was much higher among males ( 40.1% ) than females ( 8.8% ) .
similar findings had been reported from delhi by chhabra et al . in a clustered community - based study in 2001 with about 50% of adult males between 30 - 60 years found to be current smokers , and very few female subjects admitting to smoking .
the overall prevalence of smoking among 4141 persons , aged 18 years and above , belonging to different socio - economic strata , was estimated to be 23.2% ( males 39.1% and females 2.6% ) .
other studies in delhi among persons aged 15 years and above have also shown a higher level of smoking habit among males ( 23.9% to 29.5% ) in comparison to females ( 1.8% to 4.2% ) .
recently , a survey in urban area of chennai also reported a 38% prevalence of smoking among males aged 35 - 69 years in the city .
one of the important factors for low prevalence of smoking among females was social unacceptability .
there was an increasing trend of smoking with an increasing age being higher among older age groups compared with the younger ones .
the prevalence of smoking in both the sexes increased with age leveling off after 70 years of age .
similar gender differences in smoking and increasing trends with age have been reported earlier in delhi , on a national level , and in zambia .
majority of the smokers in the present study preferred bidi ( 89% ) and few smoked cigarettes ( 8% ) .
bidi is preferred by the study population due to economic reasons as it is much cheaper than cigarette . on an average ,
similar findings have been reported by chhabra in delhi with 60% smokers above 18 years age smoking bidi .
a multi - centric study in delhi , kanpur , chandigarh , and bangalore also found that most ( 51.7% ) of the urban smokers smoked bidis with an average consumption being 12.4 bidi / cigarette per day . in the present study ,
tobacco use was highest amongst the illiterates wherein 54% and 12% of illiterate males and females respectively smoked tobacco .
other studies by rani and chhabra have also shown lower literacy level to be a strong predictor of smoking .
we also found 3-fold increased risk of smoking among people with low socio - economic status .
studies in the past have already suggested that the poor are 8 - 10 times more likely to smoke bidis .
similar trends have been observed in delhi by chhabra and on a country wide basis by jindal , and the national cross - sectional survey .
interestingly , we found that overweight or obese people were less likely to be current smokers than lean people .
overall , the study highlights that smoking is a significant problem among males who are lesser educated and belong to low socio - economic class . with regard to awareness regarding hazards of tobacco smoking , two third of the people in this study
however , there were huge gaps in knowledge , and majority participants knew very little of the wide implications of tobacco use on health . added to it , a sizable population did not have any knowledge of impact of tobacco on health .
poor literacy status has been found to be associated with poor awareness of the health hazards of tobacco consumption , increased likelihood of exposure to conditions favoring initiation of smoking and chewing of tobacco , and higher overall risk taking behavior . in the present study , around 21.9% of ever smokers
had quit smoking . among those who quit , majority did so due to their health problems . among 11000 ever smokers of 15 years and above age , jindal had reported a quit rate of 10% with health problems being an important reason for abstinence .
it is a matter of concern to find high levels of smoking , especially among the illiterate and poor people .
this is bound to increase the disease burden from chronic illnesses apart from communicable and nutrition - related diseases in these vulnerable groups .
smoking has also shown a rising trend with age emphasizing that initiation into the habit may occur at any age and not just among young people .
this implies that tobacco control policies will have to focus on almost all age groups up to the 50 plus age . in this
regard , health education can play a pivotal role and can have a lasting impact on reduction of tobacco smoking by improving awareness levels of the population .
this can be done through mass media and through school and community - based education programs . in view of the limited knowledge among people regarding health implications of tobacco use
, there is need to design appropriate health education material for illiterates and poorer sections of the population and also to elaborate the scope of warning labels on tobacco packs with focus on other potential hazards of smoking like heart disease , hypertension , chronic lung disease , and infertility as well rather than just focusing on cancer .
the association between smoking and body mass index should be explored further , so that an appropriate intervention can be designed that addresses both smoking and nutrition .
the survey was done in urban resettlement colony of delhi , and hence the results can only be generalized to the sampled population .
our survey was cross - sectional , and smoking status was by self - reporting .
therefore , some participants may have under - reported their smoking habit . moreover , due to the existing social taboo about tobacco use , some female participants , in particular , might not have reported their smoking habit . in spite of these limitations
the survey was done in urban resettlement colony of delhi , and hence the results can only be generalized to the sampled population .
our survey was cross - sectional , and smoking status was by self - reporting .
therefore , some participants may have under - reported their smoking habit . moreover , due to the existing social taboo about tobacco use , some female participants , in particular , might not have reported their smoking habit . in spite of these limitations | aim : to assess the prevalence and correlates of current smoking , awareness of hazards , and quitting behavior among smokers 30 years and above.materials and methods : study design : cross - sectional ; setting : gokulpuri , a resettlement colony in east delhi , india ; sample size : 911 , persons aged 30 years and above using systematic random sampling ; study tools : semi - structured questionnaire.results:prevalence of current smoking was found to be 24.6% ( 95% ci 21.90 - 27.49 ) .
majority 198 ( 88.4% ) of current smokers smoked bidi exclusively , and on an average 13.5 bidi / cigarette were smoked per day .
multivariate analysis showed the factors associated with current smoking as male sex , advancing age , illiteracy , skilled occupation , low socio - economic status , and low bmi ( p < 0.001 ) .
64.2% were aware of the hazards of smoking .
63 ( 21.9% ) had quit smoking in the past , majority due to the health problems .
low educational status was associated with poor hazard awareness and quitting behavior.conclusion:smoking is a significant problem among poor and illiterate males , shows an increasing trend with an advancing age and is directly associated with skilled occupation and low bmi .
there are significant gaps in knowledge regarding hazards of smoking . |
the objective of this study was to present the outcome of the internal limiting membrane ( ilm ) peeling flap technique for a treatment - nave , flat edge ( type ii ) , full - thickness macular hole ( mh ) .
a 52-year - old man presented with complaints of decreased vision and seeing black spot .
he was diagnosed to have a flat edge , full - thickness mh , which was confirmed by optical coherence tomography ( oct ) .
he underwent 23 g vitrectomy with brilliant blue g - assisted inverted ilm peeling with an inverted flap over the hole followed by fluid gas exchange .
postoperative follow - up until 3 months showed successful closure of the mh , which was confirmed by oct .
the best - corrected visual acuity improved from baseline 6/60 to 6/12 at the final follow - up .
using the inverted ilm flap technique , a treatment - nave , flat edge ( type ii ) , full thickness mh achieved successful anatomical and functional outcomes .
macular hole ( mh ) is a full - thickness defect of the retinal tissue involving the fovea .
it is confirmed by optical coherence tomography ( oct ) , and clinically , an mh appears like full - thickness defect with its edges lifted toward the vitreous and cystic changes seen at the edges of the neurosensory retina .
this appearance of the mh is amenable to successful surgical outcome of its closure besides other known prognostic factors affecting the outcome.13 a large mh has increased risk of surgical failures , with 44% remains open after surgery.4 similarly , it is also difficult to achieve successful closure in the refractory mh.5,6 in the recent past , such a surgically challenging mh had a promising outcome using the inverted internal limiting membrane ( ilm ) peeling flap technique.46 we report a successful closure of a treatment - nave , flat edge , full - thickness mh ( type ii appearance ) using the inverted ilm peeling flap technique .
a 52-year - old man presented with complaints of seeing black spot in his vision in the left eye .
he had a history of undergoing phacoemulsification with intraocular lens implantation and retinal laser done ( for peripheral lattice degeneration ) 2 years ago in the right eye . on examination ,
his best - corrected visual acuity was 6/9 in the right eye and 6/60 in the left eye .
anterior segment examination was unremarkable in both eyes except posterior chamber intraocular lens in place in the right eye and grade 2 nuclear sclerosis with early cortical cataract in the left eye .
intraocular pressure was 16 mmhg and 18 mmhg in the right and left eyes , respectively .
dilated fundus examination showed clear ocular media , attached retina , inferior peripheral lattice degeneration , and vitreous liquefaction in the left eye .
the right eye showed clear ocular media , attached retina , and peripheral laser marks .
oct showed a full - thickness mh with flat edge in the left eye ( figure 1a ) and a maintained foveal contour in the right eye . based on the above mentioned clinical evaluation , a diagnosis of the full - thickness mh with flat edge
, inferior peripheral lattice degeneration and cataract in the left eye , and pseudophakia in the right eye was made .
he underwent 23 g vitrectomy , brilliant blue g - assisted ilm peeling ( inverted flap technique ) , fluid gas exchange , and endolaser in the left eye .
intraoperatively , after induction of posterior vitreous detachment , vitrectomy was completed and endolaser was barraged around the inferior lattice degeneration ( figure 2 , left top ) .
brilliant blue g was then injected over the macular area to stain the ilm ( figure 2 , left middle ) .
ilm peeling was initiated from the temporal side all around the mh , at approximately two - disk diameter area , and hinged at the edges of the hole ( figure 2 , left bottom ) .
ilm was then trimmed , and adequate residual ilm was inverted over the hole ( figure 2 , right top / middle ) . following this ,
fluid air exchange was performed and ilm was pushed into the mh ( figure 2 , right bottom )
two months follow - up examination showed the best - corrected visual acuity of 6/24 .
anterior segment examination showed grade 2 nuclear sclerosis with early posterior subcapsular cataract and cortical spokes .
fundus examination showed attached retina , laser marks around the inferior lattice degeneration , and closed mh .
oct showed closed mh with a maintained foveal contour and dimpling in the temporal macula ( figure 1b ) .
three months follow - up examination showed the best - corrected visual acuity of 6/12 and n8 .
inverted ilm peeling flap technique has improved the confidence of approach to successful surgical outcome in refractory and large mhs.46 michalewska et al4 have shown that using the inverted ilm flap technique in eyes with a large mh ( > 400 m size ) had a 98% success rate of mh closure compared to 88% in eyes that underwent the standard technique .
they suggested that the inverted ilm flap technique prevents postoperative flat open appearance of an mh and also improves the functional and anatomical outcomes of an mh > 400 m .
they have also shown that the mean visual acuity at month 12 was 0.28 with the ilm flap technique and 0.17 without the flap technique ( p=0.001 ) .
pires et al5 have also shown successful closure of the reopened mh that had undergone previous surgery using the ilm peeling translocation technique .
the current case presented closure of a treatment - nave , type ii pattern mh appearance with flat edge3 in the eye that has not undergone any previous surgery .
this has never been reported ( in the pubmed ) . using the ilm flap technique in this eye , successful anatomical and functional improvements ( figure 1 )
our case and other publications46 imply that whatever is the technique , the concept of leaving the ilm over the hole remains the same and can improve the functional outcome . in stage 2 , usually there will be evidence of some form of vitreomacular adhesion or vitreomacular traction , which was not evident in this case besides the flat appearance of edges like a type ii closure .
the size of the hole had a minimum diameter of 319 m and base diameter of 345 m .
since this was also associated with symptomatic vision decrease , the case was advised for surgery .
ideally , in small stage 2 mh , one may defer surgery as there is a possibility of spontaneous closure and the hole size is usually < 200 m . the inverted ilm flap technique is usually performed for a chronic large mh , a failed mh , or high myopia with mh and foveal schisis . in this case , possibly because of the flat edge , there is less likelihood of vitrectomy alone being successful in the closure of mh .
the ilm flap technique in such kind of eyes allows the mller cells and external limiting membrane to grow along the ilm as a scaffold to close the hole .
our case demonstrates that a treatment - nave , flat edge mh can achieve successful anatomical and functional outcomes using the ilm flap technique . | objectivethe objective of this study was to present the outcome of the internal limiting membrane ( ilm ) peeling flap technique for a treatment - nave , flat edge ( type ii ) , full - thickness macular hole ( mh).methodsa 52-year - old man presented with complaints of decreased vision and seeing black spot .
he was diagnosed to have a flat edge , full - thickness mh , which was confirmed by optical coherence tomography ( oct ) .
he underwent 23 g vitrectomy with brilliant blue g - assisted inverted ilm peeling with an inverted flap over the hole followed by fluid gas exchange.resultspostoperative follow - up until 3 months showed successful closure of the mh , which was confirmed by oct . the best - corrected visual acuity improved from baseline 6/60 to 6/12 at the final follow-up.conclusionusing the inverted ilm flap technique , a treatment - nave , flat edge ( type ii ) , full thickness mh achieved successful anatomical and functional outcomes . |
the conventional inorganic synthetic procedures usually demand long reaction time , high temperature , and toxic solvents .
different from the traditional solvents , ionic liquids are potential green solvents with many advantages , such as negligible vapor pressure , low interface tension , supramolecular solvents , and microwave absorbing ability .
because of these excellent performances , ionic liquids can be the new all in one solvents , which are combination of solvent , template , and reactant . compared with the traditional heating methods ,
moreover , microwave irradiation also has many other advantages , including volumetric heating , selectivity , fast kinetics , homogeneity , and energy saving [ 4 - 9 ] .
microwave - assisted ionic liquid reaction systems have been studied for the synthesis of inorganic materials , such as zno frameworks , high quality tio2 nanocrystals , bi2se3 nanosheets , indium tin oxide nanocrystals , metal fluorides , cuboid - like crystallites , tellurium nanorods and nanowires , manganese oxide , cdf2 nanoflakes , and zno nanosheet aggregates .
zn(oh)f has been demonstrated to be an important catalyst for the formation of pyridine from tetrahydrofurfuryl alcohol and ammonia , and it has also been used as the precursor for preparing zno .
huang et al . have presented a simple hydrothermal route toward zn(oh)f , which was then used as the precursor to prepare zno by calcination . as we know , zno has a wide range of applications in gas sensors , piezoelectric transducers , optical waveguides , acoustic
optical devices , catalysis , and solar cells , mainly due to its unique catalytic , electronical , and optoelectric properties [ 21 - 23 ] . recently
, porous zno with large specific surface area has generated considerable interest because of its potential applications in photocatalysis , environmental engineering to chemical , and gas sensors .
porous zno with various nanostructures have been reported , including hollow zno mesocrystals , porous zno nanoparticles , porous zno architectures , porous zno nanodisks , and porous zno nanowires .
herein , for the first time , ionic liquid 1-butyl-3-methylimidazolium tetrafluoroborate ( [ bmim]bf4 ) is used as the reactant and the template to synthesize novel flower - like zn(oh)f via an easy and fast microwave - assisted route .
all reagents are of analytical grade and used without further purification . in a typical synthesis ,
0.22 g ( 1 mmol ) of zn(ch3coo)22h2o powder was dissolved in 8 ml of distilled water under stirring at room temperature for 10 min , then 2 ml of [ bmim]bf4was added slowly while the stirring continued . afterward , the mixture was transferred to a 30 ml teflon - liner tube and kept inside a domestic microwave oven for 5 min ( 800 w , 40% of maximum power ) .
the obtained white precipitate was washed with distilled water and pure ethanol and collected by centrifugation .
the collected zn(oh)f sample was dried at 60 c in vacuum for 12 h. then , the zn(oh)f sample was calcined at 400 c for 2 h in air atmosphere , to yield final product zno .
the obtained samples were characterized by x - ray diffraction ( xrd ) ( bruker d8 advance ) , field - emission scanning electron microscopy ( fesem ) ( leo 1530 ) , transmission electron microscopy ( tem ) ( jeol jem-2100 ) , and nitrogen adsorption desorption analysis ( micromeritics asap2010 ) .
the xrd pattern reveals that the main composition of the product is zn(oh)f ( jcpds 32 - 1469 ) and a few impurities can also be detected . as shown in fig .
figure 1b shows the xrd pattern of the product after the heat treatment , and the pattern matches well with the standard pattern of zno ( jcpds 36 - 1451 ) .
axrd pattern of as - prepared zn(oh)f , bxrd pattern of zno sem images of zn(oh)f are shown in fig .
the sem images reveal that the sample is composed of regular hierarchical flower - like particles and the average size of the flower - like particles is about 7 m .
all the flower - like particles have six petals and every petal is composed of lots of acicular nano - structures , which grow from the center to the edge . the average length of each petal is about 3 m . the magnified image of a typical petal is shown in fig .
2c . a csem images of as - prepared zn(oh)f , d fsem images of nanoporous zno figure 2d f shows the sem images of zno sample .
the images reveal that the zno sample retains the flower - like morphology after the heat treatment at 400 c .
the size of the zno particles is similar to that of the precursor zn(oh)f . the magnified image ( fig .
figure 3a gives the micrograph of a typical zn(oh)f petal and the selected area electron diffraction ( saed ) pattern of the circular area .
the saed pattern indicates the acicular nano - structure possesses single crystal structure . besides , fig .
3a reveals that the petal of the flower - like particle does not have porous structure . after the heat treatment , the zno sample exhibits nanoporous structure , as shown in fig .
the saed pattern reveals that the petal of the particle possesses quasi - single crystal structure .
the high - resolution transmission electron microscopy ( hrtem ) images for the petal are presented in fig . 3c and d. figure 3d shows the lattice fringes , whose spacing is 0.2476 nm , which is corresponding to thedvalue of the ( 101 ) planes of zno .
atem images of the precursor zn(oh)f and electron diffraction pattern of zn(oh)f ( inserta , corresponding to the circle area of panela),btem images of zno and electron diffraction pattern ( insertb ) , andc , dhrtem images of zno figure 4 shows the nitrogen adsorption desorption isotherm and the pore size distribution plot of nanoporous zno .
the isotherm is identified as type iv , which is corresponding to the characteristic of mesoporous materials .
the bet surface area of the porous zno is about 38.2 m / g , which is obviously larger than that of commercial zno powder with a bet surface area of ca .
4b ) shows a broad peak in a region of 550 nm with an obvious maximum at about 17 nm .
desorption isotherm for the porous zno , bbarrett joyner halenda ( bjh ) pore size distribution plot from adsorption branch
based on the experimental results , it can be confirmed that the addition of ionic liquids and the microwave irradiation play important roles in the formation of zn(oh)f with novel structure .
second , because ionic liquids are composed of inorganic anion and organic cation , they have high polarizability and conductivity .
in addition , [ bmim]bf4 can decompose in the presence of transition metal salts with hydration water molecules when the temperature exceeds its boiling point , the reaction can be expressed as follows : ( 1 ) generally , when the ph value is between 6 and 9 , zn(oh)2 is obtained predominantly .
but the znf complexes will form in the presence of f under neutral or weak alkaline conditions , and the nucleation of zn(oh)f occurs during further hydrolysis .
a possible chemical mechanism can be expressed as follows:(2)(3 ) the experiment results show that ionic liquid [ bmim]bf4 plays a critical role in the formation of flower - like structure . in the reaction , supramolecular effects and solvent self - structuration of ionic liquid are important when it reacts with high concentration of zinc acetate .
the extended hydrogen - bonding and stack interaction of the neighboring imidazolium rings make ionic liquids molecular recognition and self - assembly . as
solvent , the self - assembled ability of ionic liquid ( [ bmim]bf4 ) has an important influence on the structural orientation in the reaction .
zno is obtained after the calcination of zn(oh)f at 400 c , the chemical reaction takes place as follows : zn(oh)f zno + hf . during the thermal decomposition process , molecule - size pores generated when the hf molecules released from the flower - like particles .
meanwhile , small zno units formed during this process . with the temperature increasing , the small zno units assembled into nanoparticles and the molecule - size pores became nanopores . because of the existence of nanopores , flower - like zno sample possesses a large bet surface area .
novel flower - like zn(oh)f has been successfully synthesized via microwave - assisted ionic liquid route . in addition
, nanoporous zno is obtained after the heat treatment of zn(oh)f , and the morphology is well retained .
the ionic liquid [ bmim]bf4is used as the reactant and the template in the synthesis .
it is expected that this method may be extended to the preparation of other inorganic materials .
this work was supported by natural science foundation of jiangsu province ( bk2006195 ) , doctor innovation funds of jiangsu province ( bcxj06 - 13 ) , and national natural science foundation of china ( 50502020 , 50701024 ) . | zinc hydroxide fluoride ( zn(oh)f ) with novel flower - like morphology has been prepared via a microwave - assisted ionic liquid route .
the flower - like zn(oh)f particle has six petals and every petal is composed of lots of acicular nano - structure .
nanoporous zno is obtained by thermal decomposition of as - prepared zn(oh)f in air , and the flower - like morphology is well retained . in the process of synthesis ,
ionic liquid 1-butyl-3-methylimidazolium tetrafluoroborate is used as both the reactant and the template . |
tension pneumocephalus is infrequent and the limited number of cases reported all involve positive airway pressure ventilation after head trauma with an undiagnosed skull fracture .
we present a rare case of violent pneumocephalus after head trauma not involving mask ventilation but based on pathological respiration pattern , kussmaul breathing .
a 53 year old man , known with insulin dependant diabetes mellitus , sustained a heavy blunt trauma to the back of the head from a crane arm .
he was found estimated 15 h after the incident and was transported to the nearest hospital without intubation . on admission to the local trauma centre
his glasgow coma score ( gcs ) was eight ( eyes two , motor five , verbal one ) .
there was bleeding from the external meatus of the right ear and a periorbital haematoma on the right side .
initial blood gas results showed plasma glucose 36 mmol / l , ph 7.3 , plasma lactate 5.8 mmol / l , base excess 8.3 mmol / l .
there was diminished skin turgor and a strong smell of acetone emanating from the patient .
1 ) revealed multiple skull base fractures through the clivus , the petrus bone to the foramen magnum and through the frontal sinus and the sphenoid sinus and massive tension pneumencephalon ( tp ) bi - frontally compressing the cerebrum to about 2/3 of the cranial volume ( figs . 1 and 2 )
the neurosurgeon conferred advised making a burr hole in the right temporal region to relieve the pressure pneumo - encephalon before transport to the neurosurgical department .
the burr hole was performed and air bubbled out of the incised dura . upon arrival at the neurosurgical department the patient underwent another ct - scan showing sustained pneumocephalus with compression on the brain bifrontally and air compressing the brainstem . furthermore an acute subdural haematoma was noted located under the burr hole .
the patient was at that point sedated to gcs three , intubated , non - responsive and had normal - responsive pupils .
the pt . underwent acute operation ; making use of the fracture lines in the skull and the subdural haematomas was evacuated .
the brain that had been exposed to air for 20 h had a yellowish and dry surface and was hyperaemic .
finally an intracranial pressure ( icp ) monitor was inserted through a small twist drill hole into the parenchym pre - coronally on the opposite site .
post - operative ct showed reduction of the intracranial air and a normal calibrated brain with normal surface contours and parenchyma ( fig .
the patient was admitted to neurointensive care unit , under surveillance with contiguous icp monitoring .
two weeks later the patient was still intubated due to pulmonary causes , gcs ten ( eyes three , motor six , verbal one ) and with no obvious focal neurological deficits and was referred to a neurorehabilitation centre .
two years later , the patient is awake , has gcs 15 and no cognitive deficits .
when the bicarbonate ions buffering capacity is used , plasma ph and bicarbonate decline and respiration is stimulated .
coma is uncommon ; most patients are lucid or exhibit mild - to - moderate disturbance of consciousness .
we believe that the rapid and shallow respiration in this case has pushed the air intracranial , has caused the increasing pressure to the brain and the result is pneumocephalon .
pneumocephalus develops due to a cranial or facial fracture through which air enters the intracranial cavity .
tp is characterized by continued build - up of air within the cranial cavity , due to valve - effect usually in relation to a skull base fracture .
head position during cranial surgery , duration of surgery , nitrous oxide ( n2o ) anaesthesia , intraoperative osmotherapy , hyperventilation , spinal anaesthesia , barotrauma , continuous csf drainage via lumbar drain , epidural anaesthesia are suggested as surgical causes .
meningitis , otitis media , orbital emphysema and high pressure air applied into the orbit is also suggested as reasons to pneumocephalus without bone fracture .
although the condition is generally asymptomatic , pneumocephalus of sufficient volume is implicated in postoperative lethargy , headaches , confusion , hemiparesis , abducens nerve palsy , mental changes and even seizure , in which cases treatment may be necessary .
1 . the pathophysiologic process starts with cerebral spinal fluid leak in the presence of associated discontinuity of the cranium and leptomeningeal disruption .
subsequent development of relative negative intracranial pressure results in a sufficient vacuum effect to cause additional accumulation of air within the cranial cavity .
at the site of the leptomeningeal tear , the positive end tympanic pressure exceeds the intracranial pressure , and air is forced into the cranial cavity . when the intracranial pressure exceeds the pressure within the air collection , the
one - way valve closes , thus preventing the egress of the trapped air . in this mechanism ,
the abnormal air is usually distributed in the extradural space . in the presented case ,
pathologic deep and rapid respiration exerted additional pressure on the dural fistula allowing ambient air at a pressure above icp to drive itself into the intracranial space .
the loss of csf from skull base fractures created a void space and relative negative pressure , allowing air to bubble in and fill the void .
tp is rare condition and exceptionally rare when positive airway pressure has not been applied . in this particular case , the vacuum and one - valve effects were instead accentuated by a pathological pattern of respiration due to severe ketoacidosis and have caused tension pneumocephalon .
written informed consent was obtained from the patient for publication of this case report and accompanying images .
dr . frederikke rosendal has found the case and written the case report part of the article .
shima bjerrum has written the rest of article along with the title page and has contact with the patient . | objectiveswe present a rare case of tension pneumocephalus ( tp ) after head trauma not involving mask ventilation but based on pathological respiration pattern , kussmaul breathing.tp is rare condition and exceptionally rare when positive airway pressure has not been applied . in this particular case ,
the vacuum and one - valve intracranial effects causing pneumocephalon were instead accentuated by a pathological pattern of respiration due to severe ketoacidosis
a condition not previously reported in the literature.methodsthis is a case report showing a rare cause of pneumocephalon caused by patients own respiration .
we retrospectively reviewed the patients journal to find the cause of his severe pneumocephalon .
the patient has not been ventilated and the only cause of tp in this case seems to be his own rapid and pathological breathing caused by ketoacidosis.conclusionin the presented case , pathologic deep and rapid respiration exerted additional pressure on the dural fistula allowing ambient air at a pressure above icp to drive itself into the intracranial space .
the loss of csf from skull base fractures created a void space and relative negative pressure , allowing air to bubble in and fill the void . |
dental bonding materials form a bond between tooth structure and the restorative materials . this formed adhesive bond will provide protection of the tooth structure during restoration and will lengthen the restorations clinical lifetime.1 different classifications can be made including dentin bonding agents clinical application types , their effect mechanisms and contents.2 there is less information about dentinal adhesion to primary dentin when compared with permanent dentin.3 one of the laboratory tests which guide clinicians in restorative materials clinical usage are bond strength tests .
the most commonly used ones are tensile and shear bond strength tests.4 failures are classified as adhesive , cohesive and mixed types.5 al - salehi and burke4 had reported that there was a relationship between the bond strength and fracture failure mode .
there are various shear bond strength studies reporting failure modes using different methodologies mostly by microscopic methods in literature.6,7 the first aim of this study was to compare different dentin bonding agents bond strength to primary and permanent dentin using shear bond strength test .
second aim was to compare the failure modes with a stereomicroscope , to put an effort to develop a statistical model that could be helpful to establish the relationship between the shear bond strength values and failure modes and to study whether developing this kind of a statistical model for evaluation of failure modes would be a beneficial method .
a statistical model that could be helpful in estimating the possibility of obtaining an adhesive type of fracture when a certain amount of shear bond strength was applied was aimed to be developed .
further development of statistical models for failure modes can be supportive alternatives for microscopic evaluations and also be helpful in understanding and eliminating the factors which are responsible for the formation of adhesive failures and for achieving clinically more successful adhesive restorations .
21 extracted , caries - free , unrestored primary second molars and 21 extracted caries - free , unrestored erupted permanent third molars were used in this study .
any remaining soft tissues were thoroughly hand - scaled and cleaned from the tooth surfaces and teeth were disinfected in 0.5% chloramine solution and placed in distilled water for up to 1 month at 20c .
crowns were separated from the roots 23 mm apical from the cementoenamel junction ( cej ) , and pulp tissue was removed with a dental explorer .
after this procedure crowns were embedded into teflon molds vertically by using a self - curing acrylic resin ( orthocryl eq , dentaurum , germany ) .
the mid - coronal dentin of the occlusal surfaces was exposed by a flat cut perpendicular to the long axis of the tooth with a fine diamond disc in high speed with a copious water spray and 300 , 600 grit - sic paper were used to prepare a flat dentin surface on the specimens and to simulate the dentin smear layer formed after clinical instrumentation . after the dentin surfaces had been controlled for the absence of enamel with a stereomicroscope ( leica , mz 12 , leica ag , ch-9435 heerbrugg , switzerland ) both primary and permanent molars were randomly divided into three groups respectively .
dentin bonding agents were applied according to the manufacturers instructions . before the applications an adhesive tape with a central orifice of 3 mm in diameter was applied to the dentin surfaces to demarcate the area to be treated .
i , a three - step total - etch ( scotchbond multi purpose ( sbmp ) ) , in group 2 , a two - step total - etch ( gluma comfort bond ( gcb ) ) and in group 3 , a one - step self - etch ( adper prompt - l - pop ( plp ) ) system were used .
information regarding dentin bonding agents is presented in table 1 . a halogen light curing unit ( hilux 200 , benlioglu dental inc , ankara , turkey ) with a light intensity of 400 mw / cm
this light curing unit was controlled with a radiometer ( curing radiometer , model 100 , demetron / kerr corp .
after the application of dentin bonding agents , a resin composite material ( z100 restorative a2 , 3 m espe , st paul , mn , usa ) was applied on to the prepared dentin surfaces with the help of a teflon tube with an inner diameter of 3 mm and a height of 2 mm which was carefully attached to the prepared and previously delimitated dentin surfaces by an impression putty mould .
composite materials were light cured for a total of 160 s ; 40 seconds from each perpendicular direction by using the same halogen light curing unit . after curing had been completed the teflon tube surrounding the composite was carefully removed .
after this period , samples were subjected to thermal cycling at 555c for 500 cycles with a dwell time of 30 s. 24 hours after thermal cycling , specimens were debonded using an universal testing machine ( lloyd lrx universal , lloyd instruments , fareham , hants , england - uk ) at a crosshead speed of 0.5 mm / min at room temperature ( 232c ) .
the specimens were secured in a mounting jig ( bencor multi - t shear assembly , danville engineering inc .
, san ramon , ca ) with the shearing rod against and parallel to the flat prepared bonding sites .
the distance from the probe to the dentin surface was monitored using a spacer of two celluloid matrices .
shear bond strengths were calculated by dividing the highest fracture force ( n ) with the bonded area ( diameter 3 mm ) and recorded in mpa .
after the application of shear bond strengths to resin - dentin bonded surfaces and specimens were debonded , failure modes were recorded .
for this purpose debonded areas were examined visually for their failure region and were also observed under a stereomicroscope ( leica , mz 12 , leica ag , ch-9435 heerbrugg , switzerland ) at 25 magnification to evaluate the site of failure .
the actual mode of failure was recorded according to the following criteria:5 adhesive failure mode : no signs of dentin fracture or remnants of resin on the tooth , failure in adhesion .
cohesive failure mode : complete fracture of dentin or resin , failure of the tooth substrate or failure of the resin composite .
mixed failure mode : samples showing both adhesive and cohesive failures . in the statistical analysis and modeling section
, a logistic regression model was developed to explain the fracture type by the shear bond strength , and a linear regression model was built to investigate the effects of the tooth structure and the material type on the shear bond strength values . because the ordinal logistic regression models fitted mostly failed in predicting mixed type of fractures , and also because the main goal of this study was avoiding to have the worst type of fracture , the response was categorized as observing either the worst type of fracture ( i.e. adhesive ) or observing the others ( i.e. cohesive and mixed ) .
adhesive ; it was set to zero if the fracture type was either cohesive or
mixed. several binary logistic models were fit by using spss 158 and compared by classification rates and goodness - of - fit measures.9 the best model finally obtained was : where xc is the centralized shear bond strength value , i.e. , xc = x - x .
for each possible observed value of centered strength , one can calculate the estimated probabilities .
if the estimated probability of observing adhesive type fracture is greater than 0.5 , the response was classified as adhesive. for this model , a true classification rate of ( 110/41 ) 100%=75.6% was obtained .
this means that , about 76% of all observations were classified into the correct response categories .
summary statistic based on deviance residuals ( p value=0.46 ) and hosmer - lemeshow goodness - of - fit ( p value=0.628 ) test showed no lack - of - fit . in short , by the use of this model , one can estimate the possibility of obtaining an adhesive type of fracture when a certain amount of shear bond strength is applied . to express the change in the shear bond strength values with respect to the tooth structure and the material type , a linear regression model in ( 2 ) was developed by using the statistical software spss 15.8 in this model ,
the indicator variable represents the z1 levels of the tooth structure. similarly , two other indicator variables , denoted by z2 and z3 , represent the levels of the material type. how treatment groups ( tooth structure , material type ) were represented by different codings of these indicator variables is presented in table 2 . to illustrate , the second row of the table , where z1=1 , z2=0 , z3=1 , indicates the treatment group in which the dentin bonding agent plp was applied to the primary dentin . to obtain statistically valid results ,
however , the analysis of residuals from the fitted model ( 2 ) indicated that both constant error variance and normality assumptions were violated . as a remedial measure ,
the power l=0.5 was applied to the response , x , as suggested by the box - cox power transformation.10 graphical analysis of residuals after transformation of the response , x , indicated that the white noise assumption was satisfied . the resultant model consisting of only statistically significant ( all p values<0.015 ) model parameters
because the ordinal logistic regression models fitted mostly failed in predicting mixed type of fractures , and also because the main goal of this study was avoiding to have the worst type of fracture , the response was categorized as observing either the worst type of fracture ( i.e. adhesive ) or observing the others ( i.e. cohesive and mixed ) .
adhesive ; it was set to zero if the fracture type was either cohesive or
mixed. several binary logistic models were fit by using spss 158 and compared by classification rates and goodness - of - fit measures.9 the best model finally obtained was : where xc is the centralized shear bond strength value , i.e. , xc = x - x . for each possible observed value of centered strength
if the estimated probability of observing adhesive type fracture is greater than 0.5 , the response was classified as adhesive. for this model , a true classification rate of ( 110/41 ) 100%=75.6% was obtained .
this means that , about 76% of all observations were classified into the correct response categories .
summary statistic based on deviance residuals ( p value=0.46 ) and hosmer - lemeshow goodness - of - fit ( p value=0.628 ) test showed no lack - of - fit . in short , by the use of this model , one can estimate the possibility of obtaining an adhesive type of fracture when a certain amount of shear bond strength is applied .
to express the change in the shear bond strength values with respect to the tooth structure and the material type , a linear regression model in ( 2 ) was developed by using the statistical software spss 15.8 in this model , x is the response representing the shear bond strength values measured in mpa .
the indicator variable represents the z1 levels of the tooth structure. similarly , two other indicator variables , denoted by z2 and z3 , represent the levels of the material type. how treatment groups ( tooth structure , material type ) were represented by different codings of these indicator variables is presented in table 2 . to illustrate , the second row of the table , where z1=1 , z2=0 , z3=1 , indicates the treatment group in which the dentin bonding agent plp was applied to the primary dentin . to obtain statistically valid results ,
however , the analysis of residuals from the fitted model ( 2 ) indicated that both constant error variance and normality assumptions were violated . as a remedial measure ,
the power l=0.5 was applied to the response , x , as suggested by the box - cox power transformation.10 graphical analysis of residuals after transformation of the response , x , indicated that the white noise assumption was satisfied . the resultant model consisting of only statistically significant ( all p values<0.015 ) model parameters
the minimum , maximum and the mean shear bond strength values measured in newton and mpa along with their standard deviations for all groups are presented in table 4 .
note that the percentages were calculated by dividing the count in a cell by the number of observations in each subgroup . to exemplify , 2 out of 7 primary teeth where sbmp was applied turned out to be adhesive failure mode . as a result ,
depending on the descriptive statistics calculated ( tables 4 and 5 ) and the models developed in the statistical analysis and modeling section for both shear bond strength values and failure modes , the following results were obtained ; tooth type affected the shear bond strength test values ( p value=0.0 ) ; there was a statistically significant difference in primary and permanent dentin except the self - etch adhesive system ( plp ) ( p value=0.0 ) .
higher bond strength values were obtained for permanent dentin . for primary and permanent dentin mean
total - etch adhesives displayed higher shear bond strength values than the self - etch adhesive both in primary and permanent dentin .
mean strength values for the total - etch adhesives ( sbmp and gcb ) were 15.99 mpa and 23.35 mpa for primary and permanent dentin , respectively .
mean strength values for the self - etch adhesive ( plp ) were 11.09 mpa and 12.01 mpa , for primary and permanent dentin , respectively .
although there was no statistical difference between total - etch adhesives ( p value>0.05 ) , three - step total - etch system had given slightly higher shear bond strength results compared to the two - step one both in permanent and primary dentin .
mean strength values for three - step total - each system ( sbmp ) were 16.79 mpa and 23.48 mpa for primary and permanent dentin , respectively . whereas mean strength values for two - step one ( gcb ) were 15.19 mpa and 23.23 mpa for primary and permanent dentin , respectively .
when the results were evaluated it was observed that adhesive failures were more frequently seen in primary dentin ; while the adhesive failure ratio was 38.12% in permanent dentin , this ratio was 52.38% in primary dentin . it had also been observed that the self - etch adhesive system ( plp ) displayed more adhesive failures compared to the total - etch adhesives ( sbmp and gcb ) both in permanent and primary dentin . while the adhesive failure ratio for self - etch adhesive system was 85.72% and 71.53% for primary and permanent dentin , respectively
; this ratio for total - etch adhesives was 35.71% and 21.42% for primary and permanent dentin , respectively .
in this study shear bond strength test results of primary and permanent dentin were statistically different from each other for total - etch adhesives . higher bond strength values were obtained for permanent dentin compared to primary dentin .
this result is in consistence with some of the previous studies which had reported that this lower bond strength values in primary teeth were related with the physical , micromorphological and chemical differences between primary and permanent teeth.5,1115 nr et al14 indicated in their study that the hybrid layer produced was significantly thicker in primary than in permanent teeth , suggesting that primary tooth dentin was more reactive to acid conditioning . according to these authors
, the increased thickness of the hybrid layer in primary teeth and the subsequent lack of complete penetration of adhesive resin into previously demineralized dentin may contribute to the lower bond strengths to primary dentin .
shorter time for dentin conditioning could be used as a means to reproduce the hybrid layer thickness seen in permanent teeth .
total - etch adhesives displayed higher shear bond strength values than the self - etch adhesive both in primary and permanent dentin . in literature
some studies had reported that self - etch systems did not display adequate bond strength.1620 on the other hand , there are other studies supporting these systems.2123 according to bolanos - carmona et al24 the performance of self - etching adhesives on primary dentin depends on the product .
van meerbeek et al25 concluded that in spite of enhanced ease and faster application , simplified adhesives so far seem to induce a loss of bonding effectiveness , and their advantages should therefore be traded off against their shortcomings .
nevertheless , in the end the only true criterion for an adhesive s quality had been reported as its long - term clinical performance.25 although there was no statistical difference between total - etch adhesives , three - step total - etch system had given slightly higher shear bond strength results compared to the two - step one both in permanent and primary dentin .
although this difference could be due to chance for this study , some of the researches had reported that despite the simplification studies which were trying to lesser the application steps of the bonding systems , conventional 3-step adhesive systems were the most reliable systems currently.2629 it was found that the adhesive failure ratio in permanent dentin was lower than in primary dentin . in another saying adhesive failures were more frequently seen in primary dentin .
this result was consistent with the shear bond strength test values indicating that bonding to permanent dentin was more successful compared to primary dentin . when the results were considered from the material type ; it had been observed that the self - etch adhesive system displayed more adhesive failures compared with the total - etch adhesives both in permanent and primary dentin supporting the shear bond strength test s results as it had been found lower shear bond strength values for the self - etch group like the corroborating studies.12,30,31 according to the results of this study separate applications of each step by three - step adhesive system enhances the efficacy and also provides the necessary time for the bonding material to penetrate into dentin tubules .
but it should be taken into account as leloup et al32 concluded in their study that many parameters like the test design and experimental conditions significantly influence dentin bond strength . in this study ,
the extracted teeth were stored in distilled water at 20c , like33,34 which had stated that this was the preferred method for testing the bond strength of resin composites to dentin . according to the studies33,35,36
dentin adhesives tend to function well in bond strength tests when tested shortly after application .
price and hall5 reported that they had found significant differences between fracture failure modes obtained 10 minute and 24 hour after the application of the bonding systems . in this study samples
were subjected to thermal cycling 24 hours after the restorative procedures and to shear bond strength test 24 hours after thermal cycling .
studies had reported that in vitro bonding tests were effective methods in understanding the physical strength of adhesive systems , and were also , important tools in predicting and developing the clinical performance of these systems.31,37,38 by these efforts , conservation of the tooth structure and lengthening the clinical lifetime of the restorations can be obtained.39 researchers40,41 had mentioned that the advantage of this in vitro measurement of bond strength test method was being relatively simple with respect to specimen preparation , equipment required and test setup , but the main criticism was that it measured the cohesive strength of the material being bonded or the substrate ( or both ) , rather than the bond strength of the adhesive interface .
also studies4247 reported that despite its well known limitations the shear bond test set up had been the most commonly employed laboratory technique for evaluating the bond strength of adhesives and resin - bonded restorations but a notable feature of the studies evaluating shear bond strength tests was the observation that the failure mode was predominantly cohesive within the substrate and that this was attributed to the nature of the stresses generated and their distribution within the adherence zone and the relatively low bond strengths obtained might be explained by differences in material combinations , test set up and operator factors .
finally , windley et al48 stated that though in vitro bond strength tests did not directly predict clinical performance , the comparisons between groups were valid and could be utilized when making clinical decisions .
failure modes had been classified as adhesive , cohesive and mixed.5 triolo and swift49 and mason et al50 had thought that in weaker adhesive systems , fracture type was adhesive and minimal resin penetration occurred in these systems .
perdigao et al51 had similarly observed and reported that , cohesive type of fractures were begun to be seen when the shear bond strength values exceeded 17.40 mpa .
similarly cohesive type of failures were observed when the shear bond strength values exceeded 16.5 mpa for primary dentin and 24.9 mpa for permanent dentin in this study .
it had been estimated that bond strengths of 17 to 20 mpa may be required to resist contraction forces sufficiently to produce gap - free restoration margins.52 researchers28,53,54 observed that the adhesive failures between dentin and the bonding system occurred in lower bond strength values and studied the probable factors for this in their research study .
there are also other researchers supporting the idea that failure types were not correlated with bond strength values especially in cohesive type of failures in dentin.13,42,55,56 cohesive type of failure in dentin is an important issue which should be studied in detail in a different study .
but in this study it had been concluded that , statistical investigation of failure types could be beneficial if the limitations could be eliminated in further studies and the results obtained supported the results of bond strength test values .
al quahtani et al53 also reported a corroborating result and mentioned that investigation of failure types could provide important data in the analysis of the results of shear bond strength values and that the classification of failure modes was an important observation . in short , within the limitations of this in vitro study , bonding to permanent dentin was found to be more successful compared to primary dentin .
this can be due to various factors including both the structural differences between tooth structures and the applied materials .
another important factor is the fact that dentin bonding agents are developed mostly by using permanent teeth .
there is no application protocol that is given for the usage of dentin bonding agents in primary teeth by any of the manufacturers .
for example shorter etchant application time periods can enhance adhesion by preventing excessive demineralization so can be studied and advised .
it had been found that total - etch adhesives have still got their own advantages when compared to the self - etch adhesive system .
but self - etch adhesives have also got their own clinical benefits especially in patients where isolation is hard to obtain , so they worth developing with further in vivo research .
a statistical model that could be helpful in estimating the possibility of obtaining an adhesive type of fracture when a certain amount of shear bond strength was applied was aimed to be built . developed statistical model for understanding the relationship between failure modes and the shear bond strength test values confirmed that lower bond strength values were associated with the adhesive failures . by using this model and the methodology one might predict the failure mode by substituting his / her own estimated shear bond strength data into the model and learn whether the failure mode will be adhesive or not without using a microscope .
it should be emphasized here that in its present form the developed model must not be generalized and may only be applicable to the investigated adhesive systems and the laboratory method that had been used in this study .
for example , a further research can be conducted to investigate the mixed type and the types of cohesive failure separately . besides , fuzzy approach can be used to model the data in order to take into consideration that failure mode evaluations are subjective , and thus , both models prediction performances can be compared with respect to various criteria . moreover ,
other applications like acid etching may also be factored in as one of the variables in modeling of failure modes .
further models developed based on studies using universal testing standards with increased sample size , different materials and variables according to the subject , will be useful for a larger group of investigators and can be helpful in estimating the possibility of obtaining an adhesive type of fracture when a certain amount of shear bond strength is applied and understanding the positive or negative role of different variables on shear bond strength of adhesives .
further development of statistical and fuzzy models for failure modes can be supportive alternatives for microscopic evaluations and also be helpful in understanding and eliminating the factors which are responsible for the formation of the adhesive failures and for achieving clinically more successful adhesive restorations . | objectivesfirst to compare different dentin bonding agents shear bond strength to primary and permanent dentin .
secondly to compare the fracture failure modes and making an attempt to develop a statistical model that could be helpful in predicting them.methodsextracted human primary and permanent molars were used as substrates ( dentin ) .
the shear bond strength of composite to substrate was measured and fracture surfaces were evaluated visually and with stereomicroscope . using the data obtained , a statistical model was built in order to predict the failure modes.resultshigher bond strength values were obtained for permanent dentin .
total - etch adhesives displayed higher shear bond strength values than the self - etch adhesive .
adhesive failures were more frequently seen in primary dentin .
self - etch adhesive system displayed more adhesive failures .
prepared model confirmed the negative relationship between shear bond strength and the probability of observing adhesive failure.conclusionsthere should be an application protocol for the usage of dentin bonding agents in primary dentin .
further development of statistical and fuzzy models for failure modes can be supportive alternatives for microscopic evaluations and also be helpful in understanding and eliminating the factors which are responsible for the formation of adhesive failures and for achieving clinically more successful adhesive restorations . |
however , compared with open cholecystectomy , the incidence of bile duct injury appears to be increased , resulting in significant morbidity .
bile duct injury during lc ranges from mild to severe with serious and disastrous consequences .
it may lead to fistula formation or life - threatening biliary peritonitis in case of a significant leak . in case of small leaks
, it could be entrenched by the adjacent organs and fibrin usually forming a localized collection or biloma .
bilomas are often due to a leak from an inadequately secured cystic duct stump , an accessory bile duct or a duct of luschka in the gallbladder fossa of the liver .
biloma have been reported to have occurred at unusual locations such as in the abdominal wall or even intrahepatic sub - capsular space .
we report a case of biloma presenting at an unusual location in the lesser sac .
a 28-year - old previously healthy female presented to the outpatient department 10 days following lc .
the patient complained of moderate pain in epigastrium and right hypochondrium starting 2 days after the operation .
she had no fever and no jaundice and her medical history did not suggest any major comorbid condition .
the physical examination revealed the patient to be average built , conscious , and oriented ; she was afebrile with pulse rate of 76 beats / min and blood pressure of 100/70 mm hg .
her abdominal examination revealed healed port site scars , a soft abdomen with no signs of peritonitis .
there was a vague mass palpable in the epigastrium and left hypochondrium , tender on deep palpation .
laboratory data revealed a haemoglobin of 10.9 g / dl , white blood cells of 10,700/mm(83% neutrophils ) , a blood urea of 40
liver enzymes showed a total bilirubin of 1 mg / l with a direct component of 0.4 mg / l ; serum glutamate - oxaloacetate transaminase , serum glutamic - pyruvic transaminase , alkaline phosphatase were 70 iu / l , 60 iu / l and 46 iu / l respectively .
serum amylase level were 48 u / l , ultrasonography of the abdomen revealed a large unilocular fluid - filled collection in the left hypochondrium . a diagnosis of postoperative lc subhepatic collection was made and patient posted for diagnostic laparoscopy .
diagnostic laparoscopy revealed a prominent bulge of stomach [ figure 1 ] with stretching of the gastrocolic omentum due to a collection in the lesser sac ; the gall bladder fossa and surrounding organs were unremarkable [ figure 2 ] .
bulge appeared to be a psuedocyst ; however , there were no other intra - abdominal signs of pancreatitis . in view of no positive history suggestive of pancreatitis
the gastro colic ligament was divided and a clear bilious fluid [ figure 3 ] was seen in the lesser sac .
a litre of this fluid was drained from the lesser sac and an abdominal drain left in place .
the patient had an uneventful postoperative period with no further bilious drainage in the drain .
bilomas resulting as a complication of cholecystectomy are often due to a leak from an inadequately secured cystic duct stump , an accessory bile duct or a duct of luschka in the gallbladder fossa of the liver .
bilomas usually present with abdominal pain , nausea , anorexia , jaundice , fever and abdominal tenderness , but presentation may vary from minimal symptoms to full blown biliary peritonitis .
our patient presented with unusual features for a biloma , which included an unlikely site of bile collection following an uneventful lc .
patient was managed with diagnostic laparoscopy and drainage . on follow - up , patient was subjected to a magnetic resonance cholangiopancreatography , which showed normal biliary anatomy .
bilomas must be considered in the differential diagnoses of postoperative patient presenting with unusual clinical presentation after an uneventful lc . | bilomas resulting as a complication of cholecystectomy are often due to a leak from an inadequately secured cystic duct stump , an accessory bile duct or a duct of luschka in the gallbladder fossa of the liver .
occasionally , bilomas may have an unusual presentation .
we describe here a rare case of biloma in the lesser sac after an uneventful laparoscopic cholecystectomy . |
anterior cruciate ligament ( acl ) injuries are one of the most common and devastating knee
injuries associated with sport participation1 .
surgical repair of complete rupture of the acl is recommended to
prevent knee joint instability .
while surgery corrects the structural defect , post - operative
impairments in knee strength , function and endurance are inevitable corollary problems
associated to the repair .
many patients experience some degree of muscle weakness post - acl
reconstruction ( aclr ) , especially weakness of the quadriceps muscles , which can limit their
functional ability2 .
palmieri - smith et
al.3 assessed the deficit in quadriceps
muscle strength between the reconstructed and non - injured knees in patients six months after
aclr .
several studies have suggested use of an accelerated progression of knee strength ,
function and endurance following aclr to improve outcomes4 , 5.while most recent studies
have focused on the effects of postoperative rehabilitation protocols , only a few studies
exist that have studied about effects of preoperative exercise on post - aclr outcomes6,7,8 .
keays et al.7 reported on the beneficial effects of a 5-week home - based exercise
program for improving quadriceps strength and knee function early post - aclr injury . based on
available research evidence , if a preoperative program of exercise can restore muscle
strength and function before surgery , it could be of benefit to improve outcomes
post - surgery . based on the study eitzen et al.9 the preoperative quadriceps strengthening may be a significant
predictor of knee function two year after aclr9 .
preoperative deficits in quadriceps strength of greater than 20%
have been associated with significant persistent muscle weakness two years after aclr .
however , there is still little evidence regarding the benefits of preoperative exercise on
improving postoperative knee weakness .
we hypothesized that a preoperative program of exercise would improve functional outcomes
post - aclr .
therefore , the aim of the present study was to examine the effects of a 4 week ,
hospital - based preoperative program of exercise , focusing on quadriceps strengthening and
single - leg hop function , on after aclr outcomes .
a prospective , randomized , controlled study was initiated to evaluate the effectiveness of
a 4 weeks preoperative program of exercises on after aclr knee strength and function .
patients with acl rupture were recruited from samsung medical orthopedics centers from april
2012 to august 2014 .
the inclusion criteria were men between the ages of 20 and 35 years ,
presenting with an isolated acl rupture in the knee .
the exclusion criteria were previous
aclr or meniscus repair , injury to other ligaments in the same knee , and any associated
fractures .
the 80 patients were randomly assigned into two groups , the preoperative exercise
group ( peg , n=40 ) and no preoperative exercise group ( npeg , n=40 ) . the mean height and body
weight peg were 173.85.6 cm and 75.28.9 kg ; for the npeg , they were 172.84.4 cm and
74.319.77 kg .
there were no significant between - group differences in height and weight
between groups .
the peg participated in a 4-week exercise program preoperatively and in a 12 week
postoperative program , while the npeg only participated in the 12 weeks postoperative
program .
knee muscle strength and function were measured at 4 weeks before surgery and 3
months after surgery .
all patients were supervised at least three times a week in a sports
medicine center .
the preoperative exercise program was based on known impairments associated with acl
injuries , focused mainly on strengthening , functional balance , muscle control , and
co - contraction7 .
the exercise program mainly focused
on lower limb strengthening , with particular attention paid to strengthening of the
quadriceps muscles . prior to performing the main strength training program ,
after completion of the warm - up , subjects
proceeded to a series of lower - body strengthening exercises , short arc extension , wall
squat , leg press , isometric leg extension , and leg curls as well as other exercises ( table 1table 1.a summary of the preop exercise programexercise categoryexerciserepetitions and setscardio exercisestationary bike 20 minrange of motion exerciseseat flexion / extension10 minwall slidesstrengthening exerciseopen - chain strengtheningshort arc extension 102straight leg raises102leg curl ( isometric)102close - chain strengtheningleg extension ( rom 3080)102leg press152half squat152balance / proprioceptionsingle - leg standing30 sec3balance board30 sec3 ) .
selected exercises reduced anterior shear force across the tibio - femoral
joint and , therefore , helped strengthen the muscles without risk of damaging intra - articular
structures of the knee .
the postoperative exercise program was based on a combination of
evidence - based exercises identified from the scientific literature .
immediately after aclr , the limb was immobilized in a postoperative functional brace , and
patients were instructed to perform straight leg raising and quadriceps setting exercises .
patients were allowed to undergo partially weight bearing at 2 weeks after their surgery and
to move through full - range of knee joint motion and perform closed chain exercise at 4 weeks
after surgery .
all patients underwent assessment of knee extensor strength and distance on
single - leg hop 4 weeks prior to surgery and again at 3 months after surgery .
isokinetic
strength and endurance were measured using a csmi isokinetic dynamometer ( csmi medical
solution , stoughton , ma , usa ) .
knee strength was measured through the range of 0 to 90 at
an angular speed of 60/sec , with four repetitions completed at an angular speed of
180/sec , with 20 repetitions completed to calculate average power10 .
the highest peak torque value for each velocity was
compared with the uninjured side and described as percent of strength deficit . for the
single - leg hop for test , the mean average distance was quantified by limb symmetry index
( lsi ) using the following formula : ( distance for injured leg / distance for uninjured leg )
10011 . to investigate the change in knee extensor strength and single - leg hop distance between the
peg and npeg , a repeated measures analysis using the independent sample t - test .
the knee extensor strength deficit was calculated as the percentage difference between the
injured and uninjured side .
the knee extensor strength deficits was significantly different
between the groups , both at an angular velocity of 60/s ( p=0.018 ) and 180/s ( p=0.033 ) .
patients in the peg showed a significantly greater improvement in post - operative strength
than patient in the npeg at 60/s , and180/s ( table
2table 2.change in knee extensor muscle strength and single - leg hop functionmain outcome measurementpeg ( n=40)npeg ( n=40)knee extensor 60/sec deficit ( % ) preop22.813.723.515.8post - op28.59.0 * 36.510.7knee extensor 180/sec deficit ( % ) preop16.610.617.511.9post - op23.39.0 * 27.912.6single - leg hop lsi ( % ) preop75.110.376.58.9post - op85.37.4 *
peg : preop exercise group ; npeg : no pre - op exercise
group .
* p<0.05).the peg also showed significant improvement in the single hop distance test
( p=0.029 ) .
peg : preop exercise group ; npeg : no pre - op exercise
group . * p<0.05
the purpose of this study was to examine the effects of a 4 weeks preoperative program of
the knee extensor muscle strengthening on post - operative quadriceps muscle strength and knee
function .
outcomes confirmed the benefits of the peg in significantly lowering
post - operative deficits in quadriceps strength and improving single - leg hop distance
compared to patients who did not participate in a preoperative exercise program .
knee extensor strength deficit following aclr is a common problem which has been reported
in previous studies12 , 13 . in a recent review of the literature , 11 studies
including research by palmier - smith et al.3 , reported knee extensor muscle strength deficit , ranging between 24%
and 40.5% , 6 months after aclr , while another 10 studies reported a residual , deficit in
quadriceps strength of 10% to 27% , 12 months after aclr3 .
furthermore , long - term negative outcomes of strength deficits on
knee function for sports activities and even during daily activities .
thus , the recovery of
quadriceps muscles strength is one of the most important factors after aclr14 .
recent studies have investigated the relationship between pre and postoperative quadriceps
muscle strength deficits and function . according eitzen
et al.9 reported patients with greater than 20% deficit in quadriceps
strength to have a significantly greater impairment on functional knee scores and strength .
further , shelbourne et al.8 reported that
the postoperative quadriceps muscle strength to be significantly higher in patients with
greater preoperative strength than in patients with poor preoperative strength .
these
studies provide strong evidence that preoperative quadriceps muscle strength positively
affects postoperative muscle strength and function
. therefore , adequate and suitable program
of exercise before surgery would have an important role of improving post - operative muscle
strength . in our study
, there was a significant difference in postoperative knee extensor
strength deficit between the npeg and peg groups , with a mean strength deficit of 36.5% for
the npeg compared to 28.5% .
restoration of muscle strength , which was measured by
performance on the single leg - hop distance test , is considered to be an important
determinant for a successful return to sports after aclr9 , 17 .
the limb symmetry index
( lsi ) has been the most frequently reported criterion for comparing muscle strength and hop
performance with the uninjured side18 .
our study demonstrated that patients in the showed peg significantly improved in the single
leg - hop distance compared to the npeg .
the results indicate that the greater improvements in
quadriceps strength in the peg had a positive effect on knee function test , such as the
single - leg hop , compared to the npeg .
the result indicated that preoperative exercises not
only prevented quadriceps weakness , but also accelerated the recovery of muscle strength ,
which helped patients to quickly adapt to the rehabilitation environment .
it is also
anticipated that possible re - injury could be prevented by having better strength and
function . | [ purpose ] after an anterior cruciate ligament injury and subsequent reconstruction ,
quadriceps muscle weakness and disruption of proprioceptive function are common .
the
purpose of this study was to examine the effects of a 4 weeks preoperative exercise
intervention on knee strength power and function post - surgery .
[ subjects and methods ]
eighty male patients ( 27.85.7 age ) , scheduled for reconstruction surgery , were randomly
assigned to two groups , the preoperative exercise group ( n=40 ) and a no preoperative
exercise group ( n=40 ) .
the preoperative exercise group participated in a 4-week
preoperative and 12-week post - operative programs , while the no preoperative exercise group
participated only in the 12-week postoperative exercise program .
isokinetic measured of
quadriceps strength were obtained at 4 weeks before and 3 months after surgery .
[ results ]
the knee extensor strength deficits measured at 60/s and 180/s was significantly lower
in the preoperative exercise group compared with the no preoperative exercise group . at 3
months after surgery , the extensor strength deficit was 28.59.0% at 60/sec and 23.39.0%
at 180/sec in the preoperative exercise group , whereas the no preoperative exercise group
showed extensor strength deficits of 36.510.7% and 27.912.6% at 60/sec and 180/sec ,
respectively .
the preoperative exercise group demonstrated significant improvement the
single - leg hop distance .
[ conclusion ] four week preoperative exercise may produce many
positive effects post reconstruction surgery , including faster recovery of knee extensor
strength and function , as measured by single - leg hop ability . |
all experimental procedures conform to the uk animals ( scientific procedures ) act 1986 and to ethical standards set out by the university of leeds ethical review committee . 1012 day
old wistar rats ( n=89 ) of either sex were deeply anaesthetized with urethane ( 2 g / kg of body weight intraperitoneally ) .
animals were transcardially perfused with ice cold sucrose artificial cerebrospinal fluid ( sucrose acsf ) containing ( in mm ) : sucrose ( 215 ) , nahco3 ( 13 ) , glucose ( 5 ) , kcl ( 1.5 ) , nah2po4 ( 1.5 ) , mgso4.7h2o ( 1 ) and cacl2 ( 1 ) , then humanely killed by decapitation .
the thoracic spinal cord was dissected out and 500 m transverse slices cut using a vibraslice ( campden instruments ) .
slices were stored at room temperature submerged in a holding chamber of acsf containing ( in mm ) : nacl ( 124 ) , nahco3 ( 26 ) , glucose ( 10 ) , kcl ( 3 ) , nah2po4 ( 2.5 ) , mgso4.7h2o ( 2 ) , cacl2 ( 2 ) , equilibrated with 5 % co2/ 95% o2 .
slices were allowed to equilibrate for at least 20 min in a custom built interface recording chamber , superfused with gassed acsf at 3035 c . to keep slices moist , humidified 95 % o2/ 5% co2 was circulated in the recording chamber . a glass micropipette ( 24 m tip diameter )
signals were amplified 10 by an axoclamp2b amplifier ( axon instruments , usa ) , and a further 1000 amplification was achieved with two neurolog nl106 ( digitimer , uk ) amplifier modules .
signals were low - pass filtered ( < 35 hz ) , notch filtered for 50 hz mains noise ( humbug , digitimer ) , digitized ( ced1401plus , cambridge electronic design , uk ) and captured at 5 khz on a pc running spike2 software ( cambridge electronic design , uk ) .
extracellular field potential recordings were made , at depths of approximately 100 m below the surface , from the iml of 157 transverse spinal cord slices ( which retain the mediolateral dendrites that are predominant in spns at this age ( markham and vaughn , 1991 ) ) from 89 neonatal rats .
extracellular iml activity had peak amplitudes of 2060 v which did not vary appreciably during the course of a recording .
background noise levels were determined by comparing traces captured with the electrode placed in the iml ( fig .
the amplitude of the activity was much lower with the electrode in the bath ( < 10 v ) , as expected .
1a , b ) revealed that the frequency components of the two traces were different : the background noise consisted mainly of a small peak at 3 hz , whereas a larger proportion of higher frequencies was present in the neuronal trace . to enable post hoc verification that the recording electrode was correctly positioned ,
power spectra ( fast fourier transform ( fft ) with hanning window , fft size=8192 and resolution=0.6 hz ) and autocorrelograms were generated from 1 min of activity .
the field potentials were considered to be rhythmic if there was a peak in the power spectrum and the first autocorrelogram peak to the right of the central peak indicated a correlation coefficient of greater than 0.1 .
the principal frequency of rhythmic activity was assessed from the highest peak in the power spectrum .
the degree of rhythmicity ( area power ) was quantified by measuring the area under the power spectrum in a 3 hz band surrounding the highest peak .
note that due to this analysis protocol , slices that lacked rhythmic discharges nevertheless had an area power considerably greater than zero because a degree of activity in the frequency band of interest is to be expected at all times .
if the frequency of the highest peak changed following drug treatment , the power under this new peak was calculated , not the power at the original frequency . if no power spectrum peak was present ( for example , after blockade of oscillations with a drug ) , then area power was measured from the same 3 hz range as in control conditions .
statistical comparisons involving area power were carried out with wilcoxon matched pairs signed rank test because these data do not fit a normal distribution .
frequency data are presented as meanstandard error of the mean ( sem ) , whereas area power data are presented as median and interquartile ( iq ) range .
stock solutions of drugs ( apart from 5-ht which was made up fresh on the day ) were diluted in acsf on the day of the experiment and superfused over the slice without recirculation .
drugs were obtained from tocris bioscience ( uk ) except where stated : 5-hydroxytryptamine hydrochloride ( 5-ht , sigma - aldrich , uk ) , methyl-5-hydroxytryptamine maleate ( me5-ht ) , 6-chloro-2-(1-piperazinyl)pyrazine hydrochloride ( mk212 ) , potassium ( 2s,4as,6ar,6as,6br,8ar,10s,12as,14br)-10-hydroxy-2,4a,6a,6b,9,9,12a-7 heptamethyl-13-oxo-3,4,5,6,6a,7,8,8a,10,11,12,14b - dodecahydro-1h - picene-2-carboxylate ( 18-glycyrrhetinic acid , stock in 50% ethanol ; sigma - aldrich , uk ) , ( as)-rel - a-(2r)-2-peperidinyl-2,8-bis(trifluoromethyl)-4-quinolinemethanol monohydrochloride ( mefloquine ) , n-[2-[[3-(dimethylamino)propyl]thio]phenyl]-3-phenyl-2-propenamide hydrochloride ( cinanserin ) , tetrodotoxin citrate ( ttx ) , bicuculline hydrochloride ( bicuculline ) .
power spectral and autocorrelation analysis of iml activity revealed spontaneous rhythmic field potential oscillations in 48/164 ( 29.3% ) slices tested .
the rhythmic discharges were manifest as a peak in the power spectrum in the range 7.522 hz ( mean 13.50.7 hz ) and as a sinusoidal autocorrelogram ( e.g. fig .
oscillation frequency did not drift appreciably during the recording , even though different slices showed a range of frequencies .
this rhythmic activity typically persisted for the duration of a recording , which could be in excess of 3 h. of the slices that did not exhibit spontaneous rhythmic activity , a further 18 previously non - rhythmic slices could be pharmacologically manipulated with 5-ht agonists to induce this activity ( see below ) .
the other slices were not able to generate spontaneous or 5-ht - induced oscillations ( see discussion ) and therefore were not considered any further . in six slices where robust rhythmic oscillatory activity was recorded from the iml ,
moving the electrode to regions outside the iml resulted in a loss of rhythmic activity in all slices tested .
these regions included the motor nuclei ( lamina ix ) of the ventral horn ( n=3 ) or superficial dorsal horn ( n=3 ) , ( fig .
1c ) and suggests that this particular rhythm was specific to the iml ( see discussion ) .
the positioning of the electrode in the iml was verified by deposition of rhodamine from the electrode at the end of recording ( fig .
this was seen as the disappearance of the peak in the power spectrum and the flattening of the sinusoidal morphology of the autocorrelogram ( fig .
, ttx significantly reduced the power of iml oscillations , from a median value of 45.8 ( iq range 31.667.1 v ) to 4.6 ( iq range 1.76.2 ; p=0.028 , n=6 ; fig .
the frequency of the oscillations ( measured at the latest time the power spectrum peak was still detectable ) was unaffected by ttx ( 14.31.5 hz in control conditions vs. 12.31.4 hz in ttx , p=0.201 , n=6 ; fig .
sympathetic preganglionic neurons in the iml express the gap junction channel subunit connexin 36 ( cx36 , marina et al . , 2008 ) and
fire synchronous action potentials in slices as a result of electrotonic coupling ( logan et al . ,
we therefore sought to determine whether direct electrical coupling contributed to the rhythmic population activity in our slice preparation .
the gap junction blocker 18-glycyrrhetinic acid ( 100 m , verified as effective at this concentration at blocking spikelets , the hallmark of gap junctions in recordings from single spns ; data not shown ) was continuously bath applied to six spontaneously oscillating slices ( fig .
18-glycyrrhetinic acid reduced the area power of spontaneous oscillations by an average of 68.2% ( median power was 42.9 [ iq range 26.956.1 ] v in control and 5.0 [ iq range 4.810.6 ] v in 18-glycyrrhetinic acid , p=0.028 , n=6 ; fig .
in addition , the oscillation frequency ( measured immediately before abolition of the power spectrum peak , where necessary ) was significantly reduced by 18-glycyrrhetinic acid from 14.11.0 hz in control conditions to 11.21.5 hz in the presence of the drug ( p=0.02 , n=6 ; fig .
another gap junction blocker , carbenoxolone ( 100 m , a concentration at which spontaneous spikelets were reduced in current clamped spns , not shown ) , had a similar effect ( data not shown ) , reducing the power of iml oscillations by an average of 69.8% .
area power was reduced from 5.5 ( iq range 3.6110.5 ) v to 1.4 ( iq range 1.036.6 ) v ( p=0.068 , n=4 ) by this drug ; however , this reduction did not quite reach statistical significance , possibly due to the range of ongoing area powers observed .
oscillation frequency , measured just before abolition of the power spectrum peak , was not affected ( 15.22.3 hz in control to 16.74.1 hz in carbenoxolone , p=0.47 ) .
finally , we also tested the effects of mefloquine , a gap junction blocker which has been reported to block cx36-containing gap junction channels more effectively than those with alternative subunit compositions ( cruikshank et al . , 2004 ) .
bath application of 1 m mefloquine , a concentration also verified to reduce spikelet activity in spns ( not shown ) abolished spontaneous oscillations in 2/3 slices ( fig .
j ) , and reduced the power from 33.2 to 5.8 v in the remaining slice . the mean reduction in area power produced by mefloquine was 76.4% ( median 33.2 [ iq range 20.240.0 ] under control conditions , 3.9 [ iq range 3.64.9 ] in mefloquine , p=0.109 , n=3 ; fig .
oscillation frequency ( measured just before abolition of the power spectrum peak , where necessary ) was not significantly changed by mefloquine , although a decrease from 16.73.1 hz to 12.51.7 hz ( p=0.153 , n=3 ; fig .
3i ) was observed following application of this drug . to test whether inhibitory gabaergic synaptic transmission is required for rhythm generation in the iml ,
10 m bicuculline significantly reduced the power of ongoing oscillations from a median value of 19.1 ( iq range 5.135.1 ) v to 3.6 ( iq range 0.84.4 ) v ( average 65.1% reduction fig .
the frequency of the oscillation was not significantly changed by bicuculline ( 11.92.0 hz in bicuculline vs. 10.11.2 hz under control conditions , p=0.149 , n=5 ) .
10m 5-ht was applied to eight slices which were demonstrated to be capable of oscillating , of which five were spontaneously rhythmically active and three were non - rhythmic at the time 5-ht was applied .
intermittent application of 5-ht over 30 min using a 5-min - on , 5-min - off protocol resulted in an increase in the area power at the rhythm frequency in all eight slices ( fig . 5 ) .
intermittent , rather than continuous , application of 5-ht was employed because this type of protocol was more successful at enhancing inspiratory nerve burst amplitude than continuous application of 5-ht to a brainstem - spinal cord preparation ( lovett - barr et al . , 2006 ) .
the increase in area power was from a median value of 4.1 ( iq range 2.110.4 ) v to 14.2 ( iq range 8.734.4 ) v ( average 544.7% increase fig .
the 5-ht - induced rhythmic activity lasted at least 10 min and often in excess of 1 h. 5-ht - induced oscillations fell within the normal range for spontaneous oscillations , averaging 9.91.8 hz .
in the five slices which exhibited spontaneous oscillations , the oscillation frequency was not changed by 5-ht treatment ( 9.71.1 hz vs. 9.71.0 hz , p=0.655 , fig .
selective agonists were also used to determine the receptor subtype which contributed to the effects of 5-ht .
10 m me5-ht , an agonist of 5-ht2 receptors , mimicked the effects of 5-ht . when applied to slices which were demonstrated to be capable of rhythmic activity , methyl5-ht increased area power in all 12 slices , from a median value of 4.9 ( iq range 2.112.9 ) v to 13.3 ( iq range 5.421.6 ) v ( average 574.0% increase ; fig . 6 ; p=0.005 ) .
six of these slices were spontaneously active when the drug was applied , whereas the other six were not .
similar to the effects of 5-ht , me5-ht did not significantly change spontaneous oscillation frequency ( 11.71.9 hz during control , 11.31.4 hz during methyl5-ht application , p=0.595 ; fig .
in addition , the mean frequency of rhythmic activity induced by me5-ht was very similar to that of spontaneous oscillations ( 13.02.2 hz , p=0.617 ) .
since me5-ht does not discriminate between the three subtypes of 5-ht2 receptor , and mrna for 5-ht2c is high in the iml ( fonseca et al . , 2001 ) , the action of the selective 5-ht2c agonist mk212 was tested .
10 m mk212 was continuously bath applied to 12 slices deemed capable of generating rhythmic activity , of which four were spontaneously rhythmic .
the area power of iml oscillations was significantly enhanced in all 12 slices ( fig .
the median control power in these experiments was 12.0 ( iq range 6.016.0 ) v , rising to 18.7 ( iq range 10.750.2 ) v ( average increase of 167.0% , p=0.006 , n=12 ; fig .
7e ) measured after at least 8 min in mk212 . again , the frequency of spontaneous rhythmic discharges was unaffected ( 15.01.9 hz in control , 16.12.5 hz in mk212 , p=0.288 , n=4 ; fig
. 7d ) . to determine the contribution , if any , of 5-ht receptors to the spontaneous oscillations , the 5-ht2 receptor antagonist cinanserin was continuously bath applied to three spontaneously oscillating slices .
10 m cinanserin reduced iml oscillations in all three slices , with a mean reduction in power of 33.3% ( from 0.3550.079 to 0.2360.060 , n=3 ; fig .
cinanserin did not significantly affect oscillation frequency : the mean frequency in control conditions was 11.11.2 hz , and in cinanserin the frequency was 9.81.8 hz , n=3 .
in this study we have recorded field potentials , through electrodes placed in the iml , that have ( often spontaneous ) rhythmical discharge characteristics . we therefore suggest that the neuronal networks present in a spinal cord slice preparation are sufficient to generate and maintain rhythmic sympathetic activity , challenging the current view that brainstem circuits are the key contributors to the patterning of rhythmic sympathetic nerve bursts .
rhythmic activity was abolished by application of ttx , indicating that neuronal firing plays a critical role in generating these rhythmic field potentials .
we have also observed that iml rhythmic activity is disrupted by gap junction blockers and bicuculline .
furthermore , rhythmic activity could be enhanced or induced by agonists that activate 5-ht receptors , including those selective for 5-ht2c receptors , an effect similar to that observed in vivo or in spinalized preparations .
it should be noted that these network iml rhythms are a result of ensemble neuronal activity ( probably including spns and interneurons in this region ) and as such are distinct from the membrane potential fluctuations ( similarly termed oscillations ) in single cell recordings such as those reported in hb9-positive interneurons involved in locomotion ( wilson et al . , 2005 ) or indeed spns ( spanswick and logan , 1990 ) .
however , this is not to say that these intracellular events reported by logan 's group do not correlate with , or indeed contribute to , our ensemble activity indeed , these events are gap junction - mediated potentials ( spikelets ) ( logan et al . , 1996 ) and thus they are a probable target of our gap junction blockers .
nevertheless , it is clear that our network oscillations are not simply trains of synchronized spikelets summating in the extracellular milieu the spontaneous spikelet frequency is much too low in spinal cord slices ( mean value 1 hz ) , and spikelet frequency is increased by application of 5-ht ( pickering et al . , 1994 ) , whereas our network oscillations are increased in power by this drug but their frequency remains unaffected .
it is well known that the drugs used here can have non - specific actions ( coker et al . , 2000 ;
mcardle et al . , 2006 ) , such as an inhibitory effect of carbenoxolone on ca channels ( vessey et al . ,
2004 ) or mefloquine on herg k channels ( traebert et al . , 2004 ) ; although with an ic50 of 2.6 m , higher than the dose used here . mefloquine and 18 -glycyrrhetinic acid can also block volume - regulated anion channels ( maertens et al . ,
2000 ; ye et al . , 2009 ) and since other blockers of these channels may also have an effect at glycine receptors ( scain et al . ,
2010 ) , there is a chance that these blockers may exert an action at glycine receptors .
however , the fact that three different drugs exerted similar effects suggests it is their shared action at gap junctions , rather than other possible non - specific effects , which is responsible for attenuating the oscillations .
this is further supported by the observation that all three gap junction blockers used disrupt gap junction - mediated spikelets in spns at these concentrations , without obvious effects on other firing properties of the neurons .
although further experiments may prove unequivocally that these effects are mediated solely by an action on gap junctions , this indicates that synchronization of neuronal activity by gap junctions may be an important mechanism underpinning this rhythmic iml activity . at least some of the junctions involved may contain the subunit cx36 because mefloquine , a blocker with selectivity for cx36-containing gap junctions , replicated the effects of general gap junction blockade . a similar role of cx36-containing gap junctions in the inferior olive ( placantonakis et al . , 2006
) , suprachiasmatic nucleus ( long et al . , 2005 ) , and hippocampus ( buhl et al . , 2003 ) has been confirmed in cx36-knockout mice . for two reasons ,
it is likely that the gap junctions involved in iml rhythm generation are located between spns .
firstly , gap junction coupling tightly synchronizes subthreshold and suprathreshold activity between pairs of spns ( logan et al . , 1996 ) , but gap junction coupling between interneurons or between spn - interneuron pairs has not been observed .
secondly , cx36 immunoreactivity has been localized to the dendritic membrane of spns , but not to interneurons , in the iml ( marina et al . , 2008 ) .
in common with other cns networks ( e.g. see somogyi and klausberger , 2005 ) , spontaneous iml oscillations were also attenuated by bicuculline , a gabaa receptor antagonist , suggesting that spontaneously active gabaergic interneurons also contribute to the network rhythms .
this is relevant to sympathetic control since gabaergic interneurons within the central autonomic area synapse directly onto spns ( deuchars et al . , 2005 ) and provide ongoing phasic inhibitory input in the shape of inhibitory postsynaptic potentials ( ipsps ) recorded in spinal cord slices .
therefore , antagonism of the effects of these interneurons is the likely mechanism underlying the effects of bicuculline on oscillation power .
these inhibitory interneurons may act to pace or reinforce the activity generated in the coupled networks , as originally observed in the hippocampus ( cobb et al . ,
iml rhythms were abolished by the voltage - gated na channel blocker ttx in all experiments , indicating that action potential propagation is a vital component of the oscillations . taken together with the results of gap junction and gabaa receptor blockade , these data suggest that iml field oscillations are the emergent property of a network of neurons that is dependent on synaptic properties and patterns of connections between neurons .
5-ht acts as a modulator of iml rhythmic oscillations , able both to enhance the power of existing rhythms on every occasion tested and induce rhythms in otherwise quiescent slices .
this effect was mimicked by me5-ht and mk212 , suggesting this is mediated at least in part by 5-ht2 receptors .
it is likely that the mechanisms underlying the spontaneous and 5-ht - induced rhythms are similar since the frequencies of spontaneous and 5-ht - induced rhythms are not significantly different and 5-ht does not significantly change the frequency of ongoing rhythms even when it enhances the power .
moreover , results from the slices where cinanserin reduced the power of the oscillation provide evidence that , in these cases , at least a proportion of the spontaneous oscillations is mediated by activation of 5-ht2 receptors .
where 5-ht or methyl5-ht were unable to elicit rhythmic activity in hitherto quiescent slices , it is likely that these slices were either not viable ( i.e. not healthy enough to generate complex oscillations ) , did not contain enough of the circuitry necessary for generating rhythmic activity , or may oscillate in the presence of drugs other than those of interest to us here . since the spontaneous activity level of many slices was only marginally above background noise levels , it was difficult to be certain of the viability of slices which did not display oscillations .
we therefore report the existence of these slices for transparency , and with the admission that we can not say for sure whether they were the result of sub - optimal slice preparation or maintenance , or whether some may have been alive but intrinsically unable to oscillate .
possible causes of the latter would include the ladder and rung morphology ( petras and cummings , 1972 ) of the iml , in which small clusters of spn somata are separated by highly variable gaps of 50150 m ( our unpublished estimates in 11-day - old rats ) consisting mainly of dendrites .
the number of clusters per 500 m slice is therefore likely to vary , perhaps resulting in some slices containing too few spns to generate oscillatory activity .
previous studies support the notion that 5-ht is an important modulator of rhythmic sympathetic activity .
for example , the 10 hz rhythm in sympathetic nerve discharge is selectively enhanced by intravenous administration of a 5-ht2 receptor agonist and eliminated by a 5-ht2 antagonist , and these effects are mimicked by exciting or inhibiting serotonergic neurons in the medullary raphe respectively ( orer et al . , 1996 ) .
furthermore , microinjections of 5-ht into the upper thoracic iml increased sympathetic outflow to brown adipose tissue ( madden and morrison , 2006 ) . significantly , 5-ht acting at a spinal site induces at least two distinct sympathetic rhythms ( marina et al . , 2006 ;
the effects of 5-ht on iml rhythmic activity were reproduced by the selective 5-ht2c receptor agonist mk212 , suggesting that the facilitation is at least partially mediated by this receptor .
indeed , 5-ht2c mrna is abundant throughout the spinal cord , including the iml ( fonseca et al . , 2001 ) .
the rhythmic activity reported here was confined to the iml region of the spinal cord since , in all slices tested where spontaneous activity was present in this region , moving the electrode to other areas such as the ventral or dorsal horn resulted in loss of this activity .
this suggests that , although both dorsal and ventral horn regions are capable of generating rhythmic activity if driven pharmacologically ( asghar et al .
, 2005 ; nakayama et al . , 2004 ) , this particular spontaneous or 5-ht - induced rhythm is specific to the iml .
it is therefore likely that it is generated locally within the iml , and represents the summed network activity of the spns and/or sympathetic interneurons in this region .
the presence of rhythmic activity in the iml of a spinal cord slice strongly supports previous suggestions that rhythmic sympathetic activity can be generated by the spinal cord ( see introduction ) .
the frequency of iml oscillations in the current study was in the range 7.522 hz .
in vivo , the 10 hz rhythm occurs in a similar , but much more restricted , frequency band ( 812 hz ; cohen and gootman , 1970 ; green and heffron , 1967 ) .
thus , it might be speculated that the iml oscillations in the current study represent a stripped - down version of the 10 hz rhythm . in support of this idea , although it is known that at least a component of the 10 hz rhythm is generated in the brainstem , ( barman and gebber , 2000 ) , 10 hz discharges can also be generated within the spinal cord ( kubota et al .
mccall and gebber , 1975 ; ootsuka et al . , 1995 ) and the 10 hz rhythm is dependent on the activity of 5-ht2 receptors ( orer et al . ,
however , since the closest in vivo correlate of these oscillations , the 10 hz rhythm , occurs in both young kittens and swine ( hundley et al . , 2001 ; sica et al . , 1990 ) as well as adult animals
the generation of 10 hz discharges by the spinal cord is poorly understood , so this theory remains speculative .
further , it will enable the contribution of individual cell types to network oscillations to be determined , since intracellular sharp electrode or patch clamp recordings may be performed in 500 m slices in conjunction with field recordings .
our data demonstrate that rhythmic field potential oscillations can be recorded from the iml of neonatal rat spinal cord slices , and this activity is spontaneous in a proportion of slices .
these findings suggest that the rhythmogenic capabilities of the sympathetic circuits of the spinal cord have been underestimated , and that spinal oscillators could potentially play a role in generating the physiologically - important sympathetic nerve bursts that have hitherto been credited mainly to supraspinal networks .
5-ht acting at 5-ht2 receptors modulates iml oscillations , inducing rhythmic network activity in at least a proportion of quiescent slices , and significantly enhancing spontaneous rhythmic activity in all slices tested .
action potential propagation is required for the oscillations to occur , and both gap junctions ( probably between spns ) and gabaergic interneurons are important components of the spontaneous rhythmogenic network .
iml oscillations in slices represent a valuable paradigm for studying the rhythmogenic capabilities of the spinal cord . | neuronal networks generating rhythmic activity as an emergent property are common throughout the nervous system .
some are responsible for rhythmic behaviours , as is the case for the spinal cord locomotor networks ; however , for others the function is more subtle and usually involves information processing and/or transfer .
an example of the latter is sympathetic nerve activity , which is synchronized into rhythmic bursts in vivo .
this arrangement is postulated to offer improved control of target organ responses compared to tonic nerve activity .
traditionally , oscillogenic circuits in the brainstem are credited with generating these rhythms , despite evidence for the persistence of some frequencies in spinalized preparations . here
, we show that rhythmic population activity can be recorded from the intermediolateral cell column ( iml ) of thoracic spinal cord slices . recorded in slices from 10- to 12-day - old rats ,
this activity was manifest as 822 hz oscillations in the field potential and was spatially restricted to the iml .
oscillations often occurred spontaneously , but could also be induced by application of 5-ht , -methyl 5-ht or mk212 .
these agents also significantly increased the strength of spontaneous oscillations .
rhythmic activity was abolished by ttx and attenuated by application of gap junction blockers or by antagonists of gabaa receptors .
together these data indicate that this rhythm is an emergent feature of a population of spinal neurons coupled by gap junctions .
this work questions the assumption that sympathetic rhythms are dependent on supraspinal pacemaker circuits , by highlighting a surprisingly strong rhythmogenic capability of the reduced sympathetic networks of the spinal cord slice . |
amyloids are large
aggregates of misfolded proteins with a highly
stable cross -structure , which are associated with a variety
of degenerative illnesses such as alzheimer s , parkinson s , and huntington s diseases
. proteins with different functionalities
and native structures ranging from -helical and -sheet
rich to intrinsically unordered are able to form amyloid fibrils in vitro with a characteristic cross- core structure .
this observation leads to the conclusion that protein fibrillation
is a generic property of a polypeptide chain .
there are numerous research
reports demonstrating that a general fibrillation mechanism involves
a partially unfolded protein as the first intermediate state .
steps to follow include the formation of small aggregates and a
-sheet rich nucleus , which generates further protein aggregation
and the formation of mature fibrils .
a reduced amount of hydrogen
sulfide ( h2s ) in the brain
tissue of patients with alzheimer s disease has been recently
reported . for centuries , people have been
interested in h2s for its role as a poisonous chemical .
at high concentrations ,
more recently , it has been demonstrated that h2s has gasotransmitter functions , similar to co and no .
for example , a suspended animation - like state
in mice has been achieved by administering ppm levels of h2s at low temperatures .
the metabolic rate and body core temperature
decrease and fully recover after such exposure a promising
medical benefit that reduces physiological damage after trauma . in the past two decades , significant
attention
has been paid to understanding the physiological role of h2s and its endogenous production .
h2s is biosynthesized
in mammalian tissue by nonenzymatic reactions and by the enzymatic
degradation of cysteine by cystathione synthetase ( cbs ) , cystathione
lyase ( cse ) , cysteine aminotransferase ( cat ) , and cysteine
lyase ( cl ) .
moreover , aged garlic extract has been shown to cause a reduction
of in vivo a fibrils and soluble amyloid as
well as a decrease in tau conformational changes .
this indirect evidence concerning the role of h2s in neurodegenerative diseases has motivated us to investigate the
effects of h2s on the formation of amyloid fibrils .
there is extensive literature on the inhibitory
activity of various small molecules on protein fibrillation .
recently , arioso and coauthors have reviewed the development of amyloid inhibitors , such
as antibodies and chaperones , small molecules ( e.g. , congo red and polyphenols ) ,
colloidal inhibitors , and organic / inorganic nanoparticles , as possible
participants in the various states of protein aggregation .
these states
include the inhibition of primary nucleation ( monomer - to - oligomer
transition ) , secondary nucleation ( oligomer elongation ) , and postelongation .
however , we have not found any published reports on the role of h2s in protein aggregation .
it is well documented that
h2s reacts with disulfide
bonds , leading one to hypothesize that this reaction could have a
significant effect on the mechanism of protein fibrillation .
kumar
and co - workers have reported that protecting disulfide bridges with
iodoacetamide in an alkaline solution limits the lysozyme fibril growth
to 50% .
this group has concluded that
changing the dynamics of disulfide to aberrant disulfide
bonds would redirect the process toward the formation of native - like
lysozyme aggregates .
it has been reported
that treating antibodies with h2s has resulted in ss bond
modifications , including the formation of trisulfide bonds ( sss ) assessed
by liquid chromatography and mass spectrometry ( lc - ms ) . surprisingly , no changes in antibody stability
and function have been observed .
h2s can be incorporated
as a sulfane sulfur , a divalent sulfur with six valence electrons ,
and an oxidation number of zero ( s ) that only binds to
other sulfur atoms to form polysulfides .
several research groups have also reported that the sulfur atom
of h2s can be endogenously incorporated into a large amount
of proteins by sulfuration , also known as sulfhydration of cysteines .
this leads to the formation of protein persulfides ( ssh ) , which could
play an intermediary role in protein sss formation . in the current study
, we have investigated the effect
of h2s on the aggregation of lysozyme , a glycoside hydroxylase
responsible for antimicrobial protection in most mammalian species .
hewl is a single chain protein stabilized by four ss bonds in positions
cys6-cys127 , cys30-cys115 , cys64-cys80 , and cys76-cys94 .
the effect of h2s has been investigated
under typical fibrillation conditions such as high temperature and
acidic ph using duvrr and nonresonance raman spectroscopy , fluorescence ,
lc - ms , and atomic force microscopy ( afm ) .
we have shown that in the
presence of h2s hewl forms spherical aggregates of unordered
protein under fibrillation conditions .
cytotoxicity tests reveal that
these spherical aggregates have no cell toxicity by contrast with
typical hewl fibrils .
our spectroscopic results , buttressed by data
that have been published , indicate that h2s reacts with
protein disulfide bonds to form trisulfide bridges .
this reaction
results in significant lysozyme denaturation and the formation of
spherical aggregates of unordered proteins , which prevent protein
fibrillation .
this discovery indicates possible new roles for h2s and trisulfide bridges in protein biochemistry in
vivo .
louis , mo ) : 99.7% acetic acid ( 695092 ) , sodium chloride ( nacl ) ( s771 - 3 ) ,
hewl ( l6876 ) , sodium sulfidenonahydrate salt ( 208043 ) , dipropyl disulfide
( 149225 ) , and trisulfide ( 6028 - 61 - 1 ) .
lysozyme was dissolved ( 25
mg / ml ) in 20% acetic acid and 100 mm nacl at ph 2.0 and incubated
at 60 c to form fibrils under initial ( control ) conditions .
to study the effect of h2s , sodium sulfide nonahydrate
salt ( 12 mm )
was added to the control solution in a molar ratio of
1:5 ( hewl : h2s ) , prior to the temperature elevation .
powder samples of native
and aggregated hewl were prepared by drying the solutions under nitrogen
at room temperature , which removed the acetic acid .
raman spectra
( 785 nm excitation ) of hewl powder samples and pure dipropyl di- and
trisulfide liquids were recorded using a renishaw invia confocal raman
spectrometer equipped with a research grade leica microscope and 50
objective ( numerical aperture , 0.55 ) .
five accumulations of 30 s each
were collected for each sample in the range of 4001800 cm .
a laser power of approximately 11.5 mw was used to avoid sample photodegradation . a reaction with tris(2-carboxyethyl)phosphine
( tcep ) reducing agent
hen egg white lysozyme ( hewl ) in native and
aggregated form was incubated at ph 2.0 and room temperature for 90
min in the presence of tcep .
lc - ms experiments were performed
on thermo ltq orbitrap xl mass spectrometer ( thermo , bremen , germany ) .
samples were injected using an agilent 1200 nano - hplc system ( agilent ,
palo alto , ca ) and agilent 1200 autosampler .
agilent zorbax c18 column
( 150 4.6 mm ) was used for separation of mixtures .
the injection
volume was up to 8 l , and a flow rate of the mobile phase was
250 l / min .
mobile phase consisted of 0.2% of formic acid ( solvent
a ) and 0.2% formic acid in acetonitrile ( solvent b ) with the gradient
from 5% to 40% of solvent b in 40 min followed by washing the column
by 90% of solvent b and equilibration .
the mass spectrometer operated
in esi mode in the mass range m / z 100500 with detection of positively and negatively charged
ions .
the resolution was 30 000 , and the accuracy of
mass measurements was better than 2 ppm .
powder samples of hewl
aggregates incubated at different concentrations of tcep were prepared
for nonresonance raman spectroscopic analysis by drying the corresponding
solutions under a nitrogen flow at room temperature .
duvrr
spectra ( 199.7 nm excitation ) of 25 mg / ml hewl were collected using
a home - built instrument equipped with a ccd camera ( roper scientific ,
inc . )
each
spectrum recorded an average of 20 accumulations with 30 s acquisition
time .
grams / ai 7.0 software ( thermo galactic , salem , nh ) was used
for data processing .
fluorescence spectra
were measured in a jobinyvon fluoromax-3 spectrofluorometer ( jobinyvon ,
edison , nj ) .
intrinsic tryptophan fluorescence of 25 mg / ml hewl was
measured in a 10 m path length cell without dilutions .
the
uv absorption was < 0.05 at an excitation wavelength of 295.5 nm .
three spectral accumulations were taken , and the spectra were averaged
for each sample .
hewl fibrils formed after 90 min of incubation were
also characterized using intrinsic tryptophan fluorescence .
fibrils
were washed in acetic acid solution twice in a procedure which included
sonication for 10 min , centrifugation for 4 min at 13 000 rpm ,
the removal of supernatant liquid , and resuspension in an acetic acid
solution . in the tht fluorescence assay , aliquots of 25 mg / ml
hewl were diluted in a molar ratio of 1:10 ( hewl : thioflavin t ( tht )
dye ) to a final concentration of 2.5 mm tht .
aliquots
of hewl incubated
at 60 c , ph 2.0 , 100 mm nacl , were cooled to room temperature
and deposited on freshly cleaved mica .
after a few minutes of exposure ,
the mica surface was rinsed with mq water and dried .
afm images were
collected using the smartspm 1000 system ( aist - nt , novato , ca ) .
images
were acquired in the tapping mode using silicon cantilevers with a
1025 nm tip curvature radius .
human
neuroblastoma sh - sy5y cells were
cultured in a 1:1 ( v / v ) mixture of dmem ( sigma - aldrich , st .
louis ,
mo ) and ham s f-12 nutrient mixture ( sigma - aldrich , st . louis ,
mo ) supplemented with 10% fbs ( sigma - aldrich , st .
louis , mo ) and antibiotic - antimitotic
solution ( sigma - aldrich , st .
the cells were incubated
at 37 c in an incubator with 95% humidified air and 5% co2 .
cells were plated onto flat - bottom
96-well plates ( 1 10 cells per well ) and incubated
overnight at 37 c . after cell attachment , the initial medium
was replaced with serum - free medium using different concentrations
of mature hewl fibrils or hewl aggregates ( formed with h2s ) and incubated for 24 h. cytotoxicity was assessed using the mtt
reduction inhibition assay .
mtt was added
to the culture medium to yield a final concentration of 0.5 mg / ml .
cells were incubated with the mtt medium for 4 h in a co2 incubator , followed by the addition of 200 l of an isopropanol
0.04 n hcl solution to dissolve formazan crystals .
absorbance was
measured at 540 nm using a synergy h1 plate reader ( biotek , vermont ) .
control experiments were performed by exposing cells to solutions
of an equivalent volume of the same initial buffer for the same length
of time .
cell viability was measured relative to control cells that
were not exposed to the hewl aggregates / hewl fibrils solutions .
to form fibrils , hewl was incubated at 60 c in 20% acetic acid
( ph 2.0 ) and 100 mm nacl , from here on referred to as control conditions .
the morphology of lysozyme aggregates formed in the course of incubation
under the fibrillogenic conditions and in the presence of h2s was characterized by afm .
the presence of typical long rodlike
fibrils was evident after 90 min of incubation under control conditions
( figure 1a ) . however , incubation of hewl in
the presence of h2s resulted in the formation of spherical
aggregates instead of fibrils , as evident from afm images ( figure 1b ) .
lysozyme forms -sheet - rich fibrils under fibrillogenic
control
conditions and spherical aggregates of unordered protein under fibrillogenic
conditions with h2s incubation .
afm images of ( a ) hewl
fibrils formed after incubation of the control solution for 90 min
and ( b ) hewl aggregates formed after incubation of the solution in
the presence of h2s for 48 h ; scale bars are 1 m .
( c ) aggregation kinetics ( tht fluorescence ) of hewl incubated under
control conditions ( red ) and in the presence of h2s ( black ) .
( d ) duvrr spectra of native hewl ( blue ) , hewl fibrils ( red ) and hewl
spherical aggregates ( black ) formed in the presence of h2s ; all spectra were normalized using the aromatic amino acid raman
band ( approximately 1600 cm ) for comparison .
the
amide i vibrational mode ( am i ) is dominated by c = o stretching ,
with minor contributions from c
amide ii ( am ii ) and amide iii
( am iii ) bands involve significant c
the
ch bending vibrational mode involves ch
symmetric bending and c c stretching .
tht fluorescence intensity increased dramatically after 70
min of incubation of lysozyme under control conditions , indicating
the formation of amyloid fibrils ( figure 1c ) .
however , no increase in tht fluorescence intensity was observed for
the hewl solution incubated with h2s within 48 h. we investigated changes in the lysozyme secondary structure during
incubation with and without h2s using deep uv resonance
raman ( duvrr ) spectroscopy .
duvrr has been used to study structural
rearrangements of hewl at all stages of fibrillation .
the duvrr spectrum of hewl excited
at 199.7 nm was mainly composed of the amide chromosphere and the
aromatic amino acid ( phe and tyr ) contributions . a noticeable increase in the intensity and sharpness of
the am i band ( approximately 1672 cm ) indicated
the appearance of -sheets due to the formation of fibrils .
the duvrr spectrum of fibrillated lysozyme under
control conditions confirmed the formation of -sheets .
the
spectrum of hewl after 30 min of incubation under control conditions
( figure 1d , red ) is similar to that reported
previously for hewl fibrils .
however ,
the duvrr spectrum of lysozyme incubated in the presence
of h2s confirmed the lack of -sheet formation . in
this case ,
the am i band ( approximately 1670 cm ) did not show a significant intensity change ( figure 1d , black ) . instead , the am
i band shifted slightly to a higher
frequency , signifying the formation of an unordered protein .
this was further supported by the increase in ch band intensity at 1390 cm that was
indicative of -helix melting . a
significant change in raman bands for am
iii ( approximately 1250 cm ) and am ii ( approximately 1555 cm ) was consistent with the transition of -helix to unordered
protein . therefore , afm , tht fluorescence and duvrr spectroscopy indicated
the formation of unordered spherical aggregates of hewl by contrast
with -sheet - rich fibrils in the presence of h2s .
tryptophan ( trp ) fluorescence is an efficient
intrinsic marker of local environments , which is often used for monitoring
tertiary structural changes in proteins .
native lysozyme at neutral ph shows a maximum trp emission at 340
nm . at ph 2.0 ( 20% acetic acid ) , the
trp fluorescence peak shifts to 345 nm , indicating a partial denaturation
of lysozyme . a further minor shift to 347 nm due to hewl fibril formation
under control conditions
was observed ( figure 2b , c ) . to confirm that the intrinsic trp fluorescence is dominated
by the signal from hewl fibrils , the solutions ( after incubation for
40 and 90 min ) were sonicated , centrifuged and resuspended in 20%
acetic acid to remove possible monomeric and oligomeric forms of the
protein ( figure 2b ) .
time - dependent trp fluorescence
changes of lysozyme ( a ) incubated
in the presence of h2s for 0 min ( - - - ) ,
10 min ( ) , 90 min ( ) , and
48 h ( ) and ( b ) incubated with control solution for 0 min
( ) , 40 min ) , and 90 min ( ) .
( c ) trp maximum emission wavelength of hewl incubated with h2s ( a , ) and fibrillation under control conditions ( b , ) . a significant shift of the trp
emission maximum , from 345 to 357
nm , was observed after 90 min of lysozyme incubation in the presence
of h2s ( figure 2a , c ) , with no further
changes for at least 48 h. this significant red - shift is consistent
with the previously reported maximum emission at 352 nm for fully
denatured lysozyme in 6 m guanidinium - hcl at ph 7.0 .
therefore , we conclude that incubation of lysozyme in the
presence of h2s results in a stronger denaturation than
that which occurs during control fibrillation conditions .
nonresonance raman
spectroscopy of proteins offers a unique opportunity for characterizing
the conformation of disulfide bridges .
the ss symmetric stretching vibrational mode is
typically represented as a strong raman band in the range of 505550
cm .
the raman spectrum of hewl was found to change
significantly in the ss signature region with incubation time ( figure 3a ) .
a strong 507 cm peak in
the raman spectrum of native hewl represents the gauche gauche
gauche
( g - g - g ) configuration of three ss bonds , and a small 523 cm peak can be attributed to the gauche gauche
trans
( g - g - t ) configuration of the fourth ss bond of lysozyme .
the amplitudes of these peaks decreased , and a new peak appeared
at 490 cm as a result of hewl incubation in the
presence of 12 mm h2s , indicating significant rearrangements
of ss bonds ( figure 3a ) .
evolution of lysozyme
disulfide bonds in the presence of h2s probed by normal
raman spectroscopy .
raman spectra of hewl
incubated ( a ) in the presence of h2s and ( b ) under control
conditions , where 507 and 523 cm bands correspond
to g - g - g and g - g - t ss configurations , respectively .
synchronous kinetic
change in the area of the 507 and 490 cm bands
is assigned to the newly formed rsssr group .
( c ) kinetics of rsssr
formation ( 490 cm ) and the decrease in the amount
of rssr ( 507 cm ) during the incubation of hewl
in the presence of h2s .
( d ) difference spectrum between
normal raman spectra of hewl aggregated in the presence of h2s acquired at 90 and 0 min incubation ( shown in ( a ) , gray solid line ) .
the latter spectrum is represented by the expected spectral change
demonstrating the disulfide - to - trisulfide transition symbolized by
the inverted raman spectrum of dipropyl disulfide ( - - )
and dipropyltrisulfide ( red ) .
the concentration of 12 mm h2s corresponded to
a 5:1
( h2s : hewl ) molar ratio , chosen so that a sufficient number
of h2s molecules could react with all four lysozyme ss
bonds assuming a 1:1 stoichiometric ratio .
the 1003 cm peak corresponding to phenylalanine was used to normalize raman spectra in figure 3a ( region not shown ) .
figure 3c shows synchronous
kinetic change in the area of the 507 and 490 cm bands with incubation time up to 90 min .
no further changes were
observed during 48 h of additional incubation in the presence of h2s ( data not shown ) . as discussed in detail below , the dipropyl
trisulfide ( dpts )
raman spectrum contains a 485 cm band ( figure 3d ) characteristic of the trisulfide
moiety that motivated us to investigate the possibility of assigning
the 490 cm band in the hewl aggregate raman spectrum
to the sss group .
the nonresonance raman spectroscopy of hewl fibrillation
under control conditions indicates that the 507 cm peak does not change significantly during fibril formation ( figure 3b ) .
therefore , in the absence of h2s ,
the hewl ss bands remain intact and the g - g - g conformation dominates ,
in agreement with our previous report . to test the
hypothesis about the formation of trisulfide groups
, we investigated
the reaction of hewl aggregates with tcep reduction agent by normal
raman spectroscopy and mass spectrometry .
tcep reaction with ss groups
is well - known to result in oxidation of tcep and formation of tcep(o )
and r sh groups .
more recently ,
cumnock et al . reported that tcep reacted preferentially with sss
moieties in the presence of ss bridges until the majority of sss groups
were consumed according to eqs 1 and 2 .
figure 4 shows raman
spectra of hewl aggregates after incubation with different concentrations
of tcep ( 0.5 , 1 , 2.5 , and 10 mm ) .
the amount of aggregated hewl molecules
in these samples was kept about 3.0 mm.12 normal
raman spectra of hewl aggregates in the presence of reducing
agent tcep with concentration 0 mm ( ) , 0.5 mm ( ) ,
1 mm ( - - - ) , 2.5 mm ( ) , and
10 mm ( - - )
. selected spectral regions with characteristic
raman bands of disulfide and trisulfide moieties ( a ) as well as sulfhydryl
( sh ) group ( b ) are shown .
the phenylalanine raman band at
1003 cm was used to normalize the spectra ( spectral
region not shown ) .
the raman spectrum of
hewl aggregates was found to change significantly
in the sss / ss vibrational signature region with the addition of tcep
( figure 4a ) . the sss band at 490 cm decreases after 0.5 mm tcep addition which is in a good agreement
with predominant reaction of tcep with sss groups .
the amplitudes
of both 490 and 507 cm bands ( sss and ss , respectively )
decreased as a result of hewl incubation in the presence of higher
concentration of tcep ( 110 mm ) , indicating significant reduction
of ss and sss groups and formation of r sh moiety in agreement
with an increase in 2575 cm band intensity ( figure 4b ) .
lc - ms was utilized to monitor the formation
of tcep(s ) and tcep(o )
as products of sss and ss reduction , respectively ( eqs 1 and 2 ) .
the reduction of native hewl
with an excess of tcep ( 10 mm ) resulted in products with retention
times of 6.68 , 9.01 , and traces at 17.51 min ( figure 5a ) .
accurate mass measurements confirmed that the products
correspond to tcep , tcep(o ) , and tcep(s ) , respectively .
hewl aggregates
treated with 0.5 mm tcep showed tcep(o ) and tcep(s ) , with retention
times of 9.0 and 17.53 min ( figure 5b ) .
all
initial tcep was completely consumed due to the reaction with sss
and ss groups .
combined lc - ms ( esi in negative ion mode ) chromatograms
of ions
at m / z 249 , m / z 265 , and m / z 281 corresponding
to deprotonated tcep , tcep(o ) , and tcep(s ) , respectively , for native
lysozyme incubated with 10 mm tcep ( a ) and lysozyme aggregates incubated
with 0.5 mm tcep ( b ) .
the solution of native hewl incubated with an excess of tcep
contained
significant amounts of tcep and tcep(o ) and traces of tcep(s ) .
the
main expected products of tcep reaction with rssr are tcep(o ) and
2rsh .
we believe that the traces of tcep(s )
could form due to a prolonged exposure of native hewl to the excess
of tcep prior to lc - ms analysis .
this suggestion is based on the reported
reaction 3 of triphenylphosphine ( ph3p ) with dialkyl disulfides ( rssr ) , which resulted in formation of
ph3p(s ) .
we hypothesize that
the trace amount of tcep(s ) is formed in the reaction of tcep with
native hewl due to a similar mechanism .
however , the amount of tcep(s )
is low because the second step in reaction 3 is slow and reaction 2 dominates.3overall , the analysis of reaction
products
resulting from the incubation of native and aggregated lysozyme in
the presence of tcep using lc - ms is consistent with the presence of
sss in aggregated hewl .
the variation in the amplitude of the 490
cm raman band with the concentration of tcep is
in agreement with its assignment to the sss group as well . to compare the cytotoxicity
of hewl fibrils and spherical aggregates
formed in the presence of h2s ,
samples of mature fibrils
and spherical aggregates were posteriorly transferred to pbs buffer
at ph 7.4 in order to avoid drastic changes in the ph of the cells .
to achieve this ,
mature fibrils were washed three times in pbs buffer ,
and spherical aggregates were dialyzed against pbs buffer
. the latter
procedure did not change fibrils and spherical aggregates according
to their normal raman spectra ( data not shown ) . specifically , the
490 cm band remained intact after buffer exchange
to pbs .
the incubation of confluent sh - sy5y cells with mature fibrils
( 0.536 m ) for 24 h resulted in a significant reduction
( 40% ) of the cellular viability .
mean cell viability and one standard deviation of two independent
experiments performed in triplicate are presented .
the most common methods used
for studying the fibrillation process include afm , tht , and trp fluorescence .
duvrr spectroscopy has been shown to be uniquely suitable for the
structural characterization of proteins at all stages of the fibrillation
process .
we utilized these complementary
methods for studying the effect of h2s on the morphology
and structure of lysozyme aggregates .
although fibril formation was
not detected by afm and tht fluorescence assays , the intrinsic trp
fluorescence marker suggested that significant tertiary structure
changes had taken place minutes after h2s incubation began .
the red - shift of trp fluorescence of greater than 10 nm is typical
for unfolded lysozyme .
changes were also
evident for ss bridges at the same time scale , as discussed in the
next section .
the changes observed in the tryptophan local environment
and in ss bonds indicate substantial changes in hewl tertiary structure .
duvrr spectroscopy was utilized to investigate changes in hewl
secondary structure during the incubation with and without h2s .
it was found that h2s prevented the formation of -sheet
and resulted in a significant transition of -helix to unordered
protein .
moreover , we utilized duvrr spectra of aggregated lysozyme
to evaluate the protein secondary structure composition .
xu et al . have reported on the quantitative analysis of
lysozyme duvrr spectral changes during its denaturation . according
to that work
, the amount of -helix melting can be estimated
from the intensity of ch bending band .
-sheet
and unordered structures only contribute to ch
bending duvrr band , while the -helix does not make a noticeable
input .
it is evident from amide i raman
bands in duvrr spectra presented in figure 1d that no fibril - type -sheet is formed in hewl aggregates
since the am i intensity does not increase .
therefore , the increase
in the ch band intensity in the spectrum
of hewl aggregates relative to that of native protein could be assigned
to newly formed unordered structures .
we normalized the duvrr spectra
of hewl aggregates and native protein with the denatured - reduced hewl
spectrum reported by xu et al . and estimated
the amount of -helix in hewl aggregates as 11% . assuming that
the amount of -sheet in hewl aggregates is approximately the
same as in the native protein , we estimated the secondary structural
composition of hewl aggregates as 83% unordered , 11% -helix ,
and 6% -sheet .
to summarize the results concerning the
significant tertiary structural
rearrangements , -helix melting , and lack of -sheet formation ,
we conclude that h2s causes more significant denaturation
of lysozyme than that taking place during the initial stages of protein
fibrillation , which is typically reported as partial protein denaturation .
we hypothesize
that this significant lysozyme denaturation results in rapid protein
aggregation , the formation of spherical species , and the prevention
of the formation of -sheets and fibrillation . in other words ,
this observation is consistent with an earlier
report by wang and colleagues which demonstrated that fully denatured
lysozyme forms amorphous aggregates that prevent fibril formation .
the protein has been fully denatured by reducing
ss bonds with dttred . as a result , fully denatured lysozyme
may lack the hydrophobic regions which are present in the partially
unordered intermediates formed at the early stage of fibril formation .
in addition , it is possible that amorphous aggregates decreased the
effective concentration of hewl available for fibril formation . in agreement with wang s report
, our
results suggest that lysozyme denatures strongly in the presence of
h2s and forms unordered aggregates that prevent -sheet
formation and fibrillation . according to figure 3 ,
the contributions of
both g - g - g ( 507 cm band ) and g - g - t ( 523 cm band ) conformations
of ss bonds to the raman spectrum of hewl decreased significantly
during its incubation with h2s .
simultaneously , a new peak
appeared at 490 cm ( figure 3a , c ) .
nielsen and colleagues proposed that sss bridges can form in
proteins in the presence of h2s via the thiol
we investigated the possibility of assigning
a new raman band at 490 cm to the sss moiety .
initially , we reproduced raman spectra of two model compounds , dipropyl
disulfide ( dpds ) and dipropyl trisulfide ( dpts ) , shown in figure 3d . in agreement with other published studies , these compounds exhibit strong raman bands at 509 and 485 cm , respectively , in agreement with the raman spectra
of native hewl and hewl spherical aggregates formed in the presence
of h2s .
furthermore , we obtained the difference spectrum
by subtracting hewl spectra after 0 and 90 min of incubation in the
presence of h2s and compared it to the expected spectral
change representing the ss to sss transition .
the latter spectral
change is depicted as a combination of dipropyl disulfide and dipropyl
trisulfide spectra ( figure 3d ) .
this spectral
comparison provides further support for the hypothetical assignment
of the 490 cm raman band to the sss moiety .
several studies have identified a 490 cm raman
band in inorganic compounds and small organic molecules containing
sss , and we report the appearance of this band in proteins for the first
time .
wieser and krueger have assigned the 488 cm raman peak of h sss h to a symmetric ss stretch with
a contribution from the sss bend .
freeman
has reported the raman spectra of organic ss and sss compounds , found
in natural products where a strong 485 cm stretching
band has been observed in cyclic and acyclic trisulfides .
janz et al . have reported raman spectra of inorganic
sss from bas3 where 458 and 476 cm bands
were assigned to the symmetric stretching of sss .
kimbaris et al . have reported the gc / ms and raman spectra of garlic oil , which contains
a variety of compounds with ss and sss groups .
we noticed an intense
band at 489 cm in these spectra that could potentially
originate from an sss moiety , although the assignment of the band
was not discussed in the article .
overall , our hypothetical assignment
of the 490 cm raman band to the sss moiety is
in agreement with data from the literature .
the mechanism of sss formation in proteins is unclear despite the
significant interest that this topic has gained in recent years .
there is emerging evidence indicating
that sulfane sulfur ( s ) , which is generated from h2s , is responsible for sulfuration
through the formation of persulfide or trisulfide in proteins .
it would be interesting to investigate whether these sss form by
intra- or intermolecular processes .
it is noteworthy that the 490 cm raman band
can not be assigned to rssh groups .
these groups could form as a result
of disulfide bond reduction in the presence of h2s by a
process known as sulfuration or sulfhydration . however , r sh and r ssh groups have a characteristic
raman band at 2575 cm which is not evident in
the experimental spectra ( figures s1 and s2 ) .
in addition , these groups do not have a vibrational mode at 490
cm .
there is evidence
in the literature that indicates the possibility of ss bond reduction
in the presence of h2s and the formation of rssh groups
in basic environments .
the results allowed us to eliminate rssh as a possible candidate for
newly formed species with a characteristic 490 cm raman band .
ss bonds preserve the three - dimensional structure
of proteins , and their cleavage typically results in significant disruption
of the native conformations of proteins .
it is well established that ss bonds play a significant role in
amyloid fibrillation .
dobson and colleagues
have reported that the reduction of ss bridges significantly accelerated
the rate of human lysozyme aggregation .
it has also been demonstrated that reduction of four ss bonds to
three ss bonds of apo--la accelerates its fibrillation and
leads to the formation of a new fibril polymorph with a different
morphology and structure compared to fibrils formed from the wild - type
la . at the same time , ss bonds of insulin
remain intact and preserve their conformation during the fibrillation
process .
similar to insulin , the conformation
of the ss bonds in hewl remains intact during the fibrillation of
hewl in control solution , as we have described here .
it has
been suggested that a partial denaturation of lysozyme precedes fibril
formation because the native tertiary
structure would not allow rearrangement to the cross--sheet
structure due to steric constraints .
it
has also been reported that partial denaturation , the first step of
lysozyme fibrillation , is an irreversible process . at the same time , a fully denatured lysozyme forms amorphous
aggregates that prevent fibril formation .
it is believed that the fully denatured protein lacks the hydrophobic
side chains present in partially unordered intermediates .
in addition ,
amorphous aggregates potentially decrease the effective concentration
of hewl available for fibril formation . in agreement with these observations ,
our results suggest that lysozyme
denatures strongly in the presence of h2s and forms unordered
aggregates that prevent -sheet formation and fibrillation .
amyloid fibrils are associated with many neurodegenerative
diseases
including alzheimer s , parkinson s , and systemic amyloidosis .
it has recently been found that there is a reduced amount of hydrogen
sulfide ( h2s ) in the brain tissue of patients with alzheimer s
disease , leading us to investigate the
effects of h2s on the formation of amyloid fibrils .
our
objective was to utilize several complementary techniques , including
raman spectroscopy , afm , and intrinsic tryptophan and tht fluorescence
for studying the kinetics of hewl fibrillation , a well - characterized
model amyloidogenic protein , in the presence of h2s .
lysozyme
forms typical -sheet - rich fibrils after incubation in 20% acetic
acid solution at 60 c for approximately 70 min . the addition
of 12 mm h2s in a molar ratio of 5:1 ( h2s : hewl )
completely prevented the formation of the -sheet conformation
as measured by deep uv resonance raman ( duvrr ) spectroscopy and tht
fluorescence .
by contrast , the melting of the -helix resulted
in unordered protein in the form of spherical aggregates , which were
distinctly different from amyloid fibrils . according to the intrinsic
tryptophan fluorescence ,
hewl exhibited a more significant perturbation
of its tertiary structure in the presence of h2s than that
which occurred during the partial protein denaturation at the early
stage of fibrillation .
lysozyme has four ss bonds , which stay
intact during the fibrillation
process .
however , based on our data from nonresonance raman spectroscopy ,
ss bonds exhibit significant rearrangements in the presence of h2s .
the peak area of the 507 cm raman band
corresponding to the ss segment in the g - g - g conformation was reduced significantly , and a new band appeared
at 490 cm .
we assigned this new band to the sss
group based on previously reported data , the raman spectra we acquired
for model compounds , and lc - ms analysis of tcep reduction products .
cytotoxicity tests revealed that the spherical aggregates formed by
lysozyme in the presence of h2s are nontoxic to cells by
contrast with fibrils .
overall , we report for the first time
that h2s prevents
fibrillation of hewl in vitro and results in the
formation of small spherical aggregates of unordered protein .
we also
hypothesize that the mechanism of this h2s effect involves
the formation of sss bridges .
our findings that
h2s inhibits fibril formation and
that putative sss forms open a new and intriguing topic of biochemical
and biomedical research .
the fact that the spherical aggregates formed
are nontoxic to cells by contrast with fibrils is worth further investigation in vivo .
given that there are new drugs under development
for a slow release of h2s with a variety of therapeutic
targets , including s - sildenafil for urological conditions , s - diclofenac
for inflammation , s - latanoprost for neurodegenerative illnesses , s - levodopa
for parkinson s disease , and s - aspirin for cardiovascular conditions , our results suggest possible new roles of sss in vivo . | amyloid
fibrils are large aggregates of misfolded proteins , which
are often associated with various neurodegenerative diseases such
as alzheimer s , parkinson s , huntington s , and
vascular dementia .
the amount of hydrogen sulfide ( h2s )
is known to be significantly reduced in the brain tissue of people
diagnosed with alzheimer s disease relative to that of healthy
individuals .
these findings prompted us to investigate the effects
of h2s on the formation of amyloids in vitro using a model fibrillogenic protein hen egg white lysozyme ( hewl ) .
hewl forms typical -sheet rich fibrils during the course of
70 min at low ph and high temperatures .
the addition of h2s completely inhibits the formation of -sheet and amyloid
fibrils , as revealed by deep uv resonance raman ( duvrr ) spectroscopy
and tht fluorescence .
nonresonance raman spectroscopy shows that disulfide
bonds undergo significant rearrangements in the presence of h2s .
raman bands corresponding to disulfide ( rssr ) vibrational
modes in the 550500 cm1 spectral range
decrease in intensity and are accompanied by the appearance of a new
490 cm1 band assigned to the trisulfide group ( rsssr )
based on the comparison with model compounds .
the formation of rsssr
was proven further using a reaction with tcep reduction agent and
lc - ms analysis of the products .
intrinsic tryptophan fluorescence
study shows a strong denaturation of hewl containing trisulfide bonds .
the presented evidence indicates that h2s causes the formation
of trisulfide bridges , which destabilizes hewl structure , preventing
protein fibrillation . as a result , small spherical aggregates of unordered
protein form , which exhibit no cytotoxicity by contrast with hewl
fibrils
. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.