article stringlengths 0 826k | abstract stringlengths 174 4.34k |
|---|---|
mitral valve repair with artificial chordae is considered as a good choice for correcting mitral regurgitation ( mr ) caused by mitral valve prolapse due to chordal elongation or rupture .
the polytetrafluoroethylene ( ptfe ) suture has been applied as artificial chordae in large series with good outcomes . however , artificial chordae remains challenging for cardiac surgeon because of the difficulties in adjusting the accurate length of artificial chordae and tying the knot at the intended length .
nowadays , various techniques for making artificial chordae adjustment and tying knot have been reported , but the results are controversial . to overcome these two difficulties and improve the surgical outcomes , we applied a modified artificial chordae technique with ptfe suture in mitral valve repair for mr since 2006 . recently ,
the less invasive approach using right minithoracotomy ( rm ) has been applied increasingly , which has been proved to be a safe procedure with satisfactory outcomes in the mitral valve surgery
. however , the surgical exposure of rm for the operation of artificial chordae is not as good as that of traditional median sternotomy ( ms ) , which may affect the effect of mitral valve repair with artificial chordae . therefore , the aims of the present study were ( 1 ) to evaluate the early and long - term results of the modified artificial chordae technique and ( 2 ) to compare the outcomes of modified artificial chordae technique for treating mr through rm or ms approaches .
the study protocol was approved by the institutional review board in xinhua hospital , school of medicine , shanghai jiao tong university , and informed consent was obtained from all patients . from january 2006 to january 2015 , a total of 336 consecutive adult patients with mr underwent mitral valvuloplasty ( mvp ) in our hospital . among them , 118 patients underwent mvp with ptfe artificial chordae implantation through either rm ( n = 58 ) or ms ( n = 60 ) .
all patients underwent preoperative transesophageal echocardiography ( tee ) to determine the mechanism of mr and evaluate the degree of mr .
the degree of mr was graded based on the maximum length and width of the abnormal jet relative to the left atrium : none ( 0 ) , trivial ( + ) , mild ( + + ) , moderate ( + + + ) , or severe ( + + + + ) .
all 118 patients had severe mr and mitral valve prolapse due to chordal elongation or rupture .
valve lesions were posterior in 70 cases ( 59.3% ) , anterior in 32 cases ( 27.1% ) , and both anterior and posterior in 16 cases ( 13.6% ) . the preoperative associated diseases within these 118 patients are commonly involved hypertension ( 18 , 15.3% ) , diabetes mellitus ( 8 , 6.8% ) , cerebrovascular disease ( 6 , 5.1% ) , endocarditis ( 4 , 3.4% ) , renal dysfunction ( 4 , 3.4% ) , and chronic obstructive pulmonary disease ( 3 , 2.5% ) .
thirty - two ( 27.1% ) patients had more than mild tricuspid regurgitation ( tr ) preoperatively .
preoperative left ventricular ejection fraction ranged from 36% to 62% ( mean 53.1% 4.6% ) .
preoperative left ventricular end - diastolic diameter ( lvedd ) ranged from 45 mm to 69 mm ( mean 57.5 6.8 mm ) .
twenty - one patients ( 17.8% ) were in the new york heart association ( nyha ) functional class i , 58 patients ( 49.2% ) were in nyha functional class ii , 34 patients ( 28.8% ) were in nyha functional class iii , and 5 patients ( 4.2% ) were in nyha functional class iv .
the surgical procedure was performed with cardiopulmonary bypass ( cpb ) under moderate systemic hypothermia through either rm or ms .
intraoperative tee was routinely used to monitor the cardiac function , evaluate the mechanism of valve pathology and de - air the heart after the surgery . in the rm group ,
the patient was positioned supine with the right side elevated 30. a minimal right anterolateral thoracotomy was performed through the fourth intercostal space .
peripheral cpb was established through the femoral artery and femoral vein or right jugular vein . in the ms group , traditional cpb with aortic cannulation and vena cava return
was established after a standard sternotomy . after ascending aortic cross - clamping ( acc ) ,
mitral valve repair with artificial chordae and mitral annuloplasty were performed as following [ figure 1 ] : mitral valve was approached through left atriotomy or atrial septum incision .
first , mitral valve was examined carefully , especially the place of chordal elongation or rupture .
a double - armed ptfe suture was fixed at the papillary muscle head corresponding to the prolapsed area using
then , the needles were passed through the free edge of the prolapsing portion ( 35 mm from the margin ) twice from the ventricular side to the atrial side [ figure 1a and 1b ] . if the number of elongated or ruptured chordae was more than one or the prolapsed area was wide , 2 or 3 ptfe sutures
then , mitral annuloplasty was performed using an appropriate c - ring mitral prosthetics around the posterior leaflet [ figure 1c ] .
after that , the length of artificial chordae was adjusted by injecting cold saline into the left ventricle through mitral valve orifice until perfect coaptation of the mitral leaflet was obtained [ figure 1a ] .
both needles were passed through the edge of the prolapsing scallop one more time to prevent chordae moving when tying the knot .
finally , both arms of the artificial chordae were tied together [ figure 1c ] . before closing the left atrium ,
segmental resection of posterior leaflet will be applied to patients with significant posterior leaflet prolapse .
if the result of repair was not satisfactory , edge to edge technique would also be used .
( a ) modified artificial chordae technique ; ( b ) placing the suture on the head of the papillary muscle and the prolapsing portion of mitral leaflet ; ( c ) tying and cutting the knot after length adjustment ; ( d ) valve competency was tested again by injecting cold saline into the left ventricle after mitral valvuloplasty .
if the residual regurgitation was greater than mild mr , redo mitral valve repair or replacement was necessary . to prevent thrombosis after surgery
, warfarin was administered to patients for 6 months ( international normalized ratio 2.03.0 ) .
patients in - hospital data and follow - up data were collected from clinical and outpatient clinic files .
transthoracic echocardiography ( tte ) was performed at 6 and 12 months postoperatively and every year thereafter .
the statistical analysis was performed with the spss version 19.0 software program ( spss inc . ,
categorical variables were expressed as frequencies and proportions and are compared using the chi - square test or fisher 's exact test .
continuous variables were presented as mean standard deviations ( sds ) and were compared using the student 's unpaired t - test .
the freedom from more than moderate mr after mvp was determined by kaplan - meier methods and compared using the log - rank test .
the cox proportional hazards regression method was used to assess the relationship of clinical characteristics to the recurrence of more than moderate mr during follow - up .
the surgical procedure was performed with cardiopulmonary bypass ( cpb ) under moderate systemic hypothermia through either rm or ms .
intraoperative tee was routinely used to monitor the cardiac function , evaluate the mechanism of valve pathology and de - air the heart after the surgery . in the rm group ,
the patient was positioned supine with the right side elevated 30. a minimal right anterolateral thoracotomy was performed through the fourth intercostal space .
peripheral cpb was established through the femoral artery and femoral vein or right jugular vein . in the ms group , traditional cpb with aortic cannulation and vena cava return
was established after a standard sternotomy . after ascending aortic cross - clamping ( acc ) ,
mitral valve repair with artificial chordae and mitral annuloplasty were performed as following [ figure 1 ] : mitral valve was approached through left atriotomy or atrial septum incision .
first , mitral valve was examined carefully , especially the place of chordal elongation or rupture .
a double - armed ptfe suture was fixed at the papillary muscle head corresponding to the prolapsed area using
then , the needles were passed through the free edge of the prolapsing portion ( 35 mm from the margin ) twice from the ventricular side to the atrial side [ figure 1a and 1b ] . if the number of elongated or ruptured chordae was more than one or the prolapsed area was wide , 2 or 3 ptfe sutures
then , mitral annuloplasty was performed using an appropriate c - ring mitral prosthetics around the posterior leaflet [ figure 1c ] .
after that , the length of artificial chordae was adjusted by injecting cold saline into the left ventricle through mitral valve orifice until perfect coaptation of the mitral leaflet was obtained [ figure 1a ] .
both needles were passed through the edge of the prolapsing scallop one more time to prevent chordae moving when tying the knot .
finally , both arms of the artificial chordae were tied together [ figure 1c ] . before closing the left atrium ,
segmental resection of posterior leaflet will be applied to patients with significant posterior leaflet prolapse .
if the result of repair was not satisfactory , edge to edge technique would also be used .
( a ) modified artificial chordae technique ; ( b ) placing the suture on the head of the papillary muscle and the prolapsing portion of mitral leaflet ; ( c ) tying and cutting the knot after length adjustment ; ( d ) valve competency was tested again by injecting cold saline into the left ventricle after mitral valvuloplasty .
if the residual regurgitation was greater than mild mr , redo mitral valve repair or replacement was necessary .
to prevent thrombosis after surgery , warfarin was administered to patients for 6 months ( international normalized ratio 2.03.0 ) .
patients in - hospital data and follow - up data were collected from clinical and outpatient clinic files .
transthoracic echocardiography ( tte ) was performed at 6 and 12 months postoperatively and every year thereafter .
the statistical analysis was performed with the spss version 19.0 software program ( spss inc . ,
categorical variables were expressed as frequencies and proportions and are compared using the chi - square test or fisher 's exact test .
continuous variables were presented as mean standard deviations ( sds ) and were compared using the student 's unpaired t - test . the freedom from more than moderate mr after mvp was determined by kaplan - meier methods and compared using the log - rank test .
the cox proportional hazards regression method was used to assess the relationship of clinical characteristics to the recurrence of more than moderate mr during follow - up .
all patients successfully underwent mitral valve repair with artificial chordae and annuloplasty through rm or ms .
there were no significant differences in the baseline characteristics between rm group and ms group .
average 2.2 0.7 ( range from 1 to 3 ) ptfe artificial chordae were implanted per patient .
mean ring size was 29.2 1.8 mm ( range from 26 to 32 mm ) .
intraoperative tee showed no mr in 79 cases ( 66.9% ) , trivial mr in 32 cases ( 27.1% ) , and mild mr in 7 cases ( 5.9% ) .
there were no significant differences in cpb time , acc time , and early postoperative complications between the two groups [ table 2 ] .
however , compared with the ms group , the rm group had shorter postoperative ventilation time , hospital stay , and better cosmetic outcomes [ table 2 ] .
none or trivial mr was in 114 cases , and mild mr was in 4 cases [ table 2 ] .
postoperative tte showed that lvedd was significantly reduced at postoperative 6 months compared with the preoperative values ( 51.6 4.4 mm vs. 57.5 6.8 mm , t = 11.486 , p < 0.001 ) .
baseline characteristics in both rm and ms groups data are presented as n ( % ) or mean standard deviation .
copd : chronic obstructive pulmonary disease ; lvedd : left ventricular end - diastolic diameter ; lvef : left ventricular ejection fraction ; nyha : new york heart association ; / : not applicable ; rm : right minithoracotomy ; ms : median sternotomy .
perioperative results in both rm and ms groups data are presented as n ( % ) or mean standard deviation .
acc : aortic cross - clamp ; cpb : cardiopulmonary bypass ; / : not applicable ; rm : right minithoracotomy ; ms : median sternotomy ; mr : mitral regurgitation . at a mean follow - up of 44.8 25.0 months ,
complete follow - up data were available in 109 patients ( 109/118 , 92.4% ) . during the follow - up , one patient died from heart failure .
none or trivial mr was in 89 cases ( 81.7% ) , mild mr was in 12 cases ( 11.0% ) , moderate mr was in 4 cases ( 3.7% ) , and severe mr was in 4 cases ( 3.7% ) .
four patients with recurrent severe mr received late mitral valve replacement and one patient died from multiple organ failure . for 107 survival patients with complete follow - up , 92 patients ( 86.0% ) were in nyha functional class i , 13 patients ( 12.1% ) were in nyha functional class ii , and 2 patients ( 1.87% ) were in nyha functional class iii . for the overall group , the freedom from more than moderate mr at 1 , 3 ,
5 years postoperatively was 97.5% 1.5% , 94.3% 2.3% , and 90.9% 3.3% , respectively .
the freedom from more than moderate mr at 1 year postoperatively was 96.6% 2.4% in rm group and 98.3% 1.7% in ms group .
the freedom from more than moderate mr at 3 years postoperatively was 93.9% 3.5% in rm group and 94.8% 2.9% in ms group .
the freedom from more than moderate mr at 5 years postoperatively was 90.1% 5.0% in rm group and 91.8% 4.1% in ms group .
log - rank test showed that there was no significant difference between the two groups regarding the freedom from more than moderate mr during follow - up ( = 0.247 , p = 0.619 ) [ figure 2 ] .
cox regression analysis showed that the presence of mild mr at discharge was the independent risk factor for the recurrence of more than moderate mr during follow - up [ hazard ratio 3.329 , 95% confidence interval 0.63710.809 ; table 3 ] .
however , both anterior and posterior leaflet prolapse , preoperative lvedd 65 mm , and preoperative significant tr were not an independent risk factor for recurrent significant mr . the freedom from more than moderate mitral regurgitation after mitral valvuloplasty of the two groups .
cox regression analysis ci : confidence interval ; hr : hazard ratio ; lvedd : left ventricular end - diastolic diameter ; tr : tricuspid regurgitation ; mr : mitral regurgitation .
mvp has become the first treatment choice for patients with mr , and various techniques have been reported in the recent years . among them , mitral valve repair with artificial chordae is considered to be the best method to correct mr due to chordal elongation or rupture . since chordal replacement with ptfe suture was introduced , it has been widely adopted and the outcomes are satisfactory . however , there are still two major problems affecting the results of artificial chordal technique for treating mr .
one is adjusting the accurate length of artificial chordate , and the other is tying the knot at the intended length . at present ,
cagli described a technique of making chordal loops using hegar dilators and represented tailoring of this technique to the preparation of two connected sets of chordal loops of different predetermined lengths for repair of bileaflet prolapse of opposing segments .
chang and kao reported another method using a slit plastic tube for stenting the artificial chordae at the intended length .
in addition , moorjani et al . developed a single - loop technique , which provided a simple , reproducible method for adjusting neochordal length to ensure valvular competency .
however , some techniques are unfit for minimally invasive mitral valve repair because of the complicated practical operation . determining the correct length of artificial chordate and tying the knot at the intended length remain problematic during mitral valve repair through rm . in 1991 , david et al .
reported a simple artificial chordae technique with satisfactory outcomes : a double - armed suture was passed twice through the fibrous portion of the papillary muscle head and tied down .
then , each arm of the suture was passed through the free margin of the leaflet .
after the length of the two arms was adjusted , the ends were tied together on the ventricular side of the leaflet . according to david 's method , we modified the technique and applied it to correct mitral valve prolapse since 2006 .
there are several precautions in our modified technique as following : ( 1 ) placing the suture on the head of the papillary muscle and the prolapsing portion of mitral leaflet was performed before the remodeling annuloplasty , but adjusting the length of chordae and tying the knot are performed after annuloplasty .
one reason is that the exposure of papillary muscle before annuloplasty is better than that after annuloplasty .
another reason is that subsequent annuloplasty will affect the correct length of chordae , if length adjustment is earlier than remodeling annuloplasty .
the ptfe suture could be pulled easily without the pledget , which is beneficial to adjust the length of artificial chordae .
( 3 ) each ptfe artificial chordae was sutured in the edge of valve leaflet for twice at the time of adjusting chordae length , but three times at the point of tying the knot .
only double - layer suturing is convenient for surgeon to slide and pull the suture , which is beneficial for length adjustment . whereas chordae could be fixed more firmly with three times suturing so that the artificial chordae was not easy to slide or shift when tying the knot .
( 4 ) because most patients had annulus dilatation , especially in the posterior annulus , c - ring mitral prosthetics was implanted for each patient in the present study . at present , several studies have shown the early or long - term outcomes of mitral valve repair , but most studies reported the results as cumulative data without the specificity of the technique of artificial chordae . in the present study , we described the modified technique of artificial chordae and reported the early and long - term outcomes . in our series , we performed the modified artificial chordae technique in 118 patients with severe mr and mitral valve prolapse .
intraoperative tee showed no mr in 79 cases ( 66.9% ) , trivial mr in 32 cases ( 27.1% ) , and mild mr in 7 cases ( 5.9% ) .
no patients required mitral valve replacement or redo - repair during the surgery . at discharge
, tte showed that only four patients had mild mr . at a mean follow - up of 44.8 25.0 months ,
the freedom from more than moderate mr at 1 , 3 , 5 years postoperatively was 97.5% 1.5% , 94.3% 2.3% , and 90.9% 3.3% for the overall group , respectively .
the early and mid - term outcomes of mvp with our modified method are satisfactory in our institute , and these are comparable to those reported in literature .
therefore , we concluded that our modified technique was a simple , safe , and effective for correcting severe mr associate with mitral valve prolapse .
rm has been proven to be a safe and effective approach for mitral valve surgery .
currently , a few of studies have reported the outcomes of artificial chordae technique for mr through rm , but the differences of artificial chordae technique between rm and ms were seldom reported . in our series ,
118 adult patients received mitral valve repair with artificial chordae and annuloplasty for mr . among them , 58 patients received mvp through rm , and mvp was performed through ms in other sixty cases .
there was no significant difference between the two groups with regard to the freedom from more than moderate mr .
in addition , there were no significant differences in cpb time , acc time , and early postoperative complications between the two groups ; however , the rm group had shorter hospital stay and ventilation time compared with the ms group .
therefore , we concluded that rm could achieve the similar therapeutic effects with ms for the patient who received modified artificial chordae technique for treating mr
. different approach of thoracotomy was not a risk factor for the recurrent significant mr .
previous studies have shown that mvp without annuloplasty ring , more than mild mr at discharge , preoperative significant tr , preoperative left ventricle dilation with lvedd > 65 mm , anterior leaflet prolapse , or both anterior and posterior leaflet prolapse may be the risk factors for recurrent significant mr . in our institute , annuloplasty ring was applied as a standard technique for mv repair with artificial chordae , which may be one important factor responsible for the satisfactory outcomes . according to the cox regression analysis , the presence of mild mr at discharge was the independent risk factor for the recurrent significant mr at follow - up in our study . to avoid the presence of mild mr at discharge ,
reasonable perioperative treatment is the most important cornerstone that including : ( 1 ) individualized surgical technique is the key to successful surgical therapy .
if the residual mr was greater than mild , redo mitral valve repair or replacement would be necessary .
however , redo mitral valve surgery would not be performed for patients with residual mild mr during the surgery in operation room because the second run of cpb would be more life - threatening than the mild mr . besides , mild mr might be relieved in the early postoperation after medical therapy in some patients .
( 3 ) reduced postoperative cardiac preload is also one important cornerstone of successful therapy for patients with mvp , which could avoid the tear of leaflet or chordae induced by abnormal heart contraction .
therefore , diuretics and vasodilators therapy is recommended to these patients in the early postoperative . in this study ,
intraoperative tee showed that seven patients had residual mild mr on leaving the operation room .
however , three of these four patients developed to significant mr during the follow - up .
further studies are necessary to investigate the mechanism of recurrent significant mr related to residual mild mr at discharge .
there are few limitations in this study . first , this was a retrospective analysis and thus had some inherent limitations .
second , our series were small size . whether our method had a satisfactory recovery , it was still be confirmed by more cases .
third , most patients preferred to choose mitral valve replacement rather than mvp in china because of personal economic problems .
some mr patients with severe mitral valve lesions underwent mitral valve replacement directly without trying to receive mvp in our institute , which might also have a good effect on our outcomes . in conclusion
, rm can achieve the similar therapeutic effects with ms for the patients who received modified artificial chordae method for treating mr .
| background : right minithoracotomy ( rm ) has been proven to be a safe and effective approach for mitral valve surgery , but the differences of artificial chordae technique between rm and median sternotomy ( ms ) were seldom reported . here , we compared the outcomes of modified artificial chordae technique for mitral regurgitation ( mr ) through rm or ms approaches.methods:one hundred and eighteen consecutive adult patients who received mitral valve repair with artificial chordae and annuloplasty for mr through rm ( n = 58 ) or ms ( n = 60 ) from january 2006 to january 2015 were analyzed.results:all of the selected patients underwent mitral valve repair successfully without any complication during the surgery
. there was no significant difference between rm group and ms group in cardiopulmonary bypass time , aortic cross - clamp time , and early postoperative complications .
however , compared with the ms group , the rm group had shorter hospital stay and faster surgical recovery . at a mean follow - up of 44.8
25.0 months , the freedom from more than moderate mr was 93.9% 3.5% in rm group and 94.8% 2.9% in ms group at 3 years postoperatively .
log - rank test showed that there was no significant difference in the freedom from recurrent significant mr between the two groups ( 2 = 0.247 , p = 0.619 ) .
multivariate analysis revealed that the presence of mild mr at discharge was the independent risk factor for the recurrent significant mr.conclusion:right minithoracotomy can achieve the similar therapeutic effects with ms for the patients who received modified artificial chordae technique for treating mr . |
bone mass loss and muscle atrophy are the frequent complications occurring after spinal cord injury ( sci).12 although unloading is an important factor in the pathogenesis of bone loss in sci patients , neuronal lesion and hormonal changes also seem to be involved in this process.3 inactivation and extreme unloading in sci patients result in marked atrophy of the leg and thigh skeletal muscles within a few months of the injury.4 accurate quantification of skeletal muscle is important in the assessment of nutritional status , disease risk , physical function and atrophic effects of aging and muscle wasting diseases.5 the potential risks involved with these changes in the body composition have implications for the health of the sci individual.6 thus , there is a need to quantitate and monitor body composition changes accurately in an individual with sci .
body mass is composed primarily of bone mineral , fat and fat free soft tissue [ lean body mass ( lbm ) ] . skeletal muscle is the largest component of fat free mass , representing 50% of the non fat component in the body.7 although dual - energy x - ray absorptiometry ( dexa ) was first developed to measure bone mineral content ( bmc ) , it has been shown to be one of the most feasible , valid and reliable measures of body composition in people with disabilities.8910 very few longitudinal studies have been reported in the literature to assess body composition and most include relatively small number of patients.41011 the present prospective study aimed to evaluate the body composition changes longitudinally by dexa in patients with acute sci .
this prospective , longitudinal study was carried out on 106 patients ( 79 males and 27 females ) with acute sci with neurological deficit who were admitted at our tertiary level health care institute .
only patients with grade a or b injury on the american spinal injury association impairment scale ( ais)12 at the time of presentation to the institute and those presenting within 72 h of injury were enrolled in the study . during the initial evaluation and final followup at 1 year ,
11 patients expired ; therefore , the final data analysis included 95 patients ( 71 males and 24 females ) .
the mean age of the patients was 33.3 years ( range 19 - 60 years ) .
majority of patients were adults below 50 years and only nine patients were aged above 50 years .
socio - demographic characteristics of the study population ( n = 95 ) written consent was obtained from all patients .
bmc and body composition ( lbm and fat mass ) were measured with dexa scan using hologic qdr-2000 explorer ( hologic inc . ,
the patients were asked to lie on a table and whole body scanning was carried out with a congruent beam of stable dual - energy radiation .
dexa provides a three compartment partition of the body : bone mineral , fat mass and fat free mass .
after completion of scan , the body composition results ( region wise and total body ) are provided by the system 's software ( bmc , lbm , fat , lean + bmc , total mass , % fat ) .
followup of all the above mentioned parameters was done at 3 , 6 , and 12 months .
the patients showing no signs of motor recovery during the course of the study were considered as motor complete ( aisa a and b ) ( n=41 ) , and those patients showing signs of motor recovery during the study period were considered as motor incomplete ( aisa c and d ) ( n=54 ) [ table 1 ] .
those patients who were fit for surgery and had unstable spine were preferably stabilized with a pedicle screw fixation .
seventy four patients ( 77.9% ) were managed conservatively and 21 ( 22.1% ) patients were operated .
a standard protocol of early rehabilitation of patients like mobilization , promotion of exercises and gait training was followed . at the end of 1 year , post
unpaired t - tests were performed to determine group differences and paired student 's t - tests were used to determine significant differences within the pairs .
relationship between various parameters of body composition were calculated using pearson 's correlation ( r ) .
the procedures followed were in accordance with the ethical standards of the institutional committee on human experimentation .
unpaired t - tests were performed to determine group differences and paired student 's t - tests were used to determine significant differences within the pairs .
relationship between various parameters of body composition were calculated using pearson 's correlation ( r ) .
the procedures followed were in accordance with the ethical standards of the institutional committee on human experimentation .
the data in this section show comparison of values at the time of presentation and after 1 year of injury .
as some differences in the values between the right and left sides of the body were found , the values from the right and left sides of the body were pooled to derive the mean values .
bmc was found to be significantly lower ( p < 0.05 ) in sublesional sites .
there was an average of 14.5% decrease in bmc in the lower extremities [ figure 1 ] . in tetraplegics , arm and leg
, there was 15% decrease in leg bmc , but the arm bmc decreased by 3.6% only .
the decrease in arm bmc was more in tetraplegics as compared to paraplegics , and it was statistically significant . in operated patients , there was 21.6% decrease ( p < 0.05 ) in leg bmc , but the decrease of bmc in arms was not significant .
there was an average of 13.3% decrease in the bmc of lower extremities in nonoperated patients , which was statistically significant , whereas upper limbs showed a decrease of 6.2% in bmc .
an average decrease of 14.1% ( p < 0.0001 ) in leg bmc and 7% in arm bmc was observed in patients with complete sci [ table 2 ] .
bone mineral content in spinal cord injury patients ( total ) mean values of bmc ( in grams ) in tetraplegic vs. paraplegic , operated vs. nonoperated and motor complete versus motor incomplete patients at 3 , 6 and 12 months followup there was an average of 20.5% loss of lbm in legs ( p < 0.05 ) and 15.1% loss of lbm in trunk ( p < 0.05 ) .
tetraplegic patients had significant decrease in lbm , with an average 21.5% loss of lbm in legs and 10.3% loss of lbm in trunk .
values of lbm in paraplegic patients were 20.2% less in legs ( p < 0.05 ) and 8.2% less in arms ( p < 0.05 ) [ figure 2 ] .
significant decrease was observed in the lbm of lower extremities and trunk in operated patients , with 24.7% decrease in legs and 17.3% decrease in trunk [ table 3 ] .
significant decrease in lbm was observed in nonoperated patients at lower extremities and trunk , with an average of 19.1% decrease in legs and 14.1% decrease in the trunk .
there was 23.4% decrease in lbm of legs at 1 year ( p < 0.05 ) .
motor incomplete patients had significant decrease in lbm of lower extremities and trunk , with an average decrease of 16.6% in lower extremities and loss of 13.3% lbm in trunk [ table 3 ] .
lean body mass in spinal cord injury patients ( total ) mean values of lean body mass in tetraplegic vs. paraplegic , operated vs. nonoperated , and motor complete vs. motor incomplete patients at 3 , 6 , and 12 months followup there was 0.2% increase in fat mass in legs ( statistically nonsignificant ) .
there was significant increase in fat mass in the upper extremities in tetraplegics , with 10.6% increase in fat mass ( p < 0.05 ) and 9.7% increase in trunk fat [ figure 3 ] . in paraplegics ,
there was 3.1% increase in fat mass in legs ( nonsignificant ) , but trunk fat had statistically significant increase of 9.0% .
fat mass increased by 11.7% in trunk ( p < 0.05 ) and 14% in lower extremities in operated patients [ table 4 ] , and nonoperated patients had 2.3% increase in fat mass in trunk and 5% increase in fat mass in the lower extremities .
there was 7.5% increase in fat mass in the legs of patients with complete motor injury and 4.3% increase was seen in the upper extremities ; however , it was not statistically significant .
there was 8% decrease in fat mass in the legs of patients with incomplete motor injuries and a decrease of 4.2% was seen in the values of trunk [ table 4 ] .
fat in spinal cord injury patients ( total ) mean values of fat mass in tetraplegic vs. paraplegic , operated vs. nonoperated , and motor complete vs. motor incomplete patients at 3 , 6 , and 12 months followup significant increase ( trunk p = 0.003 ; legs p <
tetraplegic patients had significant increase in the fat percentage of arms , trunk , and legs .
difference in the percentage fat of arm , trunk , and leg in operated patients was 2.8% , 1.1% , and 6.1% , respectively .
difference in the percentage fat of arm , trunk , and leg in nonoperated patients was 2.4% , 2.1% , and 5% , respectively . in patients with complete injury , percentage fat increase was 5.7% in legs , 1.5% in trunk , and 2.4% in upper extremities .
in patients of incomplete injury , percentage fat increase was 4.6% in legs , 2.4% in trunk , and 2.6% in upper extremities [ table 5 ] .
values of percentage fat in tetraplegic vs. paraplegic , operated vs. nonoperated , and motor - complete vs. motor - incomplete patients at 3 , 6 , and 12 months follow up arm bmc and arm lean tissue mass were significantly related within groups of tetraplegics ( r = 0.521 , p < 0.05 ) and paraplegics ( r = 0.732 , p < 0.001 ) [ figure 4 ] .
moderate to strong relationship was found between leg bmc and leg lean tissue mass in patients with incomplete injuries ( r = 0.565 , p < 0.001 ) . however , the relationship was not significant in motor - complete injuries ( r = 0.055 , p > 0.05 ) [ figure 5 ] .
significant correlation was not observed between body fat percentage and bmi in the present study [ figure 6 ] .
relationship of arm bone mineral content ( bmc ) with arm lean tissue mass for tetraplegia and paraplegia ( tetraplegia : r = 0.521 , p < 0.05 ; paraplegia : r = 0.732 , p < 0.001 ) relationship of leg bmc with leg lean tissue mass for those with complete or incomplete sci ( complete : r = 0.055 ,
p > 0.05 ; incomplete : r = 0.565 , p < 0.001 ) relationship of total body fat percent with body mass index for spinal cord injuries at l year ( sci : r = 0.19 , p > 0.05 )
we found a significant decrease in bmc at sublesional sites , 1 year after sci ( up to 16.9% linear decrease in lower extremities ) .
reported 25% lower bmc of the femoral neck and shaft and > 50% lower value for the proximal tibia than the normal value.13 patients with cervical lesions had lower bmc values in the femoral bones than those with thoracic lesions.13 in 1990 , biering - sorensen et al . reported that bmc of the lower extremities decreased after injury , reaching new steady - state levels at 40 - 50% and 60 - 70% for proximal tibia and femoral neck , respectively , at about 2 years post injury.14 wilmet et al . observed a rapid decrease of bmc in the paralyzed areas , of approximately 4% per month during the first year in areas rich in trabecular bone and 2% per month in areas containing mainly compact bone.10 mcdonald et al . also observed 40% lower bmc in legs in paraplegic patients ( p < 0.0001 ) , while tetraplegics had significantly less bmc in the arms ( 25% ; p < 0.0001 ) , legs ( 46% ; p <
0.0001 ) and trunk ( 30% ; p < 0.0001).11 in the present study , the tetraplegic patients had significantly lower ( p < 0.05 ) arm bmc compared with paraplegic patients , whereas bmc in the leg , trunk , and total body was not significantly different between the two groups .
these observations are similar to the findings of spungen et al.9 and mcdonald et al.11 wilmet et al.10 reported that complete motor paralysis was associated with greater bone loss , and in patients who were likely to recover , a program of prevention of bone loss should be instituted early in the course of disease.10 this was not seen in the present study .
we observed dramatic loss of lbm below the level of the lesion in all patients ( up to 22.6% loss of lbm of lower limbs ) .
reported 15% loss of lean mass in the lower limbs in the first year after sci.10 jones et al . also reported significant reduction in lean tissue mass ( 16% less ) and bone ( 12% less ) in those with sci , in comparison to the control group.15 in a study by mcdonald et al .
, lean tissue mass was 38% less in legs and 11% less in trunk in the paraplegia group and 35% less in arms and 37% less in legs in the tetraplegia group.11 similarly , spungen et al
. also reported significant loss of lean tissue mass in both the tetraplegic and paraplegic groups than in the controls.9 the possible reason for the decrease in lbm in the arms of paraplegics can be the higher amount of absolute fat mass in the arms and sacropenia observed after sci .
castro et al . observed significantly decreased cross sectional area of the muscles of legs and thighs at 6 months of sci on magnetic resonance images.4 modlesky et al .
also reported a disproportionate loss of muscle in the paralyzed thighs after sci , relative to the other nonfat constituents.16 similar to spungen et al .
's findings , we observed significantly lower arm lean mass in tetraplegics.9 mcdonald et al . also reported 36% less lbm in arms ( p < 0.0001 ) and 16% less lbm in trunk ( p < 0.05 ) in the tetraplegic group than in the paraplegic group.11 a potential reason for the significant difference observed between the paraplegic and tetraplegic groups could be that the subjects with paraplegia are likely to use their arms for the activities of daily living such as pushing a wheel chair , while the subjects in the tetraplegic group would not place these exercise demands on their arms .
we observed up to 18.2% decrease in lbm of the lower limbs in patients with incomplete injuries , as compared to 25.9% in those with complete injuries ( p < 0.05 ) , as also reported by spungen et al.9 arm bmc and arm lean tissue mass were significantly related [ figure 4 ] within the groups of tetraplegia ( r = 0.521 , p < 0.05 ) and paraplegia ( r = 0.732 , p < 0.001 ) in the present study .
similar findings were also observed by spungen et al.9 moderate to strong relationship [ figure 5 ] was found between leg bmc and leg lean tissue mass in patients with incomplete injuries ( r = 0.565 , p < 0.001 ) in the present study ; however , the relationship was not significant in motor complete injuries ( r = 0.055 , p > 0.05 ) .
similar findings were observed by spungen et al . , who found a moderate to strong co - relationship between leg bmc and leg lean tissue mass in the control group ( r = 0.86 , p < 0.0001 ) and the incomplete sci group ( r = 0.74 , p
< 0.0001 ) , whereas the relationship was weak in the complete sci group ( r = 0.25 , p = 0.01).9 in subjects with complete sci , a much weaker relationship was noted between these variables , as might have been expected in the absence of function and gravity bearing activity .
moreover , complete motor paralysis is associated with greater bone loss in the denervated extremities than in those with incomplete lesions.9 mcdonald et al . concluded in their study that the total lean tissue was highly correlated to the total bmc in the sci group and the control group.11 castro et al . suggested that there was massive loss of contractile protein early after sci , while the mechanisms responsible for loss of muscle size were not clear
it was suggested that the development of muscular imbalance as well as diminution of muscle mass would compromise the force potential early after sci.5 we observed minor increase in the fat mass at 1 year .
bauman et al . also reported the absolute leg fat to be similar in sci and non - sci twin.17 we observed a significant increase ( p < 0.05 ) in fat mass in the upper limbs of tetraplegics compared to paraplegics , whereas spungen et al .
observed significantly higher fat in the arm and leg in both tetraplegia and paraplegia groups in comparison to the control group , but the difference between tetraplegia and paraplegia groups was insignificant.9 mcdonald et al . reported that paraplegia group had 28% more fat mass in legs ( p < 0.02 ) and 35% more fat mass in trunk ( p < 0.04).13 the paraplegia group had 38% more fat in legs and 39% more total body fat than the tetraplegia group.11 similar to spungen et al
's findings , we also found higher absolute fat mass in groups with complete injury than in incomplete injury group.9 we observed even a decrease in fat mass in the lower extremities and the trunk in patients with motor incomplete injuries .
this may be due to more active rehabilitation of patients in motor incomplete group as they had incomplete injuries .
contrary to the expected findings , we also found higher fat mass increase in the trunk and legs in operated patients compared to those managed conservatively .
changes in fat mass may be variable and dependent on the interaction of different patient - specific variables , e.g. advancing age has been associated with less lean mass and increased fat mass in individuals with sci .
the activity levels may also play an important role.18 we observed 19.3% increase in the fat percentage in lower limbs and this might be related to muscle atrophy , which results in apparent increase in percentage fat in legs .
tetraplegics had 31.4% more increase in fat percentage than paraplegics in the upper extremities . in patients of complete injury ,
fat percentage was 16.67% more in trunk and 35.2% more in arms when compared to those with incomplete injury .
mcdonald et al . reported in their study that paraplegia group had 36% higher trunk fat percentage ( p < 0.001 ) , 60% higher leg fat percentage ( p
< 0.0001 ) , and 37% higher total body fat percentage , as compared to the control group.11 dopler - nelson et al . reported that more than 90% of obese sci subjects from a regional sci clinic met the criteria for metabolic syndrome , which puts them at risk for type ii diabetes , cardiovascular disease and stroke .
identification of obese patients at risk for metabolic syndrome using easily obtainable clinical criteria for obesity should be a high priority for clinical care.19 recently , it has been shown that many of the disorders associated with obesity occur prematurely and at a higher prevalence in the population with sci than in the able bodied population .
adults with sci have higher rates of carbohydrate intolerance , insulin resistance,2021 lipid abnormalities2223 and heart disease24 than the able bodied population is likely to have , and these factors may contribute to the reduced lifespan of individuals with sci .
low - energy fractures have been reported to occur in individuals with sci during events that would not normally cause fractures , such as a transfer from a bed to chair , or being turned in bed.25 complications related to fractures in sci population present additional source of morbidity.1 by estimating the body composition in the patients with sci , appropriate steps can be taken up early to minimize the effects and risks of the diseases , thus reducing the morbidity and mortality in this subset of the population .
not much significant correlation was found between the body fat percentage and bmi in the present study [ figure 6 ] .
demonstrated in their study that correlation between bmi and total body fat percentage was statistically significant ; however , in their study , the duration of injury was around 10 years and fat mass had increased with increased duration of injury.9 mcdonald et al .
reported that changes in the body composition observed in the subjects with sci had profound effects on the relationship between bmi and total fat percentage , as compared to the control subjects.11 they suggested that due to these alterations in body composition , bmi significantly underestimates the level of obesity in individuals .
findings of the present study may be explained on the basis of low bmi , dietary habits and low fat mass in the asian population .
further research is needed in this field to define new standards of obesity in the sci population .
majority of patients were adults below 50 years and this might have negated this confounding variable to some extent .
the inclusion of large number of patients in the present study might have negated this confounding variable to some extent .
we conclude that patients with sci not only lose motor and/or sensory functions , but also may experience dramatic muscle and bone changes during the first year of sci .
these adverse body composition and bone changes may negatively impact body metabolism , which may increase the risks of microvascular diseases and fractures .
it will be prudent to take measures like early mobilization , rehabilitation and specific interventions to prevent bone loss and deterioration in body composition early in the course of the sci . | background : bone mass loss and muscle atrophy are the frequent complications occurring after spinal cord injury ( sci ) .
the potential risks involved with these changes in the body composition have implications for the health of the sci individual .
thus , there is a need to quantitate and monitor body composition changes accurately in an individual with sci .
very few longitudinal studies have been reported in the literature to assess body composition and most include relatively small number of patients . the present prospective study aimed to evaluate the body composition changes longitudinally by dexa in patients with acute sci.materials and methods : ninety five patients with acute sci with neurological deficits were evaluated for bone mineral content ( bmc ) , body composition [ lean body mass ( lbm ) and fat mass ] by dual - energy x - ray absorptiometry during the first year of sci.results:there was a significant decrease in bmc ( p < 0.05 ) and lbm ( p < 0.05 ) and increase in total body fat mass ( tbfm ) and percentage fat at infra - lesional sites .
the average decrease was 14.5% in bmc in lower extremities , 20.5% loss of lbm in legs and 15.1% loss of lbm in trunk , and increase of 0.2% in fat mass in legs and 17.3% increased fat in the lower limbs at 1 year .
the tetraplegic patients had significant decrease in arm bmc ( p < 0.001 ) , arm lbm ( p
< 0.01 ) and fat percentage ( p < 0.01 ) compared to paraplegics .
patients with complete motor injury had higher values of tbfm and fat percentage , but comparable values of bmc and lbm to patients with incomplete motor injury.conclusions:our findings suggest that there is a marked decrease in bmc and lbm with increase in adiposity during the first year of sci .
although these changes depend on the level and initial severity of lesions , they are also influenced by the neurological recovery after sci . |
feeling stigmatized is common among those living with mental illness.15 around the world many people with mental illness are discriminated against , have restricted work opportunities , feel stigmatized at work,68 and are even denied the basic rights afforded to other members of society.9 where studies have been conducted in the western world , it appears that the majority of the public,3,10 from children and adolescents,11 to mental health professionals,1214 and even family members15 hold stigmatizing attitudes towards those with mental illnesses . understandably , this social derision and intolerance may produce feelings of helplessness , apathy , denial , and shame in those affected.5,8,16,17 recent research even shows that social stigma can be internalized , whereby a person starts to believe that the social stigma is an accurate reflection of themselves , and this self - stigma is evident in many patients with severe mental illness.1820 for some or all of these reasons
, a person with a mental illness may be less likely to seek treatment and/or have an increased likelihood of relapse,2,2123 in effect aiding the perpetuation of social stigma.5 within the last two decades , combating and reducing worldwide stigma towards mental illness has become a major movement in the field of psychiatry .
this has led ultimately to the development of international programs designed to raise awareness and to find ways of remedying the problem .
the global program to fight stigma and discrimination because of schizophrenia , more commonly known as the open - the - doors program , as well as the world psychiatric association s scientific section on stigma and mental health are two major undertakings around the world working towards this end.24,25 over 21 countries are now part of this network , with large , multilevel initiatives designed to bring awareness and understanding of mental illnesses to the public , in an effort to reduce stigma.24,25 although these programs and initiatives are rooted in combating the widespread social stigma which exists regarding schizophrenia,26,27 a general discriminatory attitude is persistent with most mental illnesses.28 bipolar disorder is a common29 debilitating mental illness associated with significant burden,30 and is among the top ten leading causes of disability worldwide.8 therefore , in this study , we aimed to look at the social stigma surrounding bipolar disorder ( both i and ii ) in a cross - cultural manner .
few studies have looked at stigma in patients with bipolar disorder , but there is recent evidence to suggest that they are stigmatized in society,15,26,31 and that these patients perceive themselves as being stigmatized.3234 clearly , this can affect their recovery.35 in patients exhibiting acute symptoms , those who were more concerned about the effects of stigma were also more likely to report impaired social adjustment 7 months later , compared with those who viewed stigma as less important in their lives.35 consequently , while education of the public is imperative in the long - term goals towards ending stigma , it is also vital to uncover the extent to which persons dealing with mental illness are affected , and what impact this has on their lives and daily functioning . in this study , we used a standardized questionnaire , ie , the inventory of stigmatizing experiences ( ise ) which documents both a person s experiences with stigma using a stigma experiences scale ( ses ) and the impact this stigma has had on their lives using a stigma impact scale ( sis ) , as well as general social characteristics.4,34 the ise appears to be a reliable and valid inventory of stigma , and can be used as an effective tool in measuring stigma from a patient s perspective .
the goals of this study were essentially three - fold : to validate the ise for a population of patients with bipolar i or ii disorder living in argentina ; to identify differences in the experiences and impact of stigma between patients with bipolar i or ii disorder using standardized ise measures ; and to compare the results obtained in this argentinean population with those in a canadian population of patients with bipolar disorder,34 in an effort to uncover any cross - cultural differences .
we hypothesized that patients with bipolar i disorder would be impacted more from stigma than those with bipolar ii disorder due to the presence of manic or mixed episodes in those suffering from bipolar i disorder .
a recent study found that there was significantly more caregiver stigma toward patients with bipolar i disorder.15 additionally , we hypothesized that while the argentinean population may experience similar stigmatizing events , they may not be as impacted as the canadian population , perhaps due to the greater role of family care and support found in latin american countries ( similar to spain ) . in a cross - cultural study of european countries , spaniards with bipolar disorder reported feeling less stigmatized than patients with bipolar disorder in other european countries , including france , the netherlands , and scotland.33 the authors do not make inferences from their data as to why this might be the case ; however , it is possible that cultural differences play a role . additionally , the sample was younger , with relatively low unemployment , and had more access to psychoeducation in comparison with the other countries studied .
we predicted that we would find less stigma in the argentinean population as compared with the canadian population .
they were recruited through an outpatient research program of the argentine network for bipolar disorders which includes 11 specialized third level mood disorder clinics throughout argentina .
the centers included five public psychiatric hospitals ( two in buenos aires , and one each in cordoba , formosa , and jujuy ) and six private outpatient clinics ( three in buenos aires , and one each in la plata , mar del plata , and mendoza ) .
a diagnosis of bipolar i or ii disorder was established using the structured clinical interview for diagnostic and statistical manual of mental disorders , 4th edition ( dsm - iv ) , patient edition , administered by psychiatrists experienced in affective disorders .
exclusion criteria included age less than 18 years , any significant medical illnesses , severe axis ii personality disorder , presence of suicide risk at the time of evaluation , and substance abuse disorder as the primary diagnosis .
all patients met the clinical criteria for euthymia , defined as a score 9 on the young mania rating scale score and a score 12 on the 17-item hamilton depression rating scale at the time of assessment .
the canadian component of this study was drawn from a population of patients whose demographic information has been published in a recent study.34 briefly , this population was a convenience sample and all participants meeting the dsm - iv criteria for bipolar disorder were included . after a full description of the study procedures , written informed consent was provided by all subjects .
based upon previous work,4 participants in argentina were asked to complete a translated version of the ise , including the ses and sis .
the complete inventory was translated from english into spanish by one of the authors ( gv ) . using professional argentinean translators ,
this spanish version was then back translated,36 and subsequently approved by one of us ( gv ) .
this translated scale has also been used and published recently,31 and in our study was administered to patients in the form of interviews or take - home pages .
all statistical analyses were conducted on pasw version 18 for windows ( ibm corporation , armond , ny ) .
measures to test internal consistency were performed for both ses and sis using the kuder - richardson coefficient of reliability ( kr-20 ) and cronbach s alpha reliability coefficient , respectively .
chi - square analyses were completed on frequency scores ( gender , level of highest education , employment , marital status , frequency of outpatient care , and acceptance of diagnosis ) , while t - tests or mann - whitney u tests were performed on mean scores ( age , number of years ill , years between first symptoms and treatment , and in assessing differences between ses and sis scores ) . where data were not normally distributed and did not have equal variance , nonparametric tests were performed .
a two - step forced entry multiple regression was also performed ( using variables which differed significantly between the two populations as predictor variables ) in order to examine systematic differences between ses and sis scores in the canadian and argentinean patient populations .
they were recruited through an outpatient research program of the argentine network for bipolar disorders which includes 11 specialized third level mood disorder clinics throughout argentina .
the centers included five public psychiatric hospitals ( two in buenos aires , and one each in cordoba , formosa , and jujuy ) and six private outpatient clinics ( three in buenos aires , and one each in la plata , mar del plata , and mendoza ) .
a diagnosis of bipolar i or ii disorder was established using the structured clinical interview for diagnostic and statistical manual of mental disorders , 4th edition ( dsm - iv ) , patient edition , administered by psychiatrists experienced in affective disorders .
exclusion criteria included age less than 18 years , any significant medical illnesses , severe axis ii personality disorder , presence of suicide risk at the time of evaluation , and substance abuse disorder as the primary diagnosis .
all patients met the clinical criteria for euthymia , defined as a score 9 on the young mania rating scale score and a score 12 on the 17-item hamilton depression rating scale at the time of assessment .
the canadian component of this study was drawn from a population of patients whose demographic information has been published in a recent study.34 briefly , this population was a convenience sample and all participants meeting the dsm - iv criteria for bipolar disorder were included . after a full description of the study procedures , written informed consent was provided by all subjects .
based upon previous work,4 participants in argentina were asked to complete a translated version of the ise , including the ses and sis .
the complete inventory was translated from english into spanish by one of the authors ( gv ) . using professional argentinean translators ,
this spanish version was then back translated,36 and subsequently approved by one of us ( gv ) .
this translated scale has also been used and published recently,31 and in our study was administered to patients in the form of interviews or take - home pages .
all statistical analyses were conducted on pasw version 18 for windows ( ibm corporation , armond , ny ) .
measures to test internal consistency were performed for both ses and sis using the kuder - richardson coefficient of reliability ( kr-20 ) and cronbach s alpha reliability coefficient , respectively .
chi - square analyses were completed on frequency scores ( gender , level of highest education , employment , marital status , frequency of outpatient care , and acceptance of diagnosis ) , while t - tests or mann - whitney u tests were performed on mean scores ( age , number of years ill , years between first symptoms and treatment , and in assessing differences between ses and sis scores ) . where data were not normally distributed and did not have equal variance , nonparametric tests were performed . a two - step forced entry multiple regression was also performed ( using variables which differed significantly between the two populations as predictor variables ) in order to examine systematic differences between ses and sis scores in the canadian and argentinean patient populations .
of the 178 argentinean participants , 64% were female , all were aged 1883 years , approximately 56% had a university education , 61% were employed , and 38% were married or in a common law relationship ( table 1 ) .
further , 35% lived with a spouse or partner , 72% thought that their condition had improved over the last year , over 40% had been ill for less than 10 years , and an overwhelming proportion ( about 85% ) had come to accept their diagnosis ( table 1 ) .
the respondents were further subdivided into those with bipolar i and those with bipolar ii disorder ( table 1 ) .
similar data were obtained for canadian participants.34 in total , 141 of the 178 argentinean participants originally recruited answered all 10 ses scale questions . over half of these ( 61.7% ) endorsed the question that the average person is afraid of someone with a serious mental illness ( table 2 ) .
the mean score for this scale was 4.5 , with a high kr-20 ( 0.78 ) .
one question pertaining to avoidance of stigmatizing situations had an item - rest correlation under 0.4 , but when the variable was deleted , it did not significantly change the kr-20 and was kept in the analysis ( table 2 ) .
a total of 160 participants responded to every item on the seven - question sis scale .
the mean scale score was 29.1 , with a cronbach s alpha reliability coefficient of 0.91 ( table 3 ) .
it appeared that stigma most strongly affected one s self esteem ( mean of 5.2 ) , while the lowest affected characteristic was social contacts of family members , at a mean of 3.0 ( table 3 ) .
mean ses scores for patients with bipolar i ( 4.5 ) and bipolar ii ( 4.4 ) disorder did not differ significantly ( t - test , t139 = 0.18 , p = 0.86 , table 2 ) .
mean sis scores for patients with bipolar i ( 29.1 ) and bipolar ii ( 29.2 ) disorder also did not differ significantly ( t158 = 0.06 , p = 0.58 , table 3 ) .
there were no differences in gender ( chi - square , ( 1 ) = 0.90 , p = 0.344 ) or marital status ( ( 1 ) = 0.85 , p = 0.36 ) between argentinean and canadian respondents ( table 4 ) .
both populations also showed similar rates of acceptance of their diagnoses ( ( 1 ) = 0.19 , p = 0.66 , table 4 ) and did not show differences in the number of years between symptoms and first treatment ( t - test , t131 = 1.6 , p = 0.10 , table 5 ) .
however , the argentinean population was significantly younger ( t193 = 2.1 , p = 0.04 ) and consequently had been ill for less time compared with the canadian population ( mean of 16.3 and 22.8 years , respectively ; t252 = 3.9 , p < 0.001 , table 5 ) .
argentineans also had a significantly higher level of education ( ( 3 ) = 32.19 , p < 0.001 ) , with 55.7% having a university education in comparison with 28.6% in the canadian population .
respondents in argentina were also much more likely to be employed ( 61.3% ) than canadian ( 27.4% ) respondents ( ( 1 ) = 25.98 , p < 0.0001 ) , but interestingly attended outpatient treatment less frequently than the canadian population ( ( 5 ) = 29.35 , p < 0.001 , table 5 ) .
finally , ses and sis scores were markedly different between the two populations , with the argentinean population scoring lower on both the ses ( 4.5 versus 5.6 in canadians ) and also lower on the sis ( 29.1 versus 37.5 , table 6 ) . to explore more fully any systematic differences in ses and sis scores between the two patient populations ,
the addition of all variables which differed between the two populations was able to explain 16% of the variation in ses scores ( table 7 ) .
of these , weekly attendance at an outpatient clinic and the number of years ill were significant predictors of higher ses scores , and having a university level of education showed a near - significant trend ( table 7 ) .
the addition of population as a variable ( model 2 ) did not significantly change the predictive power of the model , adding only 1% to the overall predictive power of model 1 ( table 7 ) .
with respect to sis scores , variance in any of the factors which differed between the two populations led to low predictive power of the model , with these variables explaining only 3% of the variance in sis scores ( table 8) .
adding population in model 2 increased the predictability significantly by 2% , but the overall predictive power remained low at 5% ( table 8) .
of the 178 argentinean participants , 64% were female , all were aged 1883 years , approximately 56% had a university education , 61% were employed , and 38% were married or in a common law relationship ( table 1 ) .
further , 35% lived with a spouse or partner , 72% thought that their condition had improved over the last year , over 40% had been ill for less than 10 years , and an overwhelming proportion ( about 85% ) had come to accept their diagnosis ( table 1 ) .
the respondents were further subdivided into those with bipolar i and those with bipolar ii disorder ( table 1 ) .
in total , 141 of the 178 argentinean participants originally recruited answered all 10 ses scale questions . over half of these ( 61.7% ) endorsed the question that the average person is afraid of someone with a serious mental illness ( table 2 ) .
the mean score for this scale was 4.5 , with a high kr-20 ( 0.78 ) .
one question pertaining to avoidance of stigmatizing situations had an item - rest correlation under 0.4 , but when the variable was deleted , it did not significantly change the kr-20 and was kept in the analysis ( table 2 ) .
a total of 160 participants responded to every item on the seven - question sis scale .
the mean scale score was 29.1 , with a cronbach s alpha reliability coefficient of 0.91 ( table 3 ) .
it appeared that stigma most strongly affected one s self esteem ( mean of 5.2 ) , while the lowest affected characteristic was social contacts of family members , at a mean of 3.0 ( table 3 ) .
mean ses scores for patients with bipolar i ( 4.5 ) and bipolar ii ( 4.4 ) disorder did not differ significantly ( t - test , t139 = 0.18 , p = 0.86 , table 2 ) .
mean sis scores for patients with bipolar i ( 29.1 ) and bipolar ii ( 29.2 ) disorder also did not differ significantly ( t158 = 0.06 , p = 0.58 , table 3 ) .
there were no differences in gender ( chi - square , ( 1 ) = 0.90 , p = 0.344 ) or marital status ( ( 1 ) = 0.85 , p = 0.36 ) between argentinean and canadian respondents ( table 4 ) .
both populations also showed similar rates of acceptance of their diagnoses ( ( 1 ) = 0.19 , p = 0.66 , table 4 ) and did not show differences in the number of years between symptoms and first treatment ( t - test , t131 = 1.6 , p = 0.10 , table 5 ) .
however , the argentinean population was significantly younger ( t193 = 2.1 , p = 0.04 ) and consequently had been ill for less time compared with the canadian population ( mean of 16.3 and 22.8 years , respectively ; t252 = 3.9 , p < 0.001 , table 5 ) .
argentineans also had a significantly higher level of education ( ( 3 ) = 32.19 , p < 0.001 ) , with 55.7% having a university education in comparison with 28.6% in the canadian population .
respondents in argentina were also much more likely to be employed ( 61.3% ) than canadian ( 27.4% ) respondents ( ( 1 ) = 25.98 , p < 0.0001 ) , but interestingly attended outpatient treatment less frequently than the canadian population ( ( 5 ) = 29.35 , p < 0.001 , table 5 ) .
finally , ses and sis scores were markedly different between the two populations , with the argentinean population scoring lower on both the ses ( 4.5 versus 5.6 in canadians ) and also lower on the sis ( 29.1 versus 37.5 , table 6 ) . to explore more fully any systematic differences in ses and sis scores between the two patient populations ,
the addition of all variables which differed between the two populations was able to explain 16% of the variation in ses scores ( table 7 ) .
of these , weekly attendance at an outpatient clinic and the number of years ill were significant predictors of higher ses scores , and having a university level of education showed a near - significant trend ( table 7 ) .
the addition of population as a variable ( model 2 ) did not significantly change the predictive power of the model , adding only 1% to the overall predictive power of model 1 ( table 7 ) .
with respect to sis scores , variance in any of the factors which differed between the two populations led to low predictive power of the model , with these variables explaining only 3% of the variance in sis scores ( table 8) .
adding population in model 2 increased the predictability significantly by 2% , but the overall predictive power remained low at 5% ( table 8) .
patients with bipolar disorder experience stigmatizing events associated with significant psychosocial effects . in this study , we used a questionnaire to assess patients self - perceived stigma , ie , the ise .
this study validated the ise in a population of patients with bipolar i or ii disorder in argentina .
cronbach s alpha ( sis ) and kr-20 ( ses ) scores were high at 0.91 and 0.78 , respectively , for all patients with bipolar disorder .
this suggests internal consistency and reliability of the scales , because the results are similar to the reliability measures previously found in the canadian population ( cronbach s alpha = 0.89 and kr-20 = 0.77 in patients with bipolar disorder ; cronbach s alpha = 0.91 and kr-20 = 0.78 in patients with depression).34 the ise has also been used as a self - assessment measure of stigma in patients with a variety of disorders ( schizophrenia , anxiety , bipolar disorder , depression ) in canada , again with high reliability ( cronbach s alpha = 0.91 , kr-20 = 0.83).4 the argentinean population had a lower endorsement of ses questions than the canadian population , but when asked do you think the average person is afraid of someone with a serious mental illness
similarly , over half ( 53% ) of the respondents thought that their experiences with stigma had affected their satisfaction with quality of life .
finally , argentinean patients with bipolar disorder showed lower scores on the sis scale , with the highest impact of stigma being on self - esteem ( 5.2 ) .
cross - cultural differences in the stigma associated with bipolar disorder have been found among european countries,33 and here we show differences in stigma when comparing north and south american countries .
firstly , there may be a sample bias ( see tables 4 and 5 , and comments on limitations below ) , with argentinean respondents generally having higher education , higher employment rates , attending outpatient clinics less often , and being younger , thus generally being ill for less time . using a two - step forced entry linear regression , we found that being ill for longer and attending weekly outpatient clinics were significant predictors of higher ses scores , and having a university education also showed a positive trend .
furthermore , age , employment , and education were not significant predictors , and adding population as a factor in a second model did not add significantly more predictive power .
whether weekly outpatient clinic attendance was due to patients feeling stigmatized and needing support , or to some other reason remains to be examined in future studies .
these findings suggest that the variables which systematically differed between these two populations were sufficient to predict differences in the ses scores we observed . with respect to the sis
, none of the factors which differed between the two populations had considerable predictive ability for sis scores , and addition of population explained a total of just 5% of the variation .
these findings suggest that some other variable(s ) , perhaps linked to cultural differences , are able to predict sis scores more accurately than any of the demographic variables which differed between the two populations .
the second potential reason for why we found differences in the ses and sis scores between the two populations may be couched in terms of differences in family dynamics between modern canadian and argentinean societies .
that is , the way family members , friends , and relatives act and react towards those with mental illnesses may differ culturally .
specific cultural differences , for example , emotional closeness with family members or their supportiveness of mental illness may play a role in predicting ses and sis outcomes .
notwithstanding , it is important to remember that over half of the argentinean participants felt that the stigma they experienced had influenced their quality of life , and that their self - esteem had been negatively impacted . differences between argentinean patients with bipolar i and bipolar ii disorder were negligible for both ses and sis , suggesting that stigma affects both equally .
this was against our initial prediction that bipolar i disorder would be associated with more stigma as a result of the presence of mixed and manic episodes .
our findings may be the result of the general public s inexperience with the distinctions between bipolar i and ii disorder , and this may make it more likely that people will stereotype and discriminate against both as a result . as a prerequisite for inclusion to our study , patients had to be euthymic at the time of testing ; however another explanation could be that some patients with bipolar disorder had problems with insight into their illness , in effect not realizing the severity of the stigma they were experiencing during the time of their mixed or manic episodes .
another potential explanation for this finding could be that patients with bipolar i or ii disorder consider , at some point , that depressive episodes may produce a higher impact than the euphoric phases of their illness .
thus , it could be that while mood is stable , patients with bipolar i or ii disorder viewed themselves as equally stigmatized , even though as shown previously , caregiver stigma is higher for patients with bipolar i than those with bipolar ii disorder.15 in this study , we used two populations ( argentina and canada ) which differed demographically , and in some instances these differences contributed to the variance observed between the ise answers for both countries .
we were also unable to compare the stigma associated with bipolar i or ii disorder in the argentinean sample with that experienced by the canadian sample , because the type of bipolar disorder was not reported in the latter .
however , our results with regard to the lack of differences in ise score between patients with bipolar i or ii disorder within the argentinean population are interesting , and the mechanisms and reasons behind this finding deserve further research . in this vein ,
future research should focus on patient evaluation during affective episodes in order to measure the potential influence of the emotional , functional , and cognitive impairments produced during the acute phases of the illness on stigma perception .
this study used the ise effectively to show that stigma affects the lives of patients with bipolar i or ii disorder in argentina , and has also illuminated this in a canadian population.34 thus , understanding patient experiences with stigma deserves worldwide attention .
what the open - the - doors program has started is an essential aspect of fighting social stigma around the world , and using tools such as ise to assess the patient s own perceptions of stigma will undoubtedly help in their long - term efforts .
long - term goals should include validating the ise in other cultures and other mental illnesses , in order to gain an understanding of individual experiences and the impact of stigma .
work has already started on applying the ise in an eastern european population , and it has been used in a study comparing the stigma experienced by patients with bipolar disorder in argentina , brazil , and colombia.31 it would also be fruitful to examine stigma in cultures where family groups are very cohesive , and where multiple generations live together ; whether more or less social stigma is seen in such societies would be important information to use in future stigma prevention initiatives .
it would also be useful to apply the information obtained from the ise in order to combat social stigma , including implementing educational programs designed for the public , families of patients , and even mental health care professionals , because all three groups have been shown to hold stigmatizing views about patients with mental illness ( ie , the public,3,10 family members,15 and mental health professionals9,13,14 ) .
for example , knowing that over half of the patients surveyed feel the general public are afraid of those with mental illnesses , future programs can be geared towards helping the general public in overcoming this fear . by applying the ise we can reliably ascertain what patients feel with regard to the stigma surrounding their mental illness , and whether these experiences change according to the diagnosis would be of interest .
the more knowledge we can glean from patients experiences and the impact of stigma , the greater the likelihood that stigma mitigation programs can be tailored properly in order to yield maximum benefits . | backgroundmany people with mental illness experience stigma that has impacted their lives . in this study , we validated the inventory of stigmatizing experiences ( ise ) as a tool to help quantify the stigma experienced by patients with bipolar disorder and its impact on their lives .
the ise has two components , ie , the stigma experiences scale ( ses ) and the stigma impact scale ( sis ) , which were administered to a population of argentinean patients with bipolar disorder .
we characterized the differences between these two populations using the ses and sis .
finally , we compared ses and sis scores with those in a population of canadian patients with bipolar disorder.methods:the ses and sis scales were administered to tertiary care patients with bipolar i and ii disorder in argentina ( n = 178 ) and canada ( n = 214).results : in this study , we validated both ses ( kuder - richardson coefficient of reliability , 0.78 ) and sis ( cronbach s alpha , 0.91 ) scales in a population of argentinean patients with bipolar disorder .
there were no significant differences in stigma between patients with bipolar i or ii disorder on ses or sis .
however , over 50% of all respondents believed that the average person is afraid of those with mental illnesses , that stigma associated with mental illness has affected their quality of life , and that their self - esteem has suffered due to stigma . in comparison with the canadian population , argentinean participants scored lower on both the ses and sis , which may be due to cultural differences or to differences in population characteristics.conclusion:stigma associated with mental illness is serious and pervasive .
if we are to find successful strategies to mitigate stigma , it is first important to understand how patients perceive such stigma . the ise is a valuable tool which allows us to do this with high reliability among cultures . |
the diameter of the blood vessel capillaries in most vertebrates is about 25% smaller than the mean diameter of the erythrocytes , causing blood cell deformation during the capillary flow [ 1 , 2 ] .
thus , the blood flow in the capillaries is that of a series of the red blood cells , separated by the plasma trapped between the two neighboring cells , termed the bolus blood flow or flow with the plug effect [ 3 , 4 ] . a model of the idealized motion of blood in capillary blood vessels , including a series of flat disks representing erythrocytes separated by plasma , has been analyzed earlier .
this study revealed a significant difference between the mean velocity of the plasma and that of the red blood cells , dependent on the gap between the red blood cells and the capillary wall .
this clearly shows that one should not use the measured velocity of the red blood cells as the mean blood flow velocity in the capillary ; this latter value is dependent on the cell - wall gap size .
the effect of the cell - wall gap on the flow velocity depends on the structure of the endothelial wall ; for example , the flow is affected by the presence of the porous endothelial layer .
the idea that the gap between the erythrocyte and the endothelial wall may itself be controlled has not been considered at that time .
it is generally recognized that the capillary blood flow is tightly regulated [ 6 , 7 ] .
usually , the regulation of the blood flow in small blood vessels is associated with the contractile elements outside the endothelium , like the external muscle walls of the arterioles or the external contractile glial cells ( pericytes ) on the venules and capillaries [ 6 , 8 ] . here
we suggest an additional mechanism of the blood flow regulation by the specialized endothelial microvilli , presenting a simplified model of how the microvilli could contribute to controlling the flow in small capillaries .
the specialized endothelial microvilli protruding into the blood vessel lumen , invisible in the optical microscopy , were discovered soon after the electron microscope had been introduced into the practice [ 9 , 10 ] .
these hair - like processes are about 0.1 m in diameter and 0.53 m long . the density of the microvilli on the endothelial cell surface increases during ischemia and in hypertensive animals [ 1114 ] . on the other hand , application of no reduces the count and length of the endothelial microvilli .
the microvilli formation may enhance thrombosis by promoting platelet aggregation or aggregate and promote internalization of virulent bacteria into the vascular endothelial cells .
the microvilli are associated to the intermediate filament cytoskeleton , being very rich in ezrin and moesin , two members of the erm ( ezrin / radixin / moesin ) family , and their respective transmembrane - binding proteins , such as cd44 with actin polymerization , all colocalized within these membrane protrusions .
all of these data suggest that microvilli are highly dynamic structures ; they can appear or disappear or change their length upon regulation .
for example , it was shown that ischemia may reduce the effective capillary diameter by a factor of two from its normal value , possibly because of the microvilli swelling .
our electron - microscopy study in mammals ( rats and mice ) revealed that the endothelial microvilli may participate in the plasma flow regulation by controlling the erythrocyte plug effect .
we also found that similar endothelial microvilli are also present in birds , suggesting that the microvilli and their associated mechanisms of regulation may be present in all vertebrates .
these data led us to the hypothesis that the endothelial microvilli are an important player in the blood - tissue exchange , as they can control the blood cell speed and thus the plasma flow speed in the cell - wall gap . here
we present an electron microscopy study of the microvilli in small capillaries in mammals and birds , along with a simplified model of the control of the cell - wall gap between the erythrocytes and the endothelial wall of the capillary , and thus of the blood flow in the capillaries .
all of the experimental procedures were performed in accordance with the us public health service publication guide for the care and use of laboratory animals and were approved by the animal care and use committee at universidad central del caribe .
cortical samples from sprague - dawley rats and from b6 mice of either sex of 150200 days of age were used .
bird blood vessels were studied using the sections obtained from our previous work on the pied flycatcher .
briefly , samples were fixed in the mixture of 2.5% glutaraldehyde with 4% paraformaldehyde in 90 mm sodium cacodylate buffer with 0.02 mm cacl2 added and ph adjusted to 7.27.4 .
the samples were ( 1 ) washed for 20 min in 90 mm sodium cacodylate buffer , ( 2 ) postfixed for 30 min in 1% osmium tetroxide ( oso4 ) with a few granules of potassium ferrocyanide ( k4fe(cn)63h2o ) , ( 3 ) incubated for 30 min in 1% osmium tetroxide , and ( 4 ) incubated in 2% aqueous uranyl acetate ( uo2(ch3oco)h2o ) for 1 hour . the samples were washed for 20 min in distilled water after each of the steps ( 1)(4 ) .
the samples were then dehydrated in a graded acetone series and embedded in a 1 : 1 mixture of embed-812 and spurr ( em sciences ) .
ultrathin sections ( 5060 nm ) were cut with a leica ultracut ultramicrotome , mounted on formvar - coated copper slot grids and examined with a jem 100cx ii transmission electron microscope ( jeol ) .
the chemicals for buffers and solutions were purchased from sigma - aldrich ( mo , usa ) , and the stains for the electron microscopy were purchased from em sciences ( pa , usa ) .
the transmission electron microscopy of the rat brain cortical capillaries showed a large number of microvilli on the luminal surface of the endothelial cells .
they were 0.1 to 0.5 m long , with the diameter of about 0.1 m . the erythrocytes in the capillary were frequently found surrounded by the microvilli ; especially in the zones of bifurcation there the microvilli density is usually elevated , probably allowing for a better control of the blood flow distribution between the two vessels .
the rigidity of the microvilli seemed high enough to induce invaginations in the erythrocyte membrane ( figure 1(a ) ) .
the linear density of the microvilli in the capillaries varied from 0.10.2 to 1 - 2 per m of the capillary wall cross section length in normal animals without any treatment , both on longitudinal and radial cross sections of the blood vessels , discarding those microvilli fragments that appeared unattached to the wall .
similar microvilli were present in larger vessels as well , at an even larger density ( figure 1(b ) ) .
some of the bent microvilli were found cut , showing their axial symmetry ( figure 1(b ) , red arrow ) .
very similar microvilli appear on the luminal surface of the endothelium in mice capillaries ( figure 2 ) ; some of them were cut transversally , some radially , also showing their axial symmetry ( figure 2 , the red arrow ) .
double microvilli may be formed on junctions of neighboring endothelial cells , appearing quite frequently in mice and rats ( green arrows in figures 1 and 2 ) .
motivated by the results obtained in the rat and mouse capillaries , we reexamined the samples from our previous work on birds , where the sections of the capillaries revealed very similar microvilli in their lumen . similarly to the mammals , double microvilli were frequently detected on the junctions of the neighboring endothelial cells ( figure 3 , green arrow ) .
the discovery of similar microvilli in the lumen of the capillaries of the two different vertebrate classes suggests that these structures represent an ancient mechanism , necessary for the proper functioning of the blood vessels .
we therefore suggest that the length and density of the microvilli may be important for the blood flow dynamics and regulation , affecting the blood - tissue material exchange rates and efficiency .
a detailed analysis of the theoretical models describing the flow dynamics of the heterogeneous fluids ( liquid phase with suspended cells of different shape ) in the capillary systems has been presented earlier ( secomb et al . ) [ 3 , 4 , 20 , 21 ] .
lew and fung , 1970 , demonstrated that , representing the cells ( erythrocytes ) by flat disks , the average velocity of the liquid phase may be significantly different from that of the disks , provided the disk diameter is close to the capillary diameter .
in such cases , the ratio of these two velocities is dependent on the ratio of the capillary diameter to the cell diameter .
note that the following boundary conditions were used in all of these models : ( i ) the velocity of the liquid at the capillary wall is zero ; ( ii ) the velocity of the liquid at the cell surface equals the cell velocity .
the model calculations demonstrated that the blood plasma layer near the capillary wall moves at the velocity that strongly depends on the viscosity , while the more centrally located plasma trapped between the consecutive cells moves at a different velocity , equal to that of the suspended cells .
these conclusions were confirmed in the experiments showing that the red blood cell velocity is different from that of the dye added to the plasma [ 22 , 23 ] .
taking into account that the already mentioned microvilli may change their density , shape , and length depending on conditions , therefore affecting the effective diameter of the capillary as regards the erythrocyte motion , we propose that microvilli may control not only the capillary blood flow resistance , but also the ratio between the erythrocyte velocity and the blood plasma velocity . the control of this ratio will affect the material exchange between the blood and the capillary endothelium .
presently we propose a simplified phenomenological model of the effective capillary diameter regulation by the endothelial microvilli , in function of their diameter , length , and number density ( see figure 4 ) .
we shall use the following notations : r is the microvilli radius , l their length , r the capillary radius , and l its length .
thus , we can estimate the critical count of the microvilli , corresponding to the capillary radius reduced from r to r l. the cross section area of each microvillus is given by ( 1)s=r2.the area of the internal capillary surface with the radius r l is given by(2)s0=2lrl.the critical count of microvilli is thus given by(3)nc=2lrlr2.thus , the critical density of microvilli per unit area is given by(4)c = nc2rl = rlrr2.we define c as the critical density , corresponding to the microvilli so dense that they form a new surface inside the vessel walls ( figure 4 ) .
usually the density may be lower ; therefore , we shall define the effective radius reff of the capillary dependent on the microvilli density and their other parameters as follows:(5)reff = rlrcrlc+l.it follows from ( 5 ) that we obtain reff = r at = 0 , and reff = ( r l ) at = c , as expected . according to poiseuille 's law
, the volume of a homogeneous liquid passing through a cylindrical pipe per unit time is expressed by ( 6)qr=r48lfp.we should substitute reff for r , with p being the pressure difference between the inlet and outlet sections of the pipe , the fluid viscosity , and f the pipe length .
therefore , small changes in reff may significantly affect the amount of fluid passing through the capillary .
for a homogeneous fluid in a cylindrical pipe , the fluid velocity distribution is described by a parabolic function , with zero velocity at the pipe wall and the maximum velocity on the pipe axis .
however , blood is heterogeneous ; therefore , the regulation of the flow in the gap between the capillary wall and the red blood cells may be even more efficient .
indeed , lew and fung analyzed blood flow in the capillary with small cell - wall gap ( plug flow ) .
they found that there is a significant difference between the mean plasma velocity and the mean blood cell velocity , with the ratio of the two dependent on the ratio of the capillary diameter to the cell diameter .
taking into account ( 5 ) and the results reported earlier , we obtained an approximate relationship for the ratio of the average velocities of the erythrocytes and of the blood plasma in function of the effective capillary radius and the erythrocyte radius rer , representing erythrocytes by thin rigid disks:(7)erp==reffnrerreffm+1.to obtain ( 7 ) , we assumed that the friction coefficient for the erythrocyte motion inside the capillary is given by ( 8)=nrerreffm.here , n and m are phenomenological parameters , both varying between zero and unity , and is proportional to the plasma viscosity .
it follows from ( 7 ) that the velocity ratio is zero for reff = nrer ; thus the erythrocytes are not moving ; the case of reff < nrer has no physical sense ; while , for reff nrer , we obtain 1 , as reasonably expected .
thus , ( 5 ) provides a link between the microvilli structure and density and the blood flow regulation in a capillary . since the microvilli structure and density may be altered by the regulation mechanisms , our model of the effective capillary radius controlled by the microvilli length , radius , and density allows for an efficient control of the blood flow dynamics in the capillaries .
we report that the inner surface of the endothelial cells in the capillaries has the same microvillar structure ( figures 1 and 2 ) that has been previously described in larger blood vessels [ 912 , 15 , 17 , 18 ] .
we also report that the same endothelial microvilli are found in bird capillaries as well ( figure 3 ) , extending their presence to various classes of vertebrates . according to the present study , the linear density of the microvilli on the capillary wall cross section varied between lin = ( 0.1 , , 2 ) m in rats without any special treatment .
we estimated the density of the microvilli per unit area using the following formula:(9)=linhd / h+1.here , h = 0.05 m is the cut thickness and d = 0.1 m the approximate microvillus diameter .
the calculation produced = ( 0.7 , , 13 ) m for the microvilli density in capillaries , which is much lower than their density in large arteries but still sufficiently high to affect the blood flow in the capillaries .
the density of the microvilli on the endothelial cell surface increases during ischemia and in hypertensive animals [ 1113 ] .
microvilli are associated to the intermediate filament cytoskeleton , being very rich in erm proteins that usually crosslink the actin filaments with the plasma membranes .
this suggests that the microvilli length and other characteristics may be controlled by the po2/pco2 and other metabolic regulators .
indeed , ischemia may reduce the effective capillary diameter by the factor of two from its normal value , possibly because of the microvilli swelling .
since the microvilli structure ( length and radius ) and density may be changed depending on conditions , the presently proposed simple model of the effective capillary radius control by changing the microvilli length , radius , and density describes an efficient way of the blood flow regulation in capillaries ( figure 4 ) .
the proposed mechanism of the blood flow regulation by the microvilli is only a hypothesis , lacking sufficient experimental evidence .
further advancement of this research will target the development of the experimental methods producing evidence for the proposed mechanism . on the other hand ,
the red blood cells tend to plug the capillaries preventing the plasma from flowing freely as it does in large blood vessels .
while the red blood cells move fairly steadily , the plasma trapped between the cells and the capillary wall experiences turbulent vortices and recirculation zones , with increased hydrodynamic resistance to the blood flow . as it was shown theoretically , there is a significant difference between the mean velocity of plasma and that of the red blood cells in capillaries , controlled by the cell - wall gap .
these ideas found experimental confirmation [ 22 , 23 ] ; therefore , the control of the plasma flow through the cell - wall gap by the microvilli located on the capillary wall may make the control of the capillary blood flow more efficient .
note that the extra turbulence of the plasma should facilitate the material exchange between the plasma and the capillary wall .
the microvilli also augment the contact surface of the endothelium cells with the plasma , possessing special receptors providing additional binding and internalization [ 16 , 17 , 24 ] .
still , the density of microvilli is not high enough to augment the contact surface significantly ; also , the microvilli are too thin and long to promote efficient exchange through their surface .
also , the most dense population of microvilli is found in larger vessels , like the aortic arch with its thick walls limiting the exchange .
all of these data indicate some participation of the microvilli in the exchange processes , insufficiently understood and warranting additional theoretical and experimental studies of the exchange regulation by the microvilli .
very similar endothelial microvilli were found in the lumen of capillaries in different species of mammals and birds.a simplified physical model predicts that microvilli may efficiently regulate the blood flow in the capillaries .
very similar endothelial microvilli were found in the lumen of capillaries in different species of mammals and birds .
a simplified physical model predicts that microvilli may efficiently regulate the blood flow in the capillaries . | endothelial microvilli that protrude into the capillary lumen , although invisible in the optical microscopy , may play an important role in the blood flow control in the capillaries .
because of the plug effects , the width of the gap between the capillary wall and the blood cell is especially critical for the blood flow dynamics in capillaries , while microvilli located on the capillary wall can easily control the velocity of the blood flow .
we report that microvilli in the capillaries of different vertebrate species have similar characteristics and density , suggesting similarities between the respective regulation mechanisms .
a simplified physical model of the capillary effective diameter control by the microvilli is presented . |
poor quality drug or substandard product encounters a major stringent issue for the global health system and it can not be ignored . in most streamlined regions of the globe like japan , canada , australia ,
new zealand , the united states of america and most of the european union , hardly 1% of the market value products are counterfeit , developing countries like africa , latin america and many parts of asia may markedly be the seller and producer of sffc medicines .
russia , china , india , brazil , mexico , pakistan , southeast asian and middle eastern countries are considered as the chief operators in distribution and manufacturing of counterfeit drugs .
a decade ago , it was examined by who that 10% of the global medicines were counterfeit . however , contrary to its previous communicated data who - impact pointed out that data was not much authentic .
now , it is questionable that what are the causes and influences of this problem . in turn , one reason is poverty and other is ignorance and these could contribute to the demand for counterfeit and substandard drugs .
moreover , ignorance of poor quality , unregistered medicines , lenient penalties , inadequate enforcement of laws are some of the significant causes which provoke the situation .
day by day , public trust in health system may deteriorate as the consumption of substandard drugs by patients increase due to availability and lack of detection of sffc or nsq medicine in the market .
consumption of sffc medicines can be responsible for failure of treatment or even death . unbelievably , 0.20 to 0.30 million people die every year in china just because of counterfeit and substandard drug product .
no such data is available in india , yet many patients are dying every year .
according to a report revealed by international policy network , globally 0.70 million deaths were reported for malaria and tuberculosis because of counterfeit drugs .
this data reveals the loop holes in the regulatory system and the cautions for avoiding the poor quality medicines .
india is the largest manufacturer of generic drugs and probably 12 - 25% of the medicines supplied globally are contaminated , substandard and counterfeit .
being the world 's largest manufacturers of active pharmaceutical ingredients and finished products , it is likely that india along with china could be the major contributors to spurious medications as per patrick lukulay , vice president of us pharmacopoeial convention 's global health programs . in a report , it has been declared by the european commission that 75% of the global cases of sffc medicines originate from india .
indian government officials initiated an investigation to scrutinize the drugs product which are supplying by india to nigeria when india was accused along with other 29 asian countries as the main originator of counterfeit drugs .
on one side , india extensively interacts with the african countries in providing quality medicine at affordable prices , while on other side predictive blames were imposed on india and china for exporting the fake or substandard quality of antimalarial , antibiotics and contraceptives drug product to uganda and tanzania . in turn
, indian drug regulatory authority has taken various steps against the causes and they have put all their efforts to improve the drug regulation in the country .
however , no authentic evidences exist against the country according the data provided by the government and non government agencies of india .
many researchers have investigated only individual drugs or narrow range of drug preparations and formulations .
currently , no large randomized studies of drugs quality have been done in india . in the year 2000
, it has been stated that around 35.0 , 23.1 and 13.3% global sales of counterfeit medicines come from india , nigeria and pakistan , respectively and counterfeiting includes all therapeutic classes of drug and mainly antibiotics .
a decade ago , indian government officials estimated that 9% of the drug products were of substandard quality .
although according to indian press media , 30 - 40% of the total marketed drugs are considered as spurious , but this data is without any scientific confirmation . under laboratory analysis in a survey accomplished in 2007 by south east asia region pharmaceutical ( searpharm ) forum , a group of pharmaceutical associations of international pharmaceutical federation ( fip ) and who , 10 743 samples were collected from 234 retail outlets .
about 3.1% were estimated as spurious and 0.3% were out of pharmacopoeial standard . in 2007 , 294 fixed drug combinations ( fdcs ) products were unlawfully available in the market since these were not approved by the drugs controller general of india ( dcgi ) . in 2008 , out of 1 83 020 chemist shops , 8418 chemist licenses were suspended or cancelled by the state drugs control organizations on behalf of their trade with spurious drugs . according to cdsco , estimation of the data during 2003 - 2008 indicates 6.3 - 7.5% of the samples were of substandard quality and 0.16 - 0.35% were encountered as spurious . in 2009 , cdsco reported that in 1995 - 96 , 10.64 and 0.30% tested samples out of 32 770 were substandard and spurious , respectively , while in 2007 - 2008 , 6.42 and 0.16% tested sample out of 42 354 were substandard and spurious , respectively .
nevertheless , in 2009 , 24 136 samples of 62 brands of drugs product were collected in a nationwide survey to find those products which are covertly manufactured and thus to explore the extent of spurious drug in india .
samples were drawn from over 100 pharmacy outlets from various regions of india , which were belong to nine therapeutic categories of 30 manufacturers .
supplementary information revealed by the state drugs control departments declared 1146 ( 4.75% ) products were of substandard quality .
hereby , it can be observed from the government data that spurious drugs are at same level while there is a great decline in the number of substandard drugs from 10.64% in 1995 - 96 to 5.75% in 2008 - 09 as shown in fig .
these kinds of inspections and surveys by the government officials are some driving steps for the public safety . however , stringent actions are yet to be taken for the betterment of public health . overlaying the effects of inferior manufacturing standards ,
deterioration with inactive or toxic fillers , relabeling of time expired drugs and degradation during storage are closely associated with drug quality , which must be checked regularly by fast and efficient techniques .
manufacturing of spurious and substandard quality drug products is a fraudulent activity and their availability in the market is the life threatening issue for the public health . in 2008 ,
a pilot study performed in two major cities of india , delhi and chennai to explore the extent of substandard and counterfeit drugs available in market , under which it was estimated that 12 and 5% samples from delhi and chennai , respectively , were of substandard quality . in 2007 - 08 maximum instances were from maharashtra and in 2008 - 09 kerala was the leading manufacturer of the spurious and substandard drugs . in 2007 four deaths were reported in maharashtra related to spurious drugs . while more serious results came in news when it was reported that 300 infant died in 2012 in kashmir because of ceftriaxone substandard quality product which was used to treat pneumonia .
no absolute and entire data is reported for substandard and spurious drugs after 2010 by cdsco , non government organizations or any individual research . for last 3 years
, government has noticed several cases of spurious and substandard drugs importation . in 2009 , at chennai sea port , cdsco officials caught 3 cases of unregistered bulk drugs originating from china .
cases related to the substandard quality drug product importation in india showed 35 , 35 , 34 cases for 3 consecutive years 2009 - 2010 , 2010 - 2011 and 2011 - 2012 , respectively . on a surprise inspection by the cdsco officials , 85 sales outlets out of 130 were trafficking with the banned drugs in delhi and bhiwandi city .
it is highly recommended to investigate individually every drug product that is available in the domestic market .
reports on substandard and spurious drugs defrauds in india from 2002 - 2004 considering the expansion of the pharmaceutical industry and the degree of potentially mortal diseases , any amount of substandard or spurious medicines is unacceptable because it rises the morbidity and mortality .
only few published data admit the extent of the problem and its influence on the public health .
thus , there is requirement of immediate attention and research by the regulatory authority towards this public safety issue .
indian pharmaceutical industry exists at third rank in volume and thirteenth in terms of value of worth us $ 20 billion . focusing on the accessibility and affordability of the drug products in the country
, india excels as the pharmacy of the developing world. indian government instructed to all central government hospitals and central government health scheme ( cghs ) dispensaries to prescribe generic medicines in large extent as possible .
department of pharmaceutical , ministry of chemical and fertilizers , in collaboration with the state government commenced nationwide
jan aushdhi generic drug stores in the government hospitals and supply of generic medicine through central pharma public sector undertaking . till mid of 2012
, government has already opened 122 jan aushdhi stores , where about 231 generic medicines are being marketed .
to scrutinize the complications of the sffc or nsq drug in india , government has acquired numerous steps which are , 1 .
amendment of drug and cosmetic act , 1940 in 2008 for making penal provisions and reset certain offences as perceptible and non bailable .
when adulterated or spurious drug cause death then imprisonment imposed for not less than ten years or for lifetime with penalty of not less than one million indian rupees ( inr ) or three times the value of the drugs confiscated whichever is more ; in order to make restraint for illegal practices .
in 2008 , there were 111 sanctioned posts and 64 officers in position while in 2012 there were 310 posts and 121 officers in position , which included 65 drug inspectors .
3 . for trial of offences related to adulterated and spurious drugs product , drug and cosmetic ( amendment ) act ,
2008 accredited establishment of special designated courts , and nationally 14 states / union territories already introduced such courts .
4 . for effective regulatory surveillance throughout the country , hyderabad and ahmadabad have upgraded from sub zone to full zone while bangalore , chandigarh and jammu have established as new sub zones under the direction of cdsco .
cdsco publishes monthly a list of drugs , medical devices and cosmetics that are evaluated and declared as not of standard quality / spurious / adulterated / misbranded .
enhancement of central drug laboratories with new sophisticated testing equipment set up and creation of a new testing laboratory at hyderabad
. 7 . to ensure proper traceability of those manufacturing units , which are situated abroad , from where drugs product are imported in india , new scheme for regular overseas inspection has been introduced .
8 . to encourage attentive public participation in exploring the detection of spurious drug product ,
a whistle blower scheme is initiated . under this scheme , if accurate information on the movement of spurious drugs product provided to the regulatory authorities , informers is suitably rewarded and 9 . at state level , tamil nadu and kerala government
undertake drug quality evaluation services by tamil nadu medical service corporation limited and kerala medical service corporation limited , respectively ; and regularly report the nsq products , which they fetched from government hospitals . for minimizing sffc or nsq drugs at national or states level , still there is an urgent requirement of more rigid and stringent regulations , policies and legal actions against the problem .
poor quality drugs affect the health of the public . spurious or counterfeit drugs are involved in both generic and branded products of every category throughout the world , which is growing and expanding its roots and thus emerging as menace .
standard quality obligations are related to a number of factors , including drug pricing , competition between sponsors , employment and market transparency . responding to the spreading public health crisis of spurious or substandard drugs
india is improving and achieving its mission in drug regulation process on account of decline in number of sffc or nsq drugs cases and by taking several important initiatives and preventive steps in the country and stringent penalties as well to fight against the poor quality drugs for protecting and promoting the public health .
it is now the time to explore this matter more vigorously in the times to come in order to safeguard the interests of the patient at large . | globally , every country is the victim of substandard or spurious drugs , which result in life threatening issues , financial loss of consumer and manufacturer and loss in trust on health system .
the aim of this enumerative review was to probe the extent on poor quality drugs with their consequences on public health and the preventive measures taken by the indian pharmaceutical regulatory system .
government and non - government studies , literature and news were gathered from journals and authentic websites .
all data from 2000 to 2013 were compiled and interpreted to reveal the real story of poor quality drugs in india . for minimizing spurious
/ falsely - labelled / falsified / counterfeit drugs or not of standard quality drugs , there is urgent requirement of more stringent regulation and legal action against the problem .
however , india has taken some preventive steps in the country to fight against the poor quality drugs for protecting and promoting the public health . |
primary lesions are choristomas that involve displacement of epithelial elements during closure of the neural groove or other epithelial fusion lines between the third and the fifth weeks of gestation [ 1 , 2 ] .
those located in the orbit may arise from cutaneous , conjunctival , respiratory , or lacrimal gland epithelium .
simple epithelial cysts can occur at any age but are more commonly seen in younger adults .
epidermoid cysts represent a distinct entity from the more common dermoid cysts although usually grouped together .
histologically , both are lined by squamous epithelium with desquamated layers of keratin ; however , dermoid cysts are characterized by the presence of mesodermal elements such as hair follicles or sebaceous glands . whether dermoid or epidermoid , these cysts can be either superficial or deep .
superficial cysts are more common , simple to treat , and associated with less complication [ 3 , 4 ] .
intraorbital dermoid cysts are very rare pathologies , representing 510% of all orbital dermoid cyst cases , while intraorbital epidermoids are even more infrequent .
they can break through the orbital walls into the temporal cavity , sinuses , or even intracranial cavity .
they present in a variety of ways depending upon the suture of origin , size , rate of growth , and correlation to adjacent structures .
the aim of this work is to highlight epidermoid cysts as a differential diagnosis in cases of deep orbital cystic lesions , showing various clinical and radiological presentations as well as the surgical outcomes after their removal .
this is a prospective interventional case series that comprised 17 patients suffering from intraorbital epidermoid cysts from february , 2007 , till may , 2012 .
symptomatic patients who presented with cystic lesions on clinical examination with none delineated posterior border and placed deep to the orbital septum as well as those who presented with proptosis and intraorbital cysts on ct imaging were enrolled for the study and were scheduled for surgical removal .
inclusion in the current study was based on the histopathological analysis of the surgically excised suspected lesions .
cases with history of trauma as well as cases which were proven to be dermoids were excluded .
detailed history was obtained from the patients or their guardians about the onset of the condition , duration , and associated symptoms .
all included patients were thoroughly examined for overall appearance , lid and globe position , pupillary reaction , and ocular balance and motility in the cardinal directions of gaze .
proptosis , when present , was measured by hertel exophthalmometer and any palpable masses were evaluated for their site , consistency , and local effect .
dilated fundus examination was performed and visual field was planned if there was any sign suggesting optic nerve affection .
patients were photographed and orbital ct scan with contrast was requested ( coronal , axial , and sagittal cuts ) and studied .
all procedures were performed under hypotensive general anaesthesia via anterior orbitotomy approach ; however , the incision placement and design varied according to the site and accessibility of the cyst . surgical microscope was used in cases that were showing through the conjunctiva in order to insure precise dissection and total cyst wall removal ; otherwise , the surgical loupe was used .
intraoperative findings as well as any extra , unplanned steps were documented . in cases where both the cyst wall and the bone were thin and firmly adherent , scraping ,
hydrogen peroxide wetted swabs , and cauterization were used to ensure destruction of the remaining lining cells .
all patients received postoperative combined antibiotic / steroid treatment topically and systemically for one week .
approval of the institutional review board was obtained , and the study and data collection conformed to all local laws and complied with the principles of the declaration of helsinki .
data was collected and analyzed where descriptive statistics were calculated and the numerical data were summarized as mean and standard deviation ( sd ) , while categorical data were summarized in tables and percentages ( % ) .
this study included 17 patients ( 10 females and 7 males ) with mean age 16.3 years 10.54 ( range 538 y ) .
their complaints varied among lid swelling , chronic pain , visible mass , dissimilarity between both eyes , and rarely ocular protrusion . the frequency of different complaints as stated in patients ' own words is summarized in table 1 .
lid swelling was found in all cases , yet 9 patients showed a cystic extension to the fornix with undefined posterior border .
globe displacement , proptosis , and limitation of ocular motility were also detected ; however , proptosis was mild and ranged from 2 to 4 mm ( mean 2.6 mm 0.9 ) .
limitation of the ocular motility was minimal and occurred in the direction of the mass .
four of the included patients had a scar of previous surgery for a lesion diagnosed histopathologically as epidermoid cyst in three of them .
the mean lapse between the previous surgical intervention and the current presentation was 13 months ( 4.16 ) .
best corrected visual acuity varied from 0.6 to 1 and none of the included patients suffered from optic nerve compression .
findings detected in orbital ct scans are summarized in table 2 where the presence of an orbital cyst was the common feature in all cases .
the mean length in the longest diameter was 6 cm ( 0.7 ) with various radiodensities ( figure 1 ) .
the borders were smooth in 13 patients , yet the remaining four showed irregular borders with sclerotic edges , two of whom had an additional bony defect in the orbital roof ( figure 2(a ) ) . increased orbital dimensions as well as globe displacement were also detected ( figure 2(b ) ) .
anterior orbitotomy was the used approach for the excision of theses cysts , yet incision placement varied according to their sites in order to provide the best exposure .
transcutaneous transcrease incision was chosen to treat superior orbital cysts that were deeply seated ( 6 cases/35.29% ) while transconjunctival approach was reserved for inferior orbital cysts ( 4 cases/23.53% ) as well as the remaining cases presenting with visible masses through the conjunctiva ( 7 cases/41.17% ) .
all patients showed intralesional thick fluid that was grayish white in 16 cases , while it was yellowish with foul odour in one case denoting chronic abscess . preserving the cyst intact during excision was not feasible in all cases where small defects developed during dissection ; however , walls were traced and the cysts were completely excised .
all cases showed epithelial lining of the cysts , filled with keratin with lack of skin appendages ( figure 2(c ) ) .
immediate postoperative period was uneventful and , over the follow - up period ( mean 18.8 months 0.72 ) , no recurrences were reported .
proptosis and ocular motility improved , yet globe displacement remained in 4 patients ; all of them had preoperative bony excavation on ct scan ( figures 3(a ) and 3(b ) ) , while two patients developed enophthalmos ( figures 3(c ) and 3(d ) ) .
orbital epidermoid cysts are usually mentioned with dermoid cysts although they form a separate and rare pathological entity where few reports are present in literature .
these lesions have a wide variety of clinical and radiological presentations and they should be considered in the differential diagnosis of orbital cystic lesions .
they usually warrant surgical intervention and should be totally removed as they tend to recur with lipogranuloma formation as well as the remote possibility of malignant transformation .
three patients in the current study reported chronic pain , yet there were no signs of orbital inflammation .
suggested that deeply seated dermoid could be associated with pain due to pressure and/or stretch of a related sensory nerve .
only one patient had an s - shaped deformity due to the location of the cyst behind the lacrimal gland pushing it .
mild proptosis compared to the lesion size was present in 5 patients ( 29.4% ) who were more concerned about ocular asymmetry secondary to globe displacement and lid fullness .
the fact of their presence early in life can explain this sign as the bony orbit expands with increased volume in a way similar to what happens with deeply seated dermoids .
none of the included patients suffered from diplopia in primary gaze even with globe displacement .
it was presumed that ocular adaptation had occurred with anomalous retinal correspondence being of a subtle chronic nature since early childhood .
none of the reported cases showed primary presentation of orbital inflammation or fistula formation as has been reported with deeply seated dermoids .
however , one case presented with chronic abscess with foul odour content during surgical removal and that was a recurrent cyst for the third time .
orbital ct helps in the assessment of such lesions and in delineating related bony changes where the lesion density depends on its fat content .
most of the cases included in this study showed hypodense appearance with translucent center , yet the heterogeneous appearance was mostly observed in recurrent cases especially the one associated with chronic abscess .
arana and colleagues reviewed 37 cases of intradiploic epidermoid cysts in different body sites and described their radiological appearances .
they had sclerotic borders on plain x - ray films borders , involvement of both diploic tables , and a density similar to brain parenchyma on ct scanning yet similar to dermoid cysts on mri .
intradiploic pattern was found in four of the included patients with superior and superotemporal sites , sclerotic appearance of the edges on bone window settings , hourglass appearance of the cyst , and globe displacement .
two of these patients had an associated bony defect in the orbital roof with no intracranial extension .
bony defects have been described in dumbbell dermoids on ct imaging , yet intracranial extension was usually detected .
the presence of such bone irregularities and residual edges of the diplo can explain the incomplete globe replacement after the surgical removal of the cyst .
shields and shields had classified orbital dermoid cysts according to their relation to suture lines into juxtasutural , sutural , and soft tissue cysts .
juxtasutural cyst is not firmly attached to suture while a sutural dermoid is firmly attached to and usually associated with bone erosion [ 7 , 12 ] . in the current study ,
epidermoid cysts had a comparable behavior , where 2 cases were related to frontozygomatic suture with hourglass configuration , while the rest of cases were either juxtasutural or confined to soft tissue .
keene and coworkers stated that epidermoid cysts are more commonly located laterally in the diplo of the skull , fourth ventricle , and cerebellopontine angle in comparison to dermoid cysts that frequently appear near the midline or superotemporal site where they are related to the frontozygomatic suture [ 1 , 11 ] .
epidermoid cyst position was variable in the current study ; however , the larger number of orbital cases including the soft tissue epidermoid cysts was a contributing factor in the results .
these deeply seated lesions should be differentiated from other orbital cysts such as dermoids , mucoceles , hydatid cysts , cysticercosis in addition to lacrimal gland tumors , and thyroid eye disease in adult presentations as well as encephaloceles in children [ 5 , 10 ] .
lesions visible through the conjunctival fornices should be differentiated from implantation epidermoid cysts secondary to surgery or trauma as well as dacryops of accessory lacrimal glands that are associated with conjunctivitis , especially trachoma .
histopathology is required to diagnose epidermoid cysts where they are usually lined by stratified squamous epithelium and do not contain either skin appendages , in contrast with dermoids , or goblet cells like implantation cysts .
dacryops have a cuboidal epithelium lining surrounded by a layer of spindled myoepithelial cells and chronic inflammatory reaction .
some authors suggested that patients ' age and the site of the lesion can be useful clinical clues .
eijpe and coworkers suggested that epidermoid cysts present later in life due to their deep location and longer latent period as a result of their intradiploic origin in contrast with dermoid cysts that are more common in childhood or young adolescence .
the mean age of included patients in the current study was 16.3 years 10.54 and the findings concerning intradiploic cysts were comparable , yet this study included other types that showed various age onsets .
surgical excision is recommended to provide definitive histological diagnosis , correct proptosis , prevent further destruction of related structures , and reduce the potential for malignant transformation [ 1 , 2 , 4 ] . a multidisciplinary approach using transcranial or a temporal skull base approaches
was suggested for large intradiploic cysts and cysts located along the orbital roof and temporal fossa . in all situations ,
the epithelial lining should be completely removed to avoid recurrence . in the current series , anterior orbitotomy
was successfully used in all cases with different incision placements according to site , size , and related changes .
it is to be noted that these cysts may get opened during surgery ; hence , copious irrigation is required and the walls should be traced for complete excision .
only two patients with intradiploic cysts had adherent cyst wall to bone where scraping , irrigation , and cauterization were used to destroy residual cells .
no recurrence was reported during the follow - up period , yet two patients developed postoperative enophthalmos . both of them were recurrent cases and enophthalmos could be attributed to pressure atrophy and fat necrosis from their prolonged presence , enlarged orbit that was masked by the mass presence , or posttraumatic fat necrosis secondary to surgical manipulations . in conclusion ,
deep orbital epidermoid cysts are a separate entity that can behave like deep orbital dermoids ; however , they usually present at a relatively older age .
they can be associated with increased orbital volume but not necessarily related to bony sutures .
putting clinical and radiological clues in mind can help in planning and give an idea about prognosis .
nevertheless , no effort should be spared to ensure complete excision of such lesions to avoid recurrence . | background .
orbital epidermoids form a rare pathological entity that is separate from dermoid cysts .
they have variable clinical and radiological presentations and they should be considered in the differential diagnosis of orbital cystic lesions .
this work describes the various clinical and radiological presentations of 17 cases of epidermoid cysts and the surgical outcome
. method .
a prospective interventional study was conducted on 17 patients diagnosed with epidermoid cysts .
patients ' symptoms and signs were recorded ; ct scan was done for all patients .
all lesions were removed through anterior orbitotomy and histopathological diagnosis confirmed . results .
mean age of patients was 16.3 years 10.54 .
main complaints were lid swelling , masses , ocular dissimilarity , chronic pain , and ocular protrusion .
clinical signs varied from lid swelling and masses in all cases to proptosis , globe displacement , limitation of ocular motility , and scars .
radiological findings ranged from homogenous hypodense masses ( 58.8% ) to homogenous radiolucent ( 17.6% ) and heterogenous masses ( 23.5% ) .
no recurrences following surgeries were reported throughout the follow - up ( mean 18.8 months 0.72 ) . conclusion .
deep orbital epidemoid cysts are a separate entity that can behave like deep orbital epidermoid ; however , they usually present at a relatively older age .
they can be associated with increased orbital volume but not necessarily related to bony sutures . |
signet ring cell lymphoma ( srcl ) are proliferations of malignant lymphoid cells containing cytoplasmic inclusions or vacuoles that displace the nucleus , imparting it a signet ring appearance .
it is a rare morphological variant of non - hodgkin lymphoma ( nhl ) , which can be confused with other more common tumors such as signet ring cell carcinomas , especially in cytological preparations and bone marrow biopsies . though originally described as a variant of follicular lymphoma
the signet cell appearance in these cases may be due to cytoplasmic accumulation of immunoglobulin ( ig ) or vacuoles derived from multivesicular bodies ( mvbs ) , however these morphological features in lymphomas are very rare and prompted us to report one such case where immunofluorescence ( if ) helped us to demonstrate igg in the cytoplasm of these cells .
we have not come across any other instance in literature where if was used for this purpose in srcl .
a 60-year - old male presented with a 2-month history of pain and fullness in the abdomen , breathlessness , and weight loss . on palpation , left supraclavicular and cervical lymphadenopathy was revealed .
a single , large , firm lump with nodular surface was felt in the umbilical region .
radiological investigations showed bilateral plural effusion and ascitis with extensive para - aortic , retroperitoneal , celiac , portal and mesenteric nodal masses .
fine needle aspiration smears of cervical lymph node predominantly revealed a monotonous population of medium sized lymphoid cells with scanty to moderate cytoplasm and cleaved and noncleaved nuclei showing inconspicuous nucleoli .
scattered among these were larger cells with prominent cytoplasmic vacuoles and a typical signet ring cell morphology with eccentrically placed flattened or crescentic nuclei .
( a ) fine needle aspiration smear show lymphoid population admixed with signet ring cells ( arrow , leishman stain , 400 ) .
( c ) pleural fluid show lymphocytes , mesothelial cells ( arrowhead ) , and signet ring cells ( arrow , h&e , 400 ) .
inset shows hbme1 cytoplasmic positivity in mesothelial cells ( arrowhead ) , with negative staining in signet ring cells ( arrow , immunocytochemical stain , 400 ) .
( d ) histology highlighting the follicular architecture ( h&e , 40 ) the histochemical stains for mucin ( periodic acid schiff and mucicarmine ) were negative . to demonstrate ig in the cytoplasm of these cells , if technique was used .
we re - aspirated the cervical lymph nodes , and cell suspensions were prepared in phosphate buffer saline ( pbs ) in two test tubes . from the first tube ,
the cells were washed twice and the smears were prepared from the deposit . from the second tube , the cell pellate was transferred to frozen section medium and cell block was prepared .
the smears and cell block sections both were stained for igg and igm using the direct if technique . to our surprise
, the signet ring cells gave brilliant fluorescence for igg antibody [ figure 1b ] .
no reaction could be seen with the igm antibody . the if was better demonstrated on direct smears rather than sections .
pleural fluid cytology also showed typical signet ring cells in addition to lymphocytes and mesothelial cells .
these signet ring cells showed negativity for the mesothelial marker hbme1on immunocytochemistry [ figure 1c ] .
the lymph node biopsy showed classical follicular lymphoma with some diffuse areas [ figure 1d ] .
the signet ring cells were seen mostly in diffuse areas and interfollicular areas [ figure 2a , arrow ] .
there were no plasmacytoid cells , cells with eosinophilic russel body - like inclusions or large blast cells .
( a ) histology show inter follicular area showing signet ring cells ( arrow h&e , 400 ) .
( d ) cd 20 positivity ( cd20 , 400 ) immunohistochemistry demonstrated positivity for cd 10 , cd 20 , cd 45 , and negative for t - cell markers such as cd 3 and cd 5 , as well as pan - cytokeratin [ figure 2b d ] .
bone marrow biopsy sections also showed presence of signet ring cells . considering the secreting nature of the neoplastic cells , the pleural fluid and serum
in consideration of all these findings , a final diagnosis of b - cell follicular lymphoma grade i signet ring cell type ( stage iv ) was offered .
however , subsequently , various workers described similar morphology in t - cell , immunoblastic , burkitt - like , malt - type , and small and large cell lymphomas .
the nature of the vacuoles or cytoplasmic inclusion is yet under debate , and may be igg ( in centrocytic lymphoma ) or igm , forming russel body - like eosinophilic globules ( immunoblastic and large cell lymphoma ) or membrane bound spaces derived from multivesicular bodies ( em observation ) especially in t - cell srcl . however , the morphology is rare and may cause confusion in diagnosis in certain situations . in the metastatic lesions and extranodal sites such as
the skin , bone marrow , stomach , thyroid , salivary gland and ovary primary suspicion may be of adenocarcinoma , melanoma or liposarcoma .
in addition to negative stains for mucin , the absence of clumping of cells and the fact that in most secondary deposits the aspirations smears are mostly entirely neoplastic epithelial cells , rarely having a predominantly lymphoid background , are helpful pointers for differential diagnosis . except in cases with russell body - like inclusions , where igm could be unequivocally demonstrated ,
the immunocytochemical staining for igg has not always been convincing even in b cell lymphomas . in this context , the if technique using fresh washed cytological smears may be rewarding , as in our case . incidentally , there are no previous reports on the use of if for demonstration of igg in srcl .
further proof of the secretary nature of the neoplastic cells in our case was available by demonstration of monoclonal band in gamma region on electrophoresis of serum and pleural fluid .
we could distinguish neoplastic cells because of the absence of mesothelial markers [ figure 1c , inset ] .
recently one large case series of srcl comprising seven cases with predominant emphasis on cytological features was published .
the authors of the case series emphasized distinguishing features of srcl from melanoma , adenocarcinoma , liposarcoma as well as benign histiocytic proliferations .
our aim of presenting this case is to review the awareness of this rare lymphoma among the pathologists to give due consideration for avoiding inappropriate investigations and treatment .
our new innovative immunofluorescence technique on fine needle aspiration samples can be utilized as a rapid tool to demonstrate immunoglobulins in these cells in conjunction with the histochemical stains .
| signet ring cell lymphomas are the proliferations of malignant lymphoid cells containing cytoplasmic vacuoles or globules which displace the nuclei , imparting it a signet ring appearance .
this rare tumor is a variant of non - hodgkin lymphoma .
signet ring appearance is due to cytoplasmic accumulation of immunoglobulin or vacuoles derived from multivesicular bodies .
these cells , particularly with cytoplasmic vacuoles , may be mistaken for adenocarcinoma cells .
we are presenting one such case where immunofluorescence helped us to demonstrate the immunoglobulins on fine needle aspiration smears .
this is an innovative technique and has not been reported earlier .
our aim of presenting this case is to review the awareness of this rare lymphoma among pathologists to give due consideration for avoiding inappropriate investigations and treatment . |
computed tomography angiography ( cta ) is currently the standard non - invasive imaging method used for the assessment of the aorta .
this is mainly due to high image quality , fast acquisition and easy post processing .
indications for cta are broad , including preoperative evaluation , imaging of aortic aneurysm , aortic dissection or planning for endovascular procedures ( evar ) .
several studies have been conducted concerning sufficient diagnostic luminal attenuation , , . according to the results of those studies , minimal enhancement of vascular structures of diagnostic quality varies between 250 and 350 hu . to achieve optimal enhancement various factors have to be considered : ( 1 ) scanner- and scan protocol - related factors , such as kv , tube current , pitch , gantry rotation , and timing of the scan ( scan delay ) ; especially in newest scan techniques such as high pitch scanning , .
( 2 ) patient - related factors , such as weight , body mass index ( bmi ) and cardiac output , whose influence can be taken into account and compensated for in individualized protocols ( e.g. weight - adapted cm protocols ) , , , ; ( 3 ) cm and cm administration parameters , which can be modified according to scan technique and patient characteristics . according to bae
. the key parameters of cm are concentration , volume , physicochemistry ( e.g. viscosity or temperature ) , injection duration and flow rate .
several studies indicate that the iodine delivery rate ( idr = the amount of iodine administered to a patient per second in gi / s ) is one of the most important parameters for intravascular enhancement , , . in recent years
, cm volume reduction has consistently been in the center of research , , , , , with the goal to use cm more efficiently .
apart from faster scanning techniques , new scanner- and especially the latest detector technologies with use of lower kv protocols facilitate lower cm volume . with lower kv settings , contrast to noise ratio ( cnr ) increases due to decreasing photon energy which approaches the k - edge of iodine at 33 kev resulting in higher enhancement with lower amount of iodine .
thus a reduction in cm volume may be achieved without loss of diagnostic image quality , which would be an important improvement in view of potential contrast - induced nephropathy ( cin ) , , .
therefore the purpose of this study was to evaluate the feasibility of a low volume cm protocol in 100 kv cta of the aorta .
indications for cta were as follows : preoperative evaluation ( n = 7 ) , evar or open aortic surgery follow - up ( n = 35 ) , aortic aneurysm ( n = 21 ) , clinical suspicion of bleeding ( n = 3 ) , aortic dissection ( n = 1 ) , ischemia ( n = 5 ) , search for source of pulmonary embolism ( n = 2 ) , follow - up of lung tumor ( n = 1 ) and no specified indication ( n = 2 ) . for statistical purposes , patients were divided into 3 groups according to the aorta protocol they were referred for : thoracic aorta ( group 1 ) , abdominal aorta ( group 2 ) or combined thoracic - abdominal aorta ( group 3 ) . a waiver of informed consent was given by the local ethical committee ( metc 14 - 4 - 050 ) . in order to assess scan start delay , all patients received a test bolus ( 10 ml iopromide 300 ultravist , bayer healthcare , berlin , germany at 6 ml / s , followed by 40 ml saline flush at the same flow rate ) through an 18 g i.v .
needle ( vasofix , bbraun , melsung , germany ) placed in an antecubital vein . in order to assess time to peak ( ttp ) , a region of interest ( roi ) was placed either at the level of the aortic arch for thoracic or combined thoracic - abdominal ctas , or at the level of l1l2 abdominal aorta ctas , using a dedicated software tool ( dyneva , siemens medical , forchheim , germany ) .
scan start delay was calculated from test bolus delay ( 10 s ) + measured ttp + 4 s. during the latter 4 s breathing instructions were given to the patient and the scan table was moved to its starting position .
the main bolus consisted of 50 ml cm followed by a 40 ml saline chaser , both injected at a flow rate of 6 ml / s ( idr 1.8 g / s , total iodine load til = 15 g ) .
all injection parameters were closely monitored by a dedicated software tool ( certegra informatics platform , bayer healthcare , berlin , germany ) .
patients were scanned on a multidetector - row ct ( mdct ) ( 2nd generation dual source scanner , somatom definition flash , siemens , forchheim , germany ) .
scan parameters were as follows : 2 128 0.6 mm ( using z - flying focal spot techniques ) , pitch value 0.9 , 100 kv , quality ref .
time 0.33 s , 1.0/0.8 mm slice reconstruction and soft tissue filter ( b30f ) .
measurements were carried out at 10 different anatomic locations using a dedicated software tool ( syngo.via , siemens , forchheim , germany ) 5 thoracic and 5 abdominal : t1 ascending aorta ; t2 aortic arch ; t3 transition aortic arch descending aorta ; t4 halfway t3t5 ; t5 aorta at thoracic spine level th12 ; a1 aorta at lumbar spine level l1 ; a2 halfway a1a3 ; a3 aortic bifurcation ; a4 right common iliac artery above bifurcation ; a5 right common femoral artery ( see fig .
was manually placed in the lumen of the aorta , carefully avoiding calcifications ( fig .
1 ) . mean attenuation [ hu ] and standard deviation ( sd ) ( indicator of image noise ) were recorded as well as contrast to noise ratio ( cnr ) .
overall image quality was assessed by an experienced radiologist ( 10 years of experience ) for every patient on a five - point scale : grade 1 bad , no diagnosis possible ; grade 2 poor , significantly reduced diagnostic confidence ; grade 3 moderate , sufficient image quality ; grade 4 good ; and grade 5 excellent .
body weight , length and age were tested for distribution among groups using a one - way anova .
the same test was used in order to compare attenuation and standard deviations between groups .
all values are expressed as mean sd or as a percentage with the absolute value in brackets .
indications for cta were as follows : preoperative evaluation ( n = 7 ) , evar or open aortic surgery follow - up ( n = 35 ) , aortic aneurysm ( n = 21 ) , clinical suspicion of bleeding ( n = 3 ) , aortic dissection ( n = 1 ) , ischemia ( n = 5 ) , search for source of pulmonary embolism ( n = 2 ) , follow - up of lung tumor ( n = 1 ) and no specified indication ( n = 2 ) . for statistical purposes , patients were divided into 3 groups according to the aorta protocol they were referred for : thoracic aorta ( group 1 ) , abdominal aorta ( group 2 ) or combined thoracic - abdominal aorta ( group 3 ) . a waiver of informed consent was given by the local ethical committee ( metc 14 - 4 - 050 ) .
in order to assess scan start delay , all patients received a test bolus ( 10 ml iopromide 300 ultravist , bayer healthcare , berlin , germany at 6 ml / s , followed by 40 ml saline flush at the same flow rate ) through an 18 g i.v .
needle ( vasofix , bbraun , melsung , germany ) placed in an antecubital vein . in order to assess time to peak ( ttp ) , a region of interest ( roi ) was placed either at the level of the aortic arch for thoracic or combined thoracic - abdominal ctas , or at the level of l1l2 abdominal aorta ctas , using a dedicated software tool ( dyneva , siemens medical , forchheim , germany ) .
scan start delay was calculated from test bolus delay ( 10 s ) + measured ttp + 4 s. during the latter 4 s breathing instructions were given to the patient and the scan table was moved to its starting position .
the main bolus consisted of 50 ml cm followed by a 40 ml saline chaser , both injected at a flow rate of 6 ml / s ( idr 1.8 g / s , total iodine load til = 15 g ) .
all injection parameters were closely monitored by a dedicated software tool ( certegra informatics platform , bayer healthcare , berlin , germany ) .
patients were scanned on a multidetector - row ct ( mdct ) ( 2nd generation dual source scanner , somatom definition flash , siemens , forchheim , germany ) .
scan parameters were as follows : 2 128 0.6 mm ( using z - flying focal spot techniques ) , pitch value 0.9 , 100 kv , quality ref .
time 0.33 s , 1.0/0.8 mm slice reconstruction and soft tissue filter ( b30f ) .
measurements were carried out at 10 different anatomic locations using a dedicated software tool ( syngo.via , siemens , forchheim , germany ) 5 thoracic and 5 abdominal : t1 ascending aorta ; t2 aortic arch ; t3 transition aortic arch descending aorta ; t4 halfway t3t5 ; t5 aorta at thoracic spine level th12 ; a1 aorta at lumbar spine level l1 ; a2 halfway a1a3 ; a3 aortic bifurcation ; a4 right common iliac artery above bifurcation ; a5 right common femoral artery ( see fig .
was manually placed in the lumen of the aorta , carefully avoiding calcifications ( fig .
1 ) . mean attenuation [ hu ] and standard deviation ( sd ) ( indicator of image noise ) were recorded as well as contrast to noise ratio ( cnr ) .
overall image quality was assessed by an experienced radiologist ( 10 years of experience ) for every patient on a five - point scale : grade 1 bad , no diagnosis possible ; grade 2 poor , significantly reduced diagnostic confidence ; grade 3 moderate , sufficient image quality ; grade 4 good ; and grade 5 excellent .
all data were processed via ibm spss statistics ver . 20 ( spss inc . ,
the same test was used in order to compare attenuation and standard deviations between groups .
all values are expressed as mean sd or as a percentage with the absolute value in brackets .
seven patients were excluded in the course of the study : one due to incorrect scan delay timing , six due to non - adherence to the cm injection protocol
the condition of the venous system of five patients meant that flow rates had to be decreased , and one patient had very low cardiac output with poor test bolus attenuation , leading to an increase in volume of the main cm bolus to 90 ml .
no significant difference was found within the age , weight or length distribution between groups . for detailed patient information ,
the overall mean attenuation was 324 28 hu . the highest attenuation was reached in the region of the aortic arch and the thoracic descending aorta ( t3 ) , the lowest intravascular enhancement was obtained in the common femoral artery ( a5 ) . for detailed information on attenuation in different anatomic regions and groups , see table 2 .
the attenuation values for each anatomic region are shown in fig . 2 , and the same results for each scan protocol can be found in fig .
overall sd range was 1175 hu , with lowest sd at aortic arch ( t2 ) and highest sd at half way between l1 and aortic bifurcation ( a2 ) .
except for the a4 region ( right common iliac artery above bifurcation ) , there was no significant difference among various protocols .
mean cnr was 15 ( sd 3 ) . comparison of cnr and snr can be found in fig .
pearson correlation of cnr to bmi did show a decrease of cnr with increasing bmi , both in thoracic and abdominal region ( fig .
our results show that the use of low volume cm is feasible for aortic cta . compared to our standard cm protocol ( volume 96 ml ) ,
a reduction of 52% was achieved with the new protocol . however , a combination of 100 kv with optimal scan delay timing is necessary to facilitate this injection protocol .
most of the studies have been performed on pulmonary cta , usually associated with a reduction of tube voltage to between 110 and 80 kv , , , , . however , aortic cta has also been the center of research : diehm et al .
used 50 ml of cm in the evaluation of aortoiliac aneurysm and compared it to their standard protocol using 100 ml cm ( iodine concentration 320/350 mgi / ml , flow rate 3.5 ml / s ) .
in contrast to our study , cta was only performed for the abdominal aorta , and bolus tracking technique was used with roi placed at the suprarenal aorta with a scan delay of 6 s after reaching 200 hu trigger point .
the results revealed no significant difference in attenuation levels between groups , despite the use of various cm .
compared a standard uniphasic injection protocol of 100 ml cm ( ioversol 350 ) to a multiphasic injection protocol , resulting in a decrease of cm volume to 89 ml in a 120 kv protocol for scanning the abdominal aorta .
the multiphasic protocol was established using an exponentially decelerating rate with a decay of 0.01 ml / s , according to outcomes of previous investigations by bae et al . .
results were quantitatively and qualitatively comparable but resulted only in 11% reduction in cm volume . the same authors compared their multiphasic injection protocol mentioned in a previous article , to a protocol with a 10 ml test bolus followed by a main bolus of 40 ml ( ioversol 350 ) in 30 patients ( 15 patients per group ) .
they did not find any statistically significant difference between attenuations , but it must be noted that only the abdominal aorta was evaluated , and a 120 kv protocol was used . in our study ,
a 100 kv protocol was used which facilitates higher contrast enhancement due to the contrast to noise ratio ( cnr ) increase described earlier . lowering kv thus allows a reduction in cm volume . as was shown in our study , this reduction is functional not only for abdominal or thoracic cta , but also in combined thoracic - abdominal protocols .
it is important to mention , however , that a relatively low volume bolus must be exactly timed .
the chosen timing in our study was feasible , but we did experience some decrease of enhancement in peripheral vessels in some patients undergoing combined thoracic - abdominal cta .
this could be due to the fact that a fixed bolus was used , which did not account for individual patient differences ( e.g. body weight ) , and which furthermore did not account for longer scan time necessary in thoracic - abdominal examinations in comparison to just thoracic or just abdominal scanning .
future developments in scanner technique especially in detector technology might facilitate the use of even lower kv settings in an even broader range of patients , which may lead to further increased contrast enhancement using the same bolus .
although 70 kv and 80 kv were possible at the used scanner the necessary tube current to have sufficient low image noise is not always achievable in all patients , thus lowering kv increases image noise if tube current can not be adjusted accordingly .
this makes the results applicable to a broad range of scanners and not only to the newest high - end machines .
furthermore iterative reconstruction allows reducing image noise also facilitating the use of lower kv settings in future protocols and in scanners which are not capable of higher tube current settings as lower kv settings .
it is a single center study performed on a limited number of patients , especially as far as the thoracic aorta protocol is concerned .
in addition , only one scan acquisition technique ( spiral , standard acquisition pitch ) was used .
more advanced techniques such as high pitch scanning might not be suitable for reduced cm volume , due to the fast image acquisition outrunning the bolus .
using low volume cm is beneficial in terms of cin prevention , especially in critically ill patients and patients with known impaired renal function .
furthermore , efficient use of cm in combination with lower kv settings could decrease scanning costs .
it is a single center study performed on a limited number of patients , especially as far as the thoracic aorta protocol is concerned .
in addition , only one scan acquisition technique ( spiral , standard acquisition pitch ) was used .
more advanced techniques such as high pitch scanning might not be suitable for reduced cm volume , due to the fast image acquisition outrunning the bolus .
using low volume cm is beneficial in terms of cin prevention , especially in critically ill patients and patients with known impaired renal function .
furthermore , efficient use of cm in combination with lower kv settings could decrease scanning costs .
the use of a relatively low volume of cm is feasible and diagnostic image quality in 100 kv cta of the aorta can be reached .
| objectivesusing smaller volumes of contrast media ( cm ) in ct angiography ( cta ) is desirable in terms of cost reduction and prevention of contrast - induced nephropathy ( cin ) .
the purpose was to evaluate the feasibility of low cm volume in cta of the aorta.methods77 patients referred for cta of the aorta were scanned using a standard mdct protocol at 100 kv .
a bolus of 50 ml cm ( iopromide 300 mg iodine / ml ) at a flow rate of 6 ml / s was applied ( iodine delivery rate idr = 1.8 g / s ; iodine load 15 g ) followed by a saline bolus of 40 ml at the same flow rate .
scan delay was determined by the test bolus method .
subjective image quality was assessed and contrast enhancement was measured at 10 anatomical levels of the aorta.resultsdiagnostic quality images were obtained for all patients , reaching a mean overall contrast enhancement of 324 28 hu .
mean attenuation was 350 60 hu at the thoracic aorta and 315 83 hu at the abdominal aorta.conclusionsa straightforward low volume cm protocol proved to be technically feasible and led to cta examinations reaching diagnostic image quality of the aorta at 100 kv .
based on these findings , the use of a relatively small cm bolus can be incorporated into routine clinical imaging . |
barotrauma - induced pneumocephalus resulting from a rapid change in the surrounding pressure is a major concern for airline passengers and scuba divers5,6,9 - 11,14 ) .
recent advances in aircraft technology have led to a tremendous increase in air travel for the general population and for neurosurgical patients .
neurosurgical procedures , including cranial and spinal surgery , could be a cause of residual intracranial air and could create a dormant fistulous tract that opens when the cabin pressure changes . during air travel ,
a neurosurgical patient could experience fatal tension pneumocephalus resulting from expansion of residual air in the head and pneumoencephalomeningitis secondary to cerebrospinal fluid ( csf ) leakage and the backflow of contaminated air through the bony defect . to generate interest and considerations about safe air travel of neurosurgical patient among practicing consultant neurosurgeons ,
the authors report a rare case of barotrauma - induced pneumocephalus experienced by a high risk patient after commercial air travel .
a 49-year - old female presented to the emergency department with a severe headache , nausea , and vomiting after one hour flight on a domestic commercial airliner .
a cranial nerve examination revealed anosmia through both nostrils and a visual field defect of the left inferior homonymous quadranopsia .
additional cranial nerve function , motor and sensory function , the deep tendon reflex , and cerebellar function were normal .
ten years ago , this patient was diagnosed with meningioma in the occipital lobe and underwent a suboccipital craniotomy to remove the tumor at another hospital .
further questioning revealed that the patient underwent four additional otolaryngologic operations ( two operations involving the mastoid sinus and two involving the frontal skull base through the nose ) to manage csf rhinorrhea four years after initial the craniotomy .
finally , a lumboperitoneal shunt was placed , and the patient did not experience further symptoms of a csf leak .
the revision surgery for a recurrent tumor was performed last year ; at the time of the incident discussed here , the patient was returning home after gamma knife radiosurgery for the residual tumor .
1 ) demonstrated extensive air within the subarachnoid space of the basal cistern , bilateral lateral and third ventricle , and extending to the intraparenchymal portion of the left frontal lobe .
the routine laboratory blood tests ( leukocyte count , hemoglobin , hematocrit , glucose , blood urea nitrogen , creatinine , sodium , potassium , chloride , and c - reactive protein ) were normal .
normal saline and analgesics were administered via an intravenous line , and a gradual resolution of the headache was achieved within several days .
seven days after presentation , the patient reported no complaints , and no evidence of meningoencephalitis was observed .
the patient was warned not to fly before a definite diagnostic work up and sealing procedure for the csf leak site was performed , and the patient was then discharged .
the second world war led to tremendous advances in the technologies related to airplanes and enabled many people to travel by air .
although modern commercial aircrafts provide safe and comfortable travel for most healthy people , the in - flight environment consisting of a lowered barometric pressure , ambient oxygen partial pressure , and low humidity1 ) could expose a high risk patient ( such as the patient discussed here ) to danger .
international jet airliners fly at an altitude of 9750 to 11580 meters ( 32000 to 38000 feet ) , and domestic airlines fly at 8530 to 8840 meters ( 28000 to 29000 feet ) .
modern jet aircrafts are not pressurized to a sea level equivalent pressure ( 760 mm hg ) . during flight ,
the cabin is pressurized to maintain the pressure equivalent to the altitude of 1520 to 2440 meters ( 5000 to 8000 feet)1 ) .
in other words , the cabin pressure is maintained within 536 to 611 mm hg .
gas in the cabin has been shown to expand its volume by 25 - 30% during flights3 ) .
neurosurgical , plastic , and otolaryngologic procedures , especially a craniotomy or skull base surgery , could leave air in the skull and create weak areas where a csf leak could occur .
the traveling patient could potentially encounter two neurosurgical problems : tension pneumocephalus resulting from expansion of the residual air after a craniotomy or a csf leak through a bony defect made by surgical procedures , resulting in pneumocephalus or pneumomeningoencephalitis . until now
, there have not been any reported cases of tension pneumocephalus caused by residual air during flight .
donovan et al.7 ) reported no aggravated cases of neurological deficits and intracranial pressure among twenty - one military casualties with pneumocephalus caused by trauma or a craniotomy during air transport from iraq to germany under usual cabin pressure .
two british studies focused on the medical advice given to post - craniotomy patients regarding air travel and addressed the unstandardized approach of airline companies and insufficient consensus among practicing consultant neurosurgeons2,13 ) .
a cracked tooth5 ) , mastoid air cells10 ) , osteoma of the skull base11 ) , pansinusitis6,9 ) , and a fistulous tract made by cranial4 ) and spinal8 ) surgery were suggested as weak areas or causes of weak areas that were susceptible to pressure changes . in our case
, pneumocephalus appeared to occur through the dormant fistulous tract because of the lowered cabin pressure and the synergistic effect of the lumboperitoneal shunt .
the medical guideline recommends waiting at least 7 days to fly after a transcranial procedure or a trauma that introduced gas into the skull without reliable evidence from a plain skull radiograph or ct scan that no air is present .
moreover , a person with a csf leak from any cause should not fly due to the risk of a backflow of air and microbial contamination1 ) .
although it is difficult to make one guideline to apply to all cases , the concern for possible problems during air travel by patients could lead to consensus among practicing consultant neurosurgeons .
creating guidelines for safe air travel for patients with neurosurgical problems is an important issue to consider because of the frequency with which some patients travel . a consultation with a health care provider addressing the cabin environment and neurosurgical conditions could be helpful for these patients . | a 49-year - old female with a history of several neurosurgical and otolaryngologic procedures for occipital meningioma and cerebrospinal fluid leaks was diagnosed with pneumocephalus after a one hour flight on a domestic jet airliner . despite multiple operations , the air appeared to enter the cranium through a weak portion of the skull base due to the low atmospheric pressure in the cabin .
the intracranial air was absorbed with conservative management .
the patient was recommended not to fly before a definite diagnostic work up and a sealing procedure for the cerebrospinal fluid leak site had been performed .
recent advances in aviation technology have enabled many people to travel by air , including individuals with medical conditions .
low cabin pressure is not dangerous to healthy individuals ; however , practicing consultant neurosurgeons should understand the cabin environment and prepare high risk patients for safe air travel . |
despite important developments in the medical treatment of rheumatoid arthritis ( ra ) , this disease has a major impact on important life areas of many patients . over the past two decades
, a growing emphasis has been put on arthritis self management strategies to help patients with ra cope with the consequences of the disease . in order to manage the disease on a day - to - day basis , patients need a formal body of knowledge and skills . individual , group - wise and internet - based educational programmes have proven to be effective in improving self - efficacy , as well as in diminishing pain and disability [ 35 ] in patients with ra . however , recent studies show limited long - term effects of standardised educational interventions , and the provision of more patient - centred and tailor - made programmes is advocated [ 69 ] .
tailor - made patient education requires good insight into the individual 's educational needs . until recently , no instruments were available to systematically assess ra patients ' educational needs .
this meant that the provision of educational strategies that were timely and relevant to the individual patient was difficult , and the planning of educational interventions on the group level more so . lately , the arthritis educational needs assessment tool ( enat ) was developed in the uk .
its early face validity was assessed among arthritis patients , and its test retest reliability demonstrated a good repeatability of the instrument ( rs = 0.82 ; icc = 0.87 ) .
the enat was later validated in patients with ra by rasch analysis and found to be a robust tool . until now
, little has been known about the educational needs of ra patients in the netherlands .
the aim of this paper is to describe the educational needs of dutch patients with ra by using a translated dutch version of the enat ( denat ) .
the original enat is a patient - completed questionnaire , comprising 39 items , grouped into seven domains : managing pain ( seven items ) , movement ( five items ) , feelings ( four items ) , arthritis process ( seven items ) , treatments ( seven items ) , self - help measures ( six items ) and support systems ( four items ) . within each domain ,
patients are asked to rate the question how important is it for you to know more about for all items in that domain .
the patients rate their responses using five - point likert scales with the descriptors : not at all important
= 3 , very important = 4 and extremely important
the scores of the various items are summed and divided by the number of items in that domain , resulting in all domain scores ranging from one to five .
if a single patient missed one or more items in a domain , the patient was not included in the analysis of that specific domain .
examples of statements in the denat are the following : ways to deal with moods and depression
( domain feelings ) and exercises i should be doing ( domain self - help measures ) .
the enat was translated into dutch using an established translation methodology , which comprised the following stages : an initial forward translation was undertaken by two independent bilingual translators ( cd and ib ) whose mother tongue was the target language ( dutch ) .
then , a back - translation was produced by an independent assessor ( pl and fk ) , translating the newly translated enat back into english .
finally , an expert committee including a methodologist ( tv ) , a health professional ( jv ) , all the previously mentioned translators and a translation recorder ( jh ) agreed upon the final version for field testing . the same process has been used successfully to translate the enat into finnish , norwegian , spanish and swedish . in the subsequent field testing
, 30 ra patients completed the denat and were interviewed to assess their understanding of the questions .
in october 2006 , a random sample of 319 patients with ra [ 283 women ( 89% ) and 36 men ( 11% ) , median age 68 years ] was selected from the total population of 1,054 ra patients visiting the outpatient clinic of the department of rheumatology at the leiden university medical center ( lumc ) in leiden , the netherlands , during a period of 12 months .
all patients were given a number using a microsoft excel random digit generator , and the highest 350 numbers were selected . after verification of the diagnosis in the medical record and a check of the national population register , 319 patients remained .
the denat and a questionnaire on age , gender , self - reported disease duration ( years ) and educational background were sent to these patients to complete at home and return to the lumc in a pre - stamped envelope via postal mail .
educational background was defined as highest formal education achievement and categorised as primary ( up to and including lower technical and vocational training ) , secondary ( up to and including secondary technical and vocational training ) and tertiary ( up to and including higher technical and vocational training and university ) .
the study was judged to be non - medical research according to the medical research involving human subjects act by the medical ethics review committee of the lumc . for this reason
, it was not necessary to obtain individual informed consent ( the participants were free to either fill in the questionnaire or not ) . the questionnaires were analysed descriptively using the statistical package for the social sciences ( spss 15.0 for windows , chicago , il , usa ) . because all items were measured at an ordinal level , for each domain , a median score with the inter - quartile range ( iqr ) was computed .
the educational needs were then compared between patient groups , categorised by age , disease duration , gender and educational background . the kruskal
wallis test ( h value ) was used to determine significant differences between patient groups .
the questionnaire was returned by 165 patients ( response rate = 52% ) with ra , including 146 females ( 88.5% ) and 19 males ( 11.5% ) , with a median age of 68 years ( iqr 5577 ) and a median disease duration of 13 years ( iqr 721 ) . based on their educational background ,
the numbers of patients with primary education were 29 ( 18% ) , with secondary education 99 ( 60% ) and with tertiary education 35 ( 21% ) , and two ( 1% ) had unknown educational backgrounds .
the internal consistency of the 39 denat items ( cronbach 's alpha reliability ) was 0.97 .
the median scores within the domains arthritis process , treatments from health professionals and
self - help measures were the highest ( 3.5 ) , whereas the scores for managing pain , movement , support systems and feelings were lower ( 3.0 ) .
high educational needs ) according to the denat completed in 165 dutch patients with ramanaging painmovementfeelingsarthritis processtreatments from health professionalsself - help measuressupport systemsmedian2.53.02.04.04.03.52.5iqr14141435352413 educational need scores ( range from one to five , equalling low
high educational needs ) according to the denat completed in 165 dutch patients with ra table 2 shows comparisons of enat domain scores between subgroups of patients . with the sample divided at the median age ( 68 years ) , it was found that older patients expressed significantly less educational need than younger patients regarding managing pain , feelings and support systems .
based on the cut - off point of the median disease duration ( 13 years ) , patients with longer disease durations had significantly more educational needs within the domain support systems than those with shorter disease duration .
there were no statistically significant differences in the enat domain scores between men and women or between patients with different educational backgrounds .
table 2differences in ra patients ' educational needs by age , disease duration , gender and educational backgroundmanaging painmovementfeelingsarthritis processtreatments health professionalsself - help measuressupport systemsage ( degrees of freedom ( df ) = 1)age group6868686868686868686868686868n7160776576687063726476627366median score2.52.03.03.02.51.04.04.04.04.03.53.52.51.5h value4.962 * 3.3095.644 * 2.3422.7621.04312.195*disease duration ( df = 1)years1313131313131313131313131313n7357766474687359726476597464median score2.03.03.03.02.02.04.04.04.04.03.03.52.02.5h value0.6660.5050.5821.1260.6780.0354.462*gender ( df = 1)gendermalefemalemalefemalemalefemalemalefemalemalefemalemalefemalemalefemalen17119181291813116121171241712517127median score1.82.52.03.01.02.54.04.03.04.03.03.51.02.5h value1.4041.1270.7290.2741.4990.8103.376educational background ( df = 2)level123123123123123123123n248229248933259032248131248730238830238931median score1.52.52.32.04.03.02.52.02.04.04.03.54.04.03.03.03.53.33.02.02.5h value4.0804.1220.7821.3864.4842.1720.751age ( divided in 68 years and 68 years , cut - off based on median age ) , disease duration ( divided in 13 years and 13 years , cut - off based on median duration ) , educational background ( divided in 1 : primary , 2 : secondary and 3 : tertiary)df degrees of freedom*h value indicating significant associations ( p < 0.05)managing pain associated with age : group 68 : mean rank = 72.7 and group 68 : mean rank = 58.1 ; p = 0.026feelings associated with age : group 68 : mean rank = 80.1 and group 68 : mean rank = 63.9 ; p = 0.018support systems associated with age : group 68 : mean rank = 81.1 and group 68 : mean rank = 57.7 ; p = 0.000support systems associated with disease duration : group 13 : mean rank = 63.0 and group 13 : mean rank = 77.1 ; p = 0.035 differences in ra patients ' educational needs by age , disease duration , gender and educational background age ( divided in 68 years and 68 years , cut - off based on median age ) , disease duration ( divided in 13 years and 13 years , cut - off based on median duration ) , educational background ( divided in 1 : primary , 2 : secondary and 3 : tertiary ) df degrees of freedom * h value indicating significant associations ( p < 0.05 ) managing pain associated with age : group 68 : mean rank = 72.7 and group 68 : mean rank = 58.1 ; p = 0.026 feelings associated with age : group 68 : mean rank = 80.1 and group 68 : mean rank = 63.9 ; p = 0.018 support systems associated with age : group 68 : mean rank = 81.1 and group 68 : mean rank = 57.7 ; p = 0.000 support systems associated with disease duration : group 13 : mean rank = 63.0 and group 13 : mean rank = 77.1 ; p = 0.035
the questionnaire was returned by 165 patients ( response rate = 52% ) with ra , including 146 females ( 88.5% ) and 19 males ( 11.5% ) , with a median age of 68 years ( iqr 5577 ) and a median disease duration of 13 years ( iqr 721 ) . based on their educational background ,
the numbers of patients with primary education were 29 ( 18% ) , with secondary education 99 ( 60% ) and with tertiary education 35 ( 21% ) , and two ( 1% ) had unknown educational backgrounds .
the internal consistency of the 39 denat items ( cronbach 's alpha reliability ) was 0.97 .
the median scores within the domains arthritis process , treatments from health professionals and
self - help measures were the highest ( 3.5 ) , whereas the scores for managing pain , movement , support systems and feelings were lower ( 3.0 ) .
high educational needs ) according to the denat completed in 165 dutch patients with ramanaging painmovementfeelingsarthritis processtreatments from health professionalsself - help measuressupport systemsmedian2.53.02.04.04.03.52.5iqr14141435352413 educational need scores ( range from one to five , equalling low
table 2 shows comparisons of enat domain scores between subgroups of patients . with the sample divided at the median age ( 68 years )
, it was found that older patients expressed significantly less educational need than younger patients regarding managing pain , feelings and support systems .
based on the cut - off point of the median disease duration ( 13 years ) , patients with longer disease durations had significantly more educational needs within the domain support systems than those with shorter disease duration .
there were no statistically significant differences in the enat domain scores between men and women or between patients with different educational backgrounds .
table 2differences in ra patients ' educational needs by age , disease duration , gender and educational backgroundmanaging painmovementfeelingsarthritis processtreatments health professionalsself - help measuressupport systemsage ( degrees of freedom ( df ) = 1)age group6868686868686868686868686868n7160776576687063726476627366median score2.52.03.03.02.51.04.04.04.04.03.53.52.51.5h value4.962 * 3.3095.644 * 2.3422.7621.04312.195*disease duration ( df = 1)years1313131313131313131313131313n7357766474687359726476597464median score2.03.03.03.02.02.04.04.04.04.03.03.52.02.5h value0.6660.5050.5821.1260.6780.0354.462*gender ( df = 1)gendermalefemalemalefemalemalefemalemalefemalemalefemalemalefemalemalefemalen17119181291813116121171241712517127median score1.82.52.03.01.02.54.04.03.04.03.03.51.02.5h value1.4041.1270.7290.2741.4990.8103.376educational background ( df = 2)level123123123123123123123n248229248933259032248131248730238830238931median score1.52.52.32.04.03.02.52.02.04.04.03.54.04.03.03.03.53.33.02.02.5h value4.0804.1220.7821.3864.4842.1720.751age ( divided in 68 years and 68 years , cut - off based on median age ) , disease duration ( divided in 13 years and 13 years , cut - off based on median duration ) , educational background ( divided in 1 : primary , 2 : secondary and 3 : tertiary)df degrees of freedom*h value indicating significant associations ( p < 0.05)managing pain associated with age : group 68 : mean rank = 72.7 and group 68 : mean rank = 58.1 ; p = 0.026feelings associated with age : group 68 : mean rank = 80.1 and group 68 : mean rank = 63.9 ; p = 0.018support systems associated with age : group 68 : mean rank = 81.1 and group 68 : mean rank = 57.7 ; p = 0.000support systems associated with disease duration : group 13 : mean rank = 63.0 and group 13 : mean rank = 77.1 ; p = 0.035 differences in ra patients ' educational needs by age , disease duration , gender and educational background age ( divided in 68 years and 68 years , cut - off based on median age ) , disease duration ( divided in 13 years and 13 years , cut - off based on median duration ) , educational background ( divided in 1 : primary , 2 : secondary and 3 : tertiary ) df degrees of freedom * h value indicating significant associations ( p < 0.05 ) managing pain associated with age : group 68 : mean rank = 72.7 and group 68 : mean rank = 58.1 ; p = 0.026 feelings associated with age : group 68 : mean rank = 80.1 and group 68 : mean rank = 63.9 ; p = 0.018 support systems associated with age : group 68 : mean rank = 81.1 and group 68 : mean rank = 57.7 ; p = 0.000 support systems associated with disease duration : group 13 : mean rank = 63.0 and group 13 : mean rank = 77.1 ; p = 0.035
this cross - sectional study among a random sample of patients with ra in the netherlands shows that there is a considerable educational need , particularly with respect to arthritis process , treatments from health professionals and self - help measures .
less importance was attributed to the need for education in the domains managing pain and movement .
these findings are in agreement with previous studies among ra patients and patients with various rheumatic diseases [ 10 , 18 , 19 ] which demonstrate a high need for information on disease and medical care .
a little important , despite the relatively high prevalence of anxiety and depression in patients with ra in general .
however , our results are in concordance with a recent study showing that patients with ra are the least interested in information regarding dealing with emotions . in our study , younger patients had a higher need for education within the domains managing pain , feelings and support systems than older patients .
the inverse association between age and information need is in line with the findings of other studies in the field of patient information and education [ 17 , 18 , 21 ] .
patients with longer disease duration showed higher educational needs on support systems , which is possibly related to more disease - related disability .
the division of the sample in two categories ( < or > 13 years ) for disease duration was merely based on the sample distribution . in addition ,
no significant association between gender and educational needs was observed in the present study , whereas other studies showed significantly higher needs for information and education in women than in men .
our results , however , point in the same direction , and the lack of significance could probably be explained by the fact that , in our sample , men were relatively underrepresented ( male / female ratio 1:8 ) .
our study showed no significant differences in educational needs among patients with different educational backgrounds . in literature ,
conflicting results regarding the association between educational level and educational needs among patients with arthritis have been reported [ 10 , 17 ] .
first , the sample was selected from only one hospital , the response was 52% , men were relatively underrepresented and the median age of the sample was relatively high ( 68 years ) , so the generalizability of the results may be limited . in the present study , we did not measure
if the need for information was related to the actual level of knowledge of the patients .
previous research by mkelinen in ra patients has demonstrated that younger and female patients obtained higher scores than older and male counterparts on the patient knowledge questionnaire , which was designed to assess patients ' general knowledge of ra and its treatments .
as younger people and women also appear to have the highest educational needs , measuring both the educational needs and the actual level of knowledge is probably to be preferred in the design of an educational programme for ra patients .
to conclude , the results of this study have shown that educational needs among dutch - speaking ra patients are high .
the findings underline the importance for patient education in ra as an integrated part of standard rheumatologic care . given the emphasis on patient - centred health care and tailor - made educational programmes [ 8 , 9 ] , the identification of individual educational needs becomes imperative .
so far , the denat is the only objective tool to identify educational needs among dutch - speaking patients with ra .
further research into the usefulness of the denat in daily clinical practice , and its application in other rheumatic diseases is needed .
moreover , a cross - cultural comparison of educational needs across countries [ 1316 ] would be interesting .
this collaborative work is currently underway , involving all countries which participated in the translation of the enat . | the educational needs assessment tool ( enat ) was developed in the united kingdom ( uk ) to systematically assess the educational needs of patients with arthritis .
the aim of the present study was to describe the educational needs of dutch patients with rheumatoid arthritis ( ra ) by using the dutch version of the enat ( denat ) .
the original uk version of the enat , comprising 39 items grouped into seven domains , was translated into dutch according to international guidelines for cross - cultural translation and adaptation .
the denat was then sent to a random sample of 319 ra patients registered at the outpatient clinic of a university hospital .
for each domain ( score range 15 , equalling low
high educational needs ) , a median score with the inter - quartile range was computed .
the kruskal
wallis test was used to determine possible associations between educational needs and age , disease duration , gender and educational background .
the response rate was 165 out of 319 ( 52% ) .
the median educational needs scores were 2.5 for managing pain
, 3.0 for movement , 2.0 for feelings , 4.0 for arthritis process , 4.0 for treatments from health professionals , 3.5 for self - help measures and 2.5 for support systems .
lower age and shorter disease duration were associated with more educational needs in the domain support systems .
in addition , younger patients had more educational needs regarding managing pain and feelings than older patients . there were no associations between gender or educational background and educational needs . the denat has demonstrated its ability to identify individual educational needs of dutch patients with ra .
the lower age and shorter disease duration were associated with more educational needs .
the practical applicability of the denat needs further research . |
peritoneal dialysis ( pd ) is a first choice and successful home - based dialysis modality for patients with end - stage kidney disease ( eskd ) , with great advantages for their quality of life : preservation of residual renal function , no vascular access requirement , and possibility of continuing scholar or professional activities [ 1 , 2 ] .
moreover , the international society of nephrology and international society of peritoneal dialysis strongly advise pd therapy for acute kidney injury , especially in a pediatric population . despite the abovementioned benefits ,
indeed , long - term pd may prompt the remodeling of peritoneal membrane and loss of mesothelial cells monolayer , increase in vascular density with diabetes - like vascular abnormalities ( typical pd - associated venular subendothelial hyalinosis ) , vascular calcifications , and interstitial fibrosis .
these pathological structural changes of the peritoneal membrane are most frequently followed by functional consequences resulting in progressive loss of peritoneal membrane ultrafiltration capacity leading to discontinuation of pd therapy [ 5 , 6 ] .
encapsulating peritoneal sclerosis ( eps ) is still worrying and is an uncommon life - threatening complication of peritoneal dialysis with an incidence of 0.5 to 2.5% and a high mortality rate ( 25% to 55% ) .
following the international society of peritoneal dialysis guidelines , diagnosis criteria of eps include the association of clinical symptoms , radiological and histological findings .
the main pathological feature of eps consists in a marked peritoneal fibrosis ; however it lacks specificity as various degrees of submesothelial thickening have been reported in patients with chronic kidney disease [ 9 , 10 ] .
nowadays , it appears that peritoneal fibrosis can not be entirely explained on the basis of the simple model of wound healing ( a three - phase model including injury of mesothelial cells , inflammation , and repair ) [ 7 , 12 , 13 ] .
this epithelial to mesenchymal transdifferentiation ( emt ) process , first described in kidney fibrosis , states that the mesothelial cells change into a mesenchymal phenotype , migrate to submesothelial areas , and differentiate into activated myofibroblasts , the cells responsible for fibrosis .
the emt was proposed to be involved mainly in the early stage of peritoneal fibrosis .
recent data demonstrate that the resident peritoneal interstitial cells are early activated following the aggression of mesothelial cells ( or epithelium ) , the inflammatory infiltrate , and profibrosing cytokine microenvironment . currently , new data suggest that peritoneal adipocytes could also contribute to this pathological process . in our study , we approached the emt process and adipocytes involvement in peritoneal fibrosis in a morphohistological retrospective analysis of 6 peritoneal tissue biopsies ( 3 cases with pd - related eps , 2 cases with normal peritoneal tissue , and 1 case with acute peritonitis , for a histological study during an acute inflammatory process ) .
our presented data show that the resident peritoneal adipocytes represent an underestimated source of peritoneal myofibroblasts in pd - induced eps .
the study was evaluated and approved by the local ethic committee ( erasme hospital number p2014/184 ) .
we included peritoneal biopsies samples of the 3 patients with eps diagnosed between 1995 and 2013 in our center .
we selected the 2 control patients with normal peritoneum ( randomly selected in our database of patients who had abdominal surgery in our center and with normal renal function ) .
we also analyzed 1 case with acute peritonitis , with normal renal function ( so without any eskd or peritoneal fibrosis ) , in order to evaluate the hypothesis of early crosstalk between inflammatory cells , mesothelial cells , and adipocytes .
for eps diagnosis , we applied the clinical and biological criteria adapted from nakamoto : ( i ) stage 1 ( pre - eps ) , characterized by loss of ultrafiltration , high transport status , hypoproteinaemia , bloody dialysate , ascites , and peritoneal calcifications ; ( ii ) stage 2 ( inflammatory ) , increase in c - reactive protein level and white blood cell count , fever , weight , and appetite loss ; ( iii ) stage 3 ( encapsulating or progressive ) , disappearance of signs of inflammation and appearance of signs of ileus ( nausea , vomiting , abdominal pain , and constipation ) , abdominal mass with ascites , and ( iv ) stage 4 ( obstructive or cocooning ) .
we used the formalin - fixed peritoneal tissue embedded in paraffin blocks available in the files of the pathology department of our hospital .
medical records analysis of included cases provided epidemiological data ( age , gender ) , pd characteristics ( dialysis modality , type of solution , and pd duration ) , clinical , radiological , and laboratory parameters at eps diagnosis , time between renal transplantation and the onset of eps symptoms , and prescribed immunosuppressive agents .
standard stainings ( masson 's trichrome and haematoxylin - eosin ( he ) ) were used to illustrate peritoneal fibrosis , mesothelial cells , and inflammatory infiltrate .
the entire sample of each peritoneal tissue specimen was analyzed by optical microscopy using low ( 40 and 100 ) , medium ( 200 ) , and high ( 400 ) magnifications ( carl zeiss , oberkochen , germany ) .
the study of tissue expression of podoplanin , ae1/ae3 cytokeratin ( mesothelial phenotype ) , calretinin ( expressed by mesothelial cells and adipocytes ) , vimentin ( mesenchymal phenotype ) , -sma ( myofibroblasts ) , cd4 , cd8 , cd20 , cd68 ( immunophenotyping of inflammatory cells ) , and cd31 ( endothelial cells marker ) was performed on sections of 4 m thickness using an immunohistochemistry analysis technique ( ventana xt - discovery , tucson , usa ) .
we chose the following human tissues as positive controls for immunohistochemistry of used antibodies : tonsil for immunostaining of anti - cd4 , anti - cd8 , anti - cd20 , and anti - cd68 antibodies ( 3-membrane and 1-membrane - cytoplasm patterns , resp . ) ; colon for anti - ae1/ae3 cytokeratin antibodies ( cytoplasm pattern ) ; vessels for anti--sma and anti - cd31 antibodies ( cytoplasm pattern ) ; sarcoma for anti - vimentin antibodies ( cytoplasm pattern ) ; and adipose tissue for anti - calretinin antibodies ( nuclear and cytoplasm pattern ) .
the negative controls were performed in the absence of primary antibodies and showed no staining ( table 1 ) .
the semiquantitative score for cytokeratin ae1/ae3 , calretinin , vimentin , and -sma expression was applied as follows : strong expression ( + + + ) , moderate expression ( + + ) , low expression ( + ) , or no expression ( 0 ) .
the quantitative analysis of cd4 expression ( subpopulation of t helper cells and infiltration macrophages ) , cd8 expression ( subpopulation of cytotoxic / suppressor t cells ) , cd20 ( b cells population ) , and cd68 ( circulating monocyte and macrophages ) was performed by calculating the number of positive cells per field ( high magnification , 400 ) . for quantitative analysis of cd31 expression ( vascular density ) ,
we analyzed 20 fields at random in each case using an optical microscope ( carl zeiss , oberkochen , germany ) .
we identified a 17-year - old man ( case 1 ) and two women aged 64 years ( case 2 ) and 39 years ( case 3 ) treated with pd ( for 21 , 90 , and 164 months , resp . ) , who developed eps after shift to hemodialysis ( case 1 ) and after first ( case 2 ) and second kidney transplantation ( case 3 ) . in all cases , the diagnosis was suspected because of digestive symptoms , systemic inflammation , and normocytic anemia .
their abdominal ct scan showed , in addition to abundant ascites , diffuse peritoneal calcifications , with parietal and visceral involvement ( figure 1 ) .
positron emission tomography with [ f ] fluorodeoxyglucose ( fdg - pet ) was available only in one case ( case 3 ) and demonstrated significant fdg uptake by the parietal peritoneal membrane ( figure 1 ) . compared with the normal peritoneal tissue biopsies ( controls ) , massive submesothelial thickening corresponding to fibrosis
was associated with the disappearance of the mesothelium in all eps cases ( figure 2 ) . in controls
, we observed a distinct monolayer of cubic mesothelial cells closely attached to one another and affixed to the thin basement membrane , which was in direct contact with a waste area of adipose tissue . in the control 3 biopsy ( acute peritonitis ) , mesothelium was well preserved but we found a marked hyperplasia of mesothelial cells attached to the basement membrane and the apposition of inflammatory connective tissue containing predominantly polymorphonuclear neutrophils infiltrate ( figure 2 ) . in all 3 control peritoneal biopsies ,
the thin layer of mesothelial cells strongly expressed podoplanin , cytokeratin ae1/ae3 , and calretinin ( mesothelial markers ) ( figure 3 , table 3 ) ; these data are consistent with literature .
podoplanin expression was also found in the endothelial cells of lymphatic vessels and mesothelium ( figures 3(a)3(d ) ) . in case with acute peritonitis
, mesothelial cells did not express podoplanin . only in case 1 of eps ,
hyperplastic podoplanin positive mesothelial cells were clearly identified in the interstitium , which had a completely remodeled architecture . in this case , an acute inflammatory component was present at the time of peritoneal biopsy . interestingly , in case 3 of eps , we objectified increased podoplanin expression by deep vascular structures .
high expression of cytokeratin ae1/ae3 by mesothelial cells was observed in the 3 controls but was lacking in all cases of eps ( figures 3(e)3(h ) , table 3 ) . in the acute peritonitis case , mesothelial cells did not express cytokeratin ae1/ae3 . despite basement membrane rupture , we did not find ae1/ae3 + cells migrating to interstitial areas . only in case 1 of eps ,
interestingly , expression of calretinin by adipocytes , although in low intensity ( + ) , was constant in all of our 3 controls and acute peritonitis .
nevertheless , we clearly objectified an interstitial accumulation of calretinin positive spindle cells in the 3 eps cases ( figures 3(i)3(l ) , table 3 ) . in comparison with controls ,
we found diffuse mononuclear cells infiltration containing macrophages , t cells , and few b cells in all eps cases .
we observed a marked heterogeneity between the eps cases , with a highly variable degree of mononuclear cell infiltration , containing mainly cd68 + and cd8 + cells .
those cells were absent in the interstitium from patient with acute peritonitis that contained several polymorphonuclear cells ( figure 4 , table 3 ) .
the constitutional expression of -sma was mainly found in the vessels and in some rare interstitial cells . in all cases ,
many spindle cells expressed vimentin and -sma and corresponded to mesenchymal cells and myofibroblasts accumulation ( figure 5 ) .
a significant increase in vascular density ( cd31 positive endothelial cells ) was observed in all eps cases , as compared with controls ( figure 6 , table 3 ) .
the main finding of our study was the discovery of fusiform calretinin positive cells in areas of severe submesothelial fibrosis in all eps patients .
in normal peritoneal tissue biopsy , weak calretinin staining was found in adipocytes and more enhanced in mesothelial cells according to literature .
calretinin ( 29 kda calbindin ) is a vitamin d - dependent calcium - binding protein coded by the calb2 gene and emerges as a multifunctional protein associated with cells development , proliferation , differentiation , and cell death .
our eps cases were recognized after discontinuation of pd , suggesting the need for vigilance of the nephrologists taking care about transplanted or on hemodialysis patients previously treated by pd . as the incidence of eps increases with time after renal transplantation , the immunosuppressive regimen involvement in the pathogenesis of posttransplant eps remains an unresolved question .
several other risk factors have been identified such as high glucose concentration dialysate , long duration of pd , young age , and the use of beta - blockers or cyclosporine and peritonitis [ 7 , 11 , 16 ] .
one constant in these factors is the duration of pd , confirmed recently by two independent groups [ 20 , 21 ] .
indeed , more severe fibrosis is observed in transplanted patient with longest pd vintage and who had a high glucose exposure . besides the duration of pd therapy , the number of peritonitis episodes is still a significant risk factor [ 20 , 21 ] .
for this reason , in our morphohistological study we included a case of acute peritonitis not related to pd or eskd , in order to evaluate the hypothesis of early crosstalk between inflammatory cells and resident peritoneal membrane cells ( adipocytes and mesothelial cells ) .
these interactions could be an early link between the pd - related peritonitis ( acute inflammation ) and peritoneal fibrosis .
interestingly , we found some morphological similarities between mesothelial cells hyperplasia observed in acute peritonitis and in eps cases , which is in accordance with the findings by others .
the reason for mesothelial cells hyperplasia is unknown ; however it may be postulated that the cells are activated secondarily by cytokines ( released by inflammatory cells ) or by hypertonic solutions .
peritoneal thickening and lowering in the lumen / vessels diameter ratio related to uremia have been reported in patients with chronic kidney diseases .
the emt process has been proposed as a chief pathway of peritoneal fibrosis , mainly in its early stage , so early before beginning pd . despite extensive studies on emt [ 14 , 23 , 24 ] ,
many aspects of peritoneal membrane remodeling and eps remain poorly understood [ 25 , 26 ] suggesting that additional novel mechanisms and pathways need to be explored .
interpretation of our data is unfortunately limited by the small number of studied biopsies as well as the fact that they were obtained at advanced stages of eps . indeed , agreeing to nakamoto , cases 1 , 2 , and 3 corresponded to pre - eps and inflammatory and progressive or encapsulating eps , respectively .
similar to previous report , we did not find a transmembrane migration of mesothelial cells into the interstitium , a pivotal phase of emt .
the role of emt in peritoneal fibrosis has been adapted from mechanisms reported in kidney fibrosis ( kf ) .
in fact , resident cells ( fibroblasts ) are considered as the main source as only 5% of myofibroblasts derived from emt in experimental models of kf . as in the renal fibrosis ,
already present resident peritoneal cells should be considered as a potential source for myofibroblasts generation . indeed , peritoneal adipocytes are pluripotent cells and they are active players in fibrosis [ 3234 ] .
therefore , peritoneal calretinin positive adipocytes might be a new and actually underestimated source of myofibroblasts .
as compared with controls , the submesothelial adipose tissue containing several calretinin positive adipocytes completely disappeared ; nonetheless numerous fusiform calretinin positive cells were observed in the areas of peritoneal fibrosis in eps biopsies .
intriguingly , in case of acute peritonitis , we found that a submesothelial layer of inflammatory cells closely bordered adipocytes . unfortunately because of insufficient quantity of peritoneal tissue biopsies , the expression of adipose cells mrna was not performed .
besides dialysate , several cytokines and growth factors such as transforming growth factor - beta ( tgf- ) a pivotal profibrotic cytokine secreted by injured mesothelial cells and/or inflammatory cells could be involved in adipocytes differentiation into the peritoneal fibroblasts .
in fact , strong evidence suggests a possible crosstalk between the pd solutions , adipose tissue , and peritoneal fibrosis [ 15 , 32 ] .
moreover , adipocytes mediate numerous physiological processes , secreted adipokines ( leptin , adiponectin ) , cytokines ( tnf , il-6 ) , and growth factors including transforming growth factor - beta ( tgf- ) .
leptin stimulates lipolysis and inhibits lipogenesis . in human peritoneal mesothelial cells , it has been reported that glucose increased the leptin mrna expression and its synthesis .
concomitantly , the leptin receptor was upregulated in mesothelial cells and leptin induced the release of tgf- by mesothelial cells .
it must be taken into account that adipocytes could be potentially in direct contact with the glucose contained in pd solution after disruption of mesothelium integrity .
indeed shedding of mesothelial cells into the peritoneal cavity by alteration of cell junctions and basement membrane denudation are induced by recurrent mechanical stress related to the daily variations in intra - abdominal pressure and to turbulences of in- and outflow of pd solutions ( volume , number of cycles ) [ 1 , 7 ] . above data
could be a plausible way to explain the observed loss of adipose tissue as our cases were exposed to high glucose concentration pd solutions during a long time . in conclusion , we report that the involvement of emt in peritoneal fibrosis is difficult to demonstrate .
the calretinin positive cells accumulate in the submesothelial fibrosis so that adipocytes might be an underestimated component and a new source of myofibroblasts in peritoneal remodeling during eps related to pd . | background . encapsulating peritoneal sclerosis ( eps ) is a rare but serious complication of peritoneal dialysis ( pd ) . besides the endothelial - to - mesenchymal transition ( emt )
, recently peritoneal adipocytes emerged as a potential source of fibrosis .
we performed immunohistochemistry to approach emt and to localize peritoneal adipocytes in peritoneal biopsies from pd - related eps patients .
material and methods .
we investigated tissue expression of podoplanin , cytokeratin ae1/ae3 ( mesothelium ) , calretinin ( adipocytes ) , alpha - smooth muscle actin [ -sma ] ( mesenchymal cells ) , interstitial mononuclear cell inflammation , and neoangiogenesis ( cd3 , cd4 , cd8 , cd20 , cd68 , and cd31 immunostainings , resp . ) .
results .
three patients ( 1 man/2 women ; 17 , 64 , and 39 years old , resp . ) developed eps after 21 , 90 , and 164 months of pd therapy . in patients with eps , we observed ( 1 ) loss of ae1/ae3 cytokeratin+ mesothelial cells without any evidence of migration into the interstitium , ( 2 ) disappearance of adipose tissue , ( 3 ) diffuse infiltration of calretinin+ cells in the areas of submesothelial fibrosis with a huge number of -sma and calretinin+ fusiform cells , and ( 4 ) increased vascular density . conclusion .
we report that the involvement of emt in peritoneal fibrosis is difficult to demonstrate and that the calretinin+ adipocytes might be an underestimated component and a new source of myofibroblasts in peritoneal remodeling during pd - related eps . |
the device consists of three layers made from pdms prepolymer and curing agent ( sylgard 184 , dow corning co. , midland , mi ) at a 10:1 ratio .
the top and bottom layers are molded against a master mold made by standard photolithography using the negative - photoresist su-8 ( su-8 , microchem co. , newton , ma ) .
the master molds were silanized in a desiccator for 2 hours ( united chemical tech . ,
the height of all top layer and bottom layer features is 100 m except for those in the top layer of figure 3 which is 30 m .
the pdms molds of the top and bottom layers were cured in a 120c oven for over 2 hours .
the middle - layer membrane was made by spin - coating a 30 m pdms layer on a silanized silicon - wafer at 1500rpm for 90 seconds and then curing in a 120c oven for 30min .
all layers were bonded together using oxygen plasma treatment ( spi plasma - prep ii , structure probe , inc . , west chester , pa ) for 30 seconds .
the three layers of the device are bonded together using oxygen plasma for 30 seconds . in the first step , the thin pdms membrane , while still on the silicon wafer ( or any flat substrate ) , is bonded to either the top or bottom layer and then the two bonded layers are detached from the wafer .
holes are punched into the bonded middle layer , using a 350 m biopsy punch ( ted pella inc . , redding , ca ) , for the check - valve and switch - valve components for all figures except figure 3e which used a 29 gauge insulin syringe . for check - valve components ,
a hole is punched in the downstream region of the cavity directly after the gap .
switch - valves have holes punched to interface access channels of the top and bottom layers . to ensure efficacy of the components ,
the circular shape of the biopsy punch can be molded into either or both the bottom layer and top layer so the hole is accurately punched every time ( as shown in figure 4a ) .
for the second step , the top layer and the bonded middle and bottom layers are bonded .
the gap regions of the components are rendered unable to permanently bond to the middle membrane by placing a pdms stamp which has extruding features that correspond to the gap regions negating exposure to oxygen plasma .
finally in step three , all layers are aligned and bonded together ; the device is incubated at 60c for 1 minute to enhance the bond strength .
the device should not be used directly after being placed in a vacuum since it can cause some components to open ; in which case waiting about 30 minutes allows air to penetrate back in .
the dependence of threshold pressure on the geometry of a component was characterized for three lengths of both l1 and w ( as shown in fig .
the threshold pressure was determined by continuously measuring the differential pressure across the component with a differential pressure transducer ( model px139 - 005d4v , omega eng .
inc . , stamford , ct ) as a syringe pump continuously pressurized the microchannel with a flow - rate of 6ml / hr .
the pressure transducers were connected to access microchannels that were located directly before and after the component for quicker response timing and more accurate readings . the threshold pressure for a given trial
was determined by the peak pressure in the pressure histogram as measured by the transducer as the component pressurized to a critical limit and opened .
the average of three trials was plotted to give the relationship between the threshold pressure and the component dimension .
threshold pressures for components with a constant w of 1 mm with l1 values of 800 m , 400 m , and 200 m as well as for a constant l1 of 800 m with w values of 1000 m , 500 m , and 250 m are provided in si .
the oscillator pressure measurements were performed by measuring the gauge pressure of both inlets simultaneously using two pressure transducers ( model px26 - 015dv , omega eng .
measurements were taken every 100ms and the graphs are the moving time - average of 50 minus the measured zero value for each sensor .
the device consists of three layers made from pdms prepolymer and curing agent ( sylgard 184 , dow corning co. , midland , mi ) at a 10:1 ratio .
the top and bottom layers are molded against a master mold made by standard photolithography using the negative - photoresist su-8 ( su-8 , microchem co. , newton , ma ) .
the master molds were silanized in a desiccator for 2 hours ( united chemical tech . ,
the height of all top layer and bottom layer features is 100 m except for those in the top layer of figure 3 which is 30 m .
the pdms molds of the top and bottom layers were cured in a 120c oven for over 2 hours .
the middle - layer membrane was made by spin - coating a 30 m pdms layer on a silanized silicon - wafer at 1500rpm for 90 seconds and then curing in a 120c oven for 30min .
all layers were bonded together using oxygen plasma treatment ( spi plasma - prep ii , structure probe , inc . , west chester , pa ) for 30 seconds .
the three layers of the device are bonded together using oxygen plasma for 30 seconds . in the first step , the thin pdms membrane , while still on the silicon wafer ( or any flat substrate ) , is bonded to either the top or bottom layer and then the two bonded layers are detached from the wafer .
holes are punched into the bonded middle layer , using a 350 m biopsy punch ( ted pella inc . , redding , ca ) , for the check - valve and switch - valve components for all figures except figure 3e which used a 29 gauge insulin syringe . for check - valve components ,
a hole is punched in the downstream region of the cavity directly after the gap .
switch - valves have holes punched to interface access channels of the top and bottom layers . to ensure efficacy of the components ,
the circular shape of the biopsy punch can be molded into either or both the bottom layer and top layer so the hole is accurately punched every time ( as shown in figure 4a ) .
for the second step , the top layer and the bonded middle and bottom layers are bonded .
the gap regions of the components are rendered unable to permanently bond to the middle membrane by placing a pdms stamp which has extruding features that correspond to the gap regions negating exposure to oxygen plasma .
finally in step three , all layers are aligned and bonded together ; the device is incubated at 60c for 1 minute to enhance the bond strength .
the device should not be used directly after being placed in a vacuum since it can cause some components to open ; in which case waiting about 30 minutes allows air to penetrate back in .
the dependence of threshold pressure on the geometry of a component was characterized for three lengths of both l1 and w ( as shown in fig .
the threshold pressure was determined by continuously measuring the differential pressure across the component with a differential pressure transducer ( model px139 - 005d4v , omega eng .
inc . , stamford , ct ) as a syringe pump continuously pressurized the microchannel with a flow - rate of 6ml / hr .
the pressure transducers were connected to access microchannels that were located directly before and after the component for quicker response timing and more accurate readings . the threshold pressure for a given trial
was determined by the peak pressure in the pressure histogram as measured by the transducer as the component pressurized to a critical limit and opened .
the average of three trials was plotted to give the relationship between the threshold pressure and the component dimension .
threshold pressures for components with a constant w of 1 mm with l1 values of 800 m , 400 m , and 200 m as well as for a constant l1 of 800 m with w values of 1000 m , 500 m , and 250 m are provided in si . for all components ,
the oscillator pressure measurements were performed by measuring the gauge pressure of both inlets simultaneously using two pressure transducers ( model px26 - 015dv , omega eng .
measurements were taken every 100ms and the graphs are the moving time - average of 50 minus the measured zero value for each sensor .
| a critical need for enhancing usability and capabilities of microfluidic technologies is the development of standardized , scalable , and versatile control systems1,2 .
electronically controlled valves and pumps typically used for dynamic flow regulation , although useful , can limit convenience , scalability , and robustness35 .
this shortcoming has motivated development of device - embedded non - electrical flow - control systems .
existing approaches to regulate operation timing on - chip , however , still require external signals such as timed generation of fluid flow , bubbles , liquid plugs or droplets , or an alteration of chemical compositions or temperature616 . here
, we describe a strategy to provide device - embedded flow switching and clocking functions .
physical gaps and cavities interconnected by holes are fabricated into a three - layer elastomer structure to form networks of fluidic gates that can spontaneously generate cascading and oscillatory flow output using only a constant flow of newtonian fluids as the device input .
the resulting microfluidic substrate architecture is simple , scalable , and should be applicable to various materials .
this flow - powered fluidic gating scheme brings the autonomous signal processing ability of microelectronic circuits to microfluidics where there is the added diversity in current information of having distinct chemical or particulate species and richness in current operation of having chemical reactions and physical interactions . |
effective water disinfection from fecal coliforms is a problem whose solution , leads to the improvement of environmental health conditions .
presently , water disinfection of fecal coliforms commonly uses chemical and conventional radiant heating methods .
. bacterial deactivation by conventional radiant heating is achieved through the thermal decay of biomolecules including proteins and dna .
both of these methods maintain fundamental disadvantages including harmful side effects and extensive disinfecting time .
to address this problem , the identification of rapid disinfection methods such as microwave heating was explored .
microwave heating is the use of microwave radiation ( 2.45ghz ) to induce collisional deactivation resulting in thermal heating .
this process maintains several advantages over conventional radiant heating for bacterial deactivation including rapid heating rates and reduced energy requirements .
additionally , microwave heating has been found to heat more uniformly compared to conventional radiant heating thereby increasing energy efficiency .
goldblith and wang compared the deactivation of escherichia coli and bacillus subtilis spores using microwave irradiation versus conventional radiant heating .
they suggested that the deactivation of these bacteria resulted from the dielectric heating and did not maintain any secondary effect from the microwave irradiation .
. found no difference between conventional radiant and microwave heating for the disinfection of b. subtilis spores in automated temperature monitoring systems .
kazbekov and vyacheslavov found a series of biochemical processes that were altered in e. coli and b. subtilis under microwave irradiation which included thymidine and thymine uptake , leakage of potassium and hydrogen ions , and uptake of dna .
. found no major differences in deactivation rates of e. coli in phosphate buffer between microwave and conventional radiant heating .
. also found no difference between conventional and microwave deactivation of clostridium sporogenes at 90c , 100c , and 110c .
vela et al . , rosn also found that the deactivation of several bacteria , including streptococcus faecalis ( later classified as enterococcus faecalis ) and saccharomyces cerevisiae , under microwave irradiation resulted from the dielectric heating .
conversely , shin and pyun compared the results of deactivation of lactobacillus plantarum by conventional heating at 50c versus continuous microwave heating and pulsed higher power microwave heating over a 30 minute period .
they found greater reduction in bacterial survival for pulsed microwave heating relative to conventional and continuous microwave heating .
these results suggested a secondary non - thermal mechanism assisted the deactivation of these bacteria during microwave irradiation .
culkin and fung and kozempel et al . also suggest that a secondary non - thermal mechanism assisted in the deactivation of certain species of bacteria .
heddleson and doores reported that non - thermal effects are likely to be due to the lack of precise measurements of the time - temperature history and its spatial variations . in our recent paper dependencies between bacterial viability of enterococcus faecalis , staphylococcus aureus , and escherichia coli versus microwave heating time and conventional radiant temperature ,
the proposed mathematical models for conventional and microwave heating took into account growth and death factors of bacteria whose , relationships formed second degree polynomial functions .
these models were found to be consistent with experimental data maintaining correlation coefficients between 0.84 0.99 .
watanabe et al . showed that ionic strength was able to influence the bacterial survival during microwave irradiation .
they showed that 10-fold increase in e. coli deactivation rates in the presence of molar concentrations of nacl and kcl .
several transitional metals , such as calcium , cobalt , copper , chromium , potassium , iron , magnesium , nickel , zinc , manganese , sodium , are essential for normal biochemical processes . in small concentrations they serve as micronutrients and are used for redox - processes , stabilize molecules through electrostatic interactions , are components of various enzymes , and regulate osmotic pressure . however , other transitional metals such as silver , aluminum , cadmium , gold , mercury , lead , have no biological role and are potentially toxic to bacteria . toxicity of transitional metal ions depends on their concentration , form , and other factors , including water temperature [ 25 , 26 , 27 ] .
most scientific investigations with transitional metal ions were conducted with silver and copper ions in combination with other compounds [ 28 , 29 , 30 ] .
al . reported that the addition of silver ions was effective against coliforms [ 31 , 32 ] .
abad et al . found that the existence of copper and silver ions in combination with low levels of chlorine leads to increased reduction of poliovirus .
landeen et al . showed the efficiency of copper and silver ions in combination with low level of chlorine for deactivation of legionella pneumophilla .
ragab - depre found that addition of a hydrogen peroxide - ascorbic acid - cu(ii ) ( 60 min ) to secondary effluents resulted in 99% reduction of enterobacteriaceal , total and fecal coliforms and staphylococci .
oganesov proposed a mechanism for the deactivation of bacteria in water using silver ions .
myers and nealson studied the influence of manganese oxide on bacterial reduction and growth .
calomiris et al . studied the effects of different metal ions such as cu , pb , zn , al , sn , and cd on escherichia coli , staphylococcus aureus , and several other bacteria .
they found that the existence of cu and zn sufficiently decreased the number of escherichia coli in water .
staphylococcus aureus was sensitive to all of the metal ions mentioned above except the ion al .
[ 41 , 42 ] described the resistance of staphylococcal strains to several metal ions and antibiotics .
unfortunately , the process of bacterial deactivation using only transitional metal ions takes several hours . on the other hand ,
for example , butkus et al . found that the addition of silver ions enhanced deactivation of coliphage ms-2 by uv disinfection .
it is proposed that the presence of metal ions may increase the deactivation rate of bacteria during microwave treatment , thereby , reducing the time of treatment . in this work
the effect of iron and cobalt ions in water on microwave deactivation of e. faecalis , s. aureus and e. coli was investigated .
stock cultures of e. faecalis , s. aureus and e. coli ( ward natural scientific , rochester , ny ) were created by growing them in tsb ( tryptic soy broth ) overnight in a labline imperial iii incubator ( model # 305 ) at a temperature of 37c .
an aliquot of 10l of stock culture was then placed into 250 ml sample vials containing 100 ml of distilled deionized water purified by a barnsted e - pure system ( model # d4641 ) .
the sample vials were then heated in a panasonic inverter microwave ( model # nn - s543bf ) at power 130w for 1 , 2 , 3 , 4 , and 5 minutes .
fifty microliters of the test solutions were plated in exponential spiral fashion on to 10 tsa ( tryptic soy agar ) plates for each sample group using a spiral biotech autoplate 4000 ( model # ap 4000 ) .
the plates were then incubated overnight in a labline imperial iii incubator ( model # 305 ) .
finally , the colony forming units were counted using a spiral biotech q - count ( model # 510 ) auto - plate reader set for a 50l exponential spiral pate setting .
the cfus ( colony forming units ) were then calculated and graphed using grapad prism .
stock cultures of e. faecalis , s. aureus and e. coli ( ward natural scientific , rochester , ny ) were created by growing them in tsb ( tryptic soy broth ) overnight in a labline imperial iii incubator ( model # 305 ) at temperature of 37c .
an aliquot of 10l of stock culture was then placed into 250 ml sample vials containing 100 ml a 1.0 10 m of iron or cobalt ion solution .
the sample vials were then microwave heated in a panasonic inverter microwave ( model # nn - s543bf ) at power 130 w for 1 , 2 , 3 , 4 , and 5 minutes .
the cfus of a 50l aliquot of the test solutions were calculated using the same method previously described for distilled water samples .
stock cultures of e. faecalis , s. aureus and e. coli ( ward natural scientific , rochester , ny ) were created by growing them in tsb ( tryptic soy broth ) overnight in a labline imperial iii incubator ( model # 305 ) at a temperature of 37c .
an aliquot of 10l of stock culture was then placed into 250 ml sample vials containing 100 ml of distilled deionized water purified by a barnsted e - pure system ( model # d4641 ) .
the sample vials were then heated in a panasonic inverter microwave ( model # nn - s543bf ) at power 130w for 1 , 2 , 3 , 4 , and 5 minutes .
fifty microliters of the test solutions were plated in exponential spiral fashion on to 10 tsa ( tryptic soy agar ) plates for each sample group using a spiral biotech autoplate 4000 ( model # ap 4000 ) .
the plates were then incubated overnight in a labline imperial iii incubator ( model # 305 ) .
finally , the colony forming units were counted using a spiral biotech q - count ( model # 510 ) auto - plate reader set for a 50l exponential spiral pate setting .
the cfus ( colony forming units ) were then calculated and graphed using grapad prism .
stock cultures of e. faecalis , s. aureus and e. coli ( ward natural scientific , rochester , ny ) were created by growing them in tsb ( tryptic soy broth ) overnight in a labline imperial iii incubator ( model # 305 ) at temperature of 37c .
an aliquot of 10l of stock culture was then placed into 250 ml sample vials containing 100 ml a 1.0 10 m of iron or cobalt ion solution .
the sample vials were then microwave heated in a panasonic inverter microwave ( model # nn - s543bf ) at power 130 w for 1 , 2 , 3 , 4 , and 5 minutes .
the cfus of a 50l aliquot of the test solutions were calculated using the same method previously described for distilled water samples .
experimental results for microwave irradiation of e. faecalis , s. aureus , and e. coli in the presence of cobalt ions in water are summarized into table 1 and figs . 1 and 3 ( square points ) .
the results showed the existence of two distinct processes : increasing of number of viable bacteria with microwave time of during the first stage of heating , and passing through maximum value of bacterial viability then decreases in relationship to microwave time .
the growth factor was found in the first minute of microwave heating showing a 2.4% increase in bacterial viability . above the optimal microwave time
the death factor occurred between the first and third minutes showing 102.4% decrease in bacterial viability .
the greatest drop in bacterial viability reduction ( 96.6% ) was found between the second and third minutes of microwave heating .
table 1 shows the bacterial viabilities of e. faecalis , s. aureus , and e. coli ( n=10 ) when microwaved for 4 minutes in the presence of cobalt ions compared to control samples ( distilled water ) .
the results showed notably lower bacterial viability in the presence of cobalt versus that of the control samples .
e. coli also had a growth factor in the first minute of microwave irradiation ( 25.0% increase bacterial viability ) .
the largest drop in e. coli viability ( 116% ) was found between the second and third minutes of microwave irradiation .
in contrast with other bacteria , s. aureus showed no major change in bacterial viability in the first minute of the microwave heating .
after this initial minute , s. aureus viability then slowly decreased in the second minute with a 34.9% reduction .
we can explain this fact by assuming that the death factor is influenced by the presence of cobalt ions which had a powerful effect on s. aureus compared to other test organism . for comparison , in table 1 and figs .
1 and 3 we also show data from our previous paper for microwave treatment for e. faecalis , s. aureus and e. coli in distilled water ( triangular points ) .
this data illustrates that the disinfection s in the presence of cobalt ions ( 3 min ) is less than that of the distilled water control ( 4 5 min ) .
therefore , the presence of cobalt ions into water increased the efficiency of the microwave deactivation of bacteria .
experimental results for microwave irradiation of e. faecalis , s. aureus , and e. coli in the presence of iron ions into water are summarized into table 2 and figs . 4 and 6 ( square points ) .
the results also showed the existence of both growth and death factors . in this circumstance ,
the death factor for e. faecalis is weaker , and s. aureus and e. coli are stronger in comparison with the influence of cobalt ions . for e. faecalis the growth factor
was found in the first minute of microwave heating showing a 4.7% increase in bacterial viability .
the death factor for e. faecalis occurred between the first and fourth minutes leads to 104.7% of bacterial viability reduction . the greatest decline in bacterial viability reduction
was found between the second and third minutes of microwave irradiation ( 63.7% ) . however , the influence of iron ions on e. faecalis was weaker when compared with the influence cobalt ions , and at the third minute results ( 38.2% ) .
table 2 shows the bacterial viabilities of e. faecalis , s. aureus , and e. coli ( n = 10 ) when micro - waved for 4 minutes in the presence of iron ions compared to control samples ( distilled water ) .
the results showed that the presence of iron reduced the disinfection time for all test bacteria .
the most significant decrease was e coli whose disinfection time reduced from four minutes to one minute .
the number of viable s. aureus was constant during the first two minutes of microwave treatment with a rapid decrease ( 94% ) during the third minute .
e. coli viability showed a sharp decline during microwave heating in the presence of iron ions . during the first minute of microwave treatment bacterial viability for e. coli
contrary to other data , e. coli disinfection denotes the strong influence of iron ions on micro - organisms . for comparison , table 2 and figs . 4 and 6 , data for microwave treatment of e. faecalis , s. aureus and e. coli in distilled water ( triangular points ) was included from our previous paper .
this data showed that disinfection time in the presence of iron ions ( 13 min ) is less than in distilled water ( 4 5 min ) .
so , the presence of iron ions in water increased the efficiency of the microwave deactivation of bacteria .
experimental results for microwave irradiation of e. faecalis , s. aureus , and e. coli in the presence of cobalt ions in water are summarized into table 1 and figs . 1 and 3 ( square points ) .
the results showed the existence of two distinct processes : increasing of number of viable bacteria with microwave time of during the first stage of heating , and passing through maximum value of bacterial viability then decreases in relationship to microwave time .
the growth factor was found in the first minute of microwave heating showing a 2.4% increase in bacterial viability . above the optimal microwave time
the death factor occurred between the first and third minutes showing 102.4% decrease in bacterial viability .
the greatest drop in bacterial viability reduction ( 96.6% ) was found between the second and third minutes of microwave heating .
table 1 shows the bacterial viabilities of e. faecalis , s. aureus , and e. coli ( n=10 ) when microwaved for 4 minutes in the presence of cobalt ions compared to control samples ( distilled water ) .
the results showed notably lower bacterial viability in the presence of cobalt versus that of the control samples .
e. coli also had a growth factor in the first minute of microwave irradiation ( 25.0% increase bacterial viability ) .
the largest drop in e. coli viability ( 116% ) was found between the second and third minutes of microwave irradiation .
in contrast with other bacteria , s. aureus showed no major change in bacterial viability in the first minute of the microwave heating .
after this initial minute , s. aureus viability then slowly decreased in the second minute with a 34.9% reduction .
we can explain this fact by assuming that the death factor is influenced by the presence of cobalt ions which had a powerful effect on s. aureus compared to other test organism . for comparison , in table 1 and figs .
1 and 3 we also show data from our previous paper for microwave treatment for e. faecalis , s. aureus and e. coli in distilled water ( triangular points ) .
this data illustrates that the disinfection s in the presence of cobalt ions ( 3 min ) is less than that of the distilled water control ( 4 5 min ) .
therefore , the presence of cobalt ions into water increased the efficiency of the microwave deactivation of bacteria .
experimental results for microwave irradiation of e. faecalis , s. aureus , and e. coli in the presence of iron ions into water are summarized into table 2 and figs . 4 and 6 ( square points ) .
the results also showed the existence of both growth and death factors . in this circumstance , the death factor for e. faecalis is weaker , and s. aureus and e. coli are stronger in comparison with the influence of cobalt ions .
for e. faecalis the growth factor was found in the first minute of microwave heating showing a 4.7% increase in bacterial viability .
the death factor for e. faecalis occurred between the first and fourth minutes leads to 104.7% of bacterial viability reduction . the greatest decline in bacterial viability reduction
however , the influence of iron ions on e. faecalis was weaker when compared with the influence cobalt ions , and at the third minute results ( 38.2% ) .
table 2 shows the bacterial viabilities of e. faecalis , s. aureus , and e. coli ( n = 10 ) when micro - waved for 4 minutes in the presence of iron ions compared to control samples ( distilled water ) .
the results showed that the presence of iron reduced the disinfection time for all test bacteria .
the most significant decrease was e coli whose disinfection time reduced from four minutes to one minute .
the number of viable s. aureus was constant during the first two minutes of microwave treatment with a rapid decrease ( 94% ) during the third minute .
e. coli viability showed a sharp decline during microwave heating in the presence of iron ions . during the first minute of microwave treatment bacterial viability for e. coli
contrary to other data , e. coli disinfection denotes the strong influence of iron ions on micro - organisms . for comparison , table 2 and figs . 4 and 6 , data for microwave treatment of e. faecalis , s. aureus and e. coli in distilled water ( triangular points ) was included from our previous paper .
this data showed that disinfection time in the presence of iron ions ( 13 min ) is less than in distilled water ( 4 5 min ) .
so , the presence of iron ions in water increased the efficiency of the microwave deactivation of bacteria .
results show that differences between bacterial survival and microwave time have similar bell shape forms for both with and excluding metal ions in most circumstances .
lower survival rates were found for e. faecalis , s. aureus and e. coli in the presence of metal ions under microwave heating when compared to their distilled water controls .
the results suggest that metal ion s ability to enhance bacterial deactivation primarily occurs above temperatures needed for optimal growth .
microwave disinfection times for all three bacteria were also lowered in the presence of metal ions such as cobalt and iron .
this shift found a reduction of bacterial viability becoming insignificantly small at the third minute of microwave heating .
experimental controls of distilled water found bacterial viability requiring 4 5 min of microwave irradiation for significant reduction .
the rapid reduction of viable bacteria during microwave irradiation in the presence of aqueous metal ions indicates an increase of kinetic energy of the solution .
metal ions with higher kinetic energy have a greater possibility to enter into the bacteria .
as the kinetic energy of the metal ion increases , there is an increase in ion penetration .
following metal ion penetration , they begin to damage the cell membranes of bacteria , disrupt cellular functions , and destroy the structure of dna . for preparation of mathematical model for bacterial deactivation in the presence of metal ions ,
growth of bacteria by improving conditions of their reproduction on initial stage of microwave heating , and following reduction of survival bacteria by increasing of death factor with increasing the time of microwave irradiation . in our previous work
we found that rate of change ( dn / dt ) of bacterial survival with water temperature ( t ) is described by formula :
( 1)dndt=where , and - growth and decay of viable bacteria with changing water temperature on 1c related with birth factor and death factor , respectively .
and depend on temperature , and in the first approximation , we can use linear functions :
( 2)=a0t+b0 and =a1t+b1where , a0,b0,a1,b1 -coefficients that depend on forms of bacteria . assuming , the water contains metal ions with concentration m we have to change the formula ( 1 ) and include the term that gives influence of metal ions on bacteria death . after this transformation formula ( 1 )
will be :
( 3)dndt=12where , 1=a1t+b1 - decay of bacteria number that relates with changing water temperature on 1c , 2(m ) decay of bacteria number that relates with changing metal ions concentration .
if metal ions concentration is permanent , we can decide that 2(m ) is constant .
then after taking integral from ( 3 ) we will receive :
( 4)n(t)=a1t2+b1t+c1where a1,b1,c1 - coefficients that depend on bacteria forms , type and concentration of metal ions . also , we can use relationship between microwave time t and temperature t of water , and find dependence between number n of viable bacteria and microwave time t :
( 5)n(t)=a2t2+b2t+c2where a2,b2,c2 - coefficients that depend on bacteria forms , type , and concentration of metal ions .
therefore , we can expect that relationship between number n of viable bacteria and microwave time t will be given by second order polynomial function ( 5 ) . in accordance with this theory ,
1 and 6 show the results of this approximation ( solid curves ) . for comparison with previous results
, we also provided theoretical curves for water without metal ions ( dotted curves ) .
the values of the coefficients a2,b2,c2 that gave the best correlation with experimental results were calculated by using the least squares method and placed into table 3
. table 3 shows the coefficients for the theoretical mathematical models for e. faecalis , s.aureus , and e. coli .
the mathematical models show between a 0.99 and a 0.91 correlation coefficient when compared to experimental data .
comparison of mathematical model with experimental results shows good correlation ( coefficient of correlation 0.91 0.99 ) for most results that confirm the assumptions accepted in this model .
an exception is the influence of iron ions on microwave bacteria deactivation . for this influence ,
existence of mathematical model for microwave heating of water with metal ions allows for the determination of viable bacterial levels at predetermined times . | time differences for enterococcus faecalis , staphylococcus aureus , and escherichia coli survival during microwave irradiation ( power 130 w ) in the presence of aqueous cobalt and iron ions were investigated .
measured dependencies had bell shape forms with maximum bacterial viability between 1 2 min becoming insignificant at 3 minutes .
the deactivation time for e. faecalis , s. aureus and e.coli in the presence of metal ions were smaller compared to a water control ( 45 min ) . although various sensitivities to the metal ions were observed , s. aureus and e. coli and were the most sensitive for cobalt and iron , respectively .
the rapid reduction of viable bacteria during microwave treatment in the presence of metal ions could be explained by increased metal ion penetration into bacteria .
additionally , microwave irradiation may have increased the kinetic energy of the metal ions resulting in lower survival rates . the proposed mathematical model for microwave heating took into account the growth and death factors of the bacteria , forming second degree polynomial functions .
good relationships were found between the proposed mathematical models and the experimental data for bacterial deactivation ( coefficient of correlation 0.91 0.99 ) . |
they are key players in infectious diseases and implicate toll - like receptors ( tlr ) in the activation of inflammation .
the first report on the immunostimulatory properties of bacterial dna date back to tokunaga and colleagues in 1984 due to the presence of unmethylated cpg dinucleotides in a particular base sequence context termed cpg motif .
importantly , the immunostimulatory activity is found in bacterial , yeast , viruses , insect and nematode dna .
in contrast , eukaryotic dna is nonstimulatory ; this lack of immunostimulatory potential has been explained by cpg suppression , cpg methylation , inhibitory motifs , and saturable dna uptake in combined .
microbial dna activates innate immune cells via tlr 9 leading to secretion of pro - inflammatory cytokines and directs the development of adaptive immunity , suggesting that microbial dna is an important virulence determinant and inflammatory stimulus during infections .
reported that when the microbe degraded or autolysed for any reason such as killing by antibiotics or processing by the antigen presenting cells , the dna will be released , hence , it will evoke the inflammatogenic reactions causing serious problems .
for the critical role of dna in pathogenesis and the absence of in vivo study tracing the comparison between prokaryotic unmethylated dna and eukaryotic slightly methylated dna in the respect of the urinary system , this work aimed to conduct a comparative histopathological study between dna extracted from s. aureus and c. albicans in urinary tract of mice .
mid - stream urine specimens were collected from 308 patients ( 15 - 50 years ) , presented with urinary tract infections visiting baghdad hospitals .
all specimens were inoculated on mannitol salt agar and sabouraud dextrose agar , incubated at 37c and 30c , respectively for 24hrs .
staphylococci were identified depending on biochemical tests according to forbes et al .. the classification was achieved according to holt et al .. api - staph system was employed to confirm the identification .
candida albicans was identified depending on the morphological features on culture medium and germ tube formation in addition to api - candida system .
the modified kirby - bauer method was used to investigate the antibiotic susceptibility against amoxicillin , ampicillin , cefotaxime , methicillin , oxacillin , and vancomycin . a standard s. aureus strain ( s. aureus atcc 6538p )
staphylococcus aureus dna were prepared using a wizard genomic dna purification kit ( promega ) .
the method of harju et al . was followed to extract the dna from candida albicans .
female white balb / c mice ( age 6 - 8 weeks , weight 20 - 25 gm ) were used in this study .
urethra and surrounding area were sterilized with 70% ethanol then a polyethylene tube ( 0.6 mm in diameter ) was introduced to urinary bladder via urethra ; the inoculums ( 1.5 10 cfu / ml and 1 10 cfu / ml for s. aureus and c. albicans , respectively ) was injected by aid of this catheter .
thereafter the catheter was withdrawn immediately , animals were returned to their cages with their lower end directed upward to avoid effusion of the inoculum outside .
mice were divided into fourteen groups , two animals per group :
first , second , third , fourth and fifth groups were injected with 0.1ml of s. aureus s11 dna at concentrations 10 , 20 , 30 , 40 and 50 g/100l , respectively.sixth , seventh , eighth , ninth and tenth groups were injected with 0.1ml of c. albicans c3 dna at different concentrations 10 , 20 , 30 , 40 and 50 g/100l respectively.eleventh and twelfth groups were injected with 0.1ml of s. aureus s11 and c. albicans c3 suspensions , respectively.thirteenth and fourteenth groups ( control groups ) were injected with normal saline and te buffer respectively .
first , second , third , fourth and fifth groups were injected with 0.1ml of s. aureus s11 dna at concentrations 10 , 20 , 30 , 40 and 50 g/100l , respectively .
sixth , seventh , eighth , ninth and tenth groups were injected with 0.1ml of c. albicans c3 dna at different concentrations 10 , 20 , 30 , 40 and 50 g/100l respectively .
eleventh and twelfth groups were injected with 0.1ml of s. aureus s11 and c. albicans c3 suspensions , respectively .
thirteenth and fourteenth groups ( control groups ) were injected with normal saline and te buffer respectively .
all groups were injected with two repeat to each injection and kept in their cages without water for 24hrs .
3 days later , they were sacrificed ; kidneys and bladders were removed for histopathological study .
mid - stream urine specimens were collected from 308 patients ( 15 - 50 years ) , presented with urinary tract infections visiting baghdad hospitals .
all specimens were inoculated on mannitol salt agar and sabouraud dextrose agar , incubated at 37c and 30c , respectively for 24hrs .
staphylococci were identified depending on biochemical tests according to forbes et al .. the classification was achieved according to holt et al .. api - staph system was employed to confirm the identification .
candida albicans was identified depending on the morphological features on culture medium and germ tube formation in addition to api - candida system .
the modified kirby - bauer method was used to investigate the antibiotic susceptibility against amoxicillin , ampicillin , cefotaxime , methicillin , oxacillin , and vancomycin . a standard s. aureus strain ( s. aureus atcc 6538p )
staphylococcus aureus dna were prepared using a wizard genomic dna purification kit ( promega ) .
the method of harju et al . was followed to extract the dna from candida albicans .
female white balb / c mice ( age 6 - 8 weeks , weight 20 - 25 gm ) were used in this study .
urethra and surrounding area were sterilized with 70% ethanol then a polyethylene tube ( 0.6 mm in diameter ) was introduced to urinary bladder via urethra ; the inoculums ( 1.5 10 cfu / ml and 1 10 cfu / ml for s. aureus and c. albicans , respectively ) was injected by aid of this catheter .
thereafter the catheter was withdrawn immediately , animals were returned to their cages with their lower end directed upward to avoid effusion of the inoculum outside .
mice were divided into fourteen groups , two animals per group :
first , second , third , fourth and fifth groups were injected with 0.1ml of s. aureus s11 dna at concentrations 10 , 20 , 30 , 40 and 50 g/100l , respectively.sixth , seventh , eighth , ninth and tenth groups were injected with 0.1ml of c. albicans c3 dna at different concentrations 10 , 20 , 30 , 40 and 50 g/100l respectively.eleventh and twelfth groups were injected with 0.1ml of s. aureus s11 and c. albicans c3 suspensions , respectively.thirteenth and fourteenth groups ( control groups ) were injected with normal saline and te buffer respectively .
first , second , third , fourth and fifth groups were injected with 0.1ml of s. aureus s11 dna at concentrations 10 , 20 , 30 , 40 and 50 g/100l , respectively .
sixth , seventh , eighth , ninth and tenth groups were injected with 0.1ml of c. albicans c3 dna at different concentrations 10 , 20 , 30 , 40 and 50 g/100l respectively .
eleventh and twelfth groups were injected with 0.1ml of s. aureus s11 and c. albicans c3 suspensions , respectively .
thirteenth and fourteenth groups ( control groups ) were injected with normal saline and te buffer respectively .
all groups were injected with two repeat to each injection and kept in their cages without water for 24hrs .
3 days later , they were sacrificed ; kidneys and bladders were removed for histopathological study .
mid - stream urine specimens were collected from 308 patients ( 15 - 50 years ) , presented with urinary tract infections visiting baghdad hospitals .
all specimens were inoculated on mannitol salt agar and sabouraud dextrose agar , incubated at 37c and 30c , respectively for 24hrs .
staphylococci were identified depending on biochemical tests according to forbes et al .. the classification was achieved according to holt et al .. api - staph system was employed to confirm the identification .
candida albicans was identified depending on the morphological features on culture medium and germ tube formation in addition to api - candida system .
the modified kirby - bauer method was used to investigate the antibiotic susceptibility against amoxicillin , ampicillin , cefotaxime , methicillin , oxacillin , and vancomycin . a standard s. aureus strain ( s. aureus atcc 6538p )
staphylococcus aureus dna were prepared using a wizard genomic dna purification kit ( promega ) .
the method of harju et al . was followed to extract the dna from candida albicans .
female white balb / c mice ( age 6 - 8 weeks , weight 20 - 25 gm ) were used in this study .
the bladder was emptied from urine by pressing on abdominal area . urethra and surrounding area
were sterilized with 70% ethanol then a polyethylene tube ( 0.6 mm in diameter ) was introduced to urinary bladder via urethra ; the inoculums ( 1.5 10 cfu / ml and 1 10 cfu / ml for s. aureus and c. albicans , respectively ) was injected by aid of this catheter .
thereafter the catheter was withdrawn immediately , animals were returned to their cages with their lower end directed upward to avoid effusion of the inoculum outside .
mice were divided into fourteen groups , two animals per group :
first , second , third , fourth and fifth groups were injected with 0.1ml of s. aureus s11 dna at concentrations 10 , 20 , 30 , 40 and 50 g/100l , respectively.sixth , seventh , eighth , ninth and tenth groups were injected with 0.1ml of c. albicans c3 dna at different concentrations 10 , 20 , 30 , 40 and 50 g/100l respectively.eleventh and twelfth groups were injected with 0.1ml of s. aureus s11 and c. albicans c3 suspensions , respectively.thirteenth and fourteenth groups ( control groups ) were injected with normal saline and te buffer respectively .
first , second , third , fourth and fifth groups were injected with 0.1ml of s. aureus s11 dna at concentrations 10 , 20 , 30 , 40 and 50 g/100l , respectively .
sixth , seventh , eighth , ninth and tenth groups were injected with 0.1ml of c. albicans c3 dna at different concentrations 10 , 20 , 30 , 40 and 50 g/100l respectively .
eleventh and twelfth groups were injected with 0.1ml of s. aureus s11 and c. albicans c3 suspensions , respectively .
thirteenth and fourteenth groups ( control groups ) were injected with normal saline and te buffer respectively .
all groups were injected with two repeat to each injection and kept in their cages without water for 24hrs .
3 days later , they were sacrificed ; kidneys and bladders were removed for histopathological study .
out of 72 staphylococcal isolates , 51 were identified as coagulase negative staphylococci and 21 as s. aureus .
36 specimens were identified as c. albicans . the isolates s. aureus s11 and c. albicans c3 showed the highest antibiotic susceptiblity , hence , they were selected for in vivo study .
no histological changes were observed in kidney and bladder of control mice as shown in figure 1 . a : histological section of control mouse kidney 3 days after challenged with 0.1ml of saline shows a normal structure appearance of glomeruli ( g ) and renal tubules ( t ) .
b : the histological section of control mouse urinary bladder 3 days after challenged with 0.1ml of saline shows a normal structure appearance of urinary epithelial lining mucosa ( e ) and subepithelial lining layer ( se ) .
histopathological examination of kidney from mice challenged with viable s. aureus s11 revealed congestion , inflammatory cells infiltration and degenerative changes of renal tubules ( figure 2a ) , while its bladder suffered from edema , moderate inflammatory cells infiltration and focal mucosal surface epithelial ulceration ( figure 2b ) . whereas those of mice challenged with viable c. albicans c11 showed congestion ( figure 2c ) .
the bladder developed mild infiltration of inflammatory cells with edema in subepithelial lining layer ( figure 2d ) .
a : histological section of mouse kidney 3 days after challenged with 0.1 ml of 1.5 10 cfu / ml of s. aureus s11 shows congestion ( co ) ) , inflammatory cells infiltration ( ic ) and degenerative changes of renal tubules ( d ) .
b : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 1.5
10 cfu / ml of s. aureus s11 shows edema ( o ) with moderate inflammatory cells infiltration ( ic ) and focal mucosal surface epithelial ulceration ( fu ) .
c : the histological section of mouse kidney 3 days after challenged with 0.1ml of 1 10 cfu / ml of c. albicans c3 shows congestion ( co ) and no obvious histological changes .
d : the histological section of mouse urinary bladder 3 days after intraurethrally challenged with 0.1ml of 110 cfu / ml of c. albicans c3 shows mild infiltration of inflammatory cells ( ic ) with edema ( o ) in subepithelial lining layer .
h & e ( x200 ) . kidney challenged with 50g/100l of s. aureus s11 dna showed congestion , degenerative and necrosis of renal tubule with severe infiltration of inflammatory cells , the bladder revealed damage of mucosal wall with severe inflammatory cells infiltration ( figure 3a , b ) . at 40 g/100l histological sections of kidney showed congestion of blood vessel with degenerative changes of renal tubules , the bladder developed mild edema and infiltration of inflammatory cells with sloughing of mucosal epithelial surface ( figure 3c , d ) . while at 30 g/100l histological sections of the kidney revealed congestion and mild degenerative changes of renal tubules with mild inflammatory cells infiltration , the bladder showed edema with infiltration of inflammatory cells ( figure 3e , f ) . at 20 g/100l and 10 g/100l , histological sections showed normal structure appearance of the kidney and the bladder . a : the histological section of mouse kidney 3 days after challenged with 0.1ml of 50 g/100 l of s. aureus s11 dna showing congestion ( co ) , degenerative and necrosis ( dn ) of renal tubule with severe infiltration of inflammatory cells ( ic ) .
b : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 50 g/100 l of s. aureus s11 dna showing damage of mucosal wall ( d ) with severe inflammatory cells infiltration ( ic ) .
c : the histological section of mouse kidney 3 days after challenged with 0.1ml of 40 g/100 l of s. aureus s11 dna showing congestion ( co ) of blood vessel with degenerative changes ( d ) of renal tubules .
d : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 40 g/100 l of s. aureus s11 dna showing mild edema ( o ) and infiltration of inflammatory cells ( ic ) with sloughing ( s ) of mucosal epithelial surface .
e : the histological section of mouse kidney 3 days after challenged with 0.1ml of 30 g/100 l of s. aureus s11 dna showing congestion ( co ) and mild degenerative changes ( d ) of renal tubules with mild inflammatory cells infiltration ( ic ) .
f : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 30 g/100 l of s. aureus s11 dna showing edema ( o ) with infiltration of inflammatory cells ( ic ) .
g : the histological section of mouse kidney 3 days after challenged with 0.1ml of 50 g/100 l of c. albicans c3 dna showing congestion ( co ) with moderate inflammatory cells infiltration ( ic ) .
h : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 50 g/100 l of c. albicans c3 dna showing edema ( o ) with mild inflammatory cells infiltration ( ic ) .
i : the histological section of mouse kidney 3 days after challenged with 0.1ml of 40 g/100 l of c. albicans c3 dna showing congestion ( co ) of blood vessels .
j : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 40 g/100 l of c. albicans c3 dna showing mild inflammatory cells ( ic ) infiltration and edema ( o ) .
sections of kidney challenged with 50 g/100l of c. albicans c3 dna showed congestion with moderate inflammatory cells infiltration , the bladder revealed edema with mild inflammatory cells infiltration ( figure 3 g , h ) . at 40 g/100l kidney showed congestion of blood vessels , the bladder developed mild inflammatory cells infiltration and edema ( figure 3i , j ) . while at 10 , 20 and 30 g/100l , histological sections showed normal kidney and bladder structure
no histological changes were observed in kidney and bladder of control mice as shown in figure 1 . a : histological section of control mouse kidney 3 days after challenged with 0.1ml of saline shows a normal structure appearance of glomeruli ( g ) and renal tubules ( t ) .
b : the histological section of control mouse urinary bladder 3 days after challenged with 0.1ml of saline shows a normal structure appearance of urinary epithelial lining mucosa ( e ) and subepithelial lining layer ( se ) .
h & e ( x200 ) . histopathological examination of kidney from mice challenged with viable s. aureus s11 revealed congestion , inflammatory cells infiltration and degenerative changes of renal tubules ( figure 2a ) , while its bladder suffered from edema , moderate inflammatory cells infiltration and focal mucosal surface epithelial ulceration ( figure 2b ) . whereas those of mice challenged with viable c. albicans c11 showed congestion ( figure 2c ) .
the bladder developed mild infiltration of inflammatory cells with edema in subepithelial lining layer ( figure 2d ) .
a : histological section of mouse kidney 3 days after challenged with 0.1 ml of 1.5 10 cfu / ml of s. aureus s11 shows congestion ( co ) ) , inflammatory cells infiltration ( ic ) and degenerative changes of renal tubules ( d ) .
b : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 1.5
10 cfu / ml of s. aureus s11 shows edema ( o ) with moderate inflammatory cells infiltration ( ic ) and focal mucosal surface epithelial ulceration ( fu ) .
c : the histological section of mouse kidney 3 days after challenged with 0.1ml of 1 10 cfu / ml of c. albicans c3 shows congestion ( co ) and no obvious histological changes .
d : the histological section of mouse urinary bladder 3 days after intraurethrally challenged with 0.1ml of 110 cfu / ml of c. albicans c3 shows mild infiltration of inflammatory cells ( ic ) with edema ( o ) in subepithelial lining layer .
kidney challenged with 50g/100l of s. aureus s11 dna showed congestion , degenerative and necrosis of renal tubule with severe infiltration of inflammatory cells , the bladder revealed damage of mucosal wall with severe inflammatory cells infiltration ( figure 3a , b ) . at 40 g/100l histological sections of kidney showed congestion of blood vessel with degenerative changes of renal tubules , the bladder developed mild edema and infiltration of inflammatory cells with sloughing of mucosal epithelial surface ( figure 3c , d ) . while at 30 g/100l histological sections of the kidney revealed congestion and mild degenerative changes of renal tubules with mild inflammatory cells infiltration , the bladder showed edema with infiltration of inflammatory cells ( figure 3e , f ) . at 20 g/100l and 10 g/100l , histological sections showed normal structure appearance of the kidney and the bladder .
a : the histological section of mouse kidney 3 days after challenged with 0.1ml of 50 g/100 l of s. aureus s11 dna showing congestion ( co ) , degenerative and necrosis ( dn ) of renal tubule with severe infiltration of inflammatory cells ( ic ) .
b : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 50 g/100 l of s. aureus s11 dna showing damage of mucosal wall ( d ) with severe inflammatory cells infiltration ( ic ) .
c : the histological section of mouse kidney 3 days after challenged with 0.1ml of 40 g/100 l of s. aureus s11 dna showing congestion ( co ) of blood vessel with degenerative changes ( d ) of renal tubules .
d : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 40 g/100 l of s. aureus s11 dna showing mild edema ( o ) and infiltration of inflammatory cells ( ic ) with sloughing ( s ) of mucosal epithelial surface .
e : the histological section of mouse kidney 3 days after challenged with 0.1ml of 30 g/100 l of s. aureus s11 dna showing congestion ( co ) and mild degenerative changes ( d ) of renal tubules with mild inflammatory cells infiltration ( ic ) .
f : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 30 g/100 l of s. aureus s11 dna showing edema ( o ) with infiltration of inflammatory cells ( ic ) .
g : the histological section of mouse kidney 3 days after challenged with 0.1ml of 50 g/100 l of c. albicans c3 dna showing congestion ( co ) with moderate inflammatory cells infiltration ( ic ) .
h : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 50 g/100 l of c. albicans c3 dna showing edema ( o ) with mild inflammatory cells infiltration ( ic ) .
i : the histological section of mouse kidney 3 days after challenged with 0.1ml of 40 g/100 l of c. albicans c3 dna showing congestion ( co ) of blood vessels .
j : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 40 g/100 l of c. albicans c3 dna showing mild inflammatory cells ( ic ) infiltration and edema ( o ) .
sections of kidney challenged with 50 g/100l of c. albicans c3 dna showed congestion with moderate inflammatory cells infiltration , the bladder revealed edema with mild inflammatory cells infiltration ( figure 3 g , h ) . at 40 g/100l kidney showed congestion of blood vessels , the bladder developed mild inflammatory cells infiltration and edema ( figure 3i , j ) . while at 10 , 20 and 30 g/100l , histological sections showed normal kidney and bladder structure
no histological changes were observed in kidney and bladder of control mice as shown in figure 1 . a : histological section of control mouse kidney 3 days after challenged with 0.1ml of saline shows a normal structure appearance of glomeruli ( g ) and renal tubules ( t ) .
b : the histological section of control mouse urinary bladder 3 days after challenged with 0.1ml of saline shows a normal structure appearance of urinary epithelial lining mucosa ( e ) and subepithelial lining layer ( se ) .
h & e ( x200 ) . histopathological examination of kidney from mice challenged with viable s. aureus s11 revealed congestion , inflammatory cells infiltration and degenerative changes of renal tubules ( figure 2a ) , while its bladder suffered from edema , moderate inflammatory cells infiltration and focal mucosal surface epithelial ulceration ( figure 2b ) . whereas those of mice challenged with viable c. albicans c11 showed congestion ( figure 2c ) .
the bladder developed mild infiltration of inflammatory cells with edema in subepithelial lining layer ( figure 2d ) .
a : histological section of mouse kidney 3 days after challenged with 0.1 ml of 1.5 10 cfu / ml of s. aureus s11 shows congestion ( co ) ) , inflammatory cells infiltration ( ic ) and degenerative changes of renal tubules ( d ) .
b : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 1.5
10 cfu / ml of s. aureus s11 shows edema ( o ) with moderate inflammatory cells infiltration ( ic ) and focal mucosal surface epithelial ulceration ( fu ) .
c : the histological section of mouse kidney 3 days after challenged with 0.1ml of 1 10 cfu / ml of c. albicans c3 shows congestion ( co ) and no obvious histological changes .
d : the histological section of mouse urinary bladder 3 days after intraurethrally challenged with 0.1ml of 110 cfu / ml of c. albicans c3 shows mild infiltration of inflammatory cells ( ic ) with edema ( o ) in subepithelial lining layer .
kidney challenged with 50g/100l of s. aureus s11 dna showed congestion , degenerative and necrosis of renal tubule with severe infiltration of inflammatory cells , the bladder revealed damage of mucosal wall with severe inflammatory cells infiltration ( figure 3a , b ) . at 40 g/100l histological sections of kidney showed congestion of blood vessel with degenerative changes of renal tubules , the bladder developed mild edema and infiltration of inflammatory cells with sloughing of mucosal epithelial surface ( figure 3c , d ) . while at 30 g/100l histological sections of the kidney revealed congestion and mild degenerative changes of renal tubules with mild inflammatory cells infiltration , the bladder showed edema with infiltration of inflammatory cells ( figure 3e , f ) . at 20 g/100l and 10 g/100l , histological sections showed normal structure appearance of the kidney and the bladder .
a : the histological section of mouse kidney 3 days after challenged with 0.1ml of 50 g/100 l of s. aureus s11 dna showing congestion ( co ) , degenerative and necrosis ( dn ) of renal tubule with severe infiltration of inflammatory cells ( ic ) .
b : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 50 g/100 l of s. aureus s11 dna showing damage of mucosal wall ( d ) with severe inflammatory cells infiltration ( ic ) .
c : the histological section of mouse kidney 3 days after challenged with 0.1ml of 40 g/100 l of s. aureus s11 dna showing congestion ( co ) of blood vessel with degenerative changes ( d ) of renal tubules .
d : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 40 g/100 l of s. aureus s11 dna showing mild edema ( o ) and infiltration of inflammatory cells ( ic ) with sloughing ( s ) of mucosal epithelial surface .
e : the histological section of mouse kidney 3 days after challenged with 0.1ml of 30 g/100 l of s. aureus s11 dna showing congestion ( co ) and mild degenerative changes ( d ) of renal tubules with mild inflammatory cells infiltration ( ic ) .
f : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 30 g/100 l of s. aureus s11 dna showing edema ( o ) with infiltration of inflammatory cells ( ic ) .
g : the histological section of mouse kidney 3 days after challenged with 0.1ml of 50 g/100 l of c. albicans c3 dna showing congestion ( co ) with moderate inflammatory cells infiltration ( ic ) .
h : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 50 g/100 l of c. albicans c3 dna showing edema ( o ) with mild inflammatory cells infiltration ( ic ) .
i : the histological section of mouse kidney 3 days after challenged with 0.1ml of 40 g/100 l of c. albicans c3 dna showing congestion ( co ) of blood vessels .
j : the histological section of mouse urinary bladder 3 days after challenged with 0.1ml of 40 g/100 l of c. albicans c3 dna showing mild inflammatory cells ( ic ) infiltration and edema ( o ) .
sections of kidney challenged with 50 g/100l of c. albicans c3 dna showed congestion with moderate inflammatory cells infiltration , the bladder revealed edema with mild inflammatory cells infiltration ( figure 3 g , h ) . at 40 g/100l kidney showed congestion of blood vessels , the bladder developed mild inflammatory cells infiltration and edema ( figure 3i , j ) . while at 10 , 20 and 30 g/100l , histological sections showed normal kidney and bladder structure
tissue damage was developed with features relatively less intense in mice challenged with c. albicans than those whom challenged with s. aureus .
that may be due various virulence factors produced by s. aureus of and c. albicans . from the previous findings
it was concluded that the dna extracted from s. aureus s11 bacteria and c. albicans c3 yeast may function as a virulence factor of pathogenic microbes via histopathological effects that caused to kidneys and bladders treated by both dna .
recognition of microbial dna by tlr 9 in mammalian phagocytic cell triggers an immunostimulatory cascade that culminates in the maturation , differentiation , and/or proliferation of multiple cell types .
together , these cells secrete cytokines and chemokines that create proinflammatory immune stimuli and other mediators of inflammation in addition to reactive oxygen species generation[1417 ] .
thus , this cell population and its soluble products are crucial to the observed inflammatory response to dna , and might participate , directly or indirectly , in the pathogenesis of urinary tract infection .
comparison between s. aureus dna and c. albicans dna the present study indicates that histological changes caused by eukaryotic fungal pathogen c. albicans c3 dna were generally with potency lower than that of prokaryotic bacterial pathogen s. aureus s11 dna .
they were of approximately similar gc content dna organism ( 32.5 % gc of s. aureus dna and 35.1% gc of c. albicans dna ) in order to show that the differences observed in histological changes between both were not due to the difference in frequency of cg ( fcg ) .
as that the dinucleotide ( cg ) showed a frequency as expected from the individual g+c content and that an increase in fcg went along with increased immunostimulation .
candida albicans dna have mitogenic properties for immune cells that are similar to those of bacterial dna , which correlated with the presence of nonmethylated cg dinucleotides and suggest that the cpg motif - containing dna may contribute to the development of inflammatory responses after infection with c. albicans . in addition c. albicans dna may contain as yet unidentified immunostimulatory structure other than cpg motifs that may be present at a higher frequency in this organism .
there are several explanations why c. albicans dna may not be a strong inflammatory agent : 1 ) c. albicans dna contains methylated dna which diminishes the activity of cpg dna via interaction with tlr9 ; 2 ) the cpg frequency of c. albicans dna may be less than that of s. aureus and may explain the difference in the activating capabilities of these two dna ; 3 ) it may be that candidal dna has inhibitory motifs as that of vertebrate dna which inhibit the immunostimulatory function of unmethylated cpg motifs .
hypothesized that some inhibitory effect of c. albicans dna could interfere with the dna stimulation .
this could be due to the inhibition of dna uptake by some molecules or inhibitory dna sequences that can bind tlr9 sufficiently and neutralized the cpg induced activation of immune cells . finally , alternatively ,
stimulation by unmethylated cpg motifs require optimal flanking sequences and/or depend on localization of the unmethylated cpg motifs within the genomic dna sequence .
hence , the high potency of bacterial dna probably reflects the presence of optimal flanking sequences around cpg motifs which is known that the optimal flanking sequences higher for bacterial than for eukaryotic dna . in this respect
, the optimal flanking sequences may be higher for s. aureus than for c. albicans dna .
dna from s. aureus s11 induced significant histopathological changes starting from 10 g/100 l and increasing up to 50 g/100 l .
dna from c. albicans c3 was effective at concentrations above 30 g/100 l but developed less changes than observed with s. aureus s11 dna .
most of these results agreed with many studies correlated with the important role of dna in the pathogenesis of microbes .
the histological changes severity evaluated with regard to the extent of the inflammation and judged on an arbitrary scale ( figure 4 ) ; from grade 0 ( no signs of inflammation ) , grade 1 ( mild diffuse or focal inflammation in a single area ) , to grade 2 ( moderate diffuse or focal inflammation ) , and grade 3 ( heavy diffuse and focal inflammation ) .
reported that when s. aureus dna was injected intradermally into mice , moderate to heavy inflammatory changes in skin and focal inflammation in an extended pattern were triggered .
mentioned that intratracheal instillation of cpg - odn revealed acute lung injury in a dose - dependent effect .
effect of dna concentrations on histological changes severity in issue of periodontal disease takeshita et al .
suggested that porphyromonas gingivalis dna may function as a virulence factor in periodontal disease through expression of inflammatory cytokine .
the bacterial dna markedly stimulated in a dose - dependent manner il-6 production by human gingival fibroblasts . in a study done by al - mathkhury and al - zubeidy ,
e. coli dna caused shrinkage of glomerulus and increased capsular space , edema and inflammatory cells infiltration in kidney tissue while the urinary bladder suffered from infiltration of inflammatory cells .
anders et al . found that e. coli dna increased serum dna autoantibodies in association with progression of glomerulonephritis .
dna from s. aureus s11 induced significant histopathological changes starting from 10 g/100 l and increasing up to 50 g/100 l .
dna from c. albicans c3 was effective at concentrations above 30 g/100 l but developed less changes than observed with s. aureus s11 dna .
most of these results agreed with many studies correlated with the important role of dna in the pathogenesis of microbes .
the histological changes severity evaluated with regard to the extent of the inflammation and judged on an arbitrary scale ( figure 4 ) ; from grade 0 ( no signs of inflammation ) , grade 1 ( mild diffuse or focal inflammation in a single area ) , to grade 2 ( moderate diffuse or focal inflammation ) , and grade 3 ( heavy diffuse and focal inflammation ) .
mlne et al . reported that when s. aureus dna was injected intradermally into mice , moderate to heavy inflammatory changes in skin and focal inflammation in an extended pattern were triggered .
mentioned that intratracheal instillation of cpg - odn revealed acute lung injury in a dose - dependent effect .
effect of dna concentrations on histological changes severity in issue of periodontal disease takeshita et al . suggested that porphyromonas gingivalis dna may function as a virulence factor in periodontal disease through expression of inflammatory cytokine .
the bacterial dna markedly stimulated in a dose - dependent manner il-6 production by human gingival fibroblasts . in a study done by al - mathkhury and al - zubeidy ,
e. coli dna caused shrinkage of glomerulus and increased capsular space , edema and inflammatory cells infiltration in kidney tissue while the urinary bladder suffered from infiltration of inflammatory cells .
anders et al . found that e. coli dna increased serum dna autoantibodies in association with progression of glomerulonephritis .
dna from s. aureus s11 induced significant histopathological changes starting from 10 g/100 l and increasing up to 50 g/100 l .
dna from c. albicans c3 was effective at concentrations above 30 g/100 l but developed less changes than observed with s. aureus s11 dna .
most of these results agreed with many studies correlated with the important role of dna in the pathogenesis of microbes .
the histological changes severity evaluated with regard to the extent of the inflammation and judged on an arbitrary scale ( figure 4 ) ; from grade 0 ( no signs of inflammation ) , grade 1 ( mild diffuse or focal inflammation in a single area ) , to grade 2 ( moderate diffuse or focal inflammation ) , and grade 3 ( heavy diffuse and focal inflammation ) .
mlne et al . reported that when s. aureus dna was injected intradermally into mice , moderate to heavy inflammatory changes in skin and focal inflammation in an extended pattern were triggered .
mentioned that intratracheal instillation of cpg - odn revealed acute lung injury in a dose - dependent effect .
effect of dna concentrations on histological changes severity in issue of periodontal disease takeshita et al . suggested that porphyromonas gingivalis dna may function as a virulence factor in periodontal disease through expression of inflammatory cytokine .
the bacterial dna markedly stimulated in a dose - dependent manner il-6 production by human gingival fibroblasts . in a study done by al - mathkhury and al - zubeidy ,
e. coli dna caused shrinkage of glomerulus and increased capsular space , edema and inflammatory cells infiltration in kidney tissue while the urinary bladder suffered from infiltration of inflammatory cells .
anders et al . found that e. coli dna increased serum dna autoantibodies in association with progression of glomerulonephritis .
bacterial dna has the ability to cause damage in renal tissue in a dose dependent manner .
furthermore , even though the microbe is killed or auloysed the risk of inflammation is still need to be investigated . | background : bacterial dna released upon bacterial autolysis or killed by antibiotics , hence , many inflammatogenic reactions will be established leading to serious tissue damage.aim:the present work aimed to elucidate the histopathological changes caused by prokaryotic ( bacterial ) dna and eukaryotic ( candidal ) dna.materials and methods : twenty one staphylococcus aureus and 36 candida albicans isolates were isolated from uti patients . viable cells and dna of the highest antibiotic
sensitive isolates were injected , intraurethraly , in mice .
results were evaluated via histopathological examination.results:mildest reactions were obtained from mice challenged with viable c. albicans compared with those challenged with viable s. aureus .
dose - dependent histological changes were observed for both eukaryotic and prokaryotic dna .
however , the eukaryotic c. albicans dna developed less intense histological changes than s. aureus dna.conclusion:microbial dna has the ability to cause damage in murine renal system .
nevertheless , bacterial dna caused more intense damage than candidal dna . |
the use of gene transfer as a therapeutic tool requires a regulatory system allowing control of the expression of the therapeutic gene by the administration of a small inducer molecule .
the treatment could then be adapted to the needs of the patients and , should complications arise , the therapy could be stopped or interrupted .
however , the transactivators used include peptide sequences from escherichia coli and herpes simplex and may therefore provoke immune reactions in patients .
immune responses against the transactivator of a recent version of the tetracycline - dependent regulatory system were observed after expression in the muscles of nonhuman primates .
moreover , an immunodominant hla - a*0201 epitope was detected in the reverse tetracycline - dependent transactivator .
this epitope caused cytolytic responses and compromised transgene expression under the control of the tetracycline - on system .
as a consequence , adverse immunity may interfere , in this case , with gene transfer protocols and prevent gene therapy achieving its aims .
recently , two novel regulatory systems have been developed which are induced by nonimmunosuppressive derivatives of rapamycin .
the first system interferes with transcription and exploits the inducer - dependent interaction between frap kinase and the frap kinase binding protein for the reversible in situ assembly of a functional transcription factor which activates transcription from a minimal promoter .
the second system interferes with the secretory pathway and is adapted to controlling the production of secreted therapeutic factors .
it exploits the ability of the inducer to control , in the endoplasmic reticulum , aggregation of a mutated frap kinase binding protein fusion protein harboring the secreted polypeptide .
inducer - dependent secretion may be used in combination with inducible transcription for optimized control of the production of therapeutic factors such as the glia derived neurotrophic factor ( gdnf ) .
the key advantage of rapamycin - inducible systems is that they involve fusion proteins of human origin and consequently immune reactions in humans are minimized .
however , the protein components include short peptide sequences that link the various peptide domains .
these sequences may themselves constitute novel epitopes or may affect the proteasome cleavage pattern thereby generating novel peptide antigens from the fusion proteins .
any such novel antigens may be presented by the major histocompatibility complex ( mhc ) .
this possibility can readily be assessed by application of algorithms for the prediction of proteasome cleavage and mhc class i ( mhc i ) ligand motifs .
mhc i ligands may also emerge after production of the fusion proteins due to the changes in phenotype which may result from transactivatory effects on transcription and/or competitive effects on translation and protein degradation .
moreover , the transgenic protein components of the regulatory systems may directly interfere with pathways involved in antigen processing and thereby modulate the presentation of peptide antigens .
the immunogenic potential of rapamycin - inducible transcription is of particular importance because of the diverse possible clinical applications of small molecule - inducible gene regulation .
we addressed this issue in transduced human cell lines using a mass spectrometry protocol allowing differential analysis of mhc i peptide ligands after stable isotope labeling .
we compared the presentation of mhc i peptides by cells expressing the protein components required for rapamycin - regulated transcription with the antigen presentation on the respective wild - type ( wt ) control cells .
production of the transgenic proteins was associated with major changes in the presentation of antigens by mhc i in all cell lines analyzed .
allogeneic in vitro immunogenicity assays provide first evidence that these changes may affect immune tolerance towards transduced cells , though in an individual manner .
the human cells lines hek 293 t , d407 , and her 911 were treated with lentiviral vectors mediating rapamycin - inducible production and secretion of gdnf as described previously ( figure 1a )
. selected transduced clones displaying rapamycin - inducible production and secretion of gdnf ( figure 1b ) , and the corresponding wt cell lines were then characterized for their hla genotype and their expression of immune relevant molecules .
hek 293 t cells were hla - a*02/02 , hla - b*07/07 , hla - c*07/07 , and hla - drb1 * 15/15 , hla - dqb1 * 06/06 ; d407 cells were hla - a*68:02/68:02 , hla - b*15:03/15:03 ( b72 ) , hla - c*12 , and hla - drb1 * 01:02/01:02 , hla - dqb1 * 05/05 ; and her 911 cells were hla - a*02/24:03 , hla - b*37/51 , hla - c*06/15 , and hla - drb1 * 10:01/13:01 , hla - dqb1 * 05/06 .
immune phenotyping revealed that all cell lines expressed mhc i , and low levels of mhc ii molecules , but were negative for the costimulatory molecules cd80 ( b7.1 ) and cd86 ( b7.2 ) ( supplementary figure s1 ) . to focus on the effect of the constitutive expression of the transgenic fusion proteins mediating regulation of transcription , both transduced and wt cells of each cell line
were amplified in the absence of inducers of the production and secretion of gdnf using parallel cultures maintained under identical rigorously controlled conditions .
mhc i molecules were isolated from transduced and wt cells , and the peptides presented were extracted . to distinguish glutamine and lysine residues in mass spectrometry and to ensure specificity of the subsequent n - terminal labeling step , the -amino groups of lysine residues were modified by guanidination . a source - dependent difference in neutral mass of m = 4.03 was obtained by n - terminal nicotinylation using a h and h nicotinoyloxy - succinimide reagent , maintaining the same physico - chemical properties for identical peptide sequences .
aliquots of labeled peptides from both cell populations were combined and analyzed by liquid chromatography linked to electrospray ionization mass spectrometry ( lc - esi - ms ) .
the spectra included double signals ( with peak constituents displaying a difference in neutral mass of m = 4.03 ) and single signals ( figure 2a , b ) representing peptides presented in both and only one of the two specimens , respectively . single and double signals were counted for each comparative analysis ( table 1 ) .
single signals revealing the appearance or disappearance of particular mhc i peptides in association with the expression of the transgenic proteins accounted for 40% of all signals for hek 293 t , 21% for d407 , and 43% for her 911 cells . in addition , integration of the peak intensities over time revealed differences in intensity between the peak constituents of double signals ( figure 2a , c , d ) .
these variations indicated two- to threefold up- and downregulation of various mhc i peptides and provided evidence of more subtle changes in the presentation of mhc i antigens associated with the expression of the protein components mediating rapamycin - inducible transcription . to obtain information about the sequences of peptides presented at the cellular surface by mhc i
, aliquots of labeled peptides from transduced and wt cell populations were analyzed individually by liquid chromatography linked to electrospray ionization tandem mass spectrometry ( lc - esi - ms / ms ) .
the results were first screened for peak constituents of double signals on the basis of chromatographic retention time and total mass data from lc - esi - ms analysis . as could be expected from the labeling protocol ( see materials and methods section ) , the peak constituents that corresponded to the lower masses within double signals were from wt cells , whereas peak constituents corresponding to the higher masses were from transduced cells . for a significant number of double signals , ms / ms fragment spectra of both peak constituents were analyzed and gave identical peptide sequences .
this confirms that the double signals represent peptides presented at the surface of both transduced and wt cells .
we next identified mhc i peptides that appeared or disappeared after expression of the transgenic proteins .
information on chromatographic retention time and total mass was again used to screen the lc - esi - ms / ms data for the single signals detected by mass spectrometry in combined aliquots of labeled peptides from transduced and wt cells .
the single signals were detected exclusively in either the transduced or the wt cell samples .
signal intensities were sufficiently robust to allow sequencing of a significant number of peptides , and the masses of the respective b1-fragments ( representing the h or h nicotinylated n - terminal amino acid residues ) provided controls confirming the presence of the respective peptides in the transduced or wt cell samples .
mhc i peptides that appeared or disappeared after expression of the transgenic proteins are listed in tables 2 and 3 , respectively .
epitope prediction using the netmhcpan algorithm indicated , in hek 293 t cells , the presence of peptides binding to mhc i molecules derived from the hla alleles a*02:01 and b*07:02 .
in d407 cells , peptides were observed that bind to mhc i molecules from the hla alleles a*68:02 and b*15:03 . in her 911 cells , peptides were found that bind to mhc i derived from the hla alleles a*02:01 , a*24:03 , b*51:01 , and c*06:02 .
two of the peptides dvankigii originating from the ribosomal protein l23a and dahiylnhi originating from thymidylate synthase have previously been described as ligands of mhc i derived from the hla allele b*51:01 .
the peptides identified were derived from a wide variety of cellular proteins , i.e. , self - proteins .
no hla peptide antigens originating from the expressed transgenic proteins were detected by the analytical method used . in one - way allogeneic
mixed lymphocyte reactions , we then investigated the capacity of transduced and wt hek 293 t , her 911 , and d407 cells to elicit an allogeneic response from cd3cd4 t cells which mainly comprise cytotoxic cd8 t cells .
the expression of cd25 was used as a marker of activation and cfse labeling was used to assess proliferation .
transduced d407 cells activated more strongly ( 1.7-fold ) cd3cd4 t cells than wt d407 cells ( figure 3a ) , and this significantly increased activation was followed by a significantly increased proliferation of cd3cd4 t cells ( figure 3b ) .
no significant differences compared with the respective wt controls were observed for hek 293 t and her 911 cells suggesting that immunogenicity is limited to individual cell clones .
the regulatory system allowing rapamycin - inducible transcription is promising for clinical applications in part , because it is composed of fusion proteins comprising polypeptide sequences that all originate from human proteins thereby minimizing the risk of immune reactions in patients .
however , the sequences at the junctions between the various domains could create sites that are potentially immunogenic .
we assessed changes in the presentation of mhc i peptides associated with the production of the fusion proteins allowing rapamycin - inducible expression of transgenes and observed variations in the presentation of peptide antigens .
a significant number of peptides appeared and disappeared , and the amounts of some peptides were affected .
we detected no peptide antigens originating from the two transgenic proteins allowing inducible transcription of a therapeutic transgene . using an in vitro immunogenicity assay
, we demonstrated that the expression of these transgenic proteins and the associated changes in the repertoire of mhc i - presented peptide antigens could affect the immunogenicity of the cells .
the mass spectrometry protocol used was developed for direct and quantitative comparison of mhc - presented peptides in pairs of samples .
in contrast to approaches addressing changes in the transcriptome and the proteome , this technique is able to reveal events after protein degradation and the binding of peptides to distinct mhc i molecules .
interestingly , there is only a weak correlation between mrna copy number and the density of corresponding mhc ligands indicating that the presentation of peptide antigens has to be investigated directly to obtain pertinent information about the immunological consequences of the expression of transgenes .
the detection limit of the method is about 100 fmol , so peptides present at 610 copies per cell could be detected ; nevertheless , we have to consider the possibility that peptides from the two transgenic proteins are presented by mhc i molecules in amounts too low to be detected . also , peptides derived from the degradation of the transgenic proteins may have low affinity for the mhc i molecules tested .
moreover , we can not exclude the possibility that these peptides are presented by mhc ii despite its low abundance in the cell lines used .
in contrast to the absence of mhc ligands of transgenic origin , numerous changes in the presentation of peptides of self - origin were apparent , although , most probably , we only detected the largest effects because more subtle changes may have escaped detection for the reasons discussed above .
abundant mhc ligands such as those detected by the analytical protocol can repeatedly be found in batches from cultured cells harvested at different time points which underlined evidence for the observed impact of transgene expression on the presentation of peptide antigens by mhc i. the presentation of self - peptides may result from the phenomenon of insertional mutagenesis , commonly associated with integrative vectors .
sequences randomly inserted into the genome can modify the expression of genes in the proximity of the integration sites .
indeed , such insertions may be deleterious and even lead to the activation of oncogenes . in a clinical gene therapy trial for x - linked severe combined immune deficiency
, 3 of 13 patients developed leukemia 30 months after treatment as a consequence of oncogene activation by the integrating vector genome .
activation of oncogenes is accompanied by substantial changes at the proteome level which may ultimately provoke appearance and disappearance of peptide antigens of self - origin . in the context of infection with hiv , di marzo veronese et al .
showed that infected cells from hiv-1 positive subjects overexpressed vinculin and that three peptides originating from this self - protein are presented by mhc i at the surface of these infected cells , leading to the activation of specific cytotoxic t - lymphocytes .
recently reported that lentiviral vectors may provoke somatic cell reprogramming as a result of dysregulated host gene expression in the vicinity of integration sites .
mechanisms other than those associated with genotoxicity may also contribute to the changes in the presentation of peptide antigens , including particular mechanisms involving the fusion proteins allowing rapamycin - inducible expression of transgenes . in our model , these transgenic proteins
this could lead to interference with the proteome by competing for the protein synthesis and degradation machinery .
furthermore , specific interference of these transgenic proteins might trigger changes in the presentation of self - peptides by mhc i. the transgenic proteins include domains from the human frap kinase and the frap kinase binding protein , which may interfere with the endogenous frap kinase and frap kinase binding protein in the regulation of autophagy . recently
, it has emerged that autophagy is a pathway for the processing of antigens presented by mhc i. consistent with this possibility , we detected several peptide antigens originating from membrane proteins that could not have been produced by proteasome - mediated proteolysis but might have got access to mhc i by autophagy - mediated digestion of membrane components and mitochondria .
however , these peptides may also be produced by translation of mrna using alternative translational reading frames .
regardless of the molecular mechanism involved in the changes in the repertoire of mhc i - presented peptides , our coculture experiments revealed that transduction of cells with lentiviral vectors might affect the immunogenicity of individual transduced cells .
in particular , transduced cells were able to activate and trigger proliferation of t cells .
cytotoxic t cells may arise , if the presentation of the respective mhc peptide complexes in the thymus is insufficient during the selection process leading to self - tolerance . in clinical settings ,
this phenomenon could lead to an immunological rejection of the transduced cells and thereby prevent a gene therapy protocol achieving its aims .
any adverse immune reaction probably depends on a variety of factors including cell type , the site of vector integration and the hla haplotype .
furthermore , the changes in the presentation of peptides by mhc i may only be recognized , if cytotoxic t cells bearing appropriate t cell receptors are available in the repertoire .
we studied three cell lines , and only one , the transduced d407-derived cell clone , induced proliferation of cd4 t cells ( comprising cytotoxic cd8 t and nkt cells ) .
it is therefore likely that immune reactivity to transduced cells depends on the details of each individual case and context .
most probably , following administration of lentiviral vectors to patients , only a subset of the broad diversity of transduced cells could be eliminated by the immune system . interestingly ,
in a recent trial of gene therapy for -thalassemia , one particular clone of transduced cells came to predominate over time and provided therapeutic efficacy , suggesting that the majority of the transduced cells were probably successively eliminated by the immune system .
the effects on the presentation of peptide epitopes might not be restricted to mhc i. they might also be found in the repertoire of peptides presented by mhc ii as transduced her 911 cells ( but not d407 or hek 293 t cells ) revealed , compared with wt controls , significantly enhanced capacity to activate cd3cd4 allogeneic t cells , although no significant proliferation was observed ( supplementary figure s2 ) .
it would therefore be of interest to assess the effect of the vectors on the presentation of mhc ii peptides .
these studies should also address whether activated cd4 cells belong to effector or regulatory subtypes which induce adverse immunity and immune tolerance , respectively .
indeed , particular individual subsets of transduced cells might escape elimination by the immune system by activation of tolerance - mediating cd4 regulatory t cells , a scenario frequently observed in studies monitoring the progression of tumors in patients .
taken together , our findings provide the first evidence ( i ) that pathways involved in processing of peptide antigens and their presentation by mhc i render therapeutic manipulations within the genome of particular target cells visible to the immune system and ( ii ) that the immune system may recognize these events and respond .
all cell lines were maintained at 37 c under a water - saturated atmosphere of 5% co2/95% air .
her 911 and hek 293 t cells were cultivated in dulbecco 's modified eagle medium supplemented with 10% fetal calf serum , 20 u / ml penicillin g , and 20 g / ml streptomycin sulfate ; d407 cells were cultivated in dulbecco 's modified eagle medium containing 5% fetal calf serum , and antibiotics as above . for gene transfer
, 20,000 cells were incubated overnight with aliquots of the transactivator expression vector and the gdnf secretion vector ( figure 1a ) , each corresponding to 60 ng of capsid protein p24 .
after 3 weeks , wells were screened for cell clones which were tested for inducible production of gdnf using the gdnf emax immunoassay system ( promega , charbonnires , france ) .
appropriate clones released gdnf into the medium after addition of the rapamycin derivative ap 21967 ( 10 nmol / l , ariad , cambridge , ma ) but not in the absence of the inducer .
mhc i - presented peptides were obtained by immune precipitation of mhc i molecules from the amplified cell lines as described using the hla - a , -b , and -c specific antibody w6/32 immobilized on sepharose , acid treatment and ultrafiltration . as described previously , peptides from wt and transduced cells were concentrated by lyophilization , dissolved in 500 l water , modified by guanidination , and then nicotinylated with h4 and h4 nicotinoyloxy - succinimide ( lgc promochem , molsheim , france ) , respectively .
the modified peptide extracts were analyzed as described using a reversed phase nanolc-2d system ( eksigent , darmstadt , germany ) , coupled to a hybrid quadrupole orthogonal acceleration time - of - flight ms / ms ( q - tof ultima ; micromass / waters , saint - quentin en yvelines , france ) equipped with a micro - esi source .
results for mixed transduced and wt samples were recorded in an lc - esi - ms experiment without fragmentation . for sequence analysis ,
results for transduced and wt samples were recorded separately in individual lc - esi - ms / ms experiments .
fragment spectra were analyzed manually and database searches ( proteomics department at the hammersmith campus of imperial college london , national center for biotechnology information , expressed sequence tag ) involved using the multiple alignment system for protein sequences based on three - way dynamic programming ( mascot , http://www.matrixscience.com ) .
the netmhcpan 2.3 server ( http://www.cbs.dtu.dk/services/netmhcpan ) was used to search for mhc i binding partners of the peptide sequences found .
dna was extracted from hek293 t , her911 , and d407 cells using a salting - out technique .
hla medium resolution typing for hla - a , -b , -c , drb1 , and dqb1 was performed using pcr - sequence specific oligonucleotide ( sso ) luminex kits ( labtype sso a locus , labtype sso b locus , labtype sso drb1 , and labtype sso dqb1 ; one lambda , canoga park , ca ) .
unfractionated allogeneic peripheral blood mononuclear cells ( hla - a*02/29:02 , hla - b*40:02/44:03 , hla - c*02:02/16:01 , hla - drb1 * 07:01/11:01 , hla - dqb1 * 02:02/03:01 , 1 10 cells ) purified from a blood sample from a healthy donor were labeled with the carboxyfluorescein succinimidyl ester ( cfse , 10 mol / l for 10 minutes at 37 c ) and then incubated with 1 10 target cells ( transduced cells , wt cells , or allogeneic stimulatory peripheral blood mononuclear cells for control ) . before incubation with peripheral blood mononuclear cells ,
target cells were treated with mitomycin c ( 50 g / ml ) for 30 minutes .
after 6 days of coculture , cells were stained with efluor780-conjugated anti - cd3 ( ucht1 ; ebiosciences , paris , france ) , phycoerythrin - conjugated anti - cd25 and allophycocyanin - conjugated anti - cd4 antibodies , and with 7-aminoactinomycin d to exclude dead cells ( bd biosciences , le pont de claix , france ) .
t cell activation and proliferation was then monitored by flow cytometry using a canto ii flow cytometer ( bd biosciences ) .
results were analyzed with bd diva software ( bd biosciences ) and are reported as mean values se of at least three independent experiments .
keuls test ( sigmastat software ; systat software , chicago , il ) were used for statistical analyses and a p of < 0.05 was considered significant .
( a ) flow cytometric analysis of the expression of mhc i , mhc ii ( hla - dr , hla - dq , and hla - dp ) , cd80 , and cd86 molecules and transduced her 911 cells .
( b ) expression of immune relevant molecules by wt and transduced hek 293 t , her 911 and d407 cells .
( a ) flow cytometric analysis of the expression of mhc i , mhc ii ( hla - dr , hla - dq , and hla - dp ) , cd80 , and cd86 molecules and transduced her 911 cells .
( b ) expression of immune relevant molecules by wt and transduced hek 293 t , her 911 and d407 cells . | the rapamycin - inducible gene regulation system was designed to minimize immune reactions in man and may thus be suited for gene therapy .
we assessed whether this system indeed induces no immune responses .
the protein components of the regulation system were produced in the human cell lines hek 293 t , d407 , and her 911 following lentiviral transfer of the corresponding genes .
stable cell lines were established , and the peptides presented by major histocompatibility complex class i ( mhc i ) molecules on transduced and wild - type ( wt ) cells were compared by differential mass spectrometry .
in all cell lines examined , expression of the transgenes resulted in prominent changes in the repertoire of mhc i - presented self - peptides .
no mhc i ligands originating from the transgenic proteins were detected . in vitro analysis of immunogenicity revealed that transduced d407 cells displayed slightly higher capacity than wt controls to promote proliferation of cytotoxic t cells .
these results indicate that therapeutic manipulations within the genome of target cells may affect pathways involved in the processing of peptide antigens and their presentation by mhc i. this makes the genomic modifications visible to the immune system which may recognize these events and respond .
ultimately , the findings call attention to a possible immune risk . |
the aim of the present study was to investigate whether epidural administration of a xylazine - lidocaine combination accompanied by xylazine sedation would provide satisfactory analgesia for some surgical procedures on 10 calves admitted to the department of veterinary surgery , university of kafkas with perineal urolithiasis ( n:2 ) , rectovaginal fistula ( n:1 ) , atresia ani ( n:2 ) , omphalophlebitis ( n:2 ) , omphaloarteritis ( n:1 ) and umbilical hernia ( n:2 ) .
following intramuscular injection of xylazine at a dose of 0.05 mg / kg for sedation , xylazine - lidocaine combination ( 0.2 mg / kg lidocaine + 0.02 mg / kg xylazine + 5 ml 0.9% nacl ) was administrated into the lumbosacral ( l6-s1 ) , sacrococcygeal ( s5-co1 ) or intercoccygeal ( co1-co2 ) space .
heart rate , respiratory rate and rectal temperature were recorded prior to and during analgesia at 5 , 10 , 15 , 30 and 60 minutes .
the study revealed that the combination of epidural xylazine - lidocaine with xylazine sedation was highly satisfactory for surgery of the lower urinary tract and the perineal region , but it was less so for surgery of the umbilical area .
xylazine , one of the alpha2 agonists , has been widely used in veterinary practice both systemically as a sedative and analgesic drug , and neuraxially for analgesia in various species .
it causes muscle relaxation and , depending on the dose used , it can induce cardiorespiratory depression , a fall in body temperature , a reduction in ruminal activity , a reduction in swallowing ( hence , drooling of saliva ) with an increased risk of aspiraton , and diuresis ( zuagg and nussbaum , 1989 ) . when local anaesthetic agents are administered by the epidural route , they affect both motor and sensory nerves , and motor dysfunction , resulting in severe ataxia and recumbency , is a particular disadvantage for surgery when it is desirable that the animal should remain standing .
ataxia and recumbency may occur also following epidural administration of alpha2 agonists , especially at higher doses , either due to systemic absorption of the drug and/or to local action on motor nerves .
however , at appropriate doses , xylazine has been reported to be a suitable agent for providing analgesia without excessive ataxia and recumbency .
upper caudal epidural administration of lidocaine and xylazine combination in cattle provides satisfactory analgesia for some surgical interventions such as fetotomy , repair of recto - vaginal fistulae , replacement of prolapsed uterus , vagina or rectum , facilitiation of embryo transfer , and perineal urethrostomy .
furthermore , this combination has a longer analgesic effect than xylazine used alone and should allow an animal to remain standing .
the aim of the present study was to reveal whether epidural administration of xylazine and lidocaine combined with xylazine sedation could provide satisfactory analgesia for some surgical interventions carried out on the lower urinary tract , and on the umbilical and perineal regions .
the calves ( table 1 ) exhibited various surgical disorders : urolithiasis ( n:2 ) , rectovaginal fistula ( n:1 ) , atresia ani ( n:2 ) , omphalophlebitis ( n:2 ) , omphaloarteritis ( n:1 ) and umbilical hernia ( n:2 ) .
age , breed , sex , body weight , site of the epidural injection and surgical procedure for each of the 10 animals eared : eastern anatolian red ; fc : female calf ; s. angus : sweet angus ; mc : male calves ; co : coccygeal ; s : sacral ; hu : umbilical hernia ; r - v fistula : recto - vaginal fistula ; d : day ; m : month .
after surgical preparation of the sites for the epidural injections and the operation areas , each calf was given 0.05 mg / kg body weight of xylazine intramuscularly for sedation and then the combination of anaesthetic drugs ( 0.2 mg / kg lidocaine + 0.02 mg / kg xylazine + 5 ml 0.09% nacl ) was injected into one of the following epidural spaces : lumbosacral ( l6-s 1 ; n:5 ) , sacrococcygeal ( s5-co1;n:3 ) or intercoccygeal ( co1-co2 ; n:2 )
. heart rate , respiratory rate and body temperature were recorded for each animal before the administration of the drugs and at 5,10,15,30 and 60 minutes afterwards .
responses to needle prick in the perineal and hindlimb areas and the umbilical region were assessed to monitor the effectiveness of analgesia and were graded as follows : 1 : normal reaction to pain sensation 2 : mild tail reflex and pain by needle prick 3 : tail reflex absent , mild response to needle prick 4 : tail and needle prick reflexes absent , good analgesia for surgery .
these tests were repeated at 1 , 3 , 5 , 10 , 15 , 30 , 60 , 90 , 120 , 150 and 180 minutes after the epidural injection .
measurements were compared with baseline values ( time:0 ) by performing anova followed by tukey test using minitab statistical program .
measurements were compared with baseline values ( time:0 ) by performing anova followed by tukey test using minitab statistical program .
sedation with xylazine and epidural administration of the xylazine - lidocaine combination resulted in a significant decrease of respiratory rate at 10 , 15 and 60 minutes ( p < 0.01 ) and of body temperature at 60 minutes ( p < 0.05 ) ; heart rate was decreased but the reduction was not statistically significant ( table 2 ) .
alterations in body temperature and heart - respiratory rates ( mean sd ) in 10 calves at 0 , 5 , 10,15,30 and 60 minutes after sedation with xylazine and epidural administration of xylazine and lidocaine combination n:10 , * : p < 0,01 , * * : p < 0,05 analgesia started at 3 minutes in the perineal region and at 15 minutes in the umbilical region following epidural injection .
distribution of the 10 calves amongst the grades of analgesia at intervals following sedation with xylazine and epidural injection of the lidocaine and xylazine combination 1 : normal pain sensation to needle prick 2 : mild tail reflex and pain to needle prick 3 : tail reflex absent , mild response to the needle prick 4 : tail and needle prick reflexes absent , good analgesia for surgery .
however , adequate analgesia for the surgery was not achieved at the cranial side of the umbilicus and , therefore , surgical interventions in this region were performed with local infiltration anaesthesia .
intervals during which analgesia was sufficient for surgery are shown in figure 1 . in order to avoid complications resulting from general anaesthesia ,
epidural injection of local anaesthetic agents has been widely reported for surgical interventions in the perineal region in cattle , horses , goats and sheep .
investigation revealed that epidural administration of local anaesthetic drugs when used alone had various side effects and , although providing satisfactory analgesia for laparotomy , it did not always prevent response to visceral manipulation . on the other hand ,
epidural injection of xylazine resulted in adequate analgesia , albeit with a slower onset than was achieved by the administration of local anaesthetic drugs ; however , bradycardia , respiratory depression and hypothermia have been reported . in the present study ,
the side effects of local anaesthetic / xylazine combination were minimized , and analgesia was prolonged by the low dosage of xylazine used for sedation and regional analgesia .
the results of the present study indicated that epidural administration of xylazine - lidocaine combination following sedation with xylazine provided satisfactory analgesia for perineal and lower urinary tract surgery without any complications .
however , as observed by lewis et al . , satisfactory analgesia for umbilical surgery was not achieved . | the aim of the present study was to investigate whether epidural administration of a xylazine - lidocaine combination accompanied by xylazine sedation would provide satisfactory analgesia for some surgical procedures on 10 calves admitted to the department of veterinary surgery , university of kafkas with perineal urolithiasis ( n:2 ) , rectovaginal fistula ( n:1 ) , atresia ani ( n:2 ) , omphalophlebitis ( n:2 ) , omphaloarteritis ( n:1 ) and umbilical hernia ( n:2).following intramuscular injection of xylazine at a dose of 0.05 mg / kg for sedation , xylazine - lidocaine combination ( 0.2 mg / kg lidocaine + 0.02 mg / kg xylazine + 5 ml 0.9% nacl ) was administrated into the lumbosacral ( l6-s1 ) , sacrococcygeal ( s5-co1 ) or intercoccygeal ( co1-co2 ) space . heart rate , respiratory rate and rectal temperature were recorded prior to and during analgesia at 5 , 10 , 15 , 30 and 60 minutes .
furthermore , depth and duration of analgesia were evaluated during surgical intervention.the study revealed that the combination of epidural xylazine - lidocaine with xylazine sedation was highly satisfactory for surgery of the lower urinary tract and the perineal region , but it was less so for surgery of the umbilical area . |
biliary cystadenomas are rare cystic lesions of the liver . they account for less than 5% of nonparasitic cysts of the liver and occur frequently in middle - aged women .
these cysts need to be differentiated from other cystic lesions such as simple cysts , hydatid cysts , abscesses , hematomas , and polycystic liver disease .
biliary cystadenomas were first described in 1943 ; less than 200 cases have been reported till date .
they are often benign lesions with a malignant potential [ 3 , 5 , 6 ] .
they develop from either an aberrant bile duct or directly from a primitive hepatobiliary stem cell [ 1 , 7 , 8 ] .
majority are intrahepatic ( 85% ) [ 6 , 7 , 911 ] , fewer are extra hepatic [ 57 , 12 ] and occasionally are seen to arise from the gall bladder [ 9 , 12 ] .
there is difficulty in differentiating a benign from a malignant biliary cystadenoma and hence these lesions should always be resected .
one can not always reliably distinguish a simple cyst or a hydatid cyst from a benign biliary cystadenoma . in such situations , deroofing , marsupialization , or partial resection of the suspected cysts has resulted in a very high rate of recurrence ( > 90% ) .
we report a series of 13 cases highlighting the radiological interpretation of biliary cystadenomas , issues on surgical management , and postoperative followup for recurrence .
records of patients with histologically confirmed biliary cystadenomas admitted between march 2006 and october 2011 at the institute of surgical gastroenterology and liver transplantation , government stanley medical college , chennai , india , were reviewed retrospectively .
patients ' charts were scrutinized for demographic characteristics , clinical presentation , radiological findings , and past and present surgical details and outcomes like morbidity and mortality .
preoperative diagnosis on ultrasound and cect abdomen was based on presence of one or more findings of internal septations , mural nodules , papillary projections , and cyst wall enhancement ( figure 1 ) .
the choice of surgical procedure was based on the site and size of the lesion .
liver resection was the preferred procedure and enucleation was done when resection was not feasible .
of the 13 patients with biliary cystadenomas , there were eleven women and two men .
the most common symptom was abdominal pain ( 92% ) , followed by abdominal distension , loss of appetite , and mass abdomen .
the median duration of symptoms was 18 months ( range 2 to 42 months ) .
out of seven patients with history of previous surgery for liver lesions , five patients had partial cystopericystectomies done elsewhere for suspected hydatid cyst , one patient had a laparoscopic marsupialisation and one had laparoscopic fenestration , the latter two for presumed simple cyst of the liver .
all seven patients had recurrence of symptoms after a median interval of 4 years ( range 2 months to 5 years ) .
four patients had the postoperative biopsy report as intrahepatic biliary cystadenoma and in three , the histology was inconclusive .
typical findings included multiloculated cyst with a well - defined capsule , some with wall calcification , internal septations , and solid papillary projections .
three patients had elevated serum gamma glutamyl transferase and serum alkaline phosphatase ( table 1 ) .
ten of the 13 patients had resection of the involved segments : four hepatectomies , three bisegmentectomies , two lateral segmentectomies , and one extended right hepatectomy ( figures 2 and 3 ) . in 3 patients , proper hepatic resection could not be performed owing to the large size of the lesion ( longest diameter ranging from 23 cm to 34 cm ) and the close proximity to the hilum , indenting the hilar structures .
hence enucleation was contemplated in these patients with a view to relieve the symptoms ( figure 5 ) . eventually , the histopathology in these three patients turned out to be benign .
t - tube placement was done in 2 of these patients in whom the cyst had a communication with the bile duct .
the preoperative imaging had not demonstrated this biliary communication . a leak test done after enucleation had demonstrated bile leak in the enucleation bed .
the site of leak was suture ligated with a t - tube drainage of the common bile duct .
the t - tube was removed two weeks later , after confirming absence of a bile leak .
both these patients were free of biliary sequelae or other complications in the followup period of 8 and 14 months .
postoperatively , one patient developed basal atelectasis of the left lung , which settled with supportive care and one patient developed a subdiaphragmatic collection for which ultrasound guided pigtail drainage was done .
none of the patients had recurrence of symptoms or recurrence of the cyst during a median followup of 22 months ( range 3 to 66 months ) .
the three patients in whom the lesion was enucleated were specifically followed up with regular usg abdomen even if asymptomatic , which demonstrated no recurrence .
biliary cystadenomas constitute less than 5% of cystic lesions of the liver . typically , the patient is a middle - aged woman presenting with abdominal pain and/or discomfort , with distension and a palpable mass [ 1 , 6 , 7 , 14 ] .
rare presentations include vomiting , dyspepsia , anorexia , and weight loss [ 14 , 15 ] .
acute presentation is often pain due to intracystic hemorrhage or rupture of the cyst and fever secondary to infection of the cyst .
jaundice [ 1719 ] is either due to an extrinsic compression of the bile duct , biliary obstruction by an intraluminal tumoural mass , or accretion of mucus secretion from a communicating biliary cystadenoma .
ascites is secondary to compression of the inferior vena cava or the hepatic veins [ 19 , 21 , 22 ] .
cystadenomas are known to increase in size during pregnancy and following oral contraceptives suggesting hormonal dependency [ 1 , 2 , 13 ] .
recurrence of a cyst following partial resection should raise a suspicion of cystadenoma . in our series ,
abdominal pain was the most common presentation followed by abdominal distension , anorexia and mass abdomen .
none of our patients had obstructive jaundice , but three patients had elevated liver enzymes ( table 1 ) .
biliary cystadenomas are usually large multiloculated cystic tumours and are of two types : those with [ 1 , 5 , 8 ] , and those without mesenchymal ( ovarian - like ) stroma .
the ovarian - like stroma is thick consisting of compact spindle - shaped cells and supports the epithelium and is often seen exclusively in women [ 1 , 7 , 16 ] .
microscopically the loculi are limited by single layer of cuboidal or nonciliated columnar epithelium resting on a basement membrane ( figure 6 ) . at places the epithelium forms multiple polypoidal or papillary projections .
cystadenomas with mesenchymal stroma are considered premalignant with a good prognosis while those without are known to transform to malignancy more often with a poor prognosis [ 6 , 8 , 9 ] .
the majority of biliary cystadenomas do not communicate with the bile ducts , but luminal communication may be occasionally observed [ 2 , 24 ] . in some of the cases ,
this variant is considered an intraductal papillary neoplasm with prominent cystic dilatation of the duct rather than a true biliary cystic neoplasm [ 24 , 25 ] .
ct and mri often fail to identify the narrow communication which is easily demonstratable during an intraoperative cholangiogram . the cystic fluid may be clear and mucinous [ 5 , 7 ] .
blood stained fluid within the cyst indicates a malignant component ( cystadenocarcinoma ) . rarely , the fluid may be bile stained , purulent , proteinaceous , or gelatinous .
differential diagnosis of cystadenomas include simple liver cysts , parasitic cysts ( particularly hydatid cyst ) , haematomas , post - traumatic cysts , liver abscess , polycystic diseases biliary cystadenocarcinoma , and metastatic , ovarian , or pancreatic adenocarcinoma [ 9 , 10 , 14 ] .
diagnosis of biliary cystadenomas is often possible on an ultrasonography , cect , and mri abdomen ( figure 4 ) . on ultrasound ,
cystic nature of the lesion with multiple loculi , septations , and internal echoes , with papillary projections [ 9 , 15 ] , is typical .
the cyst is well - demarcated and thick - walled , globular or ovoid with a noncalcified wall [ 79 , 27 ] .
cect in addition demarcates the anatomic relation to surrounding structures , particularly major vessels [ 14 , 15 , 28 , 29 ] .
mri is able to characterise the nature of fluid within the cyst [ 9 , 28 ] , that is , blood versus mucin . despite all the aforementioned radiological features
, the preoperative radiological diagnostic accuracy may be as low as 30% and therefore a high index of suspicion is indicated .
an irregular thickness of the cyst wall , presence of mural nodules , or papillary projections indicates the possibility of a malignancy [ 9 , 10 , 28 , 32 ] .
well - defined capsule was seen in eight patients ( 61% ) and wall - enhancement in five patients ( 38% ) .
papillary projections and calcifications were seen in three patients each . a preoperative core needle biopsy to detect malignancy is not recommended as this is not accurate and carries the risk of needle seeding and dissemination [ 16 , 34 , 35 ] . elevated cea and ca 19 - 9 in the serum or the cystic fluid aids in diagnosis and followup of patients [ 16 , 36 ] .
a normal level does not exclude a biliary cystadenoma ; some simple liver cysts may also show elevated serum or cystic fluid cea or ca 19 - 9 .
one is the incomplete excision of the cyst , misdiagnosed as a simple cyst or a hydatid cyst , resulting in recurrence and the second is the difficulty in differentiating biliary cystadenomas from biliary cystadenocarcinomas [ 1 , 5 , 9 , 12 ] , either before or during surgery .
hence the recommendation is a complete resection of any suspected biliary cystadenoma [ 1 , 5 , 12 ] . in our series
, five patients presented to us with recurrence after partial resection done elsewhere for a mistaken diagnosis of hydatid cyst and two patients with recurrence after surgery for a suspected simple liver cyst .
earlier , biliary cystadenomas have been treated with various procedures like marsupialization , internal roux - en - y drainage , aspiration , sclerosis , or partial resection .
however , all these procedures have been associated with high rates of recurrence [ 7 , 9 , 14 , 37 , 38 ] .
this procedure is a valid alternative where resection is difficult or is likely to be associated with morbidity [ 12 , 16 ] . in conclusion ,
the diagnosis of biliary cystadenoma should be considered in any multilocular cystic lesion of the liver , particularly in a middle - aged woman .
it is an important differential diagnosis for a hydatid cyst especially in endemic regions and a complete resection of the cyst is recommended when in doubt .
the recommended treatment of choice for any suspected biliary cystadenoma is resection as it is extremely difficult to differentiate preoperatively , a benign from a malignant neoplasm .
enucleation is another option and is indicated where resection is impossible due to the size and location of the tumour . | introduction and objective .
biliary cystadenoma is a rare benign neoplasm of the liver with less than 200 cases being reported allover the world .
we report a series of 13 cases highlighting the radiological findings and problems related to its management .
materials and methods .
records of thirteen patients who underwent surgery for biliary cystadenomas , between march 2006 and october 2011 , were reviewed retrospectively .
results .
majority of the patients were females ( 11 out of 13 ) , with a median age of 46 ( 2365 ) years .
the most frequent symptom was abdominal pain ( 92% ) .
seven patients had presented with history of previous surgery for liver lesions .
five patients had presented with recurrence after partial resection for a suspected hydatid cyst and two after surgery for presumed simple liver cyst .
ten of the 13 patients had complete resection of the cyst with enucleation in 3 patients , 2 of whom in addition required t - tube drainage of the bile duct .
there has been no recurrence during the follow - up period ranging from 3 months to 5 years .
conclusion .
biliary cystadenoma must be differentiated from other benign cysts .
hepatic resection or cyst enucleation is the recommended treatment option . |
central venous catheters ( cvc ) are widely used in clinical practice for total parenteral nutrition along with other functions , such as central venous pressure monitoring , fluid and blood transfusion , medication and hemodialysis .
central venous catheter thrombosis is one of the most serious , life - threatening , and costly complications .
mitochondrial neurogastrointestinal encephalopathy ( mngie ) is a rare autosomal recessive multisystem genetic disease related to the mutation of the thymidine phosphorylase gene .
clinical status is characterized by severe gastrointestinal dysmotility and includes cachexia , ptosis , external ophthalmoplegia , peripheral neuropathy and leukoencephalopathy .
mitochondrial neurogastrointestinal encephalopathy should be kept in mind for all patients presenting with both digestive and nervous system involvement , even though it lacks a classic phenotype [ 2 , 3 ] . in this case report , we present a patient with a diagnosis of cvc related thrombus who required open - heart surgery . the patient was diagnosed with rarely seen mngie and could not tolerate oral nutrition because of the operation . therefore
a twenty - one - year - old male patient ( 40 kg and 190 cm ) was diagnosed with mngie in 2009 after being evaluated in the neurology clinic with energy loss , foot - drop , difficulty swallowing , and weight loss . in 2011
, tpn was initiated through central venous catheterization ( cvc ) because he had undergone duodenojejunostomy operation due to superior mesenteric artery ( sma ) syndrome which is a rare condition , results in compression of the third portion of the duodenum by a narrow - angled sma against the aorta and could not tolerate enteral nutrition postoperatively .
central venous catheterization was changed 4 times due to thrombosis or infection , and the last catheterization was implemented on 19 november 2012 .
the catheter was inserted in our hospital radiology intervention room under sterile conditions by an interventional radiology team .
the catheter was not heparin coated , 14.5 french diameter and 28 cm long , extending from the left pectoral area to the right atrium .
the composition of the parenteral solution was lipid 20% , aminoacides 10% and glucose 40% , 1800 kcal / day and 1500 cc / day were used .
however , the patient was admitted to our hospital again one month later with fever and palpitation complaints . upon physical examination ,
his body temperature was 38.5 , blood pressure was 120/77 mmhg , pulse was 157 beats / min , and sedimentation and crp values were elevated . because of the growth of methicillin resistant staphylococcus aureus ( mrsa ) in the patient 's blood cultures obtained from the catheter lumen and simultaneously from a peripheral vein , his fever was linked to catheter - related infection , and it was decided to remove the catheter . in the echocardiography performed before the removal of the catheter , the view of the catheter inside the right atrium ( ra ) and 35 x 15 mm sized echogenicity at its end which is protruded to the right ventricle during diastole and evaluated as a mobile thrombus was visualized . after 6 days of heparin and antibiotic treatment , no difference was detected in the size of the thrombus in echocardiography .
our patient 's prothrombin time ( 12.9 second ) , international normalized ratio inr ( 1.1 ) and platelet count ( 380.000/mm ) were evaluated preoperatively , all these values were within normal limits . the patient was subsequently taken to open heart surgery and was monitored by ecg , spo2 and invasive arterial catheterization .
systemic arterial pressure was recorded as 120/80 mmhg , heart rate at 130/min , and spo2 at 97% . upon induction of anesthesia ,
intubation was performed with 0.1 mg / kg midazolam , 3 mg / kg thiopental , 4 g / kg fentanyl and 1 mg / kg rocuronium .
extracorporeal circulation was started in the patient by implementation of cannula to the ascending aorta and vena cava inferior .
the thrombus , seen at the catheter ending inside the right atrium , was removed by cutting ( fig . 1 , 2 and 3 ) .
extracorporeal circulation was 40 minutes , the whole operation was 150 minutes . at the beginning of the operation
this value decreased to 7.1 g / dl , therefore blood transfusion was performed and 1 u ( red blood cell ) rbc and 2 u fresh frozen plasma ( ffp ) were given during pumping .
the patient was moved to the intensive care unit , extubated 5 hours after the operation , and transported to the cardiovascular surgery department on the 3 day .
a catheter culture that was sent during the operation was sterile , and the pathology report was consistent with infected thrombus .
the patient refused the insertion of a permanent catheter again and was discharged with the recommendation of the gastroenterology clinic for enteral nutrition and supportive peripheral nutrition upon regression of sedimentation and crp values .
fibrous sheath wrapping the distal part of the central venous catheter thrombotic mass attached the distal tip of catheter in the right atrium mass was removed from distal catheter ending
one of the most common late complications following central venous catheterization is the development of infection in blood circulation ; bacteremia and fungemia are seen in about 5% of patients [ 5 , 6 ] . in our patient ,
both thrombus and infection developed together , and the infected thrombus was treated only by removal , surgically .
catheter - related infections can be classified in 3 groups : 1 ) colonization of the catheter ; 2 ) blood circulation infections related with catheter and 3 ) infections of the catheter insertion site . generally , in the presence of a clinical finding of catheter - related infections , removal of the catheter , taking a culture from its end , and antibiotic treatment
catheter removal has the potential to cause pulmonary embolism when the thrombus is present at the end of the catheter . in our case , if catheter removal had been performed , there would have been a risk of pulmonary septic embolism . in order to prevent this risk ,
the infected thrombus was removed by open heart surgery , visualizing it from the right atrium without allowing it to decompose or embolize .
catheter - related thrombosis is one of the chief complications of central venous catheterization and total parenteral nutrition .
its clinical importance is not fully understood . in the development of catheter - related thrombosis , underlying disease , the tendency of the patient for thrombosis , the characteristics of fluids in the catheter , and the place and time of the vessel the catheter is inserted into all play a role .
it is known that lipid emulsions , used for parenteral nutrition , predispose a patient to catheter - related thrombosis .
overly acidic or alkaline ph values of the fluids increase the tendency for thrombosis [ 8 - 10 ] .
we suggest that the use of lipid emulsions for parenteral nutrition played a role in the development of thrombosis in our patient .
catheter - related thrombosis leads to partial or total occlusion , and in total occlusion , supplying liquid or taking blood from the catheter would not be possible .
the thrombus that leads up to venous occlusion may cause pain , swelling and apparent collateral veins .
there were no mechanical obstruction symptoms detected in our patient . in literature , most catheter thrombosis cases are reported as asymptomatic [ 7 , 11 - 13 ] .
the thrombus in our case was characterized by advancing from the catheter tip into the right atrium ; however , it was not blocking blood flow in the tricuspid valve .
obstruction symptoms did not develop , since it did not block the blood flow from the superior vena cava .
for this reason , we think that the thrombus remained asymptomatic until it was infected . in an autopsy study ,
this fibrin sheath is not reported to affect catheter functions but may produce partial obstruction .
it could be suggested in our case that the fibrin sheath that developed at the tip of the catheter grew gradually , reached a thrombotic structure , and prepared the way for infection .
some type of bacteria leads to the formation of an infection in a thrombotic environment .
microbiologic studies demonstrate that some staphylococcus species adhere easily to the proteins in a thrombus such as fibrinogen and fibronectin , and the thrombus facilitates the infection with these bacteria .
there is not anything published heretofore linking the diagnosis of mngie in a patient leading to tendency for thrombosis . on the other hand ,
when considering the underlying primary disease , intestinal problems , cachexia and long - term cvc application because of tpn need , it is commonly seen in people with mngie syndrome .
the fact that should be kept in mind of clinicians who follow these patients is that it can predispose a patient to catheter - related thrombus , even infective endocarditis .
although ultrasonography is a convenient method for jugular veins , its usage is limited for subclavian veins because of the effects of the clavicle , sternum and lungs on ultrasonography waves . because venography is an invasive method , it is rarely used [ 17 , 18 ] . in our case ,
the thrombus extended through the right atrium on the tip of the catheter and was visualized with echocardiography .
we think that echocardiography is the primary method to use for the evaluation of catheter - related thrombi in the subclavian vein .
the infected thrombus developed due to long - term central venous catheterization for continuous tpn and was successfully treated , without complication , by cardiac surgery .
based on this case , we think that before removing an infected catheter , the probability of the presence of fibrin and infected thrombus ( that has not led to obstruction ) at the tip of the catheter should be evaluated , and in the presence of a large infected thrombus , the mass should be removed surgically .
| central venous catheterization as a frequent routine clinical procedure may have significant complications .
mechanical complications may occur during catheter placement , whereas thromboembolic and infectious complications can be seen during follow - up .
total parenteral nutrition ( tpn ) associated central venous catheterizations may result in early mechanical complications and thrombotic and infectious complications in the long term.this paper describes a patient diagnosed as mitochondrial neurogastrointestinal encephalomyopathy requiring long - term central venous catheterization for tpn implementation , who had an infected thrombus on the catheter tip resected by cardiac surgery . |
iridoschisis is a rare condition in which the iris stroma is cleaved in two portions and is defined as a separation of the anterior iris stroma from the posterior stroma and muscle layers .
the anterior layer splits into strands , and the free ends float freely in the anterior chamber.1 the condition was first described in 1922 by schmitt when he presented a case with detachment of the anterior iris layer.2 the term iridoschisis was first introduced by loewenstein and foster in 1945 , when they described a case of end - stage glaucoma in an old woman who had an inferior localized cleavage of the iris into two layers , with the anterior fibrils of the iris waving in the anterior chamber.3
an 80-year - old woman was referred to the emergency unit of our ophthalmology department where she presented with a history of acute and persistent pain in the left eye and temple , accompanied by nausea and vomiting during the previous 24 hours .
the clinical examination showed that the best - corrected visual acuity of the affected eye was finger count ( at 1.5 m ) , and the intraocular pressure at the time of admission was 54 mmhg .
the conjunctiva was intensely red , with corneal injection , and mild edema was seen in the corneal stroma .
the anterior chamber was remarkably shallow and showed loose ends of degenerated anterior stromal leaf fibrils floating freely in the aqueous .
the iris showed typical features of iridoschisis , ie , stromal separation with cystic iris elevation in the inferior half and forward bowing of the iris ( figure 1 ) .
the lens showed mature cataract which hindered visualization of the fundus and evaluation of any optic disc alterations .
slit - lamp examination of the fellow eye revealed similar features , with a shallow anterior chamber and iridoschisis concerning the inferior half of the tissue ( figure 2 ) .
the patient was free from a history of ocular trauma or of heritable ocular disease .
conjunctivitis occurring at any time of the year with no mucopurulent secretion or pruritus , affecting either eye during an attack .
the patient was diagnosed as having acute angle - closure glaucoma , and was receiving acetazolamide 250 mg three times daily , cosopt twice daily , isoptocarpine every two hours , intravenous mannitol ( 1 g / kg body weight stat ) , and oral pain - relieving drugs . on the third day after admission ,
the intraocular pressure of the affected eye was regulated at 14 mmhg and the administration of acetazolamide and cosopt was gradually discontinued .
slit - lamp biomicroscopy showed that the cornea was no longer edematous and gonioscopy was therefore possible .
we observed that there was a closed angle ( shaffer grade 01 ) for 270 and scattered peripheral anterior synechiae in the superior quadrant of both eyes .
laboratory investigations showed a normal full blood count , prolonged prothrombin time , and increased inr . there were slightly increased values for urea , uric acid , and c - reactive protein ( 6.03 mg / l ) .
the erythrocyte sedimentation rate was 58 mm for the first hour . observing that the lesion was in the iris stroma , we wanted to exclude whether this could be attributed to a connective tissue disease , so did an immunoserologic profile examination .
the values for rheumatoid factor , antinuclear antibodies , antimitochondrial antibodies , antineutrophil cytoplasmic antibodies , and anticardiolipin antibodies were all within normal range .
these immunoserologic assays are part of the standard procedure used in our screening protocol for exclusion of autoimmune connective tissue disease .
on the fifth day after her admission , when intraocular pressure measurements were within normal limits and showed no fluctuation , and the cornea and anterior chamber presented no inflammatory activity , the patient was ready to leave the clinic with a regimen for topical antiglaucoma treatment ( isoptocarpine twice daily ) .
the patient was extensively informed about the association of iridoschisis and the appearance of glaucoma , and she was advised to have frequent ophthalmologic examination , monitoring of intraocular pressure , and assessment for any progression of glaucomatous changes in both eyes .
the anterior layer is usually divided into a loose mixture of large number of pigmented and white atrophic strands running in all directions , but mostly from the periphery to the collarette.4 larger free sections may contain blood vessels . it has been reported by fluoroiridography that there is normal perfusion of blood vessels , from the inner pupillary margin to the outer iris of the affected sectors.5 histopathologic study of the iris showed tissue fibrosis and atrophy and evidence of several small clefts in the substance .
the vessels did not look abnormal , although the endothelial lining of some of them might be swollen.6 occasionally , separation at the posterior stroma might occur with irregular pigmentation of the pigment layers.7 electron transmission microscopy of the iris showed significant thinning of the stroma and a diminished number of collagen fibrils in the affected area , whereas the appearance of the stromal blood vessels and nerves was normal.7 corneal changes were uncommon and , if present , degenerated corneal endothelial cells were localized over the area of iridoschisis , where the strands of degenerated iris may come into contact with the corneal endothelium.7 the causative agent of iridoschisis is not yet identified .
lowenstein and foster suggested that cleavage of the iris in this particular plane may have an anatomic basis and that there has to be an atrophic effect of lytic substances in the aqueous , originating from a glaucomatous condition , or that the condition could be attributed to senile changes.3 albers and klein also ascribe the changes in the iris to the aging process and they propose that , as the sclerosis of blood vessels increases in the anterior iris stroma , a shearing action tears the tissue between the anterior and posterior sections during constriction and dilatation of the iris.6 bojer suggests that iridoschisis is a form of essential iris atrophy in the elderly.8 progressive iris atrophy begins in the third decade of life ; iridoschisis , on the other hand , is seen mainly after the seventh decade of life .
other authors have shown that both the vasculature and its perfusion are normal in iridoschisis , in contrast with the vasculature of essential iris atrophy.5,7 loewenstein et al have proposed that iridoschisis might be the result of trauma , and they assumed that a post - traumatic peak in intraocular pressure , which shears along the dilator fibers , could lead to splitting of the anterior and posterior iris stroma.9 an important aspect of iridoschisis is the frequent association with glaucoma . about two - thirds of reported cases of iridoschisis were seen in association with glaucoma.7,1012 salmon and murray studied a number of patients with iridoschisis and coexistent primary angle - closure glaucoma to determine the clinical features of the condition and to examine the relationship of iridoschisis to primary angle - closure glaucoma .
their study suggests that iridoschisis is an unusual manifestation of iris stromal atrophy , and results from intermittent or acute elevation of intraocular pressure .
they proposed that primary angle - closure glaucoma should be excluded in patients who present with iridoschisis.13 romano et al report that iridoschisis precedes the angle - closure episode.11 shima et al presented a case of iridoschisis and plateau iris configuration evidenced by ultrasound biomicroscopy.14 the patient had narrow angles and scattered peripheral anterior synechiae in both eyes .
ultrasound biomicroscopy showed anteriorly positioned ciliary body , slit - like narrowing of the iridocorneal angle , and a flat iris in all four quadrants in both eyes .
this case points to the idea that iridoschisis might be a part of a general anterior anatomic malformation of ocular structures , together with plateau iris configuration .
iridoschisis might also possess a familial character , because there is a report of a family with iridoschisis , narrow anterior chamber angle , and presenile cataract .
the author proposes that family members should be screened for iridoschisis , as well as for associated ocular abnormalities.15 iridoschisis is reported to be associated with lens subluxation , either anterior subluxation pushing the iris forward , shallowing the anterior chamber and causing angle - closure glaucoma,16 or posterior subluxation into the vitreous cavity.17 a subluxated lens rubbing against the iris may be a mechanical precipitating factor in the development of iridoschisis.16 there have been a number of cases reported to have iridoschisis and interstitial keratitis due to syphilis.1820 patients with congenital syphilis , apart from showing systemic features of congenital disease , presented with interstitial keratitis , ghost vessels , and iridoschisis involving predominantly the inferior half of the iris , and some of the patients had open - angle glaucoma .
corectopia and ectropion uvea were absent.21 no peripheral anterior synechiae or fibrovascular membranes were seen in patients with open - angle glaucoma .
neither interstitial keratitis nor iridoschisis had a suppurative component , and both were presumably immunologic in their pathogenesis.18 in the differential diagnosis of iridoschisis are the two other main iris stromal anomalies , namely , the iridocorneal endothelial syndrome and neurocristopathy of the iris and cornea ( axenfeld - rieger syndrome ) .
diagnosis is made on clinical appearance , age of onset , laterality , and whether the condition is congenital , progressive , or with coexistent glaucoma.5,22,23 the age of onset for iridocorneal endothelial syndrome is the third or fourth decade and is unilateral and progressive , while iridoschisis appears later , usually in the sixth to seventh decade , and is generally bilateral , symmetrical , and progressive .
on the other hand , axenfeld - rieger syndrome is present at birth , has a congenital character , and is bilateral , asymmetrical , and nonprogressive . in iridoschisis ,
the iris displays stromal splitting without any holes , is sectorial , is mainly inferiorly located , with anterior stromal atrophy and strands floating in the anterior chamber .
the pupil is round and reactive to light and accommodation , and there are usually no corneal changes , unless anterior iris strands reach to the endothelium . in iridocorneal endothelial syndrome ,
stromal atrophy of the iris is observed , with or without holes , and peripheral anterior synechiae extending to schwalbe s line are present .
the pupil may be ectopic , polycoria may even be observed , and the cornea manifests abnormal endothelium with pleomorphism and cell loss . in axenfeld - rieger syndrome , there is mild stromal thinning of the iris , atrophy , and hole formation , and peripheral anterior synechiae are observed on the anteriorly displaced schwalbe s line .
the pupil may be irregular , and the cornea presents with endothelial changes related to peripheral anterior synechiae.1,2225 according to the aforementioned clinical entities , our patient had the differential characteristics of iridoschisis , although the exclusion of a diagnosis of iridocorneal endothelial syndrome or axenfeld - rieger syndrome can be sometimes difficult .
an 80-year - old patient presented with an episode of acute angle - closure glaucoma and iridoschisis .
the finding of iridoschisis is a warning for the ophthalmologist to exclude any association with glaucoma , because two - thirds of patients with iridoschisis have glaucoma .
it is also possible that a patient may develop glaucoma in the future , so standard glaucoma tests ( including visual acuity , visual field assessment , tonometry , gonioscopy , biomicroscopy , and assessment of the optic nerve head ) and regular follow - up are required . | iridoschisis is a rare condition that consists of the separation of the anterior mesodermic layer of the iris . in more than two - thirds of cases
it is associated with glaucoma .
we report the case of an 80-year - old patient who had bilateral iridoschisis and presented with acute angle - closure glaucoma .
the patient was free from a history of ocular trauma or of heritable ocular disease .
chronic open - angle glaucoma , as well as intermittent angle - closure glaucoma , should be excluded in all patients with iridoschisis , and regular follow - up should be established upon diagnosis of the entity . |
the majority of thyroid cancers are classified as papillary ( 88% ) or follicular ( 9% ) ; together these two histological types are grouped as differentiated thyroid cancers ( dtc ) .
while the annual rate of cancer incidence is decreasing , there has been a 2.4-fold increase in thyroid cancer from 1973 to 2002 .
dtc occurs more commonly in women of child - bearing age with an incidence of 14 per 100,000 live births and represents the second most frequent tumor diagnosed during pregnancy only behind breast cancer [ 7 , 8 ] . as dtc is commonly found during pregnancy or in the early postpartum period , it is possible that physiological changes associated with it , as high levels of estrogen , human chorionic gonadotropin ( hcg ) and/or others , could create a favorable environment to tumor development and growth .
maternal thyroid gland secretes more thyroid hormone during early pregnancy in response to the thyrotropic activity of hcg that overrides the operation of the hypothalamic - pituitary - thyroid feedback system .
this could partially explain an increase in the size of preexisting thyroid nodules as well as new thyroid nodule formation in pregnancy [ 1015 ] .
the best treatment option for thyroid cancer in pregnant women or in the early postpartum period should be based on evidence , so the aim of this paper was to evaluate whether the prognosis of dtc associated with pregnancy is similar or not to dtc in nonpregnant women .
this literature search was conducted in the pubmed , cochrane , and scopus databases , combining the mesh terms : thyroid neoplasms and pregnancy . all studies in english until february 2011 were included . to be included in this review
the original article should describe the comparison between the outcomes in patients diagnosed with dtc during pregnancy or in the first 12 months postpartum ( dtc related to pregnancy ) , with a control group comprising women of child - bearing age , diagnosed with dtc when nonpregnant or at least 12 months after delivery .
all citations and abstracts identified by the electronic search were reviewed by two independent reviewers .
after reviewing 398 abstracts from the electronic search and 3 summaries obtained by manual search , 54 articles were reviewed in full - text form . however , after analysis of these studies , several were excluded , for the following reasons : dtc did not occur during pregnancy , there was no control group , there was no reporting of outcomes , or they described small case series , so only four studies were included in this paper , as shown in figure 1 [ 14 ] .
the characteristics of the studies and the outcomes are described , respectively , in tables 1 and 2 .
as dtc has a good prognosis , the number of patients studied should be large , and the followup should be very long to detect any difference in survival or even recurrence .
most recurrences of dtc occur within the first five years after initial treatment , but recurrences may occur many years or even decades later , particularly in patients with papillary cancer [ 16 , 17 ] .
in addition to this , decisions about cancer treatment during pregnancy are associated with ethical conflicts between the best option for the mother and for the fetus [ 18 , 19 ] .
the management of pregnant women with cancer should consider the maternal - fetal risk related to treatment , as well as the possibility of tumor progression for postponing treatment or for the tumor being related to pregnancy . during this study
we could observe that there is little published data comparing outcomes in patients with dtc related to pregnancy or not .
no randomized controlled trial was available . in the study of moosa and mazzaferri there was no impact from pregnancy in dtc - related death ; in the studies of yasmeen et al . and herzon et al .
overall survival was not affected by dtc [ 2 , 4 ] ; when evaluating if the timing of surgical treatment , during pregnancy or after birth , affected the prognosis of patients with dtc detected during pregnancy , moosa and mazzaferri and yasmeen et al . [ 2 , 3 ] have not shown differences in recurrence rates and , respectively , in dtc - related death and overall survival .
such findings , however , are not in agreement with the study published by vannucchi et al .
they found a strong association of dtc in pregnant women with recurrence or persistence of cancer ( 60% in pregnant women ( group 2 ) versus 4.2% in women with dtc diagnosed 1 year after delivery ( group 1 ) versus 13.1% in nulliparous patients when diagnosed with dtc ( group 3 ) ) .
after a stepwise logistic regression analysis entering the following variables : extrathyroidal extension , lymph - node metastases , radioiodine treatment , pregnant or not pregnant status at diagnosis , histotype , and tumor size 2 or > 2 cm , pregnancy was found to be the most significant predictor for disease recurrence or persistence . as the outcomes and
the methodology employed in each study were different , it was not possible to compare their results and to combine the data in a meta - analysis . in the studies of yasmeen et al . and herzon et al . , the overall survival was the main outcome [ 2 , 4 ] , while the study of moosa and mazzaferri had death related to dtc and recurrence , evaluated by biopsy or by i uptake in distant sites , as primary outcomes , and the more recent study of vannucchi et al .
evaluated persistent / recurrent dtc through more sensible tests such as tg basal levels and tg response to rhtsh .
such methods were not used in the study of moosa and mazzaferri , which could explain some of the discrepancies among them . in the study of vannucchi et al .
however , this factor does not seem to explain the worse outcome which has been found on the group of patients with dtc associated to pregnancy , since two of three patients with follicular histology remained in remission .
two studies reported differences among clinical presentation between pregnant and nonpregnant women [ 1 , 3 ] . in the study of moosa and mazzaferri , fewer pregnant patients showed symptoms associated to thyroid nodules ( 74% versus 43% , p < 0.01 ) . on the other hand , in the study of vannucchi et al .
dtc was less commonly an incidental finding in pregnant patients , probably indicating that these patients had more aggressive disease .
the expression of the estrogen receptor alfa through immunohistochemical analysis was higher in group 2 patients , as compared to groups 1 and 3 .
as estrogen probably increases proliferative activity of thyroid follicular cells , this hormone could be implicated in a more aggressive pattern of dtc diagnosed in pregnancy .
other important factor found in this paper refers to the time of followup of the studies .
considering that dtc is a disease with low lethality and the followup was not very long , it is possible that the full impact of dtc on the patients survival was not evident .
the central lymphadenectomy ( vi - vii levels ) was performed on all patients in the cohort described by vannucchi et al . , and , according to clinical judgment , in the other studies [ 24 ] .
there seemed to be no difference on the outcome of dtc during pregnancy whether the surgery took place at the second trimester of pregnancy or after childbirth [ 24 ] .
in contrast to these findings , kuy et al . compared the risk of thyroid and parathyroid surgery complications in pregnant and nonpregnant women , paired by age , in a retrospective cross - sectional study .
a total of 201 pregnant women and 31155 nonpregnant women were included ; among the 201 pregnant women , 45.8% have undergone surgery due to thyroid cancer , the others had benign thyroid and parathyroid diseases .
thyroidectomy during pregnancy was associated with an increased surgical complication rate in both malignant ( 21% to 8% ) and benign diseases ( 27% to 14% ) , as well as higher endocrine complication rates ( 15.9% to 8.2% ) and treatment costs ( $ 6873 versus $ 5963 ) . in summary
, there are few studies which give base to the policies about pregnant patients with dtc . up to present time , data obtained through systematic review show conflicting results when it comes to observed outcomes in this population .
there seem to be a higher disease recurrence and persistence rates in this population when current treatment response evaluation methods are employed
. however , the impact on overall survival in the long time appears to be unaltered .
there is no evidence to support termination of pregnancy when the diagnosis of dtc is performed .
the guidelines of the endocrine society for pregnancy - related dtc recommend thyroidectomy after delivery for patients with no evidence of advanced disease or without rapid progression , and thyroidectomy in the second trimester of pregnancy for the others ( uspstf recommendation level b ) .
prospective studies should be done to compare the prognosis of dtc diagnosed during pregnancy or not , as well as the effects of postponing surgery after childbirth in dtc diagnosed during pregnancy . | differentiated thyroid cancer ( dtc ) is the second most common cancer in pregnancy .
its management is a challenge for both doctors and patients , and the best timing for surgery is unclear .
a systematic review evaluating the prognosis of dtc in pregnant patients was conducted . after reviewing 401 unique citations and 54 full texts , 4 studies that compared the prognosis of patients with dtc related to pregnancy ( dtc diagnosed during pregnancy or within 12 months after childbirth ) or not were included . in two studies the primary outcome was overall survival , in one study
the primary outcomes were recurrent disease and death related to thyroid cancer , and in one study the primary outcome was recurrent or persistent disease . in the first two studies , there was no difference in overall survival in patients with pregnancy - related dtc , when compared with matched controls ; in one study , there was no difference in death caused by dtc nor recurrence in dtc related to pregnancy .
nevertheless , in a recent retrospective study , a higher rate of recurrent or persistent dtc was observed in patients with dtc related to pregnancy .
there are not many studies on which to base treatment decisions in pregnant patients with dtc . |
a 37-year - old healthy male presented with irritation , pain and reduced vision in his left eye after mud contamination .
corneal scrapings demonstrated numerous septate hyphae , and specimen cultures were positive for chrysosporium sp . the lesion did not respond to aggressive topical 5% natamycin , 0.15% topical amphotericin b and oral itraconazole .
to the best of the authors knowledge , this is the first report on the use of voriconazole for chrysosporium keratitis .
voriconazole may be an effective alternative to conventional antifungal agents in some cases of fungal keratitis .
chrysosporium is an unusual filamentous fungus commonly isolated from soil and occasionally encountered in the laboratory as contaminants of cutaneous and respiratory specimens.1 although human infection is very rare , it can lead to either serious systemic or ocular diseases.24 in the literature review , there were only two case reports on ocular infection .
both cases did not respond to aggressive medical treatment and ended up with surgical interventions.3,4 the authors herein report a first case with severe chrysosporium keratitis successfully treated with voriconazole .
the patient has signed written informed consent for the case details and accompanying images to be published .
a 37-year - old male presented with irritation , pain and reduced vision in the left eye after mud contamination . on examination , his best - corrected visual acuity in the left eye was hand movements and the right eye was 6/6 .
the left eye revealed a central , irregular , 6.87.4 mm infiltration with a feathery edge and satellite lesions .
the patient was first treated with topical 5% natamycin , 0.15% amphotericin b eye drops hourly and oral itraconazole 200 mg daily .
the patient was then treated with topical 1% voriconazole every 1 h , and topical natamycin was discontinued .
additionally , intracameral and intrastromal injections of voriconazole ( 50 mg/0.1 ml ) were given .
two days after treatment , slit - lamp examination showed marked improvement with a decreased corneal infiltrate and hypopyon .
after 7 days of voriconazole treatment , the corneal infiltration was decreased to 5.46.2 mm surrounded by corneal scarring , and no hypopyon was detected .
one month later , the patient underwent penetrating keratoplasty for corneal scar ( figure 2 ) .
immediate postoperative visual acuity in his left eye was 6/36 and final best - corrected visual acuity was 6/18 at 3 months after the procedure .
a 37-year - old male presented with irritation , pain and reduced vision in the left eye after mud contamination . on examination , his best - corrected visual acuity in the left eye was hand movements and the right eye was 6/6 .
the left eye revealed a central , irregular , 6.87.4 mm infiltration with a feathery edge and satellite lesions .
the patient was first treated with topical 5% natamycin , 0.15% amphotericin b eye drops hourly and oral itraconazole 200 mg daily .
intracameral and intrastromal amphotericin b ( 5 g/0.1 ml ) injections were also undertaken . however , there was no significant clinical improvement .
the patient was then treated with topical 1% voriconazole every 1 h , and topical natamycin was discontinued .
additionally , intracameral and intrastromal injections of voriconazole ( 50 mg/0.1 ml ) were given .
two days after treatment , slit - lamp examination showed marked improvement with a decreased corneal infiltrate and hypopyon .
was identified by corneal cultures 3 days later . after 7 days of voriconazole treatment , the corneal infiltration
was decreased to 5.46.2 mm surrounded by corneal scarring , and no hypopyon was detected .
the topical and systemic medications were continued and tapered according to clinical findings . finally , the lesion healed to be corneal scar and visual acuity was 4/60 .
one month later , the patient underwent penetrating keratoplasty for corneal scar ( figure 2 ) .
immediate postoperative visual acuity in his left eye was 6/36 and final best - corrected visual acuity was 6/18 at 3 months after the procedure .
chrysosporium is classified in kingdom fungi , phylum ascomycota , class eurotiomycetes , order onygenales and family onygenaceae .
it is a keratinophilic filamentous fungus commonly isolated from soil and occasionally encountered in the laboratory as contaminants of cutaneous and respiratory specimens.1 although human infection is very rare , it can lead to either serious systemic or ocular diseases.24 among ocular infections , there were only two reports , which were keratomycosis and endophthalmitis from literature search . medical failure has been reported , and surgical debridements , penetrating keratoplasty and pars plana vitrectomy were required in both cases.3,4 for the keratomycosis case , corneal infiltration was deteriorating and perforation was detected after natamycin eyedrops treatment .
emergency penetrating keratoplasty was undertaken.3 in this study , the fungus did not respond to topical natamycin , which corresponded to previous report . in the endophthalmitis case , diluted intravitreal amphotericin b ( 1 mg/0.1 ml )
was injected after pars plana vitrectomy with topical antibiotics , intravenous antibiotics and oral itraconazole.4 to the best of the authors knowledge , this is the first report on the successful treatment of chrysosporium keratitis with voriconazole .
information about in vitro studies of antifungal agents for chrysosporium sp . is limited . in one study that is included
, the strains of chrysosporium zonatum infection of lung and bone showed that the organism is susceptible to amphotericin b but moderately resistant to itraconazole and fluconazole , whereas 5-fluorocytosine was not effective.1 these data have suggested that current azoles may not be clinically active against the organism .
the patient in this study , however , did not respond to either amphotericin b or itraconazole treatment .
voriconazole is increasingly used as a first - line treatment for ocular fungal infections because of excellent in vitro activity against a wide range of keratitis isolates.5 eventhough the evidence shows that natamycin is more effective than voriconazole in the treatment of fungal ulcers,6,7 voriconazole has been reported to be an alternative option in some cases such as drug - resistant fungal keratitis or rare fungal species causing keratitis.8,9 in the present case , the ulcer was successfully treated with voriconazole eyedrops including adjunctive intracameral and intrastromal injections .
this may be explained by the lower minimum inhibitory concentrations of voriconazole against numerous mould isolates causing fungal keratitis.9 in addition , voriconazole concentrations in the aqueous humor after topical 1% voriconazole eyedrops are above the minimum inhibitory concentrations , which is sufficient to eradicate most fungal species.5 furthermore , from our observations , the injections can expedite the healing process .
in conclusion , voriconazole may be an alternate option for some fungal species causing keratomycosis . due to the high rate of complications after penetrating keratoplasty in active fungal keratitis , voriconazole may be considered before radical surgery is scheduled .
moreover , natamycin may not be more effective than voriconazole in all fungal keratitis cases .
standardized susceptibility testing methods using ocular strains may be required for future decisions and management . | objectiveto report a patient with severe chrysosporium keratitis successfully treated by voriconazole.methodcase report.resultsa 37-year - old healthy male presented with irritation , pain and reduced vision in his left eye after mud contamination .
examination demonstrated corneal stromal infiltration , endothelial plaque and hypopyon .
corneal scrapings demonstrated numerous septate hyphae , and specimen cultures were positive for chrysosporium sp . the lesion did not respond to aggressive topical 5% natamycin , 0.15% topical amphotericin b and oral itraconazole .
the patient was then treated by topical 1% voriconazole every hour .
intracameral and intrastromal voriconazole injections ( 50 g/0.1 ml ) were also undertaken .
the keratitis was significantly improved after voriconazole.conclusionto the best of the authors knowledge , this is the first report on the use of voriconazole for chrysosporium keratitis .
voriconazole may be an effective alternative to conventional antifungal agents in some cases of fungal keratitis .
it should be considered before shifting to therapeutic keratoplasty . |
after
undergoing a mastectomy , the patients experience lymphedema and sensory changes due to
physical changes along with restriction of the range of motion of the shoulder joints and
upper extremity muscle weakening1 .
although treatments such as radiation therapy and anti - cancer therapy are implemented as a
prescription immediately after surgery to reduce recurrence and mortality , these treatments
are reported to greatly affect the quality of life of the patients due to their adverse
effects that cause physical changes2 .
radiation therapy and other anti - cancer therapies cause nerve lesions , lymphedema , muscle
pain , headache , weight gain , a sense of fatigue , cognitive disorders , and feelings of
anxiety and depression in patients3 .
concern over rehabilitation treatment and the quality of life after a mastectomy is
discussed as an important issue .
many studies have implemented rehabilitation programs to
resolve physical , emotional , and functional problems experienced after a mastectomy and
psychological issues appearing in return to society4 .
in addition , rehabilitation of lymphedema patients is achieved
through exercise , which is regarded as the most effective method of restoring their physical
and psychological functions5 .
a previous study reported that lymphedema patient groups that received exercise treatment
in combination with mental treatment showed significantly higher physical indexes and better
depression and anxiety conditions than groups that received only mental treatment and that
exercise performed by lymphedema patients consequently led to not only physical improvement
but also psychological improvement in terms of depression and anxiety6 .
existing exercise methods for mastectomy patients have been reported to increase the heart
rate by 6080% through aerobic exercises , and physical changes have been reported7 .
these exercises were performed with a view
to increasing the patients range of joint motion , and many cases where these exercise
caused pain have been reported8
.
meanwhile , proprioceptive neuromuscular facilitation ( pnf ) exercises , which are patient
self - exercise methods conducted through pnf techniques , require patients to move within
their ability to move without pain9 , 10 , thereby enabling the patients to perform
exercises with relatively less pain .
therefore , pnf exercises are regarded as an important
element in reducing and preventing injuries due to exercise9,10,11 .
not many studies have been conducted on the effect of these
exercises within the range of no pain on the depression and psychological variables of
patients .
therefore , this study was conducted to examine the effects of exercises applied with pnf
techniques performed for 30 minutes per session , three times per week , after receipt of
radiation therapy following mastectomy on depression and anxiety in patients with lymphedema
and to prepare basic date for creation of self - directed exercise programs for lymphedema
patients that will enable them to perform exercises within the range of no pain .
the subjects of this study were 45 patients selected from among those who showed lymphedema
after receiving anti - cancer therapy following a mastectomy after being diagnosed with breast
cancer at d university hospital located in b metropolitan city .
information on the purposes ,
procedures , and risks of the experiment was provided to the recruited participants in the
experiment , and prior written consent was received from the participants . in this study ,
the subjects were divided into three groups and performed exercises for 30
minutes per session , three times per week for 16 weeks , and questionnaire surveys were
conducted every four weeks .
the pnf exercises were performed using rhythmic initiation ( ri ) ,
which is a pnf technique , for 10 minutes as warm - up exercises , and main exercises were
performed for 20 minutes using a combination of isotonic ( ci ) , contract - relax , and
hold - relax techniques .
the pnf+ super lizer group performed the same warm - up exercises as
those in the pnf group for 10 minutes and was irradiated with light by a super lizer during
performance of the main exercises .
the pnf+manual lymph drainage ( mld ) group performed the
same warm - up exercises as those in the pnf group for 10 minutes followed by the same main
exercises as those in the pnf group for 10 minutes and received mld treatment for 10
minutes . finishing mld treatment was implemented . in this study
, the psychological variables
of the patients were measured using the standard korean versions of the beck anxiety
inventory ( bai ) and beck depression inventory ( bdi ) , which are mental state rating scales
for anxiety and depression respectively .
the bai and bdi are scales consisting of 21
questions and are measuring methods with high reliability and validity that have been the
most widely used since 1961 , which is when they were proposed . after rating , the mental
states of the patients and their levels of satisfaction with the different treatment methods
were evaluated using the average values .
the effects of the
treatment methods ( pnf , pnf+super lizer , pnf+mld ) on the lymphedema patients after
mastectomy were verified by 3 2 repeated measures anovas .
post hoc comparisons were
conducted using contrast tests to verify changes over time ( before the experiment , at 4 , 8 ,
12 , and 16 weeks , and after the experiment ) .
study patients baseline and demographic characteristicsvariablepnf+superlizer(n=17)pnf(n=17)pnf+mld(n=18)age ( years)53 151 153 1height ( cm)158 1160 1159 1weight ( kg)62.3 0.963.4 1.266.0 1.6bmi ( kg / m)24.93 0.4124.92 0.4626.21 0.63a total of 52 participants ( pnf+super lizer , 17 ; pnf , 17 ; pnf+mld , 18 ) were included
in the final analysis . in the pnf+super lizer group , the mean age and bmi
were
531 years and 24.93 0.41 , respectively .. the beck depression score changed significantly during the five assessment
periods ( p<0.0001 ) ; however , there was no significant difference between the treatment
groups ( p=0.094 ) .
post hoc analyses revealed that there was a significant improvement in
beck depression score from 4 weeks in all three groups . the interaction between group and
time was also statistically significant ( p=0.035 ; table
2table 2 .
depression and anxiety after mastectomy at five assessment points by treatment
group ( mean sem ) ( value : meansem)groupvariablepnf+super lizer(n=17)pnf(n=17)pnf+mld(n=18)depressionbefore treatment28.241.13a28.291.13a28.441.10a4 wks26.121.13b25.061.13b23.891.10b8 wks24.351.13c22.771.13c19.561.10c12 wks21.531.13d19.471.13d17.391.10d16 wks17.771.13e16.351.13e14.281.10eanxietybefore treatment35.771.63a32.881.63a37.331.58a4 wks27.411.63b25.351.63b26.001.58b8 wks21.121.63c20.771.63c21.281.58c12 wks15.881.63d17.181.63d15.111.58d16 wks12.471.63d13.061.63e11.941.58d values are meanssem , and the holm - sidak method was used for multiple
comparisons .
a total of 52 participants ( pnf+super lizer , 17 ; pnf , 17 ; pnf+mld , 18 ) were included
in the final analysis . in the pnf+super lizer group , the mean age and bmi
values are meanssem , and the holm - sidak method was used for multiple
comparisons .
p values are derived from the between - group effect . regarding the time course changes in beck depression score in the pnf+super lizer , pnf , and
pnf+mld groups ,
there were significant decreases in beck depression score compared with the
previous value at all assessment points , and there were also significant differences between
the pnf+super lizer and pnf+mld groups at 4 and 8 weeks . regarding the time course changes in beck anxiety score in the pnf+super lizer , pnf , and
pnf+mld groups ,
there were significant decreases in beck anxiety score compared with the
previous value at all assessment points ; however , there was no significant difference
between the three groups .
in this study , the patients psychological variables were observed before the pnf ,
pnf+super lizer , and pnf+mld treatment methods were applied , at 0 , 4 , 8 , 12 , and 16 weeks of
treatment , and after the treatment .
based on the results , pnf+mld can be considered an
effective treatment for depression in lymphedema patients after mastectomy .
the results were
consistent with a previous report indicating that exercise therapy has effects that
significantly improve physical condition and relieve depression and anxiety12 .
.
therefore , there are limitations in the interpretation of the results because there were
difficulties in setting the control group .
however , on reviewing a previous clinical study ,
it can be seen that lymphedema patients have limitations in activities and experience
anxiety and depression13 .
another study
reported that although anxiety and depression were significantly relieved after performing
aerobic exercises , self - regard was not changed14 .
however , the aforementioned study reported that patients who
participated in the exercise program showed improvement in psychological variables compared
with patients who did not participate in the exercise program . examining the effects of
exercises using pnf techniques
is considered clinically meaningful . if future studies are
conducted on the motility of lymphedema patients , more significant results could be
obtained . | [ purpose ] this study was conducted to examine the effects of exercises applied with pnf
techniques performed for 30 minutes per session , three times per week , after receipt of
radiation therapy following mastectomy on depression and anxiety in patients diagnosed
with lymphedema and to prepare basic data for creation of self - directed exercise programs
for lymphedema patients that will enable them to perform exercises within the range of no
pain .
[ methods ] the subjects of this study were 45 patients selected from among those
diagnosed with breast cancer who showed lymphedema after anti - cancer therapy following
mastectomy . [ results ] the beck depression score changed significantly during the five
assessment periods however , there was no significant difference between the treatment
groups .
post hoc analyses revealed that there was significant improvement in the beck
depression score from 4 weeks in all three groups .
the interaction between group and time
was also statistically significant .
[ conclusion ] in conclusion , pnf techniques helped to
improve the depression and anxiety rates .
four weeks after the start of therapy , pnf
techniques depression and anxiety to create a greater degree of decline was on
display . |
supplementary material is available online and contains detailed methods , supplementary table 1 , supplementary fig . 1 and a list of all investigated sequences determined in this study.supplementary material . supplementary material . | two frequently applied genetic bacteroidetes markers for total fecal pollution ( allbac and bacuni ) were found in high numbers in pristine soil samples of two alpine catchment areas casting doubt on their value as fecal indicators .
this finding underlines the necessity to evaluate assays locally and against non - intestinal samples before application . |
dehydration is the main cause of morbidity and mortality in critically ill patients and assessment of intravascular volume status ( ivs ) is essential for their management ( 1 , 2 ) .
however , diagnosis of dehydration and intravascular volume loss is sometimes difficult ( 3 ) .
some clinical signs and symptoms are assessed for determining ivs but they have low sensitivity and specificity ( 4 )
. it could be determined by measuring peripheral blood pressure , but in many conditions , it does not reflect accurate intravascular volume status .
hypotension is detected in late stage of shock , especially when compensatory mechanisms fail ( 5 ) .
central venous pressure ( cvp ) is one of the indices of ivs and early goals of goal - directed therapy approach ( 6 , 7 ) .
a common and conventional procedure for measuring cvp is inserting a catheter in a central vein such as internal jugular , subclavian , and femoral veins .
however , the major problem with this procedure is the probability of some dangerous and sometimes lethal complications such as arterial puncture , pneumothorax , hemothorax , misplacement in carotid artery , infection , and other rare complications such as cardiac tamponade etc .
in addition , central venous catheter insertion is a time consuming and invasive procedure ( 8 - 12 ) .
recently , researchers and physicians have attempted to measure cvp with non - invasive procedures such as ultrasonography , transthoracic echocardiography , and transesophageal echocardiography ( tee ) .
they have reported a correlation between sonographic inferior vena cava ( ivc ) diameter and cvp ( 1 , 9 , 13 - 16 ) .
donahue et al . found a direct correlation between internal jugular vein sonographic diameter and cvp ( 17 ) .
however , few studies have attempted to find the best anatomic location and cut points .
therefore , the purpose of this study was determining the best anatomic location to find precise correlation between cvp and ivc diameter using tee .
study design and setting
in the present prospective cross - sectional study , the correlation of sonographic ivc diameter , aorta diameter , and ivc / aorta ratio with cvp were evaluated .
patients in need of catheterization and tee who were referred to a teaching hospital in tabriz , iran , from 2013 to 2015 were enrolled .
the patients or their relatives had signed the informed written consent form before initiation of the study and the researchers adhered to the principles of helsinki declaration . over the course of the study ,
all patients over 18 years old who needed central venous catheterization and tee were included .
consecutive sampling was used and the patients need for catheterization and tee was determined by an independent cardiologist .
those who were prohibited from assuming a supine position ( severe orthopnea , intracerebral pressure rising ) , patients who had moderate - to - severe tricuspid regurgitation , congestive heart failure , broncho - pulmonary dysplasia , body mass index > 30 , and renal and liver diseases were excluded .
after central catheterization using seldinger technique , cvp was measured using electronic transducer connected to the cv line inserted in the right internal jugular vein by central approach while the patient was placed in a 15-degree trendelenburg position ( 18 ) .
ivc and aorta diameter were measured using tee ( sonos 5500 ; philips medical systems , andover , ma ) and a 3.5 mhz probe .
all the ultrasonographies were done by a trained cardiology fellow who was blind to the patients cvp .
ivc and aorta diameter were measured at end - expiration and end - diastole in 2-dimensional long - axis mid - esophageal bicaval view .
measurements were done in the level of diaphragm , 2 centimeters above the diaphragm and at the point of entry into the right atrium and recorded in millimeter .
baseline characteristics of the patients sbp : systolic blood pressure , dbp : diastolic blood pressure , hr : heart rate , cvp : central venous pressure , ivc : inferior vena cava . correlation of cvp with ivc and aorta diameters , and ivc / aorta ratio ivc : inferior vena cava ; ci : confidence interval .
area under roc curve of ivc and aorta diameters , and ivc / aorta ratio in estimation of cvp ivc : inferior vena cava ; auc : area under curve ; ci : confidence interval .
comparison of area under the curve of inferior vena cava ( ivc ) diameter ( a ) , aorta diameter ( b ) , and ivc / aorta ratio ( c ) in different points in estimation of central venous pressure and comparison between the three indices ( d
statistical analysis
sample size was determined to be about 45 patients considering minimum correlation coefficient of ivc diameter and cvp to be 0.48 with 95% confidence interval ( ci ) ( = 0.05 ) and 90% power ( = 0.1 ) .
spearman s rank correlation test was used to determine the relationship between sonographic ivc diameter and cvp .
best index ( ivc diameter , aorta diameter , or ivc / aorta ratio ) and best measurement location ( the level of diaphragm , 2 cm above the diaphragm and at the point of entry into the right atrium ) were determined via calculating and comparing area under the receiver operating characteristics ( roc ) curve ( auc ) .
normal cvp was considered 2 - 6 mmhg for this purpose ( 19 ) . in all analyses , p
over the course of the study , 39 patients were included ( 53.8% male ; mean age 62.1 5.8 years ) .
mean cvp was 6.8 1.4 mmhg and 25 ( 64.1% ) patients had normal cvp , while 14 ( 35.9% ) showed elevated cvp ( > 6 mmhg ) .
the relationship of cvp with ivc and aorta diameter
table 2 shows the relationship of cvp with sonographic ivc diameter , aorta diameter , and ivc / aorta . as can be seen , cvp had a significant correlation with ivc diameter at the point of entry into the right atrium ( r = 0.85 ; p < 0.001 ) , 2 cm above the diaphragm ( r = 0.48 ; p = 0.002 ) , and in the level of diaphragm ( r = 0.85 ; p < 0.001 ) . at the same time , aorta diameter showed a significant correlation with cvp at the point of entry into the right atrium ( r = 0.68 ; p < 0.001 ) and 2 cm above the diaphragm ( r = 0.44 ; p = 0.005 ) .
ivc / aorta ratio also had a significant correlation with cvp at all 3 points .
comparing diagnostic values of ivc and
aorta diameter
evaluation of area under the roc curve showed that the best point for determining cvp was at the point of entry into the right atrium for ivc diameter ( p = 0.01 ) , aorta diameter ( p = 0.01 ) , and ivc / aorta ratio ( p = 0.004 ) ( figure 1a - c ) .
therefore , to identify the best index among the 3 , their area under the roc curve was compared at this point ( table 3 and figure 1-d ) . based on the findings , ivc diameter ( auc = 0.98 ; 95% ci : 0.95 - 1.0 ) and ivc / aorta ratio ( auc = 0.96 ; 95% ci : 0.92 - 1.0 ) had higher diagnostic values compared to aorta diameter ( auc = 0.89 ; 95% ci : 0.79 - 0.98 ) at this point ( p = 0.01 ) .
this study was conducted to find the precise anatomic location with the best correlation between cvp and ivc diameter , aorta diameter , or ivc / aorta ratio . based on the present findings , the ivc diameters and ivc / aorta ratio had acceptable correlation with cvp .
in addition , the point of ivc entry into the right atrium was the best anatomic location to estimate cvp .
ultrasound is a non - invasive , easy , available , and useful tool for assessment of volume status ( 20 ) .
. showed that when end - expiratory ivc diameter was lower than 10 mm , the cvp would be 10 cmh2o , ( sensitivity 77% and specificity 91% ) and when end - expiratory ivc diameter was 15 mm , cvp would be 15 cmh2o ( sensitivity 90% and specificity 89% ) ( 21 ) .
baumann et al . measured cvp using ultrasound and concluded that although estimation of cvp by ultrasound is easy , but absolute values differ from invasive measurements of cvp and ivc indices alone ca nt be used to accurately estimate intravascular volume status ( 22 ) . in line with our study , arthur et al . reported a statistically significant correlation between ivc diameter and cvp ( 16 ) .
compared different anatomic locations such as subxiphoid , mid - abdomen and suprailiac to find best anatomic location for calculating the correlation between cvp and ivc diameter .
they reported that suprailiac view had better correlation with cvp compared to other anatomic locations but measurement of cvp using ultrasound had low yield ( 23 ) .
yet , some studies demonstrate that an increase or decrease in the collapsibility of ivc can be helpful in management of patients in poor condition . based on the findings of those studies ,
the combination of absolute ivc diameter and collapsibility level , which is known as caval index , is a better estimation of cvp compared to absolute ivc diameter and can be a good replacement for invasive tests ( 24 - 26 ) .
the mechanism of this method is based on the fact that the negative pressure generated while inhalation leads to an increase in venous return to heart and ivc collapse .
while exhaling , venous return decreases and ivc diameter goes back to the basic state ( 25 , 27 , 28 ) . in the present study , caval index could not be assessed , as the ultrasonography film could not be recorded in the device used .
another limitation of this study was the little sample size , yet the minimum power calculated for this study was 85% ; so it seems that little sample size has not affected the results of this study .
based on the present findings , the ivc sonographic diameter and ivc / aorta ratio had acceptable correlation with cvp at the level of ivc entry into the right atrium .
all authors passed four criteria for authorship contribution based on recommendations of the international committee of medical journal editors . | introduction : the correlation of central venous pressure ( cvp ) with inferior vena cava ( ivc ) sonographic diameter has been reported in several studies .
however , few studies have attempted to find the best anatomic location of measurement .
therefore , the purpose of this study was determining the best anatomic location to find precise correlation between cvp and ivc diameter using transesophageal echocardiography ( tee ) .
methods : in the present diagnostic accuracy study , patients in need of central venous catheterization and tee were enrolled .
maximum diameter of ivc were measured during expiratory phase of respiratory cycle at the level of diaphragm , 2 cm above the diaphragm and at the point of entry into the right atrium using sonosite tee device .
cvp was measured using an electronic transducer connected to the central venous line .
the best location for sonography was determined via calculating and comparing area under the receiver operating characteristics ( roc ) curve ( auc).results:39 patients were enrolled ( 53.8% female ) .
mean cvp was 6.8 1.4 mmhg and 25 ( 64.1% ) patients had normal cvp , while 14 ( 35.9% ) showed elevated cvp ( > 6 mmhg ) .
evaluating auc showed that ivc diameter ( p = 0.01 ) , aorta diameter ( p = 0.01 ) and ivc / aorta ratio ( p = 0.004 ) had acceptable correlation with cvp .
point of entry of ivc into the right atrium with auc of 0.98 ( 95% ci : 0.95 1.00 ) was the location of highest correlation with cvp .
conclusion : based on the present findings , the ivc sonographic diameter and ivc / aorta ratio had acceptable correlation with cvp at the level of ivc entry into the right atrium . |
almost six million people each year all over the world die because of tobacco related smoking as well exposure to tobacco of other s smoke is significant health hazard .
significant part of children and youth are daily expose to environmental tobacco smoke , which influence on their health and increases risk of tobacco related diseases .
( 3 , 4 , 5 , 6 , 7 , 8 , 9 ) . however , tobacco is still the most preventable cause of death which could be successfully reduced by comprehensive tobacco control measures .
( 10 , 11 , 12 ) the world health organization enforced a set of relevant international documents , aimed to support member states in development of national tobacco control interventions . in 2005 , entered into force framework convention on tobacco control which underlines need of protection from smoke exposure .
mpower , as set of tobacco control measures ( 14 ) and further a health policy framework , health 2020 aimed to reduce tobacco related illness , disability and death ( 15 ) .
legislation framework of tobacco control measures in the federation of bih is contained in national tobacco control law adopted in 2011 , which ban smoking in public places , schools , health institutions and public transport vehicles .
( 16 ) most part of national tobacco control measures developed based on a document of tobacco control strategy in the federation of bosnia and herzegovina 2003 .
( 17 ) in 2013 , federal ministry of health initiated a new tobacco control strategy drafted in line with who framework convention of tobacco control ( 18 ) smoking is leading addiction disease in schoolchildren and youth in the federation of bih .
relevant survey findings indicate early start of tobacco use , with significant increase of smoking prevalence in one grade of secondary schools compare to enrolled grades of primary school ( 19 ) .
analysis of exposure to environmental tobacco smoke in school children as a significant indicator for evaluation of tobacco control law enforcement in the federation of bih as well evidence base for recommendations of policy and strategy measures .
the analysis involves data collected through two surveys conducted in the federation of bih , during period 2008 -2013 under support of the federal ministry of health and federal ministry of education who authorized the survey .
survey is conducted by the institute for public health of the federation of bih as the implementing agency .
( 19 ) for the analysis purpose , exposure to environmental tobacco smoke in school children assessed as a part of multiple - choice questionnaire adapted from a global youth tobacco standard core questionnaire .
surveys involves two - stage cluster sample design aimed to enroll students in grades 7 , 8 and 9 of primary and 1 grade of secondary school , with focus on representative sample of children age 13 - 15 . in 2013 , from 6,972-sampled schoolchildren , total 6,415 completed usable questionnaires , of which 5,060 were aged 13 - 15 years with overall response rate of schoolchildren 92 , 0% .
data entry and statistical analysis completed with sudaan , a software package used to calculate weighted prevalence estimates and standard errors ( se ) of the estimates ( 95% confidence intervals [ ci ] were calculated from the ses ) .
exposure to environmental tobacco smoke ( ets ) at home decreases from over three quarter ( 79.0% ) in 2008 to 62.6% of school children in 2013 who confirmed an everyday exposure to smoke , while 65.1% schoolchildren in 2013 confirmed exposure to ets in all school premises without any difference in sex .
a survey finding shows significant decrease of exposure of school children to ets in enclosed public places , from 85.0% in 2008 to 60.7% in 2013 .
exposure to environmental tobacco smoke in school children age 13 - 15 , federation of bih 2008 - 2013 . * all public places for 2008 .
exposed to tobacco smoke in public place in school children age 13 - 15 in the federation of bih 2008 - 2013 related to significant role of school in development of knowledge , attitude , behavior and health promotion life styles , survey findings indicates decreases of tobacco prevention in school curricula . from two third or 66.2% school children in 2008 taught in school about the dangers of tobacco use decreases to slightly over half of school children ( 54.6% ) in 2013 taught in school curriculum about health consequences of tobacco , more girls than boys .
( figure 2 ) school children taught in school about the dangers of tobacco use , federation of bih 2008 - 2013 knowledge that other people s tobacco smoke is harmful to them increases from 64.6% in 2008 to 69.9% of school children in 2013 , who definitely think other s people tobacco smoke is harmful to their health , more likely girls ( 72.7% ) than boys ( 67.3% ) .
however , a survey finding shows some changes in school children attitude related ban of smoking in public places . from over three quarter or 86.6% school children in 2008 who were in favor of banning smoking in enclosed public places ,
( table 2 ) knowledge and attitudes towards environmental tobacco smoke among school children age 13 - 15 , federation of bih 2008 - 2013 . * all public places for 2008 . equal to enclosed public places for 2013 .
a survey finding shows that exposure to environmental tobacco smoke is significant health risk factor for school children and youth in the federation of bih . exposure to ets at home decrease from 79.0% to 62.1% , ( 19 ) . which is related to recently survey results on high smoking prevalence in adults in the federation of bih ( 20 ) .
a exposure to ets in school children at public places decreases from 85.0% in 2008 to 59.8% in 2013 .
collected results of surveys performed in the federation of bih compare to neighboring countries shows that exposure to ets at home and public places is lower compare to croatia ( 66.9% at home , 67.9% at places outside their home ) , serbia ( 76.9% at home , 71.9% at places outside their home ) , and higher compare to slovenia ( 41.3% at home , 23.4% at places outside their home ) , czech republic ( 43.0% at home , 45.8% at places outside their home ) , italy ( 48.5% at home , 79.3% at places outside their home ) , hungary ( 43.0% at home , 72.6% at places outside their home)(21,22 ) .
a survey results indicates an decreases of involvement of tobacco prevention in school curriculum , from 66.2% in 2008 to 51.8% in 2013 , which is lower compare to surveys results in neighboring countries such as croatia ( 63.3% ) , serbia ( 58.0% ) , slovenia ( 65.3% ) , czech republic ( 64.4% ) , italy ( 59,1% ) , and hungary ( 57.2% ) of school children had been taught about health hazard of tobacco in class during the past year . however , there are some changes in school children knowledge and attitude related tobacco in period 2008 - 2013 .
a knowledge of harmful effects of exposure of other tobacco smoke among schoolchildren increases from 64.6% in 2008 to 67.3% in 2013 , which is similar to other countries macedonia ( 67.4% ) , croatia ( 64.1% ) , serbia ( 65.0% ) , and higher compare to slovenia ( 60.2% ) , czech republic ( 63.0% ) , italy ( 61.6% ) and hungary ( 61,5% ) ( 20 , 21 )
collected data confirmed decreases of exposure to environmental tobacco smoke in schoolchildren in the federation of bih , in period 2008 - 2013 as a significant indicator for more effective enforcement of tobacco control law by federal ministry of health .
however , survey findings indicates that significant part of school children are still daily expose to ets in all public places , as evidence for more effective enforcement of ban of smoking on public places .
promotion of schools as healthy life style environments should be an significant part of tobacco control measures in line with international good practice . in aim to promote awareness and knowledge of school children related to tobacco , there is need for more comprehensive public campaigns as well enrollment of smoking prevention and cessation as a part of curriculum of primary and secondary schools in the federation of bih . | introduction : exposure to environmental tobacco smoke ( ets ) is defined as a human cancerogen class a , due daily exposure is responsible for health hazards consider as almost equal as smoking of tobacco.goal:monitoring of exposure of school children to ets as indicator of enforcement of ban of smoking in public places as tobacco control measure in the federation of bih.methods:analysis of surveys findings performed in the federation of bih in period 2008 - 2013 , with particular focus on ets exposure in school children.results:a survey findings indicates decrease of exposure to ets in school children ate home from 79.0% in 2008 to 62.1% in 2013 , as well decrease of exposure to ets in public places from 85.0% in 2008 to 59.8% in 2013 .
however , 65.8% of school children in the federation of bih are daily expose to ets in school premises and only 54.6% of school children have been taught in school about health consequences of tobacco smoke . over three quarter of school children or 80.1%
are in favor of ban of smoking in public places.conclusions:exposure to ets in school children considers as significant evidence for more efficient enforcement of tobacco control legislation in the federation of bih . |
the study database consisted of 398 unique human infectious disease outbreak events collected from disease outbreak news , published online by the world health organization during 19962009 ( 9 ) .
for each outbreak , we defined the initial source or sources of the first public communication as the individual , organization , or website that first publicly communicated information regarding the disease threat ( locally or internationally , orally or in writing ) .
the corresponding date of communication was identified by using outbreak reports disseminated by promed - mail ( 10 ) .
all outbreaks were categorized as having been first communicated by > 1 nongovernmental or governmental source , or simultaneously by both types of sources .
when an outbreak was simultaneously first communicated by nongovernmental and governmental sources ( n = 5 ) , the outbreak was repeated in the dataset and each source was given credit .
this adjustment increased the number of outbreak events to 403 . to characterize the timeliness of outbreak communications , for each reporting source of an event , we calculated the median time in days , and bootstrapped 95% ci , from outbreak start to public communication ( table 1 ) .
median reporting times were calculated for the entire study period ( 19962009 ) , before and after public recognition of severe acute respiratory syndrome ( sars ) ( march 12 , 2003 ) , and for each who - defined geographic region .
the effect of the initial reporting source on the timeliness of outbreak communication was quantified by using negative binomial regression after adjusting for geographic region and whether the outbreak occurred before or after sars .
these variables were included in the model on the basis of a priori assumptions that public health infrastructure can vary by geographic and political region and that new pandemic preparedness strategies , including use of informal information to initiate public health responses , were developed in response to the sars epidemic ( 11 ) .
interaction terms between each variable were examined but were not included in the final model because none reached statistical significance ( p>0.05 ) .
temporal trends were assessed by using univariate negative binomial regression models , stratified by source category .
sars , severe acute respiratory syndrome . of all initial outbreak reports identified , 137 were excluded from analysis for 1 of the following reasons ( figure 1 ) : 117 ( 85% ) of the excluded reports were missing information on the estimated outbreak start date ; 20 ( 15% ) were not found in the promed - mail archives ; and 1 ( 1% ) outbreak estimated start date occurred after the date of public communication of the outbreak .
of the 266 ( 66% ) outbreaks included in analysis , 163 ( 61% ) were first publicly communicated by governmental sources , and 103 ( 39% ) were first communicated by nongovernmental sources .
chi - square tests showed no significant differences in the proportions of governmental and nongovernmental sources included in the analysis versus those excluded ( p = 0.315 ) .
exclusion criteria applied to database of 398 outbreak events publicly reported through the world health organization ( who ) disease outbreak news during 19962009 and breakdown of nongovernmental and governmental sources used to compare the timeliness of outbreak communications .
than one source may be identified for a given outbreak ; categories for exclusion are not mutually exclusive ; health officials , ministries of health , laboratories , hospitals , etc . ; included in sensitivity analysis ; includes nongovernmental organizations , individual accounts , promed requests for information , and multiple sources .
the median time from estimated outbreak start to initial public communication was 10 days shorter for nongovernmental sources ( 23 days , 95% ci 2032 ) than for governmental sources ( 33 days , 95% ci 3045 ) , although this difference was not significant according to the wilcoxon rank - sum test ( p = 0.200 ) ( table 1 ) .
additionally , multivariate modeling showed no significant difference after covariates were adjusted for ( incidence rate ratio [ irr ] 0.95 , 95% ci 0.771.18 ) ( table 2 ) .
the effect of missing data was assessed in sensitivity analyses for all outbreaks for which we had an estimated outbreak start date ( 17 of 20 ) .
when we used the who disease outbreak news communication date , our results did not change when crediting either governmental sources ( irr = 0.88 , 95% ci 0.711.09 ) or nongovernmental sources ( irr = 1.086 , 95% ci 0.8821.336 ) . * methods : the multivariate negative binomial regression model compared the timeliness of outbreaks first communicated by nongovernmental sources to those by governmental sources , while adjusting for geographic region and whether the outbreak occurred before or after public recognition of sars .
irr , incidence rate ratio ; sars , severe acute respiratory syndrome ; ref , reference value = 1 .
reference categories : ( 1 ) source : governmental , ( 2 ) sars : pre - sars , ( 3 ) geographic region : africa . examination of temporal trends over the study period ( figure 2 ) showed that nongovernmental sources generally communicated outbreak signals to the public faster after 1996 , although the trend did not reach statistical significance ( irr = 0.96 , 95% ci 0.911.01 ) .
governmental sources , in contrast , made significant improvements in lessening the time in which they publicly communicated initial outbreak signals ( irr = 0.94 , 95% ci 0.910.97 ) .
median time ( days ) from the estimated start of an outbreak to its public communication for outbreaks reported by nongovernmental sources ( a ) and governmental sources ( b ) , 19962009 .
our data suggest that , from 1996 through 2006 , outbreaks reported initially by nongovernmental sources were communicated publicly an average of 10 days earlier than those reported initially by governmental sources .
though the differences varied , nongovernmental sources tended to report outbreaks faster than governmental sources when we compared outbreaks before and after sars , or by who - defined region .
the lack of statistically significant differences in initial communication timeliness by source is probably attributable to a lack of statistical power rather than a lack of effect .
our results also provide support for the international health regulations 2005 revisions that allow who to use unofficial information to request verification from member states .
slightly more than one - third of all unique infectious disease outbreaks in the who disease outbreak news during this 14-year period were initially reported by informal information sources .
traditional governmental public health reporting mechanisms remain an integral source for outbreak information , accounting for almost two - thirds of all initial reports over this period .
our results also show that these sources made statistically significant improvements in reporting early warnings of outbreak threats more rapidly to the public , which might result in part from a shift toward automated , electronic methods that improve the timeliness of communication ( 12,13 ) .
it is possible that enhancements in nongovernmental outbreak reporting systems also contributed to improvements in governmental outbreak reporting timeliness over the study period , but we were unable to test this assumption with the current data .
we encountered difficulty in selecting and consistently applying criteria to determine the initial source of public communication from promed - mail reports , which could have resulted in misclassification bias .
although other reporting systems that use informal information exist , they either lack a publicly available archive ( for example , global public health intelligence network ) ( 14 ) or their database did not cover the entire study period ( for example , healthmap ) ( 15 ) . according to heymann , et al . , 65% of outbreaks recognized by who are first identified by informal sources ( 4 ) , a proportion we did not find .
we were able to internally validate the data that remained , but these exclusions limited the study s statistical power .
finally , use of outbreak reports collected from the who disease outbreak news might limit the generalizability of our findings to all infectious disease outbreaks . despite these limitations ,
our data highlight the value of nongovernmental sources as an integral resource for providing timely information about global infectious disease threats , and demonstrate the significant improvements in the timeliness of outbreak reporting made by governmental sources . | to compare the timeliness of nongovernmental and governmental communications of infectious disease outbreaks and evaluate trends for each over time , we investigated the time elapsed from the beginning of an outbreak to public reporting of the event .
we found that governmental sources improved the timeliness of public reporting of infectious disease outbreaks during the study period . |
considerable evidence supports that increasing consumption of dietary fiber is associated with lower risk of obesity in adults .
based on these data , the dietary reference intakes ( dris ) for americans two years and older is to consume 14 grams ( g ) of total fiber per 1000 kilocalories ( kcal ) of total energy intake . in younger children ,
a two - year follow - up study conducted in latino children 711 years old showed that an increase of 3 g of dietary fiber/1000 kcals was associated with a 4% reduction of visceral body fat while a fiber decrease of the same amount was associated with a 21% increase of visceral body fat .
in addition , overweight latino children who consumed 5.2 g of soluble fiber were more likely to have none of the features of metabolic syndrome while those who consumed 4.1 g were more likely to have 3 + features .
others failed to establish a clear relationship between fiber intake levels and body weight , possibly due to the length of the study or the different types of fiber or food sources .
obesity in childhood often results in insulin resistance , which disrupts glucose metabolism and can eventually result in diabetes , but data on glucose metabolism and fiber intake are sparse for children
. results of a meta - analysis of studies from 1980 to 2010 suggest that increased fiber intake is associated with decreased blood glucose and glycosylated hemoglobin ( hba1c ) in adults .
in addition , a review on psyllium fiber showed that increased psyllium consumption resulted in improved glucose homeostasis , with postprandial glucose values decreasing by 12.2% to 20.2% in children with type 2 diabetes .
however , research results are inconsistent , which may be due to the dissimilar effects of soluble and insoluble fiber .
current research suggests that cereal fiber and whole - grain intake is associated with decreased risk of diabetes , but no effect was found with increased intake of soluble fiber from fruits and vegetables [ 7 , 8 ] .
these data are supported by research indicating that consumption of cereal fiber and whole grains increase insulin sensitivity in overweight and obese adults [ 9 , 10 ] . to examine the issue ,
the objectives of this study were to use the data from 218 year old american children with plausible intake reports in a nationally representative data set and to ( 1 ) determine dietary fiber sources in children 's diets , ( 2 ) investigate the association between dietary fiber intake level and body weight status in 211 and 1218 year old children , and ( 3 ) investigate the association between dietary fiber intake level and impaired glucose metabolism in teenagers 1218 years old , who provided fasting blood samples .
we used socioeconomic , dietary , and medical examination data from the combined survey years of 2003 - 2004 and 2005 - 2006 of the national health and nutrition examination survey ( nhanes ( available at http://www.cdc.gov/nchs/nhanes.htm ) ) . during the survey ,
an adult was chosen for the household interview and reported sociodemographic information , such as gender , age , race , ethnicity , and household income .
for this study two mutually exclusive age groups , 211 and 1218 year olds , were created to account for the different eating patterns in these two groups . according to the interview responder 's categorization , race and ethnicity
were reported as american indian or alaskan native , asian , black or african american , native hawaiian or pacific islander , white , or other non - hispanic , mexican american , other hispanic .
these variables were recoded to reflect the cultural eating differences in hispanic / other ( mexican americans , other hispanic , other / multiethnic ) , non - hispanic white , and non - hispanic black children .
household income was used to differentiate households by the income - eligibility cut - points for usda food assistance programs ; high income was defined as 3.5 of the poverty income ratio ( pir ) , medium income defined as 1.863.4 pir , and low income defined as 1.85 pir .
the pir is used routinely to express the available income of households , accounting for the number of individuals living in the household .
two 24-hour dietary recalls of food consumption data are available for both 2003 - 2004 and 2005 - 2006 survey years .
detailed information on survey design and data collection can be found elsewhere . to accommodate the increasing food intake with older age ,
the sample was divided into two groups : 211 year olds and 1218 year olds for all analysis . for this study ,
only two - day total energy and dietary fiber data were calculated for each child in the data set . to provide a direct comparison to the dri recommendation for total fiber intake , dietary fiber density in children 's diets
was calculated ( average grams of fiber per 1000 kcal total energy consumed ) .
this dietary fiber density variable was used to create three levels of fiber consumers in tertiles of fiber density . due to
under- or overreporting of dietary data in certain groups , plausibility of the diet data was determined .
biological plausibility of the dietary energy intake records was ascertained using the method described by huang et al . .
in short , children 's reported energy intake was compared to calculated , plausible age - and - gender specific energy expenditure data .
due to the bias introduced by unreliable intake reporting , all analyses of this study were based only on children who had plausible intake data . to explore the food sources of dietary fiber ,
one day of 24-hour recall data was randomly chosen to obtain the most accurate amounts of fiber contribution for each food consumed .
this method is routinely used to address the issue of daily variation of dietary intakes .
for instance , a child might eat one egg on day one but no eggs on day two of the study . however ,
when examining food sources , one should not conclude that the child eats half of an egg every day . randomly choosing one day of the intake data
the top 20 food codes in children ages 211 and 1218 are presented in table 2 .
anthropometric data were obtained when nhanes participants visited the mobile examination center ( mec ) . using standard procedures , height and weight
were measured , and children were classified as being underweight , normal weight , overweight , or obese using the standards published by the cdc ( body - mass - index ( bmi ) weight - for age growth charts in that overweight included children whose bmi - for - age percentile was between the 85th and 94th percentile and obese if it was larger or equal to the 95th percentile . for the purpose of this study ,
children who were underweight ( less than the 5th percentile , 3% of the sample ) were combined with those who have healthy body weight ( 6th84th percentile , 58% of the sample ) .
venous blood samples were drawn only in children at least 12 years old using standard procedures , and fasting blood glucose levels were ascertained using an enzyme hexokinase ( hk ) method .
a fasting glucose level of at least 126 milligrams per deciliter ( mg / dl ) was used as the cut - point to establish impaired glucose metabolism .
full details on nhanes methodology to estimate impaired glucose metabolism can be found at http://www.cdc.gov/nchs/nhanes.htm .
the statistical software stata 11 ( stata corp , version 11 ) was used for all data analysis .
survey routine procedures were used to account for nhanes 's complex survey design and the sampling weights .
the 4-year medical sampling weights were used to generate descriptive statistics and for the logistic analysis .
food - level analysis was based on one day of intake , and the calculation of weighted total intake of dietary fiber was performed using the one - day dietary intake weight ( wtdrd1 ) .
the relationship between the dietary fiber level in children 's diets and their risk for being overweight or obese was estimated using multiple , logistic regression models .
the independent variable was expressed in tertile of fiber density ( referent , lowest tertile ) while the main dependent variable was coded as a dichotomous variable ( overweight / obese ( = 1 ) or not ( = 0 ) ) .
analyses were conducted by age group , controlling for age ( as continuous variable ) , gender , ethnicity , and income as well as ethnicity and income interactions .
similarly , the association between dietary fiber intake level and the risk for impaired glucose metabolism was examined using logistic regression models where the independent variable was expressed in tertile of fiber density ( referent , lowest tertile ) while the main dependent variable was coded as a dichotomous variable ( impaired glucose metabolism ( = 1 ) or not ( = 0 ) ) .
analyses were also controlled for gender , ethnicity , and income as well as ethnicity and income interactions . due to the lack of data using fasting blood samples in children younger than 12 years old ,
the analysis was restricted to children 1218 years old , who provided fasting blood samples .
the total population included n = 6556 children , representing 109,068,577 children ages 218 years old in the us population . within the total population ,
n = 4755 children , approximately 80% of the sample , had provided biological plausible intake reports and were included in the analysis .
there were significant differences in the ethnic background of the plausible reporters versus the nonplausible reporters . in that
more non - hispanic black and mexican american than non - hispanic white children provided plausible reports , likewise , more low - income children than medium- or high - income children were plausible reporters . in both age groups ,
more children who were plausible reporters had healthy weight ( 46% and 54% of 211 and 1218 year old , resp . ) .
overweight children who were plausible intake reporters comprised 9% of the 211 year olds and 13% of the 1218 year olds , while obese plausible intake reporters comprised 19% of the 211 year olds and 14% of the 1218 year olds .
examination of the food sources of fiber revealed that the foods providing the highest proportions of fiber to the plausible diets of children were not high - fiber foods , such as french fries and pizza or white bread / rolls ( table 2 ) .
the main sources of fiber in the 211 year old children with healthy weight compared to the overweight / obese showed several differences ; healthy weight children consumed more high - fiber foods such as peanut butter or popcorn compared to the overweight / obese .
the food that contributed the highest amount of dietary fiber in children ages 211 and 1218 years old was the meatless bean and cheese burrito , which was consumed in amounts that contributed the highest amount of fiber : up to 30.8 g of dietary fiber in the 211 year olds and up to 48.3 g in 1218 year olds .
other foods consumed in amounts that rendered them high contributors of dietary fiber included baked white potatoes , beans and franks , canned pasta with tomato sauce and meat / meatballs , refried beans , and chili con carne .
average total dietary fiber density was 6.4 g/1000 kcals in plausible reporters age 218 .
dietary fiber density intake in 211 year old children was 6.68 g/1000 kcals , significantly higher than the dietary fiber density intake for 1218 year old children of 6.15 g/1000 kcals ( p < 0.001 ) .
tertiles of average total dietary fiber density for 218 year old plausible reporters were 4.4 , 6.1 and 8.8 g fiber/1000 kcals for the lowest , medium and highest tertiles . in 211 year old plausible reporters , the fiber density intake tertiles were 4.5 , 6.2 , and 8.8 g/1000 kcal of the lowest , medium , and highest tertile , respectively . in 1218
year olds , tertiles of dietary fiber intake density were 4.3 , 6.1 , and 8.9 g/1000 kcal for the lowest , medium , and highest tertiles .
thus , on average dietary fiber intake levels were less than half of the dri .
odds ratios for disease risk factors of bmi for children 218 years old are shown in table 3 . in 218 year old plausible reporters , the risk for overweight / obesity decreased significantly by 17% from children in the medium tertile of fiber density compared to those in the lowest tertile ( or = 0.83 , p value = 0.043 ) and by 21% between those in the highest compared to the lowest tertile ( or = 0.79 , p value = 0.031 ) .
there was a trend of decreasing risk for overweight / obesity with increasing fiber density among respondents 211 years old , but this trend was not significant . in 1218
year olds with plausible diet records , the risk for overweight / obesity decreased by 25% from children in the highest fiber density intake tertile compared to the lowest tertile ( or = 0.75 , p = 0.043 ) .
analysis of further subgrouping of the population yielded mixed results . due to the small sample size of plausible reporters in the age groups , logistic models using those strata
the 2,709 teenagers 1218 years old who provided fasting blood glucose samples , 2661 were plausible reporters , and 1508 were plausible reporters with impaired blood glucose .
a large protective effect of being in the medium tertile of dietary fiber density was found ( or = 0.68 , p value < 0.001 ) , but this trend was not significant from children in the highest tertile compared to the lowest ( or = 0.75 , p = 0.070 ) ( table 3 ) .
the nhanes data are collected continuously to address the government 's mission to ensure the health and wellbeing of the american people via nutrition monitoring .
this study provides information on the sources of fiber and the association between total dietary fiber intake and the odds of selected chronic diseases in children .
to pursue this goal , nhanes data of the subsample with biological plausible intake reports were examined and stratified by age group .
furthermore , data were analyzed on the population and on the person level to explore the foods contributing most fiber to children 's diets .
the results shown here indicate a lower risk for childhood obesity with increasing dietary fiber intake . a recent review of the literature suggested a number of mechanisms by which dietary fiber intake might help downregulate body weight in adults
. data on fiber intake and body weight in the pediatric population are not consistent .
lack of dietary fiber in children 's diets was associated with higher body fatness in a sample of british children and 15 g of supplemental fiber in addition to a calorie - restricted diet resulted in 2 kg more weight loss .
others found no association between dietary fiber and adiposity . in a sample of german children ,
one longitudinal study with two year follow - up showed that 711 year old latinas who consumed higher levels of soluble fiber had a small but significant reduction of visceral body fat ; on the other hand , lower fiber intake was associated with a 10% increase of visceral body fat . increasing dietary fiber intake by the equivalent of 1/2 cup of beans per day to children 's diets for 16 weeks
conflicting results may be due to the different time periods , populations , and the amount and type of fiber assessed in these studies . one possible venue for the beneficial effect of fiber on weight status could be the increase in satiety .
postprandial glucose levels and increased insulin sensitivity are associated with the increased viscosity of soluble fiber intake which has been associated with delayed gastric emptying , altering of gastrointestinal myoelectrical activity , decreased glucose diffusion through the water layer , and decreased accessibility of substrates to -amylase thus increasing satiety [ 23 , 24 ] .
insoluble fiber , on the other hand , does not absorb water but increases insulin sensitivity ; a clear mechanism or pathway for this phenomenon has not been shown to date .
the majority of research on fiber intake and glucose metabolism focuses on adults , and data in children are scarce .
others found that consumption of 10 g of glucan by obese women resulted in significantly decreased glucose response after 30 minutes as well as a delayed glucose response .
furthermore , increasing cereal fiber by 31.2 g / day for 3 days resulted in improved insulin sensitivity in overweight and obese women .
diabetic adults who consumed a diet with 50 g of fiber for 6 weeks had significantly reduced their preprandial plasma glucose and area under the curve for 24-hour plasma glucose compared to those who consumed a diet with 25 g of fiber that was identical in macronutrient and energy content . a review by moreno et al .
found that psyllium supplementation resulted in a 12%20% reduction in postprandial glucose levels in children and adolescents with type 2 diabetes .
psyllium fiber in particular has been identified as a method to decrease glucose levels in diabetic adults and has even been suggested as an additional treatment to type 2 diabetics .
this theory is based on results of their recent study suggesting that obese adults consuming a diet high in protein have reduced insulin sensitivity and higher expression of protein ribosomal subunit serine kinase 6 - 1 ( s6k1 ) while adults consuming a high - protein and high - cereal - fiber diet had s6k1 levels similar to baseline values .
these data expand on previous research indicating that the inhibition of glucose uptake is associated with phosphorylation of downstream targets of s6k1 .
hypothesize that the stable s6k1 expression in adults consuming the high protein and cereal fiber is due to fiber 's interference in the digestion and/or absorption of the protein .
this theory may provide further insight to the effects of fiber on insulin sensitivity , and additional research should be initiated .
our findings support previous research and suggest that fiber intake is associated with improved glucose metabolism .
however , due to the relatively small number of individuals who were plausible reporters and had higher fiber intakes and the resulting intake distribution curves that were drastically skewed to the left , we were not able to show a consistent trend in improved health status with increasing level of dietary fiber intake . a number of limitations affected this study .
the most critical issue was that only dietary but not functional fiber intake can be estimated when using the nhanes data .
furthermore , only total dietary fiber but not soluble or insoluble fiber is included in the data set ; thus , the specific effects of these two types of fibers could not be discerned .
one major strength of this study was the use of a nationally representative dataset to explore diet - disease relationships .
epidemiologic and population - based studies are of tremendous value in the examination of diet - disease associations .
however , the nature of such data precludes any indication of causality , and data are limited to the variables provided , making it impossible for researchers to examine other factor of interest .
in addition , the accuracy of self - reported dietary intake data inherent to those studies is often a limiting factor .
since it is not possible to objectively and directly measure dietary intake in such large samples , individuals can under- or overreport all or selected foods , introducing reporting bias which results in skewed data .
thus , studies investigating diet - obesity relationships should include the examination of biological plausibility in the intake data , as was performed here .
although our results show a beneficial association between dietary fiber intake and lower risk for overweight and obesity , longitudinal studies clearly establishing a causal relationship are needed .
most children in this study underconsumed dietary fiber by more than 60% and even children with diets in the highest fiber density tertile failed to meet the intake recommendation , with younger children having a higher fiber density intake than older children .
we showed that high - fiber diets were the result of large food intake , not the consumption of fiber dense foods .
the potentially beneficial effect of the fiber on children 's health is diluted by excessive energy intake ; therefore , children should be encouraged to consume fiber - rich foods , such as fruits , vegetables and whole grains .
more research is needed to identify interventions to increase the fiber density of children 's diets with the goal of lowering childhood obesity . | increased fiber intake has been linked with lower risk of overweight and obesity in adults , but data are sparse for children . to address this issue , nhanes 20032006 data was used to evaluate ( 1 ) the food sources of fiber in children , ( 2 ) the dietary fiber density levels and risk of being classified as overweight / obese , and ( 3 ) the association between fiber intake level and impaired glucose metabolism in children .
analyses were restricted to the subsample of children with biological plausible diet reports ( n = 4,667 ) and stratified by 211 year olds ( n = 2072 ) and 1218 year olds ( n = 2595 ) .
results showed that the food sources are predominantly foods that are low in dietary fiber , but are consumed at high levels . in 218 year old plausible reporters , the risk for overweight / obesity decreased by 17% from children in the medium tertile of fiber density intake compared to the lowest tertile ( or = 0.83 , p value = 0.043 ) and by 21% between the highest compared to the lowest tertile ( or = 0.79 , p value = 0.031 ) .
there was a protective effect of being in the medium tertile of dietary fiber density ( or = 0.68 , p value < 0.001 ) on impaired glucose metabolism .
these results indicate a beneficial effect of higher fiber density in children 's diets . |
bisphosphonates have been considered both effective and cost - effective in preventing vertebral , peripheral , and hip fractures also in older populations [ 13 ] .
however , oral bisphosphonates may cause gastrointestinal problems , esophagitis , and , in rare cases , atypical fractures of the femur .
thus , it is recommended that prescribers regularly review the need for treatment , especially after five or more years of use .
the risk of osteoporotic fracture is markedly higher among older people suffering from cognitive impairment and dementia , including alzheimer s disease ( ad ) .
people with ad have a 23-fold risk of hip fracture compared with ad - free people .
dementia and fracture risk are both increased through decreased mobility and impaired balance , smoking , alcohol use , and vitamin d deficiency .
additionally , dementia is associated with an increased risk of falls and low bone mineral density ( bmd ) and hence , a greater risk of fracture . a lack of early recognition of osteoporosis risk through bmd tests and underutilization of osteoporosis medication have been associated with both older age and dementia [ 79 ] . as far as we know , no previous studies have investigated the incidence of bisphosphonate use among community - dwelling women and men with diagnosed ad . the objective of our study was to examine the incidence and duration of cumulative bisphosphonate use among finnish community - dwellers with or without ad .
the medalz-2005 ( medication use and alzheimer s disease ) cohort encompasses all finnish community - dwelling persons with a verified ad diagnosis and alive on december 31 , 2005 .
persons with ad were identified from the special reimbursement register maintained by the social insurance institution ( sii ) in finland , and one control matched by age , gender , and region of residence and without ad was identified for each person with diagnosis of ad .
the diagnosis of ad was based on the nincds - adrda and dsm - iv criteria for ad .
the details of the medalz-2005 cohort and registers are described by tolppanen et al . .
information on bisphosphonate use among persons with an ad diagnosis and their controls without ad in 20022009 was obtained from the prescription register .
the finnish prescription register includes information on all reimbursed prescription drug purchases classified according to the anatomical therapeutic chemical classification system ( atc ) and defined as daily dose ( ddd ) , which is the assumed average maintenance dose per day for a drug used for its main indication in adults .
atc codes m05ba ( alendronate , etidronate , risedronate , ibandronate , zoledronate , pamidronate and clodronate ) and m05bb ( risedronate and calcium , alendronate and cholecalciferol ) were included in the present study .
only bisphosphonate users who started the treatment in 20022009 ( without treatment in 2001 ) and persons using bisphosphonates for fracture prevention were included .
thus , people with cancer diagnoses ( breast cancer , prostate cancer , leukemia , and other malignant diseases of the blood and bone marrow , malignant diseases of the lymphatic system , cancer of the female genital organs , or other malignant tumors ) ( n = 2971 ) and possibly using bisphosphonates for treatment of cancer - related bone metastases or hypocalcaemia were excluded .
after exclusion of persons with bisphosphonate use in 2001 or with cancer , the present study consisted of 51,292 persons , including 25,850 persons with ad and 25,422 controls .
the follow - up ended on december 31 , 2009 , institutionalization , or death .
short - term bisphosphonate users were defined as persons who had used bisphosphonates for less than 365 days but had an opportunity to use them for at least one year in terms of the follow - up time after starting drug use .
one person may have had multiple bisphosphonate periods with either the same or different bisphosphonate substances .
these were summed together for the calculation of cumulative duration of bisphosphonate use . in finland
, a maximum of 3 months of treatment per purchase may be dispensed at one time .
drug use periods ( when continuous drug use started and ended ) were defined from individual purchase histories using the purchased amount in ddds , which is recorded for each purchase and for each drug ( atc code ) in the prescription register . this method is based on calculation of temporal sliding averages from three subsequent purchases .
purchases were included in the same drug use period if the purchased amount of drug was enough to last to the next purchase when stockpiling , personal purchase regularity , and hospitalizations were taken into account .
use of each atc code was modeled separately . when studying the cumulative duration of bisphosphonate use , overlapping periods of using bisphosphonate drug substances
thus , during any period of bisphosphonate use persons were allowed to switch between drug substances and drug combinations if there were no breaks in the availability of the drug .
charlson s comorbidity index was calculated for each person at the start of the follow - up on january 1 , 2006 , based on the diagnoses recorded in the special reimbursement register .
the index included heart failure , coronary artery disease , diabetes type i or type ii , chronic asthma or chronic obstructive pulmonary disease ( copd ) , disseminated connective tissue diseases , rheumatoid arthritis and other comparable conditions ( score of 1 ) ; uremia requiring dialysis , severe anemia in connection with chronic renal failure , leukemia and other malignant diseases of blood and bone marrow including malignant diseases of the lymphatic system , and cancer including breast and prostate cancers , female genital tract cancer and malignant neoplasms ( score of 2 ) .
the charlson s indexes were classified as : 0 , 1 , and 2 or more .
descriptive statistical analyses were done for continuous variables using means , medians , and standard deviations ( sd ) .
a t - test was used to measure differences between means and a kruskal - wallis test was used to test differences between medians .
chi - squared tests for categorical variables were used to compare the characteristics of bisphosphonate users with and without ad .
univariate and multivariate logistic regression analyses ( forward entry selection ) was utilized to evaluate factors associated with short - term bisphosphonate use in comparison with long - term use .
the medalz-2005 cohort included a total of 6041 ( 11.8% ) persons that had used bisphosphonates during the 8-year follow - up .
bisphosphonates were used by 15.8% ( n = 5519 ) of the women and 3.2% ( n = 522 ) of the men .
the mean age of the bisphosphonate users was 80.8 years ( 5499 , sd 5.815 ) .
mean age of male bisphosphonate users was 79.7 ( sd 6.192 ) and mean age of female bisphosphonates users was 80.9 ( sd 5.768 ) ( p < 0.0001 ) .
bisphosphonates were more commonly used among persons without ad ( n = 3121 , 12.3% ) than among persons with ad ( n = 2920 , 11.2% ) ( p = 0.001 ) . there were no significant gender differences in terms of ad diagnosis and bisphosphonate use . of people with ad using bisphosphonates ,
37% ( n = 1085 ) have started treatment before the diagnosis of ad .
the prevalence of asthma / copd and rheumatoid arthritis was higher among bisphosphonate users than among non - users .
the median duration of bisphosphonate use was 743 days ( iqr ) . among people with ad ,
the median duration of use was 777 days ( iqr ) and among people without ad , 701 days ( iqr ) ( p = 0.011 ) .
characteristics of the bisphosphonate users with and without ad are presented in table 1 .
persons without ad more often used bisphosphonate combination preparations , including vitamin d , than did persons with ad ( p < 0.0001 ) .
bisphosphonate use was more common among persons without ad who had comorbidities ( charlson s index 2 or more ) and among those with asthma / copd or rheumatoid arthritis compared with users with ad .
of the bisphosphonate users , 32.5% ( n = 1966 ) had used bisphosphonates for less than one year . of these persons , 89%
in the multivariate model , factors associated with short - term use were male gender , at least 80 years of age , and no ad diagnosis ( table 2 ) . in the multivariate logistic regression analysis , cumulative use of five years or more , compared with those with shorter use ,
was associated with female gender ( or 9.66 ; 95% ci , 6.9313.45 ) , rheumatoid arthritis ( or 2.98 , ci 2.233.90 ) , and having asthma / copd ( or 1.85 ; 95% ci , 1.452.36 ) .
this is the first nationwide study focusing on the incidence and duration of cumulative bisphosphonate use among women and men with diagnosed ad .
although there are no previous studies of incident use that focus on bisphosphonate use , the prevalence of any osteoporosis drug use has been negatively associated with cognitive decline among community - dwellers [ 9 , 15 ] .
previous studies have suggested that dementia dominates other comorbidities and thus may lead to underdiagnosis [ 9 , 16 ] .
polypharmacy , concerns about potential or actual adverse effects , and limited life expectancy may also limit prescribing to persons with dementia .
people without ad discontinued bisphosphonate use more often within one year and more often used preparations including bisphosphonates in combination with vitamin d than did people with ad , possibly because of better ability to communicate their needs and subjective adverse effects .
one explanation for poor adherence and persistence may be the asymptotic nature of osteoporosis ; bisphosphonate treatment aims to protect from future fractures , but has no immediate impact on symptoms or well - being .
this problem has been observed among other asymptomatic chronic conditions such as hypertension or hypercholesterolemia .
in addition to direct experiences of adverse effects as well as costs , comorbidities , and the patient s beliefs appear to have an impact on whether osteoporosis drug use is continued . in the present study , persons with asthma /
copd or rheumatoid arthritis more often were bisphosphonate users and long - term users , presumably due to glucocorticoid use . in the present study ,
the incidence of bisphosphonate use among men was rare ( 3% ) , and short - term use was associated with male gender .
osteoporosis is associated in female gender and , thus , a majority of previous studies have mostly focused on female populations [ 8 , 19 ] .
it has been suggested that male osteoporosis has been both unrecognized and undertreated , although mortality associated with fractures is even higher among men than women .
the major strength of our study is the nationwide sample of both older women and men who use bisphosphonates , with a long follow - up .
drug use was based on prescription register data , which have previously been reported to be reliable .
the present study describes the mathematically modeled duration of bisphosphonate treatment instead of a single - point cross - sectional design .
further , we compared bisphosphonate use among persons with ad with their age- , gender- , and region of residence - matched comparison persons without ad .
persons with ad in our study had a clinically verified diagnosis of ad . in the present study ,
we did not know the indication for bisphosphonate use , e.g. , whether it was used for primary or secondary prevention of osteoporosis .
another limitation was the fact that we did not capture confounders such as lifestyle factors ( height , weight , smoking , and alcohol consumption ) , bmd and socioeconomic factors , or use of calcium / vitamin d supplements ( available also over the counter in finland ) .
unfortunately , we were not able to identify other dementia etiologies or mild cognitive impairment .
however , ad covers at least 80% of the dementia cases . in conclusion , although the incidence of bisphosphonate use was slightly higher among people without ad , the cumulative duration of bisphosphonate use was longer in people with ad .
short - term use was associated with male gender , older age , and not having ad .
more research on bisphosphonate use in relation to fracture history among people with or without ad is needed to identify possible differences in treatment practices .
| we studied the incidence and duration of cumulative bisphosphonate use among older finnish women and men with or without alzheimer s disease ( ad ) .
the medalz-2005 cohort is a nationwide sample of all persons with clinically diagnosed ad on 31 december 2005 and their age- , gender- , and region of residence - matched control persons without ad .
information on bisphosphonate use by persons with an ad diagnosis and their controls without ad during 20022009 was obtained from the prescription register database containing reimbursed medications .
a total of 6,041 ( 11.8% ) persons used bisphosphonates during the 8-year follow - up .
bisphosphonates were more commonly used among persons without ad ( n = 3121 , 12.3% ) than among persons with ad ( n = 2,920 , 11.2% ) ( p = 0.001 ) .
the median duration of bisphosphonate use was 743 days ( iqr ) . among persons with ad , the median duration of use was 777 days ( iqr ) and among persons without ad , 701 days ( iqr ) ( p = 0.011 ) .
people without ad more often used bisphosphonate combination preparations including vitamin d than did people with ad ( p < 0.0001 ) .
bisphosphonate use was more common among people without ad who had comorbidities , asthma / copd , or rheumatoid arthritis compared with users with ad .
short - term users were more likely to be male , at least 80 years old , and not having ad .
although the incidence of bisphosphonate use was slightly higher among persons without ad , the cumulative duration of bisphosphonate use was longer in persons with ad .
short - term use was associated with male gender , older age , and not having ad . |
epithelioid osteoblastoma ( eo ) is an uncommon histologic variant of osteoblastoma ( ob ) and derives its name from the characteristic presence of plump epithelioid osteoblasts .
eo is also named as aggressive osteoblastoma ( ao ) due to its propensity for local invasion and high rate of recurrence .
conventional osteoblastoma ( co ) is an uncommon benign bone - forming tumor accounting for < 1% of all bone neoplasms .
it most commonly affects males during the second decade of life with vertebral column and pelvis being common sites and involves long bones of limbs infrequently .
about 1012% of co can occur in maxillofacial skeleton with mandible being the most common site .
less than hundred cases of ob of jaw have been reported in literature , with very few being of ao .
we report an interesting and rare case of eo involving maxilla in an 18-year - old female patient which challenged us and threw many differentials .
an 18-year - old girl reported to our institution with a complaint of slowly progressive palatal swelling for last 1 year on right side of her upper jaw in maxillary molar region .
there was a history of gradual loosening of teeth from # 13 to # 17 along with mild pain .
a diffuse purplish - red growth measuring approximately 4.2 cm in diameter was seen which was mildly tender , nonreducible , nonpulsatile and did not bleed on touch [ figure 1 ] .
computed tomography scan revealed a well - defined , smoothly marginated , lobulated expansile lytic lesion involving the right side of maxilla at the level of right first , second and third molar along the upper inner alveolar margin .
the lesion was seen to partially erode and encase the posterior root of the second molar tooth .
the lesion had coarse , pleomorphic calcific matrix with regions of ossification within [ figure 2 ] .
mucosal bulge in maxillary sinus and oral cavity was present with no involvement or ulceration .
fine - needle aspiration cytology ( fnac ) of the lesion was done and smears revealed monomorphic population of dyscohesive plasmacytoid epithelial cells with abundant cytoplasm , well - defined cell borders and eccentric round to oval nucleus with occasional nucleoli .
some cells were more pleomorphic with coarse chromatin and prominent nucleoli . at few places ,
these cells were seen lining eosinophilic acellular material [ figure 3 ] . multinucleated osteoclasts such as giant cells were also appreciated .
cut section of the lesion on gross was red brown with gritty consistency [ figure 4 ] .
histopathology revealed sheets of large epithelioid cells with eccentric nucleus and abundant cytoplasm , rimming the irregular deposits of osteoid and broad bony trabeculae [ figure 5 ] .
were present . peripheral maturation of blue bone to more organized eosinophilic trabeculae of woven bone was seen in the margins of lesion . no abnormal mitotic figures or area of necrosis
the diagnosis of eo was given and patient was kept in close follow - up due to aggressive nature of lesion .
clinical image shows intraoral swelling in the right side of upper jaw in maxillary molar region ( a ) contrast - enhanced computed tomography axial scan shows an eccentric expansile lytic mass arising from the medial aspect of right maxillary alveolus in the posterior molar region with foci of ossification within .
( b ) bone window in contrast - enhanced computed tomography coronal reformat shows the superior surface of the right maxillary alveolar mass abutting the right lateral aspect of the hard palate and inferior wall of ipsilateral maxillary sinus fine - needle aspiration cytology smear shows population of plasmacytoid cells , which at places are surrounding eosinophilic acellular material ( lg stain , 100 ) .
[ inset : a : high power view of plasmacytoid cells ( lg stain , 400 ) , b : high power of view of eosinophilic acellular material ( lg stain , 400 ) ] lg stain : leishman giemsa stain gross image of excised specimen showing red - brown and gritty cut surface histopathological image shows ( a ) mucosa covered unencapsulated circumscribed lesion comprising of sheets of epithelioid osteoblasts ( h&e stain , 100 ) ( b ) riming irregular , broad osteoid ( h&e stain , 400 ) ( c and d ) peripheral maturation and presence of blue bone .
( c ) h&e stain , 100 , ( d ) h&e stain , 400 and ( e ) cells showing s-100 positivity
the lesion was first described by jaffe and mayer in 1932 and has had many synonyms including giant osteogenic fibroma and giant osteoid osteoma . in 1956 , jaffe and lichtenstein separately proposed the term benign ob for an osteoblastic osteoid - forming lesion similar to osteoid osteoma , but with a greater growth potential .
ob accounts for < 1% of all primary bone tumors , with a male : female ratio of 2:1 .
it usually occurs in young adults , with mean age of 20 years and primarily involves the posterior element of the spine and the sacrum ( 4055% ) .
dorfman and weiss in 1984 described a subset of ob which was characterized by locally destructive pattern , recurrence and presence of epithelioid osteoblasts and labeled them as ao .
approximately 1012% of co occurs in maxillofacial skeleton with mandible being the commonest site as reported by alvares capelozza et al . while reviewing largest series of ob of jaw . in this series ,
7.2% cases were noted as recurrent however , no confirmatory histological features for ao were described .
ao lesions tend to be clinically and radiographically larger ( 4 cm ) than lesions of co ( < 4 cm ) .
the radiologic appearance of ao can be similar to co , consisting of circumscribed lytic defect sometimes surrounded by sclerotic rim although a more aggressive appearance with cortical expansion and local destruction can be seen .
imaging of our case revealed expansile lytic lesion involving the cortex and medullary cavity of right maxillary alveolus , eroding and encasing the posterior root of the second molar tooth .
excision with partial maxillectomy was preferred over curettage because of expansile and lytic nature of lesion and keeping in mind the possibility of osteogenic sarcoma .
few authors in literature have quoted that patients of ao are usually in older age bracket than co and are seen in the third or fourth decade . however , our patient was 18 years old at time of presentation .
differential usually considered in cases of jaw tumor includes fibro - osseous lesions , bone tumors and odontogenic tumors .
the differential offered on imaging in our case included ossifying fibroma and central giant cell granuloma , these lesions being more common in this site and age group .
osteoid osteoma which could be another close differential is usually smaller in size , seldom exceeding 1 cm in greatest diameter and are associated with characteristic pain and surrounding sclerotic bone reaction .
the plasmacytoid cells on aspiration smears pointed toward osteoblastic origin and had plasma cells and myoepithelial cells of salivary gland origin as close morphologic differentials .
the possibilities were narrowed to osteoid osteoma , ob and low - grade osteosarcoma after close clinicopathological and radiological correlation .
the presence of sheets of characteristic large epithelioid osteoblasts rimming the osteoid and irregular broad bony trabeculae helps us in reaching the diagnosis . peripheral maturation or zonation
ob - like osteosarcoma is the main differential of ao . the absence of lace - like osteoid , bizarre cells and prominent mitotic activity helped in excluding diagnosis of osteosarcoma . according to bertoni et al . , the chief microscopic feature separating osteosarcoma from ob is lack of tumor maturation at the margins of osteosarcoma , with permeation of tumor in adjacent host tissue . in a review of 306 cases of ob , lucas et al .
concluded that the clinically aggressive behavior in ob did not seem dependent totally on the presence of epithelioid osteoblasts but appear more related to precise location and size of the tumor which impact the surgeon 's ability to completely remove the lesional tissue .
considering the recurrence rate of 13.6% for ob and nearly 50% in ao , surgical resection should be preferred over curettage .
our patient was treated with surgical resection and is on close follow - up with no complaints of recurrence .
proper diagnosis and management of ao requires close and careful correlation of clinical , radiographic and histopathological findings .
| osteoblastoma ( ob ) is an uncommon benign bone - forming tumor accounting for < 1% of all bone neoplasms . unlike conventional ob
, its small subset variant epithelioid osteoblastoma ( eo ) is characterized by its propensity for local invasion and recurrent behavior .
this rare variant of an uncommon tumor when occurs in an atypical site can lead to diagnostic problems more so due to ambiguous clinico - radiologic presentation .
this was what faced in the present case of 18-year - old female with a swelling in upper jaw .
ob is usually more common in males and involves primarily the posterior element of the spine and the sacrum ( 4055% ) .
less frequently , long bones of limbs are involved .
clinical , radiological and histopathological correlation in this case guided us to reach at right diagnosis of eo which helped the patient in getting correct treatment which involves surgical excision over conventional curettage .
the purpose behind this case presentation is to improve the awareness about this recurrent tumor variant which has many close differentials including well - differentiated osteoblastic osteosarcoma . |
impaired glucose tolerance ( igt ) is a less severe form of hyperglycemia that represents an intermediate stage in the development of type 2 diabetes.13 twenty - five percent to 75% of individuals with igt progress to diabetes within a decade of diagnosis.4 in recent years , the numbers of new patients with type 2 diabetes and igt have steadily increased around the world , and it is estimated that over 300 million people will have type 2 diabetes by the year 2025.5 a number of large - scale clinical studies have made it clear that igt is a major risk factor for cardiovascular disease.68 it is also clear that prevention of diabetes before its onset and aggressive treatment of this disease at an early stage is important from the perspective of public health , medical care , and economics.9 in this context , several intervention studies have demonstrated the positive effects of lifestyle modification.914 it was recently reported that a low - carbohydrate diet ( lcd ) is useful for promoting weight loss and improving glycemic control,1524 but it remains unclear whether the lcd can normalize blood glucose in igt patients and prevent progression to type 2 diabetes . against this background ,
we designed a 7-day in - hospital educational program focused on the lcd for igt .
the aim of the present study was to assess the efficacy of this program combined with diabetes education and support at 3-month intervals for normalizing blood glucose in igt patients and preventing progression from igt to type 2 diabetes .
the participants in the present study were 72 japanese patients with igt who were enrolled from april 2007march 2013 at japan labour health and welfare organization niigata rosai hospital ( joetsu , japan ) .
we screened patients aged 2075 years with a body mass index ( bmi ) < 35 kg / m , fasting glucose < 126 mg / dl , and hemoglobin a1c ( hba1c ) < 7.0% .
patients were eligible for this study if they had igt , which was defined as a glucose level of 140199 mg / dl at 2 hours after a 75 g oral glucose load according to the 2003 american diabetes association criteria .
in addition , all of the subjects were confirmed to have a serum triglyceride ( tg ) level < 300 mg / dl and a serum low - density lipoprotein ( ldl ) cholesterol level < 200 mg / dl .
patients were excluded if they were pregnant or breastfeeding , had a serum creatinine level 2 mg / dl , had liver dysfunction , had gastrointestinal problems that would prevent them from following the prescribed diet , had active cancer , or were participating in another trial .
written informed consent was obtained from all patients and the ethics committee of the japan labor health and welfare organization niigata rosai hospital approved this study .
we obtained consent for publication of all the materials in this article , including the individual information contained in the tables .
eligible participants were assigned to one of two groups , either a group that was hospitalized for 7 days of lcd education ( lcd group ) or a group that was not hospitalized and had no education ( control group ) . the low - carbohydrate , unrestricted calorie diet aimed at a maximum daily intake of 120 g of carbohydrates .
the objectives of the 7-day in - hospital educational program were to create motivation , provide information about diabetes and igt , and change the patient s eating habits .
lessons were taught by nutritionists , pharmacologists , nurses , and physicians on a one - to - one or group basis .
after the hospital stay , we provided individual support sessions every 3 months with nutritionists , nurses , and physicians . in the control group , participants were given general information about diabetes and igt .
their physicians also provided diabetes information brochures with general instructions on diet and lifestyle improvement , but there was no individual instruction or formal group counseling .
the lcd group was admitted to hospital for 7 days to participate in an educational program . on the first day of the program ,
a physician gave a lecture about the lcd using slides that lasted for 60 minutes .
on the second day , the subjects received individual lessons from nutritionists , pharmacologists , and nurses .
after that , they ate the lcd every day and studied the diet using a textbook that was given to them
. in compliance with the lcd , rice ( the main dish ) was offered at lunchtime only .
the nutritional composition of the food was 30% carbohydrates , 25% protein , and 45% fat .
on the fifth day , the subjects completed some tests on the lcd ( 30 questions , true / false test ) , and discussed their diet with nutritionists , nurses , and physicians at a lunch meeting on the lcd .
subjects in both groups were asked to attend outpatient guidance sessions every 3 months and were also reviewed by their physicians at 3-month intervals . body weight was measured and blood and urine samples were collected . the general health of each subject was assessed , and the results of the laboratory tests were explained by the physicians , who gave advice about diabetes or igt for 510 minutes at every interview .
we emphasized the total carbohydrate intake of less than 120 g per day without restricting total calories or fat .
a 75 g oral glucose tolerance test ( ogtt ) , fasting plasma glucose , fasting plasma insulin , serum ldl cholesterol level , serum high - density lipoprotein ( hdl ) cholesterol , and serum tgs were measured at every 3-month visit .
all blood samples were sent to the central laboratory at niigata rosai hospital , and aliquots were stored at 70c until analysis .
plasma glucose levels were determined by the glucose oxidation method ( chemical reagents and glucose adams ga-1171 analyzer ; arkray , kyoto , japan ) .
hba1c was measured by high - performance liquid chromatography ( hplc ; adams a1c ha-8181 ; arkray ) .
the value of hba1c ( % ) was estimated as a national glycohemoglobin standardization program ( ngsp ) equivalent value ( % ) derived from the japanese diabetes society ( jds ) value and calculated by the formula hba1c ( % ) = hba1c ( jds ) ( % ) + 0.4%.25 serum ldl cholesterol and serum hdl cholesterol levels were measured by the direct method without deposition ( sekisui medical h-7700 ; hitachi ltd , tokyo , japan ) .
serum tgs were measured by the cholesterol oxidation enzyme and enzymatic colorimetry methods ( sekisui medical h-7700 ) .
plasma insulin levels were measured with an enzyme immunometric assay ( immulite autoanalyzer ; diagnostic products corporation , los angeles , ca , usa ) , for which the coefficient of variation was 2.5% .
intention - to - treat analysis was done on all patients in their assigned groups , regardless of whether they actually performed the specified intervention .
results are expressed as the mean standard deviation . the differences between baseline values and those after 12 months of treatment were evaluated using the paired t - test for continuous variables .
differences between the two groups were assessed using the unpaired t - test for continuous variables and by the chi - square test or fisher s exact probability test for categorical variables because the distribution of each variable did not differ significantly between the two groups . in all analyses ,
p<0.05 was considered significant and analyses were performed with statview software ( v5 ; brainpower inc . , calabasas , ca , usa ) .
eligible participants were assigned to one of two groups , either a group that was hospitalized for 7 days of lcd education ( lcd group ) or a group that was not hospitalized and had no education ( control group ) . the low - carbohydrate , unrestricted calorie diet aimed at a maximum daily intake of 120 g of carbohydrates .
the objectives of the 7-day in - hospital educational program were to create motivation , provide information about diabetes and igt , and change the patient s eating habits .
lessons were taught by nutritionists , pharmacologists , nurses , and physicians on a one - to - one or group basis .
after the hospital stay , we provided individual support sessions every 3 months with nutritionists , nurses , and physicians . in the control group , participants were given general information about diabetes and igt .
their physicians also provided diabetes information brochures with general instructions on diet and lifestyle improvement , but there was no individual instruction or formal group counseling .
the lcd group was admitted to hospital for 7 days to participate in an educational program . on the first day of the program ,
a physician gave a lecture about the lcd using slides that lasted for 60 minutes .
on the second day , the subjects received individual lessons from nutritionists , pharmacologists , and nurses .
after that , they ate the lcd every day and studied the diet using a textbook that was given to them
. in compliance with the lcd , rice ( the main dish ) was offered at lunchtime only .
the nutritional composition of the food was 30% carbohydrates , 25% protein , and 45% fat .
on the fifth day , the subjects completed some tests on the lcd ( 30 questions , true / false test ) , and discussed their diet with nutritionists , nurses , and physicians at a lunch meeting on the lcd .
subjects in both groups were asked to attend outpatient guidance sessions every 3 months and were also reviewed by their physicians at 3-month intervals . body weight was measured and blood and urine samples were collected .
the general health of each subject was assessed , and the results of the laboratory tests were explained by the physicians , who gave advice about diabetes or igt for 510 minutes at every interview .
we emphasized the total carbohydrate intake of less than 120 g per day without restricting total calories or fat . a 75 g oral glucose tolerance test ( ogtt ) , fasting plasma glucose , fasting plasma insulin , serum ldl cholesterol level , serum high - density lipoprotein ( hdl ) cholesterol , and serum tgs were measured at every 3-month visit .
all blood samples were sent to the central laboratory at niigata rosai hospital , and aliquots were stored at 70c until analysis .
plasma glucose levels were determined by the glucose oxidation method ( chemical reagents and glucose adams ga-1171 analyzer ; arkray , kyoto , japan ) .
hba1c was measured by high - performance liquid chromatography ( hplc ; adams a1c ha-8181 ; arkray ) .
the value of hba1c ( % ) was estimated as a national glycohemoglobin standardization program ( ngsp ) equivalent value ( % ) derived from the japanese diabetes society ( jds ) value and calculated by the formula hba1c ( % ) = hba1c ( jds ) ( % ) + 0.4%.25 serum ldl cholesterol and serum hdl cholesterol levels were measured by the direct method without deposition ( sekisui medical h-7700 ; hitachi ltd , tokyo , japan ) .
serum tgs were measured by the cholesterol oxidation enzyme and enzymatic colorimetry methods ( sekisui medical h-7700 ) .
plasma insulin levels were measured with an enzyme immunometric assay ( immulite autoanalyzer ; diagnostic products corporation , los angeles , ca , usa ) , for which the coefficient of variation was 2.5% .
intention - to - treat analysis was done on all patients in their assigned groups , regardless of whether they actually performed the specified intervention .
results are expressed as the mean standard deviation . the differences between baseline values and those after 12 months of treatment were evaluated using the paired t - test for continuous variables .
differences between the two groups were assessed using the unpaired t - test for continuous variables and by the chi - square test or fisher s exact probability test for categorical variables because the distribution of each variable did not differ significantly between the two groups . in all analyses ,
p<0.05 was considered significant and analyses were performed with statview software ( v5 ; brainpower inc . ,
from april 2007march 2013 , we assigned 72 participants to the two groups ( 36 to the lcd group and 36 to the control group ) .
there were no significant differences in the baseline characteristics between the two groups ( table 1 ) .
after 12 months , the 2-hour plasma glucose level of the lcd group showed a significant decrease in comparison with baseline in the ogtt ( p<0.001 ) . on the other hand ,
the control group showed a significant increase in the 2-hour plasma glucose compared with baseline ( p<0.01 ) .
after 12 months , the 2-hour plasma glucose level in the ogtt was significantly lower in the lcd group than in the control group ( p<0.001 ; table 2 and figure 1 ) . in the lcd group ,
25 patients achieved resolution of igt with normalization of glucose levels , eleven patients still had igt , and no patient developed type 2 diabetes . in the control group ,
three patients achieved resolution of igt , 28 patients still had igt , and five patients progressed to type 2 diabetes .
the igt normalization rate was significantly higher in the lcd group ( 25/36 , 69.4% ) than in the control group ( 3/36 , 8% ) ( p<0.001 ) , while the incidence of diabetes was significantly lower in the lcd group ( 0/36 , 0% ) than in the control group ( 5/36 , 13.9% ) ( p=0.02 ) . fasting plasma glucose and hba1c both showed a significant decrease compared with baseline in the lcd group ( p<0.01 and p<0.001 , respectively ) .
on the other hand , both parameters increased significantly compared with baseline in the control group ( p<0.01 and p<0.001 , respectively ) .
changes in fasting plasma glucose and hba1c over the 1-year period were significantly different between the two groups ( p<0.001 ; figure 2a and b ) .
after 12 months , the lcd group showed a significant decrease in weight compared with baseline ( p<0.001 ) .
in contrast , the body weight of the control group increased significantly compared with baseline ( p<0.01 ) .
the weight of the lcd group was significantly lower than that of the control group at 12 months ( p<0.001 ; table 2 and figure 2c ) .
at 12 months , both hyperinsulinemia and homeostasis model of assessment of insulin resistance ( homa - ir ) were improved in the lcd group compared with the control group ( p<0.001 ; table 2 ) . in the lcd group ,
homa - ir showed a significant decrease compared with baseline ( p<0.01 ) , while homa - ir increased significantly relative to baseline in the control group ( p<0.01 ) .
the 12-month change in homa - ir was significantly greater in the lcd group than in the control group ( p<0.001 ; figure 2d ) .
the serum ldl cholesterol level of the lcd group was slightly decreased ( p=0.55 versus baseline ) and that of the control group was slightly increased at 12 months ( p=0.53 versus baseline ) , but there was no significant difference between the two groups ( p=0.26 ; table 2 and figure 2e ) .
after 12 months , the serum hdl cholesterol level of the lcd group showed a significant increase ( p<0.001 ) , while that of the control group decreased significantly ( p<0.001 ) .
thus , the 12-month changes of serum hdl cholesterol were significantly different between the two groups ( p<0.001 ; table 2 and figure 2f ) .
after 12 months , serum tgs significantly decreased in the lcd group ( p<0.01 ) , and significantly increased in the control group ( p<0.01 ) .
thus , the 12-month changes of tgs were significantly different between the two groups ( p<0.001 ; table 2 and figure 2 g ) .
from april 2007march 2013 , we assigned 72 participants to the two groups ( 36 to the lcd group and 36 to the control group ) .
there were no significant differences in the baseline characteristics between the two groups ( table 1 ) .
after 12 months , the 2-hour plasma glucose level of the lcd group showed a significant decrease in comparison with baseline in the ogtt ( p<0.001 ) . on the other hand ,
the control group showed a significant increase in the 2-hour plasma glucose compared with baseline ( p<0.01 ) .
after 12 months , the 2-hour plasma glucose level in the ogtt was significantly lower in the lcd group than in the control group ( p<0.001 ; table 2 and figure 1 ) . in the lcd group ,
25 patients achieved resolution of igt with normalization of glucose levels , eleven patients still had igt , and no patient developed type 2 diabetes . in the control group ,
three patients achieved resolution of igt , 28 patients still had igt , and five patients progressed to type 2 diabetes .
the igt normalization rate was significantly higher in the lcd group ( 25/36 , 69.4% ) than in the control group ( 3/36 , 8% ) ( p<0.001 ) , while the incidence of diabetes was significantly lower in the lcd group ( 0/36 , 0% ) than in the control group ( 5/36 , 13.9% ) ( p=0.02 ) .
fasting plasma glucose and hba1c both showed a significant decrease compared with baseline in the lcd group ( p<0.01 and p<0.001 , respectively ) . on the other hand , both parameters increased significantly compared with baseline in the control group ( p<0.01 and p<0.001 , respectively ) .
changes in fasting plasma glucose and hba1c over the 1-year period were significantly different between the two groups ( p<0.001 ; figure 2a and b ) .
after 12 months , the lcd group showed a significant decrease in weight compared with baseline ( p<0.001 ) .
in contrast , the body weight of the control group increased significantly compared with baseline ( p<0.01 ) .
the weight of the lcd group was significantly lower than that of the control group at 12 months ( p<0.001 ; table 2 and figure 2c ) .
at 12 months , both hyperinsulinemia and homeostasis model of assessment of insulin resistance ( homa - ir ) were improved in the lcd group compared with the control group ( p<0.001 ; table 2 ) . in the lcd group ,
homa - ir showed a significant decrease compared with baseline ( p<0.01 ) , while homa - ir increased significantly relative to baseline in the control group ( p<0.01 ) .
the 12-month change in homa - ir was significantly greater in the lcd group than in the control group ( p<0.001 ; figure 2d ) .
the serum ldl cholesterol level of the lcd group was slightly decreased ( p=0.55 versus baseline ) and that of the control group was slightly increased at 12 months ( p=0.53 versus baseline ) , but there was no significant difference between the two groups ( p=0.26 ; table 2 and figure 2e ) .
after 12 months , the serum hdl cholesterol level of the lcd group showed a significant increase ( p<0.001 ) , while that of the control group decreased significantly ( p<0.001 ) .
thus , the 12-month changes of serum hdl cholesterol were significantly different between the two groups ( p<0.001 ; table 2 and figure 2f ) .
after 12 months , serum tgs significantly decreased in the lcd group ( p<0.01 ) , and significantly increased in the control group ( p<0.01 ) .
thus , the 12-month changes of tgs were significantly different between the two groups ( p<0.001 ; table 2 and figure 2 g ) .
the present study demonstrated that a 7-day in - hospital educational program focused on a lcd is effective for blood glucose normalization in igt patients and for preventing progression from igt to type 2 diabetes .
the blood glucose normalization rate was 69.4% in the lcd group , which is higher than previously reported with a low - fat diet ( lfd ) ( 26%47%).12,26 in the ogtt , the 2-hour plasma glucose level was reduced by 33 mg / dl in the lcd group , which was greater than the decrease in previous lfd studies ( 2229 mg / dl).12,27 the 1-year incidence of diabetes among igt patients in the control group was 13.9% , which was within the range suggested by epidemiological data ( 1.5%15.7%).11,2630 on the other hand , the 1-year incidence of diabetes was 0% in the lcd group , which was significantly lower than in the control group ( p=0.02 ) or in previous lfd studies ( 2.0%12.5%).10,26,28 although we did not assess the long - term effects of the lcd , we consider that this diet reduces progression to diabetes in the igt population more effectively than a lfd .
first , it is likely that participants with igt have glucose intolerance due to excessive carbohydrate intake ; hence , restriction of their carbohydrate intake leads to blood glucose normalization .
in fact , the blood glucose level of most subjects in the lcd group decreased after a few days of hospitalization in comparison with baseline .
second , because the lcd does not regulate the total calorie intake and allows patients to eat enough of various foods , it seems that the lcd is easier to understand and conform to than the lfd .
third , several studies have indicated that the lcd is more effective for achieving weight loss than the lfd.1524 the lcd group achieved a mean weight loss of 10.6% at 12 months , which was within the range suggested by previous reports on low - carbohydrate therapies ( 3.4%10.9%).1820 this marked weight reduction with the lcd may have led to blood glucose normalization in the lcd group and prevented progression to type 2 diabetes .
moreover , homa - ir was significantly lower at 12 months compared with baseline in the lcd group .
weight reduction probably contributed to the improvement of insulin resistance . in this study , we observed a significant increase of hdl cholesterol and a significant decrease of tgs ; however , there was no significant alteration of the ldl cholesterol level .
recent studies have shown that the lcd is better for achieving weight loss , decreasing tgs , and increasing hdl cholesterol , while the lfd is better for decreasing total cholesterol and ldl cholesterol levels.24 we obtained similar results , which suggests that the lcd might have a weak effect on reducing ldl cholesterol .
we designed the 7-day in - hospital educational program so that it focused on the lcd .
subjects in the lcd group could study the lcd , actually eat the diet , and change their eating habits during a 7-day hospital stay . on the last hospital day , most subjects already displayed weight loss and a decrease in glucose , and they were praised for achieving this goal , which might have increased their confidence and motivation .
the lcd group also received 10- to 15-minute individual counseling sessions every 3 months , and this level of support was sufficient for maintaining their knowledge and motivation .
first , it was a case control study and we could not determine whether both groups had the same unknown bias that affected glucose tolerance .
therefore , a large - scale trial would be needed to confirm the generality of our findings .
third , we did not have a lfd group as one of the study groups ; hence , we could not assess the superiority of the lcd over the lfd .
our study demonstrated that a 7-day lcd education program and periodic interval follow - up are effective for achieving blood glucose normalization and preventing progression to type 2 diabetes in patients with igt .
the lcd significantly decreased the 2-hour plasma glucose in the ogtt , as well as fasting plasma glucose , hba1c , homa - ir , body weight , and serum tgs at 12 months , while significantly increasing the serum hdl cholesterol level .
however , a large - scale study is necessary to confirm the efficacy of the lcd for igt . | backgroundin recent years , the number of people with impaired glucose tolerance ( igt ) has increased steadily worldwide .
it is clear that the prevention of diabetes is important from the perspective of public health , medical care , and economics .
it was recently reported that a low - carbohydrate diet ( lcd ) is useful for achieving weight loss and glycemic control , but there is no information about the effects of the lcd on igt .
we designed a 7-day in - hospital educational program focused on the lcd for igt.methodsthe subjects were 72 patients with igt ( 36 in the lcd group and 36 in the control group ) who were enrolled from april 2007march 2012 and followed for 12 months .
we retrospectively compared the lcd group with the control group.resultsin 69.4% of the lcd group , blood glucose was normalized at 12 months and the 2-hour plasma glucose level in the oral glucose tolerance test ( ogtt ) was reduced by 33 mg / dl .
in addition , the incidence of diabetes was significantly lower in the lcd group than in the control group at 12 months ( 0% versus 13.9% , p=0.02 ) .
the lcd group showed a significant decrease in fasting plasma glucose , hemoglobin a1c , the homeostasis model of assessment of insulin resistance value , body weight and serum triglycerides ( tgs ) at 12 months , while there was a significant increase of the serum high - density lipoprotein ( hdl ) cholesterol level.conclusionthe lcd is effective for normalizing blood glucose and preventing progression to type 2 diabetes in patients with igt . |
the value given to traditional medicine ( tm ) is a function of public health and drug policies at a national level .
its potential contribution to conventional allopathic medicine can be characterized by how it is defined , the motivation for its use , and country - specific integration strategies .
the world health organization 's ( who 's ) definition of tm recognizes that it predates western medicine . who describes tm as
the sum total of knowledge , skills and practices based on the theories , beliefs and experiences indigenous to different cultures that are used to maintain health , as well as to prevent , diagnose , improve or treat physical and mental illnesses . in some countries , the terms complementary and alternative medicine ( cam ) are synonyms for tm .
together , these terms refer to a broad set of health care practices that are not integrated into a country 's primary biomedical health care system . for example , the french health care system defines tm or cam as unconventional health care practices that should be regulated . for the purposes of this study , we merged the who definition into an integrated approach . in this approach ,
tm is seen as a medical model that has always existed and whose concepts , knowledge , skills , and practices can be associated with conventional allopathic medicine to improve levels of health care and additional services .
it also can be an evaluation , treatment , or counseling tool for health care providers to be used in the management of pathology or medical , social , cultural , ethnic , and economic problems in either a conventional or a traditional context .
for example , who 2008 figures show in some asian and african countries that 80% of the population depended on tm or cam for primary health care . in the united states ,
data from the 2007 national health interview survey showed that the adult population spent us $ 33.9 billion of their own money on visits to cam practitioners and on the purchase of cam products , training , and materials . in france
, a 2007 survey showed that 39% of french people had used at least 1 type of tm / cam in the previous 12 months .
their main motivations were reported to be a desire to take fewer drugs ( 39% ) and effectiveness ( 28% ) . in a 2008 survey ,
50% of french people reported having confidence in cam ; and 41% treated themselves without consulting a practitioner .
these numbers suggest that there is competition between primary biomedical providers and cam practitioners , as well as a sustained and growing market for cam . assuming that integration is beneficial for patients and public health , for tm to be integrated into conventional allopathic medicine , appropriate strategies must be established . in 2002 , who defined the first global traditional medicine strategy .
the purpose was to discuss the role of tm in health care systems , identify current challenges and opportunities , and assess who 's role and strategy for tm .
since then , other models for the integration of tm into western medicine have been put forward that have different interpretations and definitions of the terms integration , integrated , and integrative .
these models describe implicit and explicit levels of collaboration and communication between providers in integrative health care and may be centered on the patient , the healer , the practitioner , or the health care system .
integration is closely related to the role of health care providers and may depend partially on their capacity to assimilate tm / cam knowledge .
lack of awareness may be one reason why tm / cam integration strategies have failed and the ability of conventional practitioners to learn from a tm model may provide an indication of the capacity of the overall health care system to integrate tm knowledge . according to who classification and french health care regulations , france has an inclusive system that recognizes tm / cam but has not yet fully integrated it into all aspects of health care , including delivery , education and training , and regulation .
traditional medicine / cam is not available at all levels in the health care system .
health insurance does not cover tm / cam treatment , training in tm / cam is not available at university level , and regulation of tm / cam providers and products is partial or lacking .
this is disappointing because , ultimately , full integration can only happen when countries operate a fully inclusive system .
it follows the example of who , which has proposed incorporating traditional healers into the conventional health care system .
these individuals bring with them their own concepts , knowledge , reasoning system , skills , practices , and communication processes .
there are several challenges to be overcome in further developing the potential of tm or cam to assist in the health care system .
the first is that tm / cam practices have evolved in different cultures and regions and there has been no parallel development of standards and methods either national or international for evaluating them .
this is especially true of herbal medicines , the effectiveness and quality of which can be influenced by numerous factors .
research into tm / cam has been inadequate to date , resulting in a lack of data and methodologies .
an additional challenge is the lack of harmonization of communication between tm consumers and providers in the conventional health care system .
there is a lack of communication both between tm and allopathic medical practitioners , and between allopathic medical practitioners and consumers .
most disease management models can be described as an aggregation of concepts that are learned and shared by health care providers . explanatory models ( whether traditional or modern ) in medical anthropology , ethnomedicine , and ethnopharmacology define different disease taxonomies and use different biomedical concepts , which make it difficult for traditional healers , patients , and practitioners to communicate with one another .
this problem is exacerbated by the exponential growth of data and knowledge representation methods in both tm and mainstream allopathic medicine .
a third challenge is the provision of information to consumers about risks and risk management strategies related to the use of tm / cam .
this includes the fight against misleading advertising and sectarian divides in the use of tm / cam therapies .
another challenge is the ability to integrate tm / cam into the medical curriculum and the ongoing education of practitioners and health care professionals . for this study , we chose vodou as the representative method for tm / cam .
vodou ( also known as voodoo , voudou , vaudou , vodu , vodun , vodoun ) healing is a traditional therapy model that is common to africans , afro - americans and some europeans .
it is a recognized religion in some countries and is used in public health research .
vodou practices are understood to involve belief systems and ritual and serve as a way to treat spiritual , social , and medical problems in traditional or modern societies .
there are similarities between western medicine and cam in patients ' motives for consulting a practitioner .
pain is one of the oldest medical problems and a universal physical affliction for humankind .
it is a concept that is common to both tm and western medicine and is one of the most frequent reasons for consulting either a traditional healer or a biomedical practitioner .
for example , acupuncture has been used to treat pain ( and many other health conditions ) for more than 3000 years . on the other hand ,
traditional healers play an important role in the delivery of primary health care ( particularly in remote communities ) and offer various approaches to pain management .
the question we investigate in this study is whether it is possible to develop a vodou - based model for the treatment of patients with acute or chronic pain .
we feel it is important to study the capacity of a health care system and its providers to integrate biomedical concepts and other therapeutic and explanatory medical models . in addition
, there is a need to understand and improve risk management by anticipating and preventing potential reasons for failure in tm / cam integration strategies and to enhance communication between patients , healers , and physicians to optimize tm / cam integration .
therefore , the aim of the study was to develop a tm vodou pain management model and then to assess the capacity of french dental practitioners to use it in the context of the french health care system .
in particular , we aimed to identify specific factors , criteria , and conditions for the integration of tm into conventional allopathic medicine .
the methods were divided into 3 stages : ( 1 ) an analysis of the concepts and terminology of vodou traditional healers using knowledge - engineering techniques , ( 2 ) the development of a pain management model based on a traditional therapy , and ( 3 ) a 3-part survey of a sample of french dental practitioners . the survey gathered information about the terms practitioners typically use to describe dental pain , assessed their capacity to use the tm concepts , and evaluated their communication profile .
this study was approved by the research ethics committee of the universit de nantes . from 2002 to 2011
, we collected 30 commercial fact sheets from traditional vodou healers in various african countries ( benin , burkina faso , gabon , gambia , and mali ) .
these paper documents provided a range of information about the healers and their services , such as the therapies available , the illness or problems treated , and the medical products used . from these fact sheets , we extracted frequently used terms using natural language processing procedures .
a corpus of 10,800 words was established , unidentifiable words were checked for spelling mistakes , and the text was preprocessed using unitex 2.1 ( a corpus processing system ) .
terms were extracted manually according to token frequency , the identification of collocations , the use of patterns for locating information , and statements about the definition of pain .
we then identified the principal pathologies through a correlation of term frequencies and the concepts of healers .
we also categorized terms indexed in conventional biomedical terminologies to identify semantic differences between socioeconomic or cultural problems , and disease or illness .
although vodou is not classified by the american national center for complementary and alternative medicine and its full integration into the american health care system is still in question , in france , it is recognized as a nonconventional therapy .
there are historical , social , and anthropological links between the vodou healer and conventional french medical practitioners .
some of the earliest theories of vodou came from dahomey ( benin ) , which was a west african french colony .
thus , because vodou is recognized in the french system and we wished to survey french dentists , it was logical to select this method for tm for our study .
the principal questions were as follows : how is pain ( mal or douleur in french ) managed with vodou healing ?
how do the paradigms of the vodou model compare to modern models such as the biopsychosocial model of pain ?
from the description of how he used vodou to treat pain , we extracted 20 steps and formalized the conceptual pain management model .
we used a sample of dental practitioners in nantes , france , for this study .
dentists have traditionally been associated with pain , which is one of the most common reasons patients seek dental treatment .
dentists are expected to be able to diagnose the source of pain and provide conventional strategies for its management .
therefore , they are expected to have clinical experience of different models of pain management .
the main criterion for inclusion in the sample was dentists working in the area of nantes ( western france ) who were involved in the clinical treatment of dental pain ; this included dentists working in private practice outside an academic setting .
the profile of the sample of dentists was male ( 55% ) or female ( 45% ) aged 45 to 65 ( 57.5% ) with an average of 20 years of clinical practice .
most worked with 0 to 2 professional colleagues ( 65% ) and 0 to 2 other collaborators ( 50% ) .
the first part of the survey asked dentists to list terms frequently used in the treatment of dental pain .
the purpose of this was to be able to compare the terms used by traditional healers and conventional practitioners .
the second part of the survey assessed the ability of the sample of dentists to use the pain management model .
the 20 traditional treatment components were merged with 3 conventional modalities ( diagnosis , use of anesthetic , and therapeutic choice ) to determine the principal modalities selected by the conventional dental practitioner .
it can be difficult to translate between the concepts of tm and conventional allopathic medicine , and similarities between therapeutic methods may only refer to a logic equality or equivalence of medical facts .
the communication profile of practitioners may help to characterize the strategies of mainstream health care providers .
therefore , we asked dental practitioners to classify a set of terms and expressions , which were associated with 2 variables ( whether they had an informational or a medical / paramedical impact ) .
from 2002 to 2011 , we collected 30 commercial fact sheets from traditional vodou healers in various african countries ( benin , burkina faso , gabon , gambia , and mali ) .
these paper documents provided a range of information about the healers and their services , such as the therapies available , the illness or problems treated , and the medical products used . from these fact sheets , we extracted frequently used terms using natural language processing procedures .
a corpus of 10,800 words was established , unidentifiable words were checked for spelling mistakes , and the text was preprocessed using unitex 2.1 ( a corpus processing system ) .
terms were extracted manually according to token frequency , the identification of collocations , the use of patterns for locating information , and statements about the definition of pain .
we then identified the principal pathologies through a correlation of term frequencies and the concepts of healers .
we also categorized terms indexed in conventional biomedical terminologies to identify semantic differences between socioeconomic or cultural problems , and disease or illness .
although vodou is not classified by the american national center for complementary and alternative medicine and its full integration into the american health care system is still in question , in france , it is recognized as a nonconventional therapy .
there are historical , social , and anthropological links between the vodou healer and conventional french medical practitioners .
some of the earliest theories of vodou came from dahomey ( benin ) , which was a west african french colony .
thus , because vodou is recognized in the french system and we wished to survey french dentists , it was logical to select this method for tm for our study .
the principal questions were as follows : how is pain ( mal or douleur in french ) managed with vodou healing ?
how do the paradigms of the vodou model compare to modern models such as the biopsychosocial model of pain ?
from the description of how he used vodou to treat pain , we extracted 20 steps and formalized the conceptual pain management model .
we used a sample of dental practitioners in nantes , france , for this study .
dentists have traditionally been associated with pain , which is one of the most common reasons patients seek dental treatment .
dentists are expected to be able to diagnose the source of pain and provide conventional strategies for its management .
therefore , they are expected to have clinical experience of different models of pain management .
the main criterion for inclusion in the sample was dentists working in the area of nantes ( western france ) who were involved in the clinical treatment of dental pain ; this included dentists working in private practice outside an academic setting .
the profile of the sample of dentists was male ( 55% ) or female ( 45% ) aged 45 to 65 ( 57.5% ) with an average of 20 years of clinical practice .
most worked with 0 to 2 professional colleagues ( 65% ) and 0 to 2 other collaborators ( 50% ) .
the first part of the survey asked dentists to list terms frequently used in the treatment of dental pain .
the purpose of this was to be able to compare the terms used by traditional healers and conventional practitioners .
the second part of the survey assessed the ability of the sample of dentists to use the pain management model .
the 20 traditional treatment components were merged with 3 conventional modalities ( diagnosis , use of anesthetic , and therapeutic choice ) to determine the principal modalities selected by the conventional dental practitioner .
it can be difficult to translate between the concepts of tm and conventional allopathic medicine , and similarities between therapeutic methods may only refer to a logic equality or equivalence of medical facts .
the communication profile of practitioners may help to characterize the strategies of mainstream health care providers .
therefore , we asked dental practitioners to classify a set of terms and expressions , which were associated with 2 variables ( whether they had an informational or a medical / paramedical impact ) .
the 30 fact sheets provided by traditional healers showed that the most frequently used terms were pain and disease oriented .
the concept of mal or maux ( roughly translated as pain or ache in english ) was the most frequently cited term ( table 1 ) . in french , these terms can represent pain , symptoms , pathology , illness , disease , the supernatural , or other problems ( social , cultural , family , professional , spiritual , mystical , occultism , economic , etc ) .
these results showed that traditional african healers use biomedical concepts that are sometimes equivalent to conventional medical terminology , such as that of the medical subject headings or the french catalog and index of french language health resources on the internet , albeit without knowing the medical meaning .
indexed terms were used 25% and unindexed terms were used 75% of the time ( fig 1 ) .
we quantified this ability to use conventional concepts through the development of a health care indicator , which may be useful as a predictor of the constraints to the integration of tm / cam into western medicine .
a tm pain management model was derived from the 20 treatment components shown in table 2 .
dentists were asked to assess tm and conventional healing components according to their importance in their clinical practice .
the results shown in table 3 indicate that , for 70% of dentists surveyed , rational modalities were seen as very important ( 30% ) or important ( 40% ) in pain treatment . two traditional concepts ( in particular , the miniaturization process and thought forms )
most surveyed dentists ( 65% ) had no opinion about the miniaturization process , and it held no interest for another 22% . similarly , 50% of dentists had no opinion about thought forms ; and it held no interest for another 27.5% .
these results suggest that , apart from the more mystical modalities , the traditional pain management model could be used by dental practitioners .
an analysis of the communication profile of dental practitioners showed that they were information oriented .
they focused on health information , clinical facts , and the doctor - patient relationship ( mean , 31.18% ; standard deviation , 14.98 ) .
they were also interested in protocols and ways to measure pain management ( mean , 23.95% ; standard deviation , 14.91 ) ; the conceptualization of medical facts ( mean , 11.45% ; standard deviation , 6.73 ) ; and the social , economic , and health impacts of treatment on the patient ( mean , 8.68% ; standard deviation , 14.32 ) .
the automation of clinical procedures and the urgency of the patient 's pain were their priorities .
they tended to focus on therapeutic procedures , and patient communication was rarely mentioned ( mean , 1.57% ; standard deviation , 1.70 ) .
finally , 23.16% of the dentists sampled had no opinion about the impact of communication and terminology in dental pain management .
the aim was to describe tm / cam integration strategies at systemic and individual level .
the index uses 4 sets of indicators to characterize the capacity of a health care system and its providers to use the tm model .
the indicators represent the definition , integration , motivation , and challenges for tm / cam use .
further regulatory indicators may be implemented for the control of tm / cam therapeutic products .
knowledge - streaming indicators relate to the concepts , terminology , and therapeutic modalities of the healer .
usage indicators relate to social and environment factors , such as the conditions and constraints for the integration of tm / cam ( fig 3 ) .
the 30 fact sheets provided by traditional healers showed that the most frequently used terms were pain and disease oriented .
the concept of mal or maux ( roughly translated as pain or ache in english ) was the most frequently cited term ( table 1 ) . in french , these terms can represent pain , symptoms , pathology , illness , disease , the supernatural , or other problems ( social , cultural , family , professional , spiritual , mystical , occultism , economic , etc ) .
these results showed that traditional african healers use biomedical concepts that are sometimes equivalent to conventional medical terminology , such as that of the medical subject headings or the french catalog and index of french language health resources on the internet , albeit without knowing the medical meaning .
indexed terms were used 25% and unindexed terms were used 75% of the time ( fig 1 ) .
we quantified this ability to use conventional concepts through the development of a health care indicator , which may be useful as a predictor of the constraints to the integration of tm / cam into western medicine .
a tm pain management model was derived from the 20 treatment components shown in table 2 .
dentists were asked to assess tm and conventional healing components according to their importance in their clinical practice .
the results shown in table 3 indicate that , for 70% of dentists surveyed , rational modalities were seen as very important ( 30% ) or important ( 40% ) in pain treatment . two traditional concepts ( in particular , the miniaturization process and thought forms )
most surveyed dentists ( 65% ) had no opinion about the miniaturization process , and it held no interest for another 22% . similarly , 50% of dentists had no opinion about thought forms ; and it held no interest for another 27.5% .
these results suggest that , apart from the more mystical modalities , the traditional pain management model could be used by dental practitioners .
an analysis of the communication profile of dental practitioners showed that they were information oriented .
they focused on health information , clinical facts , and the doctor - patient relationship ( mean , 31.18% ; standard deviation , 14.98 ) .
they were also interested in protocols and ways to measure pain management ( mean , 23.95% ; standard deviation , 14.91 ) ; the conceptualization of medical facts ( mean , 11.45% ; standard deviation , 6.73 ) ; and the social , economic , and health impacts of treatment on the patient ( mean , 8.68% ; standard deviation , 14.32 ) .
the automation of clinical procedures and the urgency of the patient 's pain were their priorities .
they tended to focus on therapeutic procedures , and patient communication was rarely mentioned ( mean , 1.57% ; standard deviation , 1.70 ) .
finally , 23.16% of the dentists sampled had no opinion about the impact of communication and terminology in dental pain management .
our results were organized into a composite health care index . the aim was to describe tm / cam integration strategies at systemic and individual level .
the index uses 4 sets of indicators to characterize the capacity of a health care system and its providers to use the tm model .
the indicators represent the definition , integration , motivation , and challenges for tm / cam use .
further regulatory indicators may be implemented for the control of tm / cam therapeutic products .
knowledge - streaming indicators relate to the concepts , terminology , and therapeutic modalities of the healer .
usage indicators relate to social and environment factors , such as the conditions and constraints for the integration of tm / cam ( fig 3 ) .
in our analysis of the terms used by healers to describe the concept of pain ( mal or maux ) , it is important to highlight that the word mal has a broader meaning in french than in english . in french ,
the word mal is a synonym for douleur , which is usually used to translate the english word pain ; however , as discussed earlier , it also equates to many other biomedical terms .
the same problem occurs in the definition of the anthropological differences between illness and disease .
our approach aimed to classify the heterogeneous terminology used by the various health care providers .
conventional concepts such as evidence - based medicine are often unfamiliar to traditional healers who have their own beliefs about the safety , effectiveness , and quality of treatments , such as herbal medicines .
their therapeutic choices may be based on spiritual beliefs , traditional knowledge systems , and experience .
these conceptual differences suggest that there is a need for the translation of transcultural medical concepts , which would improve the quality of communication between traditional healers and western biomedical practitioners .
our method offers one way to compare a tm , vodou - based pain management model with conventional models .
both systems describe pain using concepts that involve systemic interrelationships between the biological , the psychological , and the social in health and illness .
however , in this study , we have not been able to establish valid correlations between the 2 models .
more research will be needed if the conventional method and the traditional approach are to be merged .
the tm model may be a tool for pain assessment and management in other domains such as social science , religion , complementary and alternative medicines , integrative medicine , allopathic medicine , chiropractic , and others .
it may also be useful for the evaluation and comparison of other western or allopathic medicines .
a comparative study of vodou - based pain management models is complex because of the variety of paradigms and forms it takes . in the course of our work , we did not find any other formalized vodou - based pain models .
the literature describing vodou therapy uses explanatory models from social , anthropological , historical , magical , and medical contexts .
secret , magic rituals , and belief in the supernatural make it difficult to explain vodou in everyday language
our results showed that the concept of miniaturization was not generally understood or accepted by our sample of dental practitioners .
this may be due to the lack of a clear and rational reasoning system around what seems to be a metaphysical concept .
more information and improved communication between traditional healers and conventional practitioners might bridge this gap .
finally , this study showed a convergence between french tm / cam policies and the dentists ' communication profile .
french authorities currently seek to limit risk related to tm / cam by providing information .
it appears that efforts should instead be made to anticipate medical risks related to a lack of understanding or the existence of misleading information .
the sample size of dentists was small , not randomized , and from only one region of one country .
it is possible that dentists from other areas or practitioners from other specialties may have responded differently .
dentists also have a unique training and thus have their own terminology and approach to pain management ; thus , they do not necessarily represent all types of western biomedical practitioners . therefore , the findings of this study are limited to dentists of this region . other studies using different types of practitioners should be considered .
concepts and terminology for vodou may not necessarily translate to other types of tm or cam .
the present study may serve as a model for research into other tm and cam areas . as authors
, we selected relevant findings and words ; thus , we influenced the process for creating the survey and models .
as more information about the effectiveness and safety of tm / cam treatments becomes available , they may become integrated into conventional medicine .
this study provides some arguments that suggest that a lack of proof and randomized clinical trials are not absolute barriers to the integration of tm / cam therapies .
some medical practitioners are already convinced of the benefits of tm / cam , and patients can decide for themselves which therapies they use .
further research is needed to assess the impact of the patient , who by their choice of treatment can influence the behavior of practitioners and healers .
it would also be interesting to look at the potential role of dental practitioners in primary health care as new diagnostic opportunities open up .
community care models for essential oral health have been encouraged in developing countries , and several pilot projects based on sociocultural conditions have been supported or carried out jointly under the auspices of the who oral health program .
the aim of the study was to assess tm / cam integration strategies at systemic and individual levels .
the composite index implements 4 sets of variables that assess the capacity of a health care system and its providers to use the traditional therapy model .
these quantitative and qualitative indicators make it possible to measure the extent to which practitioners prefer conventional , rather than traditional , practices . in light of this
, we suggest the use of a new term : associated medicine . this term may reflect the capacity of a health care system and its providers to associate or
the concept of associated medicine may also help to investigate why certain established therapies ( whether traditional or conventional ) are not used by physicians , healers , or patients despite clear medical and social evidence of their benefits .
the next step of our work is to develop an ontology and thesaurus dedicated to the concept of associated medicine and to facilitate 3-way communication between healers , practitioners , and patients and improve the quality of the information available .
the sample size of dentists was small , not randomized , and from only one region of one country .
it is possible that dentists from other areas or practitioners from other specialties may have responded differently .
dentists also have a unique training and thus have their own terminology and approach to pain management ; thus , they do not necessarily represent all types of western biomedical practitioners . therefore , the findings of this study are limited to dentists of this region .
concepts and terminology for vodou may not necessarily translate to other types of tm or cam .
the present study may serve as a model for research into other tm and cam areas . as authors
, we selected relevant findings and words ; thus , we influenced the process for creating the survey and models .
as more information about the effectiveness and safety of tm / cam treatments becomes available , they may become integrated into conventional medicine .
this study provides some arguments that suggest that a lack of proof and randomized clinical trials are not absolute barriers to the integration of tm / cam therapies .
some medical practitioners are already convinced of the benefits of tm / cam , and patients can decide for themselves which therapies they use .
further research is needed to assess the impact of the patient , who by their choice of treatment can influence the behavior of practitioners and healers .
it would also be interesting to look at the potential role of dental practitioners in primary health care as new diagnostic opportunities open up .
community care models for essential oral health have been encouraged in developing countries , and several pilot projects based on sociocultural conditions have been supported or carried out jointly under the auspices of the who oral health program .
the aim of the study was to assess tm / cam integration strategies at systemic and individual levels .
the composite index implements 4 sets of variables that assess the capacity of a health care system and its providers to use the traditional therapy model .
these quantitative and qualitative indicators make it possible to measure the extent to which practitioners prefer conventional , rather than traditional , practices . in light of this
, we suggest the use of a new term : associated medicine . this term may reflect the capacity of a health care system and its providers to associate or
the concept of associated medicine may also help to investigate why certain established therapies ( whether traditional or conventional ) are not used by physicians , healers , or patients despite clear medical and social evidence of their benefits .
the next step of our work is to develop an ontology and thesaurus dedicated to the concept of associated medicine and to facilitate 3-way communication between healers , practitioners , and patients and improve the quality of the information available .
our assessment of the ability of french dental practitioners to use a tm model of pain management highlighted 2 findings : the capacity of traditional healers to use conventional concepts and ability of conventional dental practitioners to use traditional concepts .
the ability of traditional healers to learn from conventional allopathic medicine was shown by the adoption of western terminology .
healers frequently used biomedical concepts that are part of standard western medical terminology , although they did not necessarily understand their meaning .
the ability of french dentists to use a traditional pain management model was demonstrated by an analysis of therapeutic modalities .
| objectivesthe purposes of this study were to develop a pain management model using traditional medicine ( tm ) vodou healing methods ; to survey a sample of french dentists to rate components of conventional and proposed tm vodou - based pain management model ; and to assess the possibility of conventional , allopathic providers to integrate tm or complementary and alternative medicine concepts.methodsfrom a set of 30 fact sheets collected from tm african healers ( vodou healers ) , main clinical concepts and terminology were extracted .
twenty vodou - based pain management concepts were collected from an interview with a tm vodou practitioner . from this information ,
a 7-step vodou - based pain management model was created .
a sample of 40 french dentists from nantes , france , whose practices focused on the clinical treatment of dental pain , was surveyed to assess the importance of both tm ( vodou ) and conventional biomedical components.resultsseventy percent of the dentists sampled rated the rational components of the tm model as very important or important for pain treatment , whereas 2 other traditional concepts were considered to be supernatural or beyond understanding.conclusionthis study showed that traditional healers used conventional concepts and conventional practitioners could use traditional concepts .
this suggests that conventional allopathic medical providers have the capacity to integrate biomedical concepts and other therapeutic and explanatory models
. this information may be helpful to understand and improve risk management by anticipating and preventing potential reasons for failure in tm integration strategies and to enhance communication between patients , healers , and physicians to optimize tm or complementary and alternative medicine integration . |
type one diabetes mellitus ( t1 dm ) , one of the most common chronic diseases in childhood , affects 15 million children in the world and is rapidly increasing in specific regions [ 1 , 2 ] so that an annual increase of 2 to 5 percent in europe , the middle east , and australia is reported .
in addition , wide range of serious complications and associated diseases makes t1 dm a very serious medical problem so that the average life span of individuals with diabetes is about 10 years shorter than that of the non - diabetic population .
these complications could be acute , subacute or chronic . and poor adherence resulting in poor control can predispose children at risk up these complications . therefore to decrease burden of this disease ,
the medical team should attempt to ensure a normal growth and development with minimal effect on lifestyle for the patient .
in fact , intensive control dramatically reduces the risk of long - term vascular complications ( such as retinopathy , nephropathy and neuropathy ) by 46 - 76% , growth retardation and puberty delay and also reduces abnormalities in plasma lipid levels [ 1 , 47 ] .
thus it is important to maintain a balance between tight glucose control and avoiding hypoglycemia .
also issues like nutrition , exercise , and psychosocial factors that have an impact on glycemic control should be addressed in the management of children and adolescents with type 1 diabetes .
a reliable index of long - term glycemic control is measurement of the fraction of glycosylated hemoglobin ( hba1c ) .
therefore to obtain a profile of long - term glycemic control , it is recommended that hba1c measurments be obtained 3 to 4 times per year . beside checking hba1c , optimal glycemic and metabolic control is dependent upon frequent self - monitoring of blood glucose ( smbg ) .
hence being female has been an independent risk factor of poor glycemic control in previous studies .
springer in his study on 455 patients with type one diabetes found that mean hba1c level was higher in girls than in boys . in another study in 2180 swedish children ( 1033 girls and 1147 boys )
gerstl et al in study on 27035 patients with type 1 diabetes in germany and austria reported that gender has a significant influence on hba1c . in a study in 2270
californian children with insulin - dependent diabetes mellitus ( iddm ) , females had more diabetes hospitalization than did males .
these occurred primarily in adolescents ( for females ages 10 - 14 years 50 vs. 38/100000 ) and for ages 15 - 18 ( 68 vs. 29/100000 ) . in another study by knerr et al , on 26687 children and adolescents in germany and austria ' female gender was one of the factors associated with higher prandial insulin doses .
also mean hba1c was higher in females and girls reported higher insulin doses per cho units for 3 meals .
in another study by habib in saudi arabia , females had more ketoacidosis at the onset of their illness ( 58.7% vs. 41.3% ) . in a study by ahmed et al on 46 children with iddm
( 23 girls and 23 boys ) he showed that final height in girls was shorter than in boys and at final height , they were significantly shorter with respect to mid parental height .
because effect of gender on glycemic control has not been evaluated in iran , we have studied the t1 dm patients referring to our outpatient clinic to evaluate the effect of gender on glycemic control , diabetes complications and associated abnormalities .
in a cross - sectional study on , patients with type one diabetes mellitus referred to endocrinology clinic in children 's medical center in tehran , iran from march 2005 to march 2007 were enrolled .
all subjects provided informed consent and the study was approved by ethical committee affiliated with tehran university of medical sciences .
patients within the age range of 3 to 16 years with type one diabetes mellitus who were diagnosed at least one year before our evaluation were included .
the diagnosis of diabetes mellitus was based upon the guidelines of the american diabetes association ( ada ) . during the evaluation patients with following criteria
were excluded : 1 ) type 2 diabetes mellitus as any secondary diabetes ( such as thalassemia , chronic active hepatitis , cystic fibrosis , mitochondrial disease ) , 2 ) in adequate clinic visits ( less than four visits per year ) . regarding these conditions 309 patients ( 156 females and 153 males )
boys and girls are different in their start of puberty , it can affect the comparison between boys and girls , therefore patients were categorized with respect to puberty stages .
1 ) prepubertal group ( younger than 11 years for boys and younger than 8 years for girls ) , 2 ) pubertal start group ( 11 to 13 years for boys and 8 to 10 years for girls ) , 3 ) mid puberty group ( older than 13 years for boys and older than 10 years for girls ) .
hba1c levels according to ada levels was used as a reference as follows , for children 0 - 6 years , 7.5 - 8.5% , children 6 - 12 years < 8% , and for older children
variables included sex , age , age at onset of diabetes , height , height standard deviation score ( sds ) , weight , bmi ( body mass index ) , duration of diabetes mellitus ( dm ) , mean hba1c of the last measured ones , daily insulin dose , number of blood glucose measurement in a day , lipid profile , thyroid function tests and puberty indexes ( based on tanner criteria ) .
using spss software , genders differences were analyzed by using chi - square or fisher 's exact test for nominal variables and t - test or mann - whitney u - test for quantitative variables .
our data collected from 309 ( 156 femeals and 153 males with age range of 3 - 16 years ) type 1 diabetes . descriptive and demographic data of all variables are summarized in table 1 .
descriptive statistics of studied patients sd : standard deviation age at onset of disease , disease duration and bmi and sexual maturity rating ( smr ) are considered as baseline characteristics .
hba1c as a measurement of glycemic control was significantly higher in females when evaluated quantitatively ( p<0.001 ) or qualitatively ( p<0.001 ) ( table 2 ) .
comparison of glycemic control in different genders sd : standard deviation / hba1c : glycosylated hemoglobin insulin dose per kilogram of body weight ( insulin / kg ) was significantly different between females and males both when compared quantitatively and when compared between puberty groups ( table 3 ) .
also self monitoring of blood glucose ( smbg ) was performed significantly more in boys compared to girls ( table 3 ) .
comparison of insulin dose in both genders sd : standard deviation finally complications , co - morbidities and associated diseases of dm were compared between boys and girls . as shown in table 4
height sds was significantly lower in females than in males , bmi was not significantly different in females and males , total cholesterol , low density lipoprotein ( ldl ) , and triglyceride levels were significantly higher in females than in males respectively .
hdl was not significantly different ..
complications and associated comorbidities of diabetes in both genders sds : standard deviation score / ldl : low density lipoprotein / hdl : high density lipoprotein / tsh : thyrotrophin - stimulating hormone / t4 : hormones thyroxine / dka : diabetic ketoacidosis in terms of thyroid function tests , hormones thyroxine ( t4 ) levels were significantly higher in girls than in boys though in the normal renege .
the thyrotrophin - stimulating hormone ( tsh ) levels were not significantly different among the both sexes .
diabetic ketoacidosis ( dka ) times were significantly higher in girls than in boys , also dka times based on the stage of puberty were higher in girls at all puberty stages ( table 4 ) .
apart from gender differences , mean hba1c is higher than ada recommendation , this maybe indicative of our urgent need to improve glucose monitoring and patient education .
it is worth to mention that our treatment policy has changed in the recent years from conventional therapy with two times insulin therapy a day towards much intensified treatment with 3 times a day insulin regimen .
et al study on 27035 patients from different centers in austria and germany in all age groups , girls had higher hba1c levels than boys ( mean difference 0.1% ) . in another study by springer et al , girls had hba1c levels higher than boys that has been attributed to greater than boys that has been attributed to greater depression and psychological problems in girls . in our study hba1c was categorized due to puberty stages in both girls and boys and there was significant different within both sexes ( table 2 ) . there are known differences in glucose metabolism in women and men .
it has been shown that healthy females are less insulin sensitive than healthy males , and this decreased sensitivity is compensated by increased insulin secretion . in another study higher insulin concentration during oral glucose tolerance test in non diabetic females than in males was shown . in our study insulin dose / kg
these may be due to non compliance in the pubertal age group , these places adolescents at risk of poor glycemic control .
kaufman showed in her study that adolescents have increased levels of hba1c and also decreased number of clinic visits . in terms of complications of type 1 diabetes
as shown in table 4 for height , sds was significantly different between girls and boys and girls were shorter than boys .
these differences have been shown in previous studies . in a study by ahmed et al on 46 children with diabetes ,
final height was shorter in girls than in boys , and at final height girls were significantly shorter with respect to mid parental height sds .
he concluded that advanced bone age in girls at the onset of puberty may explain blunted pubertal growth spurt , hence their shorter final height .
there was no significant difference in bmi between the genders these has been shown in the study by vanelli et al in italy . in terms of lipid control in type 1
diabetes , there was significant difference in total cholesterol , ldl , and triglyceride levels between sexes .
these may be attributed to poorer diabetes control in girls than in boys and this may endanger them for cardiovascular diseases in adulthood .
therefore the protectiveness of cardiovascular disease in premenopausal women maybe endangered in type 1 diabetes .
in contrast to several studies , we did not find any significant difference in thyroid function tests between the two genders [ 18 , 19 ] , though t4 levels were higher in girls but they were in the normal range .
similar findings were shown in a study in germany and saudi arabia where a female to male ratio of 1.4 to 1 was found .
in fact because children and their parents show poor ability to detect high or low blood glucose levels based on symptoms alone , frequent monitoring improves glycemic control and decreases prevalence of dka in children and decrease the frequency of severe hypoglycemic episodes .
. thus lower rate of using smbg in girls could cause the worse glycemic control in them .
regarding effect of nutritional and psychological factors on glycemic control , higher rate of nutritional and psychological problems in female patients could be another reason of worse glycemic control in girls . while available data suggests normal
eating attitudes in most male patients , eating disorders and sub - threshold eating disorders are almost twice as common in adolescent females with t1 dm as in their non - diabetic peers [ 1 , 22 ] .
also adolescent girls are at greater risk than adolescent boys for recurrent episodes of depression .
because of worse glycemic control in female patients with t1 dm compared to males as well as higher incidence of dka , dyslipidemia and height growth retardation in female patients , it is needed to focus on girls in local guidelines of managing t1 dm regarding smbg , nutritional and psychological factors and puberty issues .
| objectivethe aim of this study was to evaluate the influence of sex on glycemic control , diabetes complications and associated abnormalities in patients with type one diabetes mellitus.methodsin a cross - sectional study in 309 patients ( 156 females and 153 males within the age range of 3 - 16 years ) with type one diabetes mellitus referred to endocrinology clinic in children 's medical center in tehran from march 2005 to march 2007 gender differences in diabetes control were analyzed.findingsmean glycosylated hemoglobin ( hba1c ) , was significantly higher in females ( 9.25 vs. 8.01 ) . insulin dose per kilogram of body weight was significantly more in girls ( 0.910.31 vs. 0.740.37 , p<0.001 ) self monitoring of blood glucose was performed significantly more in boys .
frequency of diabetic ketoacidosis , height growth problems and dyslipidemia were significantly higher in girls .
1.200.86 vs. 0.930.55 , p=0.004 ) , ( 0.051.20 vs. 0.411.17 , p=0.015 ) , ( 134.6044.43 vs. 110.5620.72 , p=<0.001 ) respectively.conclusionfemale sex is a risk factor in glycemic control and complications of diabetes type i and females should be managed more seriously regarding self monitoring of blood glucose , nutritional and psychological factors and puberty issues . |
in 1999 , a dutch surgeon transmitted hepatitis b virus ( hbv ) to at least eight patients and possibly to a total of 28 patients .
literature shows that this form of transmission is not unique , numerous cases of hbv transmission from health care workers to patients have been reported , as reviewed by mele and gunson [ 2 , 3 ] . in 2000 , the dutch health care inspectorate established the commissie preventie iatrogene hepatitis b ( committee for prevention of iatrogenic hepatitis b ; hereinafter referred to as the committee ) .
the committee was asked ( 1 ) to review all hbv - infected health care workers in the netherlands who potentially perform exposure prone procedures ( epps ) and to advise them on how to prevent transmission ; and ( 2 ) to develop a national guideline for the prevention of transmission of hbv from health care workers to patients .
the guideline on prevention of iatrogenic hepatitis b was published in june 2002 and was subsequently endorsed by the dutch health council . in 2003
since 2003 national guidelines for the management of infected health care workers have been instituted in several countries , as reviewed during a meeting of the viral hepatitis prevention board in 2005 . to prevent iatrogenic transmission of hbv , the dutch guideline states that the hbv status of all medical personnel performing epps must be known .
the definition of epps was adopted from a report of the uk health advisory group .
this report defines epps as follows : " exposure prone procedures ( epps ) are those where there is a risk that injury to the worker may result in exposure of the patient s open tissues to the blood of the worker .
these procedures include those where the worker s gloved hands may be in contact with sharp instruments , needle tips or sharp tissues ( spicules of bone or teeth ) inside a patient s open body cavity , wound or confined anatomical space where the hands or fingertips may not be completely visible at all times . " in all but one case of reported hbv transmission to a patient , the level of hbv viremia in the health care worker was higher than 100,000 copies / ml [ 3 , 7 ] . balancing the risk of hbv transmission and the loss of medical specialists , the hbv dna threshold level above which the dutch guideline prohibits epps was chosen to be 100,000 copies / ml . in an hbv - infected person who performs epps
, it has to be demonstrated twice yearly that the hbv viremia remains below this threshold .
antiviral maintenance therapy using hbv polymerase inhibitors may successfully suppress the level of hbv dna below 100,000 copies / ml .
in this situation the level of hbv viremia in the health care worker must be monitored every three months . to ensure proper management of hbv - infected health care workers , and to help decide whether a procedure is exposure prone or not , in the netherlands every hbv - infected health care worker potentially performing epps must be reported to the committee for evaluation and advice . to facilitate reporting ,
this article describes the number and nature of hbv - infected health care workers in the netherlands as submitted to the committee in the years 20002008 .
the committee for prevention of iatrogenic hepatitis b considered the nature of the professional activities and reviewed the hbv - related laboratory test results of all hbv - infected health care workers that were submitted .
the confidential database containing the reviews and test results of the submitted cases was accessed only by members of the committee , thus guaranteeing the privacy of the persons involved .
all hbv - infected health care workers were placed into one of the following three categories : performing epps , not performing epps , or potentially performing epps in the future .
although medical interns in the netherlands in general do not perform epps , medical interns were categorized as ' performing epps ' , because they unexpectedly may encounter exposure prone situations . for this report
, all hbv dna test results expressed in international units were converted from iu / ml to copies / ml , assuming that 1 iu equals 5.8 copies of hbv dna .
the committee for prevention of iatrogenic hepatitis b considered the nature of the professional activities and reviewed the hbv - related laboratory test results of all hbv - infected health care workers that were submitted .
the confidential database containing the reviews and test results of the submitted cases was accessed only by members of the committee , thus guaranteeing the privacy of the persons involved .
all hbv - infected health care workers were placed into one of the following three categories : performing epps , not performing epps , or potentially performing epps in the future .
although medical interns in the netherlands in general do not perform epps , medical interns were categorized as ' performing epps ' , because they unexpectedly may encounter exposure prone situations . for this report
, all hbv dna test results expressed in international units were converted from iu / ml to copies / ml , assuming that 1 iu equals 5.8 copies of hbv dna .
from 20002008 , 99 cases of hbv - infected health care workers were submitted to the committee for reviewing and advice .
fifty of the 99 hbv - infected health care workers performed epps ( see table 1 ) .
seven of 99 were medical students who may perform epps in the future , and 42 were categorized as not performing epps , which included general practitioners , a nuclear physician , a pulmonologist , a geriatric doctor , nurses , technicians , researchers , drivers , janitors , etc .
the 50 epp performing persons included 20 medical specialists ( of which seven were still in training ) , nine dentists ( four in training ) , 11 medical interns , three midwives , two operating room assistants , two dentistry assistants , two dental hygienists , and one surgical intensive care nurse .
table 1number and nature of hbv - infected health care workers as submitted to and reviewed by the dutch committee for prevention of iatrogenic hepatitis b yearpersonnelperforming eppspotentially performing epps in futurenot performing eppstotal200012015272001908172002405920037281720048241420053025200623052007300320082002total5074299hbv hepatitis b virus , epp exposure prone procedure number and nature of hbv - infected health care workers as submitted to and reviewed by the dutch committee for prevention of iatrogenic hepatitis b hbv hepatitis b virus , epp exposure prone procedure eleven of the 50 epp performing persons had a viral load above the dutch threshold level ( 100,000 hbv dna copies / ml ) ; hence they were no longer allowed to perform epps .
twenty - five persons had a hbv dna load below the threshold value , enabling them to perform epps provided that their hbv dna load is monitored .
the duration of monitoring in these persons ranged from 0 to 106 months ( median 54 months ) .
monitoring of hbv dna did not take place in 14/50 persons because they stopped working , moved abroad , died , or changed profession . in the 25 persons undergoing monitoring of hbv dna , the highest level of hbv dna encountered during follow - up was as follows : below 1,000 copies / ml in 4/25 persons , between 1000 and 10,000 copies / ml in 10/25 persons , and between 10,000 and 100,000 copies / ml in 11/25 persons .
table 2 shows the number of restricted persons if other hbv dna threshold levels would have been applied .
table 2number of hbv - infected health care workers excluded from exposure prone procedures according to various hbv dna threshold levelshbv dna threshold level ( copies / ml)percentage of restricted personnel100,00031% ( 11/36)10,00061% ( 22/36)100089% ( 32/36)hbv hepatitis b virus number of hbv - infected health care workers excluded from exposure prone procedures according to various hbv dna threshold levels hbv hepatitis b virus according to the dutch guideline , hbv - infected persons may perform epps again if antiviral therapy forces the hbv load below 100,000 copies / ml , provided that three - monthly monitoring of hbv dna takes place . in five of the 11 restricted cases
the ban could be lifted because of successful antiviral therapy . in one of the 11 restricted cases the hbv dna level initially was low . during follow - up
the level of hbv dna increased , exceeding the threshold value and necessitating a ban on epps .
one of the four dentistry students had a high hbv load and initially was prohibited to carry out epps , which meant that the training had to be postponed .
nevertheless , the dentistry students , medical students , medical interns and medical - specialists - in - training were advised to consider a non - epp profession , because the possibility of them developing a high viral load in the future could not be excluded .
from 20002008 , 99 cases of hbv - infected health care workers were submitted to the committee for reviewing and advice .
fifty of the 99 hbv - infected health care workers performed epps ( see table 1 ) .
seven of 99 were medical students who may perform epps in the future , and 42 were categorized as not performing epps , which included general practitioners , a nuclear physician , a pulmonologist , a geriatric doctor , nurses , technicians , researchers , drivers , janitors , etc .
the 50 epp performing persons included 20 medical specialists ( of which seven were still in training ) , nine dentists ( four in training ) , 11 medical interns , three midwives , two operating room assistants , two dentistry assistants , two dental hygienists , and one surgical intensive care nurse .
table 1number and nature of hbv - infected health care workers as submitted to and reviewed by the dutch committee for prevention of iatrogenic hepatitis b yearpersonnelperforming eppspotentially performing epps in futurenot performing eppstotal200012015272001908172002405920037281720048241420053025200623052007300320082002total5074299hbv hepatitis b virus , epp exposure prone procedure number and nature of hbv - infected health care workers as submitted to and reviewed by the dutch committee for prevention of iatrogenic hepatitis b hbv hepatitis b virus , epp exposure prone procedure eleven of the 50 epp performing persons had a viral load above the dutch threshold level ( 100,000 hbv dna copies / ml ) ; hence they were no longer allowed to perform epps .
twenty - five persons had a hbv dna load below the threshold value , enabling them to perform epps provided that their hbv dna load is monitored .
the duration of monitoring in these persons ranged from 0 to 106 months ( median 54 months ) .
monitoring of hbv dna did not take place in 14/50 persons because they stopped working , moved abroad , died , or changed profession . in the 25 persons undergoing monitoring of hbv dna , the highest level of hbv dna encountered during follow - up was as follows : below 1,000 copies / ml in 4/25 persons , between 1000 and 10,000 copies / ml in 10/25 persons , and between 10,000 and 100,000 copies / ml in 11/25 persons .
table 2 shows the number of restricted persons if other hbv dna threshold levels would have been applied .
table 2number of hbv - infected health care workers excluded from exposure prone procedures according to various hbv dna threshold levelshbv dna threshold level ( copies / ml)percentage of restricted personnel100,00031% ( 11/36)10,00061% ( 22/36)100089% ( 32/36)hbv hepatitis b virus number of hbv - infected health care workers excluded from exposure prone procedures according to various hbv dna threshold levels hbv hepatitis b virus according to the dutch guideline , hbv - infected persons may perform epps again if antiviral therapy forces the hbv load below 100,000 copies / ml , provided that three - monthly monitoring of hbv dna takes place . in five of the 11 restricted cases
the ban could be lifted because of successful antiviral therapy . in one of the 11 restricted cases the hbv dna level initially was low . during follow - up
the level of hbv dna increased , exceeding the threshold value and necessitating a ban on epps .
one of the four dentistry students had a high hbv load and initially was prohibited to carry out epps , which meant that the training had to be postponed .
nevertheless , the dentistry students , medical students , medical interns and medical - specialists - in - training were advised to consider a non - epp profession , because the possibility of them developing a high viral load in the future could not be excluded .
over a period of nine years , from 2000 to 2008 , 99 hbv - infected health care workers were reported to the committee for prevention of iatrogenic hepatitis b in the netherlands . a ban on performing epps had to be imposed in eleven cases . the committee continues to receive requests for advice on hbv - infected personnel , but the number of submitted health care workers decreased after 2004 ( see table 1 ) .
this can be attributed to the fact that most ' prevalent ' hbv - infected persons have been detected and only new ' incident ' cases are to be reviewed .
in addition , local officials have learned to determine which health care workers certainly do not perform epps and thus are not to be submitted for review by the committee .
it is unknown how many hbv - infected , epp - performing health care workers went unreported . to investigate whether the safety of patients was sufficiently safeguarded with regard to the prevention of hepatitis b , and to enforce reporting , in 2002 and 2003 the dutch health care inspectorate sent a standardised questionnaire on the local hbv vaccination status and testing policy to all hospitals , independent treatment centres and private clinics in the netherlands .
responses to the questionnaire showed that 75% of the institutions lacked an effective hbv prevention policy .
subsequently , a representative of the dutch health care inspectorate ( author b - m ) visited selected hospitals , checking local vaccination and control procedures and explaining the liability if the guideline appeared not to be implemented . by march 2004 ,
since 2005 , all hospitals , independent treatment centres , and private clinics known to the dutch health care inspectorate adhere to the dutch guideline on prevention of iatrogenic hepatitis b. in conclusion , the exact residual risk probably is low , but remains unknown . the level of hbv viremia in the health care workers who continued to perform epps while being monitored varied considerably from person to person .
if the european consensus threshold level ( 10,000 hbv dna copies / ml ) would have been applied in the netherlands , the number of restricted workers would have doubled .
application of the british threshold level ( 1000 copies / ml ) would have nearly tripled the number of restrictions ( see table 2 ) .
unfortunately , it remains unknown how these different threshold values affect the safety of patients , as no follow - up takes place of patients undergoing epps by hbv - infected personnel . during
the last decade inhibitors of hbv polymerase gradually became available for treatment of chronic hbv infection .
lamivudine and adefovir were approved by the federal drug administration in 1998 and 2002 , and received marketing authorization for the european union in 1999 and 2003 .
unfortunately , these early hbv inhibitors frequently cause the emergence of drug - resistant hbv variants [ 8 , 9 ] .
hence , in the first years of the committee 's existence , long - term medically maintained suppression of hbv replication did not seem a solution for highly viremic , epp performing personnel .
more recent hbv inhibitors like entecavir and tenofovir display a much more favourable resistance profile [ 10 , 11 ] .
buster et al . have shown that prolonged antiviral therapy for hbv - infected health care workers is a viable option instead of work restriction , provided that the level of hbv dna is monitored regularly .
indeed in five cases the ban on epps could be lifted , because of successful suppression of hbv .
more cases are expected to follow . nevertheless , it remains questionable whether highly viremic dentistry students and surgeons in training should rely on long - term antiviral medication .
the future will tell whether a switch to a non - exposure prone profession would have been wiser . | in response to the confirmed transmission of hepatitis b virus ( hbv ) from a surgeon to several patients in the netherlands , a committee for prevention of iatrogenic hepatitis b was established in 2000 . during the years 20002008
, the committee reviewed 99 cases of hbv - infected health care workers .
fifty of them were found to perform exposure prone procedures ( epps ) .
because of high levels of hbv dna ( > 100,000 copies / ml ) , a ban on performing epps was applied in 11/50 cases ; 25/50 low - viremic health care workers were allowed to continue epps while their hbv load was being monitored ; and 14/50 cases had stopped working or changed profession . in five restricted workers who started oral antiviral treatment , hbv replication was persistently suppressed , enabling the ban on epps to be lifted . throughout the european union different levels of hbv viremia have been chosen , above which health care workers are not allowed to perform epps .
it remains unknown how this affects the safety of patients .
application in the netherlands of a european or a british guideline would have , respectively , doubled or tripled the number of restricted health care workers . |
contrast induced nephropathy ( cin ) is one of the most common complications after radiographic procedures using intravascular radiocontrast media .
cin after percutaneous coronary intervention ( pci ) is common ( 5 - 50% according to characteristics of patients ) and is associated with increased rate of morbidity and mortality , chronic renal problems and longer duration of hospitalization .
cin is more likely in patients with baseline renal insufficiency , diabetes mellitus , volume of contrast used , congestive heart failure , older ages and administration of nephrotoxic drugs .
the incidence of cin is decreasing because of more risk prevention and better contrast media , but according to the increases in the number of patients undergoing pci , the cin cases are increasing .
pathophysiology of cin is not well - known but some mechanisms including medullary ischemic damages , inflammation , production of oxygen free radicals and direct nephrotoxicity are mentioned .
several strategies have been studied to reduce cin including intravenous hydration , low and iso - osmolar contrast , hemofiltration , using n - acetylcysteine ( nac ) , dopamine , ascorbic acid , furosemide , mannitol and etc . but none of them are reported to be completely useful .
hydroxymethylglutaryl coenzyme a reductase inhibitors ( statins ) are reported to be effective on improvement of renal function and have an effect in the prevention of cin .
statins have positive effects on endothelial function , reduce oxidative stress and increase nitric oxide production .
different studies have been done on the effect of statins in the prevention of cin , but there are controversy results .
a meta - analysis conducted by zhang et al . was no conclusive for cin preventive effect of statins before contrast exposure and more studies with larger sample sizes and better designed was recommended . on
the study in iran showed that short term high dose statin use before contrast injection is associated with an increase in glomerular filtration rate ( gfr ) in comparison to control the group .
as an effect of statin use before the angiography to prevent cin is not well - known , the aim of the current study was to assess the effect of atorvastatin on prevention of cin in patients undergoing coronary angiography .
this study was a double blinded placebo controlled clinical trial conducted on a random sample of patients with chronic stable angina who were referred to shahid - chamran hospital of isfahan , iran to be undergone coronary angiography in 2013 .
the inclusion criteria were ; ( a ) having chronic stable angina who were referred for coronary angiography , ( b ) non - pregnant female subjects , ( c ) no history of the following ; diabetes mellitus , renal failure , single kidney , cardiogenic shock , unstable angina , myocardial infarction , hypersensitivity to statins , previous intravascular contrast injection during 1 month before admission .
patients were excluded according to the following criteria ; ( a ) patients with gfr < 60 , ( b ) patients with cardiogenic shock during the study and ( c ) patients who had a significant lesion and underwent pci in addition to angiography .
sample size was calculated using the estimation of differences in cin incidence rate between two groups from 15% to 2% , 95% confidence interval with 80% power .
the study was approved by the ethical committee of the isfahan university of medical sciences and is registered at clinicaltrials.gov , number nct02113540 .
an informed consent was obtained from all participants . according to the table of random numbers
also , a group of patients who were taking atorvastatin before entering the study were selected as a third group to compare the effect of long term and pre operation taking of atorvastatin .
all the participants were asked not to take non - steroidal anti - inflammatory drugs 48 h before and after the angiography .
furthermore , the subjects were asked not to use metformin by starting the angiography till 48 h after the procedures .
for all patients 30 - 40 cc , a nonionic , iso - osmolar ( 290 mosm / kg ) , visipaque ( iodixanole ) 320 mg / dl was used in all interventions .
patients were hydrated with 1 ml / kg h of isotonic saline solution 12 h before and after the contrast injection .
patients in the intervention group received 80 mg oral atorvastatin ( two 40 mg tablets , darou pakhsh pharmaceutical co. , tehran , iran ) 12 h before contrast injection .
the placebo group was treated as the intervention group with placebo similar to the atorvastatin ( produced in faculty of pharmacy , isfahan university of medical sciences ) .
demographic characteristics of the participants including age , sex , history of other diseases such as hypertension and ischemic heart disorders and also drug history of the subjects were recorded .
all participants were examined for height and weight . body mass index ( bmi ) was regarded as a weight divided by height squared ( kg / m ) .
all measurements were performed with the same tool . for the measurement of serum creatinine ( scr ) ,
gfr was calculated with chronic kidney disease epidemiology collaboration equation as the following ; gfr = 141 min ( scr/ , 1 ) max ( scr/ , 1 ) 0.993 1.018 [ if female ] 1.159 [ if black ] .
scr , is 0.7 for females and 0.9 for males , is 0.329 for females and 0.411 for males , min indicates the minimum of scr/ or 1 , and max indicates the maximum of scr/ or 1 .
cin was defined as an increase in post - procedural scr of > 0.5 mg / dl or > 25% from baseline in the absence of any other causes .
statistical analysis was performed using spss for windows ( version 16.0 , 2007 , spss inc . ,
chicago , il , usa ) . the paired t - test and analysis of variance ( anova ) followed by a post - hoc multiple comparisons and analysis of covariance ( ancova ) ( for continuous variable ) and chi - square test ( for categorical variables ) were used to compare variables . to test the normality of distributions ,
all the values are given as mean standard error mean ( mean se ) or numbers ( % ) .
this study was a double blinded placebo controlled clinical trial conducted on a random sample of patients with chronic stable angina who were referred to shahid - chamran hospital of isfahan , iran to be undergone coronary angiography in 2013 .
the inclusion criteria were ; ( a ) having chronic stable angina who were referred for coronary angiography , ( b ) non - pregnant female subjects , ( c ) no history of the following ; diabetes mellitus , renal failure , single kidney , cardiogenic shock , unstable angina , myocardial infarction , hypersensitivity to statins , previous intravascular contrast injection during 1 month before admission .
patients were excluded according to the following criteria ; ( a ) patients with gfr < 60 , ( b ) patients with cardiogenic shock during the study and ( c ) patients who had a significant lesion and underwent pci in addition to angiography .
sample size was calculated using the estimation of differences in cin incidence rate between two groups from 15% to 2% , 95% confidence interval with 80% power .
the study was approved by the ethical committee of the isfahan university of medical sciences and is registered at clinicaltrials.gov , number nct02113540 .
according to the table of random numbers , participants were divided into two groups of placebo and statin .
also , a group of patients who were taking atorvastatin before entering the study were selected as a third group to compare the effect of long term and pre operation taking of atorvastatin .
all the participants were asked not to take non - steroidal anti - inflammatory drugs 48 h before and after the angiography .
furthermore , the subjects were asked not to use metformin by starting the angiography till 48 h after the procedures .
for all patients 30 - 40 cc , a nonionic , iso - osmolar ( 290 mosm / kg ) , visipaque ( iodixanole ) 320 mg / dl was used in all interventions .
patients were hydrated with 1 ml / kg h of isotonic saline solution 12 h before and after the contrast injection .
patients in the intervention group received 80 mg oral atorvastatin ( two 40 mg tablets , darou pakhsh pharmaceutical co. , tehran , iran ) 12 h before contrast injection .
the placebo group was treated as the intervention group with placebo similar to the atorvastatin ( produced in faculty of pharmacy , isfahan university of medical sciences ) .
demographic characteristics of the participants including age , sex , history of other diseases such as hypertension and ischemic heart disorders and also drug history of the subjects were recorded .
body mass index ( bmi ) was regarded as a weight divided by height squared ( kg / m ) .
all measurements were performed with the same tool . for the measurement of serum creatinine ( scr ) ,
gfr was calculated with chronic kidney disease epidemiology collaboration equation as the following ; gfr = 141 min ( scr/ , 1 ) max ( scr/ , 1 ) 0.993 1.018 [ if female ] 1.159 [ if black ] .
scr , is 0.7 for females and 0.9 for males , is 0.329 for females and 0.411 for males , min indicates the minimum of scr/ or 1 , and max indicates the maximum of scr/ or 1 .
cin was defined as an increase in post - procedural scr of > 0.5 mg / dl or > 25% from baseline in the absence of any other causes .
statistical analysis was performed using spss for windows ( version 16.0 , 2007 , spss inc . ,
chicago , il , usa ) . the paired t - test and analysis of variance ( anova ) followed by a post - hoc multiple comparisons and analysis of covariance ( ancova ) ( for continuous variable ) and chi - square test ( for categorical variables ) were used to compare variables . to test the normality of distributions ,
all the values are given as mean standard error mean ( mean se ) or numbers ( % ) .
252 patients were excluded as they had a positive history of diabetes mellitus , renal failure , myocardial infarction , unstable angina and single kidney .
finally , three groups of 100 individuals were involved in the current study [ figure 1 , consort flow diagram ] .
mean age of the participants was 60.06 0.69 years and 276 ( 92% ) were male .
there were no significant differences between three groups for mean age and distribution of sex ( p = 0.921 and 0.554 respectively ) [ table 1 ] .
also , table 1 is reporting the comparison of mean height , weight , bmi and fbs between three groups of the study .
no significant differences were observed for height and fbs comparisons ( p = 0.840 and 0.055 respectively ) .
however , differences were statistically significant for weight and bmi ( p = 0.002 and 0.001 respectively ) .
post - hoc analysis showed that long term statin group had significantly higher bmi ( p = 0.007 and 0.005 for comparing with pre - operation statin and placebo groups respectively ) and weight ( p = 0.010 and 0.009 for comparing with pre - operation statin and placebo groups respectively ) in comparison to the other two groups .
comparison of demographic and baseline characteristics of the three groups of the study the incidence of cin in all participants was 1.3% ( 4 individuals ) .
the incidence of cin was 1% , 2% and 1% in pre - operation atorvastatin , placebo and long term statin groups respectively ( p = 0.776 ) . according to table 2 , there were no significant differences between three groups in mean scr level and gfr before ( p = 0.387 and 0.650 respectively ) and after ( p = 0.674 and 0.637 respectively ) the procedure .
scr level change was significantly different between three groups according to anova test ( 0.041 ) .
the difference was shown between group with high dose short term atorvastatin and placebo group ( p = 0.033 ) .
the differences of cr changes were not statistically significant between high dose pre operation atorvastatin group and long term statin groups ( p = 0.295 ) and also between placebo and long term statin groups ( p = 0.554 ) .
gfr change was significantly different between groups according to anova test ( p = 0.026 ) .
post - hoc analysis showed that the only difference of gfr changes between pre - operation high dose atorvastatin and placebo groups was statistically significant ( p = 0.019 ) .
the differences of gfr changes were not statistically significant between high dose pre - operation atorvastatin group and long term statin group ( p = 0.416 ) and also between placebo and long term statin group ( p = 0.507 ) .
comparison of each group before and after the procedure showed that in pre - operation atorvastatin group , cr decreased and gfr increased significantly ( p = 0.019 and 0.007 respectively ) but in two other groups there were no significant differences before and after the procedure for serum cr level and gfr ( p > 0.05 ) .
test of normality showed that cr and gfr changes were not normally distributed ( p < 0.05 ) but according to a large sample size ( more than 30 ) , ancova test was used .
results showed that scr and gfr changes between the groups had statistically significant differences ( p = 0.046 and 0.01 respectively ) when adjusted for the covariates of bmi and fbs .
comparison of serum creatinine level and gfr before and after angiography between three groups of the study
different studies have been done on the effect of statins in the prevention of cin , but there are controversy results and the data are not conclusive to prove the preventive effect of statins .
so the aim of the current study was to assess the effect of atorvastatin on prevention of cin in patients undergoing coronary angiography .
our result could nt show any association between pre operation atorvastatin and also long term use of statins and prevention of cin .
the incidence of cin in the current study was 1% in both pre operation and long term statins groups and 2% in the placebo group .
in addition , our results showed that taking 80 mg atorvastatin ( high dose ) 12 h before the angiography was associated with a significant decrease in scr level and also a significant increase in gfr after the procedure .
but long term statin use and also placebo consumption did not show the mentioned effect .
different studies have reported different incidence of cin . a study conducted by jo et al . on patients with baseline renal insufficiency revealed that the incidence of cin was 2.5% in patients treated by short term high dose of simvastatin and 3.4% in placebo group and the difference was not statistically significant .
they have mentioned that they have enrolled patients with normal or mildly impaired renal function ad it can be the reason of the lower incidence of cin .
also they have mentioned that short term use of statins may not be enough to develop the anti - oxidant effect of the drug . also , more following was suggested in that study .
another study has reported that 3.3% in the atorvastatin group ( short term high dose use ) and 10% in the control group developed cin , and the difference was not significant . but
similar to our results they have reported that the baseline cr and gfr levels were similar before the study and after the procedure a significant cr decrease and gfr increase in the atorvastatin group were shown .
toso et al . in their study concluded that short term administration of high dose atorvastatin before and after the contrast injection is not effective on reduction of cin . in that study , all patients received nac , and it was a mentioned limitation of the study by the authors .
furthermore , larger sample size and longer period of follow - up are recommended in that study .
some factors including renal dysfunction , diabetes , congestive heart failure , older age and using nephrotoxic drugs are associated with a higher incidence of cin .
we excluded patients with renal dysfunction and diabetes mellitus , and this can be the reason of the lower incidence of cin in our study compared with previous studies . also in our study patients with pci were excluded . in pci , more contrast media than angiography is used , and higher incidence of cin is expected .
some other studies have reported the same results like our study and have reported that pre - operation statin use is not associated with prevention of cin .
patient undergoing pci showed that pre - operation statin use is associated with lower incidence of cin ( 4.37 vs. 5.93 ) in comparison to no statin use group .
also , another study showed that pre pci statin use was associated with a lower incidence of cin and better cr clearance .
reported that prophylactic use of statins is associated with better scr levels and lower incidence of cin . a previous study in iran conducted by sanadgol et al .
was conclusive that short term high dose simvastatin before contrast exposure is associated with less cin .
but in that study incidence of cin is not reported , and only gfr changes are evaluated .
that study only revealed the increase of gfr after statin therapy in comparison to control the group . according to our results ,
the effect of long term use of satins was similar to placebo and had lower effects on scr level and gfr in comparison to pre - operation high dose atorvastatin use . a study conducted by xinwei et al
. showed that higher doses ( 80 mg vs. 20 mg ) of simvastatin was more effective on decrease of scr level and increase of cr clearance after the pci . a meta - analysis conducted by zhang et al .
was no conclusive for cin preventive effect of statins before contrast exposure and more studies with larger sample sizes and better designed was recommended . but
. showed different conclusion and they have reported that statin use is associated with a significant reduction of cin in patient undergoing coronary angiography . according to these results and results of the current study , more well - designed studies with larger sample sizes are recommended .
the small sample size could be a limitation of this study . although the sampling was random but finally , most of the participants were male which may another limitation of this study . also , we excluded the patients with renal dysfunction , diabetes and congestive heart failure . including these patients and evaluating them separately will provide more information .
llonger duration of follow - up of the patients may provide more results and better conclusions .
the small sample size could be a limitation of this study . although the sampling was random but finally , most of the participants were male which may another limitation of this study . also , we excluded the patients with renal dysfunction , diabetes and congestive heart failure . including these patients and evaluating them separately
llonger duration of follow - up of the patients may provide more results and better conclusions .
in conclusion , our results did nt reveal any association between pre - angiography high dose atorvastatin and also long term statin use and prevention of cin .
but our results showed that pre operation short term high dose atorvastatin use is associated with a significant decrease in scr level and increase in gfr after the procedure .
pb contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work as a first author .
fr contributed in the conception of the work , drafting and revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work as a supervisor .
hs contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work as a supervisor .
zph contributed in the conception of the work , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work as a nephrologist consultant .
ag contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
mm contributed in the conception of the work , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
ah contributed in the conception of the work , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
bp contributed in the design of the work , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
mmb contributed in the design of the work , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
mg contributed in the conception and design of the work , drafting and revising the draft and accumulating data .
ma contributed in the design of the work , revising the draft approval of the final version of the manuscript , and agreed for all aspects of the work .
as contributed in analysing data and designing tables and consort flow diagram as a statistics consultant . | background : contrast induced nephropathy ( cin ) is one of the most common complications after radiographic procedures using intravascular radiocontrast media .
the aim of the current study was to assess the effect of atorvastatin on prevention of cin in patients undergoing coronary angiography.materials and methods : in a clinical trial study , 200 patients referred for angiography were randomly divided into two groups of using 80 mg atorvastatin and placebo before the procedure .
furthermore , 100 patients who were under chronic treatment of statins were included as the third group .
serum creatinine ( scr ) levels before and after the procedure were evaluated and incidence of cin ( post - procedural scr of > 0.5 mg / dl or > 25% from baseline ) was assessed.results:mean age of the participants was 60.06 0.69 years and 276 ( 92% ) were male .
there were no significant differences between group with respect to age and gender . in pre - operation atorvastatin ,
placebo and long term statin groups , the incidence of cin was 1% , 2% and 1% , and mean changes of glomerular filtration rate ( gfr ) was 3.68 1.32 , 0.77 1.21 and 1.37 0.86 ; and mean changes of creatinine ( cr ) was 0.05 0.02 , 0.02 0.02 and 0.01 0.01 respectively .
( p = 0.776 , 0.026 and 0.041 respectively ) . in pre - operation atorvastatin group , cr decreased , and gfr increased significantly ( p = 0.019 and 0.007 respectively).conclusion : pre - operation short term high dose atorvastatin use was associated with a significant decrease in serum cr level and increase in gfr after angiography . |
food access is defined as having sufficient resources to obtain appropriate foods for a nutritious diet and is one dimension of food security ( defined as including both physical and economic access to food that meets people 's dietary needs as well as their food preferences ) .
difficulty accessing food may negatively affect the nutritional status and health outcomes , especially in older adults [ 4 , 5 ] .
accessing food is a complex process requiring a location to access food , adequate financial and transportation resources , and the cognitive ability to plan and carry out accessing food .
older adults and adults with a disability may have more difficulty accessing food due to physical limitations , inability to drive , financial limitations , and environmental limitations , among other factors .
physical limitations are more common in older age : in 2009 , 38.4% of adults 65 years reported physical limitations ( difficulty in stooping , lifting , reaching , grasping , or walking , but no limitations in carrying out activities of daily living or instrumental activities of daily living ) , and 60.8% of community - dwelling adults 65 years in 2010 reported difficulty with at least one basic action ( defined as movement , emotional , sensory [ seeing or hearing ] , or cognitive ) .
lower income is also more common in older age and in adults with disability . as these physical and financial limitations increase , environmental limitations may be more difficult to overcome .
available transportation is another important factor for food access , especially considering that reliance on cars is high in the u.s .
[ 7 , 11 , 12 ] ; adults may be less likely to drive with increasing age due to disability and cost .
an australian study reported that lack of car access was a barrier to accessing food , and that older adults were more likely to lack car access .
another study of 16 australian adults reported that they most commonly walked to food shops , but also used several other transportation modes . the built environment ( human - made structures , e.g. , buildings , roads , etc . ) of potential food access destinations may also impair the ability of older adults and adults with mobility disabilities to access food .
one study of grocery and convenience stores in chicago found that while 63% of stores had an accessible entrance , none of the stores met all accessibility criteria . while transportation and accessibility are key concepts in food access research , the perceptions of these characteristics are not well described . to date , there are few studies that explore how the built environment impacts the ability of adults with a mobility disability to access food .
we hypothesize that midlife and older adults with a mobility disability may face difficulty in accessing food .
the purposes of this study were to ( 1 ) increase understanding of where midlife and older adults with a mobility disability access food ; ( 2 ) how they travel to food access destinations ; ( 3 ) facilitators and barriers ( including built environment ) to accessing food .
we undertook a qualitative study using interviews of adults aged 50 years with a mobility disability ( defined as requiring an assistive device for mobility ) .
qualitative methods were used due to the lack of available studies about how this population perceives the built environment and to obtain robust descriptions of facilitators and barriers to accessing food .
the built environment , accessibility , and mobility study ( beams ) was a pilot study conducted from october 2010 through september 2011 in king county , washington , usa .
the primary goal of beams was to better understand built environment facilitators and barriers to physical activity in midlife and older adults with mobility disability by obtaining their perspectives .
two sets of questions were also asked about utilitarian activities for goods and services , including food destinations .
we conducted a qualitative study utilizing in - depth individual interviews in addition to obtaining participant travel information from global positioning system ( gps ) devices .
we chose interviews as the best method to obtain detailed information from study participants about their perceptions of the built environment , since there are few published studies about this topic .
study eligibility criteria were as follows : age 50 years , use an assistive device for mobility , leave home 3 days / week , reside in king county , washington , speak and read english , and allow study researchers to visit their residence .
our target study enrollment was 2540 participants with the goal of reaching theme saturation ( i.e. , no additional new themes or concepts are generated from additional participant interviews ) .
participants were purposefully recruited through study announcements in relevant organizational e - newsletters ( e.g. , senior center newsletters , arthritis foundation ) , as well as flyers distributed at senior centers , community events and other locations where older adults meet . additionally , we recruited participants with a range of disability types , who used different assistive devices , and resided in diverse types of neighborhoods ( e.g. , walkability , income ) in order to obtain a variety of perspectives .
individuals who were interested in the study , met eligibility criteria , and gave verbal consent to participate were mailed a written consent form , gps device ( qstarz bt - q1000xt , qstarz international co. , ltd . ,
taipei , taiwan ) , gps instructions for use , and a prepaid return envelope .
participants wore a gps device for 3 days ( 2 weekdays and 1 weekend day ) prior to their interview to acquire objective information about where participants travelled to destinations .
the home interview was conducted after the signed consent form and gps device were returned by mail .
prior to the interview , study researchers printed color maps from the gps device to serve as interview prompts .
one researcher interviewed the participant , while the other researcher took detailed notes using a laptop computer .
the interviewer was in the participant 's direct sight line , while the researcher taking notes sat to the side .
interviewers had a bachelor 's degree or higher in a health - related field ( e.g. , nursing , clinical psychology ) and underwent a minimum of 5 hours of training , which included practicing with the interview protocol , conducting a formal practice interview with observation and feedback from the principal investigators ( d. e. rosenberg , b. belza ) , and observing one of the primary investigators conduct an interview .
the note takers were trained to use an excel template in which they could quickly and easily fill in responses to each item of the interview guide .
this training included being observed and provided with feedback during at least one - structured - practice interview session . the interview protocol consisted of open - ended questions about facilitators and barriers to ( 1 ) accessing and using destinations while using the gps device ( up to 3 locations were discussed ) ; ( 2 ) accessing utilitarian locations ( e.g. , grocery stores , shops ) in the neighborhood ( up to 10 locations discussed ) ; ( 3 ) use of indoor and outdoor physical activity locations in the neighborhood ( interview protocol available upon request from d.r . ) .
in addition to assessing barriers and facilitators , we asked participants what transportation mode they used to travel to each location visited while wearing the gps device . immediately upon completion of the interview , the two study researchers who conducted the home visit debriefed about the interview and each confirmed the interview notes ' content and accuracy .
additional participant demographic and background data collected with a self - reported , written survey were age , race / ethnicity , checklist of health conditions , and checklist of assistive devices used .
census 2000 data were used to determine median household income at the census tract level .
( census tracts are small statistical subdivisions of counties with 2,5008,000 persons , which are designed to be homogeneous with respect to population characteristics , economic status , and living conditions . ) .
walkability is a measure of how easy it is to walk and live in an area .
walkscore may be used to estimate proximity to walkable destinations ; scores range from 0 to 100 with higher scores signifying greater walkability . the u.s .
department of agriculture 's food desert locator was used to determine whether any study participants lived in food deserts .
food deserts are defined as a low - income census tract [ poverty rate 20% or median family income 80% of area 's median family income ] where a substantial number or share of residents has low access to a supermarket or large grocery store [ 500 people and/or 33% of census tract 's population resides > 1 mile from a supermarket or large grocery store ] . for the purpose of this study ,
content analysis ( i.e. , analyzing themes and concepts ) was used to develop a start list of codes using an inductive reasoning approach after review of the interview notes .
codes pertained to participants ' reports of where they accessed food outside their home , how they travelled to food access destinations , their reasons for visiting food access destinations , and their perceptions of the indoor built environment at food access destinations .
two study researchers ( d. l. huang , d. e. rosenberg ) reviewed the start list of codes and achieved consensus .
as new themes were introduced by participants , codes were further refined during coding using both inductive and deductive reasoning approaches .
an audit trail tracking the decision - making process was kept throughout the coding process .
coding was performed by two study team members ( d. l. huang , d. e. rosenberg ) and results were discussed to determine consensus for final coding .
descriptive analyses of demographic data and assistive device use were performed using spss version 19 ( ibm , armonk , ny , usa ) .
participants had a mean age of 66.8 years , were predominantly female and caucasian , and used a variety of mobility assistive devices ( some participants used more than one assistive device ) .
two participants lived in food deserts , and four participants lived in retirement facilities that provided food on - site in a dining room .
these facilities were not counted as an out - of - home location or place to obtain food for home consumption .
grocery stores were the most commonly accessed out - of - home food location by study participants .
participants also visited food banks , warehouse stores , farmers markets , convenience stores , corner stores , and drugstores to obtain food ( see figure 1 for the number of participants who reported going to various types of food locations ) .
destinations accessed for food consumed outside the home included restaurants ( both full - service and fast food ) , cafs / coffee shops , senior centers , and shopping malls .
participants who lived in facilities that provided on - site meals also accessed food outside the home at locations such as grocery stores and restaurants .
three participants reported that family members regularly brought food to their homes ( e.g. , family purchased groceries for participant ) .
transportation used by participants included active ( e.g. , walking ) and passive ( e.g. , using a motorized chair or scooter , paratransit ) modes to access food locations ( figure 1 ) . the majority of participants reported using one transportation mode , but others reported using 2 or more modes of transportation to access food . these participants used combinations of walking , public transit , paratransit , rides from friends or family , and vans or shuttle services provided either by their residence or an organization ( e.g. , senior center ) .
reasons for visiting ( or not visiting ) food access destinations were categorized into three major themes : destination factors , participant factors , and outdoor built environment ( table 2 ) .
barriers to accessing food destinations included all three themes ; facilitators to access included destination and participant factors .
some participants reported visiting food destinations because of their proximity to other locations with goods and services , such as drugstores and banks .
cost was another common subtheme of destination factors : participants chose where they shopped for groceries and ate meals outside the home ( e.g. , restaurants , senior centers ) based on cost .
subthemes included participants ' preference for certain stores , usually based on product availability and selection .
some participants also reported going to food access destinations in order to socialize and stay active .
outdoor built environment characteristics were primarily perceived as ( 1 ) barriers to accessing certain food destinations and ( 2 ) transportation barriers to food destinations .
these included lack of sidewalks , obstructed roads ( e.g. , parked vehicles , construction ) , hills and lack of public transit to food destinations .
four themes emerged as key facilitators and barriers for visiting food access locations ( table 3 ) .
these included ( 1 ) space , ( 2 ) entry / accessibility , ( 3 ) amenities , ( 4 ) people .
this theme included participants ' general perceptions of ( a ) adequacy of space to carry out their intended activity ( e.g. , grocery shopping , drinking coffee at a coffee shop ) while using a mobility assistive device , ( b ) ease or difficulty navigating the destination , and ( c ) general destination features .
participants reported that wide , unobstructed aisles facilitated shopping in grocery stores , while a common barrier was narrow aisles .
obstructed aisles , including displays in aisles and other shoppers ' carts , were also commonly reported barriers to navigating grocery stores .
additional facilitators to navigating food destinations included elevators to access different floors , no stairs ( destination on a single level ) , and stable product layouts .
built environment barriers to navigating destinations included escalators or stairs to access different floors , small elevators , changes in product layouts ( e.g. , items periodically moved to different locations in store ) , a large number of store aisles , and poor signage .
general features that participants reported to be facilitators included clean flooring ( slippery or uneven flooring were barriers ) , adequate light , and whether the destination followed the american with disabilities act standards for accessible design .
facilitators were automatic doors , lightweight doors , entries that were conveniently located , flat , at street level , and without an entry ramp or stairs .
barriers were heavy doors , doors that opened outward , two sets of entry doors , raised thresholds and door mats , poorly located entries , and the presence of stairs .
one participant reported that an entry ramp was a barrier , because it was difficult to simultaneously open the entry door and control her assistive device on the ramp . a number of participants reported using shopping carts as an assistive device for support and mobility in stores .
participants also stated that the availability of electric shopping carts was a facilitator to food shopping and the lack of these carts was a barrier .
participants reported availability of seating and accessible restrooms as facilitators for accessing and utilizing food destinations .
seat height ( which affects the ability to sit down and rise from seating ) and space to sit with an assistive device were subthemes .
accessible restrooms with adequate space and doors that were easy to open were facilitators for use .
one participant specifically mentioned poor placement of grab bars affected his ability to transfer to and from the toilet , as well as urinals not designed for those using wheelchairs .
the major theme was quality of service given by food access destination staff / employees .
poor or suboptimal service was reported by a few participants , though typically not at grocery stores : one participant reported rude volunteers at a food bank .
examples of suboptimal service included long waiting times for service and unavailability of table service .
one participant mentioned avoiding certain food destinations because table service was not available ; she preferred going to destinations with table service due to difficulty carrying food to a table while using an assistive device .
good service was a facilitator reported by several participants , which included destination staff / employees , and paratransit and shuttle service drivers .
examples of good service included assistance with bringing groceries to the participant 's vehicle , reaching items on high shelves , and opening doors .
another theme noted was having helpful family , friends , or caregivers to access food destinations ( facilitator ) ; inattentive fellow customers were a barrier .
midlife and older adults with mobility disability in our study accessed a variety of food destinations and utilized several different modes of transportation to these destinations .
many participants accessed more than one type of food destination and used more than one transportation mode .
this included participants who lived in facilities that provided on - site meals ; these participants also obtained groceries from facility field trips to grocery stores or from family members who brought groceries to their home .
additionally , many of those who accessed grocery stores reported going to more than one store .
this demonstrates how our study participants adapted to carrying out these instrumental activities of daily living ( shopping and transportation ) , despite their mobility and transportation limitations . while most participants used passive forms of transport ( e.g. , by automobile ) to food destinations ,
this indicates that having food locations in proximity to where older adults live can promote physical activity as well as food access among people with mobility disabilities .
an interesting concept that was not fully captured in these interviews was the amount of time some participants spent accessing food .
for example , some participants reported devoting a certain day of the week to obtain food ; one participant reported regularly visiting more than one food bank .
interestingly , some participants reported accessing food in combination with carrying out other utilitarian activities such as going to the bank or to the doctor .
one participant reported that she preferred to visit the grocery stores near a senior center ( not in her neighborhood ) , because it was close to several other locations with goods and services .
the two participants who lived in food deserts also spoke about the importance of location and proximity of food access destinations .
cost was another important factor for study participants in determining where they chose to access food .
this is not surprising given that older adults are more likely to have a fixed income .
some participants also reported travelling farther from their residence to access food at a lower - cost destination .
preference for certain food access destinations was also important , but location , proximity , and cost seemed to carry greater weight in where our study participants chose to access food .
the perceived indoor built environment barriers and facilitators pertained to adequate space , ease of accessing multiple levels at destinations , ease of entry , and available amenities at food access destinations .
door features were frequently noted by our study participants , particularly doors that were difficult to open due to heavy weight and location ( e.g. , located at top of entry ramp ) .
an interesting nonbuilt environment finding was the impact of helpful people on accessing food destinations .
additionally , participants liked the extra help they received from paratransit and shuttle / van drivers .
for example , one participant reported that the van driver for a senior center carried her groceries from the store to the van and from the van to her home .
a limitation of our study was that we did not audio record and transcribe the interviews due to participant concerns .
early in the recruitment process , our target population voiced concerns about being audio recorded .
many participants received government assistance for housing and transportation , and were concerned about the potential implications of being audio recorded for receiving these benefits .
however , the credibility of our findings was enhanced by our training procedures for both interviewing and taking interview notes . in addition , the coders achieved consensus during the coding process even with their differing levels of interview involvement ( d.h . was not involved in participant interviews , d. e. rosenberg either conducted or took notes for approximately one - third of the interviews ) and their different disciplinary backgrounds ( geriatric medicine , clinical psychology , and public health ) .
an additional limitation of this study was that beams ' primary focus was to understand the impact of built environment on physical activity , though participants were interviewed about utilitarian activities ( including food access ) .
this likely influenced the depth of participant responses about food access , though accessing food was a topic initiated by many of our study participants . however , accessing food was one of the most important utilitarian activities that our participants needed to accomplish , and food locations were the most common destination visited while participants wore the gps device .
this finding must be cautiously interpreted given that 3 days is a relatively short time period to monitor mobility , but it illustrates the importance of addressing food access among this population of midlife and older adults with mobility disabilities .
other limitations of the study include that we specifically recruited participants who leave their homes at least 3 days per week , so we did not obtain the perspectives of those who are home - bound and likely face additional challenges to accessing food . additionally , our participants were fairly culturally homogeneous ( predominantly caucasian and female )
. the key strengths of our study are that it provides insightful information about where midlife and older adults with mobility disability accessed food , how they travelled to these destinations , reasons for accessing particular food destinations , and their perceptions of the indoor built environment and other factors at these destinations .
our use of qualitative methods allowed us to obtain information that would be otherwise difficult to capture using other research methods .
our findings are difficult to compare to previous studies , because these studies have not examined the types of destinations older adults with disabilities access for food , or many of the facilitators or barriers to food access .
since there is a lack of previous studies available about this topic , we feel our findings provide useful information .
accessing food is essential to life and can become more difficult with older age and mobility disability .
consideration needs to be given to how our aging population will access food , principally where grocery stores are located and proximity to different modes of transportation ( especially public transit where available ) .
urban planning should particularly consider proximity of food access destinations to other destinations with goods and services , as this may help older adults continue to live independently in the community .
attention to easy pedestrian access ( e.g. , short , well - marked , and protected routes ) would facilitate visiting multiple destinations .
food access destinations should also take into account the needs of this population , especially the need for adequate space and ease of entry while using an assistive device .
future studies should include determining how food access can be better understood and improved in order to prepare for the growing population of adults aging with a mobility disability .
improved understanding of how the types of food destinations relate to caloric intake and diet quality among older adults with mobility disabilities would also be helpful for future research efforts .
overall , further research of maintaining food access for adults aging with mobility disability would ideally impact public policy , urban planning , and businesses to help older adults function and thrive in their communities . | we examined where midlife and older adults with a mobility disability accessed food outside the home in king county , washington , usa , how they travelled to these food destinations , and facilitators and barriers to food access using qualitative interviews .
thirty - five adults aged 50 years with a mobility disability ( defined as use of an assistive device for mobility ) were interviewed .
supplemental objective information was obtained from a global positioning system device worn by participants for 3 days .
participants primarily accessed food at grocery stores , restaurants , and coffee shops / cafs .
the most common transportation modes were walking , obtaining a ride from friends , motorized chair / scooter , and public transit .
location and proximity of food destinations were factors affecting participants ' ability to access these destinations .
adequate space , ease of entry , available amenities such as restrooms , and helpful people were facilitators for participants to access food outside the home . |
after completion of the experiment , students should have a fundamental understanding of weber s law and its applications to tactile stimuli .
they should be able to describe the relationship between the physical intensity of a stimulus and perceived intensity .
. they should be familiar with the operation procedures of the cortical metrics stimulator as well as fundamentals of sensory data collection and analysis .
the cortical metrics cm-4 four - point vibrotactile stimulator ( figure 1 ) was used to conduct the exercise .
it interfaced with a personal computer ( laptop ) through an internal data acquisition box ( daq ) made by national instruments ( ni daq usb-6259 ) .
all computers were networked together to allow centralized data storage in the cortical metrics neurosensory diagnostics database .
this allowed for instant on - line data analysis at the end of the exercise .
one of the subject s hands was placed on the ergonomic armrest , while the other hand was used to press one of two buttons , located on a response device ( mouse ) connected directly to the pc .
one trial consisted of the delivery of two simultaneous vibrotactile stimuli , each through independent probe tips , for the duration of one half of a second .
these stimuli consisted of 25 hz sinusoidal vibrations of the probe tips at protocol - specified amplitudes .
one of the two stimuli , the standard , was delivered at a constant amplitude throughout a run .
the other stimulus , the test , was delivered at amplitudes that were always greater than the amplitude of the standard , but were otherwise varied according to the tracking method used .
the digit locations of both the test and standard stimuli were assigned randomly by the computer .
the subject responded as to which stimulus felt more intense by clicking the left or right button on the response device , assigned respectively to the left or right digit .
a modified bksy method , also known as the staircase or up and down method , was used to track subject performance ( cornsweet , 1962 ) .
the bksy method is an adaptive tracking method in which each test stimulus amplitude depends on both the preceding test stimulus amplitude and the subject s response . in this particular experiment ,
two variations on the bksy method were used . at the beginning of a run ,
tracking was conducted with a bias of one : a correct identification of the greater amplitude stimulus lead to a decrease in the test amplitude by a specified step size and an incorrect answer lead to an increase in test amplitude by the same step size .
later in the run ( after 10 trials ) a bias of two was added to the tracking method ; a subject had to deliver two consecutive correct answers for the test amplitude to decrease by one step size , while one incorrect answer lead to an increase in test amplitude by one step size .
the bias of one for the first ten trials allowed for the subject to track down quickly , while later increasing the bias to two , increases the accuracy of the results of the run by decreasing the effects of good guessing ( tannan et al , 2006 ) .
the method stopped after 20 completed trials . during a run a subject was able to track down to the smallest test amplitude which he / she could consistently differentiate from the standard , that subject s discrimination threshold ( jnd ) . for each run , the test amplitude started at twice the standard amplitude .
the step size at which the test amplitude was increased or decreased was 10% of the standard stimulus ( e.g. , 0.02 mm for a 0.20 mm standard ) .
these settings allowed the test stimulus strength to start out well above the discrimination threshold , but low enough for the subject to track down to his / her jnd within the twenty trials that were administered during the run : experience has shown that most subjects can reach their discrimination threshold within ten to fifteen trials .
the standard amplitudes for each run were as follows : 0.2 , 0.4 , 0.6 , 0.8 mm . maximum and minimum amplitudes were user specified in the protocol so that the stimulator only delivered amplitudes within its proper operating range ( 02 mm ) .
the maximum amplitude was set to 3x the standard , while the minimum amplitude was set to the standard amplitude plus 5um .
for example , for the first test ( 0.2 mm standard and 0.40 mm test ) the minimum amplitude was 0.205 mm .
after each run was completed , the program generated a graph of the test amplitude versus trial number ( figure 2 ) .
it was determined that most subjects reach their discrimination threshold by the last five trials of a test ; therefore the average of the last five test amplitudes is used as the discrimination threshold .
the subject s discrimination threshold was determined for each test , and data was subsequently collected from all students in the class ( n=11 ) .
the difference limen ( dl ) for each subject was determined by subtracting the standard amplitude from its corresponding final test amplitude for each run .
the averages of the dl at each standard amplitude were determined for a sub - group of five students as well as for the entire class .
the students then compared their own dl ( n=1 ) with the average dls for the group of selected sub - group five people ( n=5 ) , as well as the entire class ( n=11 ) .
students compared the three different graphs in order to evaluate the effects of increasing the sample size on experimental results .
students also considered the general form of these graphs and verified that it was in accordance with the linear relationship predicted by weber s law .
the cortical metrics cm-4 four - point vibrotactile stimulator ( figure 1 ) was used to conduct the exercise .
it interfaced with a personal computer ( laptop ) through an internal data acquisition box ( daq ) made by national instruments ( ni daq usb-6259 ) .
all computers were networked together to allow centralized data storage in the cortical metrics neurosensory diagnostics database .
this allowed for instant on - line data analysis at the end of the exercise .
one of the subject s hands was placed on the ergonomic armrest , while the other hand was used to press one of two buttons , located on a response device ( mouse ) connected directly to the pc .
one trial consisted of the delivery of two simultaneous vibrotactile stimuli , each through independent probe tips , for the duration of one half of a second .
these stimuli consisted of 25 hz sinusoidal vibrations of the probe tips at protocol - specified amplitudes .
one of the two stimuli , the standard , was delivered at a constant amplitude throughout a run .
the other stimulus , the test , was delivered at amplitudes that were always greater than the amplitude of the standard , but were otherwise varied according to the tracking method used .
the digit locations of both the test and standard stimuli were assigned randomly by the computer .
the subject responded as to which stimulus felt more intense by clicking the left or right button on the response device , assigned respectively to the left or right digit .
a modified bksy method , also known as the staircase or up and down method , was used to track subject performance ( cornsweet , 1962 ) .
the bksy method is an adaptive tracking method in which each test stimulus amplitude depends on both the preceding test stimulus amplitude and the subject s response . in this particular experiment ,
two variations on the bksy method were used . at the beginning of a run ,
tracking was conducted with a bias of one : a correct identification of the greater amplitude stimulus lead to a decrease in the test amplitude by a specified step size and an incorrect answer lead to an increase in test amplitude by the same step size . later in the run ( after 10 trials )
a bias of two was added to the tracking method ; a subject had to deliver two consecutive correct answers for the test amplitude to decrease by one step size , while one incorrect answer lead to an increase in test amplitude by one step size .
the bias of one for the first ten trials allowed for the subject to track down quickly , while later increasing the bias to two , increases the accuracy of the results of the run by decreasing the effects of good guessing ( tannan et al , 2006 ) .
the method stopped after 20 completed trials . during a run a subject was able to track down to the smallest test amplitude which he / she could consistently differentiate from the standard , that subject s discrimination threshold ( jnd ) . for each run , the test amplitude started at twice the standard amplitude .
the step size at which the test amplitude was increased or decreased was 10% of the standard stimulus ( e.g. , 0.02 mm for a 0.20 mm standard ) .
these settings allowed the test stimulus strength to start out well above the discrimination threshold , but low enough for the subject to track down to his / her jnd within the twenty trials that were administered during the run : experience has shown that most subjects can reach their discrimination threshold within ten to fifteen trials .
the standard amplitudes for each run were as follows : 0.2 , 0.4 , 0.6 , 0.8 mm . maximum and minimum amplitudes were user specified in the protocol so that the stimulator only delivered amplitudes within its proper operating range ( 02 mm ) .
the maximum amplitude was set to 3x the standard , while the minimum amplitude was set to the standard amplitude plus 5um .
for example , for the first test ( 0.2 mm standard and 0.40 mm test ) the minimum amplitude was 0.205 mm .
after each run was completed , the program generated a graph of the test amplitude versus trial number ( figure 2 ) .
it was determined that most subjects reach their discrimination threshold by the last five trials of a test ; therefore the average of the last five test amplitudes is used as the discrimination threshold .
the subject s discrimination threshold was determined for each test , and data was subsequently collected from all students in the class ( n=11 ) .
the difference limen ( dl ) for each subject was determined by subtracting the standard amplitude from its corresponding final test amplitude for each run .
the averages of the dl at each standard amplitude were determined for a sub - group of five students as well as for the entire class .
the students then compared their own dl ( n=1 ) with the average dls for the group of selected sub - group five people ( n=5 ) , as well as the entire class ( n=11 ) .
students compared the three different graphs in order to evaluate the effects of increasing the sample size on experimental results .
students also considered the general form of these graphs and verified that it was in accordance with the linear relationship predicted by weber s law .
a sample plot for the group of 11 students is shown below ( figure 3 ) .
the data we collected from this group of 11 students supported the linear relationship between the difference limen ( s ) and the standard amplitude ( s ) predicted by weber s law , and plotting this data resulted in a nearly linear graph , with a linear correlation coefficient of 0.994 .
the data from the group of five students along with the data from a single individual were still roughly linear , but much less so , with linear correlation coefficients of 0.935 and 0.794 , respectively .
clearly , larger sample sizes gave a better approximation of weber s law than smaller sample sizes .
the exercise was designed to introduce students to weber s law using the cm-4 stimulator as a tool in quantitative testing and measuring of sensory perception .
weber s law was selected as the subject of this lab because it provides an easily understandable concept as well as a simple protocol for students to test .
the cm-4 stimulator was the instrument of choice due to its particular suitability to the task at hand , as well as its versatility , making it a particular valuable research tool to understand .
the cm-4 stimulator has a wide range of applications in the area of tactile sensory testing .
simple protocols and portability not only make it ideal for an undergraduate lab setting but for clinical testing and research as well .
the integrated software makes it possible to execute protocols that can be adjusted and applied without constant human intervention .
the automatic skin detection and programmable test parameters that enable precise control of the amplitude and frequency of stimuli allow for reproducible protocols and reduction of sources of error . by the end of the exercise paper
, students gained a conceptual understanding of weber s law and its application to sensory testing .
students saw the value of larger experimental sample sizes as well as becoming familiar with the fundamentals of tactile sensory data collection and analysis .
the linearity of the collected data is easy to understand , and since linearity in any biological study is rare , we view this result as significant and robust , especially given that it can be collected in a classroom / laboratory setting . to verify that students accomplished the learning objectives laid out in the introduction of this paper , the instructor may elect to distribute a short quiz .
the assessment should be short , and could consist of short - answer questions / problems such as the four below :
define weber s law.provide an example of how weber s law relates to tactile perception.design an experiment to test weber s law.when empirically evaluating a scientific hypothesis , is a large or small sample size preferred ? why ?
when empirically evaluating a scientific hypothesis , is a large or small sample size preferred ?
the exercise was designed to introduce students to weber s law using the cm-4 stimulator as a tool in quantitative testing and measuring of sensory perception .
weber s law was selected as the subject of this lab because it provides an easily understandable concept as well as a simple protocol for students to test .
the cm-4 stimulator was the instrument of choice due to its particular suitability to the task at hand , as well as its versatility , making it a particular valuable research tool to understand .
the cm-4 stimulator has a wide range of applications in the area of tactile sensory testing .
simple protocols and portability not only make it ideal for an undergraduate lab setting but for clinical testing and research as well .
the integrated software makes it possible to execute protocols that can be adjusted and applied without constant human intervention .
the automatic skin detection and programmable test parameters that enable precise control of the amplitude and frequency of stimuli allow for reproducible protocols and reduction of sources of error . by the end of the exercise paper
, students gained a conceptual understanding of weber s law and its application to sensory testing .
students saw the value of larger experimental sample sizes as well as becoming familiar with the fundamentals of tactile sensory data collection and analysis .
the linearity of the collected data is easy to understand , and since linearity in any biological study is rare , we view this result as significant and robust , especially given that it can be collected in a classroom / laboratory setting . to verify that students accomplished the learning objectives laid out in the introduction of this paper , the instructor may elect to distribute a short quiz .
the assessment should be short , and could consist of short - answer questions / problems such as the four below :
define weber s law.provide an example of how weber s law relates to tactile perception.design an experiment to test weber s law.when empirically evaluating a scientific hypothesis , is a large or small sample size preferred ? why ?
when empirically evaluating a scientific hypothesis , is a large or small sample size preferred ? | weber s law describes the relationship between actual and perceived differences in stimulus intensity . to observe the relationship described in this law
, we developed an exercise for undergraduate students , as experiential learning is an integral part of scientific education.we describe the experimental methods used for determining the subject s discriminative capacity at multiple vibrotactile amplitudes .
a novel four - point stimulator ( designed and fabricated at the university of north carolina ) was used for the study .
features of the device , such as automated skin detection , make it feasible to perform this laboratory exercise in a reasonable lab period.at the conclusion of the lab exercise , students will thoroughly understand the principle of weber s law as well as fundamental quantitative sensory testing concepts .
this introduction to sensory testing will provide a suitable foundation for the undergraduate neuroscience student to investigate other aspects of sensory information processing in subsequent lab exercises . |
diabetes mellitus ( dm ) is an endocrine disease characterized by a deficit in the production of insulin with consequent alteration of the process of assimilation , metabolism , and balance of blood glucose concentration .
, the global prevalence of dm has increased substantially , reaching 8.3% in 2014 , which corresponds to 387 million patients . essentially , there are two types of dm : type 1 dm ( t1 dm ) and type 2 dm ( t2 dm ) . t1 dm accounts for approximately 5% of diagnosed diabetes cases .
xerostomia is a subjective complaint of dry mouth , whereas hyposalivation is an objective decreased of salivary flow .
the clinical method most often employed for the diagnosis of salivary dysfunction is a sialometry test .
hyposalivation is considered to appear when salivary flow rates are under 0.1 ml / min at rest ( uws ) or 0.7 ml / min under stimulation ( sws ) .
many cases of xerostomia have been described in patients with a normal salivary flow rate [ 36 ] .
several factors are capable of inducing salivary disorders in dm patients such as ageing , head and neck radiotherapy , systemic disorders , and several drugs .
systemic diseases associated with xerostomia include rheumatologic chronic inflammatory disorders ( sjgren syndrome , rheumatoid arthritis , and systemic lupus erythematosus ) , endocrine disorders ( dm , hyperthyroidism , and hypothyroidism ) , neurologic disorders ( depression and parkinson 's disease ) , genetic disorders , metabolic disorders ( dehydration , bulimia , anaemia , and alcohol abuse ) , infectious disorders ( hiv / aids , hcv infection ) , and others ( fibromyalgia , graft - versus - host - disease , sarcoidosis , and chronic pancreatitis ) .
many cases of xerostomia are also related to psychological conditions like depression and anxiety [ 5 , 6 ] . both types of dm , t1 dm and t2 dm , have been associated previously with xerostomia [ 712 ] .
there are also studies that have showed a decreased salivary flow in dm patients in relation to non - dm patients [ 7 , 8 , 1221 ] .
the reason for these problems could be due to damage to the gland parenchyma , alterations in the microcirculation to the salivary glands , dehydration , and disturbances in glycemic control .
considerable debate exists surrounding the issue , if the presence of xerostomia and hyposalivation is greater in dm than non - dm patients .
given the lack of systematic knowledge , we have conducted the first systematic review concerning the prevalence of xerostomia and hyposalivation in dm ( compared to non - dm ) patients .
we also have analyzed the differences in the rate of salivary flow between dm and non - dm patients .
the main objectives of this review were ( 1 ) to compare the prevalence rates of xerostomia in the dm and non - dm population , ( 2 ) to evaluate the salivary flow rate in the dm and non - dm population , and ( 3 ) to compare the prevalence rates of hyposalivation in the dm and non - dm population .
the systematic review was performed according to the prisma ( preferred reporting items for systematic reviews and meta - analyses ) guidelines .
the addressed focused questions ( pico ) were as follows : ( 1 ) do dm patients have higher xerostomia prevalence than non - dm patients ? ( 2 ) is the salivary flow rate lower in dm patients compared to non - dm patients ? ( 3 ) do dm patients have higher hyposalivation prevalence than non - dm patients ?
pubmed / medline ( national library of medicine , bethesda , maryland ) , scopus , and cochrane database were searched from 1970 until january 18th , 2016 , using different combinations of the following keywords : diabetes ; xerostomia ; dry mouth ; hyposalivation ; and salivary flow .
moreover , we performed an additional handsearch to find potential eligible studies as reference lists of review articles and relevant studies .
full - text articles were included if they met the inclusion criteria with respect to types of studies , types of population , and the main outcome / s regardless of the time period of study and the year of publication .
the studies had to be ( 1 ) original studies , ( 2 ) cross - sectional studies , ( 3 ) comparative studies ( dm group and healthy control group ( cg ) ) , and ( 4 ) only in humans . as we evaluated prevalence rates review articles , experimental studies , longitudinal studies , case - reports , commentaries , and letters to the editor
we also considered other diabetes classifications , namely , insulin - dependent ( iddm ) and non - insulin - dependent dm ( niddm ) .
the total population with dm did not have to suffer specific diseases apart from dm ( e.g. , end - stage renal disease and hypertension ) .
individuals without dm were also considered with the aim of comparing prevalence and flow rates between the dm and non - dm population .
the definitions of xerostomia , quantity of salivary flow rate , and hyposalivation are detailed below .
does your mouth usually feel dry , especially during meals ? does your mouth feel dry when you are eating a meal ?
positive response to one of these questions and the consideration of patient 's subjective feeling of dry mouth were considered to be xerostomia .
different types of salivary flow rate were considered : uws ( nonstimulated salivary flow ) , sws ( stimulated salivary flow ) , usp ( nonstimulated parotid flow ) , ssp ( stimulated parotid flow ) , and sss ( stimulated submandibular / sublingual flow ) .
furthermore , hyposalivation was considered when uws < 0.1 ml / min or sws < 0.7 ml / min , but we included studies that considered hyposalivation when uws < 0.3 ml / min and sws < 0.5 ml / min .
the main outcomes were the prevalence of xerostomia and/or hyposalivation in percentage and/or the quantity of salivary flow rate in ml / min .
they were also excluded if they solely reported prevalence of xerostomia / hyposalivation and salivary flow rates among persons with dm in relation to the total population ( dm and non - dm ) and not exclusively to the diabetic ( possibly compared to the non - dm ) population .
two authors ( rosa mara lpez - pintor and elisabeth casaas ) independently screened all the retrieved titles and abstracts identified through the search strategies to identify potentially eligible articles .
full texts of relevant studies judged by title and abstract were read and independently assessed with reference to the eligibility criteria by two authors ( rosa mara lpez - pintor and jos gonzlez - serrano ) .
data extraction was performed including information about first author , publication year , country , study population , mean age , type of dm , dm diagnosis ( if available ) , definition of xerostomia , definition of hyposalivation ( if available ) , type of flow rate , and data sources of the study . with regard to the results , xerostomia prevalence ( % ) and salivary flow rate ( ml / min ) , as well as hyposalivation prevalence ( % ) of dm and non - dm groups , were extracted .
the reported statistical signification was extracted if it was available . in the final selection of eligible studies , we assessed features that could potentially bias the estimates of xerostomia / flow rate / hyposalivation using the joanna briggs institute prevalence critical appraisal tool ( table 1 ) . using this tool we defined criteria based on clinical and epidemiological expertise and ranked potential sources of bias into low or high risk of bias .
scores of 05 were evaluated as low quality while those of 510 were considered to indicate high quality .
critical appraisal was conducted by two reviewers ( gonzalo hernndez and luca ramrez ) independently of each other .
the reviewers met to discuss the results of their critical appraisal ; if the two reviewers disagreed on the final critical appraisal and could not be resolved through discussion , a third reviewer ( julia serrano ) was required . due to the high heterogeneity of the studies
, we analyzed the outcomes of interest in accordance with the prevalence of xerostomia or salivary quantity flow rate / hyposalivation ( if available ) , type of dm , and age ( adults 19 years old / children and adolescents ) . there were studies that reported xerostomia prevalence and flow rate ; therefore , there could be two groups .
the following categories were the result : ( 1 ) xerostomia studies in adults t2 dm , ( 2 ) xerostomia studies in adults niddm , ( 3 ) xerostomia studies in children and adolescents t1 dm , ( 4 ) salivary flow rate studies in adults t1 dm , ( 5 ) salivary flow rate studies in adults iddm , ( 6 ) salivary flow rate / hyposalivation prevalence studies in adults t2 dm , ( 7 ) salivary flow rate / hyposalivation prevalence studies in children and adolescents t1 dm , and ( 8) salivary flow rate / hyposalivation prevalence studies in children and adolescents iddm . the results of xerostomia prevalence from the included studies were presented as a percentage . the results of quantity salivary flow rate were presented as mean standard deviation ( if available ) .
the age of different populations was presented as mean standard deviation , but there were studies that categorized the age or presented only the mean .
we showed the possible statistical signification if it was available . due to heterogeneity of results
thirty - eight studies , which did not fulfill the eligibility criteria , were excluded ( the appendix ) .
the selection procedure is presented in figure 1 . with regard to the main outcome , 7 papers considered xerostomia prevalence ( table 2 ) , and 12 articles considered quantity of salivary flow rate in dm patients ( table 3 ) , while 4 papers considered both .
only one paper about salivary flow rate in dm population considered hyposalivation prevalence as outcome ( table 3 ) .
the results are presented in two parts , xerostomia studies and salivary flow rate / hyposalivation studies .
therefore , we considered these two studies as one study in table 2 . the majority of studies that reported prevalence of xerostomia in dm patients were performed in adults ( n = 6 ) , 5 studies in t2 dm patients and one in niddm .
one study carried out in adults t2 dm did not show xerostomia prevalence rates , but it was included due to presence in the results of explanation of no significant correlation in xerostomia in dm / cg patients . with respect to the recruitment of patients , three studies had selected their dm patients from an endocrinology service or a diabetic care unit of a specialized medical care or hospital , two from a geriatric center and one ( the two studies realized by sanberg et al .
[ 9 , 10 ] with the same population ) had sourced the dm patients from a register of primary health care .
control patients were selected from oral health centers ( n = 4 ) and geriatric centers ( n = 2 ) . the studies included a minimum of 29 and a maximum of 102 dm patients and 18102 control patients .
only two studies specified the dm diagnosis , one who criteria 2006 ( fasting blood glucose greater 126 mg / dl ) and another one blood glucose levels 140 mg / dl at 2 hours after oral glucose tolerance test .
no one study reported duration of dm and three studies [ 8 , 12 , 18 ] reported the hba1c levels and classified the patients in well controlled dm ( wcdm ) and poorly controlled dm ( pcdm ) .
dm and cg participants were matched by gender in 4 studies , by age in 5 studies , by race distribution in one , by diuretics and antidepressants treatment in one , and by socioeconomic status in another one . with regard to statistical significance , three studies [ 810 , 12 ] found that dm patients had more significant xerostomia prevalence than non - dm patients .
regarding quality assessment all studies obtained scores 5 ; therefore the studies were evaluated as low quality
( table 2 ) . due to the poor quality of the included studies no meta - analysis was performed .
we found 12 studies about quantity of salivary flow rate that met our inclusion criteria ; one of them considered hyposalivation prevalence as outcome ( table 3 ) .
the majority of studies were carried out in adults ( n = 8) , 6 studies in t2 dm patients , one in t1 dm patients , and another one in iddm .
four studies were carried out in children and adolescents , 2 in t1 dm patients and 2 in iddm .
three studies recruited their dm patients from a diabetes care unit of a hospital , 3 from an endocrine unit , 3 from a pediatric endocrinology service , one from a university dental school , one from an oral health study , and another one from community - living / geriatric centers .
non - dm patients came from varied origins : oral health centers ( n = 3 ) , swedish register ( n = 1 ) , healthy volunteers from a hospital staff ( n = 1 ) , members of a university community ( n = 1 ) , patients of a university dental school ( n = 2 ) , and participants in an oral health study of aging ( n = 1 ) , and 3 studies did not specify the origin . the studies included a minimum of 10 and a maximum of 243 dm patients and a minimum of 10 and a maximum of 240 non - dm patients .
five studies specified the dm diagnosis , two who criteria 2006 ( fasting blood glucose 126 mg / dl ) , one modified who criteria 2006 ( fasting blood glucose 126 mg / dl ) or currently taking diabetic medications , one blood glucose levels 140 mg / dl at 2 hours after oral glucose tolerance test , and the last one american diabetes association criteria 2010 ( hba1c levels 6.5% or fasting blood glucose 126 mg / dl ) .
one study reported that dm patients suffered t1 dm since childhood , and there was another study that only included newly diagnosed diabetic children .
with respect to dental condition , one study did not include edentulous patients , one study recruited only patients wearing complete maxillary or maxillary and mandibular dentures , and another one excluded patients using total prostheses and mouth breathers .
four studies [ 8 , 12 , 13 , 18 ] reported the hba1c levels and classified the patients in wcdm and pcdm .
dm and non - dm participants were matched by gender in 7 studies , by age in 6 studies , by race distribution in 2 , by socioeconomic status in 3 , by living in the same area in two , and by tanner puberty states in another one . with regard to the type of flow rate 9 studies collected uws , 4 sws , 2 usp , one sss , one uss , and one collected ssp .
three studies did not explain the hour of collection of saliva and 4 studies did not specify the saliva collection duration .
five studies [ 13 , 17 , 18 , 20 , 21 ] did not show or clarify correctly the statistical methods .
regarding quality assessment , only one study obtained jbi scores 5 ( table 3 ) .
therefore , due to the poor quality of the majority of the included studies no meta - analysis was performed .
the definition of hyposalivation was uws < 0.1 ml / min and sws < 0.5 ml / min ( actually < 0.7 ml / min is considered ) .
the prevalence of xerostomia was analyzed in 7 studies ( table 2 ) . in adults
t2 dm xerostomia prevalence varied between 12.5% and 53.5% , compared to 028.4% in the cg [ 710 ] .
only three studies [ 810 ] ( two with the same study population [ 9 , 10 ] ) showed that dm patients suffered significantly more xerostomia than non - dm patients .
. showed that pcdm patients suffered more xerostomia prevalence than wcdm patients , 54% and 47% , respectively .
this study showed that prevalence of xerostomia in niddm patients is greater than in cg population , 50% versus 30% , but this result was not significant .
only one work was realized in children and adolescents t1 dm between 10 and 19 years old .
this study showed that prevalence of xerostomia was greater in t1 dm patients than non - t1 dm patients ( 0% ) , and the prevalence was greater in pcdm patients ( 100% ) than wcdm patients ( 80% ) .
the quantity of salivary flow rate was analyzed in 12 studies ( table 3 ) .
there was only one study in adults t1 dm ; this study showed that sws flow rate was lower in dm versus non - dm patients , 1.30 versus 1.54 ml / min , and obtained higher salivary flow rate in pcdm than wcdm ( 1.31 versus 1.34 ml / min ) .
in adults iddm it was another study that found significantly lower uws flow rate in dm patients than non - dm patients , 0.35 0.24 versus 0.48 0.23 ml / min .
a considerable part of studies were realized in adults t2 dm [ 7 , 8 , 1518 ] .
four of them evaluated uws [ 7 , 15 , 17 , 18 ] ; the uws flow rate in t2 dm and non - t2 dm patients varied between 0.160.5 ml / min and 0.260.75 ml / min , respectively .
two of these studies [ 7 , 15 ] obtained greater significant uws flow rate in t2 dm than in cg patients .
in addition , chavez et al . assessed the uws flow rate in wcdm and pcdm adults t2 dm ; they found higher rates in pcdm than wcdm .
three studies assessed sws flow rate in t2 dm [ 7 , 8 , 16 ] . the rates of sws in t2 dm and non - t2 dm patients varied between 0.630.95 ml / min and 1.141.95 ml / min , respectively .
the study of bernardi et al . showed that wcdm had greater sws rates than pcdm .
usp flow rates were analyzed in two studies [ 17 , 25 ] ; only in one of them did t2 dm patients show lower rates than non - dm patients ; none obtained significant results .
there were four studies [ 12 , 1921 ] that reported salivary flow rates in children and adolescents t1 dm and iddm between 4 and 19 years old .
all studies evaluated uws ; the rates in dm population varied between 0.15 and 0.79 ml / min and in non - dm patients 0.25 and 1.06 ml / min .
three studies [ 12 , 19 , 20 ] obtained significant lower rates in t1 dm and iddm patients .
javed et al . showed that wcdm had greater uws rates than pcdm , but this result was nonsignificant .
only one study evaluated this outcome and showed that hyposalivation prevalence was significantly greater in t2 dm versus cg patients , 45% versus 2.5% .
multiple epidemiologic studies have suggested that xerostomia is frequent among dm patients . in addition , there are studies that have showed that dm patients presented lower salivary flow rates than non - dm population . these salivary disorders could be associated with a poor quality of life and could increase the susceptibility to caries and oral infections in dm patients , particularly when there has been dehydration and inadequate blood glucose control .
dm is probably the most frequent metabolic disease with salivary implications , due to its high frequency .
this systematic review was performed to analyze the prevalence of xerostomia and hyposalivation and the rates of salivary flow in dm patients in relation to non - dm patients .
we specified explicit eligibility criteria , conducted comprehensive searches , and assessed risk of bias using criteria specific to this review .
selection bias regarding the study population was minimized through the restriction to population - based studies . at the same time
firstly , the majority of studies [ 7 , 913 , 15 , 16 , 2022 ] do not specify the dm diagnosis .
secondly , most of the studies [ 7 , 8 , 11 , 12 , 16 , 18 , 2022 ] did not show the observation period and the type of recruitment of dm cases .
with respect to the salivary flow rate , not all the studies reported the same type of salivary flow and the same technique , and these could also cause bias .
finally , dm and non - dm are not correctly matched ; there are studies that did not even match age and gender [ 8 , 12 , 15 , 19 , 20 ] and there is no study that matched correctly the use of drugs and illness ( apart dm ) , so important in xerostomia / hyposalivation etiology . as we can see in tables 2 and 3 , the sample size in the majority of studies was small ( especially in adults t2 dm ) , considering that dm is a very frequent disease . with respect to the statistical analysis , not all the studies reported continuous variables in mean standard deviation .
due to the fact that only articles published in the english language were reviewed , publication ( language ) bias could not be ruled out .
although we searched three databases , we can not guarantee that some related papers might not have been identified .
however , we did check the reference lists of reviewed articles to identify relevant studies .
the studies reviewed presented different types of dm and dm and non - dm patients of different age ( see section 2 ) that could cause detection bias . we minimized it by grouping together studies with similar age and the same dm type in every outcome .
we identified 15 studies reporting prevalence of xerostomia / hyposalivation and rates of salivary flow in dm population .
comparisons between studies were limited due to different types of dm , different types of salivary flow , and heterogeneous demographic characteristics ( age , ethnic origin ) of the studied individual .
in addition , the quality assessment of studies was low . hence , no quantitative data synthesis was performed .
all studies about this outcome showed higher prevalence of xerostomia in dm patients in relation to non - dm population , 12.5%53.5% compared to 030% [ 712 , 18 ] .
nevertheless , only four studies [ 810 , 12 ] ( two with the same study population [ 9 , 10 ] ) have shown significant statistical results .
two studies [ 8 , 12 ] showed that wcdm patients have lower xerostomia prevalence than pcdm .
all studies [ 7 , 12 , 15 , 1722 ] that analyzed the quantity of uws in dm population in relation to non - dm patients reported higher uws rates in non - dm than in dm patients . the variation flow rate among the different studies in each group ( dm / cg ) is very large .
six [ 7 , 12 , 15 , 19 , 20 , 22 ] of these studies showed significant statistical results .
the large variation flow rate among the studies could be due to the different criteria used to measure uws .
the time of measurement strongly influences the flow rate , so the saliva test ( not only uws ) has to be performed at a fixed time - point of a limited time interval early morning due to the circadian rhythm of salivary flow [ 4 , 27 ] .
in addition , the duration of salivary collection is also important , and not all studies reflected the same duration . in the studies , where the time of flow rate collection is present , this time varied between 5 and 10 minutes .
in addition , it is not clear if wcdm patients have higher uws rates than pcdm ; of two studies [ 12 , 18 ] discussing this topic only one showed nonsignificant higher rates for wcdm patients .
the comparison of the sws rates between dm and non - dm patients showed that rates were higher in non - dm patients [ 7 , 8 , 13 , 16 ] , but only half of the studies showed significant statistical results [ 7 , 8 ] .
the sws flow rate varies very much among the different studies , in the manner of uws ; the possible reason was specified previously .
only one study was about hyposalivation ; this study showed significant statistical higher hyposalivation prevalence in dm than non - dm patients ( 45% versus 2.5% ) . the hyposalivation sws level in this study
is not actually accepted ( < 0.7 ml / min ) if not < 0.5 ml / min ; therefore , the results could be biased .
the selection of studies for this systematic review was based on a systematic search approach with clearly determined search strategies .
we included only those studies reporting xerostomia prevalence / salivary flow rate / hyposalivation within the dm population in relation to a non - dm control group .
moreover , we analyzed these outcomes in separate groups according to age and type of dm .
although three databases were searched , we can not rule out having missed relevant studies , also due to publication bias .
most studies reporting our outcomes were conducted in economically developed areas such as usa and sweden and thus do not represent a worldwide perspective .
the change in the diagnostic criteria for dm from 140 mg / dl ( 7.8 mmol / l ) to 126 mg / dl ( 7.0 mmol / l ) in the fasting plasma glucose level in 1997 led to an increase of the diabetic population due to the inclusion of less severe stages of the disease , and this must be taken into consideration when interpreting the results .
criteria for the diagnosis of prediabetes and dm could change periodically ; therefore , it is very important to realize the studies according to the current criteria .
the review conducted demonstrated the considerable variation in prevalence of xerostomia and salivary flow rates among dm population in relation to non - dm patients .
most studies found a higher prevalence of xerostomia and lower salivary flow rates in dm with respect to cg .
we found only a study about hyposalivation that showed higher prevalence in dm than non - dm patients .
a few studies showed that wcdm patients have lower xerostomia prevalence and higher salivary flow rates than pcdm patients .
owing to the high degree of heterogeneity regarding the types of dm , diagnosis of dm , age of patients , and types and techniques of salivary flow collection , it was difficult to compare the studies .
we recommend that new studies analyzing the xerostomia and salivary flow rate in the dm population should use more precise and current definitions concerning the determination and diagnosis of dm patients and salivary flow rate collection .
new studies should match correctly dm and non - dm patients , keeping in mind xerostomia associated drugs and illness ( other than dm ) .
new studies are required that consider hyposalivation in dm patients because a reduction in salivary flow is not always pathological . | the presence of xerostomia and hyposalivation is frequent among diabetes mellitus ( dm ) patients .
it is not clear if the presence of xerostomia and hyposalivation is greater in dm than non - dm patients .
the aims of this systematic review are ( 1 ) to compare the prevalence rates of xerostomia , ( 2 ) to evaluate the salivary flow rate , and ( 3 ) to compare the prevalence rates of hyposalivation in dm versus non - dm population .
this systematic review was conducted according to the prisma group guidelines by performing systematic literature searches in biomedical databases from 1970 until january 18th , 2016 .
all studies showed higher prevalence of xerostomia in dm patients in relation to non - dm population , 12.5%53.5% versus 030% .
studies that analyzed the quantity of saliva in dm population in relation to non - dm patients reported higher flow rates in non - dm than in dm patients .
the variation flow rate among different studies in each group ( dm / cg ) is very large . only one existing study showed higher hyposalivation prevalence in dm than non - dm patients ( 45% versus 2.5% ) .
in addition , quality assessment showed the low quality of the existing studies .
we recommend new studies that use more precise and current definitions concerning the determination and diagnosis of dm patients and salivary flow collection . |
so far , only four case reports and one case series has been published . due to the paucity of data ,
not much is known about the biological and clinical behavior of ahl . both ahl and ah are considered to have a better prognosis and considerably less cardiac involvement when compared with its more frequent counterpart , al .
a 12-lead electrocardiogram revealed complete heart block with a ventricular rate of 40 beats / minute .
echocardiogram showed left ventricular hypertrophy with interventricular septal thickness of 26 mm ; ejection fraction 55% , normal aortic , mitral , tricuspid and pulmonary valves , mild mitral regurgitation , and normal right ventricular pressures .
based on these findings , patient was diagnosed to have hypertrophic obstructive cardiomyopathy ( hocm ) with complete heart block .
the patient received a dual chamber pacemaker following which he remained relatively asymptomatic ; his systolic blood pressures documented during follow - up visits were consistently around 100 mm hg .
nine months later , he noticed mild pedal edema and progressive numbness of toes , for which he did not seek medical attention .
he presented 18 months after the pacemaker implantation with worsening pedal edema shortness of breath and frequent episodes of syncope . on examination
the serum cr was 2.2 mg / dl , serum protein levels were 7.4 g / dl with an albumin : globulin ratio of 2.9 .
his 24 h urine protein excretion was 2208 mg / day , urinary sediment was inactive .
a 12-lead electrocardiogram showed that the pacemaker initiated rhythm in the ventricular demand mode with a rate of 60 beats / minute with intermittent under - sensing and a qrs amplitude of 5 mm in the limb leads .
serum electrophoresis revealed a monoclonal band in the region of gamma globulins and elevated free light chains ( free kappa 39.4 mg / l , free lambda 136 mg / l ) with a kappa / lambda ratio of 0.29 .
light microscopy ( lm ) revealed 27 glomeruli , of which 15 glomeruli were completely sclerosed .
viable glomeruli were enlarged in size and showed marked mesangial widening with prominent nodules composed of glassy , homogenous eosinophilic material , which was periodic acid - schiff ( pas)-positive and silver - negative [ figure 1a and 1b ] ; many blood vessels showed similar material causing luminal occlusion .
interstitium showed moderate inflammatory infiltrate composed of lymphocytes and few plasma cells , and there was tubular atrophy amounting to 60% of the core .
immunofluorescence ( if ) microscopy showed strong positive staining for heavy chain immunoglobulin ( ig ) g and light chain lambda in the mesangium , along the glomerular basement membrane , tubular basement membrane as well as along the vessels [ figure 1c and 1d ] .
the glomerular deposits revealed apple green birefringence on polarized microscopy [ figure 2a and 2b ] .
electron microscopy ( em ) revealed normocellular glomerulus with marked mesangial widening and numerous haphazardly arranged , nonbranching fibrils ranging from 7 nm to 10 nm in diameter [ figure 2c ] .
a repeat echocardiogram revealed concentric left ventricular hypertrophy , mild mitral regurgitation , mild tricuspid regurgitation , right ventricular systolic pressure of 44 mm hg and a restrictive filling pattern [ figure 2d ] .
( a ) glomeruli with marked mesangial widening , prominent nodules composed of glassy , homogenous , and eosinophilic material .
in addition , one small arteriole shows luminal occlusion by similar material ( h and e , 200 ) .
( b ) glomeruli show periodic acid - schiff ( pas ) positive mesangial widening and nodules ( pas , 400 ) .
( c and d ) immunofluorescence ( if ) shows strong positivity for both igg and lambda in the mesangiun , glomerular and tubular basement membrane ( if , 400 ) ( a and b ) congo red staining with apple green birefringence on polarized microscopy .
( c ) characteristic amyloid fibrils ranging from 8 nm to 10 nm in diameter .
( d ) echocardiogram showing left ventricular hypertrophy based on the above findings , the patient was diagnosed to have systemic amyloidosis ( heavy and light chain ) with multiple myeloma . patient was started on bortezomib - based chemotherapy .
amyloidosis is characterized by extracellular deposition of insoluble 7 - 10 nm fibrils , having a beta - pleated ultrastructure .
ig - derived amyloid deposits accounts for about 85% of cases of systemic amyloidosis . of this majority
is al , characterized by ig light chain deposition . on the other hand , ah and ahl
there have been case reports of ahl occurring in the setting of lymphoma as well .
apart from case reports , there is only one systematic analysis of ah / ahl , which has compared the characteristics of this rare disease with the more common variant , al . even though ahl has a similar age of presentation , gender predisposition and vital organ involvement ,
nasr et al . reported three patients with ah / ahl to have concurrent cardiac and renal involvement , of which two had ah whereas one had ahl .
there are no previous reports of ahl presenting with cardiac involvement with subsequent involvement of kidney .
ahl is reported to have a considerably lesser diagnostic yield from abdominal fat pad and bone marrow biopsies . when compared to al , majority of the patients
will have an intact circulating monoclonal ig as there is concomitant production of light as well as heavy chain .
the monoclonal light and heavy chains are considered to be secreted by a single clone of b cells
. a higher proportion of patients with ahl tend to have plasma cell dyscrasias when compared to al .
certain unique challenges can stand in the way of making a conclusive histologic diagnosis of ahl .
the hallmark of renal amyloidosis is the presence of homogenous , amorphous , faintly eosinophilic pas and silver - negative extracellular deposits on lm .
this deposit exhibits a characteristic apple green birefringence on congo red staining when viewed under polarized microscope .
the deposits are composed of 7 - 10 nm fibrils , which can be visualized under em .
em will reveal the fibrillary nature of the deposits , but is not useful for subtyping the amyloid .
these include pas and silver - positive deposits , prominent glomerular basement membrane involvement and mesangial hypercellularity .
these lm features are likely to be mistaken for fibrillary glomerulonephritis . in resource - poor settings where em is not routinely employed , it is prudent to screen for congo red positivity in all suspected cases of fibrillary glomerulonephritis , especially when it is associated with restriction of a heavy chain and/or light chain .
most of the centers rely on if microscopy for subtyping of renal amyloidosis . in ahl , if microscopy will demonstrate restriction of a single ig light chain and heavy chain , but can be negative in approximately 18% of cases .
the antibodies used in if bind to the epitopes on constant domains of light and heavy chains .
if these epitopes are deleted or significantly altered , the antibodies will not be able to bind .
it is likely that a proportion of ahl amyloidosis may be missed if if alone is used for amyloid typing .
the demonstration of light and heavy chains may require additional testing by use of laser microdissection with tandem mass spectrometry ( lmd / ms)-based proteomic analysis . employing lmd / ms as a tool for renal amyloid typing is likely to increase the diagnostic yield .
another potential problem that may seriously affect the validity of if is the nonspecific ig and complement staining by amyloid deposits .
this is encountered more frequently in aa amyloidosis than al ; this results from an in vitro phenomenon due to increased affinity to amyloid aa protein by the antibodies used or because of an in vivo stickiness of the amyloid to igs .
if if methods alone are used , the diagnosis of ahl should be limited to cases that show intense equal staining for a single heavy chain and one light chain .
cardiac involvement is common in al but considered to be less common in ah / ahl .
the classic clinical finding of low - voltage qrs complexes ( limb leads < 5 mm in height ) with poor r wave progression in the anterior chest leads ( pseudo infarction pattern ) is described in 50% of patients in cardiac amyloidosis .
complete heart block is an uncommon presentation of amyloidosis ; it has been described in < 3% of patients who have cardiac amyloidosis .
typical echocardiographic findings include concentric ventricular thickening with right ventricular involvement , poor biventricular long - axis function with normal or near - normal ejection fractions .
a speckled or granular myocardial appearance is considered to be characteristic , but seldom demonstrated and may depend on the machine gain settings . the classic restrictive pattern , biventricular thickening and valvular infiltration occurs late in the course of amyloidosis . in 5% patients , an echocardiographic appearance indistinguishable from hocm has been described .
cardiac magnetic resonance imaging with gadolinium contrast is a useful noninvasive test , which could differentiate amyloidosis from other causes of left ventricular hypertrophy .
to the best of our knowledge , this is the first report of ahl from india .
we wanted to highlight the atypical presentation of complete heart block , which is a rare initial manifestation of ahl .
the initial echocardiographic appearance was indistinguishable from hocm ; a restrictive pattern classical of amyloidosis was demonstrated fairly late in the course of the disease .
amyloidosis , even though uncommon , needs to be considered strongly in elderly patients presenting with left ventricular hypertrophy in the absence of hypertension .
the renal biopsy showed significant pas positivity , a finding , which is unusual in amyloidosis .
considering the fact that a major proportion of ah / ahl exhibit atypical features on lm , congo red screening should be considered for amyloid - like deposits even if it is pas / silver - positive .
in view of the intrinsic limitations of if in subtyping amyloid , it is possible that ahl might be underdiagnosed .
incorporating a direct protein identification method like lmd / ms is likely to improve the diagnostic yield . | amyloidosis is an uncommon disease characterized by deposition of proteinaceous material in the extracellular matrix , which results from abnormal protein folding . even though more than 25 precursor proteins are identified , majority of systemic amyloidosis results from deposition of abnormal immunoglobulin ( ig ) light chains . in heavy chain amyloidosis ( ah )
, deposits are derived from both heavy chain alone , whereas in heavy and light chain amyloidosis ( ahl ) , the deposits are derived from ig heavy chains and light chains . both ah and ahl are extremely rare diseases . here , we report an unusual presentation of igg ( lambda ) ahl amyloidosis in the background of multiple myeloma , where the initial clinical presentation was complete heart block , which preceded the definitive diagnosis by 18 months . |
the interest in understanding the genetic basis of diseases and drug regimens has increased , requiring dna isolation .
however the extraction of dna from buccal cells ( bc ) is bringing a new perspective to obtaining dna8 . compared to other methods , such as blood collection , it is a noninvasive collection method and is therefore better tolerated by adults , children and handicapped individuals .
this procedure has low cost and does not require medical assistance ( e.g. : nurse ) , so a wide population can be genotyped1,3,6,9 .
the wet method consist in swishing liquids in the mouth and spitting them into a collecting cup2 .
this procedure yields a higher amount and longer fragments of dna2,4 , requires more steps , is more cumbersome and has a higher cost8 .
they are simpler , more cost effective8 and are considered less sensitive to the effect of long time storage at room temperature when compared to mouthwash , which may be crucial for multicenter studies6 . according to a recent study
, the use of cytobrushes appears to be the most appropriate manner to facilitate self - collection of human genomic dna with good quality and high security when compared to the mouthwash method6 .
commercial kits are available to extract dna from bc and they can provide sufficient dna for genetic analysis .
nevertheless , due to logistic , financial , practical and methodological reasons , large studies often require the storage of bc samples before dna extraction7 .
there is a lack of information in the literature regarding the best method to store bc after collection .
therefore , the purpose of this study was to evaluate quantitatively and qualitatively the effect of the storage time of samples before the application of the cell lysis solution ( cls ) for extracting dna from bc .
the research protocol was reviewed and approved by the research ethics committee of the federal university of pelotas , brazil .
five volunteers were selected to participate in the study and were submitted to three bc collections . in each collection , 2 bc samples were obtained , being one from the upper and one form the lower gutter region .
samples were collected using disposable special cytological brushes and the volunteers were instructed to brush and twirl each cytobrush for 30 s over the gutter region , which is the space between the gums and the inner portion of the lips and cheeks along the front and sides of the mouth . for all volunteers ,
the collections were performed in different anatomical regions of the oral cavity at the same time , with 5 days of interval between each collection .
the collected samples were treated in three different forms . in the control group ( n=10 ) , immediately after the collection , the cytological brush containing the material was introduced in a microfuge tube that contained cls .
after 3 h in this solution , the samples were submitted to laboratory processing for dna extraction . in the second group ( n=10 ) , soon after collection , the cytobrush was placed in a microfuge tube , without cls , and left undisturbed for 72 h at room temperature .
thereafter , cls was applied and the samples were processed in the same way as in the control group . in the third group ( n=10 ) , the collected samples remained in the microfuge tube for 72 h at 4 c. after this period , cls was applied and the samples were processed in the same way as in the control group .
all samples were processed following the manufacturer 's instructions ( puregene dna buccal cell kit ; gentra systems , inc . ,
minneapolis , mn ) . according to the manufacturer , 0.2 to 2.0 g / brush of dna
after processing of each sample , 20 l of solution was obtained . from this amount ,
10 l were placed in a tube containing 90 l of milli - q water and the amount of dna was read in a spectrophotometer ( eppendorf biophotometer , hamburg , germany ) , in which dna concentration and purity was evaluated .
the average from the two collections in each individual was obtained , with samples submitted to the same storage condition and the obtained data analyzed statistically by one - way anova . in order to ascertain the presence of high molecular weight dna in the samples , the remaining 10 l of each sample
were used to run 0.8% agarose gel electrophoresis at 2v / cm and were stained with ethidium bromide .
the dna degradation was observed by fragmentation of the samples compared against a known molecular weight marker .
the visible bands were examined by two calibrated examiners that were not involved in the study .
the means and standard deviations for dna extracted under immediate , room temperature and cooling temperature conditions were 3.5 0.7 , 3.0 0.6 and 4.1 1.8 g , respectively .
the statistical analysis did not show statistically significant difference regarding dna concentration among the three storage conditions ( p=0.385 ) . regarding the qualitative evaluation , differences in band patterns
processed immediately after bc collection , no degradation traces were observed ( figure 1 ) . however , in the others groups with samples processed later under room and cooling temperature conditions , dna degradation or absence of bands were observed ( figure 1 ) .
this study is particularly relevant for large - scale epidemiological studies , where generally the laboratory is not available to process the genetic material immediately after collection in a field study .
therefore , sample storage is frequently necessary to prevent the loss of quantity or quality of the genetic material . although bc samples give a smaller amount of dna then blood samples , recently developed methods of genotyping use very small amounts of dna what makes the collection of bc a viable source of genetic material with high quality .
furthermore blood collection is more invasive and not well tolerated by some patients , making easier the compliance in larger epidemiologic studies4,9 .
the amount of dna material obtained from bc is dependent of the location , the force applied during collection and the patients ' individual variations6 .
another factor that is capable to influence the amount of material obtained is the time of collection . in the present study , the time of collection of 30 s
this time was used by several studies3,9,11 since longer times are unviable , especially in studies involving children . in order to avoid loss of material in the present study ,
the collections were made before volunteers had eaten or brushed their teeth , since the attrition of foods and toothbrush could reduce significantly the amount of material on the mucous membranes .
the selection for the gutter region of the mouth instead of the inner cheek was based in a recent study by saftlas , et al.9 ( 2004 ) , where collection with cytobrushes in adult women from the gutter provided significantly larger amounts of dna ( 7.5 g ) than the standard method of brushing the inner cheeks ( 3.8 g ) .
however , in the present study , the mean amount of dna obtained from the gutter area was 3.5 g , which is similar to the quantity obtained from the inner cheeks in saftlas ' et al . study .
in addition , the value obtained in the present study is similar to that reported by mulot , et al.6 ( 2005 ) using cytobrushes that were twirled in the inner cheek during 15 s. the same author observed that there was no significant decrease of the dna yield between 2 , 5 and 7 days , while all samples were maintained at room temperature6 .
these results corroborate those of the present study , with no significant difference between the three methods of storage after material collection .
in addition , for all methods , the amount of dna was greater than 1 to 2 g , which is considered adequate for epidemiological studies6,9 .
the qualitative evaluation was based on the 0.8% agarose gel observation . a decrease in dna quality
was observed when the material was not immediately placed in cls and processed , but was rather stored at room temperature or kept refrigerated until immersion in cls and processing .
this could suggest that soon after collection of genetic material , the brushes should be placed immediately in the lysis solution to preserve the material 's quality .
king , et al.5 ( 2002 ) verified the dna quality using pcr amplification and observed that cytobrushes collections , contains dna fragments for short and intermediate amplification primers , and poor results for large gene fragments . according to the authors
, it might have occurred due to degradation of the dna from the cytobrushes , suggesting that the period of storage is an important issue in dna quality , which was reaffirmed by the findings of present study .
however , we also observed that the degradation process could be minimized by immediately placing the samples in the cls .
finally , it is important to highlight that genetic material collection with cytobrushes has proved to be an effective and low cost method for the collection of genetic material for epidemiologic studies .
within the limitations of this study it may be concluded that the amount of dna obtained was not influenced by the method of storage prior to cls application .
however , the quality of the genetic material was more preserved when cell lysis was performed immediately after sample collection . | this study evaluated quantitatively and qualitatively the effect of the storage time of samples before the application of the cell lysis solution ( cls ) for extracting dna from buccal cells ( bc ) .
bc from the upper and lower gutter region were collected from 5 volunteers using special cytobrushes ( gentra ) , totaling 3 collections for each individual . in the control group ( n=10 ) ,
cls was applied soon after bc collection . in the other two groups ,
samples were stored at room temperature ( n=10 ) or at 4c ( n=10 ) .
after cls application , dna was extracted according to the manufacturer 's instructions ( puregene dna buccal cell kit ; gentra systems , inc . ) .
the dna obtained was evaluated by two calibrated blind examiners using spectrophotometry and analysis of dna bands ( 0.8% agarose gel electrophoresis ) .
the obtained data were submitted to one - way anova .
the means and standard deviations for dna extracted under immediate , room temperature and cooling temperature conditions were 3.5 0.7 , 3.0 0.6 and 4.1 1.8 g , respectively ( p=0.385 ) .
no significant differences were found in relation to the amount of dna for the different storage conditions .
however , in the visual analysis of the dna bands , no trace of dna degradation was detected when csl was applied soon after dna collection , while dna bands with degradation could be observed in the other groups . within the limitations of the study
, it may be concluded that cls should be applied soon after dna collection in order to obtain high - quality dna from bc . |
essential hypertension ( eh ) is a major risk factor for cardiovascular disease ( cvd ) , and eh incidence among youth is increasing .
african americans ( aas ) experience a higher prevalence , earlier onset , and greater severity of eh - related complications than other ethnic groups . from late childhood onward , aas display increased levels of resting and ambulatory blood pressure ( abp ) compared to other ethnic groups [ 35 ] .
stage i prehypertensive adults ( i.e. , sbp / dbp 121129/8184 mmhg ) have a 40% increased risk and adults with stage ii prehypertension ( i.e. , sbp / dbp 130139/8589 mmhg ) are twice as likely to develop cvd compared to those with optimal bp ( < 120/<80 mmhg ) [ 68 ] .
bp percentile ranking tracks from late childhood into adulthood [ 911 ] placing aa adolescents with bp between the 50th and 95th percentiles for age and sex at an increased risk of future eh and cvd development . eh , like other multifactorial chronic diseases , results from a complex interplay between an individual 's genetic underpinnings , lifestyle behaviors , psychosocial factors , and exposures to various environmental toxins . over time ,
this dynamic interplay eventuates in adverse structural and functional changes in biological organ systems culminating in disease manifestation [ 12 , 13 ] . among the myriad of environmental toxins ,
psychosocial stress such as repeated exposures to unfair treatment and discrimination associated with socioeconomic status ( ses ) inequality and race have been implicated as contributing to eh , especially among aas [ 14 , 15 ] .
clark and gochett found perceived racism to be positively associated with increased resting sbp among aa youth who reported a strong intolerance to racist attitudes .
matthews and colleagues observed unfair treatment to be associated with increased daytime abp and night / day abp ratios in adolescents , especially among aa adolescents living in lower ses neighborhoods .
aas ' bp control abnormalities are frequently associated with increased vasoconstrictive tone [ 1820 ] . studies involving normotensive youth and young adults have shown that higher levels of resting bp and exaggerated bp responses to physical and behavioral stressors between aas and european americans ( eas ) are often due to higher levels and/or greater increases in vasoconstrictive tone [ 2124 ] .
associations between psychosocial stress - related factors and autonomic nervous system ( ans ) dysregulation indicate that excessive endothelial activation also plays a contributory role .
the endothelial and vascular smooth muscle cells produce endothelin-1 ( et-1 ) , a potent vasoconstrictor , and endothelium - derived relaxing factor ( edrf ; a potent vasodilator ) .
imbalances between circulating concentrations , and/or receptor sensitivity may lead to exacerbations of vasoconstrictive mediated bp control compounding the contributions of ans dysregulation . among hypertensive adults and normotensive adolescents and adults , aas have exhibited higher plasma et-1 levels compared to eas [ 23 , 2628 ] . among normotensive adolescents and young adults ,
aas have shown greater behavioral stress induced plasma et-1 increases compared to eas [ 23 , 26 ] . a recent study by cooper et al . found that among aa adults , greater self - reported discrimination exposure was associated with higher et-1 levels , regardless of ses .
the et-1 gene is localized on chromosome 6 , spans 5.5 kb , and contains 5 exons and 4 introns .
it has been identified as a candidate gene for eh and cvd . a g - to - t transversion predicting a lysine - asparagine change at amino acid 198 ( lys198asn )
single - nucleotide polymorphism ( snp ) has been associated with increased bp levels from adolescence to middle age in japanese eas and aas [ 3133 ] .
the lys198asn snp has also been associated with exaggerated bp reactivity to laboratory stressors , particularly within the context of background stress - related factors .
for example , in a previous study , t allele carriers from lower ses backgrounds exhibited the greatest bp increases to a video game challenge compared to all other subgroups .
. found vasoconstrictive reactivity to behavioral stress was the highest among t - allele carriers with poor anger management skills .
these latter sets of findings along with other recent studies [ 3537 ] lend support to the gene environment model of stress - induced eh [ 38 , 39 ] .
that is , individuals with genetic susceptibility for eh , who are exposed to frequent environmental stress and/or other stress - related potentiating factors ( e.g. , ineffective coping skills ) , will be most likely to exhibit the greatest bp stress reactivity and to eventually develop eh and cvd .
behavioral stress reduction interventions ( e.g. , meditation , cognitive behavioral coping skills , etc . ) implemented to improve bp control and other cvd risk factors have primarily involved adults and quality of research designs and results have been mixed [ 4042 ] .
reviewed 107 stress reduction bp control studies and conducted a meta - analysis involving 20 studies that were classified as well - designed randomized control trials ( rcts ) .
collectively , transcendental meditation ( tm ) was the only treatment found to significantly reduce resting and/or 24 hour bp .
black et al . reviewed 16 pediatric sitting - meditation rcts , including breathing awareness meditation ( bam ) .
median effect sizes ranged from 0.16 to 0.29 for physiologic outcomes including resting and ambulatory bp , heart rate , and total peripheral resistance . in a recent study , bam showed significantly greater reductions in ambulatory sbp and sodium excretion compared to cognitive behavioral skills training ( lst ) and health education control ( hec ) among a group of aa prehypertensive teenagers .
increased sns activation and increased endothelial system activity ( i.e. , increased et-1 levels ) have both been shown to increase sodium appetite [ 45 , 46 ] .
the reduced sodium excretion may be indicative of reductions in sodium appetite as a result of improvements in ans regulation and/or et-1 activity .
the above review indicates that among stress reduction rcts , meditation is consistently associated with significant bp reductions .
however , even among the meditation rcts showing significant bp reductions , noticeable inter - individual differences have been observed both across and within studies [ 4144 , 47 ] .
's meta - analysis , the 95% confidence interval for resting sbp change from 6 tm studies was ( 2.3 to 7.6 mmhg ) , with net changes between tm and health education ranging from 1.1 to 10.7 mmhg .
recently , in a group of college students , nidich et al . found tm to provide an average change of 2.0 mmhg for resting sbp . a subgroup identified as high - risk for eh ( i.e. , family history of eh ) showed a reduction of 5.0 mmhg .
the variability within and across rcts using meditation interventions with comparable study samples and adherence rates may partially be due to combined influences of heterogeneity in genetic susceptibility for physiological responsivity to stress and propensity for exposure to stressful events . in genetics
, penetrance represents the percentage of cases carrying a gene or allele among those displaying the phenotype of interest ; expressivity represents variations or magnitude in a phenotype expression .
phenotypes can vary in penetrance and expressivity by a number of factors including exposure to environmental factors , allelic variation , and complex gene by environment interactions .
a growing literature is indicating that higher genetic penetrance and/or expressivity may adversely impact the degree of benefit obtained from behavioral as well as pharmacologic programs aimed at improving relevant phenotypes .
for example , among smokers who participated in cognitive behavioral interventions plus pharmacologic smoking cessation therapies , the carriers of nicotine metabolizing genetic variants , particularly those from high tobacco smoke exposure - laden environments , exhibited lower cessation rates and earlier relapse compared to noncarriers .
similarly , ancillary analyses of the highly successful diabetes prevention program which involved at - risk adults from obese laden environments receiving placebo , metformin , and lifestyle interventions revealed carriers of the tcf7l2 genetic variant associated with diabetes , had significantly higher incidence of diabetes acquisition during the study than noncarriers irrespective of the treatment they received .
the purpose of this preliminary study was to evaluate the potential modulating influences of genetic variability in the et-1 snp and differential discrimination - based stress exposure upon changes in ambulatory bp after 12-week exposure to bam , lst , and hec among prehypertensive aa adolescents .
we hypothesize that et-1 carriers will be less likely to respond to any stress reduction treatment given the purported propensity of a greater genetic predisposition to ans / et-1 imbalances related to bp control .
following , we expect et-1 carriers who report high levels of discrimination will have the most difficulty reducing ambulatory bp compared to other subgroups due to the combination of having higher genetic penetrance for an ans / et1 imbalance related to bp control , combined with increased likelihood of expressivity of the ans / et1 imbalance as a result of high levels of chronic stress exposure . among the treatment groups , we hypothesized that bam would have greater beneficial impact upon ambulatory bp reduction compared to lst and hec .
as shown in figure 1 , a total of 1827 students who would be participating in a semester - long ninth grade health education class were screened over a five - year period to determine eligibility for participation in the study .
eligibility criteria included having ( 1 ) resting sbp between 50th and 95th percentile for age , height and sex on three consecutive occasions at school , ( 2 ) no history of congenital heart defect , diabetes , sickle cell anemia , asthma , or any chronic illness or health problem that requires regular pharmacological treatment , ( 3 ) no current or planned engagement in a formal exercise , health promotion , or organized sports program outside of regular school physical education courses , ( 4 ) willingness to accept randomization by school into treatment groups , ( 5 ) being african american or black , based on parental report , ( 6 ) never pregnant at any point in the study , and ( 7 ) weighing less than 125 kg .
the institutional review boards of the georgia health sciences university and the medical university of south carolina approved the study . from the 224 eligible participants , genotyping was not conducted on 30 students .
thirty - two were omitted due to either missing postevaluation ambulatory bp ( n = 23 ) , or having extreme changes ( n = 9 ) in postintervention 24-hour sbp ( 3 sds compared to the entire sample ; 15 mmhg in either direction ) .
the distribution of the remaining 162 subjects by treatment group was : bam ( n = 46 , 16 males ) , lst ( n = 59 , 24 males ) , and hec ( n = 57 , 20 males ) .
there was no differential loss of subjects by treatment group ( x = 3.65 , df = 2 , p = .72 ) and no significant differences between omitted subjects ( n = 62 ) and the remaining 162 on anthropometric variables and ambulatory bp levels at baseline ( all p 's > .10 )
height was measured by stadiometer and weight by a detecto cn20 scale ( cardinal scale manufacturing co. , webb city , mo , usa ) .
tampa , fla , usa ) at minutes 5 , 7 , and 9 of a 10-minute rest period .
the first measurement each day was discarded and the other two measurements were averaged .
genomic dna was extracted from buccal cells using qiaamp dna blood mini kits ( qiagen ) .
the et-1 lyn198asn genotype was detected by polymerase chain reaction ( pcr ) followed by direct sequence analysis . before and following the intervention , ambulatory sbp and dbp were recorded for 24 hours .
measurements were recorded every 30 minutes during school , every 20 minutes during self - reported after school waking hours , and every 30 minutes during self - reported sleep hours using spacelabs 90207 monitors ( spacelabs , inc . , issaquah , wash , usa ) .
this monitor has been previously validated , and ambulatory bp has been found to be a better predictor of eh than casual bp .
acceptability of ambulatory readings was based on previously established criteria including pulse pressure > 20 mmhg , dbp 45 mmhg but < 100 mmhg , sbp > 70 mmhg but < 180 mmhg , hr > 39 bpm but < 180 bpm [ 47 , 54 , 55 ] .
hourly averages were obtained by averaging all readings for each clock hour across : daytime ( 8 a.m. to 10 p.m. ) , nighttime ( 12 a.m. to 6 a.m. ) , and 24-hour periods . as in previous studies , to be included in analyses , hourly averages for sbp and dbp required a minimal of 50% of total possible evaluations for the respective time period [ 47 , 54 , 55 ] . the percentage of ambulatory evaluations across groups for the pre / postinterventions were 78%|80% .
the percentage of ambulatory evaluations by group for the pre / postinterventions were similar : bam 78%|81% , lst 78%|79% , and hec 79%|80% .
the 9-item everyday discrimination scale ( eds ) was used to assess exposure to discrimination [ 56 , 57 ] .
frequency of encounters was assessed using a 6-point response format ( almost every day , at least once a week , a few times a month , a few times a year , less than once a year , and never ) .
the eds was administered via paper and pencil during pre- and postintervention evaluations as part of a battery of psychosocial questionnaires .
to investigate influence of everyday discrimination , a median split was conducted on preintervention eds scores creating low and high eds groups .
participants whose score fell on the median were included in the high eds group ( 49% low eds , 51% high eds ) .
the eds was chosen as a measure of chronic stress due to its use in several recent pediatric bp association [ 16 , 17 , 56 ] and adult et-1 association studies .
in addition , the relevance of item content was pertinent to our sample of adolescent aas ( e.g. , and in your day - to - day life , how often have you felt threatened or harassed or felt treated with less respect than other people ) .
the 12-week intervention was conducted at two high schools during subjects ' regular health education classes .
qualitative assessments of the teachers ' program implementations were conducted weekly with three likert scale items ( 04 scale ) , which assessed thoroughness , class attentiveness , and enthusiasm .
average instructors ratings across the 12-week intervention were 3.34 0.26 for thoroughness , 3.28 0.32 for class attentiveness , and 3.31 0.27 for enthusiasm .
there were no significant differences for instructor ratings across the treatment groups ( all p 's > .06 ) .
weekly health education lessons consisted of 50-minute sessions on cv health - related lifestyle behaviors based upon national heart , lung and blood institute guidelines for youth and included brochures , handouts , videotapes , discussions , and recommendations for increasing physical activity ( e.g. , walking , sports , etc . ) , establishing and maintaining prudent diet ( e.g. , reducing fat intake ) .
weekly 50-minute sessions using selected components of the lst program involved group discussions , passive and active modeling , behavioral rehearsal , feedback , reinforcement , and behavioral homework assignments .
the selected program components provided training in problem - solving skills , reflective listening , conflict resolution , and anger management to enhance social skills , assertiveness , and personal and social competence .
no relaxation or stress reduction techniques were given to the lst or hec groups .
practice involves focusing upon the moment , sustaining attention on the breathing process and passively observing thoughts .
the individual sits upright in a comfortable position with eyes closed and focuses on diaphragm movements while breathing in a slow , deep , relaxed manner .
ten - minute sessions were conducted during health education class and at home each weekday . on weekends
there were no significant differences between treatment groups on in - school attendance ( f[2 , 160 ] = 2.36 , p = .10 ) , hec 81% , bam 79% , and lst 88% .
change in values of daytime , nighttime , and 24-hour sbp , and dbp were compared using a series of 2 ( et- 1 genotype ) by 3 ( treatment group ) by 2 ( eds group ) analyses of variance of change scores ( post- minus preintervention values ) that covaried the respective preintervention values ( ancovas ) .
in addition , changes in smoking ( i.e. , average cigarettes per week ) and exercise ( i.e. , days / week engaged in sweat inducing physical activities ) from the youth risk behavior surveillance system , and body mass index covarying preintervention values were examined among subgroups .
there were no significant preintervention differences or pre- to post - changes found among the groups ( all p 's > .10 ) . to further examine three - way interactions , two - way interactions and simple main effects across each level of a third variable
the third variable was chosen on the basis of the largest f - ratio from the two variables that only had two levels ( i.e. , et-1 genotype or eds group ) .
adjusted f - values ( fadj ) were calculated using the mean square for the analyses of interest divided by the mean square error term taken from the original model .
all subsequent comparisons following the initial three - way ancova were examined using bonferroni adjusted alpha levels .
the series of analyses was originally completed with general linear modeling using eds as a continuous variable which , as anticipated , revealed similar patterns of significant results and conclusions .
given the complex interpretations of the multiple interactions that differentiate across groups , the previously described ancova models using dichotomized median split eds values are presented .
there were no significant differences between the treatment groups , et-1 genotype , eds , or treatment group by et-1 genotype by eds interactions on any of these parameters ( all p 's > .10 ) .
genotype frequencies included 100 participants homozygous for the g allele , 52 heterozygous g and t allele carriers , and 10 homozygous for the t allele .
frequencies were in hardy - weinberg equilibrium ( x = .87 , df = 1 , p = .35 ) . due to the small number of homozygous t allele carriers ,
participants classified either as heterozygous or homozygous for the t alleles were classified as carriers ( 38% ) , and homozygous g allele carriers were classified as noncarriers ( 62% ) . a two - way ( carrier status )
x treatment group anova was conducted on the eds pretest scores and verified no significant baseline differences due to carrier status , treatment group , or the interaction between carrier status and genotype ( all p 's > .24 ) .
a x analyses was used to examine the median split by treatment group dispersion rate and was not significant ( p = .88 ) .
finally , eds change scores were examined to determine if any treatment group resulted in significant changes to eds during the duration of the study .
no significant changes in eds scores by treatment group , et-1 t allele carrier status , or their interactions were found ( all p 's > .29 ) .
correlations between pre- and postintervention eds scores were significant ( r = .59 , p < .001 ) and indicate that these scores were stable throughout the study .
the omnibus ancova revealed significant main effects for et-1 genotype ( f[1 , 149 ] = 7.57 , p < .01 ) and treatment group ( f[2 , 136 ] = 4.73 , p = .01 ) which were subsumed within an et-1 genotype x treatment group x eds group interaction ( f[2 , 149 ] = 4.14 , p = .02 ) .
subsequent analyses examined the two - way interactions and simple effects for et-1 carriers and noncarriers separately .
no significant interactions or simple main effects for et-1 carriers were found . among et-1 noncarriers , a significant simple main effect for treatment group
( fadj[2 , 149 ] = 4.46 , p < .05 ) was subsumed within an eds x treatment group interaction ( fadj[2 , 149 ] = 4.46 , p < .05 ) .
further simple effects analyses of treatment effects were separately conducted across the low and high eds groups .
there was no treatment effect among the et-1 noncarriers who reported low eds with groups showing comparable 24-hour sbp changes ( range = 2.5 to 2.8 mmhg ) .
there was a significant treatment group effect among those from high eds backgrounds ( fadj[2 , 149 ] = 8.26 , p < .05 ) .
post hoc analyses revealed that those who received bam showed greater decline than lst recipients ( 4.9 versus + 2.4 mmhg , p < .05 ) .
significant main effects for et-1 genotype ( f[2 , 146 ] = 5.38 , p = .02 ) and treatment group ( f[2 , 146 ] = 3.90 , p = .02 ) were subsumed within a three - way interaction involving the eds group ( f[2 , 146 ] = 4.00 , p = .02 ) .
the pattern of the three - way interaction was similar to that observed for 24-hour sbp ( see figure 2 ) .
subsequent analyses revealed no significant interactions or simple main effects for et-1 carriers . among et-1 noncarriers ,
a simple main effect for treatment group was found ( fadj[2 , 146 ] = 5.32 , p < .05 ) .
post hoc examination revealed bam participants showed greater reductions compared to lst ( 4.4 versus + .19 mmhg , p < .05 ) .
although not statistically significant , the subgroup of et-1 snp noncarriers who reported high eds and received bam exhibited the greatest reduction across all subgroups ( 5.6 versus range of 3.5 to + 2.3 mmhg ) .
the only subgroup among et-1 snp carriers to show a reduction was those with low eds that received bam ( 3.6 versus range of .06 to + 1.95 mmhg ) . a significant main effect for et-1 genotype ( f[1 , 130 ] = 4.68 , p = .03 ) and a trend for treatment group ( f[2 , 130 ] = 3.01 , p = .06 ) were subsumed within a three - way interaction involving the eds group ( f[2 , 130 ] = 3.01 , p = .05 ) .
the pattern was similar to 24-hour and daytime sbp and is shown in figure 2 .
subsequent analyses revealed no significant interactions or simple main effects for the high eds group . among the low eds group , a significant main effect for et-1 carrier status was found ( fadj[2 , 130 ] = 4.13 , p < .05 ; noncarriers = 1.7 versus carriers = + 1.8 mmhg ) . a significant treatment group main effect ( f[2 , 149 ] = 4.58 , p
= .01 ) was subsumed within a significant three - way interaction ( f[2 , 149 ] = 5.38 , p = .01 ) .
subsequent analyses revealed no significant interactions or simple main effects for et-1 carriers . among et-1 noncarriers a significant two - way interaction between eds and treatment group ( fadj[2 , 149 ] = 6.56 , p < .05 ) and a significant simple main effect among noncarriers ( fadj[2 , 149 ] = 4.28 , p < .05 ) were found .
further examination of treatment group effects among et-1 noncarriers who reported low eds was not significant and all treatment groups showed similar reductions in 24-hour dbp .
examination of treatment group among the et-1 noncarriers who reported high eds was significant ( fadj[2 , 149 ] = 8.38 , p < .05 ) .
post hoc analyses revealed that participants who reported high eds and received bam were significantly different from those who received lst ( 3.4 versus + 2.5 mmhg , p < .05 ) .
the pattern of results is similar to the patterns found across sbp for et-1 noncarriers ; however , magnitude of change was less for dbp compared to sbp . for et-1 carriers ,
however , those who received bam displayed the best results and low eds individuals showed better reduction than those high in eds ( 4.16 versus1.23 mmhg ) .
interestingly , et-1 carriers who received bam and reported low eds had the best improvement compared to other subgroups including noncarriers ( 4.16 mmhg compared to range of 3.26 to + 2.50 mmhg ) . a significant treatment group effect ( f[2 , 146 ] = 3.26 , p = .04 ) was subsumed within a three - way interaction ( f[2 , 146 ] = 3.52 , p = .03 ) which is displayed in figure 3 .
subsequent analyses showed no significant interactions or simple main effects for et-1 carriers . among et-1 noncarriers , a significant two - way interaction between eds and treatment group emerged ( fadj[2 , 146 ] = 4.77 , p < .05 ) .
a treatment group effect was significant among the high eds subgroup ( fadj[2 , 146 ] = 6.07 , p < .05 ) and post hoc analyses revealed that the bam subgroup was significantly different from the lst subgroup ( 3.6 versus + 1.8 mmhg , p < .05 ) .
a significant treatment group effect ( f[2 , 130 ] = 3.91 , p = .02 ) was subsumed within a two - way interaction involving et-1 genotype and treatment group ( f[2 , 130 ] = 3.33 , p = .04 ) . when conducted separately , no significant interactions or simple main effects for et-1 noncarriers
, there was a significant treatment group effect ( fadj[2 , 130 ] = 4.45 , p < .05 ) and post hoc analyses revealed that participants who received bam were significantly different from those who received lst ( 3.6 versus + .74 mmhg , p < .05 ) . although a significant three - way interaction was not observed for nighttime dbp , for comparison purposes , the pattern of changes across et-1 genotype , treatment group , and eds group are displayed in figure 3 .
in this preliminary study , we hypothesized that individuals who were et-1 snp carriers would have greater difficulty in responding to any of our intervention treatments for improving ambulatory bp . in the following
, we also expected et-1 snp carriers who reported high levels of discrimination to be the most difficult to show ambulatory bp reductions .
finally , we hypothesized that bam would have greater beneficial impact upon ambulatory bp reduction compared to lst and hec .
bam participants exhibited greater reductions in 24-hour , daytime and nighttime sbp and dbp compared to the lst and hec groups .
the modulating influences of et-1 snp status and eds were similar across all three ambulatory indices for sbp and dbp . among et-1 snp carriers ,
the only subgroup to show a consistent reduction in sbp and dbp was bam recipients who also reported low eds .
in many cases , the other subgroups showed relatively little reduction or even increases in bp . among et-1 snp noncarriers , all three treatments were helpful in reducing bp among those who reported low eds .
the et-1 lys198asn snp has been shown to play a significant role in vasoconstrictive mediated bp control in normotensive and hypertensive youth and adults [ 23 , 24 , 31 , 34 , 36 ] .
our findings provide further indirect support for the significant role of the et-1 snp in bp control among aas .
for all ambulatory sbp indices , et-1 carrier status was a significant main effect showing fewer improvements compared to noncarriers .
as noted above , bam was the only treatment approach to have success in reducing sbp among et-1 snp carriers and only if they reported low eds .
it appears that among aas , behavioral stress bp reduction programs such as bam and lst may have difficulty in countering the combination of increased genetic propensity for stress - activated ans imbalance / et-1 activation and high frequency of environmental stress exposure [ 23 , 24 , 26 , 34 ] . the cognitive skills - based program ( lst ) only benefitted et-1 noncarriers and only if they reported low eds .
acquisition of the lst skills ( e.g. , reflective listening , assertiveness without aggressiveness , etc . ) may require the entire 12 weeks .
perhaps implementation of these newly learned skills in interpersonal conflict prone environments initially results in augmented vigilance and sympathetic / endothelial system activation , rather than reductions of such .
the slight increase in ambulatory sbp among lst subjects who reported high eds supports this rationale .
future studies would benefit from the utilization of repeated ambulatory bp and biomarker monitoring evaluations ( e.g. , total peripheral resistance , cardiac output , and nocturnal dipping ) , along with concomitant self monitoring of stressful encounters , affective states , coping responses , rumination , and using technological advances in cell phone capabilities .
this was an exploratory ancillary analysis of an rct , and subgroup cell sizes were relatively small .
we examined potential confounding influences of sex , bmi , physical activity , and smoking and did not detect significant subgroup differences at preintervention or in response to the interventions .
the issue of relatively small sample sizes within the three - way interactions can best be addressed by replication with larger sample sizes .
one approach to consider would be to capitalize upon archival bp reduction rcts that involved stress reduction programs and if not available , we would aquire dna samples from the participants .
we speculate that bp control improvements among bam participants may have been partially a result of improved ans balance / et-1 activity .
several previous findings showed that bam also reduced overnight sodium excretion purportedly through a reduction in sodium appetite .
however , decreased sodium appetite is a correlate and not an adequate surrogate measure of ans / et-1 activity . the dynamic interplay between biological systems related to bp control warrants inclusion of biological measures of multiple systems and investigation of the interactions among pathways including the endothelial , ans , renin - angiotensin and aldosterone , and hpa axis [ 25 , 38 ] .
as noted earlier , retrospective post hoc analyses of meditation based bp rcts involving prehypertensives and hypertensives ( especially those involving aas ) may lend some support to whether the relationships found in this study translate to others .
finding similar patterns of ambulatory bp changes among et-1 snp status and other indices of chronic stress exposure would augment support for bam as a viable approach for inclusion in nonpharmacologic programs aimed at the prevention of eh and cvd among certain subgroups of individuals ( e.g. , et-1 snp noncarriers , and carriers from low stress environments ) .
the ease of bam administration allows it to be practiced in virtual any setting ( i.e. , public schools , churches , recreation centers , and homes ) adding to its utility to become part of multifaceted dissemination efforts to help decrease cvd morbidity and mortality .
unfortunately , our study found none of the behavioral stress reduction programs were beneficial among et-1 snp carriers who reported high eds exposure . if our results are replicated , exploration of alternative behavioral and/or pharmacologic approaches that target endothelial function is warranted .
part of the study inclusion requirements was no current or planned engagement in a formal exercise , health promotion , or organized sports programs outside of regular school physical education courses , and the measures we used for physical activity were not differently influenced by the subgroups
. however , behavioral interventions that are directed specifically at enhancing high - intensity physical activity may be beneficial .
aerobic exercise training has been shown to inhibit vasoconstrictive ( e.g. , endothelin-1 ) and promote vasodilatory ( i.e. , nitric oxide ) mechanisms related to bp control providing evidence as a potentially effective therapeutic strategy [ 6567 ] .
specific to the et-1 lys198asn snp , rankinen et al . found a two fold higher risk of hypertension among low aerobically fit carriers , whereas , aerobically fit carriers ' hypertension risk was comparable to noncarriers .
additional research is needed to determine if physical activity can specifically benefit aa et-1 carriers who report high levels of background stress .
for some individuals , a gene x environment personalized behavioral intervention approach may not improve bp control to desired levels .
several large - scale pharmacologic rcts have proven beneficial in reducing onset of eh in prehypertensive adults [ 68 , 69 ] . among et-1 snp carriers , an endothelin type
a receptor antagonist may help foster vasodilation - mediated bp control . in a recent study , weber et al .
found darusentan , a selective endothelin type a antagonist , to control treatment resistant hypertension .
in summary , the findings provide preliminary evidence of some of the underlying contributors that may have moderated bp reductions but were not examined in previous meditation rcts .
one - size fits all approaches to primary and secondary preventive health - care are being replaced with strategies described as preventive , predictive , personalized , and participatory . increasingly , behavioral and pharmacologic interventions are being tailored on the basis of individual 's underlying genetic propensities and environmental factors ( e.g. , attitudes , stress exposure , etc . ) .
personalized medicine is in its infancy , but eventually , via empirical scrutiny , more efficacious best practice prevention and treatment approaches will evolve .
the end result will help reduce the incidence of chronic diseases and improve the quality and longevity of life among those with these diseases . | stress - activated gene environment interactions may contribute to individual variability in blood pressure reductions from behavioral interventions .
we investigated effects of endothelin-1 ( et-1 ) lys198asn snp and discriminatory stress exposure upon impact of 12-week behavioral interventions upon ambulatory bp ( abp ) among 162 prehypertensive african american adolescents .
following genotyping , completion of questionnaire battery , and 24-hour abp monitoring , participants were randomized to health education control ( hec ) , life skills training ( lst ) , or breathing awareness meditation ( bam ) .
postintervention abp was obtained .
significant three - way interactions on abp changes indicated that among et-1 snp carriers , the only group to show reductions was bam from low chronic stress environments . among et-1 snp noncarriers , under low chronic stress exposure ,
all approaches worked , especially bam . among high stress exposure noncarriers ,
only bam resulted in reductions . if these preliminary findings are replicated via ancillary analyses of archival databases and then via efficacy trials , selection of behavioral prescriptions for prehypertensives will be edging closer to being guided by individual 's underlying genetic and environmental factors incorporating the healthcare model of personalized preventive medicine . |
dictybase ( ) is the model organism database ( mod ) for the social amoeba dictyostelium discoideum . like other mods such as flybase ( 1 ) , wormbase ( 2,3 ) , mouse genome informatics ( 4 ) and the saccharomyces genome database ( sgd ) ( 5 ) ,
dictybase ( 6 ) uses the organism 's genome sequence to organize the biological knowledge resulting from experimental studies using dictyostelium .
an amoeba during most of its life , starvation induces a very interesting developmental program during which individual cells stream together by chemotaxis to form a multicellular tissue ( 7 ) .
a morphogenetic process involving cell migration and cellular morphogenesis transforms a simple mound of cells into a slug or pseudoplasmodium establishing a relatively simple developmental pattern .
this structure then develops into a fruiting body consisting of multiple cell types including spores and terminally differentiated stalk cells . these features together with the efficient genetic manipulation by gene targeting and replacement as well as insertional mutagenesis and suppressor screens have made dictyostelium a popular experimental system .
research using dictyostelium has been critical in understanding fundamental processes such as cell migration ( 8) , cell signaling ( 9,10 ) , phagocytosis and morphogenesis .
recently dictyostelium has also been used to help establish the mechanisms of action of medically important drugs such as cisplatin ( 1114 ) , used to treat various cancers , and lithium and valproic acid ( 15 ) , used to treat depressive disorders .
the recently completed dictyostelium genome sequence is housed at dictybase and has been integrated with other experimental data to provide investigators with a rich new resource that will facilitate future studies using dictyostelium experimentally and for comparative genomics .
in may 2005 the sequence of the complete genome of dictyostelium was reported ( 16 ) .
the a + t rich genome ( 77.6% ) consists of 34 million bases of dna sequence that are predicted to encode 13 573 genes a number of genes comparable with drosophila . dictybase houses and maintains the genome sequence produced by the international sequencing consortium . as the first free living protozoan to be completely sequenced
, the predicted proteome supports the hypothesis that dictyostelium represents an early branch in the eukaryotic tree of life that diverged after the split between animals , plants and fungi , with dictyostelium and other amoebae more closely related to animals .
many dictyostelium proteins are more similar to human orthologs than are those of saccharomyces cerevisiae .
the abundance of short sequence repeats produces unusual runs of amino acids , such as polyasparagine and polyglutamine tracts of 20 residues or more .
the genome also contains a surprisingly large number of polyketide synthases , which may produce a previously unanticipated large complement of natural products .
consistent with this apparently large secondary metabolism , the genome contains many abc transporters that may be involved in export of these natural products .
also encoded are a large number of proteins containing multiple egf repeats that have been postulated to play roles in adhesion or cell recognition .
these fascinating genomic features together with the unique biology of dictyostelium and the rich body of dictyostelium literature ( nearly 8000 publications ) provide a valuable opportunity to annotate many of the genes with functional information that will widen the spectrum of characterized proteins in public databases .
this emphasizes the need for a well - curated database for dictyostelium a need .that dictybase strives to fulfill .
as the mod for d.discoideum , dictybase provides highly curated information that facilitates research by providing a searchable , structured repository of dictyostelium experimental results .
in addition to the complete genome sequence , groups performing high - throughput experiments such as large - scale mutagenesis and microarray - based gene expression studies are depositing their data in dictybase for integration and distribution to the research community . dictybase uses the genomic dna sequence as a scaffold on which to organize and display the biological knowledge and experimental evidence derived from dictyostelium research .
dictybase is the most comprehensive source of information regarding dictyostelium , and the database presents the highest quality annotations of dictyostelium genes .
nearly all of the data in dictybase is available for bulk download through our download center ( ) .
a gene page is available for each gene that has been shown or predicted to exist in the genome .
the gene page collects and organizes all of the available information related to that gene into several sections .
a general information section provides the official gene name together with any other names that have been used to refer to that gene .
this assures that a search of the database will allow retrieval of a gene using any name that has been used to refer to that gene .
scientific curators verify published and proposed gene names to encourage use of the dictyostelium nomenclature guidelines ( ) and to ensure that names are not duplicated .
also in this section , gene product names and a brief description of the gene product are presented , as is the unique dictybaseid .
next , the chromosomal coordinates section presents a graphical view of the gene and associated sequences such as expressed sequence tags ( ests ) , cdnas and other genbank entries .
an associated sequences section provides links to sequences corresponding to each of the sequence features known for that gene , including gene predictions as well as ests , cdnas and genomic sequences submitted by individual researchers to other public databases .
the protein information section contains the size , molecular weight and protein domains of the predicted protein .
functional information is presented in sections for gene ontology ( go ) annotations and phenotypes whenever this information is available .
phenotypic data is represented using a restricted vocabulary that describes the consequences of mutations reported for that gene .
the gene ontology section lists terms from each of the function , process and component ontologies associated with the gene ( 17,18 ) .
following links in each of these sections display additional details for these annotations . clicking on a go term or
the expression section leads to developmental profiles for the gene that have been generated by large - scale microarray based studies performed at the baylor college of medicine and the university of california , san diego .
the links section on the gene page provides links to genbank , uniprot , genedb at the sanger institute and , where appropriate , to signaling pathways at the signal transduction knowledge environment at science ( 19,20 ) .
this section also links to researchers in our colleague database who are investigating that gene or gene product .
a literature section lists the most recent publications referring to the gene and a link to a literature guide that contains a complete listing of papers relevant to that gene . as of the fall of 2005 ,
> 500 gene pages had a summary paragraph written by a dictybase curator that contains the current knowledge regarding that gene .
dictybase curators are in the process of manually reviewing all of the automated gene predictions in light of available data such as ests and cdnas .
dictybase curators have reviewed nearly 2500 genes , which corresponds to 20% of the total number of genes .
dictybase also serves as a clearinghouse for resource materials for students , researchers and educators using dictyostelium in a wide range of classroom and laboratory settings .
we maintain archives of the dictynews , a weekly electronic newsletter that presents abstracts of papers available upon acceptance for publication , as well as a growing collection of protocols for working with dictyostelium .
this resource provides access to dictyostelium strains , including natural isolates , targeted mutants and gfp labeled strains .
the collection also contains plasmids used to manipulate gene expression or create targeted gene disruptions .
currently the dsc has > 700 strains and > 150 plasmids all available to researchers .
a shopping cart system allows stock center users to add strains and proceed to a checkout system familiar to any user of online ordering systems . for users who are also registered as colleagues in the dictybase colleagues database , addresses for delivery and contact information
dictybase holds all of the stock center data and provides the informatics support for the dsc .
dictybase was initially established as a clone of the software developed and generously provided by sgd .
these include the gbrowse tool for chromosome and map displays and , most recently , the chado database schema for storing sequence and sequence feature information .
this entailed porting of the chado schema to oracle since both dictybase and sgd are implemented in oracle .
dictybase has developed new code that separates communication with the database from code that generates the html interfaces .
this object layer facilitated adoption of the chado schema without significant impact on the presentation interface and enables good software practices such as unit testing .
dictybase strives to present a comprehensive , reliable , carefully curated dataset that integrates sequences , functional annotation , phenotypes , expression data and the research literature , while retaining the flexibility to integrate new data types as they become available .
our goal is to assure that the information in dictybase is accessible in an effective and intuitive interface useful for biologists , while also maximizing its utility for the bioinformatics community to use computationally .
our operating principles are to respond to users ' needs , to capitalize on the vast efforts of the dictyostelium research community , and to provide an important link in the network of mods .
as additional amoebae genome sequences become available dictybase hopes to implement , and where necessary , develop interfaces and tools that facilitate comparative genomics of this diverse group of organisms .
this sample gene page shows the types of information that are displayed on a dictybase gene page . | dictybase ( ) is the model organism database ( mod ) for the social amoeba dictyostelium discoideum
. the unique biology and phylogenetic position of dictyostelium offer a great opportunity to gain knowledge of processes not characterized in other organisms .
the recent completion of the 34 mb genome sequence , together with the sizable scientific literature using dictyostelium as a research organism , provided the necessary tools to create a well - annotated genome .
dictybase has leveraged software developed by the saccharomyces genome database and the generic model organism database project .
this has reduced the time required to develop a full - featured mod and greatly facilitated our ability to focus on annotation and providing new functionality .
we hope that manual curation of the dictyostelium genome will facilitate the annotation of other genomes . |
everyday life experience shows that playing a video game , learning how to drive a car , doing math homework , or performing another cognitively demanding task may affect breathing . in some cases respiration
tends to be inhibited ; in other cases it seems to accelerate and/or its volume changes . in general , little is known about respiratory alterations under cognitive load . as a consequence ,
it is not clear whether respiration could be used as a reliable indicator of cognitive load . in human factors and ergonomics ,
aims at predicting operator performance ( e.g. , pilot selection ) and optimizing working conditions ( e.g. , cockpit design ) in order to enhance performance and comfort . for this purpose ,
physiological parameters have been considered valid indicators of cognitive load as they are hypothesized to reveal task - related arousal states in the operator .
mental load is assumed to be high when the required resources for a satisfactory task completion exceed operator capacity [ 13 ] .
importantly , the concept of mental load should be differentiated from mental stress . as pointed out by gaillard and wientjes , arousal due to mental stress
is characterized by negative feelings such as anxiety or frustration while mental load is accompanied by neutral or even positive feelings as being challenged .
both concepts assume that the individual experiences some discrepancy between environmental demands and one 's coping resources and initiates extra effort . under mental load , the individual focuses on accomplishing the task and on performance monitoring whereas under stress , the individual is mainly concerned with threats and protection of the self . in the literature , however , the two concepts are often confounded in terms of terminology or experimental implementation .
for the manipulation of mental load , researchers typically apply cognitive tasks such as mental arithmetic or stroop tests .
these tasks have in common that they involve several aspects of cognitive processing such as perception , controlled attention , reasoning , memory , problem solving , decision making , and inhibitory control , as well as cognitive control of speech and motor activity inasmuch as this is required for performance .
study designs differ in whether a concurrent performance feedback is provided or not . on the one hand
, researchers argue that permanent feedback is necessary for an individual 's monitoring of the process and a corresponding regulation of energetic state [ 6 , 7 ] .
on the other hand , performance feedback while accomplishing the task may cause psychological stress in addition to the cognitive task demands [ 4 , 8 , 9 ] . investigating the concept of mental load
dates back to the 1970s and has generated a broad number of different methods that are generally categorized into self - report measures , performance - based measures , and physiological measures . in the past
, self - report measures have often been regarded as less reliable and valid than objective performance scores and physiological data , but today 's prevailing view considers the different methods as reflecting different aspects of operator load . as a consequence , present research and real - life assessments in human factors and ergonomics are usually based on a combination of self - report , performance , and physiological measures .
existing reviews on physiological correlates of cognitive load show that research efforts have mainly been devoted to cardiovascular , electrodermal , and brain activity measures [ 1114 ] , while comparatively less research has investigated whether and how respiration is sensitive to cognitive load .
respiration is the biggest oscillator in the body that is involved in regulating processes in response to environmental demands and in maintaining homeostasis .
the respiratory rhythm is known to be generated by pacemaker neurons which are located in the lower brainstem [ 15 , 16 ] .
for example , during cognitive as well as emotional demands , the respiratory rhythm is impacted by suprapontine influences , reflecting also limbic and paralimbic influences [ 1719 ] .
while many of the available studies on respiration applied rudimentary measurement techniques , more recent studies have adopted assessment methods from respiratory physiology and integrated more sophisticated parameters providing additional insights into breathing behavior under cognitive load ( e.g. , variability measures , see ) . in general , research in respiratory psychophysiology in healthy populations
is based on measures reflecting time , volume , and gas exchange aspects of breathing .
the most common parameters are respiratory rate ( rr ) and respiratory amplitude which corresponds to tidal volume ( tv ) , the amount of air that is inspired during one respiratory cycle .
minute ventilation ( mv ) refers to the amount of air that is inhaled in one minute and is hence contingent upon rr and tv .
further time and volume parameters that are analyzed frequently are inspiratory time ( ti ) and expiratory time ( te ) , as well as inspiratory volume ( vi ) , which equals tv and expiratory volume ( ve ) , and the timing ratio of inspiration to expiration ( ti / te )
. also mean inspiratory flow rate ( tv / ti ) and inspiratory duty cycle ( ti / ttot ) are occasionally calculated , both quotients indicating the activity of underlying respiratory drive mechanisms ( see ) .
specific response measures such as sigh rate ( sr ) and the proportion of ribcage breathing to vi ( % rci ) have rarely been reported in the literature .
in addition to basic time and volume parameters , corresponding variability measures have been computed to quantify total variability by using statistical variance ( var ) or the coefficient of variation ( cv ) as well as structured variability by using the autocorrelation ( ar ) of successive breaths .
since total variability is considered to comprise structured and random portions [ 20 , 22 ] , which might be affected differently by environmental demands , total variability measures should be interpreted together with a measure of correlated variation . among the gas exchange parameters ,
partial pressure of end - tidal carbon dioxide ( petco2 ) , an estimate of arterial pco2 , is particularly interesting since reduced co2 values generally indicate that ventilation is in excess of metabolic need . also oxygen consumption ( vo2 ) and co2 production ( vco2 ) , which usually covary with mv , as well as the proportion of released co2 to inhaled o2 ( respiratory exchange ratio , rer ) have been investigated to determine energy expenditure in demanding situations .
since most of the outlined measures may vary with age , gender , and physical fitness , it is useful to take possible control variables into account when investigating respiratory reactivity in healthy individuals [ 2326 ] . apart from person - related covariates , verbal activity during data acquisition can influence time and volume parameters .
speech production requires a coordination of articulatory and respiratory movements which can override the regular respiratory rhythm [ 27 , 28 ] and typically leads to a shorter ti , accompanied by increased airflow velocity , and to a longer expiratory time together with decreased airflow velocity [ 29 , 30 ] .
in addition , speech and motor activity can cause artifacts in the recording process . while spirometric and capnographic methods directly sampling from mouth and nose are inevitably affected by vocal activity ,
electronic signals of impedance - based methods are particularly prone to motion [ 31 , 32 ] . as a consequence ,
most researchers counter such artifacts by selecting tasks that require a minimum of speech and motor activity and by instructing participants not to talk or move during the periods of data acquisition , unless it is required .
general measurement techniques to quantify respiration in healthy individuals comprise spirometry , respiratory inductive plethysmography , strain gauges , impedance - based methods , capnography , and metabolic analyzers . while all these techniques are usually suited to record timing parameters , the amplitude of breathing can only be assessed by a direct measurement of lung volume ( using spirometry ) or indirectly through changes in girth of thorax and abdomen ( using strain gauges or respiratory inductive plethysmography ) or through changes in impedance of the thorax .
spirometric devices such as spirometers , flowmeters , and pneumotachographs provide accurate assessments of vi and ve but also require participants to wear a facemask , a mouth- or noseclip that , in itself , may alter the respiratory behavior . most common is the use of inexpensive strain gauges , converting mechanical strain into voltage , and inductive plethysmography , measuring self - inductance in transducer bands .
both techniques are unobtrusive and easy to handle . however , without a constant and valid calibration procedure they do not provide absolute measures of respiratory depth .
hence , it has been suggested to estimate rr and amplitude by means of spectral analysis from the impedance cardiography signal [ 3436 ] since respiratory and cardiac monitoring are often combined .
petco2 is mainly assessed by means of a capnograph with infrared spectrography and a sampling site that is attached to the mouth and/or nose . for the combined determination of vo2 and vco2 ,
metabolic measurement systems are used which commonly are equipped with paramagnetic o2 and infrared co2 sensors .
due to the direct sampling from mouth and nose , also capnographs and metabolic analyzers are rather intrusive but , on the other hand , they provide accurate and absolute assessments of respiratory parameters .
the objective of this review was to provide an overview on empirical studies examining the respiratory effects of cognitive load for research and application purposes such as monitoring operator load .
specifically , we aimed at analyzing all published results provided by a search in electronic databases that investigated changes in at least one respiratory measure from a baseline to a task period characterized by any kind of cognitive load .
we further integrated findings on respiratory sensitivity to different levels of task difficulty as well as findings on the effect of task duration .
finally , we made a comparative evaluation of respiratory reactivity under experimental conditions with and without concurrent performance feedback .
electronic database searches of psycinfo , pubmed , and web of science were conducted using the following terms without a priori publication date restrictions : [ cognitive or mental or attentional ] and [ load or workload or stress or effort ] and [ respirat or breath or co2 ] .
[ cognitive or mental or attentional ] and [ load or workload or stress or effort ] and [ respirat or breath or co2 ] .
the remaining 183 references were subjected to a detailed screening based on the full papers .
we selected journal publications in english language reporting original data on respiratory measures in response to cognitive task load .
study samples had to consist of healthy adult participants breathing spontaneously during at least one period of data acquisition under cognitive load .
clinical studies and experiments that entailed physical activity , emotion induction , physical or psychosocial stress ( e.g. , cold pressor , public speech ) , manipulated or controlled breathing , or pharmaceutical intervention were only selected if respiratory data were reported for a control group or control condition ( i.e. , spontaneous breathing without any manipulation other than cognitive load ) , respectively . for those studies ,
further inclusion criteria were data acquisition during rest for the analysis of baseline - to - task changes as well as a limited level of movement activity and speech , which might in itself impose respiratory changes . strictly speaking ,
studies were excluded if participants were allowed to move and/or to speak more than briefly indicating a required task response by moving a mouse cursor or saying a single word or number .
if authors disagreed , the procedure was repeated for the corresponding reference after discussing the prevailing concern .
a total of 53 journal articles evaluating respiratory parameters in response to cognitive task load and meeting the selection criteria were included in this review .
study characteristics and findings were extracted from every publication and listed . during the process of data
acquisition and integration , this list was completed with additional variables that appeared relevant and eventually covered the following information : first author , publication year , sample size and characteristics , type of experimental manipulation , duration of analyzed task period , respiratory outcome measures and measurement techniques , additional information on verbal activity and performance feedback , and the reported findings on respiratory changes in response to cognitive task load including possible effects of task difficulty and duration ( if analyzed ) .
table 1 summarizes the study characteristics of 54 experiments which are reported in 53 articles .
the experimental tasks to induce cognitive load were categorized according to the cognitive processes primarily required for accomplishing the task ( i.e. , attention , reasoning , short - term or working memory , psychomotor coordination , and vigilance ) or according to the respective task type / paradigm if more than one major facet of cognitive control was required ( i.e. , stroop , mental arithmetic , choice reaction time , and multitasking ) .
operator load was most often manipulated by administering mental arithmetic or multiple tasks , followed by attention , memory , stroop , reasoning , and psychomotor tasks . as depicted , rr is the only variable that has been analyzed in all studies under review .
apart from tv and mv , all other parameters have been evaluated in fewer than seven studies . to collect respiratory signals , most of the studies used a strain gauge or an inductive plethysmograph , which are not intrusive and relatively easy to handle .
however , spirometry , capnography , and impedance plethysmography were also conducted in at least five of the reviewed studies .
a detailed list of the studies included in the present review is shown in table 2 .
as indicated , the duration of task period that was extracted for data analysis varied between 30 and 1800 sec , with 57% of the studies choosing sampling periods lasting between 180 and 300 sec .
four of the seven studies requiring a verbal task response systematically investigated the effect of verbal activity on respiratory changes under cognitive load [ 3841 ] .
one of these studies systematically compared respiratory reactivity to cognitive task load with and without performance feedback . to integrate the findings on respiration under cognitive load , we coded baseline - to - task changes for every respiratory outcome measure as increasing ( ) , decreasing ( ) , or not significantly changing ( ) at p < .05 .
if a study included more than one experimental period ( trial ) , reported findings were counted according to the number of trials ( e.g. , twice if a study reported an increase in two trials ) .
table 3 displays overall effects as reported by more than 50% of the reviewed studies .
if two different effects were revealed by an equal number of studies or experimental periods ( e.g. , increase and decrease were found in five studies each ) , we coded the overall effect accordingly as , , or . the same procedure was applied to review respiratory changes in response to different levels of task difficulty ( n = 14 ) as well as changes in respiratory reactivity over time ( n = 6 ) . in order to evaluate the magnitude of effects , we computed standardized mean differences for every significant baseline - to - task change for which the required descriptive data were available . in sum , 50% of the reviewed studies reported their significant findings together with mean ( m ) and standard deviation ( sd ) or standard error ( se ) scores for either baseline and task conditions or for the discrepancy between baseline and task .
as a measure of effect size , we calculated whenever feasible cohen 's d for each respiratory parameter using pooled sd and adjusted for small sample bias if less than 50 participants were included in the reported analysis . for a comparative summary of the obtained effect sizes
, we additionally computed a sample weighted mean effect size for each measure [ 90 , 91 ] .
as illustrated in figure 1 , the most robust measure is rr which is based on a total sample of 930 individuals .
a solid data base yielded by more than three studies was further available for tv and mv , showing that strong effects are also reported for mv while tv should not be regarded as a robust measure . in the following , we present the integrated effects for each respiratory measure .
corresponding effect sizes are reported and evaluated if ( a ) the overall effect for the respective measure indicates an increase or decrease and ( b ) at least one study confirming to the overall effect was available for calculating cohen 's d. as shown in table 2 , the breathing pattern under cognitive load was mainly characterized by faster respiration than during baseline . following the guideline by cohen ,
five studies suggest small effects ( .20 d < .50 [ 20 , 38 , 45 , 47 , 88 ] ) , six studies suggest medium effects ( .50 d < .80 [ 20 , 47 , 60 , 61 , 66 , 69 ] ) , and 20 studies suggest large effects ( d .80 [ 38 , 41 , 42 , 45 , 46 , 51 , 54 , 58 , 6366 , 68 , 73 , 76 , 79 , 80 , 82 , 87 ] ( two studies reported in ) ) for the increase in rr . for one study ,
the calculated effect size indicates that the significant increase in rr while performing a vigilance task can be considered negligible ( d = .12 ) .
table 2 further shows that higher task difficulty resulted in an additional increase of rr .
those studies providing data for calculating effect sizes on different levels of task difficulty indicate that the increase in rr changed from small to medium effects and from medium to large effects [ 45 , 66 ] when the task became more difficult in a parallel fashion .
while the studies including tv are rather inconsistent and mainly reported no significant changes from baseline to task , mv increased in all studies with two studies suggesting large effects [ 42 , 66 ] and one study suggesting a small effect for the increase in mv .
overall , reactivity patterns were further marked by a reduced correlated variability ( ar ) of rr with two studies indicating medium effects [ 20 , 58 ] , whereas total variability ( var , cv ) of rr was mostly invariant to cognitive load .
capnographic measures show that petco2 levels were lower during task performance ( d = .26 ; ) , while vo2 and vco2 were higher during the task and vco2 additionally elevated with increasing difficulty .
effect sizes for the increase in vo2 ranged from small [ 46 , 63 ] to medium and large effects and from medium to large effects for the increase in vco2 .
the available data suggest that both low and high levels of task difficulty elicited a medium increase in vco2 from baseline to task .
the two studies including rer revealed opposite results , one increasing and one decreasing from baseline to task .
however , the same number of studies provides support that elevations in rate persisted over time or from trial to trial . across all trials ,
the analyzed task period averaged 1550 sec for the studies indicating habituation and 2270 sec for the studies reporting no change in reactivity .
respiratory reactivity effects published in the seven studies that required verbal responding to the cognitive task [ 3840 , 47 , 50 , 70 , 88 ] largely correspond with the overall effects : an elevated rr ( available effect sizes are provided below ) and no change in respiratory waveform ( ti / te ) .
tv , however , was found to decline from baseline to tasks with verbal responding in one out of three studies analyzing tv .
the only study including respiratory variability reported a decrease in total variability of rr , which is not in line with the overall effects outlined above .
in addition , it has to be noted that the systematic investigation revealed significant differences between silent and aloud conditions in three out of four studies : in one study , rr was found to be increased only in the aloud condition of a stroop interference task ( d = 6.40 ) while in two other studies , rate was found to be increased only in the
silent condition of a mental arithmetic task ( d n / a , d = 1.88 ) .
furthermore , a reduced tv has been reported exclusively when participants remained silent , which conflicts with the finding mentioned above , as well as a reduced ti / te when participants indicated their response verbally ( d n / a ) . when comparing the respiratory measures from experimental conditions with and without concurrent performance feedback that were investigated by a minimum of three studies , we found for both conditions an increase in rr and in mv from baseline to task .
effect sizes were available for ten studies with at least one feedback condition , suggesting small [ 20 , 47 , 88 ] as well as medium [ 20 , 47 , 60 , 61 , 69 ] and large effects [ 51 , 68 , 80 , 87 ] for rr and small as well as large effects for mv .
the available 16 studies with at least one no - feedback condition mainly suggest large effects for rr [ 38 , 41 , 42 , 45 , 46 , 54 , 58 , 6366 , 73 , 76 , 79 , 80 ] and mv .
interestingly , the implementation of feedback was mostly associated with a decrease in tv , two studies indicating small effects ( d = .27 , d = .26 ) and one indicating a large effect ( d = 2.51 ) , whereas the experiments not providing feedback did not show significant changes in tv .
the direct comparison of feedback and no - feedback conditions within a single experiment revealed no significant differences in reactivity for any respiratory parameter under study ( rr , tv , mv , tv / ti , ti / ttot , and petco2 ) .
this study was conducted to review the available literature on respiration under cognitive load by integrating findings on respiratory changes from baseline to task and possible effects of task difficulty , task duration , and concurrent performance feedback .
in addition , we surveyed the methods used to manipulate cognitive load and to quantify respiration and separately analyzed respiratory changes from baseline to tasks that required verbal responding .
the present findings show that cognitive load was accompanied by a clear increase in rr . of note , 48% of the reviewed studies indicated medium to large effects for the increase from baseline to task . also , higher levels of task difficulty resulted in an additional increase of rr . while tv appeared to be insensitive to cognitive load , mv , following logically from the increase in rr without changes in tv , showed a consistent increase from baseline to task .
since mv was , however , not sensitive to different levels of task difficulty and predominantly reflects the increase rr , we conclude that , for the assessment of operator load , mv does not provide incremental information over the more convenient frequency measure .
this general increase in ventilation has been explained by a higher metabolic rate during performance but also by psychological processes such as learned anticipation of metabolic need [ 9395 ] .
while human and animal research on limbic and paralimbic influences on breathing is still scarce , available evidence suggests that an increase in cognitive as well as emotional impact is associated with corresponding changes in neural activity not only in the brainstem but also in the limbic and paralimbic regions , particularly amygdala and anterior cingulate cortex [ 17 , 96 ] , the latter being a key prefrontal region that is also involved in executive function [ 9799 ] .
the timing parameters discussed in the following have been investigated by less than three studies and should thus be interpreted with caution .
considering the increase in rr , a shorter ti and an invariant ratio of ti to te signify a shortening of both ti and te under cognitive load .
the reported increase in tv / ti was observed together with no changes in ti / ttot , indicating that the overall elevations of ventilation are rather caused by a higher intensity of the central inspiratory drive mechanism ( [ 21 , p. 106 ] ) than by alterations in timing .
however , pattyn et al . provide support that also the timing mechanism might trigger the increase in ventilation under cognitive load , suggesting that additional studies are needed to clarify the underlying mechanisms of ventilatory changes .
frequency of sighing under cognitive load was investigated by two studies [ 20 , 86 ] showing that sr increased in response to mental arithmetic .
the authors assume that sighing counteracts erratic breathing patterns which may occur under cognitive load .
also in the present study , cognitive load consistently elicited a decrease in correlated variability of rr while , overall , total variability of rr did not change from baseline to task .
. only total variability of tv has been reported to increase considerably during mental arithmetic [ 20 , 86 ] . moreover ,
cognitive load was shown to be associated with reduced petco2 , indicating hyperventilation , and higher levels of vo2 as well as vco2 , which are usually assessed to track energy expenditure .
it has to be noted , however , that petco2 is a fractional measure , not allowing conclusions about absolute co2 levels , and that the relationship between etco2 and vco2 is contingent on alveolar ventilation which could have differed between the respective samples .
vco2 is the only capnographic measure that demonstrated medium to large effect sizes and was sensitive to increasing task difficulty , which suggests that mental effort actually entails additional energy expenditure ( see also ) .
however , petco2 was consistently reported to decrease whereas findings on vco2 did not entirely point in the same direction .
since petco2 additionally provides information on whether ventilatory changes in response to cognitive load correspond to actual changes in metabolic demand , both petco2 and vco2 are promising indicators of cognitive load .
only six studies analyzed respiratory changes over the course of the cognitive task or from trial to trial .
for most variables , these studies revealed no change as well as inconsistent findings for the habituation of rr .
hence , changes in respiratory reactivity over time also require further investigation . by specifying a priori selection criteria
, we obtained a database of experimental studies on cognitive load with an acceptable degree of consistency regarding study design and the induction of operator load .
although performance feedback during cognitive tasks has been assumed to elicit stress responses comparable to the effects of social evaluative threat [ 4 , 100 , 101 ] , we decided not to exclude these studies but to analyze them additionally in comparison with studies not providing feedback .
also , we did not exclude any study applying verbal - response tasks in order to maintain a sufficiently large sample of studies .
instead , we accepted studies with a limited amount of verbal activity and additionally evaluated them separately in a subanalysis .
as summarized above , most of the studies manipulated cognitive load by means of mental arithmetic or multitasking .
the 11 studies including more than one type of cognitive task in their experimental design ( see table 2 ) imply that the magnitude of respiratory effects may vary depending on the given types of cognitive demands . particularly sigh rate and respiratory variability measures have been shown to be differently altered by mental arithmetic and attentional tasks [ 20 , 70 , 86 ] .
however , the current database is insufficient for a systematic investigation of respiratory responses to various facets of cognition . also the findings reported by roman - liu et al
. suggest that vigilance behavior , involving uninterrupted attention on the detection of infrequent signals , is characterized by particular respiratory changes which should be addressed in future studies . in a separate analysis
in general , the reviewed studies imply that performance feedback on cognitive tasks is only accompanied by a decrease in tv , which has not been observed in the overall findings outlined above .
since decreases in tv have also been reported for negative emotions such as anxiety and sadness , we conclude that a concurrent feedback may have emotional impact on the operator , inducing stress rather than mental load ( see also [ 4 , 8 , 9 ] ) , and should thus be avoided in future experiments on cognitive load .
unfortunately , no data were available to evaluate the effect of performance feedback on variability measures .
our survey revealed that most of the studies used recording techniques that are not directly disturbed by speech .
but since respiration itself may be affected by verbal activity , we additionally reviewed the seven studies involving speech . in sum , the findings were inconsistent and generally corresponded to the overall effects .
however , the systematic comparison of verbal- and manual - response conditions also revealed some indication for erratic breathing patterns as well as shorter inspiration and longer expiration phases when performing a mental arithmetic with verbal responding . given that this is in line with the existing knowledge about the interplay of speech and respiration [ 29 , 30 ] and that manual responding is easy to integrate in computerized task designs , we suggest evaluating respiratory measures for the assessment of operator load only under silent conditions .
first , our analyses were restricted to published journal articles and we found some indication for publication bias , meaning that analyses on respiratory parameters with insignificant results were reported less often .
for instance , some studies described the measurement of single variables without mentioning the according results .
as displayed by the integration of reactivity effects , however , a considerable number of studies also reported respiratory measures showing no changes from baseline to task .
second , only 50% of the reviewed studies provided data for a determination of respective effect sizes .
third , the present integration of findings was not weighted according to sample size and quality criteria as required for the statistical data integration in meta - analyses , since larger samples are supposed to increase the precision of findings [ 37 , 103 ] .
this choice was made because the magnitude of effects could be quantified only in 50% of the studies , suggesting a qualitative comparison .
but we followed the recommendations by durlak to adjust the obtained effect sizes for small sample bias .
fourth , comparability of the reviewed studies is limited due to heterogeneous study samples and possible differences regarding the motivation of participants ( experimental context , instructions , and incentives ) and study design ( randomization of trials with modified task difficulty ) .
fifth , only a small number of studies mentioned to have included potential confounders ( covariates ) in their analyses such as age and what possibly could lead to an over- or underestimation of effects .
sixth , only a few studies mentioned whether participants were allowed to switch from nasal to oral respiration or vice versa .
we assume , however , that studies using methods with a direct sampling from nose and/or mouth instructed individuals accordingly to breathe only through their nose or mouth within the experimental periods .
finally , except for rr , tv , and mv , only few studies were available reporting data for addressing the present research question .
as a consequence , it was further not possible to investigate whether respiratory responses vary as a function of different types of cognitive processing .
the primary aim of this study was to investigate whether respiratory parameters are useful indicators of cognitive load in addition to other physiological correlates and well - established performance and self - report measures .
we found evidence that rr is a sensitive measure of operator load which can be obtained easily and inexpensively by using a strain gauge . while at first sight tv and mv may contain little additional information , correlated variability in rr , sigh frequency , petco2 , vo2 , and vco2 are promising measures for research and application purposes as they appear to be sensitive to cognitive load and , furthermore , reflect some of the physiological and psychological processes underlying task - related changes in respiratory behavior .
however , this review also revealed that the database for evaluating these measures is rather poor in quantity and quality and that most studies are restricted to the traditional measurement of rr and tv .
since a further motive underlying this study was to contribute to the relatively limited knowledge about breathing under cognitive load , we derived some general recommendations for future research as based on a proper understanding of the respiratory system .
this is a complex , multilayered , integrated , and highly versatile system serving to maintain appropriate partial pressures of o2 and co2 in the blood to accommodate both metabolic and behavioral demands . at the same time
breathing regulation hence serves stability but also allows flexibility to quickly adapt to internal and external homeostatic challenges .
the respiratory system at rest is considered a dynamic steady state , which is characterized by different types of variability and occasionally requires resetting which apparently is accomplished by sighing .
importantly , breathing is also largely driven by feedforward regulation , meaning that the system anticipates perturbations ( i.e. , discrepancies from normative values ) and corrects them before they occur [ 95 , 104 ] .
this perspective has a number of implications for the use of respiration to assess cognitive load .
first , baseline recordings during which an episode of cognitive load is anticipated may already indicate a certain degree of anticipatory arousal and reduce possible effects of the cognitive load manipulation .
this problem could be solved by randomization of baseline and task conditions and by including a vanilla baseline with a low demanding cognitive task , occupying working memory and thus reducing anticipatory arousal .
second , rr alone provides only very partial information about the dynamic changes of the respiratory system
. underlying drive and timing mechanisms such as central inspiratory drive and inspiratory duty cycle may be much more sensitive to cognitive and emotional demands .
an increase in rate may be adjusted by a decrease in tv to maintain appropriate breathing . however
, absence of appropriate compensation by tv may result in overbreathing which leads to a decrease in etco2 . as a consequence ,
the combined assessment of rr , mv ( the product of rr and tv ) , and gas exchange parameters , particularly etco2 , provides a more integrated account of respiratory responses to cognitive load .
an additional benefit is that etco2 allows assessing whether the response to cognitive load is in accordance with or in excess of metabolic requirements .
the latter state ( hypocapnia ) is of particular relevance for cognitive load because hypocapnia is associated with reduced cerebral blood flow and possibly impaired cognitive performance [ 107109 ] . in this respect ,
a more integrated assessment may help to distinguish between cognitive load and stress . in the first case ,
respiratory changes are supposed to be task - related and support adequate performance , while in the latter case , stress being linked with concerns about threats and protection of the self , respiratory changes may exceed task - related metabolic need [ 110 , 111 ] .
third , recent evidence suggests that general and specific parameters of respiratory variability allow measuring stability and flexibility of the respiratory system in response to cognitive load [ 22 , 112 ] .
specifically , variability in rr has been shown to decrease during sustained attention as induced by a task with a single behavioral response set , while during a mental arithmetic , decreased autocorrelations and increased random variability in respiration have been found [ 20 , 86 ] . moreover ,
the need of the respiratory system to reset has been found to differ between sustained attention and mental arithmetic , as manifested by a higher frequency of sighing during or after the task , respectively .
these findings suggest that variability of the respiratory system is sensitive to different types of cognitive load and that it is useful to decompose the concept of cognitive load into basic components .
a systematic approach to basic cognitive processes might also clarify current inconsistencies in respiratory correlates of cognitive load as revealed , for instance , by this review .
to this end , elementary cognitive tasks which require a small number of cognitive processes such as joystick tracking , card - sorting , or response choice tasks could be used in single as well as multiple task configurations , manipulated at different levels of task difficulty to study respiration in response to increasing cognitive load ( see also ) .
may play an important role in how a demanding cognitive task is appraised , how coping resources are evaluated , and how the individual responds [ 114118 ] .
specific combinations of individual and task - related characteristics may elicit different respiratory patterns , possibly ranging from a strained breathing pattern ( characterized by breathing inhibition with elevated etco2 ) when preparing for highly attentive episodes to hypocapnic hyperventilation when preparing to cope with demanding situations by energy mobilization [ 120 , 121 ] . a comprehensive assessment , involving the interaction of physiological and person - related measures , is hence required for a better understanding of individual differences in the physiological response to cognitive load .
finally , an integrative assessment of respiratory measures would be enriched by simultaneously taking cardiac measures into account , because the respiratory system exerts considerable influence on cardiac functioning [ 122 , 123 ] .
certainly , cardiac measures have a long tradition in research on mental load assessments , which recently predominantly focuses on heart rate variability ( hrv ) .
however , beyond studying respiratory sinus arrhythmia ( being a major source of hrv , see ) , concurrent respiratory assessment has largely been neglected .
although the debate on the usefulness of correcting for respiration when assessing hrv has not yet resulted in clear conclusions ( see [ 125128 ] ) , an integrated approach would provide a more elaborate database to detect and interpret psychophysiological responses to cognitive load . obviously , the parallel assessment of cardiac and respiratory parameters would also impact data - analytic strategies .
analyses could be performed by applying classical multivariate statistics ( if assumptions are met ) or , for a more detailed examination , by time series data analysis such as change point detection methods ( e.g. , ) , transfer function analysis ( e.g. , ) , or similar methods that have been employed to study the structure of cardiorespiratory coupling [ 131133 ] . | when people focus attention or carry out a demanding task , their breathing changes . but which parameters of respiration vary exactly and can respiration reliably be used as an index of cognitive load ? these questions are addressed in the present systematic review of empirical studies investigating respiratory behavior in response to cognitive load .
most reviewed studies were restricted to time and volume parameters while less established , yet meaningful parameters such as respiratory variability have rarely been investigated .
the available results show that respiratory behavior generally reflects cognitive processing and that distinct parameters differ in sensitivity : while mentally demanding episodes are clearly marked by faster breathing and higher minute ventilation , respiratory amplitude appears to remain rather stable .
the present findings further indicate that total variability in respiratory rate is not systematically affected by cognitive load whereas the correlated fraction decreases .
in addition , we found that cognitive load may lead to overbreathing as indicated by decreased end - tidal co2 but is also accompanied by elevated oxygen consumption and co2 release .
however , additional research is needed to validate the findings on respiratory variability and gas exchange measures .
we conclude by outlining recommendations for future research to increase the current understanding of respiration under cognitive load . |
it is the destruction or removal of all pathogenic micro - organisms which give rise to infection , but not necessarily their spore forms .
it is the process by which an article , surface , or medium is freed of all microorganisms either in the vegetative or spore state . with the whole world looking at the eradication of existing infectious diseases and preventing any new infections ,
sterilization of instruments is significant to ensure optimal patient care . in contemporary dental practice ,
the instruments directly come in contact with tissues , blood and tissue fluids , saliva , and gingival crevicular fluid which may seep through the rubber dam if not properly placed .
dental health personnel are constantly exposed to the potential threat of developing an infection by occupational exposures to a variety of microbial pathogens ; most common of all are hepatitis b virus ( hbv ) , hepatitis c virus ( hcv ) , tuberculosis ( tb ) , and acquired immunodeficiency syndrome ( aids ) .
the prevention of cross - contamination of infectious diseases among dentists , dental staff , and patients is a major concern in dental practice .
also , aseptic technique is especially important in endodontics because microorganisms are the major cause of endodontic disease .
diseases may be transmitted by indirect contact when dental instruments contaminated by one patient are reused for another patient without adequate disinfection or sterilization between uses .
apart from maxillofacial surgery , the potential for cross - infection is highest in the prosthodontic environment .
dental burs have been identified as a source of cross - contamination between patient and dental personnel .
they may become heavily contaminated with necrotic tissues , saliva , blood , and potential pathogens during use .
however , it is difficult to do the pre - cleaning and sterilization of burs because of their complex architecture .
endodontic files are slender , tapered instruments , about 25 mm long , with intricate topography and spiral cutting edges , and are used for cleaning and shaping root canals during endodontic treatment . because of their size and shape , it is difficult to remove all the biologic material during resterilization procedures . hence , a strict sterilization protocol is essential as the risk of cross - infection is higher .
various methods have been proposed by many manufacturers for this purpose , namely , the autoclave , dry - heat sterilization , laser , chemical sterilization , etc .
therefore , the present study was designed to investigate the pathological evaluation for sterilization of routinely used prosthodontic and endodontic instruments . to investigate the effectiveness of various sterilization procedures commonly applied to used burs . to investigate the effectiveness of various sterilization procedures commonly applied to used endodontic files .
it is the destruction or removal of all pathogenic micro - organisms which give rise to infection , but not necessarily their spore forms .
it is the process by which an article , surface , or medium is freed of all microorganisms either in the vegetative or spore state . with the whole world looking at the eradication of existing infectious diseases and preventing any new infections ,
sterilization of instruments is significant to ensure optimal patient care . in contemporary dental practice ,
the instruments directly come in contact with tissues , blood and tissue fluids , saliva , and gingival crevicular fluid which may seep through the rubber dam if not properly placed .
dental health personnel are constantly exposed to the potential threat of developing an infection by occupational exposures to a variety of microbial pathogens ; most common of all are hepatitis b virus ( hbv ) , hepatitis c virus ( hcv ) , tuberculosis ( tb ) , and acquired immunodeficiency syndrome ( aids ) .
the prevention of cross - contamination of infectious diseases among dentists , dental staff , and patients is a major concern in dental practice .
also , aseptic technique is especially important in endodontics because microorganisms are the major cause of endodontic disease .
diseases may be transmitted by indirect contact when dental instruments contaminated by one patient are reused for another patient without adequate disinfection or sterilization between uses .
apart from maxillofacial surgery , the potential for cross - infection is highest in the prosthodontic environment .
dental burs have been identified as a source of cross - contamination between patient and dental personnel .
they may become heavily contaminated with necrotic tissues , saliva , blood , and potential pathogens during use . however , it is difficult to do the pre - cleaning and sterilization of burs because of their complex architecture .
endodontic files are slender , tapered instruments , about 25 mm long , with intricate topography and spiral cutting edges , and are used for cleaning and shaping root canals during endodontic treatment . because of their size and shape , it is difficult to remove all the biologic material during resterilization procedures . hence , a strict sterilization protocol is essential as the risk of cross - infection is higher .
various methods have been proposed by many manufacturers for this purpose , namely , the autoclave , dry - heat sterilization , laser , chemical sterilization , etc .
therefore , the present study was designed to investigate the pathological evaluation for sterilization of routinely used prosthodontic and endodontic instruments .
to investigate the effectiveness of various sterilization procedures commonly applied to used burs . to investigate the effectiveness of various sterilization procedures
this is an in vitro study in which used burs and files were considered for sterilization . after sterilization
, they were incubated for a period of 72 h. ethical clearance was obtained from sridevi institute of medical sciences and research centre .
procedure and purpose of the study was explained to the participants from whom used burs and files were obtained , and their consent was taken .
an unused bur was placed in a sterilized hand piece and used for cavity preparation .
20 file used for endodontic purpose was collected in a sterile tube and cleaned properly by scrubbing . out of the total 60 burs and 60 files , 12 burs and 12 files
were taken as the control group ( group e ) ; the remaining 48 burs and 48 files were divided into four groups of 12 each and they were tested for the efficacy of sterilization with different methods such as autoclave ( group a ) , glass bead ( group b ) , glutaraldehyde ( group c ) , and quitanet plus solution ( group d ) .
the 12 contaminated burs and files in group a were placed in an endodontic instrument box and subjected to autoclave at 121c for 15 min at a pressure of 15 pounds .
the 12 contaminated burs and files in group b were wiped for 10 s with surgical spirit and placed in the periphery of the glass - bead sterilizer and sterilized for 45 s at 240c .
the 12 contaminated burs and files in group c were placed in a sterile plastic container containing 2.4% glutaraldehyde solution and left in it for 12 h. the 12 contaminated burs and files in group d were placed in a sterile plastic container containing quitanet plus solution and left in it for 12 h. the 12 contaminated burs and files in group e ( control group ) were put in separate tubes without doing any sterilization . on completion of the procedure ,
the burs and files were transferred in a sterile fashion into test tubes containing a culture medium selected to grow oral bacteria ( todd - hewitt broth ) .
all samples ( n = 120 ) were then placed in an incubator maintained at 37c to mimic body temperature .
the burs and files were examined daily over 72 h to check for evidence of bacterial growth .
a color change , cloudy broth , and visible precipitate in the test tube were all considered as indicative of bacterial growth [ figure 1 ] .
if the solution remained clear throughout the incubation period , the sample was considered sterile .
an unused bur was placed in a sterilized hand piece and used for cavity preparation .
20 file used for endodontic purpose was collected in a sterile tube and cleaned properly by scrubbing . out of the total 60 burs and 60 files , 12 burs and 12 files
were taken as the control group ( group e ) ; the remaining 48 burs and 48 files were divided into four groups of 12 each and they were tested for the efficacy of sterilization with different methods such as autoclave ( group a ) , glass bead ( group b ) , glutaraldehyde ( group c ) , and quitanet plus solution ( group d ) .
the 12 contaminated burs and files in group a were placed in an endodontic instrument box and subjected to autoclave at 121c for 15 min at a pressure of 15 pounds .
the 12 contaminated burs and files in group b were wiped for 10 s with surgical spirit and placed in the periphery of the glass - bead sterilizer and sterilized for 45 s at 240c .
the 12 contaminated burs and files in group c were placed in a sterile plastic container containing 2.4% glutaraldehyde solution and left in it for 12 h. the 12 contaminated burs and files in group d were placed in a sterile plastic container containing quitanet plus solution and left in it for 12 h. the 12 contaminated burs and files in group e ( control group ) were put in separate tubes without doing any sterilization . on completion of the procedure , the burs and files were transferred in a sterile fashion into test tubes containing a culture medium selected to grow oral bacteria ( todd - hewitt broth ) .
all samples ( n = 120 ) were then placed in an incubator maintained at 37c to mimic body temperature .
the burs and files were examined daily over 72 h to check for evidence of bacterial growth .
a color change , cloudy broth , and visible precipitate in the test tube were all considered as indicative of bacterial growth [ figure 1 ] .
if the solution remained clear throughout the incubation period , the sample was considered sterile .
in the study , the endodontic files sterilized by autoclaving in an instrument box at 121c for 15 min at a pressure of 15 pounds ( group a ) showed total sterility . ten burs ( 83.3% )
subjected to sterilization by glass - bead sterilizer and seven files ( 58.33% ) after wiping for 10 s with surgical spirit and sterilized for 45 s at 240c ( group b ) showed incomplete sterilization [ figures 2 and 3 ] .
sterilization efficiency of different methods for burs sterilization efficiency of different methods for files burs and files sterilized by immersing in glutaraldehyde ( 2.4% ) for 12 h ( group c ) showed complete sterilization .
ten burs ( 83.3% ) and nine files ( 75% ) showed incomplete sterilization with quitanet plus ( group d ) solution .
the control group ( group e ) , for which the files after contamination were not sterilized by any method , showed growth in all samples .
statistical analysis of the four sterilized groups using k analysis of variance ( anova ) showed a statistically significant difference between groups with regard to their efficacies in sterilization of both with burs and files ( p 0.05 ) [ tables 1 and 2 ] .
comparison of different methods of sterilization for burs comparison of different methods of sterilization for files
the risk of disease transmission is unknown in endodontic procedures ; even if the risk of disease transmission is minimal during endodontic procedures , the high frequency of root canal treatments could increase the possibility of an adverse event .
this is one example of why it is so important to ensure that resterilization procedures are effective .
there are three principal methods currently available for sterilization of instruments : steam under pressure ( autoclave ) , dry heat , and chemiclave .
steam autoclaving and glass - bead sterilizers are among the commonly recommended methods of sterilization .
the goal of instrument sterilization in dentistry is to protect patients from cross - contamination via instruments . at present , only a few dental instruments can not be sterilized and these are either disinfected or disposable .
the complex miniature architecture of dental burs and endodontic files makes precleaning and sterilization difficult . for decades , clinicians have searched for the ideal chair - side sterilization method and several different mediums have been used .
the present study showed that complete sterilization was possible by autoclaving the instruments in an endodontic box .
this is significantly similar to the findings from studies of other researchers like hurtt et al .
damaging alterations of proteins by dry heat are a result of oxidation , desiccation , and changes in osmotic pressure owing to evaporation of moisture .
dry heat sterilization is slower and requires temperatures higher than those used in moist heat sterilization .
this study showed that sterilization by a glass - bead sterilizer was not able to completely eliminate microorganisms and that total sterility was not found .
the present study result was contradictory to that of previous research done by rajkumar et al . , but it was the same as that of hurtt et al . who performed their study with salt instead of glass bead .
in the present study , immersing the files in glutaraldehyde solution for 12 h resulted in complete sterilization , which is similar to the results of the study done by hurtt et al .
but glutaraldehyde solution can not be relied upon completely to sterilize endodontic instruments as it is used in a limited number of applications , rather than as a general disinfectant , as it is a toxic chemical .
contact with glutaraldehyde liquid and vapor can severely irritate the eyes , and at higher concentrations , it burns the skin .
breathing glutaraldehyde can irritate the nose , throat , and respiratory tract , causing coughing and wheezing , nausea , headaches , drowsiness , nosebleeds , and dizziness .
quitanet plus is commonly used nowadays in the dental office for sterilization of burs and files .
it can be concluded that it is not an effective means of sterilizing burs and files .
routine sterilization procedures were not effective for previously used burs and files , and further research is warranted to devise an effective sterilization protocol .
future studies should focus on determining the best method of pre - cleaning these devices .
if such procedures can not be devised , perhaps the instruments should be considered single - use devices .
glass - bead sterilizer can be used as an alternative when these two methods are not available , but the problem with glutaraldehyde sterilization is tissue toxicity . though autoclave is an effective method for sterilizing endodontic files , the time taken by it to sterilize is more . hence there is a need for an alternative method which has a good sterilization capacity and involves less time . | background : in daily practice of dentistry , we use same instruments on many patients . before use , all instruments must be cleaned , disinfected , and sterilized to prevent any contamination .
pre - cleaning and sterilization of some devices can be difficult because of their small size and complex architecture .
dental burs and endodontic files are such instruments .
dental burs come in a variety of shapes and sizes , all with highly complex and detailed surface features.aim:to determine the effectiveness of various disinfectants and sterilization techniques for disinfection and resterilization of dental burs and endodontic files.materials and methods : the materials used for the study were dental burs and endodontic files .
disinfectants used were quitanet plus , glutaraldehyde , glass - bead sterilizer , and autoclave .
the sterility of used dental burs and endodontic files was analyzed .
burs and files that had been used were pre - cleaned , resterilized , and then tested for various pathogens .
each item was transferred by sterile technique into todd - hewitt broth , incubated at 37c for 72 h , and observed for bacterial growth.results:the present study shows that the endodontic files and burs sterilized by autoclaving and glutaraldehyde showed complete sterilization .
burs and files immersed in glutaraldehyde ( 2.4% ) for 12 h showed complete sterilization , whereas quitanet plus solution and glass - bead sterilizer showed incomplete sterilization.conclusion:the present study results indicate that autoclaving and glutaraldehyde ( 2.4% ) showed complete sterilization .
other methods can not be relied upon for sterilization . |
sudden cardiac death exhibits diurnal variation in both acquired and hereditary forms of heart disease 1 , 2 , but the molecular basis is unknown . a common mechanism that underlies susceptibility to ventricular arrhythmias is abnormalities in the duration ( e.g. short or long qt syndromes , heart failure ) 3 - 5 or pattern ( e.g. brugada syndrome ) 6 of myocardial repolarization . here
we provide the first molecular evidence that links circadian rhythms to vulnerability in ventricular arrhythmias in mice .
specifically , we show that cardiac ion channel expression and qt interval duration ( an index of myocardial repolarization ) exhibit endogenous circadian rhythmicity under the control of a novel clock - dependent oscillator , krppel - like factor 15 ( klf15 ) .
klf15 transcriptionally controls rhythmic expression of kchip2 , a critical subunit required for generating the transient outward potassium current ( ito ) . 7 deficiency or excess of klf15 causes loss of rhythmic qt variation , abnormal repolarization and enhanced susceptibility to ventricular arrhythmias . in sum
, these findings identify circadian transcription of ion channels as a novel mechanism for cardiac arrhythmogenesis . | |
a 37-year - old woman presented to us complaining of sudden right flank pain and lower abdominal pain that had lasted for 1 week , as well as nausea and vomiting .
two years previously she had undergone a laparoscopic right partial nephrectomy at another hospital owing to a small right renal mass that was diagnosed as renal cell carcinoma ( t1an0m0 ) .
postoperatively , she had gradually acquired lower urinary tract symptoms , such as urge incontinence , urgency , frequency , and nocturia .
three months earlier , she had been checked with abdominopelvic computed tomography ( ct ) for regular follow - up of the renal cell carcinoma and heard that there were no definite abnormal findings in the ct scan . in the physical examination ,
the results of a urine test showed 5 to 10 red blood cells per high power field , and plain x - ray of the kidney , ureter , and bladder revealed metallic surgical clips on the right upper abdomen and a possible right renal stone , but no abnormal density on the ureteral courses ( fig .
1 ) . the abdominopelvic ct scan revealed a 0.5 cm1.0 cm opacity on the right proximal ureter with borderline hydronephrosis and a tiny right renal stone ( fig .
2 ) . ureteroscopy with the patient under general anesthesia showed a white rectangular parallelepiped foreign body at the proximal right ureter ( fig .
the foreign body was removed by use of a ureteroscopic stone basket device and was identified as a medium - sized surgical clip ( fig .
3b ) . there was no extravasation of the renal pelvis during contrast media instillation via the channel of the ureteroscope .
a ureteral stent was placed for 1 week , and the patient had no more flank pain .
currently , partial nephrectomy is considered a standard treatment for small renal tumors with the benefit of preserving renal function ; improving overall survival , especially for patients younger than 65 years of age ; and decreasing the overall mortality rate . for t1b tumors ,
more clinical data are required to establish the oncological and functional benefits of partial nephrectomy ( pn ) .
lpn has come to represent comparable perioperative and oncological outcomes in the recent era and has gained popularity , although it remains a challenging and highly advanced laparoscopic procedure .
the most demanding step during lpn is the repairing of the collecting system and renal defect because this repair requires advanced laparoscopic skills and is performed under time pressure to minimize the warm ischemia time .
there is a report of the migration of absorbable lapra - ty suture clips in the collecting system after lpn , and massoud also reported the migration of a metal surgical clip into the ureter after opn , all of which were passed spontaneously .
furthermore , intravesical migration and stone formation of a surgical clip after laparoscopic radical prostatectomy has been reported , but there have been no reports of ureter migration of a surgical clip after partial nephrectomy .
reviewed the different sealants and laparoscopic instruments that are available for achieving hemostasis of the renal parenchyma in lpn and determined that there is no gold standard single agent or combination that can be applied to all cases .
the decision as to which technology to use and how to manage the hilum should be made on a case by case basis .
hem - o - lok or metal clips that are used to repair the collecting system and the renal defect in lpn can migrate postoperatively and cause secondary complications , such as urinary stones .
ureteral stones following lpn can be managed conservatively with hydration and narcotics , but if symptoms do not improve , surgeons may consider more aggressive ureteroscopic management . | we report a case of ureteral migration of a surgical clip after partial nephrectomy in which the clip was misdiagnosed as a ureteral stone .
a 37-year - old woman had undergone laparoscopic partial nephrectomy of right renal cell carcinoma at another hospital 2 years previously .
postoperatively , she had gradually acquired lower urinary tract symptoms . then , she complained of sudden right flank pain for a week .
a plain x - ray and enhanced abdominopelvic computed tomography scan were performed .
a 0.5 cm1.0 cm right upper ureteral opacity with borderline hydronephrosis was seen but could not be found on the x - ray .
ureteroscopy revealed a medium - sized hem - o - lok clip on the right upper ureter that was removed with a stone basket .
we concluded that a hem - o - lok clip used for collecting system sealing had migrated to the ureter and had been misdiagnosed as a ureteral stone on a computed tomography scan . |
despite enormous improvement of diagnostic and therapeutic possibilities , 2 of every 3 cases of head and neck cancer are detected in advanced stage and , even after curative treatment , 30% to 50% of patients sustain a locoregional recurrence with worse prognosis.1 in addition to long periods without symptoms , the difficult access to some head and neck subsites and the field cancerization process are major reasons why it is so difficult to detect head and neck cancer in an early stage as well as to guarantee clear tumor free margins ( r0 ) when approaching a tumor with surgical therapy.2 tumorfree margins are a major prognostic factor for local tumor recurrence , which occurs in 7% to 30% of patients with advanced disease.3 the field cancerization process leads to the fact that the otorhinolaryngologist facing a suspicious lesion in the head and neck region typically is confronted with a combination of inflammatory , dysplastic , and cancerous areas.4 , 5 in earlystage cases , it is difficult to differentiate chronic inflammation from early cancer and , in advanced tumors , it is difficult to define the tumor borders clinically , even when using endoscopic or microscopic assistance . even for benign diseases , it might be very difficult to clearly define the border of the lesion .
to date , the clinician can rely only on systematic biopsies and their histopathological grading of the epithelial dysplasia .
this is timeconsuming , must be performed ex vivo , and has methodological limitations.6 it is well known that there are other molecular factors indicating genetic altered cells beyond dysplasia that have a major prognostic impact on tumor diagnosis and evaluation of tumor margins .
new optical diagnostics are needed to allow a faster noninvasive ( or least lessinvasive ) differentiation between normal tissue and tumor tissue , between benign and malignant tumor tissue , and between tumor tissue and surrounding inflammation .
the development of nearinfrared ( nir ) optical fluorescent techniques for diagnosis , treatment , and followup of head and neck lesions , especially for head and neck cancer , is a growing field that provides realtime information regarding the presence , location , and dimensions of the cancer tissue and/or metastasis through creation of a specific contrast between normal and cancer tissue .
this contrast could be the result of tumorinduced morphologic and biochemical alterations that alter optical properties of tissues and lead to tumorspecific autofluorescence .
furthermore , fluorescence can be achieved through targeting head and neck lesions by fluorescent probes .
it is approved by the food and drug administration and the european medicines agency for determining cardiac output , hepatic function , and liver blood flow , and for ophthalmic angiography , but so far not for head and neck lesions . in the head and neck area ,
it has been used so far casuistically only as icg angiography for the monitoring of free flaps or for the evaluation of the relation of larger vessels to skull base tumors.7 , 8 it has been applied in paranasal tumors to adapt intraarterial chemotherapy.9 recently , icg has been introduced as a marker for sentinel node biopsies in patients with head and neck cancer.10 , 11 if icg nir endoscopy could improve the visualization of the mucosal lesion itself , it has not been evaluated so far .
because of its ability to visualize neoplastic vascularization , it has been shown to support the endoscopic detection of lung metastasis or early gastric cancer as well as the detection of liver metastasis during open abdominal surgery.12 , 13 , 14
therefore , we started a pilot study to explore the feasibility , opportunities , and potential drawbacks of nir endoscopy with icg to examine mucosal head and neck lesions .
this prospective observational study was performed at the department of otorhinolaryngology , jena university hospital , jena , germany .
approval for the study was obtained through the local institutional review board and informed consent was obtained from all study participants . the study cohort consisted of 55 patients with different mucosal head and neck lesions treated between november 2013 and december 2015 .
inclusion criteria were age 18 years , indication for diagnostic panendoscopy or microlaryngoscopy in general anesthesia and taking biopsies , and written informed consent , including consent for the offlabel use of icg .
exclusion criteria were severe chronic kidney , lung and liver disease , and thyroid autonomy .
standard panendoscopy or microlaryngoscopy with careful evaluation of the suspected mucosal lesion area and its surrounding tissue was performed .
an niroptimized hd camera system ( image1 s nir / icg system ; karl storz , tuttlingen , germany ) and light source ( dlight p ; karl storz ) were used for nir endoscopy .
this system allows a switchover via a footswitch between fluorescence and standard white light mode .
niroptimized telescopes were used ( icg hopkins 0 telescope , 5.8 mm diameter , 19 cm length ; and icg hopkins 0 telescope , 10 mm diameter , 20 cm length ; karl storz ) . then , icg ( 5 ml of 25 mg/15 ml solution = 8.3 mg icg ; pulsion , feldkirchen , germany ) was administered intravenously . before this study , we tested solutions from 25 mg/30 ml to 25 mg/5 ml . the 25 mg/15 ml solution gave the best image contrast .
the initial icg uptake phase was completely recorded in the nir icg mode of the imaging system . after the end of this uptake phase ,
it was switched back and forth several times from the nir icg mode to the white light mode of the endoscope before the recording was completed .
finally , standard biopsies were taken from the same areas and preceded for standard histopathology .
rigid nearinfrared ( nir ) with indocyanine green ( icg ) endoscopy was performed directly after injection of the icg .
a split screen allowed observation of white light image and fluorescence image at the same time .
the images were evaluated independently by 2 evaluators who were blinded with respect to the final histopathological results .
the videos were evaluated for 3 parameters : ( 1 ) icg positivity of the head and neck lesion ( yes / no ) was the first parameter .
a lesion was defined as icgpositive if the lesion showed a fast uptake of icg within 1 to 2 seconds after icg injection .
therefore , it was possible that the lesion itself was icgnegative but contained icgpositive vessels .
( 2 ) pooling of icg was the second parameter ( pooling yes / no ) : some lesions showed a constant icg labeling throughout the entire videorecording phase and a pooling of icg within the lesion . ( 3 ) the tumor borders were evaluated as the third parameter . in case of an icgpositive lesion ,
the size of the icglabeled tumor was compared to the size of the tumor under white light endoscopy ( same / larger / smaller ) .
statistical analyses were performed using ibm spss version 23.0 statistical software for windows ( chicago , il ) .
the diagnostic accuracy of nir icg positivity to prognosticate a malignant tumor was evaluated by a 2by2 table and calculation of sensitivity and specificity .
differences concerning the evaluation parameters between 2 subgroups of patients were evaluated with the chisquare test .
for all statistical tests , significance was 2sided and set to p < .05 interobserver variability of the assessment of the nir icg findings was analyzed using kappa statistics .
this prospective observational study was performed at the department of otorhinolaryngology , jena university hospital , jena , germany .
approval for the study was obtained through the local institutional review board and informed consent was obtained from all study participants .
the study cohort consisted of 55 patients with different mucosal head and neck lesions treated between november 2013 and december 2015 .
inclusion criteria were age 18 years , indication for diagnostic panendoscopy or microlaryngoscopy in general anesthesia and taking biopsies , and written informed consent , including consent for the offlabel use of icg .
exclusion criteria were severe chronic kidney , lung and liver disease , and thyroid autonomy .
standard panendoscopy or microlaryngoscopy with careful evaluation of the suspected mucosal lesion area and its surrounding tissue was performed .
an niroptimized hd camera system ( image1 s nir / icg system ; karl storz , tuttlingen , germany ) and light source ( dlight p ; karl storz ) were used for nir endoscopy .
this system allows a switchover via a footswitch between fluorescence and standard white light mode .
niroptimized telescopes were used ( icg hopkins 0 telescope , 5.8 mm diameter , 19 cm length ; and icg hopkins 0 telescope , 10 mm diameter , 20 cm length ; karl storz ) . then , icg ( 5 ml of 25 mg/15 ml solution = 8.3 mg icg ; pulsion , feldkirchen , germany ) was administered intravenously . before this study , we tested solutions from 25 mg/30 ml to 25 mg/5 ml . the 25 mg/15 ml solution gave the best image contrast .
the initial icg uptake phase was completely recorded in the nir icg mode of the imaging system . after the end of this uptake phase ,
it was switched back and forth several times from the nir icg mode to the white light mode of the endoscope before the recording was completed .
finally , standard biopsies were taken from the same areas and preceded for standard histopathology .
rigid nearinfrared ( nir ) with indocyanine green ( icg ) endoscopy was performed directly after injection of the icg . a split screen allowed observation of white light image and fluorescence image at the same time .
the videos were viewed repeatedly . additionally , all videos were evaluated in singleframe mode .
the images were evaluated independently by 2 evaluators who were blinded with respect to the final histopathological results .
the videos were evaluated for 3 parameters : ( 1 ) icg positivity of the head and neck lesion ( yes / no ) was the first parameter .
a lesion was defined as icgpositive if the lesion showed a fast uptake of icg within 1 to 2 seconds after icg injection .
therefore , it was possible that the lesion itself was icgnegative but contained icgpositive vessels .
( 2 ) pooling of icg was the second parameter ( pooling yes / no ) : some lesions showed a constant icg labeling throughout the entire videorecording phase and a pooling of icg within the lesion .
( 3 ) the tumor borders were evaluated as the third parameter . in case of an icgpositive lesion ,
the size of the icglabeled tumor was compared to the size of the tumor under white light endoscopy ( same / larger / smaller ) .
statistical analyses were performed using ibm spss version 23.0 statistical software for windows ( chicago , il ) . if not otherwise indicated , data are reported as mean with sd .
the diagnostic accuracy of nir icg positivity to prognosticate a malignant tumor was evaluated by a 2by2 table and calculation of sensitivity and specificity .
differences concerning the evaluation parameters between 2 subgroups of patients were evaluated with the chisquare test . for all statistical tests ,
significance was 2sided and set to p < .05 interobserver variability of the assessment of the nir icg findings was analyzed using kappa statistics .
the majority of the lesions were localized in the larynx ( 58% ) and the oropharynx ( 29% ) .
the dominant histology was squamous cell cancer or a premalignant squamous intraepithelial neoplasia ( sin ) iii tumor ( 33% ) , followed by benign squamous cell hyperplasia ( 15% ) , normal mucosa ( 13% ) , and reinke edema ( 11% ) .
benign lesions were icgnegative and premalignant or malignant tumors ( severe dysplasia sin iii and squamous cell cancer ) were icgpositive ( table 2 , figure 2 ) . in icgpositive tumors , normal icgpositive vessels were no longer separately identifiable .
icgpositive lesions showed a fast and gradual uptake of the icg with seconds after the intravenous bolus injection ( figure 3 ) .
if the lesion was icgpositive , it seemed to be of the same size or larger during nir icg endoscopy than during white light endoscopy when the lesion was malignant ( table 3 ) .
in contrast , icg size seemed to be smaller than the size in white light endoscopy in benign icgpositive lesions .
retention of icg was visible in 21 of 22 icgpositive lesions ; only the benign papilloma showed a strong icg positivity but no pooling after the icg uptake phase .
the retention of the icg could be homogeneous or inhomogeneous with an icgpositive lesion ( figure 2 ) .
relation of histopathology to size of the indocyanine green positive lesion compared to the size during white light endoscopy .
endoscopic examples of nearinfrared ( nir ) with indocyanine green ( icg ) finding in different types of mucosal head and neck lesions in the larynx .
white light image on the left side ( a e ) and corresponding nir icg image on the right side ( f j ) .
normal mucosa ( ab ) and reinke edema ( bg ) only showed icg positivity in the submucosal vessels . the mucosal hyperplasia on the right anterior vocal cord ( ch ) was completely icgnegative , even sparing icgpositive vessels .
the severe dysplasia of the right vocal cord ( squamous intraepithelial neoplasia [ sin ] iii , di ) and the squamous cell cancer of the left anterior vocal cord ( t1 glottic cancer , ej ) showed a diffuse icg positivity and retention of icg .
two endoscopic examples of gradual onset of indocyanine green ( icg ) in 2 icgpositive malignant tumors . the glottic carcinoma on the left anterior vocal cord ( a e , same as ej in figure 2 ) starts to become clearly icgpositive 5 seconds after the intravenous icg bolus injection .
the oropharyngeal carcinoma in the left tonsillar fossa ( f j ) showed first icg positivity after 6 seconds .
the icgpositive area is larger than the visible area of the tumor in the white light image ( compare f to j ) ; normal submucosal vessels are visible on the posterior pharyngeal wall ( see i and j ) .
this resulted in a sensitivity , specificity , and accuracy that icg positivity was related to a malignant tumor of 90.5% , 90.9% , and 89.1% , respectively .
diagnostic accuracy of indocyanine green positivity of malignant tumors ( n = 55).a
abbreviation : icg , indocyanine green . including premalignant squamous intraepithelial neoplasia ( sin iii ) lesions .
the kappa index for the interobserver assessment of the nir icg finding showed a 94.4% , 79.4% , and 62.5% agreement , respectively , for the assessment of the icg positivity of the lesion , the size in relation to the white light image , and concerning the retention of icg within the lesion .
the majority of the lesions were localized in the larynx ( 58% ) and the oropharynx ( 29% ) .
the dominant histology was squamous cell cancer or a premalignant squamous intraepithelial neoplasia ( sin ) iii tumor ( 33% ) , followed by benign squamous cell hyperplasia ( 15% ) , normal mucosa ( 13% ) , and reinke edema ( 11% ) .
benign lesions were icgnegative and premalignant or malignant tumors ( severe dysplasia sin iii and squamous cell cancer ) were icgpositive ( table 2 , figure 2 ) . in icgpositive tumors , normal icgpositive vessels were no longer separately identifiable .
icgpositive lesions showed a fast and gradual uptake of the icg with seconds after the intravenous bolus injection ( figure 3 ) .
if the lesion was icgpositive , it seemed to be of the same size or larger during nir icg endoscopy than during white light endoscopy when the lesion was malignant ( table 3 ) .
in contrast , icg size seemed to be smaller than the size in white light endoscopy in benign icgpositive lesions .
retention of icg was visible in 21 of 22 icgpositive lesions ; only the benign papilloma showed a strong icg positivity but no pooling after the icg uptake phase .
the retention of the icg could be homogeneous or inhomogeneous with an icgpositive lesion ( figure 2 ) .
relation of histopathology to size of the indocyanine green positive lesion compared to the size during white light endoscopy .
endoscopic examples of nearinfrared ( nir ) with indocyanine green ( icg ) finding in different types of mucosal head and neck lesions in the larynx .
white light image on the left side ( a e ) and corresponding nir icg image on the right side ( f j ) .
normal mucosa ( ab ) and reinke edema ( bg ) only showed icg positivity in the submucosal vessels .
the mucosal hyperplasia on the right anterior vocal cord ( ch ) was completely icgnegative , even sparing icgpositive vessels .
the severe dysplasia of the right vocal cord ( squamous intraepithelial neoplasia [ sin ] iii , di ) and the squamous cell cancer of the left anterior vocal cord ( t1 glottic cancer , ej ) showed a diffuse icg positivity and retention of icg .
two endoscopic examples of gradual onset of indocyanine green ( icg ) in 2 icgpositive malignant tumors . the glottic carcinoma on the left anterior vocal cord ( a e , same as ej in figure 2 ) starts to become clearly icgpositive 5 seconds after the intravenous icg bolus injection .
the oropharyngeal carcinoma in the left tonsillar fossa ( f j ) showed first icg positivity after 6 seconds .
the icgpositive area is larger than the visible area of the tumor in the white light image ( compare f to j ) ; normal submucosal vessels are visible on the posterior pharyngeal wall ( see i and j ) .
this resulted in a sensitivity , specificity , and accuracy that icg positivity was related to a malignant tumor of 90.5% , 90.9% , and 89.1% , respectively .
diagnostic accuracy of indocyanine green positivity of malignant tumors ( n = 55).a
abbreviation : icg , indocyanine green . including premalignant squamous intraepithelial neoplasia ( sin iii ) lesions .
the kappa index for the interobserver assessment of the nir icg finding showed a 94.4% , 79.4% , and 62.5% agreement , respectively , for the assessment of the icg positivity of the lesion , the size in relation to the white light image , and concerning the retention of icg within the lesion .
in head and neck oncology , nir fluorescence imaging has so far been introduced for sentinel lymph node mapping and might be a promising alternative to gamma rayemitting radiotracers for transcutaneous visualization of superficial lymphatic channels and sentinel lymph nodes in the future.15 , 16 for direct tumor imaging , it has been used so far in a limited number of studies , mainly in patients with hepatobiliary cancer , colorectal metastases , gastric cancer , or breast cancer.17 , 18 , 19 , 20 to our knowledge , yokoyama et al21 were the first to apply nir icg endoscopy to visualize the primary head and neck cancer in 5 patients .
the same group recently published a series of 36 patients with advanced paranasal sinus cancer receiving an icg injection together with intraarterial chemotherapy .
this was helpful to confirm the target region for intraarterial chemotherapy , especially in cases in which standard ct angiography was not indicative.9 recently , digonnet et al22 used nir icg imaging primarily to study the fluorescence of negative and negative lymph nodes during neck dissection in 11 patients .
four of these 5 tumors were icgpositive ( 80% vs 89% of the premalignant sin iii tumors or malignant tumors in the present study ) .
the margins were icgnegative after tumor resection or second resection in 1 case with residual fluorescence . these results and the findings of the present study
confirm that icg positivity is a marker of most head and neck cancers , as it has already been shown for other solid tumors ( see above ) .
no adverse reactions related to the icg injection occurred in patients with head and neck lesions .
it is repeatedly stated in the literature that bolus injections of 0.25 to 0.5 mg / kg body weight might increase the risk of allergic reactions .
however , this statement is actually related to only 1 study.23 interestingly , we needed only a fixed dose of 8.3 mg per patients ( which would be only 0.12
mg / kg in a patient with 70 kg body weight ) to achieve a fast visualization within seconds to minutes , whereas others report a best visualization with 0.5 mg / kg icg within 60 to 120 minutes.21 we can only speculate that our imaging system might be better able to detect the fluorescence than other systems .
it binds to plasma proteins , remains within the vascular system , and does not diffuse into the interstitial space under physiological conditions.15 it is proposed that the peritumoral vascular hyperpermeability is one reason for the tumor fluorescence.16 this might be the reason why tissue with strong vascularization , like the lymphatic tissue of the tonsil or a benign papilloma , or hyperpermeability because of inflammation , also could show ( false ) icg positivity .
furthermore , tumor neovascularization is characterized by newly formed and more porous blood vessels , leading to passive accumulation of icg in tumor tissue.15 this results in retention and pooling of icg within the malignant tumor , as it could be seen even in a premalignant lesion and in early glottic cancer ( sin iii lesion or t1 glottic cancer , respectively ) in the present study or as a characteristic feature of early glottic cancer.17 , 24 interestingly , the icg signal not only helped to differentiate between benign and malignant lesions , but also to differentiate different types of benign lesions .
the normal submucosal vessels system in the head and neck mucosa is always icgpositive . in case of benign squamous cell hyperplasia
it might be that the hyperplasia covered the fluorescence of the vessels in a deeper layer .
future studies should show how thick such a hyperplasia must be to cover icgpositive vessels .
this is important because this factor could be important in ( false ) icgnegative malignant tumors .
furthermore , at the moment , targeted fluorescent dyes in the nir range are being introduced into clinical trials , which might replace nontargeted ones in the near future.25 , 26 this will further improve the accuracy of the technology . beyond icg positivity ,
the demarcation of the tumor borders is of interest in respect of imageguided surgery.27 in the present study , the tumor borders appeared to be larger under icg than under white light endoscopy , but the true histological borders were not correlated to the endoscopic appearance .
if icgguided surgery could lead to clearer tumor margins and better outcome , it has to be shown in future studies with histological correlations . in any case
, it has been shown already that a repetition of the nir icg endoscopy directly after tumor resection can help to obtain clear margins because the wound bed should be icgnegative after resection.22
the advantage of nir icg imaging is that several endoscopy systems as well as icg are licensed and on the market .
the nir light does not alter the vision of the surgeon and it is easy to switch between white light and icg image . furthermore , the signaltobackground ratio is impressive because of very low autofluorescence.15 in contrast , a dense submucosal vascular network , like in the tonsils , might make it more difficult to demarcate a melanoma against the background . the good tissue penetration of about 5 to 10 mm is an advantage to other optical imaging techniques ( for instance , autofluorescence , confocal laser endomicroscopy , or optical coherence tomography ) , but , of course , still not enough to get an overview of larger tumors ( > t1).28
the diagnostic accuracy , sensitivity , and specificity to predict a malignant tumor by icg positivity was satisfactory for such a first feasibility study .
one should not forget that the evaluation was performed offline by watching the videos repeatedly and in singleframe modus .
icgpositive and icgnegative regions was only subjectively evaluated , so the method lacks any objectivity ( apart from the interobserver evaluation ) .
especially with regard to a possible application during a resection of tumors , where blood , tissue debris , and coagulation artifacts might reduce the contrast even further , a high contrast would be mandatory
. it would be worthwhile to develop automated image analysis methods for icg images as it has also ready been introduced for confocal laser endomicroscopy images.29 for optical imageguided surgery , it would be helpful to develop tools to overlay icg image and white light image.30 finally , the approval of tumorspecific nir probes or the conjunction of tumorspecific antibodies with unspecific nir probes will be the most important step to develop intraoperative imageguided cancer surgery.31
nir icg endoscopy was feasible in 55 patients with different mucosal head and neck lesions .
complications were not seen . for a first feasibility study , the diagnostic accuracy analysis to predict a malignant tumor by offline evaluation of the icg videos for icg positivity of the tumors was satisfactory .
the analysis showed a sensitivity , specificity , and accuracy that icg positivity of the tumor was related to a malignant tumor of 90.5% , 90.9% , and 89.1% , respectively .
this has to be confirmed in larger confirmatory studies , including tumors that are more advanced and especially in relation to the correlation between icg tumor margins and histological tumor margins . | abstractbackgroundthe purpose of this study was to explore the feasibility and potential drawbacks of nearinfrared ( nir ) endoscopy with indocyanine green ( icg ) to examine mucosal head and neck lesions.methodsnir icg endoscopy was applied to image head and neck cancer epithelium in vivo .
the evaluation of the icg videos was performed offline independently by 2 evaluators and blinded with respect to final histopathological results from biopsies taken as the gold standard.resultsforty percent of the lesions from 55 patients were histologically malignant .
icg positivity showed a sensitivity , specificity , and accuracy to be related to a malignant tumor of 90.5% , 90.9% , and 89.1% , respectively .
the kappa index for the interobserver assessment showed a 94.4% agreement for the assessment of the icg positivity .
side effects of the nir icg endoscopy did not arise.conclusionnir icg endoscopy in patients with mucosal head and neck lesions was feasible and safe .
it might help intraoperatively to differentiate benign from malignant lesions .
2016 wiley periodicals , inc .
head neck
39 : 234240 , 2017 |
alzheimer 's disease is the most common form of neurodegenerative disorders characterized by the formation of extracellular deposits composed of amyloid beta peptide ( a ) and masses of paired , helically wound protein filaments in the cytoplasm of neuronal cell bodies and neuritic processes called neurofibrillary tangles .
the tau proteins are phosphoproteins whose levels of phosphorylation are regulated by tau kinases and phosphatases .
substantial evidence reveals the increased activity of glycogen synthase kinase 3 ( gsk3 ) ( also known as human tau protein kinase i ) during ad .
similarly , p25/cyclin - dependent kinase 5 ( cdk5 ) , dual - specific tyrosine [ y ] regulated kinase 1a ( dyrk1a ) , and mitogen - activated protein kinases ( mapk ) also possess higher activity in ad brain .
thus , our work focuses on the chosen 10 kinases involved in hyperphosphorylation of tau and elevated responses in ad .
. developments of discriminating inhibitors are a key task in drug discovery and development , and appreciating the basis of kinase inhibitor selectivity is critical to the design of effective drugs .
gsk3 is composed of three domains : an n - terminal domain consisting of a closed -barrel structure , a c - terminal domain containing a
kinase fold structure , and a small extradomain subsequent to the c - terminal domain .
the catalytic site is between the two major domains and has an atp analogue molecule in its atpbinding site .
the adenine ring is buried in the hydrophobic pocket and interacts specifically with the main - chain atoms of the hinge loop .
the structure of gsk3 is known to have a catalytically active dimer conformation that progressively phosphorylates substrates with ser / thr penta repeats .
it is known that the inhibitors compete with the atp binding sites of gsk3 [ 10 , 11 ] . realizing the need to design the inhibitors for these kinases , with the hope that it could affect the hyperphosphorylation of tau , the investigations have been undertaken .
the studies reveal shared conservations across sequences , structural homologies , and atp binding site geometries across the ten tau kinases .
interestingly , the inhibitor 3-aminopyrrolidine scaffold exhibits high preferential affinity with gsk3. though the literature on ad indicates overexpression and activity of gsk3 during pathogenesis of ad , surprisingly , the pdb does not contain the structural details of gsk3 with these specific inhibitors .
consequently , our explorations provide vital clues towards design of novel off - target drugs for ad .
the analysis of the structures of the 10 tau kinases , along with their respective ligands , was carried out as illustrated in the flow chart ( figure 1 ) . to begin with
, the structures of the 10 tau kinases , along with their respective ligands , were retrieved from the pdb and their details are provided in table 1 .
a phylogenetic tree was generated for the amino acid sequences of 10 tau kinases using clustalw and is illustrated in figure 2 .
the dendrogram reveals that gsk3 , cdk5 , mapk such as p38 , extracellular signal - regulated kinases 1 & 2 ( erk 1/2 ) , c - jun n - terminal kinase ( jnk ) , and dual - specificity tyrosine-[y]-phosphorylation - regulated kinase 1a ( dyrk1a ) are closely related ( as in cluster 1 ) ; protein kinase a ( pka ) , protein kinase b ( akt / pkb ) , and protein kinase c ( pkc ) form the closely related second cluster .
interestingly , casein kinase 1 delta ( ck1d ) stands out as an independent taxis , indicating characteristic sequence variations from the group . to observe the conservation of residues in the atp binding region ,
a multiple sequence alignment was carried out amongst the 10 kinases , using the tool multalin .
the alignment is depicted in figure 3(a ) , which reveals that the sequences differ significantly at the positions of gate - keeper residues and the surface residues , while they are well conserved at the subsites that interact directly with atp .
the atp binding amino acids lys 85 & asp 200 , asp 133 & val 135 and glu 185 are conserved across these kinases , and lie in the phosphate binding region , adenine binding region and in the sugar binding regions respectively ( refer to figure 3(b ) ) .
overall sequence identity and similarity amongst the sequences and rmsd between the 3d geometries are highlighted in table 2 .
the identity ( and similarity ) amongst the kinase sequences lies in the broad range of 22.8% ( 48.1% ) and 49% ( 77.4% ) .
the closest set appears between erk1/2 and p38 , which share the highest identity of 49% , while the least values of 22.8% exist between 2 sets , namely , ck1d and cdk5 and akt and erk1/2 , respectively .
it is interesting to note that the rmsd between all pairs of 10 tau kinases for c atoms range between 1.07 and 1.82 ( refer to table 2 ) .
interestingly , these lowest and highest values of rmsd are related to the molecule pkc .
however as expected , for the molecule ck1d which stands out in the phylogeny , the identities with all other kinases are less than 30% . similarly ,
the rmsd values of all the kinases with ck1d lie in the higher range of 1.57 to 1.76 .
further , the structural alignments revealed that the active site occurs between two lobes of kinases showing the conserved overlap of the atp binding regions .
thus , the rmsd values for the entire atp binding region amongst the kinases lie between 0.63 and 1.25 . however , the rmsd values for the phosphate binding region lie between 0.23 and 0.46 , and the nucleotide binding region is in - between 0.16 and 1.25 respectively .
hence , docking the binding site of kinases with atp was attempted to appreciate the nature of interactions .
table 3 provides the molecular details and properties of the various inhibitors used in the study .
their relative binding affinities in terms of ic50 and k
i values are also indicated for each inhibitor ( table 3 ) .
the set of chosen inhibitors does contain two small molecules which are deposited in the drug bank , that is , inhibitor 2 ( drug bank i d db07794 ) and inhibitor 5 ( drug bank i d db07919 ) . in order to appreciate the structural similarity of these inhibitors with atp ,
the outcome of these structural comparisons revealed that the rmsd between atp and the 7 ligands lie between 0.37 and 0.67 , while the inhibitor - to - inhibitor rmsd values are in the range of 0.32 to 0.67 .
table 5 lists the various residues forming the atp binding pocket and exhibiting favorable interactions with atp . in order to appreciate the conservation of this atp binding site across all 10 tau kinases ,
docking studies were carried out using the discovery studio software version 3.5 ( accelrys software inc . ,
it is clear from table 5 that g63 , a83 , k85 , e97 , d / e133 , n186 , and d200 form the set of well - conserved residues in the atp binding pocket and interact with atp in all the 10 kinases . though the molecules jnk and erk1/2 exhibit less number of interactions with atp , key contacts of conserved residues are indeed present .
residue corresponding to v110 exhibits least number of interactions across kinases . though the residue corresponding to r141 appears changed in all the kinases , its interactions with atp , across the receptors , are well conserved .
our aim to study the efficacies of select inhibitors with gsk3 triggered the need to dock these ligands to the key tau kinase gsk3. identifying the atp binding site , the molecular docking studies of kinase inhibitors were carried out using the discovery studio software version 3.5 and lead it tool of flexx 2.1.2 .
gsk3 receptor structure was docked to all of the seven ligands to the atp binding pocket by the rigid receptor - flexible ligand docking competencies of flexx and the interactions are tabulated in table 6 .
the docking examination revealed that the inhibitor-3-aminopyrrolidine scaffold exhibits high preferential affinity with gsk3. while all inhibitors appear to sit in the atp pocket of gsk3 , the most favorable is inhibitor 6 and the least probable is inhibitor 5 .
in the present study , the analysis of 10 tau kinases implicated in ad has been performed to elucidate the conservation of the binding site and selectivity of the 7 inhibitors .
multiple sequence alignment , 3d structural alignment , catalytic active site overlap , and docking studies of inhibitors with gsk3 have been carried out to fingerprint the interactions with the key / gatekeeper residues in the atpbinding pocket .
the results highlight that tau protein kinases share common structural elements for the binding of the inhibitors and atp . comparatively , the inhibitor 3-aminopyrrolidine ( inhibitor 6 ) exhibits high preferential affinity with gsk3. interestingly , the literature on ad indicates the overexpression and activity of gsk3 during pathogenesis of ad , and surprisingly , the pdb does not contain the structural details of gsk3 with this specific inhibitor .
our studies disclose that regions of the active site which found high conservation across tau kinases may form the determinants for binding to the ligand .
interactions of 7 inhibitors with the remaining 9 tau kinases in ad are also being explored .
our results indicate that the binding pocket of the 10 tau kinases is structurally conserved and offer a common feature of determinants with the 7 inhibitors investigated .
this study highlights that suitable therapeutics can be successfully developed from the available chemical space , thus facilitating inhibitor design and off - target effects for ad . | alzheimer 's disease ( ad ) is a neurodegenerative disorder characterized by the accumulation of amyloid beta
peptides ( a ) and neurofibrillary tangles ( nfts ) .
the abnormal phosphorylation of tau
leads to the formation of nfts produced by the action of tau kinases , resulting in the loss of
neurons and synapse , leading to dementia .
hence , tau kinases have become potential drug target
candidates for small molecule inhibitors . with an aim to explore the identification of a common inhibitor ,
this investigation was undertaken towards analyzing all 10 tau kinases which are implicated in
phosphorylation of ad .
a set of 7 inhibitors with varied scaffolds were collected from the protein
data bank ( pdb ) .
the analysis , involving multiple sequence alignment , 3d structural alignment ,
catalytic active site overlap , and docking studies , has enabled elucidation of the pharmacophoric
patterns for the class of 7 inhibitors .
our results divulge that tau protein kinases share a specific
set of conserved structural elements for the binding of inhibitors and atp , respectively .
the scaffold of 3-aminopyrrolidine ( inhibitor 6 ) exhibits high preferential affinity with gsk3.
surprisingly , the pdb does not contain the structural details of gsk3 with this specific inhibitor .
thus , our investigations provide vital clues towards design of novel off - target drugs for alzheimer 's . |
schools are an ideal setting where health promotion strategies can be used to enhance the oral health of children and an indirect channel to target community for promoting oral health .
oral health promoting schools that incorporate health education , promotion , prevention , and curative services are effective in lowering the burden of oral disease among children .
it is also reported that along with this , there is a significant improvement in tooth brushing behavior and in the use of topical fluorides . though research has suggested that oral disease burden is lower in the oral health promoting schools than elsewhere , dental problems such as dental pain still exist in certain risk groups , accounting for loss of school hours , difficulties in eating , speaking , and learning , and lower grades in children , and absence from work and financial burden for parents .
the prevalence of dental pain varies from 5 to 71% , and this oral health inequality hits the poor and deprived with the hardest impact . the outcome of oral health promotion in a school - based setting on dental pain experience and its impact on daily life on children has not been thoroughly investigated .
this research will help in identifying and addressing the determinants of dental pain experience which impacts more significantly the risk groups , than merely treating the disease in those who present for care .
thus , the present study was conducted to assess the prevalence of dental pain and its impact on daily life and to further explore the role of socio - behavioral and clinical oral health status in dental pain experience among 1015-year - old school children attending school oral health promotion program .
oral health promotion programs have been conducted for the last 8 years by vokkaligara sangha dental college to improve the oral health of school children of bangalore city .
bangalore south zone was randomly selected from the four zones of the city ( north / southwest / east ) with six geographic clusters and one school was selected randomly from each geographic cluster .
children in the age group of 1015 years were included in the study as the cognitive and language development is better in this age strata and they would be able to communicate their feelings better .
children who reported dental pain beyond 3 months period , those who were undergoing any medical treatment , and those who were mentally challenged were excluded from the study .
finally , a sample of 1237 school children in the age group of 1015 years participating in the school oral health promotion program were screened for history of dental pain .
data collection included questionnaire assessing socio economic status ( kuppuswamy scale ) , oral health behavior and dental pain .
dental pain was assessed by child - dental pain questionnaire ( c - dpq ) given by barretto et al .
the questionnaire measures the prevalence , severity , and impact of dental pain on children 's quality of life with two items for each measure .
severity of dental pain was categorized as mild , moderate , and severe , and the measure impact on daily life was categorized into with and without impact .
clinical oral examination was conducted in the classroom by a single investigator using mouth mirror and who cpi probe .
recording of clinical oral health status included dental caries status , periodontal status , and malocclusion using who oral health survey criteria , 1997 .
the community periodontal index ( cpi ) was used to record the presence of bleeding on probing ( code 1 ) and calculus ( code 2 ) on six index teeth ( 16 , 11 , 26 , 36 , 31 , 46 ) .
the pilot study was conducted to find out the feasibility of the study , for training and calibration of the examiner and to check for the test - retest reliability of the questionnaire .
retest reliability of c - dpq was 0.84 and the intra - examiner reproducibility of clinical measures was 0.87 .
data were analyzed using the statistical package spss 19.0 with values < 0.05 being significant . for statistical analysis ,
very mild pain and mild pain were categorized as mild pain , and severe and very severe pain as severe pain .
statistical analysis was done by using chi - square test and logistic regression was also used .
data were analyzed using the statistical package spss 19.0 with values < 0.05 being significant . for statistical analysis ,
very mild pain and mild pain were categorized as mild pain , and severe and very severe pain as severe pain .
statistical analysis was done by using chi - square test and logistic regression was also used .
results of the study showed the prevalence of dental pain to be 15.6% ( 194 ) .
also , 47.4% and 52.6% of the children were males and females , respectively , with a majority of them from lower middle class families [ table 1 ] .
twenty percentage of participants had their last toothache within last month and 76% ( n = 147 ) reported pain more than a month ago .
32% ( n = 63 ) of participants cries during the worst pain attack and 37% ( n = 78 ) reported their pain as severe / very severe .
72% ( n = 139 ) of participants were awakened during night due to pain and 66% had reported normal daily tasks were affected due to pain ( n = 128 ) [ table 2 ] . among the participants who reported severe pain , 47% were females ( p < 0.05 ) . among those who reported impact of pain on daily activities , 52%brushed twice a day ( p < 0.05 ) , 49% consumed sweets more than twice a day ( p < 0.05 ) , 51% of participants with impact of pain had dmfs > 2 [ table 3 ] .
mean dmft or dmfs did not show any association with severity of the pain ( p > 0.05 ) whereas dmft / dmfs was significantly more among severe pain group ( p < 0.05 ) .
similarly dmft / dmfs was significantly higher among participants with impact of pain than who had no impact ( 2.84/3.60 v / s 2.10/3.22 ) [ table 4 ] .
regression analysis showed higher odds of pain severity among females ( or = 1.69 , 1.121.88 ) , in consumption of sweets ( or = 1.68 , 1.331.89 ) , and dmfs < 2/>2 ( or = 1.84 , 1.103.78 ) .
brushing twice a day was protective in nature ( or = 0.79 , 0.530.85 ) [ table 5 ] .
impact of dental pain showed the risk of variables such as consumption of sweets ( or = 1.45 , 1.281.68 ) , dmfs < 2/>2 ( or = 1.25 , 1.032.79 ) , and presence of calculus ( or = 1.35 , 1.021.85 ) [ table 6 ] .
prevalence , reason of self - reported dental pain , and demographic factors of the study participants distribution of study participants according to child - dental pain questionnaire ( c - dpq ) response comparison of severity and impact of dental pain and independent variables comparison of dmft , dmfs , dmft , dmfs based on severity and impact of dental pain logistic regression of severity of dental pain and independent variables logistic regression of impact of dental pain and independent variables
despite great achievements made globally in the oral health of the population , problems still remain in many communities all over the world , particularly among the underprivileged groups in developed and developing countries .
the present study assessed the outcome of these oral health promotion activities on the prevalence , severity , and impact of dental pain , which further serves as an adjunct to normative need assessment for oral health care .
various studies on prevalence of dental pain reported different values : 50% was reported in a ugandan study , whereas the study by pau et al . reported 37.4% prevalence among greek school children .
71.4% was reported by kiran kumar et al . in indian children of similar age group .
our study found the prevalence of mild , moderate , and severe pain to be 2% , 7% , and 6% , respectively , which is very low compared to other previous studies .
kumar et al . in their study observed a prevalence of 14.3% , 8.8% , and 11.7% for mild , moderate , and severe pain , respectively .
the low prevalence of dental pain and severity observed in the present study could be attributed to systematically organized oral health care given in these health promoting schools .
the oral health program comprised regular dental screening , oral prophylaxis , restoration and extraction procedures using a specially equipped mobile dental clinic and referral for complex treatment modalities to the dental hospital .
a higher odds of having severe dental pain was observed in girls compared to boys , but this sex difference was not observed for impact of dental pain on daily life .
this could be because generally boys have higher pain thresholds and tolerance and lower pain ratings than girls .
association between social gradient and severity of dental pain was not observed as most children belonged to low - income families suggesting social homogeneity of children
. oral hygiene practice of participants revealed that once a day brushing and not changing the tooth brush for more than 3 months had higher odds of causing severe dental pain .
this finding revealed that inspite of having knowledge through the education program , children at risk were not able to follow recommendations .
there could be other contributory factors which could have played a role , such as low - income families of these children fail to maintain regular oral hygiene or are often unable to afford oral hygiene aids as their priority will be basic necessities such as food , shelter , and clothing .
everyday consumption of sweets has shown higher odds of causing severe dental pain and impact on daily life .
, zhu et al . , aurelius and lindstrm , johansson et al . , slade et al . , and shepherd et al .
decayed / missing and filled teeth measured by mean dmft / s was 1.8/2.11 and mean dmft / s was 2.47/3.4 .
this is similar to iranian study ( dmft = 1.8 ) , but higher value was observed in the study by begzati et al . in kosovo ( dmft = 5.8 ) , tsanidou et al . in greece
( 2.3 2.5 ) , and alvarez - arenal et al . in austria and spain ( 3.30 ) .
compared to our study , higher dmft / dmfs was observed in the study of alvarez - arenal et al .
research suggests that presence of decayed teeth is the most important influencing factor for dental pain .
results of the present study suggest that children with more than two deciduous caries index score have higher odds of having severe dental pain and impact on daily life .
this could be explained by the observation of levine et al . which suggested that the earlier a tooth decays prior to natural exfoliation , the longer it is in the mouth and the greater the likelihood of pain .
dmft / s index as an independent variable failed to show association with severity / impact of dental pain . in the present study ,
it is unlikely that mortality of the permanent dentition could be observed considering the age of the participants and , at the same time , deciduous dentition was at the peak period of their life expectancy .
the study included a comparatively large population of a particular age group in bangalore city and used a validated questionnaire ( c - dpq ) for assessment of dental pain .
dental pain and its magnitude may differ across populations with different cultural backgrounds and settings , especially like our sample population where oral health promotion activities exist .
one of the limitations of our study is that assessment of dental pain was based on self - reported data and its cross - sectional nature .
pain is subjective in nature , and hence , self - reported pain measures are considered to be gold standard for assessing children 's perceptual or psychological experiences of pain .
another limitation of the study was that we did not consider the number of years the child has participated in oral health promotion program .
the phenomenon of student mobility is less likely to be observed in these schools ; therefore , we did not take this into account .
from the present study it is concluded that dental pain and its impact in children from low - income families is associated with gender , brushing behavior , consumption of sweets , and deciduous dental caries experience , thus necessitating further actions to be taken to alleviate the pain .
| introduction : dental pain is a major public health problem and one of the consequences of oral diseases which requires significant adjustments in life management leading to decreased quality of life.objective:to assess prevalence of dental pain and its impact on daily life and to explore its relationship with oral health behavior and clinical oral status among 10 - 15 year old school children attending oral health promoting schools.method:this cross sectional study was conducted in 6 schools serving low -middle socio economic strata in bangalore , india .
a total of 1237 children were surveyed for history of dental pain during past 3 month .
participants who reported dental pain completed self - reported oral health behaviour and child dental pain questionnaire . clinical oral examination included assessment of dental caries , periodontal status .
data was analyzed using t - test , chi - square test , anova and regression analysis.results:prevalence of dental pain was 15.6% ( n = 194 ) . among children with pain ,
17% , 43% and 40% reported mild , moderate and severe pain .
impact on daily activities was reported by 66% .
mean dmft and dmfs was 1.80 and 2.11 mean deft and defs was 2.47 and 3.41 .
multiple logistic regression revealed that severity and impact of dental pain was associated with gender , frequency of tooth brushing , consumption of sweets and deciduous dental caries experience.conclusion:prevalence of dental pain is associated with brushing behavior , consumption of sweets and deciduous dental caries experience , showing need for further attention to these conditions and a need to strengthen preventive and therapeutic dental services . |
under the influence of some emergencies ( mad cow disease , dioxin in feed ) , there has been a significant development of food laws which led to the enhancement of some normative papers that make up the basis of food security such as the council regulation ( ec ) n. 178 of 28 january 2002 ( european commission , 2002 ) .
this last is intended to lay down the general principles and requirements of food law by a series of regulations .
more precisely , it has confirmed that food business operators ( fbo ) are the main responsible for the hygienic and healthy production of food and must adopt the most appropriate measures to ensure consumers health and expectations by means of the self - control plan following the principles of hazard analysis and critical control points ( haccp ) . in the present paper , we want to present some critical comments resulting from the activities carried out by the prevention services [ national information system on agriculture ( sian ) and veterinary service ] of the local health service of rome ( asl rm / a ) , italy .
we compare them with those acquired from a project of integration concerning the european regulations of the chinese community of prato , carried out by the territorial service of the ausl 4 of prato ( acsa ) .
in the period 2007 - 2009 , the veterinary service , in cooperation with the health food and nutrition territorial service of the ausl rm / a , carried out an investigation on the raw fish in japanese restaurants located in the centre of rome ( masotti et al . , 2010 ) . the primary objective was to evaluate the structural , operational and general hygiene of the equipment and the staff , and to assess the freshness of the fish products used and distributed raw .
thirty restaurants were inspected : most of them were japanese preparing sushi and sashimi . as for data collection , checklists were arranged individually by the two services , for their investigation , based on the recommendations included in the guidelines of latium region for the implementation of the reg .
the activity had several positive effects in terms of the awareness of the issues related to the consumption of raw fish preparations and it resulted in a reduction of non - conformities .
still , its most relevant result is the ongoing adoption of the correct procedures for the prevention of anisakis risk by the fbos involved .
particularly , the first checks showed a wide use of fresh product not subject to any remediation by freezing . on the contrary , as a result of the prescriptive acts , a greater spread of freezing of the raw material performed on site using correct procedures was detected the following years .
as an alternative , the purchase of the product already subject to necessary remediation was registered .
therefore , the project can be considered as a successful example of the interaction between official control and fbos , especially given that it has been able to act not only on the mere application of regulatory provisions , but also on the cultural approach in preparing of traditional ethnic foods . in the period 2009 - 2010 , in the province of the ausl 4 in prato ,
a project was launched , aiming at improving the quality level of the retail outlets managed by the chinese community operators .
the project involved all the professionals of the competent authority for food safety of the ausl 4 in prato ( acsa ) ( armani et al . , 2011 ; guidi et al . ,
the activity involved 24 shops , including 9 supermarkets which sell meat and fish products , 6 supermarkets which sell meat and fish products and other food products , 4 restaurants , 2 stores , 1 street vendor .
similarly to the services of asl rm / a , the investigation was carried out by adopting the method used to perform audits , i.e. by customising the checklist for the assessment of health standards in the production , preparation , administration and sale of foodstuffs of plant origin and drink and the haccp checklist official controls . on the whole ,
the 24 controlled stores showed the following faults : hygienic - sanitary ( 100% of the controlled stores ) ; traceability / labelling of products ( 100% ) ; training of personnel ( 100% ) ; prescriptions not acquitted ( 25% ) .
in particular , it was found that the plan for self control is formally present in all the stores , but in 90% of them it is not understood and is disregarded , although the documents have been translated into chinese . during the inspection activities , 91 proceedings were performed , of which : 33 administrative sanctions , 32 prescriptions , 3 administrative seizures , 6 reports of crime , 4 destructions , 3 seizures and 2 temporary closures . at the end of the activity , anyway , a substantial decrease in serious non - conformities and the permanence of not serious non - conformities was recorded . in addition , a marked improvement of the use of labelling in italian language on products was found even if accompanied by a poor traceability of the food .
furthermore , the staff and the management training on the european legislation on food safety showed no improvement .
the results of these two experiments allow you to make some considerations that can be extended to all kinds of food stores in the area .
it has been shown that very few fbos have a thorough knowledge of the regulations on food safety , especially on food production sanitation . when comparing official control and fbos , the difficulties one may come across with and have to take into consideration are to face cultural and linguistic differences . as highlighted , in line with the content of the 2008 report of the ministry of health , the diversification of food production , in relation to the different sectors and the size of the fbo , causes a non - uniform awareness of fbo in the way the application of self - control systems is concerned , in order to ensure the product food safety of . in the evaluation of the inspection activities carried out by the competent authorities , in fact , a high prevalence of non - conformities in the framework of general hygiene prerequisites
is confirmed , in the application of the haccp system and in the staff training .
therefore , it is vital to provide a general training program , involving the operators in charge of the control and fbo , in order to allow the effective and definitive resolution of the non - compliances , through the proper use of the audit , an instrument introduced by the regulations of the hygiene package and not yet properly used throughout the national country ( italian ministry of health , 2008 ) .
indeed , the type of non - conformities detected has highlighted the inadequacy of the role played by the consultants , with regards to the application of the haccp . in an ethnic community , this makes an expert advice highly desirable , which may interact with fbos in a better way from a linguistic viewpoint , and , above all , which is to be a real reference point for the different critical aspects for the fbo .
the inadequate application of the self - control systems ( prerequisites of haccp ) is also reflected in the recurrence of non - conformities in the quality control activity of finished food products . as a matter of fact , it was observed that , the obligation for the fbo to have a self - control plan has been envisaged for 16 years .
an intervention by the central authority would be desirable , in order to rule the activities of the self - control consultants , considering the possibility to establish an official list of people in charge of the self - control , who are to be certified and trained , as well as the ability to designate people who are not suitable for that activity . the initiatives to provide the consumer with correct information should be encouraged and could be developed directly at the level of food marketing and service , through periodic campaigns reporting on the major food risks . | the purpose of the present paper is to highlight some critical situations emerged during the implementation of long - term projects locally managed by prevention services , to control some manufacturing companies in rome and prato , central italy . in particular ,
some critical issues on the application of self - control in marketing and catering held by chinese operators are underlined .
the study showed serious flaws in preparing and controlling of manuals for good hygiene practice , participating of the consultants among food business operators ( fbos ) to the control of the procedures . only after regular actions by the prevention services ,
there have been satisfying results .
this confirms the need to have qualified and expert partners able to promptly act among fbos and to give adequate support to authorities in charge in order to guarantee food safety . |
adjuvant radiotherapy after breast - conserving surgery constitutes an indispensable part of breast conserving therapy in early breast cancer .
the standard technique of radiation therapy is to treat the entire breast up to a total dose of 40 - 50 gy , with or without a boost dose of 10 - 15 gy to the tumor bed depending on boost indications . a decreased risk of local recurrence , particularly in younger patients , as a result of a boost dose has been confirmed in a large randomized trial . for selected low - risk patients , accelerated partial breast irradiation ( apbi ) is an alternative treatment option to whole - breast radiotherapy ( wbrt ) .
a non - inferiority of apbi with interstitial multi - catheter brachytherapy ( bt ) technique was recently proved by gec - estro ( groupe europen de curiethrapie european society for radiotherapy and oncology ) trial .
brachytherapy is an attractive option for both tumor - bed boost and apbi , allowing local dose escalation while reducing the dose to the surrounding normal structures .
radiotherapy for breast cancer often involves some incidental exposure of the heart to ionizing radiation .
darby et al . demonstrated that the relative risk of major cardiac events including myocardial infarction , coronary revascularization , and death from ischemic heart disease , increases linearly with the mean heart dose ( mhd ) by 7.4% per gray with no apparent threshold .
the increase of the subsequent rate of ischemic heart disease in irradiated patients is proportional to mhd , begins within a few years after exposure , and continues for at least 20 years .
apart from individual characteristics i.e. co - morbidities and age , systemic therapy such as anthracyclines and trastuzumab may further potentiate the radiation s effect on the heart .
the aim of this study was to assess dose received by the left anterior descending ( lad ) coronary artery during interstitial multi - catheter pulsed - dose - rate bt ( pdr - bt ) boost with 3-dimensional ( 3d ) computed tomography ( ct ) based planning for left - sided breast cancer patients undergoing organ - sparing treatment .
thirty consecutive patients were selected from women who received interstitial multi - catheter 3d pdr - bt boost dose to the conserved left breast , following wbrt at the medical university of gdask between 2014 - 2015 ( table 1 ) .
catheter implantation was performed in a geometrically uniform way using the standardized templates for a triangular array with 16 mm separation of the holes .
post - implant , non - contrast ct with a slice thickness of 3 mm was done .
the contours of ptv ( planning target volume ) and critical organs ( skin and ribs ) were imported and analyzed in treatment planning system oncentra v. 3.3 ( nucletron , an elekta company , elekta ab , stockholm , sweden ) . the clinical target volume ( ctv ) consisted of the tumor bed with an adequate safety margin .
the size of the safety margin was calculated as the sum of the width of the clear pathological surgical margins , and the radiation safety margin based on the localization of the clips left in tumor bed .
it had to be approximately 20 mm , as defined individually for every patient , considering clinical information .
the ptv was contoured 5 mm below the skin and above the chest wall , or just above the chest wall along the pectoralis muscle for superficial and deep tumors , respectively .
paris system rules , with graphical and manual optimization to deliver adapted homogenous dose distribution to the ptv , and to keep the dose non - uniformity ratio ( v150/v100 ; dnr ) as close as recommended ( < 0.35 ) were applied .
dose - volume histogram analyses were used to confirm that 100% of the prescribed dose covered at least 90% of the target volume .
the maximum skin dose was restricted to less than 100% of the prescribed dose . a dose of 10 gy with pulses of 1 gy / h was delivered . patient and tumor characteristics ( n = 30 ) wbrt whole breast radiotherapy , 3d - tcrt
3-dimensional tangential conformal radiotherapy the lad was retrospectively contoured on the ct scans by one of the radiation oncologists , based on guidelines described by the feng et al . .
left anterior descending coronary artery was contoured from its origin to each utmost visible part on planning ct image ( figure 1 ) .
a margin of 5 mm was added to each lad ( lad5 mm ) to allow for uncertainties regarding the exact position of the coronary artery .
dosimetric parameters extracted from dose - volume histograms including lad doses of standardized plans were analyzed .
rigid needles , planning target volume , and organs at risk including left anterior descending ( lad ) coronary artery ( a ) , and isodose 10% of the prescribed dose with reference to lad ( b ) statistical analysis was performed using spss software ( version 20.0 , ibm corporation , usa ) .
for statistical analyses , four quadrants of the breast were assumed . if > 50% of the ptv was situated above the line dividing the breast into equal upper and lower portions , than the location was assigned as
dose distribution to lad , according to the tumor bed localization was compared by u - mann whitney test with two - sided p - values and significance level of = 0.05 .
statistical analysis was performed using spss software ( version 20.0 , ibm corporation , usa ) .
quantitative data were expressed as mean standard deviation ( sd ) . for statistical analyses , four quadrants of the breast were assumed . if > 50% of the ptv was situated above the line dividing the breast into equal upper and lower portions , than the location was assigned as upper .
dose distribution to lad , according to the tumor bed localization was compared by u - mann whitney test with two - sided p - values and significance level of = 0.05 .
selected parameters of bt implants are presented in table 2 . the volume enclosed by the reference isodose ranged from 15.3 cc to 109.3 cc ( mean 42 cc )
tumor bed was in upper quadrants in 80% of cases , with the upper inner quadrant being the most common localization .
unsatisfactory higher dnr in half of the cases was related to our learning curve in 3d planning .
a summary of radiation doses to the lad and lad5 mm including d0.1cc ( representing the highest dose received by 0.1 cc of the lad , i.e. the dose peak ) is presented in table 3 .
the average ( dmean ) and maximal dose ( dmax ) to lad were 1 gy and 1.57 gy , respectively .
there is substantial patient - to - patient variability with the lad dmax up to 55% of the prescribed dose .
d0.1cc of the lad and lad5 mm were 1.42 gy and 1.85 gy ( range : 0.01 - 4.98 gy and 0.1 - 6.89 gy , respectively ) .
dose distribution to lad according to the tumor bed localization is presented in table 4 .
there was no difference in dmax to lad for medial versus lateral parts of the breast ( p = 0.92 ) .
no differences were noted for average dose according to tumor bed location ( lower vs. upper quadrants ; p = 0.35 , medial vs. lateral quadrants ; p = 0.92 ) .
dmax to lad was significantly higher for tumors located in lower versus upper part of the breast ( p = 0.04 ) .
selected parameters of brachytherapy implants ( 10 gy in 10 pulses per hour , n = 30 ) dnr dose non - uniformity ratio , v100 the percentage of the planning target volume ( ptv ) receiving 100% of the prescribed dose or more , d90 the percentage of the prescribed dose received by 90% volume of the ptv radiation dose to left anterior descending ( lad ) coronary artery for 30 left - sided breast cancer patients treated with 10 gy/10 pulses / hour pulsed - dose - rate brachytherapy tumor - bed boost lad left anterior descending coronary artery dose distribution to left anterior descending ( lad ) coronary artery according to the tumor bed localization lad left anterior descending coronary artery
micro- and macro - vascular injury in tissues within the radiotherapy field is considered the main pathophysiological cause of radiation - related heart disease .
the lad artery is of particular interest by its anatomical localization within the high dose region ( denoted by 95% of the radiation prescription ) of the wbrt fields .
an increased risk of stenosis in the lad for left - sided radiotherapy ( rt ) was reported . according to darby et al .
, a study based on doses estimated from the rt charts , the mhd was a better predictor of the rate of major coronary events ( angina episodes were not included ) than the mean dose to the lad . in clinical practice ,
several reports evaluated heart dose during breast irradiation and have provided ( for standard fractionation ) current recommendations of mhd and dose and volume constrains for this organ - at - risk ( oar ) to keep the probability of long - term cardiac mortality < 1% [ 8 , 9 , 10 , 11 ] .
more recently , danish experts have suggested to respect dose constrains to the heart as well as maximal dose to lad of 20 gy . in the literature , there are limited data of lad doses during breast irradiation , with only two published reports considering multi - catheter high - dose - rate bt ( hdr - bt ) as a form of apbi [ 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 ] ( table 5 ) .
chan et al . performed a quantitative intra - patient comparison of oar dosimetry between hdr - bt versus wbrt in a group of 15 patients with left breast cancer .
the authors assumed the maximum dose for the heart as a parameter to report lad dose .
the mean lad dose was 6.0 gy , which constitutes 17.6% of the prescribed bt dose of 34 gy in 10 twice daily fractions , and 5.9% ( after adjusting for eqd2 ) of 50 gy .
accelerated partial breast irradiation with the use of hdr - bt compared to conformal wbrt was associated with a significant reduction in radiation dose for the lad ( dmean 6.0 gy vs. 45.9 gy ; p < 0.01 ; dose differed by a factor of 7.7 ) .
the lad dose was the highest ( 7.8 gy ) in lower inner quadrant - located tumors . in this study ,
the d0.1cc of the heart and the mhd were 16.3 gy and 2.3 gy for apbi , respectively , and were significantly lower than for wbrt .
study , which compared radiation dose to the lad during hdr - bt apbi and wbrt , lad was outlined as in our series , but in uncertain bt cases each artery was identified with reference to the preoperative enhanced ct images to determine lad . in the bt group ( 100 cases ) , mean ptv was 35.8 cc ( 6.8 - 135.8 ) , mean v100 29.8 cc ( 7.0 - 106.5 ) , and mean dnr was 0.3 ( 0.2 - 0.6 ) .
the mean number of catheters and implant planes was 6.1 ( 3 - 12 ) and 1.6 ( 1 - 3 ) , respectively . in this series ,
the mean and maximal lad doses for tumors in inner quadrants or central locations ( 2.54 0.21 and 4.43 0.38 gy , respectively ) were significantly higher than those in outer quadrants ( 1.02 0.17 and 2.1 0.29 gy , respectively ; p < 0.0001 ) . after adjustment of the cumulative lad dose of apbi to wbrt using the bed equations , the mean and maximal doses in bt patients
were significantly reduced in patients with tumors in outer quadrants , but increased in inner quadrants or central location .
these authors stated that in patients with left - sided breast cancer , the risk of the relatively high dose to lad should be examined before treatment . in the present series with lad delineated according to guidelines by feng et al .
, lad dose during pdr - bt of 10 gy boost dose applied in addition to wbrt , the dmean and dmax to the lad were on average 1 gy and 1.57 gy , respectively .
however , in some cases , the latter dose constitutes up to 55% of the prescribed dose . as the lad is a serial organ , some authors postulated dmax to be applicable as a parameter in reporting lad exposure . in our series ,
mean d0.1cc was 1.42 gy , and ranged from 0.01 to 4.98 gy ( 0.1 - 49.8% of the tumor dose ) .
we did show the difference between lad maximal , but not average doses among patients with tumors located in the upper and lower quadrants . in a series of 60 left - sided breast cancer patients who were treated with balloon - based hdr - bt apbi using mammosite ( hologic inc . ,
aliso viejo , ca , usa ) applicators , for balloons located in the upper inner quadrant of the breast , the average whole heart dmean was the highest .
the lowest mhd ( 0.51 gy ) with 3d - conformal rt ( crt ) apbi as compared to multi - catheter and balloon hdr - bt apbi ( 1.58 gy and 2.17 gy , respectively ) for medially located left - breast tumors was demonstrated in an anthropomorphic phantom . in the most recent study by nilsson et al .
based on coronary angiography , which was performed at a mean follow - up of 3.8 years ( range : 0.3 - 8.2 years ) after 3d - crt , the distribution of radiation dose in the segments of the lad differed markedly between left- and right - sided breast cancer . in the left - sided tumors in mid - lad component and in particular segment ,
8 ( corresponding to distal lad ) doses approached the target of 50 - 60 gy . in 6 out of 7 left - breast cancer patients
, it was substantially higher mean dose ranging from 30 to 55 gy to the distal lad than 3 to 13 gy to the heart .
according to these authors , mid - lad is a critical vascular structure for developing late heart radiation effects .
patients with right - sided cancer had low mhd in a range of 1 - 3 gy , and left - sided had higher mhd in a range of 3 - 13 gy .
recent studies on left anterior descending ( lad ) coronary artery doses in breast cancer patients treated conservatively ( mean and maximum dose the values are averaged over analyzed patients ) wbrt whole breast radiotherapy , vdibh voluntary deep - inspiratory breath - hold , fb free - breathing , cwbrt conformal wbrt , hdr - bt high - dose - rate brachytherapy , apbi partial breast irradiation , 3dcrt three - dimensional conformal rt , imrt intensity modulated radiotherapy , for - imrt forward imrt , inv - imrt inverse imrt , ht
helical rt , vmat volumetric - modulated arc rt , sib simultaneous integrated boost , crt conformal rt , t - imrt tangential imrt , pdr - bt pulsed - dose - rate brachytherapy including 4 boosted cases , the most common wbrt dose fraction was 42.5 gy/16 fraction depending on the lad s segment in wbrt for left - sided breast cancer , the lad dose distribution varied among studies and depended on the technique used , being the highest with free - breathing ( fb ) crt [ 13 , 16 , 18 , 21 ] .
techniques to reduce cardiac irradiation dose include two - tangential or multi - beam intensity - modulated rt ( imrt ) , prone positioning , and breath holding techniques
. however , each of them has some limitations , which should be considered in clinical practice .
intensity - modulated rt in left breast cancer is associated with an improvement in dose homogeneity in the breast as well as reduction in cardiac dose , while the integral dose to the thorax , lungs , and contralateral breast is often increased . in terms of lad dose , dmean of the lad for prone position
is substantially lower compared to supine position , but at the expense of a higher mhd .
volumetric - modulated arc radiotherapy ( vmat ) resulted in a significant further reduction in both dmean and dmax of the lad compared with tangential imrt , based on deep inspiration breath - hold ( dibh ) .
plans based on dibh resulted in a dose reduction compared with fb for all heart and lad parameters .
notably , vmat - dibh is associated with 30% greater v5gy , as well as greater dose to the contralateral breast .
study investigated supine voluntary deep - inspiratory breath - hold ( vdibh ) and fb techniques to deliver 40 gy in 15 fractions demonstrated significant reduction of ntdmean of the lad ( a biologically equivalent mean of total dose to tissue normalized to 2 gy fractions using a standard linear quadratic model , / = 3 gy ) for supine vdibh than fb prone technique ( 2.9 and 7.8 ; p < 0.001 ) . overall , cardiac doses were low for both techniques .
deep - inspiratory breath - hold for left - sided breast cancer was associated with 43.5% reduction in dmean of the lad , as compared to fb wbrt by others .
comparison among current different irradiation techniques ( wbrt , hdr - bt apbi , and 3d - crt apbi ) demonstrates that wbrt appears to be the most challenging , especially for patients with large breasts or when significant set - up errors are anticipated with greater probability of having cardiovascular events in the future .
apart of apbi and modern external beam rt technique , intra - operative rt could further minimize dose to the coronary arteries .
most patients in our series were hypofractionated with the uk standardization of breast radiotherapy trial ( start ) schedule of 40 gy in 15 fractions . applying the relative seriality model , the risk of cardiac death at 15 years of 1.4% for conventional schedule ( 50 gy in 25 fractions ) and 0.7% for start regimen was assumed .
the others reported no statistically different cardiac mortality at 15-year follow - up among left - sided breast cancer patients treated with either conventional or hypofractionated wbrt .
cardiac damage is correlated to the heart - absorbed dose , which is greater for left- than right - breast irradiation and evidently in boosted patients .
the mean lad dose from left - sided wbrt was approximately five times higher than the dose from right - sided irradiation with the distal lad receiving the highest doses ( > 30 gy ; 75% of tumor dose ) , and the right and circumflex coronary arteries received approximately 2 gy mean dose . in this study ,
patient - to - patient variability in mean dose was the greatest for lad dose from left - sided irradiation , high lad dose was associated with high mhd , and the patient with the highest mhd ( 4.4 gy ) also had the highest lad dose ( 21.3 gy ) .
they reported that lad dmean for left - tangential irradiation has decreased from 63.6% in the 1970s to 19.0% of tumor dose in 2006 .
apart from historical changes in heart doses during breast cancer rt , the part of heart , particularly the anterior myocardial wall with lad lying on this surface , is receiving a dose of 20 gy , which determine the risk of ischemic heart disease for years after rt .
for this analysis , the lad was retrospectively contoured by one author according to feng et al . guidelines .
a multi - center study from denmark and the uk demonstrated substantial inter - observer variation in the estimated dose to the lad , even when guidelines for delineation were applied [ 12 , 28 ] .
for the heart , there was little inter - observer variation in the estimated dose .
organ motion during the treatment including inter - fraction variations is another factor influencing the lad estimated dose . in this series ,
the maximal dose for lad with 5 mm margin was on average 1.99 gy , and ranged from 1% to 75% of the tumor dose .
given the geometric uncertainties , it was postulated to consider all cardiac dose parameters including v4gy and v25gy , along with mhd , when assessing the risk of future cardiac morbidity .
for interstitial bt with the use of both metal and plastic catheters , the planning system applied was demonstrated to influence the dose to various volumes of interest [ 29 , 30 ] .
in patients with breast cancer , it is intended to minimize , as much as possible , the heart volume that is irradiated without compromising the target coverage .
recent implementation of 3d techniques has allowed delineation of the heart and coronary artery during rt planning processes including bt . the lad dose for patients with left - sided breast cancer should be routinely examined ( should be kept as low as possible ) and reported to clarify its clinical consequences , and eventually establish constraints for this artery .
our data demonstrated that the mean lad dose in interstitial multi - catheter pdr - bt boost of 10 gy in - left breast is , on average , low .
however , higher dose in individual cases may result in clinically relevant late cardiac toxicity ; therefore , in selected patients , the boost dose may require alternative approaches .
| purposeto assess dose received by the left anterior descending ( lad ) coronary artery during interstitial pulsed - dose - rate brachytherapy ( pdr - bt ) boost for left - sided breast cancer patients undergoing organ - sparing treatment.material and methodsthirty consecutive pt1 - 3n0 - 1m0 breast cancer patients boosted between 2014 and 2015 with 10 gy/10 pulses / hour pdr - bt following a computed tomography ( ct ) simulation with the multi - catheter implant were included .
the most common localization of primary tumor were upper quadrants .
patients were implanted with rigid tubes following breast conserving surgery and whole breast external beam irradiation ( 40 gy/15 or 50 gy/25 fractions ) .
computed tomography scans were retrospectively reviewed and lads were contoured without and with margin of 5 mm ( lad5 mm ) .
standard treatment plan encompassed tumor bed determined by the surgical clips with margin of 2 cm .
dosimetric parameters were extracted from the dose - volume histograms.resultsthe mean d90 and v100 were 10.3 gy ( range : 6.6 - 13.3 ) , and 42.0 cc ( range : 15.3 - 109.3 ) , respectively . the median dose non - uniformity ratio ( dnr ) was 0.50 ( range : 0.27 - 0.82 ) .
the mean doses to lad and lad5 mm were 1.0 gy and 0.96 gy , and maximal doses were 1.57 gy and 1.99 gy , respectively .
dose to the 0.1 cc of the lad and lad5 mm were 1.42 gy and 1.85 gy ( range : 0.01 - 4.98 gy and 0.1 - 6.89 gy ) , respectively.conclusionsinterstitial multi - catheter pdr - bt used as a boost for left - sided breast cancer is generally associated with low dose to the lad .
however , higher dose in individual cases may require alternative approaches . |
mechanical stress caused by flexibility training can affect hemodynamic responses.1 it has been shown that stretched muscle fibers activate mechanoreceptors , which elicit cardiovascular adjustments through parasympathetic withdrawal and sympathetic activation.26 in this context , previous studies with animal models have demonstrated that the muscle tension produced while stretching increases cardiovascular responses , particularly the heart rate ( hr).7 other studies have demonstrated that small muscle fiber receptors also react to stretching in humans,4,8 with a significant impact on the initial hr acceleration . in addition , sustained contractions of large muscle groups increase the peripheral vascular resistance and therefore influence the cardiac output and blood pressure ( bp).9 considering this accumulated evidence , it is reasonable to hypothesize that the muscle mass affected by a stretching exercise may also be a determinant of cardiovascular responses to flexibility training .
another issue to be considered is the increase in cardiac preload due to the valsalva maneuver ( vm).10 depending on the body position , it is not unusual for respiration to be blocked while stretching .
the expiratory effort and increase in thoracic pressure during the vm reduce the venous return and cardiac output , which provokes baroreflex responses that can increase the bp.11 the combination of prolonged static contractions and the vm is known to amplify the increase in bp and the pressure load on the heart.12,13 sedentary or less flexible subjects may perform the vm during stretching exercises due to difficulty in reaching and sustaining extreme ranges of motion .
in addition , maintaining an adequate workload position for several seconds may demand sustained static ( isometric ) contractions of reasonable intensity . despite these considerations , studies on the acute cardiovascular responses to flexibility training
are lacking . assuming that important levels of static contraction may occur during this kind of exercise
, it is possible that cardiovascular responses are great enough to be a concern in exercise programs designed for special populations , such as cardiac patients .
it would be also interesting from a clinical perspective to investigate the potential of flexibility exercises to induce post - exercise hypotension .
there is substantial evidence showing that bp decreases following dynamic resistance exercises.14,15 it is also well accepted that cardiovascular responses are influenced by training variables , such as the exercise execution time ( or number of repetitions ) , workload , muscle mass recruited , type of contraction , and respiratory blockage.9,12,15,16 however , studies of cardiovascular post - exercise responses have focused mainly on aerobic and strength training bouts . to the best of our knowledge , no previous research has observed the influence of these variables on bp following flexibility training sessions .
therefore , the purpose of this study was to evaluate , in young healthy subjects with poor flexibility levels , hr , systolic bp ( sbp ) , and the rate - pressure product ( rpp ) during and after passive stretching exercises involving different muscle masses performed with and without the vm .
we hypothesized that stretching exercises involving larger muscle masses and the vm would induce greater cardiovascular responses as compared to exercises involving smaller muscle masses and avoiding the vm .
additionally , post - exercise hypotension was expected to occur , at least after stretching larger muscle groups .
all of the subjects in this study declared themselves to have very limited flexibility and to have not stretched regularly for at least two years . additionally , they needed to exhibit a low level of flexibility in hip and ankle flexion movements ( less than 90 and 30 , respectively).17 the following were additional exclusion criteria : a ) use of tobacco or drugs that could affect cardiovascular responses ; b ) bone , joint , or muscle problems or any clinical condition that could limit exercise performance .
a total of 22 healthy male subjects without previous experience in flexibility training volunteered for the study and satisfied the inclusion and exclusion criteria .
the subjects had the following characteristics : age , 223 years ; weight , 736 kg ; height , 1755 cm ; resting hr , 669 bpm ; resting sbp , 11310 mmhg ; hip flexion maximal range of motion , 699 degrees .
the experimental approach had institutional ethical board approval , and all of the subjects signed an informed consent form prior to participation in the study .
all of the subjects were instructed to avoid caffeine , alcohol , and any kind of physical exercise in the 24 hr prior to the exercise session .
the subjects were matched according their flexibility to assure that the exercises represented a similar relative workload .
this procedure was adopted due to a possible relationship between flexibility levels and cardiovascular responses .
flexibility was assessed by a universal goniometer , and a poor flexibility level was ratified by means of the cut - off points previously mentioned .
the stretching exercises were performed passively , according to the static method , in four sets of 30 s separated by 15-s intervals .
two movements that aimed to stretch a larger muscle group ( the ischio - tibialis muscle ) and a smaller muscle group ( the gastrocnemius muscle ) were selected .
the exercises were performed over the maximal range of motion with and without the vm , which was carried out during the last 15 s of the stretching stimulus .
each subject completed four exercise sessions separated by 48 hrs in a counterbalanced cross - over design : a ) hip flexion with the subject lying prone , the knees extended , with the vm ( hfv+ ) ; b ) hip flexion with the subject lying prone , the knees extended , without the vm ( hfv- ) ; c ) dorsiflexion with the subject lying prone , the knees extended , with the vm ( dfv+ ) ; d ) dorsiflexion with the subject lying prone , the knees extended , without the vm ( dfv- ) .
the left and right limbs were stretched alternately in each session ( unilateral exercise ) to minimize possible effects of the ischio - tibial muscle stretching on the gastrocnemius flexibility ( passive resistance of the posterior muscle groups ) .
the hr and sbp were assessed at rest and during and after the exercise session ( immediately after and every 10 min for 30 min after the exercise session ) . for the rest assessment
, the subjects remained comfortably seated in a quiet environment for 5 min prior to the assessment .
for the post - exercise assessments , the subjects remained seated , relaxed and quiet for 30 min .
the sbp was measured by a semi - automatic device ( hem-431 cint omron , vernon hills , il , usa ) , following published recommendations.18 the hr was assessed beat - by - beat using an r - r recorder ( polar s810 , kempele , finland ) . a pilot study with 12 healthy , active
, low flexibility male volunteers was implemented to determine the reliability of the sbp assessment during exercise . to estimate the test - retest reliability ,
the same evaluator measured the sbp three times at the end of the same stretching exercise .
the intra - class correlation coefficient was considered satisfactory ( icc = 0.81 , p = 0.032 ) , and a one - way anova model did not detect differences between the measurements ( p = 0.08 ) .
hence , a three - way anova model with repeated measures for the third factor ( exercise vm temporal comparison ) and the tukey post - hoc test ( where indicated ) were used to compare the hr , sbp , and rpp at rest , during the exercise session , and during the post - exercise recovery period . for all analyses , significance was set at p 0.05 .
the same statistical software was used for all calculations ( statistica 6.0 , statsoft , tulsa , ok , usa ) .
all of the subjects in this study declared themselves to have very limited flexibility and to have not stretched regularly for at least two years . additionally , they needed to exhibit a low level of flexibility in hip and ankle flexion movements ( less than 90 and 30 , respectively).17 the following were additional exclusion criteria : a ) use of tobacco or drugs that could affect cardiovascular responses ; b ) bone , joint , or muscle problems or any clinical condition that could limit exercise performance .
a total of 22 healthy male subjects without previous experience in flexibility training volunteered for the study and satisfied the inclusion and exclusion criteria .
the subjects had the following characteristics : age , 223 years ; weight , 736 kg ; height , 1755 cm ; resting hr , 669 bpm ; resting sbp , 11310 mmhg ; hip flexion maximal range of motion , 699 degrees .
the experimental approach had institutional ethical board approval , and all of the subjects signed an informed consent form prior to participation in the study .
all of the subjects were instructed to avoid caffeine , alcohol , and any kind of physical exercise in the 24 hr prior to the exercise session .
the subjects were matched according their flexibility to assure that the exercises represented a similar relative workload .
this procedure was adopted due to a possible relationship between flexibility levels and cardiovascular responses .
flexibility was assessed by a universal goniometer , and a poor flexibility level was ratified by means of the cut - off points previously mentioned .
the stretching exercises were performed passively , according to the static method , in four sets of 30 s separated by 15-s intervals .
two movements that aimed to stretch a larger muscle group ( the ischio - tibialis muscle ) and a smaller muscle group ( the gastrocnemius muscle ) were selected .
the exercises were performed over the maximal range of motion with and without the vm , which was carried out during the last 15 s of the stretching stimulus .
each subject completed four exercise sessions separated by 48 hrs in a counterbalanced cross - over design : a ) hip flexion with the subject lying prone , the knees extended , with the vm ( hfv+ ) ; b ) hip flexion with the subject lying prone , the knees extended , without the vm ( hfv- ) ; c ) dorsiflexion with the subject lying prone , the knees extended , with the vm ( dfv+ ) ; d ) dorsiflexion with the subject lying prone , the knees extended , without the vm ( dfv- ) .
the left and right limbs were stretched alternately in each session ( unilateral exercise ) to minimize possible effects of the ischio - tibial muscle stretching on the gastrocnemius flexibility ( passive resistance of the posterior muscle groups ) .
the hr and sbp were assessed at rest and during and after the exercise session ( immediately after and every 10 min for 30 min after the exercise session ) . for the rest assessment ,
the subjects remained comfortably seated in a quiet environment for 5 min prior to the assessment .
for the post - exercise assessments , the subjects remained seated , relaxed and quiet for 30 min .
the sbp was measured by a semi - automatic device ( hem-431 cint omron , vernon hills , il , usa ) , following published recommendations.18 the hr was assessed beat - by - beat using an r - r recorder ( polar s810 , kempele , finland ) . a pilot study with 12 healthy , active
, low flexibility male volunteers was implemented to determine the reliability of the sbp assessment during exercise . to estimate the test - retest reliability ,
the same evaluator measured the sbp three times at the end of the same stretching exercise .
the intra - class correlation coefficient was considered satisfactory ( icc = 0.81 , p = 0.032 ) , and a one - way anova model did not detect differences between the measurements ( p = 0.08 ) .
hence , a three - way anova model with repeated measures for the third factor ( exercise vm temporal comparison ) and the tukey post - hoc test ( where indicated ) were used to compare the hr , sbp , and rpp at rest , during the exercise session , and during the post - exercise recovery period . for all analyses , significance was set at p 0.05 .
the same statistical software was used for all calculations ( statistica 6.0 , statsoft , tulsa , ok , usa ) .
the statistical power of the within - between - group interaction test in the repeated measures anova model was determined using the gpower version 3.1.2 software ( universitt kiel , kiel , germany ) .
the following parameters were used to calculate the statistical power : effect - size = 2.5 ; type i error probability = 0.05 ; number of groups = 4 ; number of measurements = 8 ; correlation among repeated measures = 0.5 ; and nonsphericity correction = 1 . the actual power for n = 22 was 0.797 , which is considered to be acceptable for a type ii error .
figures 1 to 3 show the results for the within - group and between - group comparisons .
the number of sets done influenced the sbp , but not the hr ( p < 0.03 ) .
in fact , the sbp increased significantly between the 1 and 2 sets in all of the stretching protocols , between the 1 and 3 sets in the hfv+ , hfv- , and dfv+ protocols , and between the 2 and 4 sets in the hfv+ and hfv- protocols .
no post - exercise hypotension was observed in the 30 min following the end of the exercise session , regardless of the stretching protocol ( p > 0.08 ) .
the bp responses influenced the rpp , which increased significantly between the 1 and 2 sets of exercise in the hfv+ protocol [ p < 0.017 ] and between the 1 and 3 sets ( p <
the rpp also increased between the 2 and 4 sets in the hfv+ and hfv- protocols ( p < 0.04 ) . in both
the ischio - tibialis and gastrocnemius stretching exercises , there was a clear tendency for the cardiovascular responses to increase when the vm was performed . the between - group comparison allowed for a more specific analysis of the influence of stretched muscle mass and the vm on the cardiovascular responses for an equivalent training volume in each exercise ( e.g. , the number of sets and time of stimulation ) .
the sbp increased throughout all of the sets for the hfv+ and hfv- protocols , but not for the dfv+ and dfv- protocols .
furthermore , the sbp values assessed for the hfv+ protocol were significantly higher than those obtained for the dfv+ and dfv- protocols .
this pattern was observed when comparing the hfv- and the dfv+ protocols and the hfv- and the dfv- protocols .
no differences in the hr for any set were detected between the hfv+ and hfv protocols or the dfv+ and dfv - protocols . by contrast , the hr was systematically higher with the hip flexion than with the dorsiflexion , regardless of the inclusion of the vm . as expected from the results obtained for the sbp and hr , the rpp was significantly higher throughout all of the sets for the hfv+ and hfv- protocols as compared to the dfv+ and dfv- protocols .
moreover , the rpp was higher in the 2 to 4 sets of the hfv+ protocol than in the same sets of the hfv- protocol . therefore , the rpp was affected by both the vm and the muscle mass stretched .
the present study aimed to observe the cardiovascular responses to multiple sets of stretching exercises involving different muscle masses and the vm .
the primary findings revealed that there were significant and cumulative increases in the sbp and rpp throughout the passive stretching sets and that such increases were higher when the exercises were performed with the vm .
by contrast , the hr remained stable throughout the sets , although it was significantly greater than the resting condition value .
the physiological mechanisms underlying cardiovascular responses during flexibility exercises are not completely known . in the present study ,
the maximal range of motion was reached and held passively , and the stretched muscle was certainly contracted because of the muscle spindle reflex .
the sustained muscle tension may have favored the hr and sbp increases due to the activation of muscle and tendon mechanoreceptors.6,19 the sustained static contraction combined with stretching to the maximal range of motion may also have occluded muscle vessels , leading to an increase in the sbp.3,20 moreover , it has been shown that , in simultaneous muscle stretching and contraction ( which is typical of the static stretching method , due to the muscle spindle reflex ) , type iii fibers and metaboreceptor activation may induce vagal inhibition and baroreflex stimulation and contribute to an increase in the overall cardiovascular response.21,22 it has been established that the training level can reduce the hemodynamic response to resistive exercises.23 moreover , the acute hr response depends on the duration of the muscle contraction , being higher at the end of prolonged exercise than for shorter exercise.24 in the present study , the hr was assessed during exercise sessions performed with a static component sustained for 30 s , with four repetitions .
because the subjects had low flexibility levels , the contraction intensity can be considered as at least moderate , representing a non - negligible muscle workload . additionally , the hr and bp in each set increased proportionally to the duration of the muscle contraction .
this issue evokes the importance of controlling the stimulation duration to prevent undesirable cardiac stress .
the mass of the stretched muscle influenced the hr , regardless of the presence of the vm .
the values for the hfv+ and hfv- protocols were systematically higher than those of the dfv+ and dfv- protocols .
it is possible to imagine that , in stiff subjects , stretching exercises increase the intramuscular pressure and therefore the peripheral resistance and ejection volume.25 in addition , the execution of the vm may enhance the intra - abdominal and intra - thoracic pressures , which would influence the bp.26 it has been previously demonstrated that static contractions with 40%-60% of the maximal voluntary strength can restrain blood flow and elevate the bp response , particularly if the muscle contraction is prolonged.27 it is well accepted that successive sets of resistive exercises lead to a progressive and cumulative rise in the sbp.28 the same tendency was observed in the present study for multiple sets of stretching exercises , even though they were performed passively .
cornelius et al.25 did not observe alterations in the sbp during flexibility exercise using proprioceptive neuromuscular facilitation and short static contractions .
the respiration was not controlled , however , which raises the possibility that the vm had been performed .
moreover , the static contraction period was considerably shorter than in the present study ( 4 to 5 s ) .
gladwell and coote8 observed the hr and sbp during a sustained passive stretch of the triceps surae for 1 min and found a significant increase in the hr but not in the sbp , while our findings indicate that both the sbp and hr increase .
a possible explanation for such disparity lies in type iii afferent fibers being sensitive to stretching and contraction and therefore being stimulated by muscle tissue deformation and static tension .
the sbp was influenced by the vm , at least in the exercises that engaged a larger muscle mass . in all of the sets
, there were significant differences between the hfv+ and hfv- protocols but not between the dfv+ and dfv- protocols .
these results suggest that the influence of respiratory blocking on the cardiovascular response during flexibility exercises is greater when larger muscle groups are stretched .
o'connor et al.26 proposed that the vm combined with static exercises may significantly increase the bp in normotensive subjects .
it is also possible that the vm interferes with the transition from rest to exercise , perhaps contributing to the bp increase.29 our findings are consistent with this idea ; the combination of incorporating a larger muscle mass and the vm produced greater increases in the bp , regardless the number of sets done .
the rpp is usually applied to estimate the cardiac workload in aerobic and strength exercises,15 but data on flexibility training are not available .
there is accumulated evidence indicating that the muscle mass exercised influences the cardiac workload during resistive training ( the larger the muscle mass , the greater the workload imposed on the heart).9,12,15 it has also been shown that in static flexibility training , the rpp may reach levels similar to those observed during dynamic resistive exercises performed with a high intensity and a relatively low number of repetitions.13,30 our results agree with these findings because the rpp observed in the hfv+ protocol is similar to the values previously reported for resistance exercises performed with 80% of 1 rm.23 based on these findings , and considering that subjects with coronary disease may have very low ischemic thresholds , further research comparing resistive and flexibility exercises performed by the lower and upper limbs in these patients would be valuable for determining the relative cardiac workloads in different stretching protocols .
previous research has demonstrated that bouts of resistance exercise may induce post - exercise hypotension,14,16 but the effects of stretching exercise sessions have not been investigated . in the present study , no post - exercise hypotension was observed , regardless of the muscle group stretched . a possible explanation may be the small volume of work involved , considering that each stretching session was only 2 min .
changes in the neural control of the circulatory system and the release of vasodilatory metabolites are probably connected with the phenomenon , however.31 in this sense , the volume , intensity , and type of exercise may influence the magnitude and duration of the hypotension.9,1416 hence , it is possible that the short exercise periods and relatively small muscle masses recruited by the study 's stretching protocols represented a small exercise volume that was not capable of inducing the hypotensive response .
the vm intensity was not controlled , so the expiratory pressure was set individually . during the flexibility exercises ,
the range of motion was also not predefined , and the intensity of the reflex static contractions during the stretching was not quantified . in this context , the measurement of electromyographic activity could provide essential information about muscle activity .
the exercise protocol did aim to reproduce actual training practices , however , to increase the potential impact for practitioners who need to make appropriate decisions when designing exercise programs . in summary , the muscle masses involved and the vm influenced the bp responses during the stretching exercises .
by contrast , there was no effect on the hr or bp in the post - exercise recovery period .
the number of sets performed had a cumulative incremental effect on the sbp but not on the hr , regardless of the muscle masses involved . the cardiac workload ( as reflected by the rpp )
it was higher in situations that combined a larger stretched muscle mass , a higher number of sets , and the vm .
although the present findings were obtained from young , healthy subjects , they may have important practical implications for exercise prescriptions in other training contexts ; the question certainly warrants future research .
for example , it is conceivable that an increase in cardiovascular responses during flexibility training sessions should be avoided in subjects with a high risk of adverse cardiovascular events , given that flexibility exercises are commonly executed after aerobic or resistive training , when the hr and rpp may be still elevated .
in conclusion , the muscle mass stretched and the vm during passive static flexibility exercises influence acute cardiovascular responses , particularly the sbp .
this study was partially supported by grants from the brazilian council for research and technological development ( cnpq ) and the carlos chagas foundation for research support in rio de janeiro ( faperj ) . | background : the respiratory pattern is often modified or even blocked during flexibility exercises , but little is known about the cardiovascular response to concomitant stretching and the valsalva maneuver ( vm ) in healthy subjects.objectives:this study evaluated the heart rate ( hr ) , systolic blood pressure ( sbp ) , and rate - pressure product ( rpp ) during and after large and small muscle group flexibility exercises performed simultaneously with the vm.methods:asymptomatic volunteers ( n = 22 ) with the following characteristics were recruited : age , 22 3 years ; weight , 73 6 kg ; height , 175 5 cm ; hr at rest , 66 9 bpm ; and sbp at rest , 113 10 mmhg .
they performed two exercises : four sets of passive static stretching for 30 s of the dorsi - flexion ( df ) of the gastrocnemius and the hip flexion ( hf ) of the ischio - tibialis .
the exercises were performed with ( v+ ) or without ( v- ) the vm in a counterbalanced order .
the sbp and hr were measured , and the rpp was calculated before the exercise session , at the end of each set , and during a 30-min post - exercise recovery period.results:the within - group comparisons showed that only the sbp and rpp increased throughout the sets ( p<0.05 ) , but no post - exercise hypotension was detected .
the between - group comparisons showed that greater sbp increases were related to the vm and to a larger stretched muscle mass .
differences for a given set were identified for the hr ( the hfv+ and hfv- values were higher than the dfv+ and dfv- values by approximately 12 bpm ) , sbp ( the hfv+ value was higher than the dfv+ and dfv- values by approximately 12 to 15 mmhg ) , and rpp ( the hfv+ value was higher than the hfv- value by approximately 2000 mmhgxbpm , and the hfv+ value was higher than the dfv+ and dfv- values by approximately 4000 mmhgxbpm).conclusion : both the stretched muscle mass and the vm influence acute cardiovascular responses to multiple - set passive stretching exercise sessions . |
the platinum - based doublet is the chemotherapy of choice in patients with stage iiib / iv non small cell lung carcinoma ( nsclc).1 pemetrexed is given with platinum compounds in patients with the nonsquamous type of nsclc.2 the pemetrexed - platinum combination has an overall survival advantage in patients with nsclc.3 however , this combination is known to cause grade 3/4 adverse drug reactions , including neutropenia , thrombocytopenia , anemia , nausea , vomiting , rash , and diarrhea.4 hyponatremia is not a common adverse drug reaction associated with the pemetrexed - platinum combination .
cisplatin is associated with grade 3/4 hyponatremia in 4%10% of patients due to renal salt wasting.5 however , the incidence of severe hyponatremia with carboplatin is much lower , and mostly due to the syndrome of inappropriate antidiuretic hormone secretion ( siadh ) .
, the incidence of hyponatremia was around 2.12% in pemetrexed - treated patients.6 however , for reasons that are not well understood , a high incidence of hyponatremia has been observed in our patients receiving a pemetrexed - platinum combination for nsclc .
this trend was further confirmed during a bioequivalence study of two pemetrexed formulations conducted in our center .
here we report the findings of our exploratory study to understand the reasons for the high incidence of hyponatremia observed in our patients , particularly its correlation with pemetrexed exposure .
forty - six patients with nsclc were enrolled for the bioequivalence study ( clinical trials registry of india , ctri/2012/09/002972 ) of pemetrexed ( pemgem , dr reddy s laboratories ltd , hyderabad , india ) versus alimta ( eli lilly and company , indianapolis , in , usa ) in combination with platinum compounds .
patients received pemetrexed 500 mg / m with either cisplatin 75 mg / m or a dose of carboplatin based on a target area under the curve ( auc ) of 5 .
pemetrexed was reconstituted in 100 ml of normal saline and administered as an intravenous infusion over 10 minutes , followed by administration of cisplatin in normal saline or carboplatin in 5% dextrose solution over 3060 minutes .
written informed consent was obtained from all patients prior to enrolling them in the bioequivalence study .
pharmacokinetic blood samples were collected in the first cycle during and at various time points after the 10-minute pemetrexed infusion .
the safety analysis comprised blood counts , serum electrolytes , and liver and renal function tests as per routine institutional practice .
owing to a high incidence of hyponatremia in the first few patients , it was decided to do a complete work - up comprising serum osmolality , a urine sodium spot test , and urine osmolality in subsequent patients whenever a hyponatremia episode was observed .
the number of episodes of grade 3 hyponatremia over six cycles and number of patients requiring intervention in the form of salt tablets or normal saline injections were evaluated .
after six cycles of the doublet regimen , patients were administered single - agent pemetrexed as maintenance treatment according to institutional practice .
the auc of pemetrexed and its clearance was estimated by noncompartmental analysis using winnonlin software ( winnonlin professional , version 6.3 , certara usa , inc . , st .
serum sodium levels were further classified as normal ( 131145 meq / l ) , low - grade hyponatremia ( 125130
meq / l ) . mean values for auc and clearance was compared between the groups using the nonparametric mann
the tendency for hyponatremia with respect to pemetrexed exposure ( auc ) in the three groups was analyzed using the kruskal
the effect of covariates on hyponatremia was analyzed using logistic regression with backward elimination . a p - value less than 0.05 was considered to be statistically significant .
the auc of pemetrexed and its clearance was estimated by noncompartmental analysis using winnonlin software ( winnonlin professional , version 6.3 , certara usa , inc . , st .
serum sodium levels were further classified as normal ( 131145 meq / l ) , low - grade hyponatremia ( 125130
meq / l ) . mean values for auc and clearance was compared between the groups using the nonparametric mann
the tendency for hyponatremia with respect to pemetrexed exposure ( auc ) in the three groups was analyzed using the kruskal
the effect of covariates on hyponatremia was analyzed using logistic regression with backward elimination . a p - value less than 0.05 was considered to be statistically significant .
we prospectively evaluated 46 patients with nsclc who received the pemetrexed - platinum doublet regimen .
sixteen of 46 patients developed grade 3 hyponatremia at least once during the doublet regimen .
the baseline characteristics of patients having hyponatremia and those without are shown in table 1 .
logistic regression analysis showed that baseline variables including age , sex , stage of disease , performance status , formulation ( pemgem or alimta ) , or regimen ( cisplatin or carboplatin ) did not have any effect on hyponatremia .
there was a total of 26 episodes of grade 3 hyponatremia over 200 chemotherapy cycles of the doublet regimen .
median chloride levels were 91 ( 8494 ) meq / l , while potassium was 4.5 ( 3.585.4 ) meq / l .
almost all patients had borderline low chloride ( n=14 ) and normal potassium ( n=16 ) levels .
median serum osmolality was 273 ( 256286 ) mosmol / kg while urine osmolality was 401 ( 219635 ) mosmol / kg and fractional excretion of sodium in urine was 31 ( 993 ) meq / l ( table 2 ) .
serum creatinine did not change significantly from baseline during the course of treatment , even in those patients who developed hyponatremia .
patients with high - grade hyponatremia had a higher auc compared with patients having normal or low - grade hyponatremia ( p=0.001 and p=0.063 , respectively ) .
there was a trend towards progressively more severe hyponatremia with higher exposure to pemetrexed ( kruskal wallis , p=0.006 , figure 1 ) .
consequently , the clearance of pemetrexed was less in patients with high - grade hyponatremia compared with those with normal / low grade hyponatremia ( p=0.001 and p=0.055 , respectively ) .
clearance of pemetrexed ( median and range ) in the normal , low - grade , and high - grade groups was 4,021 ( 1,46211,698 ) ml per hour , 3,096 ( 2,0227,336 ) ml per hour , and 1,569 ( 6382,503 ) ml per hour , respectively ( kruskal wallis , p=0.007 ) .
three of 18 patients on maintenance pemetrexed developed grade 3 hyponatremia , one of whom was a 25-year - old woman diagnosed with metastatic papillary adenocarcinoma who developed grade 4 hyponatremia ( sodium 103 mg / dl ) on day 4 of the fifth maintenance cycle .
other significant biochemical findings included low levels of serum chloride ( 88 meq / l ) , low serum osmolality ( 263 mosmol / kg ) , high urine osmolality ( 889 mosmol / kg ) , and high urine random sodium ( 170 meq / l ) . serum potassium , magnesium , and calcium were within normal limits , and the patient was asymptomatic .
sodium and other parameters returned to baseline by day 7 and the patient was discharged .
patients with high - grade hyponatremia had a higher auc compared with patients having normal or low - grade hyponatremia ( p=0.001 and p=0.063 , respectively ) .
there was a trend towards progressively more severe hyponatremia with higher exposure to pemetrexed ( kruskal wallis , p=0.006 , figure 1 ) .
consequently , the clearance of pemetrexed was less in patients with high - grade hyponatremia compared with those with normal / low grade hyponatremia ( p=0.001 and p=0.055 , respectively ) .
clearance of pemetrexed ( median and range ) in the normal , low - grade , and high - grade groups was 4,021 ( 1,46211,698 ) ml per hour , 3,096 ( 2,0227,336 ) ml per hour , and 1,569 ( 6382,503 ) ml per hour , respectively ( kruskal wallis , p=0.007 ) .
eighteen patients received maintenance pemetrexed therapy . three of 18 patients on maintenance pemetrexed developed grade 3 hyponatremia ,
one of whom was a 25-year - old woman diagnosed with metastatic papillary adenocarcinoma who developed grade 4 hyponatremia ( sodium 103 mg / dl ) on day 4 of the fifth maintenance cycle .
other significant biochemical findings included low levels of serum chloride ( 88 meq / l ) , low serum osmolality ( 263 mosmol / kg ) , high urine osmolality ( 889 mosmol / kg ) , and high urine random sodium ( 170 meq / l ) . serum potassium , magnesium , and calcium were within normal limits , and the patient was asymptomatic .
sodium and other parameters returned to baseline by day 7 and the patient was discharged .
in the present study , an unusually high incidence ( 35% ) of hyponatremia was seen in nsclc on treatment with a pemetrexed - platinum combination .
chee et al reported a 3% incidence of grade 3 hyponatremia due to the pemetrexed - carboplatin combination.7 their study enrolled a similar number of patients as in our study . in another study
the incidence of hyponatremia was 0.5%.8 the high incidence of hyponatremia in indian patients suggests possible ethnic variations in the disposition and off - target effects of the doublet .
although hyponatremia is not a very common side effect of carboplatin or pemetrexed carboplatin is known to cause severe hyponatremia occasionally mostly due to siadh.9 case reports have shown that carboplatin can cause siadh by increasing the activity of vasopressin - associated peptide .
cisplatin on the other hand causes hyponatremia by causing direct damage to renal tubular cells , resulting in renal salt wasting.10 siadh and renal salt wasting are biochemically identical conditions that can only be differentiated on clinical grounds .
euvolemia or mild hypervolemia is seen in siadh , as opposed to hypovolemia in renal salt wasting .
differentiation of these two conditions is essential , because treatment requires fluid restriction in siadh and fluid and electrolyte replenishment in renal salt wasting . in our study ,
spot urine sodium excretion was higher in patients with hyponatremia and urine osmolality was higher than the serum osmolality , suggesting siadh as the likely mechanism of hyponatremia .
pemetrexed exposure ( auc ) in high - grade hyponatremia patients was reported to be 427 ( 3051,095 ) g hour / ml , which is significantly higher than the auc of 182 ( 99.8302 ) g hour / ml reported in western studies.11 it is therefore conceivable that higher exposure to pemetrexed is responsible for its hyponatremia effects in indian patients .
the high incidence of hyponatremia observed during single - agent maintenance therapy lends further credence to the fact that pemetrexed by itself may have hyponatremic effects , independent of the coadministered platinum .
interestingly , only one of the three patients had hyponatremia during the earlier doublet regimen .
clearance of pemetrexed is known to decrease with prolonged treatment,12 which might have resulted in higher exposure during maintenance chemotherapy in the other two cases.12 pemetrexed is predominantly excreted by glomerular filtration and renal secretion .
it is excreted by organic anion transporter 3 ( oat3 ) in the proximal tubule .
the frequency of the oat3 allele in the western population is approximately 1% . in vitro assay with three variants ( p. arg149ser , p. gln239stop , and p. ile260arg ) showed complete loss of function.13 however ,
allele frequency has not been reported in the indian population.13 future studies should look at oat3 polymorphisms in indian patients because this could explain the increased exposure to and reduced clearance of pemetrexed observed in most subjects who develop hyponatremia .
this study has an obvious limitation , ie , the correlation between pemetrexed exposure and hyponatremia was an incidental finding .
knowledge of platinum exposure in this cohort of patients would have given a better understanding of the nature of the drug
the plasma levels of pemetrexed may be suggestive but do not prove causation , since we do not know the plasma levels of the platinum compounds .
this potential interaction needs to be evaluated in prospectively designed clinical trials in the future .
we report a high incidence of severe hyponatremia in indian patients with nsclc receiving the pemetrexed - platinum combination .
higher exposure to pemetrexed was found in patients with hyponatremia than in those without hyponatremia . | backgroundpemetrexed - platinum doublet therapy is a standard treatment for stage iiib / iv nonsquamous non small cell lung cancer ( nsclc ) .
while the regimen is associated with several grade 3 toxicities , hyponatremia is not a commonly reported adverse effect .
here we report an unusually high incidence of grade 3 hyponatremia in indian patients receiving pemetrexed - platinum doublet , and the pharmacological basis for this phenomenon.methodsforty-six patients with advanced nsclc were enrolled for a bioequivalence study of two pemetrexed formulations .
all patients received the pemetrexed - platinum doublet for six cycles followed by single - agent pemetrexed maintenance until progression .
pharmacokinetic blood samples were collected at predefined time points during the first cycle and the concentration - time profile of pemetrexed was investigated by noncompartmental analysis .
hyponatremic episodes were investigated with serum electrolytes , serum osmolality , urinary sodium , and urine osmolality.resultssixteen of 46 patients ( 35% ) had at least one episode of grade 3 hyponatremia .
twenty - four episodes of grade 3 hyponatremia were observed in 200 cycles of doublet chemotherapy .
plasma exposure to pemetrexed was significantly higher in patients with high - grade hyponatremia than in those with low - grade or no hyponatremia ( p=0.063 and p=0.001 , respectively ) .
pemetrexed clearance in high - grade hyponatremia was quite low compared with normal and low - grade hyponatremia ( p=0.001 and p=0.055 , respectively ) .
median pemetrexed exposure in this cohort was much higher than that reported in the literature from western studies.conclusionhigher exposure to pemetrexed is associated with grade 3 hyponatremia .
the pharmacogenetic basis for higher exposure to pemetrexed in indian patients needs further investigation . |
mood disorders , principally major depressive disorder and bipolar disorder , are associated with about 60% of all suicides.16 an often - quoted figure is that about 15% of patients with major depression will eventually die by suicide.7,8 this estimation is , however , derived largely from studies of severely depressed inpatients . more recently a more conservative lifetime suicide risk in the general population of depressed patients of about 6% has been calculated.9 this discrepancy has been erroneously interpreted by many primary care physicians and certain psychiatrists as evidence that overt suicidal behavior occurs only in severe depression .
the more recent clinical literature clearly supports the idea that suicidality ( thoughts and behavior ) is associated with any type of depressive disorder and any degree of severity.10,11 antidepressant therapy , which is effective in managing the symptoms of major depressive disorder , is expected to reduce or prevent suicidal behavior associated with depression.12,13 this hypothesis has been questioned , however , by large multi - study analyses that have suggested that , at least in certain patients groups , antidepressants may enhance or even induce suicidal ideation.14,15 in 2004 the us food and drug administration warned of the possible enhancement of suicidal ideation in pediatric and adult patients receiving modern antidepressants especially at the beginning of therapy and at dose increase .
this interpretation is controversial and the results of other meta - analyses16,17 have not supported the enhancement of suicidal ideation in adult patients with short - term antidepressant treatment compared to placebo .
the latest analyses indicated that patients receiving ssris and tricyclic antidepressants ( tcas ) do not show significantly more suicidality than patients receiving placebo.6,18 indeed several studies have shown that suicide rates have decreased since the introduction of modern antidepressants supporting the hypothesis that the use of antidepressants may prevent suicide.19,20 in the light of this controversy , the effect of an antidepressant , especially a recently introduced one , on suicidal ideation clearly remains an important question .
thus , in addition to assessing the general efficacy and tolerability of milnacipran ( ixel ) , a serotonin and norepinephrine reuptake inhibitor ( snri)21 recently introduced into russia , the primary aim of the present investigation was to observe the effects of the drug on the occurrence and intensity of suicidal thoughts and behavior in patients with mild to moderate depressive disorders and to assess whether suicidality decreased in parallel with other depressive symptoms .
the investigation was a 6-week open label study in patients enrolled from an outpatient clinic ( psychiatric hospital n12 ) in moscow .
inclusion criteria were : age 16 to 65 years , a diagnosis of mild to moderate depression which could be either a single depressive episode , recurrent depressive disorder , bipolar disorder , dysthymia , cyclothymia , continuous depressive reaction within an adaptation disorder or other mood disorder .
exclusion criteria included severe depression with psychotic manifestations ; schizophrenia and schizoaffective disorder ; abuse of alcohol and other psychoactive agents ; pronounced manifestations of psycho - organic syndrome ( or chronic brain disorder ) , including paroxysmal disorders ; severe or decompensated somatic pathology requiring continuous polypharmacotherapy ; pregnancy and lactation ; participation in clinical trials within 30 days prior to start - up of the present study ; and contradictions to milnacipran treatment .
the study was approved by the local ethics committee and was carried out in accordance with the declaration of helsinki .
in addition to a standard psychiatric and general clinical examination ( including urinalysis , hematology and biochemistry , electrocardiogram ) , the 17-item hamilton depression rating scale ( hdrs17 ) , clinical global impression ( cgi ) , beck depression inventory ( bdi ) , beck scale for suicidal ideation ( bss)22 and the udvalg for kliniske undersgelser side effect rating scale ( uku - side - effects ) were used .
milnacipran was administered initially , for 2 to 3 days , at 25 to 50 mg / day depending on the severity of depressive symptoms .
if the drug was well tolerated the dose was increased to 100 mg / day ( 50 mg twice daily ) .
the statistical significance of changes from baseline during the study were determined using paired student s t - test and wilcoxon nonparametric test using the statistical and analytical software package statistica .
women comprised 86.6% of the cohort and the mean age of patients was 41.4 9.5 ( all values are given as mean standard deviation ) .
in general the educational level was high with 60% of patients having a higher ( university ) education and 33.3% a secondary education .
the majority of patients ( 60% ) had a diagnosis of a single depressive episode .
the apathetic form of depression was the most frequent while anxious , asthenic and hysteric forms were also common .
two patients withdrew from the study , one at the end of the first week of treatment because of adverse events ( nausea ) and the other at the end of the 4th week of treatment due to lack of efficacy of the treatment .
the efficacy of the antidepressant treatment was demonstrated by the steady reduction of the mean hdrs17 score throughout the study ( figure 1 ) .
statistically significant differences compared to baseline occurred from the first week of therapy . at endpoint ( after 6 weeks treatment ) mean hdrs17 was 9.5 4.4 and 60% of patients were treatment responders ( reduction of baseline hdrs17 of at least 50% ) .
bdi scores showed a similar progressive reduction with a significant difference ( p < 0.05 ) from baseline occurring from the third week of treatment .
the mean bdi score at endpoint was 21.4 6.1 ( data not shown ) .
the mean baseline score on the cgi ( severity ) scale was 3.9 0.4 indicating a moderate severity .
this value decreased progressively with a significant difference ( p < 0.05 ) from baseline occurring after 3 weeks of treatment . at endpoint the mean cgi ( severity )
no current or previous suicidal attempts , planning or preparation were noted in any patient .
a total of 57 suicidal manifestations were found during the study ( table 2 ) .
the most common suicidal manifestations were thoughts of inanity of existence , thoughts that death could resolve existing sufferings , suicidal thoughts and unwillingness to live .
more rarely , different signs of suicidality were reported : visualization of own suicide , death or funeral , as well as ( supraliminal ) death instinct . only in a few patients
did these suicidal ideations develop into either ideational compulsions ( compulsive thoughts and concepts of death and funerals ) or suicidal fantasies .
suicidal compulsive thoughts and concepts developed in patients with asthenic and hypochondriac depression , and suicidal fantasies in patients with hysteric depression .
no other relationships , including those between suicidal phenomena and patients personality characteristics were detected .
the entry criteria of this study allowed the recruitment of patients with a single depressive episode , recurrent depressive disorder , chronic depression , bipolar disorder , dysthymia or cyclothymia .
unfortunately subanalysis of the different types of depression was not possible due to the small numbers of each subtype .
mean baseline bss score was 4.9 4.9 , indicating a mild level of suicidality in this group of patients .
suicidality decreased rapidly with a significant reduction observed from the second week of treatment ( table 3 ) .
after 4 weeks of treatment , mean bss scores were close to zero indicating an absence of any suicidal activity in treated patients .
none of the patients showed any increase in bss score during milnacipran treatment indicating an absence of any activation syndrome
, sometimes observed at the early stages of therapy with certain antidepressants.10 analysis of the suicidal thoughts / attempts item of the hdrs17 at baseline showed a score of 1 in 10 patients ( 33.3% ) and of 2 in one patient .
at endpoint only 3 patients had a score of 1 , all others scoring zero .
the hdrs17 items of psychic anxiety and retardation showed a similar progressive reduction throughout the study .
the rate of decrease of the two items was approximately parallel ( figure 2 ) . at the end of the study anxiety
the anxiety / retardation ratio remained essentially constant during milnacipran therapy confirming the absence of any activation syndrome.10
adverse events ( aes ) with milnacipran therapy were scored with the uku side effect rating in all patients .
no ae was scored with a severity rating greater than 2 , indicating that they did not significantly affect the patients daily life .
the most frequent aes , which occurred in more than 5 patients , were nausea , anxiety , tachycardia and dizziness .
the majority of aes occurred within the first week of treatment with milnacipran and tended to resolve spontaneously from the beginning of the second week .
the cohort of the present study was a relatively classical mild to moderately depressed population although the proportion of women ( 86% ) was somewhat higher than that commonly reported . at baseline
nearly 50% of patients reported some form of suicidal ideation although none reported previous suicidal attempts , planning or preparation .
almost all of the suicidal manifestations observed during the study were limited to the cognitive sphere ( thoughts , concepts ) .
in addition , in the majority of cases , suicidal manifestations occurred only occasionally , and the suicidal fantasies , reported in only 2 patients , were transient ( up to 1 to 2 hours per day over several days ) .
the wide prevalence of different suicidal manifestations in patients with mild to moderate depressive disorders shown here is important since , even in absence of a behavioral component they are considered to be a potent predictor of future suicidal behavior.2,13,23 regular patient assessment with hdrs17 , cgi and bdi showed a progressive regression of depressive symptoms throughout the study .
there were few aes , all of them mild as assessed by the uku side effect rating .
the progressive regression of suicidal thoughts during milnacipran therapy observed at weekly testing showed no enhancement of suicidal risk at early stages of antidepressant pharmacotherapy . on the contrary
, the administration of milnacipran led to a progressive and almost total reduction of all suicidal manifestations .
the drug s effects on important aspects of the clinical profile of depression such as anxiety and retardation appeared to be well balanced .
this may have contributed to the lack of activation syndrome which has been associated increased suicide risk.10 even the occurrence of aes such as anxiety during milnacipran therapy did not negatively affect the general suicidality of patients .
this study suffers from several weaknesses , namely the small cohort studied , its open nature and the relatively short observation period ( 6 weeks ) . to our knowledge
this is the first study to have analyzed suicidality and depressive symptoms in parallel during the treatment with milnacipran .
a meta - analysis of suicidal behaviors and ideation in clinical trials in depression with another snri , duloxetine , has also demonstrated the absence of increased risk of suicidal behaviors or ideation during treatment with the snri compared with placebo.24 from this small open study there is a clear suggestion that mild suicidal thoughts can be relatively common even in mild to moderately depressed patients . during treatment with milnacipran suicidal thoughts
regressed progressively in parallel with other depressive symptoms . at no time was there any noticeable increase in suicidal thoughts even in patients who reported anxiety as an adverse event .
this study clearly warrants replication in a larger cohort which should be followed for a longer period of time . | the presence of suicidal manifestations ( thoughts and behavior ) was studied in a cohort of 30 patients with mild to moderate depression during a 6-week treatment with the serotonin - norepinephrine reuptake inhibitor , milnacipran . at baseline
mild suicidal thoughts were present in 46.7% of patients , the mean hamilton depression rating score ( hdrs17 ) was 23.9 1.8 and the mean suicidality score on the beck scale for suicidal ideation ( bss ) was 4.9 4.9 .
suicidal thoughts decreased progressively throughout the study in parallel with other depressive symptoms . at no time during treatment was there any indication of an increased suicidal risk .
notably , the items retardation and psychic anxiety on the hdrs17 decreased in parallel .
this may possibly explain the lack of any activation syndrome , which is occasionally observed at the early stages of therapy with some antidepressants and may be linked to a temporary increase in suicidal ideation . to our knowledge
this is the first detailed report of suicidality during treatment with milnacipran . |
vascular leiomyoma ( vl ) or angioleiomyoma comparable to the one described in this study is extremely rare .
only 8.5% to 10% of vl are found in the head and neck area and , among these , only 3% occur in the nasal cavity [ 1 , 2 ] .
we describe the clinical and histological findings and the feasibility of surgical treatment using a radiofrequency instrument .
a 45-year - old man reported to his general practitioner with recurrent and strong , but self - limiting , left - sided epistaxis over the preceding 2 to 3 months , each time lasting up to 10 minutes .
he also felt an intermittent , dull pain on the left side of his nose and the strange sensation of a slowly growing mass inside his nose , but neither nasal obstruction nor hypesthesia of the face .
the effort was abandoned because of strong bleeding , a nosepad was applied and then the patient was referred as an emergency to our clinic . upon arrival
the personal history showed an appropriately treated arterial hypertension and no regular alcohol or nicotine consumption or substance abuse .
a clinical examination showed a healthy albeit obese man with a marginally elevated blood pressure level .
after removal of the nosepad and suction cleaning , the nasal inspection showed a well - defined tumor of the lateral nasal wall on the anterior face of the inferior turbinate , approximately 10 mm in size .
anterior and posterior rhinoscopy revealed a slight deviation of the nasal septum , but no other intranasal pathology .
the external nose showed a slight , though distinctly palpable swelling in the area between the lateral cartilage and the nasal bone on the left side .
to further investigate the repeatedly bleeding endonasal mass a ct scan with contrast was conducted .
it showed a tumor of the inferior turbinate , only marginally contrast enhancing , 24 mm in the largest diameter .
no bony erosion was reported , and an infiltration of the lateral nasal cartilage could not be ruled out ( figure 1 ) .
a biopsy under local anesthesia revealed the diagnosis of angioleiomyoma . to differentiate the tumor growth and the involvement of nasal cartilage , a mri scan was ordered ( figure 2 ) .
the scan showed a 9 11 8 mm ( w h d ) sized , nodular , contrast enhancing lesion emanating from the lateral nasal wall and extending to the anterior face of the inferior nasal turbinate on the level of the piriform aperture without any sign of infiltrative growth .
a transnasal endoscopic tumor resection was performed under general anesthesia using a radiofrequency instrument ( ellman surgitron ) ( figure 3 ) .
the histological examination confirmed the diagnosis of angioleiomyoma ( figure 4 ) . during the clinical follow - ups conducted at six and twelve months after the surgery , a nasal endoscopy showed no sign of tumor recurrence and the patient remained symptom - free .
vascular leiomyomas are benign neoplasms that are rarely found in the head and neck region .
the presenting symptoms are nonspecific and usually characterized by nasal obstruction , epistaxis , and nasal discharge .
vascular leiomyomas occur as small , painless masses in the superficial layer of the skin or mucosa .
. these tumors can affect persons of any age , but they are more common in people between 30 to 60 years of age with a female predominance ( female to male ratio of 2 to 1 ) . while the etiology of sinonasal leiomyoma remains uncertain , there are three dominant hypotheses to explain the origin of sinonasal leiomyoma .
they could stem from aberrant undifferentiated mesenchymal or smooth muscle elements in the blood vessel wall . in the nasal vestibule
the observation of many tumors located in nasal turbinates seems to support this hypothesis ; these areas are relatively abundant with blood vessels and smooth muscles .
some authors suggest that vascular leiomyoma could be a vascular malformation or a progressive development of smooth muscle proliferation from hemangioma , to angioma with much muscle , to leiomyoma with many vessels , and to solid leiomyoma .
the inferior nasal turbinate , the nasal septum , and the nasal vestibule are reported as the most common sites of occurrence .
hypothesized that the tumor growth might be hormone - dependent due to the reported female predominance and the increased pain during pregnancy or the menstrual cycle in patients described elsewhere .
more studies are needed to clarify the influence and mechanism of action of sex hormones on this tumor type . the world health organization ( who ) classified leiomyoma into three groups : nonvascular leiomyoma , vascular leiomyoma , and epithelioid leiomyoma .
morimoto divided angiomyoma into three histologic subtypes in 1973 : solid or capillary , cavernous , and venous .
the vascular subtype is the most common one and angiomyoma of the head and neck usually occurs as a venous or cavernous type .
the solid type has smooth muscle bundles that intertwine and surround the vascular slit - like channels .
the venous type has vascular channels with thick muscular walls that are easily discerned from smooth muscle bundles .
the histopathological differential diagnosis of angioleiomyoma includes hemangioma , angiofibroma , myopericytoma , fibromyoma , and leiomyosarcoma .
epithelial tumors are the most common and originate from the epithelial lining , accessory salivary glands , neuroendocrine tissue , and olfactory epithelium .
inverted papillomas and osteomas are the most common benign tumors followed by fibrous dysplasia and neurogenic tumors , for example , schwannomas .
squamous cell carcinomas are the most common malignant sinonasal tumors ( 80% ) , followed by adenocarcinoma .
chondrosarcoma , lymphoma , salivary gland tumors , neuroendocrine tumors , and mucosal malignant melanoma represent a further differential diagnosis . radiological imaging , for example , mri and/or ct scans ,
represents an helpful tool for visualizing the extension of the tumor and for the proper planning of the surgical approach , but there are no particular imaging techniques that specifically characterize the vl .
nevertheless , images may be helpful in differentiating deeply seated vascular leiomyoma from malignant or other benign tumors , such as lipoma or fibroma [ 12 , 13 ] .
the surgical approach depends on the size , the location , the extension of the tumor , and the experience of the surgeon .
different surgical techniques are well known from the surgery of the turbinates ( e.g. , resectioning , laser surgical procedures , and coagulation procedures ) . in most patients ,
transnasal endoscopic excision as shown in our case can be performed successfully because many of the tumors are limited to the sinonasal cavity .
the presented technique of excision with a radiofrequency instrument has many advantages , for example , clear surgical field and less hemorrhage , and can be safely performed by an experienced surgeon in a two - hand technique .
this was probably due to an incomplete excision of the tumor margin and the adjacent bony shell .
thus , the chance of local recurrence is mainly related to incomplete excision at the time of the initial surgery .
it appears that the absence of mitosis is the most useful histological indicator of a benign lesion .
surgical excision accompanied by a histological study is the only way to confirm the diagnosis .
special stains for smooth muscle cells are sometimes necessary to differentiate vl from other spindle cell tumors such as hemangioma , angiofibroma , fibroma , and angiomyolipoma .
angioleiomyoma in the nasal cavity is extremely rare but an important differential diagnosis in a patient with a nasal tumor .
attention should be paid to intra- and postoperative hemorrhage due to the hypervascularity of this neoplasm . in our case of a vl originating from the anterior border of the inferior turbinate
, we demonstrated that the endoscopic approach with a radiofrequency instrument resulted in a complete and safe removal of the mass with no recurrence during a period of 12 months . | vascular leiomyomas or angioleiomyomas are rare tumors that can be found in the nasal cavity .
the etiology of angioleiomyoma remains poorly understood and there are several hypotheses to explain the origin of sinonasal leiomyoma .
we here describe the clinical and histological findings in a case study along with the feasibility of surgical treatment using a radiofrequency instrument .
in particular , we describe the case of an adult patient with recurrent epistaxis because of a nasal angioleiomyoma and the performed treatment in the form of complete surgical excision .
radiological imaging is a helpful tool to give an indication of the extension of the tumor , as well as for the proper planning of the surgical approach .
either mri or ct scans are found to be best suited for this purpose .
this case report recommends the complete surgical excision of the angioleiomyoma , by either an endoscopic or an open procedure .
this can be safely performed using a radiofrequency instrument as shown in this case with no recurrence during a follow - up of 12 months . |
fatigue is a complex and common symptom present in a wide range of neurological conditions including multiple sclerosis ( ms ) .
in fact , it is reported to be one of the three most frequent disabling symptoms in ms with as many as 90% of patients reporting fatigue .
clinically , patients with ms report fatigue as exhaustion , lack of energy , increased somnolence or worsening of symptoms and weakness exacerbated by activity and heat ( uthoff phenomenon ) .
certain factors such as neurological impairment , spasticity , motor weakness , nocturia , pain , depression , sleep disturbances , and heat sensitivity correlate consistently with fatigue and considered secondary causes of fatigue in ms .
quality - of - life ( qol ) is defined as individual perception of their position in life in the context of the culture and value systems in which they live and in relation to their goals expectations , standards and concerns . several studies have reported that qol is worse in patients with ms as compared to healthy controls with a higher prevalence of depression and fatigue . although there is a plethora of literature regarding the effect of ms related fatigue on the qol in the western countries , but no case series has been published with indian population of patients with ms as per our knowledge . the objective of this prospective study was to observe the prevalence of fatigue in indian patients with ms and also to see its effect on various domains of qol .
this prospective observational study was performed with 31 patients with ms ( 25 females ) , who visited the out - patient facility or admitted in the department of neurology of the university tertiary research hospital between february 2010 and december 2011 .
patients with definite ms according to the mcdonald 's ( 2005 ) , criteria were included in the study irrespective of age and gender .
patients were excluded from the study if they had an acute relapse in the preceding 2 months , having systemic infection , received pulse methylprednisolone during the past 4 weeks and already receiving medication to reduce fatigue . all patients who agreed to participate in the study were evaluated with a questionnaire , which included personal data , kurtzke 's expanded disability status scale ( edss ) , and krupp 's fatigue severity scale ( fss ) .
history of medication use such as antidepressants , sedatives and anti - hypertensives , which may have contributed to fatigue , was recorded .
the qol was assessed using world health organization ( who ) qol - bref questionnaire .
patient related information such as filling of proformas , history , and clinical examination of patients was carried out by a neurologist .
patients underwent a complete hemogram and peripheral smear , random blood sugar , renal and liver function tests , thyroid function tests apart from imaging when necessary .
the scale provides a score between 0 ( very little disability with a normal neurological examination ) to a maximum of 10 ( death due to ms ) .
the first levels 1 - 4.5 refer to people with a high degree of ambulatory ability and the subsequent levels 5 - 9.5 refer to the loss of ambulatory ability .
in addition , it also provides eight subscale measurements called functional system ( fs ) scores .
these systems include pyramidal , cerebellar , brainstem , sensory , bowel and bladder , visual , cerebral , and others .
the fs are scored on a scale of 0 ( low level of problems ) to 5 ( high level of problems ) to reflect the level of disability observed clinically .
fatigue severity was assessed using krupp fss , which consists of nine items each rated on a seven point scale , which has five equidistant anchor points : strongly disagree ( 1 ) , rare ( 2,3 ) , sometimes ( 4 ) , frequently ( 5,6 ) , and strongly agree ( 7 ) .
the score is obtained by computing the average of the nine items with higher scores indicating increasing fatigue severity .
patients having a total fss score of 36 and above were categorized as having fatigue and those who have a score < 36 were categorized as not having fatigue .
this contains a total of 26 questions , which measure the qol in four domains : physical health , psychological , environmental , and social relationships .
the mean score of items within each domain is used to calculate the domain score .
these raw scores are then converted to the final transformed scores on a 0 - 100 scale .
descriptive statistics included frequency , means , and standard deviation for quantitative variables such as age , age at first symptoms , number of episodes , edss and fss scores and duration of illness .
all quantitative measures were treated with parametric statistical analysis such as student 's t - test like ; fss , who qol domain scores in patients with ms with and without fatigue .
qualitative measures such as correlation between fss scores and various domains of who qol were analyzed using chi - square test .
patients underwent a complete hemogram and peripheral smear , random blood sugar , renal and liver function tests , thyroid function tests apart from imaging when necessary .
the scale provides a score between 0 ( very little disability with a normal neurological examination ) to a maximum of 10 ( death due to ms ) .
the first levels 1 - 4.5 refer to people with a high degree of ambulatory ability and the subsequent levels 5 - 9.5 refer to the loss of ambulatory ability .
in addition , it also provides eight subscale measurements called functional system ( fs ) scores .
these systems include pyramidal , cerebellar , brainstem , sensory , bowel and bladder , visual , cerebral , and others .
the fs are scored on a scale of 0 ( low level of problems ) to 5 ( high level of problems ) to reflect the level of disability observed clinically .
fatigue severity was assessed using krupp fss , which consists of nine items each rated on a seven point scale , which has five equidistant anchor points : strongly disagree ( 1 ) , rare ( 2,3 ) , sometimes ( 4 ) , frequently ( 5,6 ) , and strongly agree ( 7 ) .
the score is obtained by computing the average of the nine items with higher scores indicating increasing fatigue severity .
patients having a total fss score of 36 and above were categorized as having fatigue and those who have a score < 36 were categorized as not having fatigue .
this contains a total of 26 questions , which measure the qol in four domains : physical health , psychological , environmental , and social relationships .
the mean score of items within each domain is used to calculate the domain score .
these raw scores are then converted to the final transformed scores on a 0 - 100 scale .
descriptive statistics included frequency , means , and standard deviation for quantitative variables such as age , age at first symptoms , number of episodes , edss and fss scores and duration of illness .
all quantitative measures were treated with parametric statistical analysis such as student 's t - test like ; fss , who qol domain scores in patients with ms with and without fatigue .
qualitative measures such as correlation between fss scores and various domains of who qol were analyzed using chi - square test .
clinical and demographic data of the patients their clinical presentation has been given in the table 2 .
clinical symptoms in multiple sclerosis the mean fatigue score was 38.7 18.5 , which is above the cut off value of 36 in the fss .
the mean age and age at 1 symptom was significantly greater in the group of ms patients with fatigue as compared to those without fatigue ( p = 0.01 and 0.001 respectively ) [ table 3 ] .
comparison of parameters between patients of ms with and without fatigue all four domains of qol ; physical health , psychological , environmental , and social relationships were significantly more impaired in the group of patients with fatigue than in those without fatigue as mentioned in table 4 .
the mean fatigue score was 38.7 18.5 , which is above the cut off value of 36 in the fss .
the mean age and age at 1 symptom was significantly greater in the group of ms patients with fatigue as compared to those without fatigue ( p = 0.01 and 0.001 respectively ) [ table 3 ] .
all four domains of qol ; physical health , psychological , environmental , and social relationships were significantly more impaired in the group of patients with fatigue than in those without fatigue as mentioned in table 4 .
very few studies in india have been conducted in patients with ms and these aspects have not been addressed by most of the authors .
the aim of this study was to estimate the prevalence of fatigue in patients with ms and its effect on qol of these patients . in our study , patients of ms with and without fatigue were compared and it was found that the severity of fatigue correlated with poorer qol in all domains .
the observation highlights the importance of initiating management of fatigue in these patients as it will help not only in improving the symptom , but also will provide a global higher qol .
even higher prevalence has been reported in the previous studies with much greater sample size like north american research committee on multiple sclerosis survey .
this survey observed that ms patients with fatigue tended to be older and had more disability according to patient determined disease scale ( pdds ) as compare ms patients without fatigue .
respondents with severe fatigue also had significantly higher mobility impairment as measured by pdds scores compared with respondents with mild / moderate fatigue .
similar significant correlation between fatigue and mobility impairment was reported in another study by schwartz et al . however , krupp et al .
corpus callosal atrophy , cortical atrophy of the parietal lobe with dysfunctions in higher - order aspects of motor control , regional atrophy of supratentorial brain parenchyma involving the cerebral cortex , nearby white matter and the caudate head areas , significant white matter atrophy in the posterior part of the corpus callosum and significant grey matter atrophy of the left superior frontal sulcus , left pre - central gyrus , posterior cingulate cortex , right thalamus , and left middle frontal gyrus have been some of the structural derangement in the brain found to be correlating with fatigue in ms .
the causes of primary fatigue in ms include down regulation of gamma - aminobutyric acid activity as a compensatory mechanism due to conduction failure in demyelinated pyramidal tract fibers .
conduction block , and activity dependent conduction block are also considered to be the mechanisms responsible for fatigue in ms patients .
cytokine mechanism with increased level of tumor necrosis factor- levels and interferon- levels are found in fatigued ms patients compared to non - fatigued patients and considered to be responsible for fatigue .
these tests were not done or reported in the present study . in a previous longitudinal study with ms patients ,
authors examined the symptom cluster of fatigue , pain , and depression as a correlate of reduced qol .
cluster analysis revealed the presence of three subgroups differing in experiences of the three symptoms .
the sub - group with the lowest scores on all three symptoms had the highest qol , whereas the sub - group with the highest scores on the symptoms had the worst qol .
this observation supports the concept of fatigue , pain and depression as a symptom cluster , which correlates with reduced qol in patients with ms .
another case - control study in women with relapsing - remitting multiple sclerosis ( rrms ) found that pain and pain intensity were significantly more in the rrms group as compared to controls .
it was observed that increased fatigue intensity was a predictor for decreased physical qol in all women , regardless of group .
ghaem and borhani haghighi ( 2008 ) in their study found 87.2% of patients with ms had poor sleep .
significant high positive correlation was observed between the quality of mental and physical health composite scores .
there was a significant negative correlation between the quality of physical score and age , fatigue score , edss score and pittsburgh sleep quality index ( psqi ) .
linear regression analysis showed that psqi score , edss , and fatigue score were predictors in the model between the quality of physical score and covariates .
linear regression model showed that fatigue score and psqi were predictors in the model between the quality of mental score and covariates .
the explanation could be that the three symptoms are often co - occurring and possibly synergistic in persons with ms and are etiologically linked through cytokine induced manifestations of sickness behavior with diffuse axonal damage across different regions of the central nervous system .
researchers have identified fatigue , depression , and pain as a symptom cluster , which is associated with reduced physical activity and qol in persons with ms .
another study reported decreased qol in all domains with physical functioning being the most affected in patients with ms .
the results of this study corroborate the notion that fatigue , increased lower limb tone , poor gait , and greater disability are independent factors that negatively affect the qol especially physical functioning domain in patients with ms .
fatigue negatively affects both the physical and the mental components of the qol irrespective of the duration of the disease or the degree of disability .
the prevalence of fatigue was found to be high in patients with ms in the present study .
all four domains of qol ; physical health , psychological , environmental , and social relationships were significantly more impaired in the group of patients with fatigue than in those without fatigue .
the treatment of fatigue therefore will not only help alleviating fatigue , but also improve qol of these patients .
a follow - up study could have not only thrown light on the impact of fatigue on other co - morbidities , but also effectiveness of treatment in improving qol and functional abilities of these patients .
fatigue is a symptom with multiple contributory factors such as poor sleep , depression , disability , and autonomic dysfunction .
larger studies will be necessary to find out , which of these abnormalities are the major contributors to fatigue in ms .
this may have potential therapeutic implications in the form of early recognition and treatment of these comorbidities .
correlation of fatigue with radiological / imaging abnormalities in these patients can also be attempted .
a follow - up study could have not only thrown light on the impact of fatigue on other co - morbidities , but also effectiveness of treatment in improving qol and functional abilities of these patients .
fatigue is a symptom with multiple contributory factors such as poor sleep , depression , disability , and autonomic dysfunction .
larger studies will be necessary to find out , which of these abnormalities are the major contributors to fatigue in ms .
this may have potential therapeutic implications in the form of early recognition and treatment of these comorbidities .
correlation of fatigue with radiological / imaging abnormalities in these patients can also be attempted . | objective : this prospective study was carried out to observe the prevalence of fatigue in patients with multiple sclerosis ( ms ) and its effect on quality - of - life ( qol).study design and setting : prospective observational study in a university tertiary research hospital in india.patients and methods : a total of 31 patients ( 25 females ) with definite ms according to mcdonald 's criteria presented in out - patient / admitted in the department of neurology ( between february 2010 and december 2011 ) were included in the study .
disease severity was evaluated using the kurtzke 's expanded disability status scale ( edss ) .
fatigue was assessed using krupp 's fatigue severity scale ( fss ) .
qol was assessed by the world health organization qol - bref questionnaire.results:the mean age of patients was 30.1 9.1 years .
the mean age at first symptom was 25.23 6.4 years .
the mean number of relapses was 4.7 3.6 in the patients .
the mean duration of illness was 4.9 4.4 years .
the mean edss score was 3.5 2.2 .
mean fatigue score was 38.7 18.5 ( cut - off value 36 in fss ) . the prevalence of fatigue in patients with ms was 58.1% ( 18/31 ) .
ms patients with fatigue were significantly more impaired ( p < 0.05 ) on all qol domains ( i.e. , physical , psychosocial , social , and environment ) than ms patients without fatigue.conclusion:prevalence of fatigue was found to be high in the ms patients in the study .
all four domains of qol were significantly more impaired in the group with fatigue than in those without fatigue . |
early childhood caries is again on the rise in australian children despite considerable public health initiatives , including fluoridation of drinking water and use of fluoridated toothpaste .
dental caries continues to affect large numbers of children with nearly 50% of australian 6-year - olds having a history of decay in their primary teeth and 10% having at least 8 affected teeth . for children under the age of 15 years , dental procedures are the most common reason for undergoing a general anaesthetic in australia .
dental caries is not only affecting the most vulnerable people in our community , leading to significant human costs of pain , discomfort , and issues of self - esteem , but management of dental caries is also associated with considerable financial cost to individuals and governments
. a greater understanding of the behaviour of cariogenic bacteria in the oral environment , together with improved knowledge of the nature of the interplay between a person 's genetic makeup and their exposure to environmental factors , should lead to better methods for assessing caries risk and , in turn , establishing more effective prevention strategies .
caries is recognised as a multifactorial disease as a result of the findings of many studies that have investigated the ecology of dental plaque , including the different types of microflora that may be present , the levels of various oral bacterial species , and also the patterns of microbial transmission observed within families [ 35 ] . until recently ,
relatively little was known about the role of genetic factors in dental caries initiation in humans . our focus in this paper is to throw new light onto how genetic and environmental factors influence observed variation on the timing of colonization of streptococcus mutans ( s. mutans ) in the oral cavities of a large sample of monozygotic ( mz ) twins .
s. mutans is the most well - documented species of the microbiological genus mutans streptococci ( ms ) .
ms are generally considered to be some of the major pathogens associated with the process of dental caries , and s. mutans is frequently isolated from carious lesions .
ms exist as part of the oral biofilm 's ecosystem , and they are characteristically anaerobic , acidogenic , aciduric , and carbohydrate metabolizers .
the oral microenvironment consists of many different bacteria , and it is the balance of these bacteria that determines both health and disease of the oral tissues .
several models have been proposed to explain the commencement and progression of dental caries . the extended caries ecological hypothesis explains the caries process , comprising a stable stage , an acidogenic stage , and an aciduric stage .
there is a shift in bacteria within the oral biofilm from non - ms and actinomyces at the stable stage , to ms and lactobacilli in the aciduric stage , although it is possible to reverse this process [ 5 , 7 ] .
proposed a window of infectivity for the initial colonization of ms coinciding with the emergence of the primary teeth .
it was found that the average age of colonization was around 26 months of age , about the time when most of the primary teeth had emerged into the oral cavity .
studies have shown that earlier colonization of ms can lead to an earlier onset of dental caries in children under five years of age [ 1012 ] .
our research group has been conducting dental research involving australian twins and their families for over 25 years . by using twins
we can clarify how genetic and environmental influences affect the timing of dental development and also the timing of colonization of ms within the oral cavity .
for example , we have shown already that there is a very strong genetic contribution to the timing of emergence of the primary teeth [ 13 , 14 ] . in this paper
we will focus on the differences rather than the similarities between mz co - twins , who share a common genetic makeup and often a common environmental background .
this should allow us to gain greater insight into unique environmental effects operating on the twins as individuals as well as epigenetic influences .
the advantage of mz twins for these types of studies is that they are matched perfectly for age and sex , and share the same genes . given the lack of information on genetic and environmental contributions to variation in ms colonization , the aim of this study is to clarify whether there is a definite pattern of association between the timing of emergence of the first primary tooth and the timing of colonization with s. mutans in pairs of mz twins .
we hypothesize that colonization will occur after emergence of the first primary tooth , and also that mz co - twins should show a similar sequence of first tooth emergence and colonization , reflecting underlying shared genetic influences .
the cohort used in this study is from a larger longitudinal study of twins focusing on primary tooth emergence and oral health .
the study sample consists of 151 mz twin pairs who were recruited into our study between 0 and 1 year of age and are now aged between 2 and 8 .
the co - twins have all been raised together , are all of european ancestry , and are all in good health .
twins enrolled in this study were recruited through the australian twin registry , australian multiple births association , newspaper birth announcements , hospitals and prenatal classes .
zygosity of the mz twins has been confirmed by dna analysis of 10 highly polymorphic genetic loci ( d3s1358 , vwa , fga , amel , d8s1179 , d21s11 , d18s51 , d5s818 , d13s317 , d7s820 ) covering 10 chromosomes from buccal swabs .
the study sample includes 67 pairs of mz males and 84 pairs of mz females .
ethical approval has been obtained by the university of adelaide human research ethics committee ( h-78 - 2003 ) .
tooth emergence for the twins was determined by parental reports using specially designed recording charts .
parents were given detailed instructions and were advised to note the date when the tooth first broke through the gingival surface and how to palpate for the tooth .
the accuracy of parental reports has been confirmed by clinical examination of randomly selected twins aged 3 months to 2 years .
birth weight and gestational age were obtained from the parents via a questionnaire administered before age one , which captures significant developmental time points .
this questionnaire consists of questions relating to the conditions surrounding the pregnancy , birth and early months of life of the twins .
the parents were asked questions about problems that may have occurred during pregnancy , type of delivery , placenta type , twins ' birth weights and lengths , and parental lifestyle habits .
specifically engineered collection kits were mailed to parents quarterly , commencing at 3 months of age , to collect saliva and plaque samples of oral bacteria from the twins .
each kit contained two swabs per person for collection of one morning and one evening sample on a single day .
parents were instructed to wipe over the oral cavity , including the gums and tongue , and also teeth when present , using a sterile cotton swab for approximately 10 seconds .
they then placed the swab tip into a sterile ependorf tube containing a semisolid transport medium to ensure the survival of the oral bacteria during transportation .
the ependorf tubes were then sealed tightly and posted to the laboratory in adelaide . upon arrival ,
each sample was plated out on selective media ( tys20ba ) then incubated for 48 hours at 37c in an atmosphere of 95% nitrogen and 5% carbon dioxide .
after incubation , plates were scored visually under a dissecting microscope for presence or absence of s. mutans based on colony morphology .
a subsample of colonies identified as positive through visual scoring was confirmed as s. mutans by analysis of carbohydrate fermentation patterns .
twins were tested every three months until three contiguous positive scores for both twins were obtained .
at least three collection kits were administered to the families covering a period of no less than 9 months .
the date at which the first of the three positive scores was identified for each twin was used as their colonization date .
descriptive statistics ( interval scale variables means , standard deviations ; dichotomous variables frequencies , relative frequencies ) were calculated using one randomly selected twin per pair for all variables . where variable means are presented in the text , they are accompanied by the sample standard deviation .
intra- and interobserver errors for colonization scoring were very low ( cohen 's kappa ~ 0.9 ) .
sexes were compared using variance ratio ( f ) tests and student 's t - tests .
the relationships between timing of both first tooth emergence and colonization and between twin pairs for interval scale data were examined using pearson 's correlation coefficient .
twin pairs considered premature ( < 37 weeks gestation ) comprised 62% of the sample ( males 63% , females 61% ) .
males ( 2.5 0.6 kg ) were heavier , on average , than their female twin counterparts ( 2.3 0.6 kg ) .
optimal birth weight of twins is 2.5 kg or greater , with those individuals less than this classified as either low ( 1.52.5 kg ) or very low ( 1.5 kg and less ) birth weight . in our study 46% of males and 62% of females
the first tooth to emerge was generally a lower central incisor , with no evidence of directional asymmetry in emergence times .
the first tooth erupted significantly earlier in males ( 7.8 1.6 months ) than females ( 8.8 2.0 months ) .
table 1 lists the proportion of concordant pairs for emergence of the first tooth , illustrating the trend as a progressively more liberal interpretation of concordance was applied .
allowing for a discrepancy of up to 28 days between co - twins , 86% of the twin pairs were concordant for timing of emergence of the first tooth .
the mean age of colonization was 12.7 6.1 months , with the earliest time of colonization observed at 2.4 months and the latest to colonize at just over 2.5 years .
table 2 shows the overall proportion of twin pairs concordant for s. mutans presence , and additionally the breakdown of male and female twin pairs . allowing for a discrepancy of up to 12 months between co - twins , 93% of the 151 twin pairs
figure 1 examines the relationship between tooth emergence timing and colonization timing . there was no significant association between timing of tooth emergence and timing of colonization .
table 3 compares twins within a pair for their colonization status before the emergence of the first tooth .
concordance for colonization prior to first tooth emergence was 15% ( 23 twin pairs ) .
the covariates , birth weight and timing of first tooth emergence , were not significantly different between pre- and postemergence colonizers , with an average intrapair difference of 0.27 0.24 kg and 18 30 days , respectively .
timing of s. mutans colonization was , unsurprisingly , significantly different between pre- and postemergence colonizers , with an average intrapair difference of 7.2 5.2 months .
studies of twins have contributed significantly to our understanding of the role of genetic factors in the process of dental caries in humans [ 1719 ] .
most previous studies of dental caries based on twins have employed the classical twin model in which comparisons are made between mz twin pairs who share the same genes and dizygotic ( dz ) twin pairs who share 50% of their genes on average .
this model enables estimates to be made of the heritability of selected phenotypes , with values ranging from 0% ( no genetic contribution to observed variation ) to 100% ( all the variation can be explained by genetic factors ) .
different researchers have focussed on different variables relating to the process of dental caries , with evidence of genetic influences being found for bacterial , dietary , and host factors [ 6 , 20 , 21 ] .
there is also evidence , based on assessments of the genetic correlation between primary and permanent caries scores , that different genes may be involved in the carious process between dentitions .
while estimates of heritability are important in establishing whether there is a significant genetic contribution to phenotypic variation , they are population - based statistics , and caution is needed in extrapolating findings to the individual .
for example , even though the estimate of heritability for a given feature may be high , this does not necessarily mean that an environmental intervention can not have a major effect on the phenotype .
another twin model that has been applied in a limited way to the study of dental caries in humans is the twins reared apart model .
two studies based on twins in the minnesota study of twins reared apart have provided valuable insights into the important role of genetic influences on the carious process [ 23 , 24 ] .
these studies looked at caries experience in adult twin pairs who had been separated around birth and then raised in different environments throughout their lives . despite their separation , the twin pairs showed remarkably similar patterns of dental caries experience as disclosed by the numbers of decayed , missing and filled teeth .
the researchers noted that there were several variables , all of which are likely to have a genetic basis that could explain their findings including : similarities in salivary factors and oral microflora ; similarities in timing and sequence of tooth emergence ; similarities in dental morphology , arch dimensions , and dental spacing ; and dietary preferences .
our previous studies of australian twins have confirmed that there is a significant genetic contribution to variation in timing of tooth emergence and various morphological features of both the primary and permanent dentitions [ 13 , 14 ] .
the twin model that we have applied in the present study is the mz co - twin model which has several advantages for studies of complex diseases such as dental caries .
for example , mz co - twins are matched for age and sex and have very similar dentitions from a developmental and morphological perspective , reflecting their similar genetic makeup [ 16 , 25 , 26 ] .
we have , however , shown that mz co - twins are commonly discordant for the expression of certain dental features , such as missing and extra teeth , which reflects differences in environmental and/or epigenetic , influences between the co - twins [ 15 , 27 ] .
the mz co - twin model therefore provides an opportunity to obtain new insights into the interactions between genetic , epigenetic and environmental influences on phenotypic variation .
the mz co - twin model is extremely powerful because data from only a relatively small number of twin pairs are required to be examined to gain insight .
this makes this particular twin model ideal for clinical studies where it is often difficult to recruit the large numbers of subjects who are otherwise required for studies based on the classical twin model .
our approach to the use of the mz co - twin model has been to focus initially on the early stages of the carious process , that is , the initial colonization of caries - related microorganisms within the oral cavity .
this approach is in contrast to many previously published studies which score the outcomes of the process , that is , decayed missing and filled teeth .
it is clear that further studies are needed on genetic contributions to variability observed between individuals at all stages of the process of dental caries .
however , we believe that focussing on the early stages may provide results that will have more immediate application in the prevention of the disease . by referring to the detailed information on general health , oral hygiene practices , and diet of the twins and their families in our study , we have been able to retrospectively explore potential factors that may have contributed to discordances between mz co - twins .
for example , differences in the timing of initial colonization of decay - producing bacteria such as s. mutans , as well as exploring why some twin pairs or co - twins may have become colonized with s. mutans prior to the emergence of the first primary tooth and others afterwards .
we acknowledge that s. mutans is not the only microorganism that is involved in the carious process , and that around 10% of individuals with rampant caries do not have detectable levels of s. mutans .
we consider , however , that there is sufficient published evidence to focus on genetic and environmental influences relating to this microorganism in the first instance within the context of the ecological plaque hypothesis .
further investigation of significant differences in measurable variables such as biologically meaningful birth weight differences between co - twins creates a unique environmental factor which may be contributing to discordance of other variables .
fourteen twin pairs in our current sample exhibited a birth weight difference of 500 g or greater , possibly as a result of twin - twin transfusion syndrome ( ttts ) arising from vascular anastomoses in utero .
such birth weight discordance may have significant effects on the future health and wellbeing of the lighter twin , as well as implications for the timing and processes of development that scale allometrically with body weight .
ttts complicates traditional twin models as it is a function of the mz twinning process and hence reduces the mz correlation relative to the dz correlation , overestimating the contribution of the unique environment to phenotypic variance .
the mean time of first tooth emergence in this sample was around 8 months of age , similar to our previously reported findings for the larger cohort , and significantly later , by approximately two months , than that commonly reported for singletons .
this is likely to reflect an allometric relationship between tooth emergence timing and body weight as males were also heavier at birth , on average .
however , this finding may also reflect fundamental differences in genetic and/or hormonal influences between sexes acting on the twins in utero or early postnatally .
as reported in our recent papers [ 13 , 14 ] , emergence of the first tooth has a very high narrow - sense heritability estimate of 8796% , suggesting that the process of tooth emergence is under strong genetic control within a population .
this is not to say that specific environmental ( e.g. , ttts ) or epigenetic factors can not give rise to significant discrepancies in tooth emergence timing within individual mz pairs .
when tooth emergence timing in twin pairs in the current study was categorized as concordant / discordant , allowing an intrapair difference of up to 28 days , approximately 90% of the twin pairs were classified as concordant . when taken in light of our previous high estimates of heritability
, this suggests that an intrapair difference of greater than one month is appropriate for ascertainment of mz twins markedly discordant for tooth emergence timing and for further analysis of unique environmental or epigenetic influences .
the mean age of colonization ( 12.7 6.1 months ) calculated for our sample of twins is one of the first large - sample estimates of colonization timing reported in the literature as far as we are aware . at a population level ,
both distributions showed significant overlap , and there was no significant association between timing of first tooth emergence and timing of colonization ( see figure 1 ) .
these two factors cast doubt on a model of colonization which requires a hard tooth surface to be present in the mouth prior to colonization , and this is emphasized by the fact that approximately 25% of our the individuals in our sample were colonized prior to tooth emergence .
this result supports the work of wan et al . , who showed that colonization can occur in predentate singletons .
it is a significant issue that needs to be considered when developing and analyzing models of early childhood caries aetiology . in a manner analogous to that for timing of emergence of the first tooth ,
when colonization timing in twin pairs in the current study was categorized as concordant / discordant , allowing an intrapair difference of up to 12 months , approximately 90% of the twin pairs were found to be concordant . when taken in light of our previous moderate- to high estimates of heritability for colonization timing
, this suggests that an intrapair difference of greater than a year is appropriate for ascertainment of mz twins markedly discordant for colonization timing for further analysis of unique environmental or epigenetic influences .
an exploration of our questionnaire material for feeding practices , tooth brushing habits , and general health may give further insight into factors influencing the timing of s. mutans colonization .
the relationship between tooth emergence timing and colonization timing was examined further by comparing twins within pairs for their event sequence ( i.e. colonization before or after tooth emergence ) . a significant proportion ( 21% )
we have demonstrated that discordance was not due to birth weight discrepancies between twins , nor to marked intrapair differences in tooth emergence timing .
it is likely that a range of genetic and nongenetic factors play a significant role in both the timing of emergence of the first tooth and when the oral cavity becomes colonized with s. mutans , and further multivariate modelling of this relationship in the larger cohort of twins is ongoing .
a particularly exciting prospect for future studies of dental caries progression will be to carry out genomic and epigenomic scans of the mz co - twins who are discordant for expression of the disease or for factors known to be linked to the disease .
already , studies have been performed showing that there can be differences in the epigenetic profiles of mz twin pairs , and that these differences can be associated with discordances in particular phenotypic features between the co - twins [ 27 , 32 ] .
however , so far we are not aware of any studies of this type that are related to dental caries . a recent study has provided the first genome - wide scan for dental caries in a human population .
these researchers were able to identify suggestive genetic loci for both low caries susceptibility and high caries susceptibility on chromosomes 5 , 13 , and 14 , as well as on the x chromosome .
they also speculated that there may be a protective locus for caries on the x chromosome that might explain the tendency for a difference in caries experience between the sexes .
there has also been a complex segregation analysis carried out recently on brazilian families that has indicated a dominant , major gene effect influencing resistance to dental caries .
we believe that future studies combining the advantages of studying twins and their families with modern methods of genome scanning and segregation analyses offer great potential to identify key genetic risk factors for susceptibility to dental caries . it has generally been assumed in the past that dental caries is mainly determined by environmental factors , and so most of the strategies for preventing or managing the disease have focussed on modifications to that environment , including oral hygiene or diet alteration
. however , dental caries continues to be a major public health issue , even in countries such as australia .
there is a growing interest in the identification of risk factors that might predispose individuals to dental caries and also in identifying factors that might provide individuals with protection .
it is highly likely that these factors will reflect the genetic makeup of host - related factors , including the nature of the oral biofilm .
if our understanding of the development of the oral biofilm can be improved , it may be possible to adjust its ecology and thereby decrease the likelihood of children developing dental caries .
clinical applications of findings from our project , focussing on preventive practices in young children during primary tooth emergence , promise to lead to reduced dental disease prevalence and significant reductions in health expenditure .
hillman 's work with genetically modified mutans has been through the clinical trial stage and our findings on timing of s. mutans colonization will provide important evidence for the most appropriate timing of inoculation [ 35 , 36 ] .
thus , information on colonization timing will be invaluable for developing strategies to prevent or delay infection with ms in young children . | findings are presented from a prospective cohort study of timing of primary tooth emergence and timing of oral colonization of streptococcus mutans ( s. mutans ) in australian twins .
the paper focuses on differences in colonization timing in genetically identical monozygotic ( mz ) twins .
timing of tooth emergence was based on parental report .
colonization timing of s. mutans were established by plating samples of plaque and saliva on selective media at 3 monthly intervals and assessing colony morphology . in 25% of individuals colonization occurred prior to emergence of the first tooth .
a significant proportion of mz pairs ( 21% ) was discordant for colonization occurring before or after first tooth emergence , suggesting a role of environmental or epigenetic factors in timing of tooth emergence , colonization by s. mutans , or both .
these findings and further application of the mz co - twin model should assist in development of strategies to prevent or delay infection with s. mutans in children . |
depression is a widespread condition ( 1 , 2 ) that can cause significant worsening of comorbid medical conditions , socioeconomic burden resulting from functional disability , and reduced quality of life ( 3 - 5 ) .
the world health organization has predicted that by the year 2030 , depression will be among the top three causes of disability - adjusted life years lost , both globally and regionally ( 6 ) .
diabetes , a common chronic disease in older populations , is another major worldwide public health problem , particularly in some asian countries ( 7 , 8) .
almost 346million people currently have diabetes worldwide ( 9 ) , and one person in ten is expected to have diabetes by 2030 ( 10 ) .
korea has one of the highest rates of diabetes among asian countries ; the prevalence in korea 's general population is 10.1% ( 11.3% in male and 9.0% in female individuals ) ( 11 ) . both diabetes and depression increase morbidity and mortality , and
their co - occurrence increases the risks of complications and their related costs ( 4 , 12 - 15 ) .
several studies have shown an association between depression and diabetes and their effects on healthcare utilization .
however , most of these previous findings came from western populations ( 13 , 15 - 17 ) .
few studies have examined depression among people with diabetes in asian countries ( 18 , 19 ) .
to our knowledge , little has been reported about the relationship between diabetes and depression and their effects on healthcare utilization in korea . the current study aimed to explore the relationship between diabetes and depression and their related factors using data from the 2006 korean longitudinal study of ageing ( klosa ) .
in addition , this article aimed to investigate the effects of comorbid diabetes and depression on healthcare utilization .
the data used for the following analyses were derived from the klosa , which was a cross - sectional survey that enrolled a large , nationally representative sample of community - dwelling koreans aged 45 years .
the survey was conducted by the ministry of labor of korea from august 1 to december 22 , 2006 and examined mental and physical health status , healthcare utilization , and socioeconomic data .
detailed descriptions of the study design and methods of klosa have been presented elsewhere ( 20 , 21 ) .
participants were selected randomly by a multistage , stratified probability sampling design to select household units according to geographical area including both urban and rural areas . in case of refusal to participate ,
the survey was conducted by skilled interviewers in the participants ' homes using a structured questionnaire .
the final survey sample included 10,254-persons , who represented 0.07% of koreans aged 45 years and had representative age and gender distributions and geographic localization ( 16 major metropolitan cities and provinces ) .
in the current study , we analyzed 10,179 subjects aged 45 years after excluding 75people ( 1non - responder regarding diabetes status and 74 non - responders on the short - form [ 10-item ] center for epidemiological studies depression scale [ ces - d10 ] ) .
furthermore , any non - response bias in estimates should be very small , because the percentage of non - respondents was only 0.7% .
the final sample included 4,436 men and 5,743 women aged 45105 years ( m = 61.7 , sd = 0.1 ) .
computation of weightemployed three steps including the design weight based on two - staged sampling probability , the non - response - adjusted weight , and the benchmark weight reflecting population distribution changes using demographic changes in other large - scale surveys .
socioeconomic variables assessed during the interviews included age , gender , marital status , education , and household income .
marital status was self - reported as married , divorced / separated , widowed , or single .
education level was classified into elementary school or less , middle school , high school , and college or above .
adjusted monthly household income was calculated as the total household income divided by the square root of the number of household members .
these scores were then divided into quartiles ( eg , < 250,000 south korean won [ krw ] , 250,000 krw1,000,000 krw , 1,000,000 krw2,500,000 krw , and > 2,500,000 krw ) .
bmi was computed from self - reported weight and height as weight in kg divided by the square of the height in metre square ; participants were categorized as normal , overweight , or obese ( 24.9 kg / m,25.029.9 kg / m , and 30 kg / m , respectively ) , following who definitions ( 22 ) .
the presence of diabetes was exclusively assessed based on self - reports and not base upon clinical screenings or medical records .
participants were asked whether they had ever been diagnosed by a physician with diabetes . the specific type of diabetes ( type 1/type 2 ) was not assessed .
participants were also asked whether they had ever been diagnosed by a physician with chronic diseases , including hypertension , heart disease ( congestive heart failure or myocardial infarction ) , stroke , lung disease , and arthritis .
the number of chronic diseases was calculated by counting the number of disease diagnosed by a physician .
depressive symptoms were measured using the ces - d10 , which is commonly used to assess depressive symptoms in non - psychiatric community settings ( 23 - 25 ) .
the ces - d10 assesses the frequency or duration of depressed mood , feeling tired or low in energy , feeling lonely , trouble concentrating , and sleep disturbances during the preceding week ( 20 , 25 ) .
the ces - d10 is a 10-item scale ; each item can be scored 03 , total scores range 030,and higher scores indicate the presence of more depressive symptoms . the cutoff between moderately severe and severe depression has been identified as 10 points ( 26 ) .
therefore , this study uses the standard cutoff score of 10 to categorize individuals with depression .
the ces - d10 has good internal consistency , acceptable test - retest reliability ( 20 , 21 , 26 , 27 ) , and has shown a statistically significant correlation with self - rated health ( 28 ) .
the internal consistency of the ces - d10 in the current sample was cronbach 's = .82 .
three types of healthcare utilization during the previous year were examined:1 ) physician visits the number of visits to a physician in the last 12 months ; 2 ) hospital admissions
the number of hospital admissions due to medical problems during the last12 months ; and 3 ) length of hospital stay the number of inpatient hospital days during the last 12 months . in the multiple logistic regression models ,
increased healthcare utilization was defined as multiple physician visits ( above average : 6 physician visits ) , multiple hospital admissions ( 2 ) , and prolonged length of hospital stay ( above median : 11 days ) .
median is preferred to mean values when parameters are not normally distributed ( 29 ) .
as length of hospital stay was not normally distributed , median was used as the cutoff of prolonged length of hospital stay .
descriptive statistics , chi - squared ( ) tests , t - tests , analyses of variance ( anovas ) , scheffe 's tests , and multiple logistic regression analyses were conducted to assess the association between diabetes and depression in people with diabetes .
the normality of the variables was acceptable except length of hospital stay , based on kurtosis and skewness analysis .
these multivariate models were adjusted for several potential covariates , including socioeconomic characteristics ( age , gender , marital status , education , and income ) and health - related factors ( bmi , smoking , alcohol drinking and number of chronic diseases ) .
these covariates were selected from earlier literature reporting that increasing age , female gender , being unmarried , low socioeconomic status , high bmi , smoking , alcohol consumption , and comorbidities are associated with the presence of depression in people with diabetes ( 15 , 30 - 33 ) .
finally , both simple logistic regression and adjusted multivariate logistic regression analyses were conducted to determine whether diabetes and depression independently predict healthcare utilization across the three groups ( neither diabetes nor depression , diabetes alone , and diabetes plus depression ) .
adjusted multivariate models were controlled for related variables , including socioeconomic characteristics and health - related factors .
the data used for the following analyses were derived from the klosa , which was a cross - sectional survey that enrolled a large , nationally representative sample of community - dwelling koreans aged 45 years .
the survey was conducted by the ministry of labor of korea from august 1 to december 22 , 2006 and examined mental and physical health status , healthcare utilization , and socioeconomic data .
detailed descriptions of the study design and methods of klosa have been presented elsewhere ( 20 , 21 ) .
participants were selected randomly by a multistage , stratified probability sampling design to select household units according to geographical area including both urban and rural areas . in case of refusal to participate ,
the survey was conducted by skilled interviewers in the participants ' homes using a structured questionnaire .
the final survey sample included 10,254-persons , who represented 0.07% of koreans aged 45 years and had representative age and gender distributions and geographic localization ( 16 major metropolitan cities and provinces ) .
in the current study , we analyzed 10,179 subjects aged 45 years after excluding 75people ( 1non - responder regarding diabetes status and 74 non - responders on the short - form [ 10-item ] center for epidemiological studies depression scale [ ces - d10 ] ) .
furthermore , any non - response bias in estimates should be very small , because the percentage of non - respondents was only 0.7% .
the final sample included 4,436 men and 5,743 women aged 45105 years ( m = 61.7 , sd = 0.1 ) .
computation of weightemployed three steps including the design weight based on two - staged sampling probability , the non - response - adjusted weight , and the benchmark weight reflecting population distribution changes using demographic changes in other large - scale surveys .
socioeconomic variables assessed during the interviews included age , gender , marital status , education , and household income .
marital status was self - reported as married , divorced / separated , widowed , or single .
education level was classified into elementary school or less , middle school , high school , and college or above .
adjusted monthly household income was calculated as the total household income divided by the square root of the number of household members .
these scores were then divided into quartiles ( eg , < 250,000 south korean won [ krw ] , 250,000 krw1,000,000 krw , 1,000,000 krw2,500,000 krw , and > 2,500,000 krw ) .
bmi was computed from self - reported weight and height as weight in kg divided by the square of the height in metre square ; participants were categorized as normal , overweight , or obese ( 24.9 kg / m,25.029.9 kg / m , and 30 kg / m , respectively ) , following who definitions ( 22 ) .
the presence of diabetes was exclusively assessed based on self - reports and not base upon clinical screenings or medical records .
participants were also asked whether they had ever been diagnosed by a physician with chronic diseases , including hypertension , heart disease ( congestive heart failure or myocardial infarction ) , stroke , lung disease , and arthritis .
the number of chronic diseases was calculated by counting the number of disease diagnosed by a physician .
depressive symptoms were measured using the ces - d10 , which is commonly used to assess depressive symptoms in non - psychiatric community settings ( 23 - 25 ) .
the ces - d10 assesses the frequency or duration of depressed mood , feeling tired or low in energy , feeling lonely , trouble concentrating , and sleep disturbances during the preceding week ( 20 , 25 ) .
the ces - d10 is a 10-item scale ; each item can be scored 03 , total scores range 030,and higher scores indicate the presence of more depressive symptoms . the cutoff between moderately severe and severe depression has been identified as 10 points ( 26 ) .
therefore , this study uses the standard cutoff score of 10 to categorize individuals with depression .
the ces - d10 has good internal consistency , acceptable test - retest reliability ( 20 , 21 , 26 , 27 ) , and has shown a statistically significant correlation with self - rated health ( 28 ) .
the internal consistency of the ces - d10 in the current sample was cronbach 's = .82 .
three types of healthcare utilization during the previous year were examined:1 ) physician visits the number of visits to a physician in the last 12 months ; 2 ) hospital admissions
the number of hospital admissions due to medical problems during the last12 months ; and 3 ) length of hospital stay the number of inpatient hospital days during the last 12 months . in the multiple logistic regression models ,
increased healthcare utilization was defined as multiple physician visits ( above average : 6 physician visits ) , multiple hospital admissions ( 2 ) , and prolonged length of hospital stay ( above median : 11 days ) .
median is preferred to mean values when parameters are not normally distributed ( 29 ) .
as length of hospital stay was not normally distributed , median was used as the cutoff of prolonged length of hospital stay .
descriptive statistics , chi - squared ( ) tests , t - tests , analyses of variance ( anovas ) , scheffe 's tests , and multiple logistic regression analyses were conducted to assess the association between diabetes and depression in people with diabetes .
the normality of the variables was acceptable except length of hospital stay , based on kurtosis and skewness analysis .
these multivariate models were adjusted for several potential covariates , including socioeconomic characteristics ( age , gender , marital status , education , and income ) and health - related factors ( bmi , smoking , alcohol drinking and number of chronic diseases ) .
these covariates were selected from earlier literature reporting that increasing age , female gender , being unmarried , low socioeconomic status , high bmi , smoking , alcohol consumption , and comorbidities are associated with the presence of depression in people with diabetes ( 15 , 30 - 33 ) .
finally , both simple logistic regression and adjusted multivariate logistic regression analyses were conducted to determine whether diabetes and depression independently predict healthcare utilization across the three groups ( neither diabetes nor depression , diabetes alone , and diabetes plus depression ) .
adjusted multivariate models were controlled for related variables , including socioeconomic characteristics and health - related factors .
socioeconomic variables assessed during the interviews included age , gender , marital status , education , and household income .
marital status was self - reported as married , divorced / separated , widowed , or single .
education level was classified into elementary school or less , middle school , high school , and college or above .
adjusted monthly household income was calculated as the total household income divided by the square root of the number of household members .
these scores were then divided into quartiles ( eg , < 250,000 south korean won [ krw ] , 250,000 krw1,000,000 krw , 1,000,000 krw2,500,000 krw , and > 2,500,000 krw ) .
bmi was computed from self - reported weight and height as weight in kg divided by the square of the height in metre square ; participants were categorized as normal , overweight , or obese ( 24.9 kg / m,25.029.9 kg / m , and 30 kg / m , respectively ) , following who definitions ( 22 ) .
the presence of diabetes was exclusively assessed based on self - reports and not base upon clinical screenings or medical records .
participants were also asked whether they had ever been diagnosed by a physician with chronic diseases , including hypertension , heart disease ( congestive heart failure or myocardial infarction ) , stroke , lung disease , and arthritis .
the number of chronic diseases was calculated by counting the number of disease diagnosed by a physician .
depressive symptoms were measured using the ces - d10 , which is commonly used to assess depressive symptoms in non - psychiatric community settings ( 23 - 25 ) .
the ces - d10 assesses the frequency or duration of depressed mood , feeling tired or low in energy , feeling lonely , trouble concentrating , and sleep disturbances during the preceding week ( 20 , 25 ) .
the ces - d10 is a 10-item scale ; each item can be scored 03 , total scores range 030,and higher scores indicate the presence of more depressive symptoms . the cutoff between moderately severe and severe depression has been identified as 10 points ( 26 ) .
therefore , this study uses the standard cutoff score of 10 to categorize individuals with depression .
the ces - d10 has good internal consistency , acceptable test - retest reliability ( 20 , 21 , 26 , 27 ) , and has shown a statistically significant correlation with self - rated health ( 28 ) .
the internal consistency of the ces - d10 in the current sample was cronbach 's = .82 .
three types of healthcare utilization during the previous year were examined:1 ) physician visits the number of visits to a physician in the last 12 months ; 2 ) hospital admissions
the number of hospital admissions due to medical problems during the last12 months ; and 3 ) length of hospital stay the number of inpatient hospital days during the last 12 months . in the multiple logistic regression models ,
increased healthcare utilization was defined as multiple physician visits ( above average : 6 physician visits ) , multiple hospital admissions ( 2 ) , and prolonged length of hospital stay ( above median : 11 days ) .
median is preferred to mean values when parameters are not normally distributed ( 29 ) .
as length of hospital stay was not normally distributed , median was used as the cutoff of prolonged length of hospital stay .
descriptive statistics , chi - squared ( ) tests , t - tests , analyses of variance ( anovas ) , scheffe 's tests , and multiple logistic regression analyses were conducted to assess the association between diabetes and depression in people with diabetes .
the normality of the variables was acceptable except length of hospital stay , based on kurtosis and skewness analysis .
these multivariate models were adjusted for several potential covariates , including socioeconomic characteristics ( age , gender , marital status , education , and income ) and health - related factors ( bmi , smoking , alcohol drinking and number of chronic diseases ) .
these covariates were selected from earlier literature reporting that increasing age , female gender , being unmarried , low socioeconomic status , high bmi , smoking , alcohol consumption , and comorbidities are associated with the presence of depression in people with diabetes ( 15 , 30 - 33 ) .
finally , both simple logistic regression and adjusted multivariate logistic regression analyses were conducted to determine whether diabetes and depression independently predict healthcare utilization across the three groups ( neither diabetes nor depression , diabetes alone , and diabetes plus depression ) .
adjusted multivariate models were controlled for related variables , including socioeconomic characteristics and health - related factors .
among the 10,179 subjects included in the analysis , 1826(17.9% ) had depression alone , 838 ( 8.2% ) had diabetes alone , and 375 ( 3.7% ) had both diabetes and depression .
characteristics of the subjects by diabetes and depression ( n = 10,179 ) persons with neither diabetes nor depression were significantly younger , more likely to be married , more educated , and had higher household incomes and lower numbers of chronic diseases than those with diabetes or diabetes and depression .
there were statistically significant differences in the number of physician visits ( f = 112.02 , p <
.001 ) , hospital admissions ( f = 65.42 , p < .001 ) , and length of hospital stay ( f = 8.13 , p <
individuals with diabetes and depression had significantly higher mean scores for physician visits , hospital admissions , and length of hospital stay compared with the other groups . in this sample , diabetes was significantly associated with depressive symptoms ( table 2 ) .
first , individuals with diabetes had significantly higher mean scores for depressive symptoms compared with those without diabetes ( ces - d scores : 7.95 and 6.48 , respectively [ p < .001 ] ) .
second , persons with diabetes exhibited a higher prevalence of depression compared with those without diabetes ( 30.9% vs. 20.4% [ p < .001 ] ) .
these associations remained significant even after adjustment for covariates ( age , gender , bmi , marital status , education , household income , smoking , drinking , and number of chronic diseases ) .
after adjusting for those covariates , korean adults with diabetes were 1.3 times as likely to have depression as individuals without diabetes .
a multivariate model was built to explore the factors associated with depression in persons with diabetes . in this model , elementary school education ( or = 1.91 vs. > elementary school ,
95% ci = 1.063.44 , p = .002 ) , being more than 25.0 in bmi ( or = 1.39 vs. less than 24.9 , 95% ci = 1.011.90 , p = .041 ) , being in the lowest quartile of household income ( or = 1.94 vs. other quartiles , 95% ci = 1.422.66 , p < .001 ) , being smoker ( or = 1.60 vs. non - smoker , 95% ci = 1.042.46 , p = .031 ) , and having 2 chronic diseases ( or = 2.34 vs. 1 , 95% ci = 1.693.24 , p < .001 ) were significantly associated with the presence of depression among those with diabetes , independent of age , gender , marital status , and alcohol drinking ( table 3 ) .
level of depressive symptoms in subjects with and without diabetes ( n = 10,179 ) table 4 shows the unadjusted and adjusted ors of diabetes and depression in binary regression analyses with healthcare utilization measures as dependent variables . after controlling for the above - mentioned covariates , those with diabetes had significantly greater ors of multiple physician visits ( 6 , or=3.02 , 95% ci = 2.543.58 , p < .001 ) compared with those with
neither diabetes nor depression , and those with both diabetes and depression had increased odds of multiple physician visits ( 6 , or=2.62 , 95% ci=2.013.42 , p < .001 ) , multiple hospital admissions ( 2 , or=3.71 , 95% ci=2.176.34 , p < .001 ) and prolonged hospitalization ( 11 days , or=2.33 , 95% ci=1.324.13 , p = .004 ) compared with those with neither diabetes nor depression .
after adjusting for potential confounding factors , there was a significant difference between depressed and non - depressed persons with diabetes in terms of multiple hospital admissions ( 2 , or = 2.75 , 95% ci = 1.405.40 , p = .003 ) .
however , there were no significant differences between depressed and non - depressed persons with diabetes in terms of multiple physician visits ( 6 , or = 1.01 , 95% ci = 0.751.36 , p = .960 ) and prolonged hospitalization ( 11 days , or = 1.82 , 95% ci = 0.913.66 , p = .091 ) .
univariate and multivariate analyses for factors associated with depression in subjects with diabetes unadjusted and adjusted odds of diabetes and depression in binary regression analyses with healthcare utilization measures as dependent variables
the aim of this study was to examine the relationship between diabetes and depression and their related factors , and investigate the effects of comorbid diabetes and depression on healthcare utilization in koreans aged 45 years .
individuals with diabetes experienced elevated symptoms of depression , and the prevalence of depression was higher in diabetics than non - diabetics .
this effect persisted after adjustment for confounding factors , showing that korean adults with diabetes were 1.3 times as likely to have depression as individuals without diabetes .
this finding is in the line with previous research reporting an increased prevalence of depression among those with diabetes ( 13 , 15 - 17 , 34 ) .
low socioeconomic status is known to be associated with depression ( 31 , 33 ) .
there is also an independent relationship between comorbid depression and low socioeconomic status in individuals with diabetes ( 15 , 17 ) .
researchers ( 1 , 32 ) have previously determined the relationship between depressive symptoms and obesity .
consistent with previous studies , we observed that obese people had greater odds of having depression among those with diabetes .
previous studies ( 30 , 32 ) have indicated the relationship between depressive symptoms and smoking .
we also found that smokers had greater odds of having depression among those with diabetes .
earlier studies have shown a positive association between depression and the number of chronic diseases in individuals with diabetes ( 4 , 15 , 17 , 32 ) .
the present study also demonstrated that the number of chronic diseases is an independent risk factor for depression .
therefore , it is necessary to assess depression in diabetic patients who have low socioeconomic status , who are obese , who are smokers , and who have higher numbers of chronic diseases .
simple measures , such as the ces - d10 used in the present study , can be used to screen for depression .
people with depression have reported higher rates of alcohol drinking compared with those without depression ( 30 , 35 ) . in the current study , we found no differences between depressed and non - depressed patients with diabetes in terms of alcohol consumption . at the univariate level
, people with both diabetes and depression showed a lower rate of alcohol drinking compared with people with diabetes but no depression .
however , this association was no longer significant after controlling for covariates . the lower alcohol - drinking rate in people with both diabetes and depression might be partly attributed to the plurality of women ( who show a lower alcohol - drinking rate than men ) in that group .
compared with individuals with neither diabetes nor depression , those with diabetes and depression had greater odds of multiple physician visits , multiple hospital admissions , and prolonged hospitalization .
these results are consistent with findings showing that persons with chronic medical conditions , such as diabetes and depression , have higher healthcare utilization ( 4 , 15 ) .
previous research has also indicated that comorbid depression is associated with multiple hospital admissions and prolonged length of hospital stay in persons with diabetes ( 12 , 13 , 15 , 17 ) .
consistent with previous studies , we found that patients with both diabetes and depression were 2.8 times more likely to report multiple hospital admissions compared with non - depressed diabetic patients .
we did not observe a significant difference between depressed and non - depressed patients with diabetes in terms of prolonged hospitalization .
a possible interpretation of this might be attributed to the low statistical power to detect the relationship due to the low number of persons with diabetes and depression .
more research is needed to clarify the underlying mechanisms of association between co - occurring depression with diabetes and increased healthcare utilization ; further , it would also be useful to test various clinical practices intended to reduce the risk of comorbid depression in individuals with diabetes .
this study contributes to the current literature by providing a better understanding of the associations between depression , diabetes , and healthcare utilization in an understudied population , namely community - dwelling korean adults .
first , this study was based on a cross - sectional survey , which can not generate inferences regarding causality ; this makes it difficult to conclude that the increased healthcare use among depressed persons with diabetes can be attributed solely to depression / diabetes .
second , because the diabetes was measured by self - report , the prevalence of diabetes may be underestimated ( 15 ) . some people with unknown diabetes
the use of a self - reported single - item global assessment rather than medical confirmation of diagnoses for diabetes may be incomplete and prone to errors with regard to recall .
earlier studies have indicated that the prevalence rates of type 1 diabetes are substantially lower in asian countries , including korea , than in caucasian countries ( 36 , 37 ) .
therefore , we believe that most participants with diabetes in this study had type 2 diabetes . finally , even though diabetes complications were closely related to the level of healthcare utilization ( 17 ) , the present study did not include data on diabetic complications experienced by the participants .
the strength of our study is its use of a large , nationally representative sample of the korean non - institutionalized population .
an additional strength is the fact that the klosa was a household survey conducted via face - to - face interview .
many researchers have indicated that the response rate of face - to - face interviews is higher than those of mail surveys and telephone interviews ( 38 , 39 ) .
after controlling socioeconomic and health variables , diabetes is associated with depression in this korean adults aged 45 years .
we also observed that depression is related with bmi , smoking , socioeconomic status and number of chronic diseases among diabetic patients .
these findings indicate that diabetic patients who are obese , smoker , who have low socioeconomic status , and who have higher numbers of chronic diseases may derive an advantage from screening , because they seem to be at the highest risk for depression .
people those with diabetes and depression had significantly increased odds of multiple physician visits , multiple hospital admissions , and prolonged hospitalization compared with individuals with neither diabetes nor depression .
patients with both diabetes and depression had greater odds of multiple hospital admissions than patients with diabetes alone .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors . | abstractbackgroundthe aim of this study was to explore the relationship between diabetes and depression and investigate the effects of comorbid diabetes and depression on healthcare utilization.methodsthe study sample included 10,179 korean adults aged 45 years .
the presence of diabetes was assessed by asking participants if the participants had ever been diagnosed with diabetes .
depression was measured using the 10-item center for epidemiological studies depression scale .
healthcare utilization was assessed by self - report .
multiple logistic regression analyses were performed.resultsdiabetes was positively associated with depression after controlling socioeconomic and health variables .
diabetic patients who had low socioeconomic status , who were obese , who were smokers , and who had higher numbers of chronic diseases had a higher depression risk . diabetes and depression was associated with increased healthcare utilization .
people with both diabetes and depression had significantly increased odds of multiple physician visits , multiple hospital admissions , and prolonged hospitalization compared with individuals with neither diabetes nor depression .
patients with both diabetes and depression had greater odds of multiple hospital admissions than patients with diabetes alone.conclusionswe found a positive association between diabetes and depression .
depression in persons with diabetes is associated with increased multiple hospital admissions .
more research is warranted to clarify an association between co - occurring depression with diabetes and increased healthcare utilization . |
and gary ruvkun ( wightman et al . , 1993 ) first discovered that a small non - coding rna lin-4 was able to repress the translation of lin -14 , a gene important for developmental timing of c. elegans , the scientific community accepted the findings as an oddity of worm biology .
since then a plethora of studies have solidified the notion that these small non - coding rnas , which are named micrornas ( mirnas ) , are evolutionary conserved , are responsible for regulating the expression of the majority of protein coding genes , and play a critical role in diverse cellular functions .
the biogenesis of mirnas starts when they are transcribed from intergenic or intronic genomic regions into primary mirna precursor molecules , known as pri -mirnas ( reviewed in bartel , 2004 ; krol et al .
pri -mirnas are cleaved inside the nucleus by the components of the microprocessor complex , drosha and dgcr8 , to generate hairpin structured rna hairpins called pre - mirnas ( bartel , 2004 ; krol et al . , 2010a ) .
pre - mirnas are exported into the cytoplasm and undergo further cleavage by rnaseiii enzyme dicer , thereby forming a complementary duplex of two mirna strands ( bartel , 2004 ; krol et al . , 2010a ) .
the mirna duplex is unwound and one of the strands , the mature mirna , is incorporated into a large mirna - induced silencing complex ( mirisc ) , which serves to detect and bind into complementary sequences inside messenger rnas ( mrnas ) . as a result of an efficient binding of the mature mirna to its target , which is usually in the 3 untranslated region ( 3 utr ) of the mrna , translational inhibition and/or mrna cleavage occur with mechanisms that are still not fully understood ( bartel , 2004 ; pillai et al . , 2007 ;
mirnas are known to not only restrict the expression of their target genes in certain cell types or during specific developmental periods , but also to fine tune the levels of co - expressed targets so that a desired biological response can occur .
the mammalian brain is characterized by a notable abundance of mirnas . targeted deletion studies of the mirna processing enzyme dicer in different cellular populations in the mouse brain
have provided strong evidence for the significance of mirnas in the development and maturation of both neuronal and glial cells , with consequent abnormalities in brain morphology and connectivity ( cuellar et al .
, 2008 ; davis et al . , 2008 ; shin et al . , 2009 ; dugas et al . , 2010 ;
however , the fact that dicer can process other types of small non - coding rnas does not allow us to exclude mirna - independent mechanisms behind these observed phenotypes .
in addition , deletion of another mirna processing enzyme dgcr8 in neurons , results in alterations in dendritic branching , excitatory synaptic transmission , and short term plasticity ( stark et al . , 2008 ; fenelon et al . , 2011 ;
a large number of studies have identified mirnas that are important for brain development and neuronal differentiation , which have been described in previous reviews ( li and jin , 2010 ; bian and sun , 2011 ) . however
the focus of this review is on mirnas that have been proven to influence brain maturation and plasticity , mechanisms that are known to be perturbed in psychiatric diseases ( table 1 ) .
dendritic spines are protrusions at branches of a neuron s dendritic tree that form the post - synaptic end of a synapse .
their structural properties are known to reflect the degree of brain maturation and their dynamics are an important component of brain plasticity .
moreover , alterations in dendritic spine density have been reported in numerous neuropsychiatric disorders , including schizophrenia and autism spectrum disorders ( asd ; penzes et al . , 2001 ) .
interestingly , a loss of dendritic spines has been reported to occur in schizophrenia ( glantz and lewis , 2000 ; kolomeets et al . , 2005 ; sweet et al . , 2009
) , whereas an increase in the number of spines has been proposed for asd ( hutsler and zhang , 2000 ) . in both diseases , however , the changes in dendritic spine density are limited to specific brain regions and cortical layers ( glantz and lewis , 2000 ; hutsler and zhang , 2000 ; kolomeets et al . , 2005 ; sweet et al . , 2009 ) .
micrornas involved in brain plasticity and maturation with links to schizophrenia and autism spectrum disorders .
links to altered expression for autism are showed in parenthesis and in blue , all other descriptions refer to schizophrenia and are shown in red .
the first demonstration that mirnas are localized in the synapse and can regulate dendritic spine structure came when mir-134 was found to be expressed in hippocampal dendritic spines and shown to be capable of reducing spine width by targeting spine growth - promoting kinase limk1 ( schratt et al . , 2006 ) . since then , a number of mirnas such as mir-132 ( vo et al .
, 2005 ; wayman et al . , 2008 ; edbauer et al . , 2010 ; impey et al . ,
2010 ) , mir-125b ( edbauer et al . , 2010 ) , mir-138 ( siegel et al . , 2009 ) , and mir-137 ( smrt et al . , 2010 ) have been shown to regulate dendritic spine structure and morphology . in the case of mir-138
it reduces spine size by targeting depalmitoylation enzyme acyl - protein thioesterase 1 ( apt1 ; siegel et al . ,
2009 ) , whereas mir-125b reduces spine width potentially by targeting nmda receptor 2a ( nr2a ; edbauer et al . , 2010 ) . a negative impact on spine maturation
was also shown for mir-137 , with the proposed mechanism of action being its effect on ubiquitin ligase mind bomb 1 ( mb1 ; siegel et al . , 2009 ) .
neuronal activity and camp response binding protein ( creb ) signaling was found to regulate the expression of mir-132 , which has been shown to increase dendritic spine density and size and promote mature spine morphology by targeting spine inhibitor gtpase p250gap ( vo et al . , 2005 ; wayman et al . , 2008 ; impey et al . ,
2010 ) . in newborn hippocampal neurons mir-132 plays an additional role by influencing dendritic branching and synaptic integration ( magill et al . , 2010 ; luikart et al . , 2011 )
notably , growth factors such as brain - derived neurotrophic factor ( bdnf ) are known to interfere with mirna expression and function .
for example , bdnf can induce the expression of mir-132 and co - transcribed mir-212 ( remenyi et al . , 2010 ) and inhibit the actions of mir-134 ( schratt et al . , 2006 ) , both in an activity - dependent manner .
despite the fact that most of the initial discoveries pertaining to the role of mirnas in brain maturation were based in neuronal cultures or slices , recent studies have employed new methods for in vivo manipulation of mirna levels in mouse brain , and have provided important insights into the interplay between mirna - mediated structural effects and their impact in brain plasticity and function .
the most well studied mirna family is that of mir-132/mir-212 , two mirnas of the same family that share sequence similarities , and are expressed from the same genomic location .
both mir-132 and mir-212 have been demonstrated to respond to cocaine treatment and in vivo manipulation of mir-212 expression was found to modulate cocaine - induced plasticity and cocaine seeking behavior by indirectly promoting creb signaling ( hollander et al . , 2010 ) .
a follow - up study revealed that mir-132/212 were involved into a complex activity - dependent loop with bdnf and methyl - cpg - binding protein ( mecp2 ) , that resulted in the observed effects in cocaine plasticity ( i m et al . , 2011 ) .
a similar interplay between mecp2 and mir-132 expression , that involves bdnf , has been previously shown to occur in neuronal cultures ( klein et al . , 2007 ) .
furthermore , two independent studies have recently shown that mir-132 is an experience - dependent mirna in mouse visual cortex , which regulates dendritic spine morphology in vivo , and whose balanced expression is needed to maintain visual cortex plasticity ( mellios et al . , 2011 ; tognini et al . , 2011 ) .
in the first study mir-212 was included together with mir-132 in the subset of mirnas that showed significant changes in their expression following visual deprivation , an established paradigm for studying cortical plasticity ( mellios et al . ,
led to increased levels of spine inhibitor p250gap and reduced dendritic spine density and immature morphology ( mellios et al . , 2011 ) . in the second study , on the other hand , in vivo upregulation of mir-132 expression promoted spine maturation ( tognini et al . , 2011 ) .
notably , both of these manipulations abrogated ocular dominance plasticity , the ability of neurons of the visual cortex to adjust their synaptic weights in response to altered visual drive following visual deprivation during a specific sensitive period of plasticity known as the critical period .
these finding suggest that balanced levels of mir-132 are required for brain plasticity , and that too much or too little mir-132 expression can result in precocious or delayed cortical maturation , respectively .
the effect of mir-132 in experience - dependent cortical maturation is very likely to not be limited to the visual cortex , since multiple studies have shown that mir-132 expression is induced in other brain regions in an experience - dependent manner ( nudelman et al . , 2010 ) .
furthermore , a number of recent studies have shown that a subset of brain expressed mirnas can affect learning and memory .
specifically , mir-134 expression in the hippocampus of sirtuin 1 ( sirt1 ) knockout mice , which display memory deficits during fear conditioning and aberrant long term potentiation ( ltp ) , was shown to be increased , and in vivo inhibition of mir-134 expression in hippocampus , was able to rescue both the memory and plasticity impairments ( gao et al . , 2010 ) .
the novel mechanism proposed by this study was that sirt1 normally inhibits mir-134 transcription , and mir-134 targets creb , which in turn increases bdnf expression ( gao et al . , 2010 ) .
two more studies described creb - targeting mirnas as being important for plasticity and memory , with mir-124a shown to block serotonin - induced long term plasticity in aplysia ( rajasethupathy et al . , 2009 ) , and mir-128b proposed to regulate the formation of fear extinction memory in mice ( lin et al . , 2011 ) .
the latter study also demonstrated that mir-128b , which is an intronic mirna , targets its host gene , regulator of calmodulin signaling ( src , or rpp21 ) , along with a number of other plasticity - related genes such as reelin ( reln ) , protein phosphatase 1c gamma ( ppp1cc ) , and trans - acting transcription factor 1 ( sp1 ) .
of note , mir-124 is an example of a brain enriched mirna that acts in a temporal and cell - specific manner , since it can also affect neuronal development ( cheng et al . , 2009 ) , differentiation , including neurite branching ( makeyev et al .
2008 ) , and is able in parallel to influence the activation of brain microglia ( ponomarev et al . , 2011 ) , in which it is also abundantly expressed ( see also figure 1 ) . finally , transgenic mice overexpressing mir-132 were also shown to have impairments in novel object recognition memory ( hansen et al . ,
surprisingly , the conditional and transient deletion of dicer1 in adult mouse forebrain caused an unexpected improvement in learning and memory ( konopka et al .
drawing showing examples of mirnas enriched in different cellular populations in the central nervous system .
aneuron is shown in yellow orange with mir-132 activating and mir-134 , mir-137 , and mir-138 inhibiting spine growth .
expression of mir-132 is present ( albeit in lower levels ) in astrocytes ( shown in green ) , which also express high levels of mir-195 and mir-30a , mir-30b , and mir-30c .
secretion of microvesicles that are known to contain mirnas ( exosomes ) by astrocytes is also depicted .
expression of mir-124 is shown in both neurons , where it promotes neurite outgrowth , and microglia ( shown in red ) , where it suppresses their activation .
oligodendrocytes ( shown in light blue ) express high levels of mir-219 and mir-23a , which regulate their differentiation .
the first psychiatric disease to be linked to mirna expression and function was tourette s syndrome , following the report that mutations in the 3utr of slitrk1 were affecting the targeting by mir-189 in a limited subset of patients ( abelson et al . , 2005 ) .
however , a plethora of postmortem studies using subjects diagnosed with schizophrenia provided the strongest support for aberrant mirna expression in psychiatric diseases ( perkins et al . , 2007 ; beveridge et al . , 2008 , 2010 ; mellios et al . , 2009 , 2010
; zhu et al . , 2009 ; kim et al . , 2010 ; moreau et al . , 2011 ; santarelli et al . , 2011 ; miller et al . , 2012 )
. among the reported dysregulated mirnas are those described above as being important regulators of brain maturation and plasticity ( table 1 )
. the known limitations of postmortem studies , however , and differences in mirna quantification techniques , have not allowed for a comprehensive description of which mirnas are reliably affected in schizophrenia , and more importantly which might be important for the pathogenesis of this highly heterogeneous psychiatric disorder .
in addition to individual mirna expression the possibility that mirna processing might be perturbed as a whole in a subset of subjects of schizophrenia has been proposed ( beveridge et al . , 2010 ; santarelli et al . ,
2011 ) : although debatable , the idea deserves to be further investigated , especially in light of the fact that patients suffering from digeorge 22q11,2 deletion syndrome , which harbor microdeletions that affect mirna processing gene dgcr8 , display a 30-fold increase in the prevalence of schizophrenia and schizoaffective disorder ( lindsay et al . , 1995 ; murphy et al .
, 1999 ; stark et al . , 2008 ) . a subset of mirna altered in the brains of subjects diagnosed with schizophrenia , such as mir-132/212 ( perkins et al . , 2007 ; kim et al . , 2010
; miller et al . , 2012 ) , mir-219 ( beveridge et al . , 2010 ) , and mir-195 ( beveridge et al . , 2008 , 2010 ) deserves special attention . in the case of mir-132 and mir-212 ,
their prementioned links to activity - dependent synaptic plasticity , and neuronal maturation , are of interest given the known abnormalities in synaptic plasticity and connectivity observed in schizophrenia . the fact that nmda inhibition is reported to affect the stability of mature mir-132 in neuronal cultures ( krol et al .
, 2010b ) is of additional importance since nmda hypofunction is hypothesized to be linked to the core of schizophrenia pathophysiology . on a similar note , mir-219
, whose expression is downregulated in response to acute pharmacological blockade of nmda receptors with diclozapine and in nmda receptor 1 ( nr1 ) knockout mice , can target calcium / calmodulin - dependent protein kinase ii subunit ( camkii ; kocerha et al . , 2009 ) .
however , both mir-219 and camkii levels are increased in the prefrontal cortex ( pfc ) and superior temporal gyrus ( stg ) of patients with schizophrenia ( beveridge et al . , 2010 ) , suggesting an additional level of complexity .
another notable similarity between mir-219 and mir-132 is that they were both shown to influence genes important for circadian clock entrainment ( cheng et al . ,
2007 ) , which is of potential relevance to schizophrenia given the observed deficits in circadian synchronization ( lamont et al .
another mirna that deserves notice is mir-195 which was found to be increased in the brain of subjects with schizophrenia ( beveridge et al . , 2010 ) , and which has been proven to regulate numerous schizophrenia - related genes , such as bdnf ( mellios et al . , 2008 ) ,
reln ( beveridge et al . , 2010 ) , visinin - like 1 ( vsnl1 ; beveridge et al . , 2010 ) , 5-hydroxytryptamine ( serotonin ) receptor 2a ( htr2a ; beveridge et al . , 2010 ) , and glutamate receptor , ionotropic , n - methyl - d - aspartate 3a ( grin3 ; beveridge et al . , 2010 ) .
the presence of two gabaergic expressed genes ( reln , vsnl1 ) in the above list of validated mir-195 targets , and the fact that bdnf is known to influence gabaergic gene expression and function , position mir-195 as an intriguing candidate for schizophrenia research given the known deficits in gabaergic gene expression and inhibitory neuron function in schizophrenia ( akbarian et al . , 1995 ; guidotti et al .
the findings that disease - related changes in mir-195 are inversely correlated to those of bdnf protein levels , which in turn are associated with the observed changes in somatostatin ( sst ) and neuropeptide y ( npy ) mrna levels in human pfc of subjects with schizophrenia ( mellios et al . , 2009 ) , adds value to the above hypothesis .
last , but not least , an in silico study of schizophrenia - related mirnas and transcription factors , depicted mir-195 as the core component of the predicted schizophrenia regulatory gene networks ( guo et al . , 2010 ) . despite the known neuronal - specific targets of schizophrenia - related mirnas it is tempting to speculate that disease - related changes in the expression of a subset of mirnas in schizophrenia might not be limited to neurons but could be also prevalent in glial cell populations .
for example , mir-219 expression is abundantly expressed in oligodendrocytes and regulates their maturation ( dugas et al . , 2010 ) , and mir-132 , mir-195 , and many members of the mir-30 family are also expressed in astrocytes ( moser and fritzler , 2010 ; mor et al .
in addition , the findings of the existence of microvesicles secreted by astrocytes called exosomes that contain mirnas and could be taken up by neurons introduce a novel unexplored mechanism between cell to cell communication in the brain ( faure et al . , 2006 ;
differential expression of mirnas within different neuronal populations was recently discovered in mouse neocortex , with the example of mir-34a , a mirna altered in the pfc of subjects diagnosed with schizophrenia ( kim et al .
, 2010 ) , being particularly enriched in parvalbumin expressing interneurons ( he et al . ,
future studies using similar cell - specific methods for mirna detection , including exosome profiling , are needed to elucidate the role of non - neuronal mirnas in schizophrenia .
in addition to the alterations in mirna expression in schizophrenia a growing number of genetic studies has provided intriguing links between mirnas and schizophrenia .
initially , single nucleotide polymorphisms ( snps ) within mir-206 and mir-198 were shown to be nominally associated with schizophrenia ( hansen et al . , 2007 ) .
furthermore , another snp in pre - mir-30e was strongly linked to the disease ( xu et al . , 2010 ) .
notably , the expression of mir-30e is known to be altered in the pfc of subjects with schizophrenia , together with other members of the mir-30 family ( perkins et al . , 2007 ) , including mir-30a and mir-30d , which have been proven to target bdnf ( mellios et al .
in addition , another member of the mir-30 family , mir-30b , was shown to be predominantly affected in female subjects with schizophrenia , and to be influenced by a disease - related snp in estrogen receptor alpha ( mellios et al . , 2010 ) .
however , the most robust genetic evidence came from a recent meta - analysis of genome - wide association studies ( gwas ) for schizophrenia that reported that a snp within intronic mir-137 displayed the most significant association with the disease ( ripke et al . ,
this impressive finding was accompanied by the observation that four more significant loci contained mir-137 targets ( ripke et al . , 2011 ) .
other than the pre - mentioned reported effect of mir-137 in dendritic spine maturation ( smrt et al . , 2010 ) , it is of interest that mecp2 inhibits mir-137 expression , which in turn can target other chromatin modifying genes , such as lysine ( k)-specific demethylase 1a ( kdm1a , also known as lsd1 ; sun et al . , 2011 ) , and histone - lysine n - methyl - transferase , enhancer of zeste ( drosophila ) homolog 2 ( ezh2 ; szulwach et al . , 2010 ) .
notably , a recent finding demonstrated that mir-137-mediated regulation of lsd1 can also regulate neuronal differentiation and migration by affecting neural stem cell renewal ( sun et al . , 2011 ) .
furthermore , the interplay between mir-137 and genes important for chromatin remodeling is of importance given the hypothesized role of epigenetics in schizophrenia ( akbarian , 2010 ) , and especially since a large number of other schizophrenia - related mirnas , such as mir-132/212 , mir-195 are known to be sensitive to epigenetic regulation ( li et al .
, 2011 ; tognini et al . , 2011 ; zhang et al . , 2011 ) .
interestingly , recent work has uncovered that the deficits in mir-132 in schizophrenia are accompanied by an increase in mir-132 target dna methyl - transferase alpha ( dnmt3a ; miller et al . ,
further work is warranted to determine whether epigenetic regulation of mirna expression could play an important role in the pathophysiology of the disease .
unlike the large number of studies examining the role of mirnas in schizophrenia , little is known about the potential importance of mirnas for asd , and especially for the non - syndromic asd subtypes .
so far two studies have determined the expression of mirnas in lymphoblastoid cell cultures of asd patients ( abu - elneel et al . , 2008 ; talebizadeh et al . , 2008 ; sarachana et al . , 2010 ; seno et al . ,
2011 ) , and one study has identified dysregulated mirnas in the cerebellum of asd patients ( abu - elneel et al . , 2008 ) .
among the most promising results ( table 1 ) is the finding of altered expression of mir-132/212 , the two mirnas of the same family described above to be dysregulated in schizophrenia ( perkins et al .
, 2007 ; kim et al . , 2010 ; miller et al . , 2012 ) and
to be important for the control of experience - dependent cortical plasticity ( mellios et al .
notably , mir-132 effects on synaptic structure are modulated by fmrp ( edbauer et al . , 2010 ) , the product of the fmr1 gene responsible for fragile - x mental retardation , the leading cause of mental retardation in adults and a subtype of syndromic asd ( dhulst and kooy , 2009 ) .
intriguingly , mir-132 is known to be induced by endotoxins and regulate the immune response ( taganov et al .
, 2006 ; shaked et al . , 2009 ; lagos et al . , 2010 ) , as well as to be affected by cytomegalovirus infection ( wang et al . , 2008 ) , which are known to contribute to autism pathogenesis ( stubbs et al . , 1984 ; onore et al . , 2012 )
in addition , mir-132 levels are reduced in rett syndrome , another subtype of syndromic asd , caused by mutations in mecp2 ( klein et al . , 2007 ;
as mentioned above , mecp2 can increase the expression of mir-132 through its effect on bdnf , and decrease mir-137 by binding to its promoter and inducing transcriptional inhibition ( klein et al .
, 2007 ; wu et al . , 2010 ) . however , the effect of mecp2 on mirnas is far more complex , since mecp2 is known to regulate a large number of mirnas in the mouse brain , and influence a plethora of mirna - mediated functions with potential importance for brain disease ( wu et al . , 2010 ; de leon - guerrero et al . ,
furthermore , mir-195 , mir-219 , mir-346 , mir-181b , and mir-128b , all known to be altered in schizophrenia ( beveridge et al . , 2008 , 2010 ;
zhu et al . , 2009 ) , exhibit changes in asd samples as well ( abu - elneel et al . , 2008 ;
2011 ) , strengthening the argument for the existence of common molecular pathways behind the pathophysiology of both neuropsychiatric diseases .
interestingly , and as mentioned above , mir-195 is known to target bdnf ( mellios et al . , 2009 ) and mir-128b to inhibit creb ( lin et al . , 2011
) , whereas mir-132/212 are induced by bdnf and positively regulate creb signaling ( hollander et al . , 2010 ; remenyi et al . ,
2010 ) , which , in conjunction with two more bdnf regulating mirnas ( mir-495 , mir-381 ; wu et al . , 2010 ) altered in autism ( talebizadeh et al . , 2008 ; sarachana et al . , 2010 ) , allows us to speculate that activity - dependent mirnas could be affected in asd .
such abnormalities in activity - dependent bdnf / creb - related mirnas are expected to have an impact on synaptic connectivity and maturation , which are known to be perturbed in asd . as in the case of schizophrenia , the cell - specificity of asd - related alterations in mirna expression warrants further investigation ,
since differentially expressed mirnas are known to be also expressed in astrocytes and oligodendrocytes ( dugas et al . , 2010 ; moser and fritzler , 2010 ; numakawa et al . , 2011 ; mor et al .
, 2011 ; lin and fu , 2009 . in the case of mir-23a , for example , which together with mir-132 is altered in three out of four asd studies ( abu - elneel et al . , 2008 ; talebizadeh et al . , 2008 ;
2010 ) , there is strong evidence suggesting that it is an oligodendrocyte enriched mirna that regulates their maturation by inhibiting lamin b1 ( lin and fu , 2009 ; see also figure 1 ) .
another pathway that is emerging to be regulated by asd altered mirnas and that is also affected by bdnf signaling , is that of phosphoinositide 3-kinase ( pi3k)/protein kinase b ( pkb also known as akt ) , with the best example being the reported changes in mir-21 , a mirna known to target phosphatase and tensin homolog ( pten ; meng et al . , 2006 ; iliopoulos et al . , 2010 ) , which is responsible for inactivating akt .
given that patients with pten mutations represent a substantial proportion of syndromic asd ( varga et al .
, 2009 ) , further research is warranted to elucidate the importance of mir-21 for asd pathogenesis .
the increasing number of studies uncovering novel mirna - mediated mechanisms that influence brain maturation and plasticity , in conjunction with the parallel findings for the potential involvement of such mirnas in schizophrenia and autism , elevates the importance of mirnas for brain function and dysfunction to a new level .
it is tempting to speculate that a subset of the reported dysregulated in neuropsychiatric disorders mirnas might turn out to be integral for shedding light on the elusive pathophysiology or pathogenesis of these complex and enigmatic disorders .
moreover , given the fact that both autism and schizophrenia pathogenesis appears to be influenced by mechanisms related to neurodevelopment , priority should be given to asd or schizophrenia altered mirnas with specific developmental patterns .
for example , the experience - dependent mir-132/212 mirna family holds great promise for schizophrenia , since its expression in mouse pfc peaks around adolescence ( miller et al . , 2012 ) , which coincides with the age of onset of schizophrenia .
in theory , if a mirna is indeed regulating genes and pathways that could trigger the onset of the disease , it is expected that its dysregulation will have the biggest impact at the time point when its expression reaches the maximum , because this is when its targets will be most robustly affected . moreover , in the case where alterations in specific mirnas are only an epiphenomenon of the disease , they could be ideal biomarker candidates , given the increased stability and durability of mirnas , even in harsh handling conditions ( chen et al .
indeed , recent studies are exploring this possibility and have already reported some aberrantly expressed mirnas in blood cells that could be associated with schizophrenia symptomatology , including mirnas known to be altered in the brains of schizophrenia subjects as well , or affected by antipsychotic treatment ( gardiner et al . , 2011 ; lai et al .
2012 ; table 1 ) . ideally , the use of blood expressed mirnas as biomarkers can be expanded to monitor the progress and response to therapeutic treatment of a disease , such as in the case of mir-134 and bipolar disorder ( rong et al . , 2011 ) .
2011 ) , or induced pluripotent stem cell - derived ( pedrosa et al . , 2011 ) neurons , from patient fibroblasts might be an alternative for uncovering novel mirna biomarkers , as well as for discovering new treatment options .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | micrornas ( mirnas ) are small non - coding rnas conserved throughout evolution whose perceived importance for brain development and maturation is increasingly being understood .
although a plethora of new discoveries have provided novel insights into mirna - mediated molecular mechanisms that influence brain plasticity , their relevance for neuropsychiatric diseases with known deficits in synaptic plasticity , such as schizophrenia and autism , has not been adequately explored . in this review
we discuss the intersection between current and old knowledge on the role of mirnas in brain plasticity and function with a focus in the potential involvement of brain expressed mirnas in the pathophysiology of neuropsychiatric disorders . |
in eukaryotes , the basic repeating unit
of chromatin is the nucleosome , consisting of 147 base pairs of dna
wrapped around an octamer of histone proteins .
the octamer contains
two copies of each of the core histones , h2a , h2b , h3 , and h4 .
histone proteins are dynamically post - translationally
modified to regulate a wide array of nuclear processes , including
transcription , dna damage repair , and signaling pathways .
most of this post - translational modification
( ptm ) occurs on the n - terminal histone tails that protrude from the
nucleosomal surface . of the core histones ,
h3 and
h4 undergo the most extensive modifications mass spectrometry
( ms ) has emerged as a powerful tool to characterize histone ptms as
it can accurately identify and quantify all histone ptm profiles in
an unbiased manner .
ms can also identify novel modifications
as well as multiple modifications on a single peptide .
most histone ptm analysis by ms has been conducted on high - resolution
mass analyzers , such as orbitraps , because they provide sufficient
mass accuracy to differentiate two very common , nearly isobaric ptms :
acetylation and trimethylation , 42.0106 and 42.0470 da , respectively .
for example , the ultrahigh - resolution fourier transform ion cyclotron
resonance mass spectrometer ( fticr ms ) has a resolving power
( > 10 ) that can differentiate peptides with almost identical
mass ( m / z < 0.001 ) , and
can therefore easily discriminate trimethylation and acetylation based
on mass alone .
lower - resolution mass analyzers ,
such as linear ion traps , are unable to resolve this small mass difference .
however , other techniques can be used to
differentiate these modifications on lower - resolution mass analyzers ,
such as ms / ms spectra in combination with retention time information or synthetic peptide coelution information .
the hunt lab demonstrated that the h3 917 aa peptide bearing
k14ac or k9me3 eluted 17 min apart based on a 240 min gradient ( 0
to 100% b ) , suggesting that relative retention time can be used to
distinguish the modifications .
subsequently ,
the freitas group utilized this shift in retention time to demonstrate
that trimethylated and acetylated peptides can be distinguished on
low - resolution mass spectrometers based on their relative retention
times .
they validated their peak assignments by running the same sample
on a high - resolution mass spectrometer to resolve the mass difference
on the ms1 level and also performed ms / ms for further validation .
one way to accomplish this
task is to use heavy isotope labeled methyl and/or acetyl donors so
that the modifications are no longer isobaric .
however , it is relatively time - consuming
to wait for the light modifications to turn over .
another option is
to spike in heavy labeled synthetic peptides , which will then coelute
with the modified peptide of interest , but will be distinguishable
based on its unique mass .
used synthetic peptide coelution
to determine that a potential new modification on a histone peptide
( h2at15ac ) was falsely assigned .
neutral losses can also be used to lend confidence to identity assignments
for isobaric peptides .
trimethylated peptides undergo signature neutral
losses during collision induced dissociation ( cid ) fragmentation ,
and the resulting mass shifts observed in ms / ms spectra can be used
to validate methylation sites .
fragmentation of acetylated
peptides does not result in neutral losses but does produce immonium
ions at m / z 143.1 which can be used
to verify the presence of acetylated resides
. since lower - resolution instruments are less expensive , easier
to maintain , and somewhat more ubiquitous compared to high - resolution
instruments , we aimed to determine if lower - resolution mass analyzers
are as capable of robust and accurate histone ptm identification and
quantification as high - resolution mass analyzers using several of
the above - described techniques . to this end , we compared the performance
of a low - resolution linear ion trap ( ltq velos pro ) and a high - resolution
ion trap orbitrap hybrid instrument ( ltq - orbitrap velos pro )
in comprehensive ptm analysis of histones , one of the most extensively
modified proteins in eurkaryotes .
most modifications have a large
enough mass difference to be resolved on lower - resolution mass analyzers ,
and so one of the biggest challenges when using low - resolution detectors
for histone ptm analysis is differentiating trimethylation from acetylation .
we first determined the optimal scan mode on the ltq velos pro
based on three criteria : ( 1 ) reproducibility of relative peptide abundance
measurements , ( 2 ) resolution of peptides in higher charge states ( e.g. ,
+ 2 and + 3 charges ) , and ( 3 ) the number of ms1 and ms2 scans obtained
per run . from this analysis
, we determined that enhanced scan mode
has the optimal trade - off between resolution and number of scans ,
while providing very consistent quantification .
we then compared the
performance of the ltq velos pro on enhanced scan mode to the orbitrap
velos pro using the same criteria listed above as well as mass accuracy .
the orbitrap velos pro was able to resolve the mass difference between
acetylation and trimethylation , while the ltq velos pro could not .
however , these modifications could be accurately quantified on the
ltq velos pro using either retention time information or stable isotope - labeled
synthetic peptide spike - in standards . as such ,
we conclude that while
high - resolution mass analyzers are ideally suited for histone ptm
analysis , low - resolution detectors are also adequate .
hela s3 cells were gown in suspension as described previously and harvested using standard protocols .
nuclei were resuspended in 0.4 m nacl
buffer containing 1 mm dtt , 0.3 mm aebsf , and 10 mm sodium butyrate
( 10:1 buffer : pellet by volume ) and were incubated at 4 c with
shaking for 30 min .
the nuclei were pelleted at 3000 g for 5 min at 4 c , and the supernatant was removed by decanting .
the pellet was resuspended in 2.5 m nacl containing 1 mm dtt , 0.3
mm aebsf , and 10 mm sodium butyrate ( 5:1 by volume ) .
an equal volume
of cold 0.4 n h2so4 was added slowly , and the
nuclei were incubated at 4 c with shaking for 2 h. the nuclei
were pelleted at 3400 g for 5 min , and proteins were
precipitated from the supernatant with tca as previously described . when needed , offline reverse - phase high - performance
liquid chromatography ( rp - hplc ) was used to further purify histone
proteins as described previously .
acid - extracted total histones or rp - hplc - purified
histones were chemically derivatized with propionic anhydride and
digested using trypsin ( promega ; substrate / protease ratio of 20:1 )
as described previously .
histone peptides
were subsequently desalted for ms analysis using homemade c18 stage
tips as described previously .
briefly , 93 synthetic tryptic histone peptides containing
heavy - labeled amino acids were synthesized containing the most common
ptm profiles .
the peptides were purified by rp - hplc and combined to
a final concentration of 0.27 pmol/l / peptide in water .
the synthetic peptide library was added to a
total acid - extracted histone sample in a ratio of 100 fmol of synthetic
peptides:1 g of histone . a fused silica microcapillary column ( 75 m i.d . )
was packed
in - house with reprosil - pur c18 resin ( 3 m , dr .
the column was fitted to a commercial fused silica emitter with a
10 m tip ( new objective ) .
small aliquots ( 1.5 g ) of
a single histone h4 sample were loaded onto the column by an eksigent
nanolc as-2 autosampler .
peptides were separated using an eksigent
nanolc 2d plus system hplc across a 76 min multistep gradient : 2%
buffer b for 1 min ( a , 0.1% formic acid in water ; b , 0.1% formic acid
in acetonitrile ) , 2% to 30% b in 55 min , 30% to 98% b in 15 min , 98%
b for 10 min , 98% b to 2% b in 30 s , 2% b for 9.5 min ( equilibration )
at a constant flow of 250 nl / min .
the hplc was coupled to a linear
quadrupole ion trap ( ltq velos pro , thermo scientific ) mass spectrometer
operating in zoom , enhanced , normal , or turbo scan modes ( see table 1 for scan rate information ) .
a full ms spectrum
was obtained followed by 6 data - dependent ms / ms acquisitions for the
top six most abundant ions using cid fragmentation ( collision energy
of 40 , activation q of 0.25 , and activation time
of 10 ms ) .
three technical replicates were obtained for each scan
mode . based on a 76 min
gradient ( 2% b for 1 min ; 2% to 30% b in 55 min ; 30 to 98% b in 15
min ; 98% b for 10 min ; 98% to 2% b in 30 s ; 2% b for 9.5 min ) at 250
nl / min flow rate using an eksigent nanolc ultra loading pump .
aliquots ( 1.5 g ) of the
same acid - extracted histone sample with synthetic peptides were run
on two separate mass spectrometers : a linear ion trap ( ltq velos pro )
and a hybrid linear ion trap
column was used on both instruments ( packed
in - house with 3 m c18 resin ) fitted with a fused silica emitter
with a 10 m tip ( new objective ) .
the sample was loaded using
an eksigent nanolc 2d plus system hplc for the ltq instrument while
a thermo easy nlc 1000 was used to load the samples for the hybrid
ltq - orbitrap instrument .
the same multistep gradient was used for
both instruments , consisting of 2% b for 1 min , 2 to 30% b in 40 min ,
30% to 98% b in 15 min , 98% b for 10 min , with the exception that
the eksigent nanolc gradient had an additional 10 min equilibration
step at 2% b. data acquisition for both instruments was broken into
3 segments , 14 , 26 , and 16 min long , respectively . in the first segment ,
a full
ms was obtained followed by 9 data dependent ms / ms acquisitions
of the top nine most abundant ions from the full ms . in the second
segment , a full
ms was obtained , followed by 5 targeted ms / ms acquisitions
( m / z : 528.30 , 570.84 , 754.93 , 761.94 ,
and 768.95 ) and 5 data dependent ms / ms acquisitions of the top 5 most
abundant ions from the full ms . in the third segment , a full ms was
acquired followed by 10 data dependent ms / ms acquisitions of the top
10 most abundant ions .
all full ms acquisitions for the orbitrap velos
pro were obtained in the orbitrap in profile mode ( resolution : 60,000
at m / z 400 ) , while ms / ms acquisitions
were obtained in the ion trap .
cid fragmentation was used to fragment
ions ( collision energy of 40 , activation q of 0.25 ,
activation time of 10 ms ) .
we used an in - house
developed algorithm to identify and quantify ptms for the ltq - orbitrap
velos pro data , as described in wu et al .
the algorithm uses ms , ms / ms , and retention time information to
accurately identify and provide relative abundances of ptm profiles
for tryptic histone peptides .
relative abundance is obtained by integrating
the single ion chromatogram of a particular modified peptide in all
occupied charge states and dividing it by the total ion current for
that peptide in all of its modified forms .
the relative abundances
of three technical replicates were averaged to obtain the final estimation
of relative abundance .
all ltq data were manually quantified because
they are not compatible with the aforementioned algorithm .
monoisotopic
raw abundance of each peptide was manually extracted from xcalibur
qual browser , based on the area underneath extracted ion chromatograms
at the full ms level .
all detectable charge states were considered ,
typically [ m + h ] , [ m + 2h ] , and [ m + 3h ] as previously described .
the
ltq velos pro mass spectrometer can operate in four different scan
modes that have varying scan rates : turbo , normal , enhanced , and zoom
( rates listed in table 1 ) .
the scan rate affects
several important properties , including reproducibility of peptide
abundance measurements , resolution , and number of scans collected
per run .
the optimal scan mode will vary depending on the specific
application , and , as such , we sought to determine which scan mode
is optimal for histone ptm analysis based on their ability to resolve
doubly and triply charged histone peptides while still allowing for
the maximal number of scans and consistent quantification . to our
knowledge , this study represents the first comprehensive analysis
of different scan modes for histone ptm analysis on a low - resolution
mass spectrometer .
three technical replicates of a single histone
h4 sample were analyzed for this experiment .
the histone sample was
purified from hela cells treated with butyrate , a histone deacetylase
inhibitor , therefore containing more pronounced and combinatorial
acetylation profiles .
the sample was derivatized using our propionic
anhydride methodology as it increases the hydrophobicity of the histone
peptides , allowing for better retention on c18 resin , and also prevents
trypsin cleavage after lysine . to reduce variance due to instrument
setup , the sample replicates were run using identical chromatographic
gradients ( delivered by different hplcs ) and the same analytical column
within 2 days . since small changes in ptm abundances
can have
large biological implications , it is important to run samples for
ptm analysis on an instrument that generates highly reproducible results .
therefore , any observed differences can be attributed to biological
phenomena rather than technical variances . as such , we investigated
the reproducibility of measuring the relative abundances of modifications
for a typical example peptide from histone h4 ( amino acids 417 ;
sequence : gkggkglgkggakr ) , for each scan mode .
relative
abundances were obtained by integrating the single ion chromatogram
( sic ) in ms1 spectra of a particularly modified peptide in all occupied
charge states and normalizing the signal by dividing it by the total
ion current of that peptide in all of its modified forms , as we and
others have performed for many years now .
the
relative abundance values obtained on each scan mode were found to
have a fairly small standard deviation , indicating that each mode
produces highly reproducible abundance measurements ( figure 1 ) .
however , some scan modes produce different relative
peptide abundance measurements compared to the other scan modes , with
turbo scan mode being the most variable .
this variability indicates
that turbo scan mode may lead to inaccuracies in abundance measurements ,
possibly due to the presence of multiple species in a given m / z range that can not be resolved .
the
tri- and tetra - acetylated peptides have larger standard deviations
than the other modified forms of the peptide , which is more common
for low - abundance peptides .
reproducibility of relative peptide abundance
measurements for h4(417aa ) peptides on each ltq velos pro
scan mode .
the relative abundance of each modified form of the peptide
was calculated from three technical replicates of the same purified
h4 sample .
error bars represent standard deviation from average relative
peptide abundances . * p < 0.05 .
both resolution and scan rate are important factors
affecting accuracy in peptide and ptm identification .
obtaining adequate
resolution is vital for identifying and quantifying the ptm profiles
present in a sample .
if the resolution is too low , the charge state
of the peptides can not be determined , and the identity can not be confidently
assigned .
ion trap mass analyzers scan and record the m / z range by increasing the radio frequency ( rf ) voltage applied
to the electrode over time to eject peptide ions of increasing m / z from the trap to be detected .
fast
scan rates result in poor resolution because the ions of a given m / z do not have enough time to fully eject
before the rf increases , causing peak widening .
the resolution obtained in the four different ltq
velos pro scan modes is shown in figure 2a
for an example peptide , diacetylated h4 417 + 2 ( [ m + 2h ] = 761.939 ) .
the fastest scan rate , turbo , is completely
unresolved , and the isotopes can not be distinguished at all .
however ,
the zoom , enhanced , and normal scan modes have sufficient resolution
to reliably assign charge states and are therefore amenable to this
type of analysis . resolution of diacetylated h4 417 on each ltq
velos pro scan mode .
mass spectra of ( a ) doubly charged ( [ m + 2h ] = 761.939 ) and ( b ) triply charged ( [ m + 3h ] = 508.295 ) peptides are displayed . the resolution ( m / m ) of the monoisotopic peak
( c ) resolution of the peptides from panels a and b as a function of
scan rate . as the charge state increases
,
it becomes more difficult to resolve the isotopes of a given peptide .
propionylated tryptic histone peptides generally occupy lower charge
states ( + 1 to + 3 ) .
figure 2b displays the resolution
of the triply charged example peptide ( [ m + 3h ] = 508.295 ) .
zoom and enhanced modes can resolve the charge state , while normal
and turbo scan modes do not fully resolve the peptide .
therefore ,
zoom and enhanced scan modes are better options for histone ptm analysis
on a low - resolution mass spectrometer .
figure 2c illustrates the relationship between scan rate and resolution for
the example peptide in both charge states .
one important note
is that scan rate affects the amount of data that can be collected
during an ms analysis .
zoom has the best resolution , but is also the
slowest scan rate and therefore does not collect as many full ms and
ms / ms spectra as enhanced scan mode ( table 1 ) .
since some modified peptides have low abundances ( e.g. , k18me1 ,
k23me1 ) , it may be advantageous to sacrifice higher resolution for
an increased number of scans .
as such , we recommend using enhanced
mode for analyzing histone ptms as it has sufficient resolution to
resolve isotopes for double and triply charged peptides , allows reproducible
quantification , and allows for almost 20% more ms2 scans compared
to zoom mode .
high - resolution mass analyzers have been at the forefront in histone
ptm analysis , despite the fact that low - resolution mass analyzers
are less expensive and generally more accessible .
one of the main
reasons for using a high - resolution detector is that it can resolve
the mass difference between trimethylation and acetylation modifications
( 42.0470 and 42.0106 da , respectively ) , which occur at high frequency
on histone proteins .
however , it is still possible to differentiate
these ptms on a low - resolution detector using a combination of retention
time and ms / ms information .
furthermore ,
krey et al . demonstrated that the low - resolution ltq and ltq velos
pro mass spectrometers can quantify protein abundance as accurately
as high - resolution orbitrap mass spectrometers over a range of protein
concentrations .
as such , low - resolution
mass analyzers could potentially be useful in analyzing histone ptm
profiles , however to our knowledge no side - by - side comparison between
low- and high - resolution mass analyzers has been published yet for
comprehensive analysis of histones , which contain one of the most
complicated ptm profiles of any eukaryotic protein .
we therefore compared
the performance of the ltq and orbitrap mass analyzers to determine
if low - resolution mass analyzers are adequate for this type of complicated
analysis . to conduct this comparison
, we used a single sample
containing total acid - extracted histones from butyrate - treated hela
cells , which were subsequently propionylated and digested with trypsin .
propionylated ,
heavy isotope - labeled synthetic peptides were spiked
in the hela histone peptides to aid in identification of endogenous
histone peptides during data analysis , as will be described in more
detail later .
we analyzed three technical replicates of this sample
on each instrument and compared the resulting reproducibility of relative
peptide abundance values , resolution , and mass accuracy .
the ltq velos
pro was operated in enhanced scan mode as this was determined to be
optimal for histone ptm analysis .
the runs were conducted within 3
days on the same analytical column , instrument method , and gradient
to reduce differences due to instrument setup .
one drawback
of using the orbitrap velos pro mass analyzer is that the scan rate
is inherently slower than that of the ltq velos pro mass analyzer .
table 2 compares scan rate information for
the ltq velos pro and the orbitrap velos pro .
the scan numbers refer
to the number of scans collected in the first three segments ( see experimental section ) .
the orbitrap velos pro collected
an average of 873 full ms scans and 8,784 ms / ms scans , while the ltq
velos pro collected 1,189 and 11,703 , respectively ( table 2 ) .
thus , while high - resolution detectors allow
for better mass accuracy and consequently more facilitated data analysis ,
low - resolution detectors collect a larger amount of information even
when operated on one of the slowest scan modes .
this trade - off of
reduced accuracy for increased ms and ms / ms scans could be desirable
for the identification and quantification of rare or low - level ptms .
the orbitrap data is based on a 66 min gradient that omits the
final equilibration step ( 2% b for 1 min ; 2% to 30% b in 55 min ; 30
to 98% b in 15 min ; 98% b for 10 min ) at 250 nl / min flow rate using
a thermo easy nanolc hplc . as mentioned previously
, it is important that the instrument used
for ptm analysis generate highly reproducible abundance measurements .
as such , we compared the reproducibility of calculated relative peptide
abundances obtained on the ltq velos pro and the orbitrap velos pro
instruments based on three technical replicates each .
we only analyzed
h3 and h4 because they are the most modified histone proteins and
are therefore the most challenging to analyze .
the results , as shown
in figure 3 , demonstrate that the standard
deviation in relative abundance measurements is very small on both
instruments , and results are very comparable between both instruments
( p = 0.09 ; paired t test comparing
standard deviations between the two instruments ) , indicating that
both instruments are highly reproducible . reproducibility
of relative peptide abundance measurements obtained on the ltq velos
pro and the orbitrap velos pro .
( a , b ) each point represents a particular
modified form of either ( a ) an h3 peptide or ( b ) an h4 peptide , while
the color of the point indicates the identity of the peptide .
the
black line indicates perfect correlation between relative peptide
abundance values on the two instruments . the dashed line is a linear
regression for all data points on the plot ( pearson , ( a ) r = 0.878 , ( b ) r = 0.839
;
spearman , ( a ) r = 0.853 , ( b ) r = 0.883 ) .
the modified peptides shown in the
figure include the following : ( a ) 38 , unmodified , k4me1 ; 917 ,
unmodified , k9me1 , k9me1k14ac , k9me3k14ac , k9me2 , k9me3 , k9 or k14ac ,
k9me2k14ac ; 1826 , unmodified , k18ac or k23ac ; 2740 ,
unmodified , k36me1 , k36me2 , k27me1 , k27me2 , k27me3 , k27me2k36me1 ,
k27me1k36me2 , k27me1k36me3 , k27me1k36me1 ; ( b ) 417 , unmodified ,
monoacetylated , and diacetylated ; 2023 , unmodified , k20me1 ,
k20me2 .
each point represents a particular
modified form of the h3 917 peptide , listed in panel b. the
blue points represent the data before normalization as shown in panel
b , and the red points represent the data after normalization to the
synthetic peptide standards .
the dashed blue line is a linear regression fit of the
data before normalization ( r = 0.579 ) ,
and the red dotted line is a linear regression fit of the data after
normalization ( r = 0.979 ) .
since the same sample was analyzed on both instruments ,
we would expect the calculated relative abundance measurements on
each instrument to be similar .
the results indicate that while in
general this is true , some of these values differ between the two
instruments ( figure 3a , b , as evidenced by deviation
from the black line that indicates perfect correlation ) .
however ,
a linear regression fit to all data points for h3 or h4 peptides demonstrates
a high degree of correlation between the values obtained on each instrument
( pearson , r = 0.878 for h3 and r = 0.834 for h4 ; spearman , r = 0.853 for h3 and r =
0.883 for h4 ) , indicating that the instruments produce highly similar
abundance measurements .
it is also important to note that the measurements
are relative , so an error in the abundance of one modified form of
a peptide affects the relative abundance measurement of all other
forms of that peptide due to the way the data is normalized .
although the correlation of peptide abundance measurements between
the two instruments is relatively high overall , some peptides do not
correlate well .
the peptide with the lowest correlation between instruments
was the h3 917 peptide ( pearson : r = 0.579 ) .
low correlation is likely a result of the major differences
in how the instruments collect data .
there were no common features
between modifications or peptides that did not correlate well .
to
correct for differences in instrument data acquisition , the relative
peptide abundance measurements of the endogenous peptides can be normalized
to those of the synthetic peptide standards , which are present in
equal concentrations . to normalize the data , a normalization factor
was calculated for each form of the peptide by dividing the expected
relative abundance measurements of the synthetic peptides by the observed
relative abundance measurement of the synthetic peptides .
the average
raw abundance values for the endogenous peptides were then multiplied
by the respective normalization factor , and the relative peptide abundances
were calculated from these corrected values .
our group has previously
used this method to correct for differences in ionization efficiencies
between differently modified histone peptides during quantification .
figure 3c plots the relative
abundances of the h3 917 peptides before and after normalization
to the synthetic peptide standards .
after normalization , the abundance
measurements obtained on the two instruments are very highly correlated
( pearson : r = 0.979 ) , indicating that
the ltq velos pro measures histone ptm abundances as accurately as
the orbitrap velos pro .
we calculated the average mass accuracy
of the ltq velos pro and the orbitrap velos pro based on two example
peptides , h3 1826 and h4 417 , in different modified
forms to gauge what mass tolerance can be used to identify peptides .
the mass accuracy for the ltq velos pro ranges from 53.0 to 193 ppm ,
with an average of 129 ppm , and the mass accuracy for the orbitrap
velos pro ranges from 0.00 to 6.62 ppm , with an average of 2.01 ppm
( table 3 ) .
using a mass tolerance of 10 ppm ,
the orbitrap velos pro can differentiate trimethylation and acetylation ,
while the ltq velos pro , using a mass tolerance of 150 ppm , can not ,
as has been noted by others .
this is demonstrated
in figure 4 , which shows the chromatograms
of different modified forms of the histone h3 917 peptide .
for the orbitrap velos pro ,
the trimethylated and acetylated peptide
( row 4 and 5 , respectively ) have a large enough mass difference under
the given mass tolerance to be unequivocally assigned to the single
peak , while the ltq velos pro can not resolve these peptides .
the resolution
of the ltq velos pro is high enough to differentiate all of the other
common ptms , such as mono- and dimethylation and multiply modified
peptides such as k9me1k14ac ( figure 4 , rows
13 ) .
chromatographic information
for h3 917 obtained on ltq velos pro or ltq - orbitrap velos
pro .
the mass tolerance used for selection is 150 ppm for the ltq
velos pro and 10 ppm for the ltq - orbitrap velos pro . in each row ,
labeled 1 to 7 , the mass of the peptide bearing a specific modification
was specified .
rows 1 to 5 represent endogenous peptides while rows
6 and 7 represent heavy - labeled synthetic peptides .
the acetylated and trimethylated peptides can still
be distinguished on the ltq , however , by using relative retention
time information and high - resolution ms / ms data as has been noted
by the freitas group .
however , this group
did not derivatize their samples with propionic anhydride and did
not use this technique to quantify peptides , and so we decided to
apply this method to quantify histone ptms for the instrument comparison .
synthetic peptides eliminate the need to perform high - resolution ms
to validate peak assignments .
the retention time of acetylated peptides
is later than their corresponding methylated peptides because acetyl
groups are more hydrophobic than trimethyl groups ( figure 4 , row 4 versus 5 ) .
since
the peptides are propionylated in this study , the di- and trimethylated
peptides are more hydrophilic than the unmodified peptide .
di- and
trimethylation prevent propionylation so k9 is propionylated in the
unmodified peptide and is not propionylated in the di- and trimethylated
peptides
. since propionyl groups are more hydrophobic than di- and
trimethylation , the unmodified peptide is more hydrophobic and elutes
later ( figure 4 , row 3 and 4 compared to 1 ) .
heavy - labeled synthetic peptides bearing a trimethyl or acetyl
group at the residue of interest can also be used to validate peak
assignments .
similar methods have been described by others , but there
have been no studies using heavy - labeled synthetic peptides to differentiate
nearly isobaric ptms .
the synthetic peptides have the same retention time as the unlabeled
endogenous histone peptides containing the same modifications , as c or n isotopes do not influence retention on
c18 columns , but impart a unique mass . therefore , we can determine which ambiguous peak contains a trimethylated
or acetylated peptide by seeing which coelutes with the synthetic
peptide bearing the respective modification .
in figure 4 , synthetic peptides were used to differentiate trimethylated
and acetylated peptides .
rows 6 and 7 show the chromatograms for the
h3 917 synthetic peptides bearing k9me3 or k14ac , respectively .
the k14ac synthetic peptide ( row 7 ) elutes under the k14ac peptide
peak in the endogenous trace ( row 5 ) , and the k9me3 synthetic peptide
( row 6 ) elutes under the corresponding k9me3 peak in the endogenous
trace ( row 4 ) .
therefore , low - resolution detectors can be used to
accurately quantify and identify histone ptm profiles when supplemented
with synthetic peptides .
the results of the current study show
for the first time that low - resolution mass analyzers , such as the
ltq velos pro , are adequate for comprehensive ptm analysis although
the data analysis is more easily facilitated on high - resolution instruments .
the reproducibility of obtained relative peptide abundances is equally
high on the ltq velos pro as the orbitrap velos pro .
although the
ltq velos pro is not able to resolve the small mass difference between
acetylation and trimethylation , other orthogonal lines of evidence
can be used to accurately identify the peak containing each modified
peptide . as such
, high - resolution does not seem to be absolutely required
for histone ptm analysis . | mass
spectrometry ( ms ) is a powerful tool to accurately identify and quantify
histone post - translational modifications ( ptms ) .
high - resolution mass
analyzers have been regarded as essential for these ptm analyses because
the mass accuracy afforded is sufficient to differentiate trimethylation
versus acetylation ( 42.0470 and 42.0106 da , respectively ) , whereas
lower - resolution mass analyzers can not . noting this limitation
, we
sought to determine whether lower - resolution detectors are nonetheless
adequate for histone ptm analysis by comparing the low - resolution
ltq velos pro with the high - resolution ltq - orbitrap velos pro .
we
first determined that the optimal scan mode on the ltq velos pro is
the enhanced scan mode with respect to apparent resolution , number
of ms and ms / ms scans per run , and reproducibility of label - free quantifications .
we next compared the performance of the ltq velos pro to the ltq - orbitrap
velos pro using the same criteria for comparison , and we found that
the main difference is that the ltq - orbitrap velos pro is able to
resolve the difference between acetylation and trimethylation while
the ltq velos pro can not .
however , using heavy isotope labeled synthetic
peptide standards and retention time information enables confident
assignment of these modifications and comparable quantification between
the instruments .
therefore , lower - resolution instruments can confidently
be utilized for histone ptm analysis . |
according to global initiative for asthma ( gina ) guideline , patient who do not reach an acceptable level of control with highest possible step four treatment , i.e. , high dose inhaled corticosteroids ( ics ) , inhaled long acting beta2 agonist ( laba ) , montelukast , and oral sustained release theophylline , can be considered to have difficult - to - treat asthma .
incorrect diagnosis , non - compliance and incorrect technique of inhalation are most common causes for persistent uncontrolled asthma
classical presentation makes the diagnosis of abpa easy , but atypical clinicoradiological presentation makes the confusion .
the prevalence of abpa in an asthmatic population is probably between 1 - 2% and as high as 14% in corticosteroid dependent asthma .
a 28-year - old nonsmoker , male office worker , presented with persistent cough with scanty , mucoid expectoration and gradually progressive breathlessness for last two years .
past history revealed that since childhood he was suffering from recurrent cough and cold , nasal itching , and obstruction , especially in summer .
therefore , the patient was diagnosed as having asthma and medium dose ics plus inhaled laba was advised . despite adequate compliance and correct inhaler technique ,
his asthma was uncontrolled ; inhaled salbutamol was taken more than twice a week . on general survey at presentation , only mild pallor was seen .
his respiratory rate was 24 breaths / minute , and pulse rate 120 beats / minutes .
there were bilateral hyperresonant percussion note , diminished vesicular breath sound , and bilateral crackles with occasional wheezing .
chest x - ray ( cxr ) , posteroanterior view showed bilateral hyperinflated lung with reticular shadows .
spirometry in our institution showed mixed pattern with partial reversibility to inhaled salbutamol , although his effort was not adequate .
the patient was advised high dose ics , inhaled laba , and once daily 10 mg montelukast , and the treatment was gradually stepped up by addition once daily 400 mg sustained release theophylline within two months , as his symptoms were not under control .
we also advised once daily 40 mg esomeprazole and 30 mg sustained release domperidone , and once daily mometasone nasal spray ( two sprays in each nostril ) .
high resolution computed tomogram ( hrct ) of thorax revealed bilateral reticulonodular pattern with patchy consolodation [ figure 1 ] .
further investigations showed total serum immunoglobulin e ( ige ) level was 1979.1 u / l and aspergillus fumigatus specific serum ige was positive ( 1.39 u / l ) .
the diagnosis of abpa was suggested , although diagnosis was confused with diffuse parenchymal lung disease ( dpld ) due to atypical presentation and hrct pattern .
oral prednisolone at dose of 0.5 mg / kg / day along with oral itraconazole 200 mg twice daily was added .
oral prednisolone after six weeks was tapered off at the rate of 5 mg / week over six weeks .
itraconazole was continued as 200 mg twice daily for eight weeks , then 200 mg once daily for another eight weeks . on six month
first confirmation of the diagnosis of asthma , then identification of the cause of the persisting symptoms , assessment of adherence with therapy and technique of inhalation therapy should be done .
lastly physician should search for alternative etiology of asthma like symptoms , and definitely abpa is an important differential diagnosis for difficult - to - treat asthma .
because of this hypersensitivity , eosinophilic infiltration of the lung parenchyma , bronchial wall and mucus plugging of the bronchi occur , which manifest as eosinophilic pneumonia , bronchiectasis , asthma like symptoms and subsequent fibrosis . aspergillus after entering the airway releases gliotoxin , which causes epithelial damage and cilliary dysfunction .
after that , it colonizes within the airways by adhering with fibronectin of extracellular matrix .
type i response leads to increased level of non - specific and aspergillus specific ige .
type iii reaction results in high level of both total and aspergillus specific igg and iga .
there are eight major criteria like asthma , fleeting pneumonia , positive aspergillin skin test , eosinophilia , precipitin antibodies in serum , serum ige level > 1000 mg / ml , central bronchiectasis on hrct thorax , presence of aspergillus fumigates specific igg and ige antibodies in serum , and three minor criteria like presence of aspergillus hyphae in sputum , expectoration of black mucus plug , and delayed skin reaction to aspergillus antigen for the diagnosis of abpa . these criteria may not be evident during remission or in fibrotic stage .
abpa is divided into five stages , stage i - acute , stage ii - remission , stage iii - exacerbation , stage iv - corticosteroid dependent asthma , stage v- fibrotic end stage disease .
important hrct findings are fleeting pneumonia in upper lobe , central bronchiectasis , and endobronchial mucus plugging
. acute exacerbation of abpa can be treated with oral prednisolone , and itraconazole along with step 4 management of gina guideline .
oral prednisolone may be continued till good clinical response , radiological clearing of the shadows and a significant fall in the ige level is achieved .
classical presentation of abpa in difficult - to - treat asthma makes its diagnosis easy . in our case , due to irregular therapy
, classical symptoms of asthma were altered and an irreversible component of airway obstruction was developed .
classical hrct features of abpa like fleeting pneumonia , and central bronchiectasis were absent in our case , whereas bilateral reticulonodular shadows confused us with the diagnosis of dpld .
but , persistent peripheral blood eosinophilia gave the initial clue for the diagnosis of abpa , which was confirmed by high level of total and aspergillus specific ige , positive aspergillin skin test , and eosinophil predominance on bal fluid study .
therefore , the dose of steroid should not be increased inadvertently , rather should search for the abpa in case of difficult - to - treat asthma , if compliance and correct inhaler technique are ensured . | allergic bronchopulmonary aspergillosis ( abpa ) commonly presents with persistently uncontrolled asthma , despite of the therapy with highest possible anti asthma medications .
most common cause of abpa is aspergillus fumigates .
hence , abpa is one of the important differential diagnoses of difficult - to - treat asthma .
atypical presentation of abpa misleads the diagnosis and asthma remains uncontrolled .
here we present such a case of 28-year - old non smoker , normotensive male office worker who presented with persistent cough with scanty white , mucoid expectoration and gradually progressive breathlessness with bilateral crackles for last two years .
diagnosis of asthma was made based on clinical evidences and spirometry .
anti
asthma treatment was started and gradually stepped up .
further evaluation was done due to lack of clinical improvement , and diagnosis of abpa was made from bilateral reticulonodular lesions on hrct thorax , increased levels of serum ige and aspergillus fumigates specific ige , and positive aspergillin skin test .
oral prednisolone and itraconazole were started with anti asthma medications . |
considerations of suicidality as a phenomenon developing along a continuum arose several decades ago as an opposition to - at the time conventional - static medical models , which focused mainly on completed suicides with little or no attention to the events and processes that lead to these deaths . among others ,
mikawa and paykel et al . called for a new , process - oriented definition of suicidal behaviour that reflected the dynamic interactions of environmental and personal factors . since then
, it has become a widely accepted model of suicidality , reflected in a wealth of research studies based on these conceptualisations . within the new definition ,
suicide became conceptualised as a process or a continuum of ideations / behaviours developing from mild to more severe forms of suicidality , most often including the following stages : suicidal ideation , suicide plan , suicide attempt , and completed suicide . in recent years
for example , suicidal ideation refers to cognitions that can vary from transient thoughts about the worthlessness of life and death wishes to concrete plans for killing oneself and obsessive preoccupation with self - destruction .
thus , silverman and colleagues suggested the following division of suicide ideation based on the severity of the subject 's intent to die : the casual , transient , passive , active , and/or persistent thoughts of suicide .
additionally , several authors differentiate between planned and unplanned - or impulsive - suicide attempts .
internationally , there is a growing body of work investigating the prevalence of suicidal ideations and/or attempts in large population cohorts , providing reliable accounts of the dimensions of these phenomena .
however , the nature of transitions between these stages remains poorly understood , as only a limited number of studies to date have investigated temporal links between suicidal features of different severity . in particular , there is scarcity of epidemiological studies with longitudinal designs that would allow for follow - up of developments of suicidality in subjects expressing suicide - related thoughts at the first assessment .
firstly , we will describe different models of risk factors that contribute to individual 's vulnerability for development of suicide - related outcomes .
secondly , we will present findings of a few prominent studies which assessed the prevalence of persons in the general population experiencing specific stages on the continuum of suicidality .
thirdly , we will summarise available empirical knowledge on the determinants of transition along the suicidal continuum ( escalation from suicidal thoughts to attempted or completed suicide ) .
lastly , we discuss the clinical implications of these concepts from the standpoint of suicide prevention .
suicide is not simply a reaction to a time - limited crisis , but involves the individual 's entire life experience , including his sociocultural milieu ( maris rw , 1981 ) .
the quote above is taken from a landmark work by ronald w. maris , entitled pathways to suicide : a survey of self - destructive behaviours ( 1981 ) .
while three decades have passed since the release of his theory , it remains one of the most comprehensive biopsycho - social models explaining risk factors for suicide .
the central idea of maris ' work is the concept of a suicidal career , stating that suicide can never be completely explained by acute , situational factors ; instead , it develops over time and against certain social , psychological and genetic conditions .
the model was developed based on the results of a large case - control study of 266 cases of completed suicide , investigating the role of a wide range of predictors of suicidal outcomes covering the entire life span ( separated into individuals ' background , early life , mid - life and late - life ) .
, recognises any suicidal outcome as a complex and interactive effect of many inter - related factors .
the four main domains involved in the development of suicidality include : psychiatric , biological , psychological and social circumstances .
over the course of development of one 's suicidality , a variety of predisposing factors influences its escalation , such as age , sex , race , history of psychiatric illness in parents , and broader social environments ( either stimulating or destructive ) .
particular risk factors , that determine the transition from trait suicidality towards heightened risks for completed suicide , include : mental disorders ( in particular affective , anxiety / panic and personality disorders ) , alcohol and drug abuse , inadequate social support , impulsivity and cognitive rigidity , and work - related problems .
however , harmful effects of these factors can be countered by protective influences of physical and mental health , social integration and good coping skills . as a next stage in the proposed model , a vulnerable individual enters into an acute suicidal crisis or a suicide zone , which represents a convergence of multiple risk and protective factors that temporarily , yet significantly , increase the risk for suicide - related outcome .
authors maintain that the precipitating events , which seemingly trigger or aggravate completed suicidal acts , are rarely a single negative life event or stressor .
rather , they represent a gradual accumulation of many interactive risk factors , increasing one 's vulnerability over a long time .
an additional concept introduced by this model is the feedback loop , suggesting that those in the suicide zone who do not complete suicide , often either cycle back to a stage of increased vulnerability for eventual suicide at a later stage , or alternatively develop greater resilience through protective factors and thus interrupt the progression of their suicidal career .
the stress - diathesis model of suicide risk conceptualises risk factors as either distal or proximal .
distal risk factors are background characteristics or underlying vulnerabilities that heighten a person 's risk for suicide anytime in life and include developmental , personality , biological , and genetic variables , along with impulsive - aggressive personality traits .
distal risk factors affect the threshold for suicide and increase an individual 's risk when faced with proximal risk factors , which are more immediate antecedent to the suicidal event itself , and may include life events , stress , acute intoxication , etc
. the specificity of risk factors may be less important than their cumulative burden on a vulnerable individual .
the complex contributions and interactions among risk and protective suicide factors reflect fluid processes that change with time and individual experience ( as is evident in the previously described model by maris et al . ) .
risk and protective factors can be further distinguished in internal and external , based on whether they originate from an individual or the environment .
acquiring an accurate picture of the prevalence of these phenomena is difficult , since information on suicide ideations and plans can not be collected in any routine fashion . for observation of transitions in specific stages of suicidal behavior
, frequent serial data would need to be obtained but that would represent technically an extremely challenging enterprise , even in clinical populations .
data on suicide attempts can be obtained through records of hospitalizations and presentations to emergency departments ; however , it is a well - known fact that the majority of people who engage in non - fatal self - harming acts do not seek medical attention in its aftermath . in australia , for example ,
data on hospitalizations for suicide attempts exist but they are event based , not person - based , which further hinders the elaboration of population - based rates . therefore , the optimal way of gauging the exact dimensions of prevalence of suicidal thoughts , plans and attempts is through large epidemiological community surveys . international literature offers a reasonable number of such studies , and we here present findings from a few of them . in 2005 ,
bertolote and colleagues published data from the largest international study on suicidal behaviour conducted to date : the who multisite intervention study on suicidal behaviour ( supre - miss ) . in this study , community surveys were distributed to about 70,000 respondents in 10 countries , enquiring - among others - about the lifetime prevalence of suicide ideation , plans and attempts .
results varied significantly across sites : prevalence of suicide ideation ranged between 2.6 and 25.4% , plans between 1.1 and 15.6% , and suicide attempts between 0.4 and 4.2% .
another international survey , conducted in 17 developed and developing countries , yielded lifetime prevalence for suicide ideation of 9.2% , 3.1% for suicide plans and 2.7% for suicide attempts .
one of the largest community surveys ever performed in a single country was carried out by de leo et al . in 2005 : results of this study are presented in table 1 , along with results of two australian national surveys of mental health and wellbeing ( nsmhwb ) .
table 1lifetime prevalence of suicide ideation , plan and attempts in australian general population.de leo et al .
. 2009surveysupre - missnsmhwbnsmhwbsample11,57210,6418841life weariness ( % ) * 21.1n / an / asuicide ideation ( % ) 10.416.013.3suicide plan ( % ) 4.4n / a4.0suicide attempt ( % ) 4.23.63.2supre-miss , world health organization multisite intervention study on suicidal behaviour ; nsmhwb , australian national surveys of mental health and wellbeing ; n / a , not assessed.*have you ever thought life s not worth living?have you ever seriously thought about committing suicide ?
supre - miss , world health organization multisite intervention study on suicidal behaviour ; nsmhwb , australian national surveys of mental health and wellbeing ; n / a , not assessed .
these occurred among 2.3% , 0.6% and 0.4% of the population , respectively . compared to results of the nsmhwb survey conducted in 2000
, the 12-month prevalence of suicide ideation seems to have declined by 1.1% , while rate of attempts stayed unchanged .
existing literature provides evidence for the fact that suicidality develops along a continuum ranging from less severe forms ( thoughts of death or suicide ideation ) to most severe expressions of the intent to die ( serious suicide attempts or completed suicides ) .
however , the particularities of transitions through these stages remain insufficiently understood due to the scarcity of methodologically sound ( in particular prospective ) studies examining the development of different suicide - related phenomena .
one key - study on the development of suicidality over time was performed by kessler et al .
this epidemiological cross - sectional study was the first to measure the likelihood of transitioning between different stages of suicidality ; authors reported that 34% suicide ideators progress to developing a suicide plan , 72% progress from having a suicide plan to an attempt , and 26% from ideation to an unplanned attempt .
risk for these progressions is highest in the first year following onset of the prior condition .
this observation was replicated in a study conducted in metropolitan china , which also reported comparable conditional probabilities among ideators to develop a suicide plan ( 29% ) or make a suicide attempt ( 32% ) - the latter risk was higher for ideators with a plan than those engaging in impulsive attempts .
however , australian data suggest that only 12% of ideators progress to making a suicide attempt . a review of studies that have reported the ratios of ideation to attempt has shown these to vary between 4:1 and 13:1 .
the proportion of ideators who complete suicide is even smaller , estimated to be somewhere between 1:100 and 1:2000 . in a survival analysis of suicide risk in a cohort of 1573 suicide attempters , followed for 5 years by nordstrom and colleagues , the suicide mortality was 6% - almost twice as prevalent among the males as in females - with the highest risk observed during the first year .
it is apparent that suicidal ideation is considerably greater , in terms of incidence and prevalence , than suicide attempts .
this has led some authors to question the relevance of these thoughts in predicting the risks for development of more progressed expressions of suicidality . however , there is some support for the fact that suicidal thinking in adolescence , even of an ostensibly low severity , predicts suicidal ideation and attempts in adulthood .
similar results were obtained from clinical cohorts , demonstrating that even mild suicidal ideation can lead to progressively more frequent and lethal risk behaviours .
while only a fraction of suicide ideators proceed to attempted or completed suicide , it is generally believed that majority of attempters and completers experience suicidal ideation and develop a suicide plan before engaging in self - harming acts . indeed ,
in the already quoted community survey conducted in australia , only 0.8% of participating suicide attempters reported the absence of previous suicidal ideation . among older adolescents with a history of suicide attempts , proportion of respondents who also evidenced suicidal ideation
in contrast , international literature provides several accounts of attempted and completed suicides , particularly in young people , which do not involve a progression in stages of suicidality .
for example , hoberman and garfinkel found that in a sample of 229 cases of completed suicides among adolescents , only 28% evidenced a plan to commit suicide , while definite preparation for death was apparent in only 8% of suicides .
similar results were provided by hall and colleagues , who interviewed 100 patients hospitalised after a serious suicide attempt .
authors found that only 29 of these patients reported having persistent and serious suicidal thoughts prior to their attempt , while 69 had only fleeting thoughts of suicide or no suicidal thoughts at all .
in estonia , 28% of suicide attempters did not indicate to have ever had thoughts about committing suicide or to ever have made a plan .
findings presented above demonstrate that while suicidal thoughts may be frequent , they are by no means definite motivators for attempted and completed suicides .
so what factors distinguish between ideators who act on their suicidal thoughts from those who do not ? as has been noted by brezo et al . , to increase the specificity and predictive value in identifying individuals at risk for more serious suicidal behaviours , it is important to consider the properties of suicidal thoughts themselves but also the presence of other contributing factors .
marusic and farmer proposed that all stages of suicidal behaviours , as well as transitions between these stages , are influenced by genetic and environmental influences and their reciprocal interactions .
an example of the interactions between genes and environment on the development of passive suicide ideation is the observation that individuals genetically predisposed to depression may themselves seek high - risk environments where an occurrence of threatening events is more likely .
alternatively , depression - prone persons may view the environment as more hostile and threatening than the average person .
in addition , authors introduce traits of impulsivity and aggression , both also influenced by genetic proneness and ( unfavourable ) environmental circumstances , as key factors determining the fatality of an attempted suicide .
approximately two - thirds ( 66% ) of people who have seriously considered killing themselves report having a prior psychiatric disorder ; this percentage is even higher among persons who go on to make a suicide plan ( 77% ) or suicide attempt ( 80% ) .
history of mental disorders is higher among respondents who make a planned attempt ( 83% ) compared to an unplanned attempt ( 74% ) , suggesting that the latter may be influenced to a greater extent by other factors , such as stressful life events . despite these recent findings ,
some epidemiological studies suggest that mental disorders predict the onset of suicide ideation , but may have weaker effects in predicting suicide plans or attempts among people with suicide ideation .
it has also been reported that depression predicts suicide ideation , but not suicide plans or attempts among those with ideation .
instead , disorders characterized by severe anxiety / agitation ( e.g. post - traumatic stress disorder ) and poor impulse - control ( e.g. conduct disorder , substance disorders ) offer more accurate predictions into which suicide ideators go on to make a plan or attempt .
an additional factor marking the progress from suicide ideators to suicide attempters has been found to be unemployment , while the investigation of traumatising events on escalation of suicidality has yet not yielded any conclusive evidence .
the above mentioned large community survey , conducted in australia , aimed to explore whether suicidal behaviour develops along a continuum of progressively ascending severity or it fluctuates in its intensity .
respondents with a lifetime history of suicide plan or attempt were presented with a visual image ( figure 1 ) , which depicted two possible scenarios detailing the development of suicidal thoughts and behaviours over time : a continuum hypothesis ( presented as orange line ) and a fluctuating hypothesis ( presented as blue line ) .
subjects were asked to select which of the two patterns of suicidality depicted in the figure best approximated their own experience .
results showed that only 20.0% of suicide planners and attempters reported their suicidal process to be developing continuously in severity over an extended period of time .
in contrast , 57.1% of participants declared that their suicidal process was not continuous , but rather fluctuated irregularly before they attempted suicide or were close to attempting suicide .
no significant predictors of the respondents ' declarations were found . a further aim of the same study was to assess if individuals experience all levels of suicidal ideation and behaviour leading up to their highest reported level .
data showed that only 53% of participants presented all levels of suicidal ideation preceding the one with the highest severity .
individuals who had a diagnosis of depression prior to their suicidal behaviour , and reported that their act was not an impulsive one , were five times more likely to have experienced all the hypothetical stages of the suicidal process that their counterparts . a study performed in iran by ghazinour et al . also asked participating suicide attempters if prior to their attempt they had experienced the following suicide - related thoughts with a steadily increasing severity : life weariness , death thoughts , death wishes , and suicide ideation .
only 20% of individuals reported they had experienced all these thoughts , which adds further support to the notion that the course of suicidal ideation and suicidal attempts is rarely continuous .
in fact , non - fatal suicidal behaviour is the strongest known clinical predictor of eventual suicide .
however , the question remains whether this relationship is non - spurious and possibly even causal , or is it accounted for by a set of third variables , such as enduring predispositions or various clinical conditions .
findings from studies comparing characteristics of persons who attempt or complete suicides are suggesting that these relationships may not be adequately explained by overlapping risk factors for the two acts . on the other hand , several authors are arguing the existence of causal links between suicidal features of different severity .
this view has been supported by post et al . , who first noticed that in depressed patients , the first episode of depression is more strongly connected to precipitating adverse life circumstances than later recurring episodes .
similarly , beck theorised that previous suicidal experience sensitises suicide - related thoughts and behaviours and leads to the development of a suicidal mode .
the more active these schemas and modes become ( through the repetition of suicidal thoughts of actions ) , the more easily they are triggered ( even in the absence of negative events ) , and the more severe are the subsequent suicidal episodes .
recently , neurological studies have provided further evidence for this concept by demonstrating that suicidal behaviour is a state - based condition stored in neural circuitry that can be quickly switched on by the recall of an experience of mental pain .
joiner concurs that initial suicidal behaviour sets processes into motion that spur later suicidal behaviours .
he proposed two psychological processes explaining the link between past and future suicidal behaviour : cognitive sensitization and opponent processes .
while the former aligns with becks ' cognitive theory ( described above ) , the latter means that with repetition of suicidal behaviour , the painful and fear - inducing qualities of suicidality diminish , and opponent processes ( e.g. calming and pain - relieving effects ) may intensify .
indeed , obvious precipitating recent life events have been reported more frequently by first - ever than repeat self - harmers . however , this hypothesis has yet not been directly examined and prospective evidence is lacking .
a handful of studies to date have explored factors that help ameliorate suicidal thoughts over time .
a study investigating persistence of suicidal ideation in a sample of finnish subjects from the general population reported that 31% males and 41% females having suicidal thoughts at baseline assessment had stopped experiencing them 12 months later .
a similar survey , performed in great britain , found that among 2.3% of adults that reported experiencing suicidal thoughts in the last year , 57% had recovered by the 18-month follow - up interview .
recovery was more likely in women and in those aged below 25 years or over 65 years .
further , improvement was strongly associated with absence of psychiatric illness , and favourable social and economic circumstances .
a somewhat surprising discovery by these authors was that persons receiving antidepressants or counselling or who were in contact with health care professionals in the period between baseline and follow - up assessments , were in fact less likely to recover from suicidal thoughts .
results of these studies suggest that the course of suicidality is not necessarily chronic , as only a minority of suicidal thought develop over time with progressively increasing severity .
an interesting observation has been derived from a study conducted in iranian kurds , where a much wider gap was noticed between occurrence of suicidal thoughts of any kind and frequency of suicide attempts , compared to other countries .
authors proposed that at the higher stages of the suicidal behaviour continuum , religious , cultural and societal norms might disrupt the transition along the continuum , acting as a barrier to acting on suicidal impulses .
observations that the evolution from thoughts to plans and attempts is influenced by the specific cultural settings has been confirmed in a large international study by the world health organization , suggesting the need for development of different , site - specific approaches to suicide prevention .
an understanding of the transitions between less severe manifestations of suicidality ( i.e. suicide ideation ) to fatal or non - fatal suicidal acts has huge practical implications for timely identification of persons at risk and development of targeted suicide prevention strategies .
this is especially important for clinical purposes , as clinicians are often faced with the task of determining the likelihood that a patient with suicide ideation will subsequently engage in a fatal or non - fatal suicidal act , so they can intervene at early stages of these dangerous trajectories .
however , empirical knowledge on this topic remains so poor that it is practically impossible to predict the development of more severe stages of suicidality based on individual 's reports of suicide ideation , even in combination with a plethora of other well - recognised risk factors for suicide .
the idea of a continuum seems to apply only to certain cases ( possibly long - lasting / chronic depression sufferers ) , which may not represent the majority of suicidal subjects . if this were true ( but further research should confirm it ) , this would have important implication for both detection and prevention of suicide .
for example , excessive reliance on screening programs for suicidality might bring to remarkable underestimation of risk , so that what is not captured today could be present tomorrow . from this point of view
, detection of depressive symptomatology would seem to be more reliable in predicting future risks , even if straight comparisons by the two screening targets have never been directly presented in the literature .
in addition , the absence of present suicidality or the denial of it can easily become the justification for reduced vigilance , even in persons of demonstrated suicidal potential and/or history of past suicidal behaviour .
one such segment of population that warrants maximum prudence are psychiatric patients upon discharge from the hospital when they might be disguising their determination to suicide in order to avoid preventative efforts .
this , and several other reasons previously noted in existing literature , contributes to very high rates of suicide among post - discharge patients .
monitoring of suicidal ideation / behaviour should therefore not rely heavily on such denials , yet still too often recording the absence of a suicide plan at discharge satisfies clinicians . while such actions put them on a safe shore from a medico - legal perspective
nevertheless , despite our inability to predict who will die by suicide , there are a number of clinical features that are , at the very least , statistically associated with subsequent suicide .
past suicidal thoughts and/or acts are undoubtedly the strongest of such features , and any person presenting with thoughts of suicide , especially if they are persistent and involve a strong intent to die , warrants immediate and constant professional attention . | the idea of a progression in suicide phenomena , from death wishes to suicide attempts and completed suicides , is quite old and widely present in literature .
this model of interpreting suicidality has great relevance in preventative approaches , since it gives the opportunity of intercepting suicidal trajectories at several different stages .
however , this may not be the case for many situations , and the hypothesis of a continuum can be true only in a limited number of cases , probably embedded with a specific psychopathological scenario ( e.g. depression ) and with a frequency that should not permit generalisations .
this paper reviews the available evidence about the existence and validity of this construct , and discusses its practical implications . |
cardiovascular disorders are one of the the leading causes of mortality and morbidity today all over the world .
they are endemic , and have been seen to increasingly affect a considerable number of people .
they are also responsible for a major financial burden on the community and cause healthcare expenses .
although ischemic heart disease can be seen in different age groups , usually it is a disease of the aging population in whom related or un - related systemic disorders may also co - exist . on the other hand , other than the well known risk factors such as genetic inheritance , hyperlipidemia , cigarette smoking etc
, it is well known that some of these co - existing systemic medical problems may also presdispose to coronary artery disease .
it is characterized with deposition of crystals of monosodium urate due to the increased circulating levels of uric acid in the blood .
literature includes scant reports about the co - existance of gout arthritis and ischemic heart disease , or hyperuricemia related coronary artery disease.[1313 ] in this report , we present pre- , peri- , and post - operative strategies in a 63-year - old male patient with the history of gout disease , and who underwent a successful surgical treatment for coronary artery disease .
the patient was a 63-year - old white turkish male living in istanbul , turkey who presented to the clinic with increasing chest pain on exertion , which had progressed in the last six months .
he had been a smoker for more than 45 years , and on an average smoked 1 - 1.5 packs per day .
he was not hypertensive ( blood pressure of 128/76 mmhg on left arm and 132/77 mmhg on right arm at rest ) and did not have diabetes mellitus ( overnight fasting blood glucose of 98 mg / dl , normal range : < 100 mg / dl ) .
blood lipid profile indicated total cholesterol and low density lipoprotein levels of 193 mg / dl ( normal range : < 200 mg / dl ) and 124 mg / dl ( normal range : < 130mg / dl ) , respectively .
cardiologic check up protocol was considered and the patient underwent stress electrocardiography which resulted positive .
myocardial thallium perfusion scintigraphy indicated ischemic zones at the inferior , inferolateral and inferoapical zones of the heart . according to the results ,
coronary angiography was performed and it revealed triple vessel disease with subtotal occlusion of left anterior descending artery ( lad ) at the midportion , midportion 80% stenosis at the circumflex coronary artery ( cx ) and 70% stenosis at the right coronary artery ( rca ) .
echocardiography was normal with preserved left ventricular functions ( 65% ejection fraction ) and left ventricular hypertrophy . following the consent of the patient , coronary artery bypass grafting ( cabg ) was planned . during the preparatory phase for surgery , the patient complained of acute first toe pain .
laboratory findings including complete blood count , blood lipid profile , renal and hepatic enzymes , clotting times , were normal except increased serum uric acid levels ( 10.74 mg / dl , normal : 3.4 - 7 mg / dl ) and slighly elevated c - reactive protein ( 6.72 mg / l , normal : 0 - 5 mg / l ) .
he was prescribed allopurinol 300 mg twice daily and scheduled for surgery when the circulating uric acid levels returned to normal . following four days of treatment
, uric acid levels returned to normal limits , and he underwent triple vessel cabg ( left internal mammarian artery to lad , aorta - first obtuse marginal artery and aorta - posterior descending branch of the right coronary artery bypasses with separate saphenous veins ) with the use of cardiopulmonary bypass on arrested heart at 33 - 34c .
cross clamp and cardiopulmonary bypasses were 35 minutes and 47 minutes , respectively . after the operation ,
the patient was transferred to the intensive care unit and extubated there on the post - operative 4 hour .
he was taken to the ward the next day and discharged on the 6th day .
blood and blood product usage was 1 units of erythrocyte suspension and 2 units of fresh frozen plasma in total . immediately after the surgery
, there was a slight increase in serum uric acid levels ( 7.4 mg / dl ) detected in the blood drawn in the intensive care unit .
as soon as the patient was extubated and oral intake was started , allopurinol was initiated at the same pre - operative dosage , and this returned the serum uric acid levels to normal .
he has been followed symptom free for more than 9 months and is on allopurinol treatment in addition to anti - aggregant ( aspirin , 100 mg daily ) , anti - lipidemic ( atorvastatin , 20 mg daily ) and low dose beta - blocker ( metoprolol 25 mg daily ) medications and a low calori diet .
coronary artery disease is the leading cause of mortality and morbidity worldwide in the current decade . with the advances in medical knowledge about the different pathophysiologic events leading to ischemic heart disease , diagnostic methods and treatment strategies , various therapeutic measures are now - a - day performed to prevent , diagnose , treat and obtain deeper knowledge about the disease .
it is very well known that there are certain risk factors such as genetic susceptibility , hypertension , hyperlipidemia , smoking , and diabetes mellitus , which may predispose an individual to coronary artery disease .
additionally , hyperhomocysteinemia and metabolic syndromes have been identified as other risk factors for the disease as well as predictors of the success of the treatment and survival of the patients .
recently , elevated serum uric acid level is identified as an independent risk factor for cardiovascular diseases.[1313 ] several prospective studies have shown an association between hyperuricemia and cardiovascular diseases and death.[1571011 ] in our case , the patient only had smoking as a major cardiovarcular risk factor , and otherwise he was not hypertensive , hyperlipidemic , or diabetic , and did not define positive family history .
we may speculate that in addition to the over 45 years of cigarettes smoking history , increased serum uric acid levels might have increased the risk of coronary artery disease or have exacerbated the symptoms of the patient in our case study .
gout is a kind of acute inflammatory arthritis , and characterized by recurrent painful attacks . in more than half of the patients ,
the metatarsophalangeal joint is the most commonly affected region as well as the presenting symptom of the patients in the clinic .
the pathology is caused by the crystalization , accumulation and deposition of elevated levels of uric acid of monosorium urate character in the blood , at the joints , tendons , cartilages , and the surrounding tissues .
additionally , the disease may also present as tophi , kidney stones , or urate nephropathy .
it has been shown that chronic inflammatory disorders such as systemic lupus erythematosus , rheumatiod arthritis , ankylosing spondilitis , diabetes mellitus , etc are associated with shorter life expectancy in affected individuals as compared to the general population . on the other hand ,
hyperuricemia is associated with reduced survival due to increased tendency to obesity , hypertension , insulin resistance , diuretic usage and renal disease . the national health and nutrition examination survey
i follow - up study reported that serum uric acid was an independent predictor of cardiovascular mortality in subjects above 45 years of age regardless of race , menopausal status , diuretic use , or presence of cardiovascular disease .
the framingham study showed that serum urate levels were not independently associated with the risk of coronary heart disease ; however , gout was associated with a 60% increased risk of coronary artery disease .
a recent study , based on the multiple risk factor intervention trial reports that gout may lead to upto 26% increased risk of acute myocardial infarction .
choi et al . , in their 12 years health professionals follow - up study , which included 51,297 male participants , strongly support the link between hyperuricemia , gout , and cardiovascular diseases .
although a clear mechanism indicating the consequences of hyperuricemia on cardiovascular diseases and decreased survival could not be identified , a recent novel rodent model showed that that uric acid could cause renal afferent arteriolopathy and tubulointerstitial disease , which leads to hypertension .
when the serum uric acid levels are reversed , the renal lesions and hypertension were prevented .
another explanation for the increased cardiovascular disease rate in the presence of gout may be the ongoing and relapsing inflammation due to hyperuricemia among patients with the disease , which might enhance and promote atherogenesis and thrombogenesis , as seen in other inflammatory rheumatic disorders . in conclusion ,
patients with gout have higher risks of cardiovascular disorders , myocardial infarction and death due to increased blood uric acid levels .
as sson as hyperuricemia has been diagnosed , strict control of gout should be aimed for , to prevent any systemic complications as well as cardiovascular consequences .
this can be achieved with a multidisciplinary approach through the usage of well known cardioprotective medications such as aspirin , statins , beta - blockers when needed , and angiotensin converting enzyme inhibitors following coronary artery bypass grafting . | ischemic heart disease is accepted as the most common cause of mortality and morbidity nearly all over the world .
gout disease is the most common condition of inflammatory arthritis among the adult population .
literature includes limited information about the treatment strategies when both the conditions coexist . in this report , we present the case report of a 63 year old male patient with the diagnosis of gout arthritis who underwent a coronary artery bypass grafting procedure successfully . |
the operative methods of this procedure are generally grouped into cold steel / dissection methods and more modern methods such as coblation , use of a harmonic scalpel , suction diathermy , radiofrequency ablation , electrocautery , microdebrider , and laser .
proponents and opponents of these modern methods have hinged their arguments on issues bothering on pain , bleeding , and duration of admission . in our setting ,
this method usually involves curetting for the adenoid and intracapsular dissection with tonsillar dissector under general anesthesia .
hemostasis , the main concern of this approach , is ensured by dissection at the right plane . due to the risk of hemorrhage ,
preoperative clotting profile is done in conjuction with grouping and cross - matching of blood for possible transfusion . in our practice ,
blood availability for elective surgery usually relies on getting the relatives to donate blood or source for suitable donors for grouping and cross - matching in readiness for surgery .
there is an increasing challenge in getting safe blood available and as a consequence of the scarcity , there is an increase in case postponement and cancellation . in the light of this challenge with blood availability for our patients
, we undertook this study to review our practice in relation to utilization of blood among pediatric patients undergoing adenotonsillectomy in our facility .
the medical records of patients 16 years of age who had adenotonsillectomy under general anesthesia in our facility over a 5-year period ( from january 2010 to december 2014 ) were retrieved .
we extracted the biodata , presentation , preoperative investigations , preoperative blood request , surgery performed records of transfusion , and transfusion - related complications .
the data were entered into the spss statistics software version 20 ( ibm corporation ) for windows and data were presented as frequencies or proportions of the total .
there were 74 cases identified in the period under review , but only 52 case notes were retrieved made up of 33 males and 19 females .
the mean age was 3.27 2.76 years with an age range of 1 - 16 years .
sinus tachycardia was found in 11 ( 21.2% ) of the subjects and t wave anomaly in 1 ( 1.9% ) of the subject .
one patient suspected to have cardiovascular anomaly was found to have a ventricular septal defect with mild regurgitation and normal ventricular function .
thirty - five ( 67.3% ) patient had adenotonsillectomy , 13 ( 25.0% ) adenoidectomy only , and 4 ( 7.7% ) tonsillectomy only .
twenty - four ( 46.2% ) belonged to american society of anesthesiologists ( asa ) physical status class i , 25 ( 48.1 ) belonged to class ii , 1 ( 1.9% ) belonged to class iv , while the asa status of two ( 3.4% ) were not specified .
the grade of tonsillar enlargement among the patient preoperative blood request rate of 94.3% ( 49 patients ) was found in the study .
etamsylate , a platelet aggregator , was used in 15 ( 28.8% ) of the subjects .
there was no significant difference in the use of etamsylate with regards to the rate of intraoperative transfusion ( p = 0.310 ) .
one patient had cardiac arrest but was promptly resuscitated and was transferred to the intensive care unit ( icu ) after the procedure .
acetaminophen combined with other analgesics was used for postoperative analgesia for most of the patients [ figure 2 ] .
pattern of analgesic use postoperatively in patients type of analgesic used and rate of use five patients had postoperative nausea and vomiting ( ponv ) and were successfully managed . moreover , one patient developed airway compromise postextubation and was re - intubated and transferred to icu for further management .
the summary of haematological profile of subjects and rates of post - operative complications are shown in tables 2 and 3 respectively .
preoperative hematological investigation findings rates of postoperative complications twenty - one patient had both pre- and post - operative weight assessment at 68 weeks . among these patients , the mean pre- and post - operative weight was 11.8 3.6 kg and 13.3 3.3 kg , respectively ( wilcoxon signed rank test p < 0.001 ) .
symptoms analysis shows that recurrent nasal discharge , snoring , and difficulty with breathing are the top presenting complaints . although sleep apnea ranked fourth , it is possible that caregiver may not have noticed this episode as much as the snoring .
however , our findings still buttress the assertion that with more effective antimicrobial therapy the obstructive symptoms as an indication for surgery has increased over the infective symptoms in the last decades .
if surgery does not immediately eliminate these top symptoms , there may be issues with low satisfaction on the parts of parents / caregivers . in our setting
, the fear of bleeding associated with adenotonsillectomy has resulted in a policy of rigorous preoperative investigations .
apart from scaling the hurdle of normal investigation results which includes normal clotting profile , patients have to make available obligatory one pint of blood before qualifying for surgery .
why this practice persists in not understandable as it has been shown that coagulation testing prior to tonsillectomy and adenoidectomy in children is not cost - effective .
this also questions the need for grouping and cross - matching which is high in our subjects compared with the rate of transfusion . in our setting where most patients pay out of pocket , it makes sense to discard this wasteful practice .
however , a detailed family history and past medical history should be obtained to rule out bleeding disorders .
acetaminophen in combination with nonsteroidal anti - inflammatory drugs ( nsaids ) or opioids was the mainstay for postoperative pain management in most of the patients .
nsaids have been favored by some authors in the management of posttonsillectomy pain however there exist concerns regarding the effect of nsaids on platelets and increased risk of bleeding in the postoperative period .
recent studies however have found that there is no significant increase risk of bleeding except with the use of aspirin .
perioperative complications in this series include ponv seen in five ( 8.6% ) patients is low .
this rate compares favorably with the incidence of ponv among adenotonsillectomy patients reported by other authors .
in view of the low transfusion rate in our study , our protocol of routine grouping and cross - matching can not be justified when there are no risks factors for bleeding disorders .
this study , however , suffers the limitations common to all retrospective reviews viz - a - vis small sample size .
a prospective multicenter study could help to validate some of the assertions of this review .
| objectives : to examine the practices related paediatric adenotonsillectomy in our setting especially in relation to blood request and transfusion , routine investigations , post - operative analgesic practice and complications.methods:we reviewed the record of paediatric patients who had adenotonsillectomy in our facility over a 5-year period to obtain relevant information to our study.results:there were 33 males and 19 females with mean age of 3.27 2.76 years . sinus tachycardia was found in 11(21.2 % ) of the subjects and t wave anomaly in 1(1.9% ) of the subject .
thirty - five ( 67.3% ) patient had adenotonsillectomy , 13(25.0 % ) adenoidectomy only and 4(7.7% ) tonsillectomy only .
majority of the patients ( 24 , 46.2% ) were classified as asa physical status i. pre - operative blood request rate was high ( 49 , 94.3% ) though the transfusion rate was 1.9 % ( 1 patient ) .
acetaminophen combined with other analgesics was used for post - operative analgesia for most of the patients .
there was significant weight gain post - operatively among patientconclusions : cold steel adenotonsillectomy is safe and effective in our environment .
we believe that there is no justification for routine pre - operative blood request as a preconditions for surgery .
we also like to suggest that post - operative pain management be streamlined taking into consideration the available analgesics in our setting . |
obstetric injury is the most common cause of sphincter injury and pelvic floor failure resulting in lack of bowel control .
the pudendal nerve may be damaged during the course of prolonged vaginal delivery consequent to stretching [ 13 ] .
a third / fourth - degree tear ( involving the anal sphincter complex ) occurs in 0.52% .
eighty five per cent will have a persistent defect of the sphincter despite the immediate ( primary ) repair by the obstetrician .
conservative treatment ( diet / medical manipulation , biofeedback and pelvic floor exercises ) can be successful .
secondary repair is usually offered to patients with gross faecal incontinence [ 4 , 5 ] .
the outcome depends on the extent of the anal sphincter damage and associated neurological injury .
a 32-year - old woman was admitted electively for the management of a 2-year history of anal incontinence following a traumatic vaginal delivery of her second child .
she had undergone a manual forceful dilatation of the posterior vagina for cephalo - pelvic disproportion which resulted to a severe perineal tear .
this was repaired but she complained of severe urgency of defaecation and flatus incontinence since then .
she had awareness of the need to defaecate but was unable to retain solid stool for more than a few minutes .
reduced anal sensation for liquid stool and faecal perianal soiling followed a high residue diet .
she had severe discomfort and soiling during sexual intercourse because of the very close proximity of the anal canal to the vagina .
her faecal incontinence score was 15/20 according to the cleveland clinic scoring system [ i.e. solids ( usually ) 3 , liquids ( always ) 4 , flatus ( always ) 4 , use of pad ( never ) 0 , lifestyle alteration ( always ) 4 ] .
physical examination revealed a patulous anus immediately adjacent to the posterior for chette of the vagina indicating a poor internal sphincter function ( fig . 1 ) .
she had a lax external sphincter tone on voluntary squeezing and the anorectal angle was weakly accentuated with squeeze .
proctoscopy revealed an empty rectum and normal mucosa . a preoperative diagnosis of a fourth - degree perineal tear involving the internal anal sphincter ( ias ) and external anal sphincter ( eas ) with possible mild pudendal neuropathy was made and she consented to a perineal repair ( table 1 ) .
table 1classification of perineal tear first degreeinjury to perineal skinsecond degreeinjury to perineum involving perineal muscles but not involving the anal sphinctersthird degreeinjury to perineum involving the anal sphincter complex:3a : < 50% of ext anal sphincter thickness3b : > 50% eas thickness3c : both eas and ias involvedfourth degreeinvolves anal sphincter complex ( eas and ias ) and anorectal mucosa .
figure 1:a severe chronic fourth - degree tear secondary to birthing with grossly deficient perineum ( a thin demarcation between anus and vagina ) .
classification of perineal tear a severe chronic fourth - degree tear secondary to birthing with grossly deficient perineum ( a thin demarcation between anus and vagina ) .
following mechanical bowel preparation and i / v prophylactic antibiotics ( ceftriaxone 1 gm and metronidazole 500 mg ) given prior to induction of anaesthesia , and , with the patient in the lithotomy position a proctoscopy was carried out to irrigate the rectum .
the dissection was commenced laterally out in the ischiorectal fat to establish an appropriate plane and proceeded towards the site of sphincter injury which was in the anterior margin .
the anodermal flap was carefully mobilized from the vagina by sharp dissection in a cephalad direction to expose the entire length of the injury with the plane lying posterior to any large paravaginal veins ( fig . 2 ) .
the edges of the damaged sphincter muscle were identified and the plane between the anal mucosa and the muscle on either side was developed . as the injury extended proximally into the levator ani ( puborectalis ) muscle , an anterior levatorplasty was performed by plicating the anterior limbs of the muscle to the midline with 2 - 0 polyglactin sutures ( fig . 3 ) .
the anterior defect of the ias extended through the anal mucosa and was plicated with 2 - 0 polygalactin suture ( fig . 3 ) .
the vaginal wall was plicated with interrupted sutures of 3 - 0 polygalactin to provide added support to the rectovaginal septum . an overlapping repair of 3 cm of the mobilized edges of the external sphincter extended the length of the anal canal and was performed using five horizontal mattress sutures of 2 - 0 polygalactin ( fig .
4 ) . following irrigation and haemostasis the semi - circular skin wound which has now almost become longitudinal was closed in an inverted y fashion .
the distance between the posterior forchette and the anal canal was seen to be lengthened ( fig .
postoperatively , sitz baths were instituted and the patient was given a low - residue diet for the first 48 h. apart from constipation relieved with microlax enema , she made good recovery with no signs of wound infection nor haematoma .
postoperatively , her anal tone at rest was increased and there was reasonable increase in the maximum squeeze pressure . her incontinence score a week after repair was 2/20 , i.e. solids ( never ) 0 , liquids ( never ) 0 , flatus ( sometimes ) 2 , use of pad ( never ) 0 , lifestyle alteration ( never ) 0 .
she was discharged on the 10th postoperative day and long - term follow - up planned ( table 2 ) .
table 2ccis for the assessment of faecal incontinence neverrarelysometimesusuallyalwayssolids01234liquids01234flatus01234use of pad01234lifestyle alteration01234rarely : less than once a month ; sometimes : more than once per month or less than once a week ; usually : more than once a week but less than once a day ; always : more than once a day.ccis 0 , perfect continence ; ccis 17 , good continence ; ccis 814 , moderate incontinence ; ccis 1520 , severe incontinence ; ccis > 20 , completely incontinent .
figure 2:vagina carefully separated from the anterior rectal wall ( arrow ) ; gauze swab in the right and left ischioanal fossa , respectively .
figure 3:ias plication ( long arrow ) extending to the plicated levator ani ( short arrow ) ( forceps on the separated external sphincter , urethral catheter in situ ) .
figure 4:anterior external sphincteroplasty ( covered by isciorectal fat ; finger in anal canal ) .
figure 5:wound closed in an inverted y-shaped manner with elongation of the skin over the perineal body ( arrow - anal canal ; deeply - seated anal verge with increase length of anal canal ) .
ccis for the assessment of faecal incontinence rarely : less than once a month ; sometimes : more than once per month or less than once a week ; usually : more than once a week but less than once a day ; always : more than once a day .
ccis 0 , perfect continence ; ccis 17 , good continence ; ccis 814 , moderate incontinence ; ccis 1520 , severe incontinence ; ccis > 20 , completely incontinent .
vagina carefully separated from the anterior rectal wall ( arrow ) ; gauze swab in the right and left ischioanal fossa , respectively .
ias plication ( long arrow ) extending to the plicated levator ani ( short arrow ) ( forceps on the separated external sphincter , urethral catheter in situ ) .
wound closed in an inverted y-shaped manner with elongation of the skin over the perineal body ( arrow - anal canal ; deeply - seated anal verge with increase length of anal canal ) .
primary repair is ideal as successful primary sphincteroplasty substantially improves quality of life and reduces overall cost of treatment . following primary repair
a poor continence score at 3 months post - partum , usually with urge incontinence of faeces denotes severe anal sphincter dysfunction and is a predictive factor for persistent faecal incontinence . in a resourced area , endoanal ultrasound
will localize the injury site and size the extent of sphincter damage prior to a secondary repair [ 4 , 5 ] .
anorectal physiology is useful for patients not considered for operative repair so as to obtain baseline information and , to determine the extent of anal sphincter damage and identify pudendal neuropathy in candidates for surgery [ 4 , 5 , 7 , 8 ] .
operative management is usually offered to a patient with a score of 12 or greater , an underlying correctable abnormality and gross faecal continence [ 4 , 5 , 8 ] . these range from an overlapping eas repair for a distal sphincter defect to repair of the entire pelvic floor for neuropathic faecal incontinence [ 4 , 5 ] . where ias injury can be identified , it is advisable to repair separately .
improvement in the functional length of the sphincter corresponded to a successful outcome [ 4 , 5 , 7 , 8 ] .
patients with coexisting pudendal neuropathy or operative pudendal nerve damage will be at risk and may benefit from sacral nerve stimulation or a neosphincter procedure or even an end - stoma [ 4 , 5 , 7 ] .
it should be compared with long - term results following a structured training in recognizing and repairing sphincter injury primarily .
written informed consent was obtained from the patient for publication of this case report and any accompanying images .
a copy of the written consent is available for review by the editor of this journal.
written informed consent was obtained from the patient for publication of this case report and any accompanying images .
a copy of the written consent is available for review by the editor of this journal.
| obstetric injury is the commonest cause of anal incontinence .
we report a case of anal incontinence as a result of severe chronic fourth - degree perineal tear secondary to birthing with complete disruption of the perineum .
secondary repair consisting of an anterior sphincter repair and levatorplasty in a poor resourced area rendered excellent immediate clinical result .
the outcome of anterior sphincter repair following obstetric trauma is good but long - term follow - up is required because of the underlying complexity of obstetric injury
. as prevention is not always possible , immediate recognition and adequate primary treatment is of importance . |
poor sleep quality and sleep disorders particularly insomnia , osa , and rls are common problems in people with type 2 diabetes ( 3,6,8,12,13 ) .
sleep quality provides a global subjective assessment of sleep that includes features such as sleep duration , time needed to initiate sleep ( i.e. , sleep latency ) , percentage of time asleep while in bed ( i.e. , sleep efficacy ) , sleep disturbances , and general satisfaction with sleep ( 14 ) .
studies utilizing the pittsburgh sleep quality index ( psqi ) ( 14 ) indicate that people with type 2 diabetes have poor sleep quality ( mean psqi global scores 6.38.3 ) , with 4971% identified as poor sleepers according to the suggested cutoff for the psqi global score ( psqi > 5 ) ( 8,1517 ) .
data from self - reports and polysomnography suggest that people with type 2 diabetes have an average sleep duration of 6 hours ( 15,18 ) .
insomnia can be defined as a symptom comprising sleep - specific complaints such as difficulty initiating and maintaining sleep , waking too early , and difficulty returning to sleep , or as nonrestorative sleep , or as a disorder denoting sleep and daytime symptoms , including fatigue , irritability , and decreased concentration .
insomnia may be transient , but it can become a chronic problem if perpetuated by maladaptive sleep habits and dysfunctional beliefs and attitudes about sleep .
the prevalence of insomnia is significantly higher among people with type 2 diabetes than among those without type 2 diabetes , even after accounting for age and sex ( 12,19 ) . with regard to specific insomnia symptoms , 817% of people with type 2 diabetes report difficulty falling asleep , 2340% have difficulty staying asleep , and 2643% report difficulty both in initiating and maintaining sleep ( 7,12 ) .
rls is a condition that negatively affects sleep and is prevalent in people with type 2 diabetes ( 13 ) .
rls has a higher prevalence in people with type 2 diabetes than in the general population .
symptoms of rls include an uncomfortable urge to move the legs or unpleasant sensations that worsen with rest or inactivity and increase in intensity during the evening and at night ; movement brings partial or total relief of these negative sensations ( 20 ) .
frequently , rls symptoms result in a secondary insomnia , with disturbance of the individual s ability to initiate and maintain sleep .
osa is a common sleep disorder characterized by recurrent occurrences of upper airway collapse during sleep that produces apneas ( cessation of airflow for at least 10 seconds ) and hypopneas ( decreased airflow by 50% that is associated with an oxygen desaturation ) .
there is a transient arousal from sleep that is associated with the termination of apneas and hypopneas .
the most common signs of osa are loud snoring , gasping , or witnessed pauses in breathing , as well as excessive daytime sleepiness . an apnea - hypopnea index ( ahi ) , which is the mean number of apnea and hypopnea episodes per hour of sleep , is obtained during overnight polysomnography and used to diagnose osa .
the following thresholds are used to classify the severity of osa : normal ( ahi < 5 ) , mild ( ahi 514.9 ) , moderate ( ahi 1530 ) , and severe ( ahi 30 ) .
osa often goes undiagnosed among people with type 2 diabetes , such that only 18% of those being managed in primary care clinics received an osa diagnosis ( 5 ) .
overweight and obesity are not only risk factors for type 2 diabetes , but also major risk factors for osa ( 4 ) .
the prevalence of moderate to severe osa among people with type 2 diabetes is high , with rates ranging from 24 to 36% ( 6,8,9,21 ) , and is significantly greater than in those without type 2 diabetes ( 5,9,21 ) .
older age , male sex , and obesity are the strongest risk factors for osa ( 3,6,10,22 ) .
in an epidemiological study of obese people with type 2 diabetes , 87% were found to have osa , with 30.5% having moderate osa and 23% having severe osa ( 4 ) .
quality of life , according to the world health organization ( 23 ) , encompasses physical and psychological health , functional status , and beliefs , values , and relationships .
studies examining the association between sleep and quality of life have primarily examined aspects of health - related quality of life ( hrqol ) . a large study ( n = 19,711 ; 5,161 with insomnia and 14,550 without insomnia )
found that people with insomnia had significantly ( p < 0.01 ) lower physical hrqol , mental hrqol , and work productivity than people without insomnia ( 24 ) . sleep disorders
such insomnia , rls , and osa and poor sleep quality have all been associated with decreased quality of life in people with diabetes ( 8,2527 ) .
a study of individuals with type 2 diabetes ( n = 300 ) examined the relationship between sleep quality , hrqol , and diabetes - related quality of life ( 8) .
people with poor sleep quality ( psqi > 5 ) had significantly lower scores on hrqol ( sf-36 mental component summary and subscores [ social functioning , emotional role , and mental health ] and sf-36 physical component summary and subscores [ physical functioning , physical role , bodily pain , general health , and vitality ] ) and on diabetes quality of life ( dqol ) questionnaire total score and subscores ( dqol satisfaction , dqol impact , and dqol diabetes - related worry ; all p < 0.002 ) .
similar findings were found in another study of patients ( n = 124 ) with comorbid rls and type 2 diabetes ; rls was an independent risk factor for lower scores on the sf-36 mental component summary score and the vitality , mental health , and role limitations subscores related to emotional health problems ( 28 ) .
although the association between decreased quality of life and sleep disturbances is well established , the effect of impaired sleep on aspects of diabetes self - care behaviors ( e.g. , physical activity , diet choices , and medication adherence ) is less certain . in a descriptive correlational study of 107 adults with type 2 diabetes ( 29 ) ,
increased subjective daytime sleepiness ( epworth sleepiness scale ) ( 30 ) was significantly associated with worse self - care and control problems .
additionally , impaired sleep quality ( psqi ) ( 14 ) was significantly associated with lower scores on diabetes glycemic control , a worse attitude toward activities required for optimal management of diabetes , decreased positive attitude toward feeling able to manage diabetes , lower self - reported adherence to good self - care behaviors , and decreased adherence to good diet choices ( all p < 0.05 ) . maintaining a physically active lifestyle is important in the prevention of diabetes .
preliminary evidence suggests that impaired sleep has a negative impact on physical activity in people with diabetes .
data from the 20052006 national health and nutrition examination survey found that impaired sleep was common ( 26% with 6 hours of sleep per night ; 17% with daytime sleepiness ) among people with prediabetes ( n = 866 ) ( 31 ) .
a regression analysis found higher levels of insomnia symptoms to be a significant predicator of objectively measured steps after controlling for age , bmi , self - reported health , and education ( p = 0.026 ) .
results from several studies indicate that inadequate sleep , poor sleep quality , and sleep disorders such as osa are associated with decreased objective physical activity and subjective vigor in people with diabetes ( 3235 ) .
furthermore , data from a small intervention study ( n = 23 ) suggest that treatment of osa without assistance in improving activity in people with type 2 diabetes who have a sedentary lifestyle may be insufficient to change established behaviors ( 35 ) .
there is a lack of information on the effect of impaired sleep on medication adherence in people with diabetes .
however , data from an observational study of older adults ( n = 897 , 37% [ n = 338 ] with diabetes ) found that self - reported medication nonadherence according to the 4-item morisky medication adherence scale ( 36 ) was increased by almost 50% in individuals with sleep disturbances ( odds ratio [ or ] 1.48 , 95% ci 1.121.96 ) ( 37 ) .
these results agree with a prospective study on the effect of impaired sleep on medication nonadherence ; among heart failure patients ( n = 280 ) , those with impaired sleep quality were significantly more likely to be nonadherent to their medication regimen ( p = 0.035 ) ( 38 ) .
in addition to impeding diabetes self - management , sleep disturbances have also been found to negatively affect psychological well - being and daily functioning . in a sample of 39 adults with type 2 diabetes with and without rls ,
decreased sleep quality was associated with more fatigue and depression symptoms , and these associations persisted when adjusting for rls status ( 13 ) .
data from another study of people with type 2 diabetes found that those with rls had more than three times the depression risk ( or 3.21 , 95% ci 1.0711.23 ) of those without rls ( 28 ) .
sleep quality has been found to have an indirect effect on the relationship between psychological distress ( depression and anxiety symptoms ) and diabetes - related quality of life ( 39 ) .
data from a recent study ( 26 ) suggest that poor sleep quality in adults with type 2 diabetes is associated with decreased functional outcomes evaluated by the functional outcomes of sleep questionnaire ( fosq ) , including the capacity to realize a lifestyle that is active and productive , maintain social relationships with friends and family , sustain vigilance to required tasks , and continue healthy intimate sexual relationships , even after controlling for age , race , bmi , marital status , and hrqol .
poor sleep quality , insomnia symptoms , osa , and sleep disturbances such as pain , rls symptoms , and nocturia are associated with increased odds of frequent daytime sleepiness among adults with type 2 diabetes .
those with untreated osa may experience daytime sleepiness resulting from fragmented sleep due to arousals associated with termination of apneas and hypopneas .
compared to age- and sex - matched controls without type 2 diabetes , excessive daytime sleepiness , defined as an epworth sleepiness scale score 12 , was significantly more frequent among those with type 2 diabetes ( 2.1 vs. 15.5% , p = 0.02 ) ( 12 ) . in a sample of 44 male veterans with type 2 diabetes ,
those with daytime sleepiness had significantly lower functional outcomes based on the fosq total score and all fosq subscale scores ( 40 ) .
data from studies of normoglycemic patients with osa found that functional outcomes ( fosq scores ) ( 41 ) are improved with continuous positive air pressure ( cpap ) treatment if patients wear their cpap devices for 6 hours per night ( 42,43 ) .
furthermore , daytime sleepiness was associated with significantly higher levels of stress and physical and mental exhaustion ( 40 ) .
a secondary analysis of data from the 2003 sleep in america poll found that adults with type 2 diabetes and daytime sleepiness had lower self - rated health and greater physical functioning impairment and were more likely to take daytime naps and feel that they accomplish little during the day compared to those without daytime sleepiness ( 44 ) .
preliminary data suggest that poor sleep is associated with increased fatigue and daytime sleepiness , decreased quality of life , impaired self - management , increased mood disturbances , and decrements in functional outcomes in areas sensitive to sleep disruption .
there is a lack of evidence regarding the potential effects of treating sleep disorders on patient - centered outcomes , suggesting that further research is necessary to evaluate whether sleep disorder treatment could be an effective strategy for addressing this potential barrier to effective diabetes management . | in brief poor sleep quality and sleep disorders , particularly insomnia , obstructive sleep apnea , and restless legs syndrome , are prevalent among people with type 2 diabetes .
evidence suggests that coexisting diabetes and sleep disturbances are associated with decreases in quality of life , diabetes self - care behaviors , and patient - reported outcomes .
additional research is required to determine the effect of treatment of sleep disorders on patient - centered outcomes in people with type 2 diabetes . |
the protozoan trypanosoma cruzi , the causative agent of chagas ' disease in humans , parasitizes several other mammalian species . after infection with t. cruzi ,
the parasites survive and multiply in nucleated cells as amastigotes , eventually reaching the bloodstream as trypomastigote forms .
the acute infection phase is characterized by high levels of circulating parasites , while parasite proliferation is contained during the chronic phase .
innate immune responses play critical roles in the control of parasite spreading and host survival .
toll - like receptor ( tlr ) family of pattern recognition receptors ( prrs ) plays a central role in the recognition of t. cruzi by the immune system ; tlr4 , tlr2 [ 46 ] , tlr9 , and tlr7 initiate a signaling cascade that culminates in the activation of proinflammatory genes which are important for resistance to t. cruzi infection .
nod1 , a member of the cytosolic nod - like receptor ( nlr ) family , also plays a role in controlling t. cruzi infection ; nod1/ mice were shown to be very susceptible to t. cruzi , succumbing to the infection and displaying higher parasitemia and parasite loads in the spleen and heart tissues .
recent works suggest that asc inflammasomes are critical determinants of host resistance to t. cruzi infection ; moreover nlrp3 inflammasome controls parasitemia by inducing no production via a caspase-1-dependent , il-1r - independent pathway .
the early control of replication depends largely on nitric oxide ( no ) induction in macrophages mediated by gamma - interferon ( ifn- ) and tumor necrosis factor alpha ( tnf- ) .
ifn- is synthesized shortly after infection , mainly by il-12 and tnf- activated nk cells [ 1316 ] .
the in vivo inhibition of inos results in increased susceptibility to parasites [ 17 , 18 ]
. the effector mechanisms that control parasite loads and survival during the acute infection phase also depend on specific cell - mediated immune responses .
mice depleted or deficient in cd4 or cd8 lymphocytes show early mortality and increased numbers of parasites in their bloodstreams and tissues [ 1921 ] . as a mechanism of evasion during t. cruzi replication they release immunomodulatory molecules that delay parasite - specific responses mediated by effector t cells .
resistance to t. cruzi infection in humans as well as mice may vary according to the genetic background of the host and the virulence of the parasite strain [ 23 , 24 ] .
genetic control of responses to t. cruzi is governed by multiple genes , and mice of different strains can develop infections that evolve towards either early death or a chronic phase .
silva et al . recently analyzed the susceptibility of several inbred mouse lines to infection with the y strain of t. cruzi and found that susceptibility varied among those lines , especially between a / j and c57bl/6 mice .
a / j mice are extremely susceptible , with 100% death rates , whereas c57bl/6 mice are resistant .
data obtained with an f1 ( a / j x c57bl/6j ) population suggested the existence of one or more loci mapping on chromosome x that contribute to resistance to t. cruzi infections .
in addition to these inbred mouse lines , the involvement of different genetic backgrounds in infection control has been analyzed in mice lines selected for either high ( h ) or low ( l ) antibody responses and maximal ( airmax ) and minimal ( airmin ) acute inflammatory reactivity ( air ) .
starting from a genetically heterogeneous founder population ( f0 ) of albino swiss mice , the selection of lines for antibody responsiveness ( named selection iii ) was carried out using assortative mating in successive generations based on secondary antibody response to salmonellae flagellar antigens .
this bidirectional selective pressure resulted in the accumulation of alleles at multiple quantitative trait loci ( qtls ) in each h and l line endowed with opposite modulatory effects on the various steps of antibody biosynthesis .
the differences in antibody responses between hiii and liii lines are not restricted just to the selection immunogen but encompass a wide range of complex antigens , showing evidence for multispecific effects of the relevant genes [ 28 , 29 ] .
genetic analyses indicated that 510 qtls regulate the antibody production phenotype , and a qtl mapping experiment using microsatellite markers yielded three highly significant qtls on chromosomes 3 , 8 , and 9 .
hiii and liii lines also show extreme divergence in other phenotypes , such as skin carcinogenesis and pristane induced arthritis pia .
our group successfully detected a pia - susceptibility qtl on chromosome 3 by examining the cosegregation of the most significant ab qtl markers with arthritis phenotypes .
selection for acute inflammatory response was carried out in a similar manner , using polyacrylamide beads ( biogel p-100 ) , with induced local inflammatory influx and exudated protein concentrations as the selection phenotypes [ 33 , 34 ] .
significant interline differences were also observed in response to several phlogistic agents , including carrageenan , zymosan , and inactivated bacteria .
these mouse lines have been used to study the effects of genetic control of nonspecific immunity on susceptibility to neoplastic , autoimmune , and infectious diseases .
the selective process did not affect specific immune responses , as both airmax and airmin mice produced similar amounts of antibodies after immunization with optimal doses of complex antigens ( such as heterologous proteins and bacterial antigens ) .
cell - mediated immune responses , such as t - cell specific proliferation and delayed - type hypersensitivity reactions , were also similar in both lines . on the other hand , these lines differ in natural resistance to pristane induced arthritis , various bacterial infections , lung , kidney , and colon chemical carcinogenesis , as well as wound - healing capacities .
the relative contributions of innate and specific immune responses to t. cruzi infections have not yet been determined , nor their genetic influences on infection susceptibility . in this study
we analyzed the relationships between the genetic controls involved in antibody production and inflammatory responses and resistance to t. cruzi infection by examining the course of parasite infection in mice selected for high ( hiii ) and low ( liii ) antibody responses ( selection iii ) or for maximal ( airmax ) and minimal ( airmin ) acute inflammatory responses ( air ) .
male and female 812-week - old mice were used in all experiments . all stock mice and crosses used were developed and maintained at the animal facilities of the immunogenetics laboratory at the butantan institute , so paulo state , brazil .
all animals received humane care according to criteria outlined in the ethical principles in animal research guidelines adopted by the brazilian college of animal experimentation .
066/02 ) by the committee on ethics in the use of animals of the biomedical sciences institute usp . airmax and airmin mice were selected from a polymorphic foundation population constructed by the balanced intercrossing of eight inbred mouse lines ( a / j , dba2/j , swr / j , cba / j , sjl / j , balb / cj , p / j , and c57bl/6j ) , as described in detail elsewhere .
although the formal stock designations are ibut : airh and ibut : airl , we refer to them in this paper and in previous publications as airmax and airmin , respectively . the selection for high ( hiii ) and low ( liii ) antibody responder mice ( selection iii )
inbred hiii and liii lines derived from their respective outbred stocks were used to produce f1 ( hiii liii ) hybrid mice and 242 backcrossed ( f1 liii ) segregating ( bc - l ) mice for genetic studies .
nonselected swiss albino male mice purchased from the central animal facilities at the butantan institute were used for in vivo maintenance of t. cruzi .
the parasite was maintained in vivo by serial passage of the parasite blood forms in swiss albino mice .
infected with t. cruzi blood forms diluted at the indicated concentrations in 100 l pbs buffer and monitored daily for deaths .
parasitemia levels were determined by hemocytometer counts of trypomastigotes in fresh blood samples diluted in ammonium oxalate ( 1% ) .
mice were euthanized at 0 , 7 , 15 , and 20 days after infection with 1 10 parasites .
their peritoneal cavities were washed with 5 ml of pbs under sterile conditions , and the cells were pelleted and then resuspended in complete rpmi-1640 medium ( rpmi-1640 supplemented with 2 mm l - glutamine , 10 g / ml gentamicin , and 10% fetal calf serum ) .
the cells ( 2 10/well ) were cultured for 48 h at 37c and 5% co2 in a final volume of 100 l / well in 96-well flat - bottom plates with or without stimulation with cona ( 2.5 g / ml ) . lymph node and spleen cell suspensions were obtained by homogenizing those organs in glass grinders with rpmi-1640 medium under sterile conditions and then washing and diluting the cells to 1 10 cells / ml in modified click medium ( rpmi-1640 supplemented with 0.05 mm 2-mercaptoethanol , 2 mm l - glutamine , 1 mm sodium pyruvate , 10 g / ml gentamicin , and 2% heat - inactivated normal mouse serum ) to a final volume of 1 ml / well in 24-well flat - bottom plates .
the cells were stimulated with cona ( 2.5 g / ml ) and cultured for 48 h at 37c and 5% co2 .
unlabeled xmg1.2 ( 5 g / ml ) and biotinylated an-18 ( 5 g / ml ) rat anti - mouse ifn- monoclonal antibodies were used in two - site sandwich elisa assays using an alkaline avidin - phosphatase and p - nitrophenyl phosphate substrate in tris - nacl buffer to detect ifn- contents in supernatants of 48-hour cultured lymph node or spleen cells .
absorbance at 405 nm was measured in a multiskan ms plate reader ( labsystems , finland ) , and ifn- concentrations were determined by comparisons with a standard curve obtained from serial dilutions of recombinant ifn-. forty - eight - hour cell - free peritoneal culture supernatants were assayed for no2 using the griess reaction .
briefly , 50 l of culture supernatant was incubated with 50 l of a mixture of 1% sulfanilamide and 0.1% n-(1-naphthyl ) ethylenediamine dihydrochloride in 2.5% orthophosphoric acid ( h3po4 ) at room temperature for 10 min .
absorbance was measured at 540 nm using a multiskan ms plate reader ( labsystems ) ; the micromolar concentrations of no2 were determined by interpolation from a nano2 standard curve .
genomic dna from mouse cardiac muscle was isolated using dneasy tissue kit ( qiagen , germany ) following the manufacturer 's instructions .
the primer pairs tcz - f : 5-gct ctt gcc cac cmg ggt gc-3 ( where m = a or c ) and tcz - r : 5-cca agc agc gga tag ttc agg-3 were used in qpcr to detect the target t. cruzi 195-bp repeat dna in the cardiac muscles of infected mice . in parallel , primers for the murine specific tnf - single copy genomic sequence ( tnf-5241 : 5-tcc ctc tca tca gtt cta tgg ccc a-3 and tnf-5411 : 5-cag caa gca tct atg cac tta gac ccc-3 ) were used in a parallel assay as an internal control to normalize the amount of host dna loaded in each reaction , as described by cummings and tarleton .
normalization was obtained by calculating the ratios of the concentrations of target t. cruzi dna and murine tnf- reference gene dna in the same tissue sample .
real - time pcr was carried out with 65 ng of sample dna , 12.5 l quantitect sybr green pcr master mix ( qiagen ) , 0.5 m of each primer , and nuclease - free water to a final volume of 25 l .
usa ) with an initial step of 15 min at 95c followed by 50 denaturation cycles ( 20 s at 95c ) , annealing ( 20 s at 55c ) , and extension ( 1 min . at 72c ) .
fluorescence intensity was detected at the end of each extension phase using a chromo 4 detector ( mj research ) .
all data was analyzed using opticon monitor analysis software v2.03 ( mj research ) . in order to estimate target t. cruzi dna concentrations ( and therefore the parasite load of each sample ) , a standard curve was constructed through serial dilutions ( ranging from 10,000 to 10 parasite equivalents ) of gdna obtained from uninfected cardiac tissue with 10 t. cruzi trypomastigotes artificially added .
the standard curve derived from these dilutions ( log transformed ) indicated the amounts of parasite equivalents in each sample ( adapted from ) . for genomic dna extraction
, frozen mouse tail tips were incubated at 65c for 1 h in 100 l of lysis buffer containing 50 mm tris - hcl ( ph 8.0 ) , 10 mm edta ( ph 8.0 ) , 0.5% sds , with 1.5 mg / ml proteinase k ( invitrogen ) . following another addition of 100 l of lysis buffer , incubation for 15 min , and centrifugation ( 13,000 g/10 min ) , the supernatants were mixed with 0.1 volumes of 3 m sodium acetate ( ph 5.2 ) and 2 volumes of 100% ethanol .
the precipitated dna was washed , dried at room temperature , and dissolved in sterile nuclease - free water .
the genotyping of the ab qtl microsatellite markers , as described by de souza et al . , was carried out by pcr amplification of 100 ng of dna using specific primers ( research genetics , birmingham , ca ) .
pcr reactions were incubated for 2 min at 94c , followed by 35 cycles of 30 s/94c , 35 s/5557c , and 45 s/72c , followed by a final extension for 7 min at 72c .
individual genotypes of the 242 backcrossed ( bc - liii ) mice for each marker were determined by comparing their pcr fragment sizes ( as visualized in 4.5% agarose gels ) with those of the parental lines .
means were compared by analysis of variance ( anova ) and multiple comparison tukey post hoc tests .
individual genetic and phenotypic data from the 242 bc - liii segregant mice were analyzed using mapmanager qtx software [ 44 , 45 ] to determine the significance of the association between marker genotypes and the t. cruzi infection phenotypes . due to the striking gender difference in infection survival ,
critical lrs ( likelihood ratio statistic ) values corresponding to suggestive ( p < 0.63 ) , significant ( p < 0.05 ) , or highly significant ( p < 0.001 ) linkage were determined by random permutation testing .
mortality rates , monitored at doses ranging from 10 to 10 blood forms , showed marked gender - related differences in susceptibility to acute infection in all of the mouse lines analyzed .
males were more susceptible than their respective littermate females ( figures 1 and 2 ) .
in addition , we observed divergent levels of resistance in both the air ( figure 1 ) and selection iii ( figure 2 ) lines .
airmax males were significantly more resistant to infection with 10 parasites than airmin males ( figure 1(a ) ) , while no differences were observed at higher infective doses ( figures 1(b ) and 1(c ) ) .
airmax females were likewise more resistant than airmin females , showing no mortality when challenged with 10 and 10 parasites ; airmin females inoculated with 10 trypomastigotes showed high mortality rates ( figure 1(b ) ) and different survival curves .
infection with more than 10 parasites , however , resulted in similar susceptibilities in females of both air lines ( figure 1(c ) ) .
both hiii and liii male mice had high and similar mortality rates ( figures 2(a ) , 2(b ) , and 2(c ) ) when infected .
liii male mice died earlier than hiii animals , however , resulting in significantly different survival curves when infected with 10 , 10 , and 10 parasites .
female hiii mice were more resistant than liii females independent of the challenge dose , with clearly different survival curves and mortality rates ( figures 2(a ) , 2(b ) , and 2(c ) ) . while only one hiii female died when challenged with the highest dose , mortality was already significant at the lowest dose among liii females , reaching 100% after challenges with 10 parasites .
female liii mice mortality was similar to that of the extremely susceptible liii males ( figure 2(c ) ) .
males and females of all mouse lines tested developed similar parasitemia peaks in acute t. cruzi infections , independent of initial parasite challenges ( representative plots for the 10 dose are shown in figure 3 ) .
differences related to both gender and lines were observed in parasite - clearance in these mice .
thus , except for a few airmax males that cleared blood parasite forms to undetectable levels , the other males died after acute infection ( showing high levels of circulating parasites ) .
high percentages of females from airmin ( 60% ) and liii ( 100% ) susceptible lines died without showing any effective control of parasitemia levels , whereas all females of resistant airmax and hiii lines cleared blood parasites during acute t. cruzi infection .
differences in parasitemia control among hiii and liii females in the acute infection phase were not correlated with parasite loads in cardiac tissue in the late phase ( 150 days after challenging ) ( figure 4 ) . this correlation could not be determined in males because all liii males died during the acute phase .
gender - related differences were observed in hiii mice in terms of the amounts of t. cruzi genomic dna found in their cardiac tissue , with higher values being found in males than in females of both lines ( figure 4 ) .
this data indicates that males differ from females not only in terms of the lethality of infection and of parasitemia control , but also in terms of parasite burdens in heart tissue .
production of ifn- and nitric oxide ( no ) in the acute phase of t. cruzi infection was investigated to evaluate whether these mediators were associated with the different levels of infection resistance in mice selected for air or ab response phenotypes .
increases in both ifn- and no production were observed in infected airmax and airmin mice , but the increases were similar in both lines and did not correlate with either strain - related or gender - related differences in resistance ( data not shown ) .
lines selected for ab response , on the other hand , showed distinct ifn- production patterns that increased significantly at 7 days and remained elevated 15 days after infection in hiii males and females ; in liii mice , ifn- production was similar to noninfected control levels at all time points ( figure 5(a ) ) .
our data also suggests that ifn- production influences no synthesis during acute infection as increases in this trypanocidal mediator were observed in both hiii males and females ( figure 5(b ) ) after , or at the same time as , ifn- detection .
similar profiles of ifn- and no secretion were observed with lymph node , peritoneal , and spleen cells ( data not shown ) .
interestingly , we observed the same patterns of ifn- and no production with males and their littermate females , so that no correlations between the production of these mediators and gender - related resistance to infection could be established in any of the mouse lines studied .
the quantitative trait loci ( qtls ) controlling ab production in selection iii lines had been previously mapped in genome - wide screening with polymorphic genetic markers ( microsatellites ) .
we therefore investigated the participation of these chromosomal regions in the response to t. cruzi infection .
inbred subpopulations of hiii and liii lines that showed the same resistance pattern to t. cruzi infections as the outbred parental lines described above were used for this purpose .
f1 ( hiii liii ) hybrids , obtained by reciprocal crosses ( hiii males x liii females or hiii females x liii males ) , showed identical resistance patterns to t. cruzi challenges ( data not shown ) , indicating that there were no maternal or parental effects in determining resistance / susceptibility to infection . on the other hand , there was an overdominance effect of the resistance phenotype , with f1 hybrids showing greater resistance than the parental hiii line ( figures 6(a ) , 6(b ) , and 6(c ) ) . due to the strong overdominance observed in f1 mice infected with 10 parasites ( figure 6(c ) ) and to a wide range of other challenge doses ( data
not shown ) , a segregating population of 242 mice was constructed by backcrossing f1 mice with the susceptible parental liii line ( bc - l ) .
composite data related to the survival times of males and females from this backcross population ( figure 6(d ) ) were submitted to genetic analysis , considering sex as a covariate for that trait . of all microsatellites tested , the ab qtl marker located at 34.8 cm on chromosome 1 ( d1mit303 ) attained significant cosegregation values for survival time ( table 1 ) .
a more distal peak in chromosome 1 ( marked by three adjacent microsatellites ) also involved in ab regulation in hiii and liii lines showed a suggestive level of cosegregation with mortality and survival rate .
the present work demonstrated that polygenic regulation leading to high or low antibody production and maximal or minimal acute inflammatory responses affects host resistance against t. cruzi infections .
our results showed a positive correlation between the resistance phenotype and mouse lines selected for high responses . during acute infection , mice from both high - responder lines had lower mortality rates and showed greater capacities to control circulating parasites when compared to low - responder animals .
gender differences were also observed in mortality rates , with male mice being more susceptible than females .
male mice have been observed to be more susceptible to acute infections than females in other genetic mouse models , with significantly lower numbers of circulating parasites being observed in the latter , and hormones such as estrogen have been observed to reduce mortality in t. cruzi infected mice , presumably by their ability to stimulate macrophage activity .
et al . [ 50 , 51 ] showed that gonadectomy affected the courses of t. cruzi infections in females , with high parasitemia levels in the ovariectomized animals as compared to controls and sham - operated groups , indicating that sex hormones can influence natural immune mechanisms .
the influence of gender on human susceptibility to t. cruzi has similarly been reported [ 52 , 53 ] .
recent work analyzing an f2 population obtained by intercrossing resistant and susceptible isogenic strains of mice found a significant association between parasitemia and mortality . by analyzing males and females separately
, the authors found that males were more susceptible to death but parasitemia was similar in males and females .
in fact they obtained a negative correlation of parasitemia with longevity in females but not in males , suggesting that additional factors independent of parasitemia cause early mortality in males during infection with t. cruzi . in the present study ,
the selected mouse lines behaved like other mouse lines with susceptible male mice dying with higher numbers of blood trypomastigotes , while in females this association could not be done .
some studies demonstrated that antibodies are responsible for the survival of susceptible animals in the initial phase of t. cruzi infection and for the maintenance of low levels of parasitemia in the chronic phase [ 5557 ] . despite the important effector role of antibody in the control of t. cruzi infection
, resistant lines do not necessarily produce higher levels of specific antibody in comparison to susceptible lines [ 58 , 59 ] .
elevation of specific antibody in the acute phase t. cruzi infection showed no correlation with the survival in isogenic mice .
in the other hand , resistance correlated with enhance of some parasite - specific antibodies isotypes , particularly of igg2b , [ 6062 ] . it has been shown that an x - linked mutation ( that prevents b1 cell development and specific and nonspecific immunoglobulins production ) of balb .
surprisingly , t. cruzi infected xid mice were more resistant than wild - type mice , and the resistance was associated with the absence of il-10 secreting b1 cells and increased production of ifn- [ 63 , 64 ] .
cellular immune responses are considered important components of resistance to t. cruzi infection , with ifn- as a central mediator that activates no - dependent parasiticidal mechanisms in macrophages [ 17 , 65 , 66 ] . in the present study ,
the increased levels of ifn- observed 7 and 15 days after infection in cona - stimulated cells from hiii mice ( figure 5(a ) ) ( as compared to cells from liii mice ) apparently trigger the higher no levels observed in stimulated cells in those animals , suggesting an association between no production and infection resistance .
however , no and ifn- were produced in significant levels in both resistant female and susceptible male mice of the hiii and airmax and airmin lines , indicating that ifn- and no secretion are not the only parameters that contribute to gender differences in infection resistance and may not always correlate with survival , so that other mechanisms must be involved .
wrightsman et al . studied the genetic control of responses to t. cruzi infection and observed that multiple genes were involved in the control of parasitemia and survival , with female f1 hybrid mice from crosses of several susceptible and resistant mouse lines surviving the infections , indicating dominance of the resistance genes .
our results confirmed and extended these observations , indicating an overdominance of the resistance phenotype in f1 ( hiii liii ) mice , with females being more resistant than males .
this data is in agreement with other genetic studies in which infection resistance was observed to be inherited in a dominant manner , with heterozygosity in crosses between susceptible and resistant inbred lines ( or even between two susceptible lines ) increasing resistance [ 2426 , 67 ] .
overall , these results indicate that , in addition to polygenic regulation , there is complementarity between different loci in determining the infection resistance phenotype . the overdominance of the resistance phenotype in selection iii mouse lines led us to choose a segregating population bc - l , created by backcrossing f1 [ hiii liii ] with the susceptible parental liii mice , to carry out the genetic linkage analysis .
backcrosses are more powerful than intercrosses for examining dominant / recessive traits because they eliminate interference from homozygous dominant genotypes in the analyses .
susceptibility to infectious disease is influenced by multiple host genes , most of which are low penetrance qtls that are difficult to map .
so , the strategy that we chose for genetic analysis was to analyze the linkage between the mortality and survival phenotypes after infection of the bc - l population with markers that were previously described as implicated in antibody production regulation as well as other markers implicated in resistance to t. cruzi infection microsatellite markers of qtls for antibody production mapping on chromosomes 1 , 3 , 5 , 6 , 9 , 11 , and 12 were tested in this linkage analysis .
we also genotyped polymorphic microsatellites among lines of selection iii mice that mark chromosomal regions related to resistance to acute infection by t. cruzi on chromosome 7 and near the h-2 locus on murine chromosome 17 [ 67 , 69 ] .
two other markers on chromosome 1 were tested in a region associated with resistance to african trypanosomiasis ( tir3b ) .
we detected a significant association between alleles of an ab qtl on chromosome 1 ( marked by microsatellite d1mit303 at 34.8 cm ) with the survival phenotype after t. cruzi acute infection , obtaining a significant level of cosegregation in this region in spite of the strong influences on the phenotype of environmental factors such as sex hormones and limited population sizes .
described one qtl ( tir3a ) associated with african trypanosomiasis infection adjacent to the abovementioned qtl confidence interval .
this region overlaps a qtl that controls antibody production in hiii and liii mouse lines as well as a putative qtl for acute inflammatory response mapped in airmax and airmin mice .
several genes map at the qtl interval that could interfere in the various steps of innate or adaptative immune response regulation . a candidate gene in this region is slc11a1 ( solute carrier family 11 ; proton - coupled divalent metal ion transporters , member 1 ( formerly known as nramp1 ) ) which is a major gene regulating control of intracellular pathogen infections such as those caused by salmonella typhimurium , leishmania donovani , and mycobacterium bovis bacillus calmette - guerin ( bcg ) in mice and humans .
this gene is also involved in inflammatory autoimmune diseases and seems to interact with other genes to modulate this phenotype , as could be the case with t. cruzi infection in mice selected for acute inflammatory reaction . however , this gene has no influence on the differential response of selection iii mice to t. cruzi because both lines have the resistance associated allele of this gene . despite this
, hiii and liii lines differ in susceptibility to salmonella typhimurium showing that the region that controls antibody production marked by the d1mit303 microsatellite harbor genes involved in resistance to this bacterial infection and also to t. cruzi , in absence of nramp1 polymorphism . also in humans a lack of association between nramp1 gene polymorphism and t. cruzi infection was described .
other genes located in this region , such as casp8 , icos ( induced t - cell costimulator ) , cd28 , and chemokine receptors cxcr1 and cxcr2 ( il-8 receptor ) could also be involved in this phenotype by regulating activation of the inflammatory and adaptive immune responses .
genes evolved in apoptosis like casp8 may be implicated in the different resistance pattern we observed .
infection with t. cruzi triggers apoptosis of t and b lymphocytes , and lymphocyte apoptosis has immunoregulatory implications for host immune responses .
treatment in vivo with a caspase inhibitor reduces lymphocyte apoptosis and improves protective immune responses in mice infected with t. cruzi .
other studies assessed the involvement of caspase signaling in thymocyte death during t. cruzi infection and showed that caspase-8 and caspase-9 mediate thymocyte apoptosis in trypanosoma cruzi acutely infected mice .
another gene described in this region codes for cd28 molecule that mediates costimulatory signals required for t - cell activation .
the involvement of cd28 in the modulation of protective immunity against t. cruzi was shown by mediating the activation of both cd4 + and cd8 + t cells , the production of ifn- , and , as a consequence , the production of no efficient to control parasite growth during the acute phase of the infection .
when infected with the low virulent sylvio x10/4 trypanosome strain cd28-ko mice exhibited resistant phenotype , with no parasitemia or mortality .
the role of cxc chemokines in proinflammatory phenotype , developed by t. cruzi infection , was shown by experiments , in which tissue culture trypomastigotes activate innate sentinel cells via tlr2 , releasing cxc chemokines , which in turn evoke neutrophil / cxcr2-dependent extravasation of plasma proteins , including high molecular weight kininogen , in parasite infected tissues [ 81 , 82 ] .
the qtl on chromosomes 3 and 9 that show the highest cosegregation significance with antibody production levels in hiii and liii mice were not involved in t. cruzi infection control . in previous studies with parasite infections ,
the response of selection iii lines to infection by the protozoan toxoplasma gondii showed correlation with the potentiality of specific antibody production of their lines .
also in the course of infection by y strain of t. cruzi , minor mortality rates and more efficient control of parasitemia were associated with significant differences in t. cruzi specific igg antibodies .
herein , using cl strain , we quantified antibodies against t. cruzi antigen during the acute phase of infection but no differences in specific antibody production could be detected between lines , in spite of an increase of both igm and igg levels at 20 days of infection ( data not shown ) , presumably due to a polyclonal activation induced by this parasite [ 85 , 86 ] .
the chromosome 5 ab qtl located at 85 cm was not associated with the phenotypes analyzed here , although graefe et al . [ 67 , 87 ] described a locus on chromosome 5 at 58 cm associated with male mortality in the acute phase of t. cruzi tulahuen strain infection .
iraqi et al . also described a qtl associated with survival of t. congolense infections adjacent to this region ( at 4244 cm ) .
one reason for the failure to detect any association may be the large genetic distance between the marker and the published t. cruzi resistance qtl on this chromosome . the markers available in this 4060 cm interval in the microsatellite panel used for mapping ab qtl were not polymorphic among the hiii and liii lines , and additional markers will need to be tested for polymorphism and any associations before definitive conclusions can be drawn .
the chromosome 11 qtl showed the highest significance among the resistance loci ( survival ) to the y strain parasite in inbred mice . these and other authors also described a qtl on chromosome 17 close to the h-2 complex as a determinant of responses to challenge with both t. congolense ( tir1 ) and t. cruzi , although this region was not associated with either t. cruzi infection control or antibody production phenotypes in hiii and liii mouse lines in the present study [ 30 , 88 ] .
differential gene expression was analyzed in the spleens of infected susceptible c57bl/6 and resistant ( c57bl/6 x dba/2 ) f1 mice using microarrays , and the results suggested that the differential transcription of certain genes involved in immune responses and inflammatory processes accounted for the differences in susceptibility to the tulahuen strain of t. cruzi . in humans
many genetic linkages and association studies have attempted to identify genetic variations that are involved in immunopathogenesis of chagas disease . however ,
susceptibility / resistance to chagas disease involves multiple genetic variants functioning jointly , each with small or moderate effects .
polymorphism in the actc1 gene of humans contributes to the progression to chronic autoimmune chagas cardiomyopathy , and polymorphisms of other genes that affect several immune parameters such as innate immunity , signal transduction , and t - cell / monocyte migration to inflammatory regions play a role in genetic susceptibility to ccc development .
our data suggest that one out of the several quantitative trait loci that regulate antibody production also contributes to the control of t. cruzi infection .
the modifications in mechanisms that lead to differential immune response of hiii and liii selected lines rather than the produced anti - t .
overall , the results of this study demonstrated that an immunomodulatory qtl mapping on mouse chromosome 1 significantly cosegregated with the phenotype of survival time to acute t. cruzi infection .
therefore , our data indicates that a region controlling ab production and inflammation on mouse chromosome 1 harbors genetic factors that also determine resistance to acute t. cruzi infections .
this region had not previously been implicated with this disease , demonstrating the potential of this genetic model for dissecting complex multigenic regulated traits . | trypanosoma cruzi infection was studied in mouse lines selected for maximal ( airmax ) or minimal ( airmin ) acute inflammatory reaction and for high ( hiii ) or low ( liii ) antibody ( ab ) responses to complex antigens .
resistance was associated with gender ( females ) and strain the high responder lines airmax and hiii were resistant .
the higher resistance of hiii as compared to liii mice extended to higher infective doses and was correlated with enhanced production of ifn- and nitric oxide production by peritoneal and lymph node cells , in hiii males and females .
we also analyzed the involvement of previously mapped ab and t. cruzi response qtl with the survival of selection iii mice to t. cruzi infections in a segregating backcross [ f1(hiiiliii ) liii ] population .
an ab production qtl marker mapping to mouse chromosome 1 ( 34.8 cm ) significantly cosegregated with survival after acute t. cruzi infections , indicating that this region also harbors genes whose alleles modulate resistance to acute t. cruzi infection . |
malignant brain cancer persists as a catastrophic illness and is the second leading cause of cancer death in children [ 14 ] .
the failure to effectively manage malignant brain cancer has been due in large part to the highly invasive nature of the disease and to the unique anatomical and metabolic environment of the brain , which prevents the large - scale resection of tumor tissue and impedes the delivery of therapeutic drugs .
invasion / metastasis involves the dissemination of tumor cells from the primary neoplasm to surrounding tissue and distant regions .
in addition , the invasive cells establish a microenvironment facilitating colonization ( angiogenesis and further proliferation ) , resulting in macroscopic malignant secondary tumors [ 5 , 6 ] .
tumor cell invasion is correlated with tumor angiogenesis ( vascularity ) , as prognosis is generally worse for brain tumors that are more vascular than for those that are less vascular [ 79 ] .
consequently , therapies that can simultaneously target both angiogenesis and invasion could provide effective longer - term management of malignant brain cancer .
gangliosides are a family of cell surface - enriched glycosphingolipids that have long been implicated in tumorigenesis [ 1012 ] .
these molecules contain an oligosaccharide head group attached to a lipophilic ceramide , consisting of a sphingosine base and a long - chain fatty acid ( figure 1 ) .
the presence of sialic acid ( n - acetylneuraminic acid , neuac ) distinguishes the gangliosides from other glycosphingolipids .
gangliosides are anchored in the outer surface of plasma membranes through their ceramide moiety , which allows the head group to modulate numerous cell surface events such as growth , migration , adhesion , and signaling [ 1215 ] .
the structurally simple monosialoganglioside gm3 contains a single terminal sialic acid ( figure 1 ) .
n - acetylneuraminic acid is the predominant sialic acid species expressed in mammalian brain gangliosides [ 16 , 17 ] .
in contrast to n - acetylneuraminic acid , n - glycolylneuraminic acid is a predominant sialic acid species expressed in gangliosides from nonneural tissues of most nonhuman species ( rodents , bovine , etc . ) . as humans lack the gene for the synthesis of n - glycolylneuraminic acid [ 18 , 19 ] , expression of n - glycolylneuraminic acid in gangliosides of human cells or tissues is attributed to contamination from exposure to nonhuman serum or from diet [ 17 , 20 , 21 ] .
the involvement of gangliosides in angiogenesis is dependent on the intact molecules as neither asialo species nor sialic alone influence angiogenesis .
gm3 modulates the function of several receptors implicated with angiogenesis to include those for the insulin - like growth factor-1 ( igf-1 ) , basic fibroblast growth factor ( b - fgf ) , epidermal growth factor ( egf ) , platelet - derived growth factor ( pdgf ) , vascular endothelial growth factor ( vegf ) , and cell adhesion molecules including the integrins [ 7 , 12 , 2328 ] .
furthermore , alessandri , ziche , and coworkers originally found that several complex gangliosides ( gm2 , gm1 , gd3 , gd1a , gd1b , and gt1b ) enhanced the action of angiogenic inducers , whereas ganglioside gm3 was inhibitory [ 3032 ] .
these observations suggest that gm3 could have therapeutic potential against tumor cell proliferation and angiogenesis . the ratio of gm3 to the proangiogenic gangliosides gd3 and gd1a ( gm3/gd3 ; gm3/gd1a ) is lower in more metastatic and aggressive tumors than that in less metastatic tumors [ 7 , 3335 ] , suggesting that elevated expression of complex gangliosides enhances tumor malignancy .
in contrast to most human glioma tumor tissues , which contain high levels of the pro - angiogenic ganglioside gd3 [ 3641 ] , gd3 is not heavily expressed in mouse brain tumors or in most cultured human brain tumor cells [ 17 , 4244 ] .
although gm3 is also expressed in malignant human brain tumors , we think that gm3 expression in these tumors might serve to regulate or to counteract the pro - angiogenic action of gd3 and other complex gangliosides .
table 1 summarizes data from our previous studies on the association of gm3 expression with the angiogenic properties of multiple experimental mouse and human brain tumor models [ 17 , 44 , 45 ] .
this survey shows that brain tumors with high gm3 expression are less angiogenic ( vascularized ) than brain tumors with low gm3 expression .
gm3 expression was also correlated with greater cell - cell adhesion and slower growth [ 14 , 44 ] .
we later showed that the gene - linked knockdown of gm3 expression in the experimental ependymoblastoma ( epen ) tumor , which contains gm3 as the only ganglioside , increased vascularity ( angiogenesis ) .
an opposite effect was observed in the highly angiogenic ct-2a astrocytoma when we upregulated gm3 expression ( below )
. these and other findings led us to conclude that the ratio of gm3 to complex gangliosides ( gm1 , gd1a , gt1b ) can influence the angiogenic properties of a broad range of brain tumor types and are consistent with previous findings on the role of gm3 in other systems [ 22 , 29 , 32 , 41 , 4649 ] .
the ct-2a astrocytoma was produced following implantation of the chemical carcinogen , 20-methylcholanthrene , into the cerebral cortex of c57bl/6j mouse according to the procedures of zimmerman and arnold [ 44 , 50 ] .
the ct-2a tumor grows rapidly , is deficient in the phosphatase and tensin homologue / tuberous sclerosis complex 2 , and is highly angiogenic [ 7 , 51 , 52 ] .
we used an antisense construct to inhibit galnac - t expression in ct-2a cells as shown in ( figure 2 ) .
this caused a significant shift in ganglioside distribution , elevating gm3 content while reducing gd1a content ( figure 3 ) .
the shift in ganglioside distribution significantly reduced growth , vegf gene and protein expression , and blood vessel density in the orthotopically grown ct-2a tumors ( figure 4 ) . moreover , the shift in ganglioside distribution reduced gene expression for hypoxia inducible factor 1a ( hif-1 ) and the vegf coreceptor neruropilin-1 ( np-1 ) in the ct-2a cultured cells ( figure 5 ) .
this is interesting as hif-1 is a transcription factor that regulates vegf expression through the pi-3k / akt signaling pathway [ 51 , 5355 ] .
viewed collectively , these data show that endogenous upregulation of gm3 reduces growth and angiogenesis in the rapidly growing and highly vascularized ct-2a mouse astrocytoma .
it was initially unclear , however , whether it was the elevation of gm3 , the reduction of the pro - angiogenic ganglioside gd1a , or the change in gm3/gd1a ratio that was responsible for the reduction in ct-2a angiogenesis .
it is well documented that gangliosides are shed from tumor cells into the microenvironment where stromal ( endothelial ) cells take them up to influence tumor progression [ 5660 ] .
our most recent findings show that gm3 , by itself , markedly reduces ct-2a vascularity when grown in the in vivo matrigel model ( figure 6 ) .
these findings suggest that gm3 could be applied as a drug therapy directly to the tumor site and to surrounding areas following surgical tumor resection in humans .
alternatively , gm3 could be applied in liposomes as a pharmacotherapy for preformed tumors .
our findings in brain tumor cells are also consistent with previous findings in rabbit cornea showing that gm3 applied directly to tissue is anti - angiogenic . viewed , collectively , our findings indicate that gm3 has powerful anti - angiogenic action against the ct-2a astrocytoma when present in the microenvironment and can counteract the pro - angiogenic effects of complex gangliosides .
further evidence for a direct anti - angiogenic role of gm3 came from our recent studies with human umbilical vein endothelial cells , huvec .
we found that gm3 , by itself , significantly suppresses vegf - induced proliferation and migration of huvec .
moreover , gm3 significantly blocks gd1a - induced angiogenesis in the in vivo matrigel assay ( figure 7 ) .
gd1a is a complex ganglioside associated with enhanced angiogenesis [ 7 , 61 ] .
the suppression of vegf receptor 2 and akt phosphorylation underlies the anti - angiogenic effect of gm3 on huvec ( figure 8) .
additionally , the epen tumor , which expresses only gm3 , has few blood vessels relative to tumors that express complex gangliosides [ 44 , 45 ] .
consistent with our findings , chung and coworkers recently showed that gm3 could suppress angiogenesis through the inactivation of vegf - induced signaling by direct interaction with vegfr-2 .
gm3 treatment could also reduce in vivo vascularity in the lewis lung carcinoma model , while van cruijsen et al .
showed that vascularity was less and patient survival was better for nonsmall cell lung carcinomas that contained more gm3 than less gm3 .
hence , gm3 is anti - angiogenic through its inhibition of the proangiogenic actions of complex gangliosides as well as through its direct inhibition of endothelial cell growth . in summary ,
although gm3 is elevated in human malignant brain tumors , its concentration is less than that of complex gangliosides especially gd3 .
we suggest that increasing the ratio of gm3 to complex gangliosides may be effective in reducing angiogenesis and growth in human glioblastomas . our findings suggest that pharmacological application of gm3 is warranted as a potential nontoxic anti - angiogenic therapy for malignant brain cancer . | progression of malignant brain tumors is dependent upon vascularity and is associated with altered ganglioside composition and distribution .
evidence is reviewed showing that the simple monosialoganglioside , gm3 , possesses powerful antiangiogenic action against the highly vascularized ct-2a mouse astrocytoma , which primarily expresses complex gangliosides .
brain tumors expressing high levels of gm3 are generally less vascularized and grow slower than tumors that express low levels of gm3 .
gm3 inhibits angiogenesis through autocrine and paracrine effects on vascular endothelial growth factor ( vegf ) and associated receptors .
gm3 should be a clinically useful compound for managing brain tumor angiogenesis . |
to ultimately understand the structure - function relationship resulting from protein isoform variation , mutation , and posttranslational modification , one must be able to quantify the functional effect of the structural alteration on the interaction of the protein with its binding proteins .
traditional methodologies used to investigate these interactions , such as equilibrium dialysis and affinity chromatography , rely on large amounts of proteins , are time consuming , and are labor intensive . while newer methodologies such as frster resonance energy transfer or surface plasmon resonance utilize less protein and can be of high throughput , they rely on specialized , costly equipment and/or modification of the target protein with labeling that by itself may alter the protein - protein interaction to be investigated . over the past number of years , we have developed a novel microplate - based solid - phase protein - protein binding assay .
this assay requires no specialized equipment , uses a minimal amount of protein , is rapid throughput , does not rely on modification of the target protein , and results in quantitative measurements . in this assay one of the proteins of interest
is noncovalently immobilized to a solid phase followed by incubation with a soluble binding partner protein dissolved in a physiological solution .
binding is then detected via an antibody against the soluble partner protein using enzyme - linked immunosorbent assay ( elisa ) .
here we present the detailed methodology for this novel high - throughout protein - binding assay that we have successfully employed for investigating myofilament protein binding , including troponin t to tropomyosin [ 13 ] and troponin t to troponin i [ 1 , 2 , 4 ] .
the assay is also highly effective in revealing the functional effects of muscle myofilament protein alternative splicing variants [ 1 , 2 ] , phosphorylation , restrictive proteolysis [ 4 , 6 ] , point mutations , as well as the effects of solution salt , metal ions , or ph on myofilament protein binding [ 811 ] .
in addition , this methodology has also been used to study the binding of calponin [ 12 , 13 ] and titin motifs to f - actin . beyond these applications this assay
any protein binding pair can be analyzed provided that a specific antibody against one of the proteins is available . in this paper
we first discuss traditional protein - binding assays and use this background to present the general concepts of the microplate elisa - based solid - phase protein - binding assay .
we then provide detailed methodology to conduct a simple binary solid - phase binding assay .
finally , we will discuss modifications expanding on the simple binary binding experiment and optimization of the assay conditions .
classical assays to measure the interaction and binding of one protein to another largely consist of two main methodologies : ( 1 ) equilibrium dialysis and ( 2 ) affinity chromatography .
these two methodologies rely on different principals to separate bound from nonbound interacting proteins . to determine the affinity of two proteins for each other by equilibrium dialysis , the experimental proteins of known concentration
are placed in two chambers separated from each other by a membrane permeable to only one of the proteins .
the permeable protein is then allowed to diffuse across the membrane and bind the nonpermeable protein .
once the permeable protein achieves equilibrium between the two chambers , its free concentration is determined in the chamber lacking the impermeable protein . following dialysis of the protein pair at appropriate concentrations ,
the dialysis can be conducted with one or more variants of one of the two proteins for comparison .
equilibrium dialysis , thus , provides the affinity of one protein for another at equilibrium between association and disassociation in solution .
although the data generated by equilibrium dialysis is quantitatively informative , a major limitation of this method is that it requires a size difference between the two binding proteins to be distinguishable by the dialysis membrane .
the downfall of this method also includes its labor - intensive nature and its requirement for large amounts of the proteins .
affinity chromatography requires immobilization of one protein to a support resin that is usually packed into a column for chromatographic analysis .
the binding partner protein in solution is then incubated with the protein - resin conjugate at sufficient concentration and contact time to saturate its binding to the immobilized protein . the binding affinity between the two proteins is then assessed by step or continuous gradient elution with a buffer condition that weakens the protein - protein interaction and the strength of elution necessary to achieve peak dissociation of the bound protein determined .
once the bound protein is completely eluted , the column can be reequilibrated and a similar measurement conducted for another or variant partner protein . unlike the solution steady - state binding measured in the equilibrium dialysis method , affinity chromatography measures a nonequilibrium disassociation rate from a maximally bound state .
therefore , by its nature this assay only investigates the disassociation characteristic of the two proteins .
further drawbacks of this methodology include the measurement of only relative affinity and the necessity of chemically coupling one of the proteins to a support resin , which by itself may affect the structure and function of the immobilized protein .
the solid - phase protein - binding assay was developed as an alternate methodology to asses association and disassociation of protein - protein interactions using relatively small amounts of protein without specialized equipment .
the basis for the solid - phase protein - binding assay is derived from elisa - based methodology .
the rational for designing the protein - binding assay based on elisa , a well - established immunological assay , is that the antibody - antigen interaction measured by various immunological detection methods is basically a protein - protein interaction .
the first is immobilization of a protein to the wells of an assay plate by noncovalent coating .
, we will first describe details of a standard solid - phase protein - binding assay followed by variants of the assay for extending its applications .
the simplest and most widely used format is the binary binding assay that measures the interaction between two proteins , one immobilized and the other free in solution .
this assay format is commonly used to compare the binding interactions between an immobilized protein to two or more variants of a soluble partner protein . however
, the assay can be designed such that the variant proteins are either in the solution or immobilized position . although simple in its design , the binary assay format ( figure 1(a ) ) demonstrates the basis of the solid phase protein binding assay . in this experimental system a single protein is noncovalently coated through absorption to the well surface of a 96-well polystyrene ( not polypropylene ) assay plate .
the remaining available binding surfaces of the wells are blocked with a non - interacting protein such as bovine serum albumin ( bsa ) often together with a nonionic detergent .
the plate is then washed again followed by adding serial dilutions of the binding partner protein to the wells and incubated allowing equilibrium binding with the immobilized protein to be reached . remaining free protein in solution
is then removed followed by washes , and the portion of the partner protein bound to the immobilized protein is quantified through detection via an antibody specific to the binding partner protein .
the enzyme , for example , horse radish peroxidase ( hrp ) , can be directly conjugated to the detecting antibody ; however , it is more convenient to use an enzyme - conjugated second antibody . in this setting a primary antibody specifically recognizing the bound protein is used as the detecting antibody , and excess antibody
subsequently an enzyme - conjugated second antibody recognizing the detecting primary antibody is added for another step of incubation followed by washes to remove excess second antibody .
the amount of the bound enzyme - linked second antibody is in direct proportion to the amount of bound primary detecting antibody that is determined by the amount of the soluble partner protein remaining bound to the immobilized protein . as the result of
this direct relationship between the bound protein and enzyme - linked secondary antibody , the intensity of the color or fluorescence product produced from the substrate reaction is quantitatively dependent on the amount of the soluble protein remaining bound to the immobilized protein . by plotting the microplate readings against the concentration of the free protein used in the equilibrium binding step
, the association and disassociation features can be compared between two or more variants of the proteins studied .
as outlined above , figure 1(a ) shows the basic design of the solid - phase protein - protein binding assay consisting of a binary protein - binding experiment .
the design of the binary binding experiment investigates the binding characteristics between two proteins , one of which is immobilized in the wells of microplate and allowed to incubate with the binding partner protein in solution .
a thorough understanding of this basic experimental setting will provide the foundation for understanding more sophisticated designs derived from it .
for this reason we will first present the binary binding assay protocol and then the application of this methodology to other designs . as routinely employed in our laboratories , the binary protein - binding experiment consists of coating the immobilized protein through noncovalent absorption , binding of the partner protein , and indirect elisa detection of the protein binding .
this section will describe the detailed protocol to conduct the binary binding assay similar to that described in our previous publications [ 2 , 9 , 15 ] .
a standard 500 ml laboratory wash bottle that can be used to provide a consistent stream of wash buffer from a spout to fill the wells of the assay plate .
buffer a ( buf a ; 100 mm kcl , 3 mm mgcl2 , and 10 mm pipes , ph 7.0 ) can be made as a 5x stock , stable at room temperature .
neutral or alkaline ph is required for proper coating of the immobilized protein to the plate .
a concentration of 36 m urea can be included for the coating of less soluble proteins .
neutral ph should be used for the urea - coating buffer to avoid carbamylation of the protein .
most proteins will refold well following immobilization during the blocking step after urea is removed .
substrate solution ( 2,2-azino - bis(3-ethylbenzo - thiazoline-6-sulfonic acid ( abts)/h2o2 is used for horseradish peroxidase - conjugated first or second antibody ) .
0.04% abts diammonium is dissolved in 65.7 mm citric acid monohydrate , 34 mm sodium citrate dihydrate , ph 4.0 , adjusted with sodium citrate dihydrate .
the substrate stock should be made in autoclaved , deionized water with autoclaved tools to avoid peroxidase contamination and stored at 20c in aliquots of the volume for individual experiments . before use
the substrate solution is brought to room temperature and immediately prior to its application , 0.03% h2o2 added .
microplate reader capable of reading absorbance at 415 nm or 405 nm ( for the abts substrate ) .
although it is necessary to have a specific antibody against one of the proteins to be studied , current methods of generating recombinant fusion proteins with a tag , such as flag or his6 - 8 , and the availability of antibodies against such tags allow this approach to be applied to a wide range of protein interactions , overcoming the restriction from the availability of a specific antibody .
horseradish peroxidase - conjugated second antibody that recognizes the primary antibody species ( e.g. , goat anti - mouse igg horseradish peroxidase conjugated secondary antibody ) was used in our studies employing mouse monoclonal primary antibodies .
a practical binary protein - binding assay design consists of eight dilutions of the soluble binding protein in triplicate .
the 8 12 well format of the 96-well microplate should be considered in the assay design .
for example , the immobilized protein can be arranged in columns ( a to h ) and incubated with eight serial dilutions of the soluble variant proteins .
the assay design should also include control columns for each variant protein consisting of the serial diluted soluble protein incubated in triplicate wells without immobilized protein .
figure 2 illustrates the 96-well microplate layout of a typical binary binding experiment conducted in triplicate for two variant soluble proteins .
it is preferred that the single partner protein is selected to be the immobilized protein with the two or more variant binding proteins incubated in the soluble phase .
this strategy will ensure a uniform level of the coated protein for the comparison among the variants of the binding protein .
however , multiple variants of the proteins to be studied may be coated under similar conditions for incubation with a single soluble partner protein as well .
standard coating of the immobilized protein occurs through absorption to the wells of the assay plate based on hydrophobic interactions between the plastic surface of the assay plate and the nonpolar amino acid residues of the protein to be immobilized .
the coating of the immobilized protein onto the wells of a microtiter plate is performed at 100 l / well with 25 g / ml protein in buf a by incubation at 4c sealed overnight .
coating conducted at these protein concentrations is in excess of the amount able to bind the plate well for most proteins of 10200 kda in size .
the use of excess amount of protein for coating exploits conditions to ensure saturated coating to minimize variation of the assay .
most small proteins or peptide fragments are sufficiently immobilized to the plate well to allow a robust assay . in the case that simple hydrophobic absorption does not result in a sufficient amount and strength of coating
; microplates with added reactive groups for covalent conjugation may be considered ( see section 4.10 ) . to begin protein binding ,
the well contents of the microplate are emptied by shaking into a sink , and the remaining solution removed by tapping onto a stack of paper towels .
the plate is then washed once rapidly to avoid protein drying by the addition of a volume of buf t sufficient to fill each well using a squishing bottle ( see section 4.6 ) . following filling of the wells
, the washing buffer is emptied as above , tapped dry , and the wells are blocked with 150 l / well 1% bsa in buf t by incubation at room temperature for 1 hr sealed . when dealing with limited protein material , the coating protein solution may be recovered for reuse , although the resulting coating capacity may decrease . following empting of the blocking solution from the wells and tapping ,
the plate is washed three times with buf t to remove free protein ( see section 4.6 ) .
serial dilutions of the binding partner protein solution in buf b are then added to the wells at 100 l / well and incubated with the immobilized protein at room temperature for 2 hrs sealed . a typical binding assay designed for myofilament proteins
consists of free protein concentrations starting from 0.51 m and eight 3-fold serial dilutions ( figure 2 ) . following protein - binding incubation ,
the well contents are emptied by shaking into the sink , the remaining solution is removed by tapping onto paper towels , and the plate is washed a total of three times with buf t in a total period of 10 min .
the lag time between emptying the well to filling with buf t should be as short as possible to avoid drying of the binding protein on the plate resulting in high background .
washing is conducted using a squishing bottle by applying a consistent stream of buf t to sequentially fill the wells without overfilling .
accurate filling is critical for the first wash to avoid spilling over trace amount of the binding protein between wells , especially from high to low concentration and from positive to negative control wells .
it is useful to start the wash stream outside of the plate and then move sequentially through the wells delivering a continuing stream of wash solution while moving from well to well .
it is helpful to hold the plate slightly tilted , beginning filling from the lower - side rows .
after the first filling , the washing buffer is immediately removed followed by the second wash .
this will limit the time for any spillover protein to interact at a significant concentration with the immobilized protein in unwanted wells .
the plate is then allowed to incubate at room temperature for approximately 3 min .
the wash procedure is repeated for the 3rd time and allowed to incubate approximately 4 min before final removal of the washing buffer as above .
the washing condition is an important factor in determining the effectiveness and stringency of the assay by eliminating nonspecific binding while quantitatively evaluating the dissociation of specific binding between the protein pair .
using appropriate washing conditions will allow evaluating the coupling strength of the two proteins studied .
more stringent separation by increasing the number of buffer changes , duration of the washes , and/or the detergent concentration will differentially affect weak and strong bindings as a sensitive method to reveal differences among protein variants of interest .
it is worth noting that no single washing condition fits all protein - protein interactions , and the wash strength should be evaluated empirically .
the partner protein specifically bound to the immobilized protein is detected using an elisa procedure in which an antibody recognizing the partner protein is the primary reagent ( figure 1(a ) ) .
following the final wash to remove unbound partner protein a predetermined , constant dilution of the primary antibody in buf b is added to all the wells at 100 l / well using a multi - channel pipette and incubated sealed at room temperature for 1 hr .
the working concentration of the primary antibody should be predetermined to give a final absorbance of around 1.0 by elisa titration against the partner protein directly coated to a microplate in the same buffer system , incubation , and washing conditions .
the antibody solution should be added quickly such that the well contents do not dry out .
the plate is then washed 3 times in 10 min as described in the washing section .
a constant dilution of hrp - conjugated second antibody against the primary antibody in buf b is added to all the wells at 100 l / well and incubated at room temperature for 45 min .
similar to that of the primary antibody , the second antibody 's working concentration should be determined empirically .
the plate is then washed 3 times in 10 min as described in the washing section ( see section 4.10 ) prior to adding 100 l / well of the abts - h2o2 substrate solution .
the substrate reaction is incubated at room temperature with periodic mixing ( e.g. , 2 - 3 seconds shaking in the plate reader ) and the color development monitored by absorbance reading at 415 nm or 405 nm using a microplate reader at several time intervals ( e.g. , 5 , 10 , 15 , 20 , 25 , and 30 min ) .
the well of highest absorbance is then plotted against time and a time point chosen for analysis before deviation from linear color development . under typical assay conditions , this will be between 10 to 20 minutes of development .
the time of development should also be such that the absorbance reading remains within the reliable reading range of the microplate reader , less than 2.0 for most instruments .
if the color development is too quick and the absorbance values too high , the concentration of the primary and/or second antibody should be decreased .
background absorbance for each serial dilution of the binding protein is determined from 3 control wells not coated with immobilized protein but processed the same as the assays wells .
absorbance of the 3 control wells is averaged , and this value is subtracted from data readings for that dilution .
resultant absorbance values at the highest concentration of each binding protein are averaged as the maximum ( 100% ) binding for that protein .
it is important to only compare the absolute values of the maximal binding from experiments conducted at the same time to avoid the effect of day - to - day variations .
background - subtracted absorbance values for each dilution of the binding protein are then normalized to the average maximal binding value and the titration curve plotted against a log scale of the dilution concentrations .
the curve is then fit to determine the soluble protein concentration required to reach 50% maximal binding .
although it is best to compare the 50% maximal binding values of protein variants from the same assay , it is possible to compare day - to - day results as long as the reagents , incubation times , washing stringency , and room temperature remain consistent ( figure 3 ) .
the above procedure provides relative comparisons between two or more binding protein variants for their interaction with the immobilized protein . with a standard curve produced with known concentrations of the binding partner protein ,
this approach can be employed to gain quantification of the partner in an unknown sample of purified protein , body fluid , or tissue homogenate .
the molar concentration required for 50% maximal binding of the soluble partner protein to the immobilized protein reflects the on - rate of their association at equilibrium and is a representative of the binding affinity ( ka ) .
although the strength and time of washing will affect the nonequilibrium disassociation of the binding protein , these conditions affect all samples similarly .
thus , the initial binding between the immobilized and free proteins during equilibrium incubation is determined by the intrinsic affinity between the protein pair . on the other hand
, the level of maximal binding of the soluble partner protein to a given amount of the immobilized protein represents their coupling strength or resistance to the washes .
in contrast to the maximally saturated binding achieved during the equilibrium incubation step , during washes the absence of free soluble binding protein produces nonequilibrium dissociation .
thus , this coupling strength determined in the solid - phase protein - binding assay employing stringent washing - separation steps reflects the off - rate of the protein pair 's binding . in the assay system , immobilized protein coating is conditioned to a maximum , and binding of the partner protein at high concentration reflects saturated binding . therefore , similar to that in affinity chromatography , the disassociation resulting from wash separation conditions is a highly sensitive measure to provide information of the disassociation rate ( kd ) of the protein pair studied .
washing strength can , therefore , be altered to exploit coupling strength differences between protein variants .
a number of conditions can be modified to optimize the solid - phase protein - binding assay allowing investigation of a number of specific protein - protein interactions , including nonmuscle proteins . unlike most traditional protein
binding assays , a unique advantage of the microplat - based protein binding assay is that it allows different buffer conditions during the incubation and washing steps .
for example , one may coat a low - solubility protein to the plate by dissolving it in a modified coating buffer containing high salt and/or 36 m urea .
the salt and urea will then be washed away , and the following binding assay can be performed in physiological buffers .
another example is that reducing agents may be included for coating and protein - binding steps but removed before the antibody incubation steps ( reducing agents will dissociate the quaternary structure of immunoglobulins ) .
further examples include the use of different buffer conditions for the equilibration protein - binding step and the washing steps that determine the stringency for separately investigating association and dissociation rates .
small peptides that are weak in hydrophobic absorption may be immobilized as a conjugate with a carrier protein .
small peptides may also be immobilized through a specific interaction such as the use of biotin - streptavidin system .
microtiter assay plates of varied surface chemistry can be used to enhance the coating of the immobilized protein .
for example , covalent bonding of peptides can be achieved via precoating the plate with a hydrophilic polymer such as soluble dextran treated with 2,2,2-triflouroethanesulphonyl chloride ( tresyl chloride ) to activate hydroxyl groups . as discussed above
, separation strength can be varied by altering the number , time , or stringency of the washes to exploit the properties of the interaction between the protein pair studied .
issues of low amounts of protein binding can be overcome by employing detection methods of increased sensitivity .
alternatively , instead of abts , o - phenylenediamine ( opd ) or 3,3,5,-tetramethylbenzidine ( tmb ) can be employed as the substrate to increase detection sensitivity of weaker binding protein pairs .
if labeling a protein does not interfere with its binding , the binding partner protein can directly be labeled by conjugation to a fluorescent tag and its binding to the immobilized protein detected by measuring fluorescence of the bound protein . taken together
the adaptability of the solid - phase protein - binding assay offers significant flexibility to develop specifically optimized experiments allowing for the investigation of a wide range of proteins under varied conditions .
as presented above , the simple binary protein - binding assay can provide significant information regarding differences in the interaction of one protein with another .
additionally the solid - phase protein - binding assay is amendable to provide information on more than binary protein - protein interactions . with appropriate optimization
, other protein - protein interactions of increased complexity can be studied using this approach .
one or both of the binding partners may be a protein complex as long as a suitable antibody is available for the elisa detection .
this methodology can also be readily applied to multilayer binding assays and competition assays . in the multilayer binding assay
an additional protein binding step can be added to evaluate the binding among the subunits of a multiprotein complex ( figure 1(b ) ) .
we have successfully employed a similar multilayer assay in our laboratory investigating the binding of tropomyosin and troponin t in the presence of filamentous actin ( unpublished data ) . likewise , other multi - protein complexes or binding cofactors could similarly be investigated . in the competition assay , binding of a partner protein at a constant concentration to the immobilized protein is carried out in the presence of serial concentrations of a competitive protein ( figure 1(c ) ) . using a specific primary antibody to detect the partner protein
, its affinity to the immobilized protein relative to that of the competitive protein can be assessed .
the competition assay design can be modified to study the blocking effect of a protein , a peptide , or a small - molecule ligand on the binding of the partner protein to the immobilized protein .
the competition assay is also applicable not only to two proteins but also to two isoforms of the same protein or different posttranslational modifications to asses the effect of the modification on binding .
the competition assay is also amendable to study the spatial relationship between a protein - binding site and an antibody - binding site . using a monoclonal or anti - peptide antibody against a known epitope of structural and/or functional interests ,
the assay can be extended to identify binding partners of the protein in a complex mixture through competitive blocking of the antibody epitope by protein binding .
likewise , substrate - enzyme interactions could be investigated using a similar competitive approach by employing an antibody against the catalytic site .
when an antibody probe is available , the competitive assay configuration is likewise applicable to study the interactions between proteins and cofactors .
although the solid - phase protein - binding assay is readily amendable to a number of different situations , a few key points must be observed to ensure success .
importantly , reducing agents must be excluded from all buffers for the primary antibody incubation and subsequent steps .
the inclusion of reducing agents in these steps will disrupt immunoglobulin disulfide bonds destroying the ability of the antibody to detect the bound protein and , thus , rendering no signal .
furthermore , although employing methods of increased sensitivity can help with detection of low - affinity binding , this methodology , applying high stringent washes , is most effective in studying high - affinity binding events .
we have presented detailed methodology of a novel solid - phase binding assay to assess protein - protein interactions emphasizing examples using muscle regulatory proteins .
this assay expands on previous methodologies to provide a simple and high - throughput assay to assess protein - protein interactions in solution .
in contrast to many other current methods that process a few samples a time , this approach readily handles hundreds of assay wells by a single operator in a days time using common laboratory equipment . by employing the adaptations and optimizations discussed , this assay should be readily applicable to the quantitative assessment of other nonmuscle proteins interactions . | to understand the structure - function relationship of muscle - regulatory - protein isoforms , mutations , and posttranslational modifications , it is necessary to probe functional effects at the level of the protein - protein interaction .
traditional methodologies assessing such protein - protein interactions are laborious and require significant amounts of purified protein , while many current methodologies require costly and specialized equipment or modification of the proteins , which may affect their interaction . to address these issues
, we developed a novel method of microplate - based solid - phase protein - binding assay over the recent years .
this method assesses specific protein - protein interactions at physiological conditions , utilizes relatively small amounts of protein , is free of protein modification , and does not require specialized instrumentation . here
we present detailed methodology for the solid - phase protein - binding assay with examples that we have successfully applied to quantify interactions of myofilament - regulatory proteins .
we further provide considerations for optimization of the assay conditions and its broader application in studies of other protein - protein interactions . |
ethiopia has one of the worst maternal mortality ratios in the world , at 673 per 100,000 ( range 54810).1 concealed within this figure is a marked urban / rural split .
the 2011 ethiopian demographic health survey carried out by the ministry of health showed that in the capital , addis ababa , 82% of mothers deliver in a health facility whereas in the amhara and afar districts that are largely rural , the rates are 10% and 7% , respectively.2 there are many problems involved in overcoming this .
for example , in the amhara region of ethiopia with a population of over 20 million people there were 16 hospitals in 2010 and only six of these could reliably deliver emergency obstetric care .
lack of facilities combined with costs that were cheap in global terms ( us$5 ) , but prohibitively expensive for the local population , poor roads and communications , most women can not attend a hospital for their delivery . as a result only 10% of
women in ethiopia receive help from a skilled delivery assistant with some estimates of 96% women delivering at home in some areas of ethiopia.3 the ethiopian government has tried some programs to increase the human resources to deliver emergency obstetric care ( emoc ) in those remaining hospitals . the current scheme is a 3-year master of surgery course available not only to medical doctors , but also to health officers .
the master of surgery course not only covers emergency obstetric management , but also emergency surgery .
however , it will be many years before the shortage in labor is resolved due to the number of candidates being trained versus the number required and the length of time it takes to train each candidate . in the meantime , the amhara regional health bureau of ethiopia requested overseas help to overcome the labor shortage by placing volunteer teams of obstetricians and midwives in rural hospitals to help provide the service and also train local staff members in emoc .
the objective of the study reported here was to assess the impact of placing volunteer medical teams within the ethiopian government hospital system in targeted hospitals on maternal morbidity and mortality , before , during , and after the intervention .
it is a government district hospital that was opened in the year 2000 to service a population of 1.2 million people .
these are fresh university graduates who have no surgical training or experience . before the placement of volunteers there was no emoc service and those women needing some emergency or operative intervention had the option of returning home or being referred to the regional referral hospital in the town of barhirdar , 120 kilometers away along an unsealed road .
there was one hospital ambulance that charged 400 birr ( or about us$30 ) to take them to barhirdar , or an unreliable bus service .
the expense of both meant that most women in a critical condition were sent home .
the population , knowing that there was very little help to be offered at mota hospital generally did not present to hospital in labor .
the hospital had many other problems : no running water , a temperamental generator to cover frequent power shortages , shortage of staff , no blood transfusion service , and a poor supply of drugs to the pharmacy .
volunteer teams of one obstetrician and one volunteer midwife were recruited from holland , australia , india , and america .
they would stay for periods of 24 months , usually 3 . over the 3 years
they were self - funded with respect to air travel , visas , living expenses , and health insurance .
accommodation was provided at the hospital , medical registration was organized with the amhara national regional state health bureau , and internal transport was provided by the program .
the first volunteer team arrived at mota in may 2010 and the last left in june 2013 .
a supervisory visit was made by a volunteer in january 2014 and then in may 2014 .
the role of the volunteers was to establish and provide an emergency obstetric service , including full operative and emergency care along with blood transfusion service .
they were also to supervise and train local staff . a retrospective analysis of monthly hospital records from january 2009 until april 2013 was done , with 2009 being the control year .
since the placement of the volunteer teams of obstetricians and midwives within mota hospital began in may 2010 , the intervention took place during only some months of the year , so this year was excluded from the comparison .
data were collected from the birth registry book and entered into a microsoft excel spreadsheet at the end of each month and the raw data analyzed from excel .
outcome measures were the number of deliveries before , during , and after the 3-year intervention period , the maternal mortality rate , and maternal morbidity rate , with the latter assessed by the number of referrals of obstetric fistula patients to a nearby specialist fistula repair centre .
also analyzed were the instrumental and operative delivery rates , number of women needing referral during labor , and perinatal mortality .
the placement of volunteers was phased out when the regional health bureau was able to staff the target hospital sufficiently to provide the service without outside assistance .
there was no ethical board at mota hospital at the time of our study , and as this was a review of cases , permission to do the study was granted by the current medical director .
there was a 40% increase in the number of women delivering within the hospital from 738 in 2009 to over 1,000 in both 2011 and 2012 ; there was a slight proportional decrease in the number of assisted vaginal deliveries ( table 1 ) .
there was an obvious increase in the number of deliveries by cesarean section as there was no service provided in 2009 ( 0.0% ) and the cesarean rate was 8.7% and 10.7% for 2011 and 2012 , respectively .
there was a large decrease in the number of patients referred to the referral hospital in barhirdar for further treatment : from 79 ( 9.3% ) pregnant women in 2009 to only one in 2011 and 2012 .
this referral was at a time when there was no anesthesia cover for a short period of time and the patient needed an operative delivery .
, it is estimated that there were 17 maternal deaths within the hospital itself ( or 2.4% of women delivering ) , but there were at least 100 patients referred to barhirdar or sent home in extremis during 2009 as there was nothing the hospital could offer the patients .
many women died en route to barhirdar or after arrival and most women who went home died . estimating that up to 50% of women transferred or sent home died
would make approximately 60 maternal deaths that year , or one in 14 women presenting to the hospital ( 738 deliveries plus 100 women turned away ; 60 deaths from 838 women )
. this figure could easily be higher and is thought to be a conservative estimate . compared with 2009 ,
in 2011 and 2012 there were no women turned away from the hospital and only one transfer with 15 maternal deaths over the 2 years from 2,043 deliveries this works out to be less than one in every 157 women who presented for delivery at mota .
the number of perinatal deaths was not recorded in 2009 , so comparison was not possible .
most of these were either stillbirths with the woman presenting late in labor with the fetus already deceased in utero on arrival , or other unavoidable deaths often associated with a long labor , uterine rupture , and sepsis .
the number patients with obstetric fistula referred from mota hospital for fistula repair in a specialist unit in barhirdar in 2009 was eleven , as per mota hospital records ( 1.5% of women delivering ) . from ab s experience of working as the surgeon at the barhirdar fistula hospital during those years , on average , four fistula patients would present per month ,
a total of up to 48 women , most of whom delivered in mota hospital so the real figure is likely to be higher .
after the intervention , over the 2 years , twelve ( 0.5% of hospital deliveries ) presented at mota hospital with an obstetric fistula , none of whom had their fistula develop within the hospital , but already had the injury on arrival in labor .
the regional health bureau placed a local health officer with emoc training in mota hospital in january 2013 and the volunteers worked alongside the health officer before leaving .
after withdrawing the full time volunteer presence and leaving the service in the hands of the local health officer , monitoring visits were made six and 11 months later .
the number of deliveries was maintained at the same level as when the volunteers had left .
no maternal deaths and few stillbirths were recorded , although it was unclear if adequate records had been maintained for accurate comparison of the latter two parameters .
there have been many different efforts to try to combat maternal morbidity and mortality in the developing world , from introducing birth preparedness
schemes,4 to getting women to assess health facilities during labor,5 and even providing financial assistance and motivation.6,7 the ultimate aim of these interventions has been to get women to deliver within a health institution .
however , there has been some question as to whether it is worthwhile encouraging women to access health services if the quality of the health services is poor.8,9 other groups have thus focused on brief periods of intensive training to improve this , but the impact of short - term training has been questioned.10,11 it is certainly our personal experience that short - term training , although enthusiastically taken on board , makes little impact on changing practices on the ground .
it appears more long - term investment into training over years is what slowly brings change , which was the aim of the program reported here .
as expected , establishment of an emoc service at mota has had positive benefits for the women who are able to attend the hospital for antenatal care and delivery , most particularly in relation to maternal death , which fell from a conservatively estimated 1 in 14 in 2009 to 1 in 157 women delivering within the hospital during 2011 and 2012 .
many of the maternal deaths were high - risk patients who had not attended any antenatal services and arrived at the hospital in labour , in extremis from surrounding rural areas .
it was interesting to note that a further increase in women coming to the hospital to deliver did not occur in the second year of activity in mota this has been taken to indicate that even though there are undoubtedly thousands more women in the region who could benefit from delivering in mota , they live too far away to walk there , are too poor to afford public transport , or live too far away from a road .
the women who came for delivery at mota were probably only from the immediate surrounds and it is likely the women from more remote areas remained at home to deliver . the benefits the volunteers brought were not only the introduction of a service and training of all staff , including cleaners , but also an improvement in infrastructure .
the volunteers certainly felt ownership of the project and raised money from their home countries to fix the water well ; replace water piping ; purchase a new water pump to ensure a water supply to the hospital ; and buy other surgical instruments , supplies , and training equipment .
the other impact was on the volunteers themselves , many of whom have returned for their second or third term of volunteering while two others have committed to 12 years of volunteering at other sites having had their
the budget for the intervention was low ; initial funds were used to upgrade hospital accommodation for the volunteers and in - country transport to get volunteers to the hospital .
the project budget was also used to purchase new delivery equipment and an ultrasound unit , repair a water well , purchase a new pump for the well , and repair plumbing to ensure a water supply to the hospital .
although this is a single example of one site in ethiopia , the intervention had a very positive impact on maternal morbidity and mortality .
the analysis was limited by rough , incomplete records being interpreted for 2009 and for the period of 2013 after the volunteers left .
although the follow - up after the 3-year intervention is only at 11 months at this stage , we have seem a sustainable improvement in services and significant impact on maternal morbidity and mortality for very little overall financial input .
we believe it has been a cheap , effective strategy to commence an emoc service in an area that has never had one and we believe it is also sustainable , as the service , now successfully started , has been handed over to the responsible ethiopian health bureau .
similar projects utilizing volunteers have been undertaken in four other hospitals in ethiopia and two in tanzania with similar success .
placement of volunteer teams of obstetrician and midwife volunteers had a positive and ongoing impact on the women of the area of mota in terms of both maternal morbidity and mortality .
it was cheap , is easily replicable , and if volunteers can be found , can easily be introduced into other areas . | objectivesto determine the impact of volunteer obstetricians and midwife teams on obstetric services in a rural hospital in ethiopia.methodsthe intervention was undertaken in mota district hospital , a rural hospital in the amhara region of ethiopia , which is the only hospital for 1.2 million people . before the placement of volunteer teams it had a rudimentary basic obstetric service , no blood transfusion service , and no operative delivery .
the study prospectively analyzed delivery data before , during , and after the placement of volunteer obstetrician and midwife teams .
the volunteers established emergency obstetric care , and trained and supervised local staff over a 3-year period .
measurable outcomes consisted of the number of women delivering , the number of referrals of pregnant women , the number of maternal deaths , and the number of referrals of obstetric fistula patients.resultswith the establishment of the service the number of women attending hospital for delivery increased by 40% . in the hospital maternal mortality decreased from 7.1% to < 0.5% , and morbidity , as measured by number of obstetric fistulae , decreased from 1.5% deliveries to 0.5% over the 3-year intervention period . the improvements were sustained after handing the project back to the government.conclusionthe placement of volunteer teams was an effective method of decreasing maternal mortality and morbidity . |
asthma has been shown to have prevalence of 7 - 10% world - wide and 9% in malta and is a common cause of emergency room visits .
recent studies reveal that management of adult asthma in the accident and emergency ( a&e ) department setting often differs from that which is recommended in clinical practice guidelines .
common problems include poor adherence to published guidelines , inadequate assessment and recognition of severity and confusion over the use and interpretation of investigations .
others include infrequent measurement of the peak expiratory flow rate ( pefr ) , insufficient use of systemic steroids , over - reliance on bronchodilators , delayed specialist or intensivist referral and poor follow - up arrangements . in view of the absence of local data , the current management of acute exacerbations in a hospital setting
the study was carried out over a period of 43 weeks , between january and october 2010 .
approval was obtained from the chairman of the department of medicine , all consultants at the a&e department and admitting consultant respiratory physicians together with the data protection officer at mater dei hospital .
mater dei hospital is the only state hospital and secondary referral center present serving the entire population of malta 417,617 in 2010 .
the bed capacity is of 949 beds including 20 beds in the intensive care unit .
no beds are solely reserved for respiratory cases . respiratory teams are readily available during the morning and early afternoon with a respiratory consultant on call for the rest of the time .
all patients under the age of 65 admitted with acute asthma are admitted under the care of a respiratory physician .
a number of health centers is available throughout the island where nebulized bronchodilators are readily available . a number of patients with acute asthma present at these centers and were not included in our cohort , unless they were referred to a&e department with persistent or worsening asthma .
all a&e notes of the discharged patients were reviewed and patients with asthma exacerbations identified .
patients admitted with asthma exacerbations were identified from a record book kept for medical admissions .
the study consisted of recording demographic data , mode of clinical presentation , drug history , management at a&e department and the management plan for all discharged and admitted adult patients presenting to a&e department during the stipulated time with acute asthma exacerbations .
analysis of the data was performed using the statistical package for the social sciences ( spss ) .
statistical analysis of the results was performed using pearson chi - square test and t - test
a total of 244 patients , 164 females ( 67.2% ) and 80 males ( 32.8% ) were included .
of these , 126 patients ( 51.6% ) were admitted , 97 ( 39.8% ) were discharged and 21 ( 8.6% ) discharged themselves against medical advice .
the admission rate for females and males was 57.6% and 39.2% respectively ( p = 0.007 ) .
there was a statistically significant difference ( p = 0.002 ) between the age of those admitted ( mean 48 , range 14 - 95 ) and those discharged ( mean 40 , range 14 - 82 ) . there was no significant difference in the admission and discharge rate across the months ( p = 0.42 ) .
one patient ( 0.41% ) was referred to a&e department by a respiratory physician , 2 ( 0.82% ) patients by a general physician , 96 ( 39.3% ) by a general practitioner ( gp ) and 142 ( 58.2% ) were self - referred .
the trend in the number of admissions and discharges per month with asthma exacerbations can be seen in [ figure 1 ] and the times of presentation are seen in figure 2 .
number of patients presenting to the accident and emergency department with asthma exacerbations per month number of patients versus time of presentation to the accident and emergency department on presentation to the a&e department , 189 patients ( 77.5% ) were using regular inhaled bronchodilators at the time of the exacerbation , 77 ( 31.5% ) were using regular inhaled corticosteroids ( ics ) , 104 ( 42.6% ) had received nebulized bronchodilators at the auxiliary health centers within a few hours prior to presentation , 48 ( 16.4% ) were prescribed antibiotics and 44 ( 18% ) were on oral corticosteroids previously prescribed by their gp .
one hundred and forty seven patients ( 60.2% ) had symptoms suggestive of a respiratory tract infection .
sixty one patients ( 25% ) were current smokers and 31 ( 12.7% ) were ex - smokers .
forty two patients ( 17.2% ) were febrile at presentation with 69% of these patients admitted ( p = 0.028 ) .
the respiratory rate was documented in 151 patients ( 61.8% ) , the heart rate in 204 ( 83.6% ) and a record on the ability to complete sentences in 123 ( 50.4% ) , by a&e department staff . pulse oximetry ( spo2 ) was performed in 207 patients ( 84.8% ) , arterial blood gases ( abgs ) in 133 ( 54.5% ) , a pefr in 106 ( 43.4% ) and a chest radiograph in 206 ( 84.4% ) . a radiological infiltrate suggestive of pneumonia
a white cell count ( wcc ) was available in 165 patients ( 67.6% ) , which was elevated in 30.2% of admitted patients and in 12.7% of discharged patients ( p = 0.1 ) . in the a&e department ,
196 patients ( 80.3% ) were treated with nebulized bronchodilators , 109 221 ( 44.7% ) were given oxygen , 103 ( 42.2% ) intravenous corticosteroids , 7 ( 2.87% ) oral corticosteroids , 28 ( 11.5% ) were given antibiotics and nine ( 3.69% ) required intravenous magnesium .
there was a statistically significant difference between systemic corticosteroid administration at the a&e department and the admission rate ( p < 0.0001 ) , but not for antibiotic administration ( p = 0.076 ) .
on discharge from the a&e department , 32 patients ( 27.1% , n = 118 ) were referred for follow - up to a respiratory physician and 26 patients ( 22% , n = 118 ) were referred to their gp .
oxygen saturation monitoring was ordered in 54 ( 42.9% ) and pefr monitoring in 40 ( 31.7% ) of admitted patients and intravenous corticosteroids were prescribed in 69% of admitted patients .
figure 4 compares clinical features recorded on patients admitted or discharged and [ figure 5 ] compares investigations performed on such patients . of patients who had an elevated wcc ( n = 53 ) , 39 patients were admitted and 14 were discharged ( p = 0.1 ) .
statistical analysis of blood gas results and spo2 were unreliable since there was no standardization as to when these investigations were performed in relation to oxygen therapy and timing of treatment . comparing treatment prescribed to the admitted and discharged patients
this graph compares the percentages of admitted ( n=126 ) or discharged ( n=118 ) patients whose clinical features were present and documented compares the percentages of admitted ( n=126 ) or discharged ( n=118 ) patients in whom these investigations were performed
hospitalizations and a&e department visits account for a large proportion of the health - care cost burden of asthma .
clinical evidence demonstrates that management of acute asthma in the emergency room entails crucial decisions that could determine the clinical outcome .
progression in the severity of an acute asthma attack can occur very rapidly . therefore , close monitoring of patient progress is critical to identify patients most likely to have a severe course of illness .
presentation time to the a&e department was highest between 8 am and 12 pm , which indicates that the onsets of patients symptoms were most likely to have occurred in the earlier hours of the morning .
the downward trend in the number of presentations between january and july followed by an upward trend is in keeping with increased presentations during colder temperatures and more frequent respiratory tract infections , but unlikely to be due to allergen exposure .
a majority of patients who presented in july were admitted suggesting worse exacerbations possibly explained by non - compliance to asthma medications during better weather conditions .
the severity of the exacerbation determines the treatment administered . the general appearance of patient , including difficulty in speaking , respiratory rate and heart rate form the basis of the clinical assessment of severity . indices of severity , particularly pefr , pulse rate , respiratory rate and pulse oximetry , should be monitored during treatment . in our a&e department , such vital signs were not always checked or documented .
this seems to be a problem internationally since similar studies show that the heart rate was measured in 72% and 50% and a respiratory rate in 16% and 27% of patients .
locally , patients discharged home were less likely to have had their heart and respiratory rates checked possibly because these patients appeared to be objectively better .
in fact , an increasing heart rate is closely correlated with increasing severity of asthma .
lung function tests are the basis for assessment of the severity of the asthmatic attack used to measure changes in expiratory airflow . without unduly delaying treatment , a baseline pefr or forced expiratory volume in one second ( fev1 ) measurements
locally , a pefr was performed in < 50% despite peak flow meters being readily available and documentation of whether it was carried out pre- or post - treatment was poor . neither was pefr calculated as the percentage predicted for patients sex , height and age .
the importance of pefr seems to be underestimated at our a&e department . in a study by linares et al .
, pefr was monitored in 20% of patients , whilst in another study , it was performed in 60% on admission , 58% on discharge and 47% on both occasions .
one might argue that patients who are distressed would be unable to perform spirometry or pefr . however , silverman et al .
demonstrate conclusively that most adult patients seen for severe asthma exacerbations in an a&e department can successfully perform criteria - specific acceptable and reproducible spirometry maneuvers .
pefr is mentioned on any guideline as an objective measure leading to the decision of whether a patient should be admitted or discharged .
oxygen saturation of < 92% predicts the need for hospitalization and the global initiative for asthma ( gina ) guidelines recommend that this should be closely monitored , preferably by pulse oximetry .
locally , the majority of patients had at least one reading in both admitted and discharged patients , but regular monitoring was infrequent despite being non - invasive , painless , easily performed and not time consuming . in two similar international audits , pulse oximetry was performed in 72% and 93% of patients .
it was not possible to determine any statistically significant difference between the admitted and discharged patients due to lack of standardization as to when it was checked in relation to treatment administration .
abg analysis should follow if there is concern that the patient is not improving , if the data is thought to be unreliable or for oxygen saturations of < 92% on room air whilst the patient is kept on supplemental oxygen . in our a&e department ,
abg acquisition was often carried out haphazardly and frequency was similar to an international audit .
locally , abgs were taken more frequently in the admitted patients indicating their use in the more severe cases .
oximetry provides real - time , continuous measurements , whereas abgs are monitored only intermittently and the samples take time to process .
hence , every a&e department officer should justify abg sampling . according to the gina guidelines ,
a chest x - ray ( cxr ) is not routinely required in adults , but should be carried out if a complicating cardiopulmonary process is suspected , in patients requiring hospitalization , those not responding to treatment and where a pneumothorax may be difficult to diagnose clinically .
there is a tendency locally , as is the case internationally , to take cxrs unnecessarily with practically all admitted patients having one done . despite being non - invasive
the aims of treatment during an exacerbation are to relieve airflow obstruction and hypoxemia as quickly as possible and to plan the prevention of future relapses .
the primary therapies for exacerbations include repetitive administration of rapid - acting inhaled bronchodilators , early introduction of systemic glucocorticosteroids and oxygen supplementation .
some who did not receive bronchodilators at a&e department most likely had improved after presently receiving bronchodilators at the auxiliary health centers or gps .
the addition of ipratropium bromide to inhaled -agonist therapy is recommended since it provides an increase in the bronchodilator response in severe asthma although this is controversial according to other studies it is recommended that a dose of systemic corticosteroids should be administered within the first hour of treatment for acute asthma for all but mild attacks since they markedly reduce the need for hospital admission .
the local administration rate ( 45% ) is less when compared to 60% in a canadian cohort and 68% in an american cohort and to 80% , 82% , and 60% in other studies .
oxygen therapy should be titrated against pulse oximetry to maintain satisfactory oxygen saturation and should only be prescribed in severe asthma with hypoxia to achieve saturations greater than 92% . despite being
so frequently used and so readily available , its use was documented in 50% of our cohort , which creates doubt over whether this reflects its actual use . in a study , linares et al .
when unresponsive to bronchodilator therapy or in life - threatening or near fatal asthma intravenous magnesium sulphate use must be considered . in a systematic review , it was concluded that most a&e department physicians accept its efficacy , but despite this , its use remains uncommon , as is the case in our study .
both ipratropium bromide and intravenous magnesium have been shown to reduce hospitalizations for moderate to severe exacerbations .
response to treatment may take some time and patients should be closely monitored using clinical as well as objective measurements .
treatment should continue until measurements of lung function return to their previous best or otherwise before a decision to admit or discharge can be made .
the gina guidelines recommend that patients with pre - treatment fev1 or pefr < 25% or post - treatment fev1 or pefr < 40% predicted or personal best , usually requires hospitalization .
patients with post - treatment lung function of 40 - 60% predicted or more may be discharged .
some patients respond rapidly to aggressive therapy and they can be discharged quickly while others require admission for more prolonged treatment .
this poses a major challenge in the a&e department . only about 6 - 13% of affected patients require admission to hospital as shown in a study with admission rates of 11% and 21% .
our elevated admission rate of 51.6% could be an overestimate as milder cases tend to visit the health centers with only the more severe cases reaching a&e department .
antibiotics should not be routinely prescribed as bacterial ( as opposed to viral ) infections seldom provoke exacerbations and their routine prescription does not influence outcome .
the discharging doctor should ensure that patients are discharged on regular ics and that their inhaler technique is checked .
locally there was under - prescription of ics , with other international studies showing inferior results of 20% , 11% and 16.2% .
doctors are also encouraged to prescribe a 7 day course of oral steroids as this improves outcome with a fourfold reduction in relapse rate in the following week , and reduction in admission rates , along with continuation of bronchodilator therapy .
ipratropium bromide is unlikely to provide additional benefit beyond the acute phase . prior to discharge , instructions to contact primary health - care professional or an asthma specialist and
local data reveals that < 50% of patients were advised to have such a follow - up .
prospective data indicate that patients discharged from a&e department for follow - up with specialist care do better than patients returned to routine care .
the reason for presentation to a&e department should be addressed , with the aim of directing patients toward primary health - care services in the community during a similar exacerbation together with exploring possible actions to prevent future emergency presentations .
to reduce the risk of relapse , optimizing management after discharge should be a high priority .
there is strong evidence to support the role of action plans detailing how to prevent and manage future exacerbations . in similar studies
, it was concluded that the assessment and treatment was often suboptimal , management diverged from guideline recommendations and there was underuse of corticosteroids and inappropriate admission rates according to severity as appears to be the problem locally .
limitations of this audit include lack of documentation , especially in the management plan of discharged patients . at times , this gave uncertainty if treatment was actually given , but not documented .
the audit deals with asthmatic patients presenting to a&e department ; however , we are aware that many attend health centers where nebulized bronchodilator treatment and doctor assessment is readily available .
the implementation of a local guideline should aid to define the severity of the exacerbation , optimize treatment , whilst avoiding unnecessary admissions and hence reducing healthcare costs . a proforma sheet would also help improve documentation .
presentation to a&e department is a good opportunity to educate patients about their condition , identify pitfalls in their management and help prevent future presentations to a&e department
. limitations of this audit include lack of documentation especially in the management plan of discharged patients . at times , this gave uncertainty if treatment was actually given , but not documented . the audit deals with asthmatic patients presenting to the a&e department ; however , we are aware that many attend health centers where nebulized bronchodilator treatment and doctor assessment is readily available
. the publication and implementation of a local guideline on asthma management at the a&e department should lead to an improvement , which can be assessed by another study . | aim : this study was performed to assess the management of adult patients presenting to the mater dei hospital accident and emergency ( a&e ) department with acute asthma.subjects and methods : asthmatic patients age 14 or older who presented to a&e department between january and october 2010 with asthma exacerbations were included .
data were collected from the clinical notes and analyzed.results:a total of 244 patients ( 67.2% females ) were included , 126 ( 51.6% ) were admitted , 97 ( 39.8% ) discharged and 21 ( 8.6% ) discharged themselves against medical advice . there was a decline in the presentations between january and july , followed by an upward trend until october ( p = 0.42 ) .
pulse oximetry was performed in 207 patients ( 84.8% ) , arterial blood gases in 133 ( 54.5% ) , peak expiratory flow rate in 106 ( 43.4% ) and chest radiography in 206 ( 84.4% ) patients .
the respiratory rate was documented in 151 ( 61.8% ) , heart rate in 204 ( 83.6% ) and ability to complete sentences in 123 ( 50.4% ) patients .
one hundred and ninety six patients ( 80.3% ) were given nebulized bronchodilators , 103 ( 42.2% ) intravenous corticosteroids , 7 ( 2.87% ) oral corticosteroids , 109 ( 44.7% ) oxygen , 28 ( 11.5% ) antibiotics and 9 ( 3.69% ) magnesium .
systemic corticosteroids and antibiotics were more commonly prescribed to patients admitted ( p < 0.001).conclusion : management of acute asthma in malta requires optimization in order to compare with international guidelines . |
orthopaedic surgery , such as total hip and total knee replacement surgery , is associated with an increased risk of life - threatening and morbidity - associated venous thromboembolism ( vte ) during the peri- and post - operative periods . as a result ,
current evidence - based clinical guidelines recommend the administration of anticoagulants to patients undergoing orthopaedic surgery .
in particular , patients undergoing elective hip or knee arthroplasty are recommended to receive thromboprophylaxis for at least 10 days , with treatment being continued for up to 35 days .
it is extremely important that patients continue to receive their thromboprophylactic treatment once they have been discharged from hospital ; this can be a challenge because several of the currently available agents , particularly those used in europe ( e.g. the low molecular weight heparins , lmwhs , such as enoxaparin ) , are parenterally administered .
other limitations associated with lmwhs , such as their indirect mode of action , inability to inhibit clot - bound thrombin , and association with complications such as heparin - induced thrombocytopenia and osteoporosis , can have a negative impact on their long - term , post - operative use .
in addition , the oral vitamin k antagonists ( vkas ) such as warfarin , which are widely used in north america in this setting , are associated with a number of limitations ( e.g. slow onset and offset of action , narrow therapeutic window , multiple drug and food interactions , and an unpredictable anticoagulant effect requiring regular anticoagulant monitoring and dose adjustment ) that make their long - term use very problematic .
there has been a clear need for novel oral anticoagulant agents for some time , and a number are being developed that target either one of two specific molecules within the coagulation cascade , thrombin and factor xa .
dabigatran etexilate is a direct thrombin inhibitor that reversibly inhibits the active site of thrombin , which is a central player in the coagulation cascade converting fibrinogen to fibrin .
rivaroxaban , apixaban and edoxaban are all factor xa inhibitors , which bind reversibly to the active site of factor xa .
the bioavailability of dabigatran etexilate is much lower than that of the other three agents , so a higher dose of this agent is required .
all four agents are given as a fixed dose , and their anticoagulant effects are so predictable that they do not require routine coagulation monitoring . in total knee or hip replacement , dabigatran etexilate , rivaroxaban and edoxaban
dabigatran etexilate is mainly cleared by the kidneys , so care must be exercised in patients with renal insufficiency ( creatinine clearance , 3050 ml / min ) . compared with the vkas , there are few drug interactions with these novel oral anticoagulants , although they do interact with ( i ) potent inhibitors of p - glycoprotein ( all except apixaban ) and ( ii ) potent inhibitors of the cytochrome p450 enzyme cyp3a4 ( all except dabigatran etexilate ) .
table 1pharmacokinetic profiles of the new oral anticoagulant agents characteristicdabigatran etexilaterivaroxabanapixabanedoxabantargetthrombinfactor xafactor xafactor xaprodrugyesnononobioavailability ( % ) 6806050dosingonce dailyonce dailytwice dailyonce dailyhalf - life ( h)121771112911renal clearance ( % ) 80662535routine coagulation monitoringnonononodrug interactionspotent inhibitors of p - glycoproteinpotent inhibitors of cyp3a4 and p - glycoproteinpotent inhibitors of cyp3a4potent inhibitors of cyp3a4 and p - glycoproteinadapted from potent inhibitors of p - glycoprotein include quinidine . weak inhibitors of p - glycoprotein include amiodarone .
potent inhibitors of cyp3a4 include azole anti - fungals , macrolide antibiotics and protease inhibitors .
potent inhibitors of both p - glycoprotein and cyp3a4 include azole anti - fungals and protease inhibitors pharmacokinetic profiles of the new oral anticoagulant agents potent inhibitors of p - glycoprotein include quinidine . weak inhibitors of p - glycoprotein include amiodarone .
potent inhibitors of cyp3a4 include azole anti - fungals , macrolide antibiotics and protease inhibitors .
potent inhibitors of both p - glycoprotein and cyp3a4 include azole anti - fungals and protease inhibitors
the remainder of this review will focus on the published evidence from the clinical trial programmes for dabigatran etexilate , rivaroxaban and apixaban , in terms of the evaluation of their efficacy and safety for the primary prevention of vte in patients undergoing elective hip and knee replacement surgery .
three phase iii clinical trials that form part of the re - volution study programme undertaken by boehringer ingelheim have been completed and published on the efficacy and safety of dabigatran etexilate for the primary prevention of vte following elective hip and knee replacement surgery [ 57 ] .
the three clinical trials had identical non - inferiority study designs with a primary endpoint of a composite of total vte ( asymptomatic and symptomatic deep vein thromboses and non - fatal pulmonary embolism ) and all - cause death during treatment .
major bleeding during the treatment period was defined as : clinically overt bleeding associated with 20 g / l fall in haemoglobin ; clinically overt bleeding leading to a transfusion of 2 units of packed cells or whole blood ; fatal , retroperitoneal , intracranial , intraocular or intraspinal bleeding and bleeding warranting treatment cessation or leading to reoperation .
it is important to note that the assessment of bleeding also included surgical site bleeds .
the re - novate i trial randomized 3,494 patients undergoing total hip replacement surgery to receive 2835 days of either dabigatran etexilate , 220 mg ( n = 1,157 ) or 150 mg ( n = 1,174 ) once daily , or subcutaneous enoxaparin , 40 mg ( n = 1,162 ) once daily .
the dose of enoxaparin was equivalent to that used routinely in the european union ( eu ) .
the re - model trial randomized 2,101 patients undergoing total knee replacement surgery to receive 610 days of either dabigatran etexilate , 220 mg ( n = 694 ) or 150 mg ( n = 708 ) once daily , or subcutaneous enoxaparin , 40 mg ( n = 699 ) once daily .
the third trial , re - mobilize , used the north american enoxaparin regimen of 30 mg enoxaparin ( n = 876 ) twice daily , compared with either dabigatran etexilate , 220 mg ( n = 862 ) or 150 mg ( n = 877 ) once daily for 1215 days , in patients undergoing total knee replacement surgery . the follow - up period for these trials was 1214 weeks . in both the re - novate i and re - model trials ,
dabigatran etexilate demonstrated non - inferiority with the eu dose of enoxaparin ( 40 mg once daily ) for the primary efficacy composite outcome of total vte and all - cause mortality ( fig . 1 ) [ 5 , 6 ] .
in re - novate i , 6.7% ( 60/897 ) of the enoxaparin group , compared with 6.0% ( 53/880 ) of the dabigatran etexilate 220-mg group and 8.6% ( 75/874 ) of the dabigatran etexilate 150-mg group , experienced a primary efficacy outcome event ( fig .
although the rates of the primary efficacy outcome were higher in the re - model trial , as expected for knee replacement surgery , there were no significant differences between the three groups : 37.7% ( 193/512 ) of the enoxaparin group compared with 36.4% ( 183/503 ) of the dabigatran etexilate 220-mg group and 40.5% ( 213/526 ) of the dabigatran etexilate 150-mg group ( fig .
1composite of total venous thromboembolic events ( asymptomatic deep vein thrombosis and non - fatal pulmonary embolism ) and all - cause mortality during treatment with either dabigatran etexilate , 150 mg or 220 mg once daily , or enoxaparin , 40 mg once daily : 2835 days in re - novate i ( n = 3,494 ) ( a ) and 610 days in re - model ( n = 2,076 ) ( b ) trials [ 5 , 6 ] composite of total venous thromboembolic events ( asymptomatic deep vein thrombosis and non - fatal pulmonary embolism ) and all - cause mortality during treatment with either dabigatran etexilate , 150 mg or 220 mg once daily , or enoxaparin , 40 mg once daily : 2835 days in re - novate i ( n = 3,494 ) ( a ) and 610 days in re - model ( n = 2,076 ) ( b ) trials [ 5 , 6 ] in terms of safety , both the re - novate i and re - model trials demonstrated similar major bleeding rates for the two dabigatran etexilate groups and the enoxaparin group ( fig .
2 ) [ 5 , 6 ] . in re - novate i , major bleeding occurred in 1.6% of the enoxaparin group , compared with 2.0% of the dabigatran etexilate 220-mg group and 1.3% of the dabigatran etexilate 150-mg group ( fig .
similarly , in re - model , major bleeding events occurred in 1.3% of the enoxaparin group , compared with 1.5% of the dabigatran etexilate 220-mg group and 1.3% of the dabigatran etexilate 150-mg group ( fig . 2b ) .
fig .
2major bleeding events during treatment with either dabigatran etexilate , 150 mg or 220 mg once daily , or enoxaparin , 40 mg once daily : 2835 days in re - novate i ( n = 3,494 ) ( a ) and 610 days in re - model ( n = 2,076 ) ( b ) trials [ 5 , 6 ] . major bleeding during the treatment period was defined as : clinically overt bleeding associated with 20 g / l fall in haemoglobin ; clinically overt leading to transfusion of 2 units packed cells or whole blood ; fatal , retroperitoneal , intracranial , intraocular or intraspinal bleeding and bleeding warranting treatment cessation or leading to reoperation major bleeding events during treatment with either dabigatran etexilate , 150 mg or 220 mg once daily , or enoxaparin , 40 mg once daily : 2835 days in re - novate i ( n = 3,494 ) ( a ) and 610 days in re - model ( n = 2,076 ) ( b ) trials [ 5 , 6 ] .
major bleeding during the treatment period was defined as : clinically overt bleeding associated with 20 g / l fall in haemoglobin ; clinically overt leading to transfusion of 2 units packed cells or whole blood ; fatal , retroperitoneal , intracranial , intraocular or intraspinal bleeding and bleeding warranting treatment cessation or leading to reoperation in the re - mobilize trial , when dabigatran etexilate ( 220 mg and 150 mg once daily ) was compared with the north american dose of enoxaparin ( 30 mg twice daily ) , it was associated with numerically fewer major bleeding events , while it did not statistically achieve non - inferior efficacy , likely due to the 50% higher us dose of enoxaparin used in the study and the prolonged dosing regimen . in summary
, the three clinical trials described above demonstrated that dabigatran etexilate was as effective as the eu dose of enoxaparin ( 40 mg once daily ) at preventing vte and all - cause mortality after total hip or total knee replacement surgery , but less effective than the north american dose of enoxaparin ( 30 mg twice daily ) following knee arthroplasty .
the safety profile of dabigatran etexilate was comparable with that of enoxaparin after either total hip or total knee replacement surgery .
there were no significant differences between dabigatran etexilate and enoxaparin in terms of bleeding outcomes , the incidence of liver enzyme elevations ( of particular relevance because of the problems experienced with another direct thrombin inhibitor , ximelagatran ) , and the incidence of acute coronary events either on or off therapy , which suggests there is no rebound activation of coagulation with dabigatran etexilate [ 57 ] . a fourth , phase iii clinical trial of dabigatran etexilate for the primary prevention of vte following elective hip replacement surgery , re - novate ii ( re - novate ii ; clinicaltrials.gov identifier : nct00657150 ) ,
has recently been completed , and the results were reported at the 15th congress of the european hematology association held in june 2010 . in this double - blind , non - inferiority trial , patients ( n = 2,055 ) undergoing total hip arthroplasty were randomized to receive either oral dabigatran etexilate , 220 mg once daily , or subcutaneous enoxaparin , 40 mg once daily , for 2835 days .
dabigatran etexilate demonstrated non - inferiority to enoxaparin for the primary efficacy outcome , a composite of total vte and all - cause mortality , which occurred in 7.7% ( 61/792 ) of the dabigatran etexilate group versus 8.8% ( 69/785 ) of the enoxaparin group .
major bleeding rates were comparable in both groups and occurred in 1.4% of the dabigatran etexilate group and 0.9% of the enoxaparin group .
the study concluded that oral dabigatran etexilate , 220 mg once daily , was as effective as subcutaneous enoxaparin , 40 mg once daily , in reducing the vte risk after total hip arthroplasty , with similar safety profiles and bleeding risk .
as part of the record clinical programme being undertaken by bayer schering pharma ag , four phase iii clinical trials have been completed and published on the efficacy and safety of rivaroxaban for the primary prevention of vte following hip and knee arthroplasty [ 1014 ] ( table 2 ) . of particular note is that the incidence of surgical site bleeding was not included in the bleeding data for the record trials , which resulted in lower overall rates of bleeding compared with clinical trials of other thromboprophylactic agents such as dabigatran etexilate [ 5 , 6 ] .
table 2the main efficacy outcomes of the four record trials in patients undergoing elective hip or knee arthroplasty [ 1014]trialsettingenoxaparin subcutaneousrivaroxaban oraldeep vein thrombosis / pulmonary embolism / deathevents ( % ) relative risk reduction ( % ) p valuerecord1 , n = 4,541total hip arthroplasty40 mg once daily for 35 days10 mg once daily for 35 days3.7 versus 1.170<0.001record2 , n = 2,509total hip arthroplasty40 mg once daily for 1014 days10 mg once daily for 3139 days9.3 versus 2.079<0.0001record3 , n = 2,531total knee arthroplasty40 mg once daily for 1014 days10 mg once daily for 1014 days18.9 versus 9.649<0.001record4 , n = 3,148total knee arthroplasty30 mg twice daily for 1014 days10 mg once daily for 1014 days10.1 versus 6.9310.0160adapted from copyright ( 2010 ) , with permission from elsevier the main efficacy outcomes of the four record trials in patients undergoing elective hip or knee arthroplasty [ 1014 ] adapted from copyright ( 2010 ) , with permission from elsevier the record1 trial randomized 4,541 patients undergoing total hip replacement surgery to receive either rivaroxaban , 10 mg ( n = 2,266 ) once daily , or subcutaneous enoxaparin , 40 mg ( n = 2,275 ) once daily , for 35 days . significantly fewer patients in the rivaroxaban group ( 1.1% ; 18/1,595 ) experienced a primary efficacy outcome event of deep vein thrombosis ( symptomatic or venography - confirmed asymptomatic ) , non - fatal pulmonary embolism or death from any cause at 36 days , compared with patients in the enoxaparin group ( 3.7% ; 58/1,558 ) ( table 2 ) .
there was no significant difference between the two groups in the rate of major bleeding ( 0.3% for rivaroxaban versus 0.1% for enoxaparin ) ( fig . 3 ) .
3major bleeding events during treatment with either rivaroxaban , 10 mg once daily , or enoxaparin , 40 mg once daily , for 35 days in record1 during total hip arthroplasty ( n = 4,541 ) ; with either rivaroxaban , 10 mg once daily for 3139 days , or enoxaparin , 40 mg once daily for 1014 days , in record2 during total hip arthroplasty ( n = 2,509 ) ; with either rivaroxaban , 10 mg once daily , or enoxaparin , 40 mg once daily , for 1014 days in record3 during total knee arthroplasty ( n = 2,531 ) and with either rivaroxaban , 10 mg once daily , or enoxaparin , 30 mg twice daily , for 1014 days in record4 during total knee arthroplasty ( n = 3,148 ) .
major bleeding during the treatment period was defined as bleeding that was fatal , occurred in a critical organ ( e.g. retroperitoneal , intracranial , intraocular or intraspinal bleeding ) , required reoperation or extra - surgical site bleeding that was clinically overt and was associated with a fall in haemoglobin level of at least 2 g / dl , or that required transfusion of 2 units packed cells or whole blood [ 1013 ] major bleeding events during treatment with either rivaroxaban , 10 mg once daily , or enoxaparin , 40 mg once daily , for 35 days in record1 during total hip arthroplasty ( n = 4,541 ) ; with either rivaroxaban , 10 mg once daily for 3139 days , or enoxaparin , 40 mg once daily for 1014 days , in record2 during total hip arthroplasty ( n = 2,509 ) ; with either rivaroxaban , 10 mg once daily , or enoxaparin , 40 mg once daily , for 1014 days in record3 during total knee arthroplasty ( n = 2,531 ) and with either rivaroxaban , 10 mg once daily , or enoxaparin , 30 mg twice daily , for 1014 days in record4 during total knee arthroplasty ( n = 3,148 ) .
major bleeding during the treatment period was defined as bleeding that was fatal , occurred in a critical organ ( e.g. retroperitoneal , intracranial , intraocular or intraspinal bleeding ) , required reoperation or extra - surgical site bleeding that was clinically overt and was associated with a fall in haemoglobin level of at least 2 g / dl , or that required transfusion of 2 units packed cells or whole blood [ 1013 ] similarly , the record2 trial that was also undertaken in hip replacement patients ( n = 2,509 ) demonstrated superior efficacy for rivaroxaban compared with enoxaparin for the same primary outcome composite , although it should be noted that rivaroxaban was administered for a longer period of time than enoxaparin ( 3139 days versus 1014 days , respectively ) ( table 2 ) .
the major bleeding rates were identical for the two groups ( 0.08% ) ( fig . 3 ) .
two studies , record3 and record4 , were undertaken in patients undergoing total knee replacement surgery .
record3 randomized 2,531 patients to receive either rivaroxaban , 10 mg ( n = 1,254 ) once daily , or subcutaneous enoxaparin , 40 mg ( n = 1,277 ) once daily , for 1014 days .
in contrast , record4 compared rivaroxaban , 10 mg ( n = 1,584 ) once daily , with the north american dose of enoxaparin ( 30 mg twice daily ; n = 1,564 ) .
both studies demonstrated significantly fewer primary outcome events ( vte events and all - cause mortality ) with rivaroxaban compared with enoxaparin ( table 2 ) and comparable rates of major bleeding ( record3 : 0.6% versus 0.5% , respectively ; record4 : 0.7% versus 0.3% , respectively ) ( fig .
once daily oral rivaroxaban ( 10 mg ) was significantly more effective than subcutaneous enoxaparin ( both the eu and north american doses ) at preventing vte - related events after either elective hip or knee replacement surgery .
there was no significant increase in the rate of major bleeding between rivaroxaban and enoxaparin , but surgical site bleeds were not included in the safety outcome evaluation , and it is known from other studies that these contribute considerably to the total major bleeding rate [ 5 , 6 ] .
bleeding into the surgical site is of clinical importance to orthopaedic surgeons because of the negative impact it can have on the risk of wound infection and the need for reoperation of the prosthetic joint . the advance clinical programme , which is being coordinated by bristol
myers squibb and pfizer , is evaluating the thromboprophylactic efficacy and safety of apixaban in a range of indications .
two phase iii clinical trials that have been undertaken in orthopaedic patients have been published to date : the advance-1 and advance-2 studies in patients undergoing total knee replacement [ 15 , 16 ] .
similar to the dabigatran etexilate trials , these studies included bleeding at the surgical site in their safety analyses .
the advance-1 study compared 1014 days of treatment with apixaban ( 2.5 mg twice daily ) with enoxaparin at the north american dose ( 30 mg twice daily ) in 3,195 patients , and failed to show non - inferiority for apixaban for the composite primary efficacy outcome of total vte events and all - cause mortality ( fig .
this was because the incidence of the composite primary efficacy outcome in patients treated with enoxaparin was only 55% of the predicted rate that was used to establish the criteria for non - inferiority and to calculate the sample size .
apixaban treatment was associated with fewer major bleeding events than enoxaparin ( 0.7% versus 1.4% , respectively ) ( fig .
in contrast , the subsequent advance-2 study in 3,057 patients demonstrated superior efficacy for apixaban ( 2.5 mg twice daily ) compared with enoxaparin used at the eu dose ( 40 mg once daily ) for the same primary efficacy composite outcome ( 15.1% versus 24.4% , respectively ) ( fig .
in addition , there was no significant difference in the rate of major bleeding ( apixaban , 0.6% ; enoxaparin , 0.9% ) ( fig .
5b ) and the rate of the composite of major bleeding and clinically relevant non - major bleeding between the two treatment groups ( apixaban , 3.5% ; enoxaparin , 4.8% ) .
4composite of any deep vein thrombosis , non - fatal pulmonary embolism and all - cause mortality during treatment with either apixaban , 2.5 mg twice daily , or enoxaparin , 30 mg twice daily , for 1014 days in the advance-1 study ( n = 3,195 ) during total knee arthroplasty ( a ) ; and with either apixaban , 2.5 mg twice daily , or enoxaparin , 40 mg once daily , for 1014 days in the advance-2 study ( n = 3,057 ) during total knee arthroplasty ( b ) [ 15 , 16]fig .
5major bleeding events during treatment with either apixaban , 2.5 mg twice daily , or enoxaparin , 30 mg twice daily , for 1014 days in the advance-1 study ( n = 3,195 ) during total knee arthroplasty ( a ) ; and with either apixaban , 2.5 mg twice daily , or enoxaparin , 40 mg once daily , for 1014 days in the advance-2 study ( n = 3,057 ) during total knee arthroplasty ( b ) .
major bleeding was defined as acute , clinically overt bleeding accompanied by one or more of the following events : a decrease in the haemoglobin level of 2 g / dl or more within a 24-h period ; a transfusion of 2 or more units of packed red cells ; bleeding at a critical site ( i.e. intracranial , intraspinal , intraocular , pericardial or retroperitoneal bleeding ) ; bleeding into the operated joint , requiring an additional operation or intervention ; intramuscular bleeding with the compartment syndrome or fatal bleeding [ 15 , 16 ] composite of any deep vein thrombosis , non - fatal pulmonary embolism and all - cause mortality during treatment with either apixaban , 2.5 mg twice daily , or enoxaparin , 30 mg twice daily , for 1014 days in the advance-1 study ( n = 3,195 ) during total knee arthroplasty ( a ) ; and with either apixaban , 2.5 mg twice daily , or enoxaparin , 40 mg once daily , for 1014 days in the advance-2 study ( n = 3,057 ) during total knee arthroplasty ( b ) [ 15 , 16 ] major bleeding events during treatment with either apixaban , 2.5 mg twice daily , or enoxaparin , 30 mg twice daily , for 1014 days in the advance-1 study ( n = 3,195 ) during total knee arthroplasty ( a ) ; and with either apixaban , 2.5 mg twice daily , or enoxaparin , 40 mg once daily , for 1014 days in the advance-2 study ( n = 3,057 ) during total knee arthroplasty ( b ) .
major bleeding was defined as acute , clinically overt bleeding accompanied by one or more of the following events : a decrease in the haemoglobin level of 2 g / dl or more within a 24-h period ; a transfusion of 2 or more units of packed red cells ; bleeding at a critical site ( i.e. intracranial , intraspinal , intraocular , pericardial or retroperitoneal bleeding ) ; bleeding into the operated joint , requiring an additional operation or intervention ; intramuscular bleeding with the compartment syndrome or fatal bleeding [ 15 , 16 ] in summary , apixaban demonstrated superiority compared with the eu dose of enoxaparin ( 40 mg once daily ) but failed to show non - inferiority compared with the north american dose of enoxaparin ( 30 mg twice daily ) for the prevention of vte following total knee replacement surgery [ 15 , 16 ] . in terms of the incidence of major bleeding
three phase iii clinical trials that form part of the re - volution study programme undertaken by boehringer ingelheim have been completed and published on the efficacy and safety of dabigatran etexilate for the primary prevention of vte following elective hip and knee replacement surgery [ 57 ] .
the three clinical trials had identical non - inferiority study designs with a primary endpoint of a composite of total vte ( asymptomatic and symptomatic deep vein thromboses and non - fatal pulmonary embolism ) and all - cause death during treatment .
major bleeding during the treatment period was defined as : clinically overt bleeding associated with 20 g / l fall in haemoglobin ; clinically overt bleeding leading to a transfusion of 2 units of packed cells or whole blood ; fatal , retroperitoneal , intracranial , intraocular or intraspinal bleeding and bleeding warranting treatment cessation or leading to reoperation .
it is important to note that the assessment of bleeding also included surgical site bleeds .
the re - novate i trial randomized 3,494 patients undergoing total hip replacement surgery to receive 2835 days of either dabigatran etexilate , 220 mg ( n = 1,157 ) or 150 mg (
n = 1,174 ) once daily , or subcutaneous enoxaparin , 40 mg ( n = 1,162 ) once daily .
the dose of enoxaparin was equivalent to that used routinely in the european union ( eu ) .
the re - model trial randomized 2,101 patients undergoing total knee replacement surgery to receive 610 days of either dabigatran etexilate , 220 mg ( n = 694 ) or 150 mg ( n = 708 ) once daily , or subcutaneous enoxaparin , 40 mg ( n = 699 ) once daily .
the third trial , re - mobilize , used the north american enoxaparin regimen of 30 mg enoxaparin ( n = 876 ) twice daily , compared with either dabigatran etexilate , 220 mg ( n = 862 ) or 150 mg ( n = 877 ) once daily for 1215 days , in patients undergoing total knee replacement surgery .
the follow - up period for these trials was 1214 weeks . in both the re - novate i and re - model trials , dabigatran etexilate demonstrated non - inferiority with the eu dose of enoxaparin ( 40 mg once daily ) for the primary efficacy composite outcome of total vte and all - cause mortality ( fig . 1 ) [ 5 , 6 ] . in re - novate
i , 6.7% ( 60/897 ) of the enoxaparin group , compared with 6.0% ( 53/880 ) of the dabigatran etexilate 220-mg group and 8.6% ( 75/874 ) of the dabigatran etexilate 150-mg group , experienced a primary efficacy outcome event ( fig .
although the rates of the primary efficacy outcome were higher in the re - model trial , as expected for knee replacement surgery , there were no significant differences between the three groups : 37.7% ( 193/512 ) of the enoxaparin group compared with 36.4% ( 183/503 ) of the dabigatran etexilate 220-mg group and 40.5% ( 213/526 ) of the dabigatran etexilate 150-mg group ( fig .
1composite of total venous thromboembolic events ( asymptomatic deep vein thrombosis and non - fatal pulmonary embolism ) and all - cause mortality during treatment with either dabigatran etexilate , 150 mg or 220 mg once daily , or enoxaparin , 40 mg once daily : 2835 days in re - novate i ( n = 3,494 ) ( a ) and 610 days in re - model ( n = 2,076 ) ( b ) trials [ 5 , 6 ] composite of total venous thromboembolic events ( asymptomatic deep vein thrombosis and non - fatal pulmonary embolism ) and all - cause mortality during treatment with either dabigatran etexilate , 150 mg or 220 mg once daily , or enoxaparin , 40 mg once daily : 2835 days in re - novate i ( n = 3,494 ) ( a ) and 610 days in re - model ( n = 2,076 ) ( b ) trials [ 5 , 6 ] in terms of safety , both the re - novate i and re - model trials demonstrated similar major bleeding rates for the two dabigatran etexilate groups and the enoxaparin group ( fig .
2 ) [ 5 , 6 ] . in re - novate i , major bleeding occurred in 1.6% of the enoxaparin group , compared with 2.0% of the dabigatran etexilate 220-mg group and 1.3% of the dabigatran etexilate 150-mg group ( fig .
similarly , in re - model , major bleeding events occurred in 1.3% of the enoxaparin group , compared with 1.5% of the dabigatran etexilate 220-mg group and 1.3% of the dabigatran etexilate 150-mg group ( fig .
2major bleeding events during treatment with either dabigatran etexilate , 150 mg or 220 mg once daily , or enoxaparin , 40 mg once daily : 2835 days in re - novate i ( n = 3,494 ) ( a ) and 610 days in re - model ( n = 2,076 ) ( b ) trials [ 5 , 6 ] .
major bleeding during the treatment period was defined as : clinically overt bleeding associated with 20 g / l fall in haemoglobin ; clinically overt leading to transfusion of 2 units packed cells or whole blood ; fatal , retroperitoneal , intracranial , intraocular or intraspinal bleeding and bleeding warranting treatment cessation or leading to reoperation major bleeding events during treatment with either dabigatran etexilate , 150 mg or 220 mg once daily , or enoxaparin , 40 mg once daily : 2835 days in re - novate i ( n = 3,494 ) ( a ) and 610 days in re - model ( n = 2,076 ) ( b ) trials [ 5 , 6 ] .
major bleeding during the treatment period was defined as : clinically overt bleeding associated with 20 g / l fall in haemoglobin ; clinically overt leading to transfusion of 2 units packed cells or whole blood ; fatal , retroperitoneal , intracranial , intraocular or intraspinal bleeding and bleeding warranting treatment cessation or leading to reoperation in the re - mobilize trial , when dabigatran etexilate ( 220 mg and 150 mg once daily ) was compared with the north american dose of enoxaparin ( 30 mg twice daily ) , it was associated with numerically fewer major bleeding events , while it did not statistically achieve non - inferior efficacy , likely due to the 50% higher us dose of enoxaparin used in the study and the prolonged dosing regimen . in summary , the three clinical trials described above demonstrated that dabigatran etexilate was as effective as the eu dose of enoxaparin ( 40 mg once daily ) at preventing vte and all - cause mortality after total hip or total knee replacement surgery , but less effective than the north american dose of enoxaparin ( 30 mg twice daily ) following knee arthroplasty .
the safety profile of dabigatran etexilate was comparable with that of enoxaparin after either total hip or total knee replacement surgery .
there were no significant differences between dabigatran etexilate and enoxaparin in terms of bleeding outcomes , the incidence of liver enzyme elevations ( of particular relevance because of the problems experienced with another direct thrombin inhibitor , ximelagatran ) , and the incidence of acute coronary events either on or off therapy , which suggests there is no rebound activation of coagulation with dabigatran etexilate [ 57 ] . a fourth , phase iii clinical trial of dabigatran etexilate for the primary prevention of vte following elective hip replacement surgery , re - novate ii ( re - novate ii ; clinicaltrials.gov identifier : nct00657150 ) ,
has recently been completed , and the results were reported at the 15th congress of the european hematology association held in june 2010 . in this double - blind , non - inferiority trial , patients ( n = 2,055 ) undergoing total hip arthroplasty were randomized to receive either oral dabigatran etexilate , 220 mg once daily , or subcutaneous enoxaparin , 40 mg once daily , for 2835 days .
dabigatran etexilate demonstrated non - inferiority to enoxaparin for the primary efficacy outcome , a composite of total vte and all - cause mortality , which occurred in 7.7% ( 61/792 ) of the dabigatran etexilate group versus 8.8% ( 69/785 ) of the enoxaparin group .
major bleeding rates were comparable in both groups and occurred in 1.4% of the dabigatran etexilate group and 0.9% of the enoxaparin group .
the study concluded that oral dabigatran etexilate , 220 mg once daily , was as effective as subcutaneous enoxaparin , 40 mg once daily , in reducing the vte risk after total hip arthroplasty , with similar safety profiles and bleeding risk .
as part of the record clinical programme being undertaken by bayer schering pharma ag , four phase iii clinical trials have been completed and published on the efficacy and safety of rivaroxaban for the primary prevention of vte following hip and knee arthroplasty [ 1014 ] ( table 2 ) .
of particular note is that the incidence of surgical site bleeding was not included in the bleeding data for the record trials , which resulted in lower overall rates of bleeding compared with clinical trials of other thromboprophylactic agents such as dabigatran etexilate [ 5 , 6 ] .
table 2the main efficacy outcomes of the four record trials in patients undergoing elective hip or knee arthroplasty [ 1014]trialsettingenoxaparin subcutaneousrivaroxaban oraldeep vein thrombosis / pulmonary embolism / deathevents ( % ) relative risk reduction ( % ) p valuerecord1 , n = 4,541total hip arthroplasty40 mg once daily for 35 days10 mg once daily for 35 days3.7 versus 1.170<0.001record2 , n = 2,509total hip arthroplasty40 mg once daily for 1014 days10 mg once daily for 3139 days9.3 versus 2.079<0.0001record3 , n = 2,531total knee arthroplasty40 mg once daily for 1014 days10 mg once daily for 1014 days18.9 versus 9.649<0.001record4 , n = 3,148total knee arthroplasty30 mg twice daily for 1014 days10 mg once daily for 1014 days10.1 versus 6.9310.0160adapted from copyright ( 2010 ) , with permission from elsevier the main efficacy outcomes of the four record trials in patients undergoing elective hip or knee arthroplasty [ 1014 ] adapted from copyright ( 2010 ) , with permission from elsevier the record1 trial randomized 4,541 patients undergoing total hip replacement surgery to receive either rivaroxaban , 10 mg ( n = 2,266 ) once daily , or subcutaneous enoxaparin , 40 mg ( n = 2,275 ) once daily , for 35 days . significantly fewer patients in the rivaroxaban group ( 1.1% ; 18/1,595 ) experienced a primary efficacy outcome event of deep vein thrombosis ( symptomatic or venography - confirmed asymptomatic ) , non - fatal pulmonary embolism or death from any cause at 36 days , compared with patients in the enoxaparin group ( 3.7% ; 58/1,558 ) ( table 2 ) .
there was no significant difference between the two groups in the rate of major bleeding ( 0.3% for rivaroxaban versus 0.1% for enoxaparin ) ( fig . 3 ) .
3major bleeding events during treatment with either rivaroxaban , 10 mg once daily , or enoxaparin , 40 mg once daily , for 35 days in record1 during total hip arthroplasty ( n = 4,541 ) ; with either rivaroxaban , 10 mg once daily for 3139 days , or enoxaparin , 40 mg once daily for 1014 days , in record2 during total hip arthroplasty ( n = 2,509 ) ; with either rivaroxaban , 10 mg once daily , or enoxaparin , 40 mg once daily , for 1014 days in record3 during total knee arthroplasty ( n = 2,531 ) and with either rivaroxaban , 10 mg once daily , or enoxaparin , 30 mg twice daily , for 1014 days in record4 during total knee arthroplasty ( n = 3,148 ) .
major bleeding during the treatment period was defined as bleeding that was fatal , occurred in a critical organ ( e.g. retroperitoneal , intracranial , intraocular or intraspinal bleeding ) , required reoperation or extra - surgical site bleeding that was clinically overt and was associated with a fall in haemoglobin level of at least 2 g / dl , or that required transfusion of 2 units packed cells or whole blood [ 1013 ] major bleeding events during treatment with either rivaroxaban , 10 mg once daily , or enoxaparin , 40 mg once daily , for 35 days in record1 during total hip arthroplasty ( n = 4,541 ) ; with either rivaroxaban , 10 mg once daily for 3139 days , or enoxaparin , 40 mg once daily for 1014 days , in record2 during total hip arthroplasty ( n = 2,509 ) ; with either rivaroxaban , 10 mg once daily , or enoxaparin , 40 mg once daily , for 1014 days in record3 during total knee arthroplasty ( n = 2,531 ) and with either rivaroxaban , 10 mg once daily , or enoxaparin , 30 mg twice daily , for 1014 days in record4 during total knee arthroplasty ( n = 3,148 ) .
major bleeding during the treatment period was defined as bleeding that was fatal , occurred in a critical organ ( e.g. retroperitoneal , intracranial , intraocular or intraspinal bleeding ) , required reoperation or extra - surgical site bleeding that was clinically overt and was associated with a fall in haemoglobin level of at least 2 g / dl , or that required transfusion of 2 units packed cells or whole blood [ 1013 ] similarly , the record2 trial that was also undertaken in hip replacement patients ( n = 2,509 ) demonstrated superior efficacy for rivaroxaban compared with enoxaparin for the same primary outcome composite , although it should be noted that rivaroxaban was administered for a longer period of time than enoxaparin ( 3139 days versus 1014 days , respectively ) ( table 2 ) .
the major bleeding rates were identical for the two groups ( 0.08% ) ( fig . 3 ) .
two studies , record3 and record4 , were undertaken in patients undergoing total knee replacement surgery .
record3 randomized 2,531 patients to receive either rivaroxaban , 10 mg ( n = 1,254 ) once daily , or subcutaneous enoxaparin , 40 mg ( n = 1,277 ) once daily , for 1014 days .
in contrast , record4 compared rivaroxaban , 10 mg ( n = 1,584 ) once daily , with the north american dose of enoxaparin ( 30 mg twice daily ; n = 1,564 ) .
both studies demonstrated significantly fewer primary outcome events ( vte events and all - cause mortality ) with rivaroxaban compared with enoxaparin ( table 2 ) and comparable rates of major bleeding ( record3 : 0.6% versus 0.5% , respectively ; record4 : 0.7% versus 0.3% , respectively ) ( fig .
once daily oral rivaroxaban ( 10 mg ) was significantly more effective than subcutaneous enoxaparin ( both the eu and north american doses ) at preventing vte - related events after either elective hip or knee replacement surgery .
there was no significant increase in the rate of major bleeding between rivaroxaban and enoxaparin , but surgical site bleeds were not included in the safety outcome evaluation , and it is known from other studies that these contribute considerably to the total major bleeding rate [ 5 , 6 ] . bleeding into the surgical site is of clinical importance to orthopaedic surgeons because of the negative impact it can have on the risk of wound infection and the need for reoperation of the prosthetic joint .
myers squibb and pfizer , is evaluating the thromboprophylactic efficacy and safety of apixaban in a range of indications .
two phase iii clinical trials that have been undertaken in orthopaedic patients have been published to date : the advance-1 and advance-2 studies in patients undergoing total knee replacement [ 15 , 16 ] .
similar to the dabigatran etexilate trials , these studies included bleeding at the surgical site in their safety analyses .
the advance-1 study compared 1014 days of treatment with apixaban ( 2.5 mg twice daily ) with enoxaparin at the north american dose ( 30 mg twice daily ) in 3,195 patients , and failed to show non - inferiority for apixaban for the composite primary efficacy outcome of total vte events and all - cause mortality ( fig .
this was because the incidence of the composite primary efficacy outcome in patients treated with enoxaparin was only 55% of the predicted rate that was used to establish the criteria for non - inferiority and to calculate the sample size .
apixaban treatment was associated with fewer major bleeding events than enoxaparin ( 0.7% versus 1.4% , respectively ) ( fig .
in contrast , the subsequent advance-2 study in 3,057 patients demonstrated superior efficacy for apixaban ( 2.5 mg twice daily ) compared with enoxaparin used at the eu dose ( 40 mg once daily ) for the same primary efficacy composite outcome ( 15.1% versus 24.4% , respectively ) ( fig .
in addition , there was no significant difference in the rate of major bleeding ( apixaban , 0.6% ; enoxaparin , 0.9% ) ( fig .
5b ) and the rate of the composite of major bleeding and clinically relevant non - major bleeding between the two treatment groups ( apixaban , 3.5% ; enoxaparin , 4.8% ) .
4composite of any deep vein thrombosis , non - fatal pulmonary embolism and all - cause mortality during treatment with either apixaban , 2.5 mg twice daily , or enoxaparin , 30 mg twice daily , for 1014 days in the advance-1 study ( n = 3,195 ) during total knee arthroplasty ( a ) ; and with either apixaban , 2.5 mg twice daily , or enoxaparin , 40 mg once daily , for 1014 days in the advance-2 study ( n = 3,057 ) during total knee arthroplasty ( b ) [ 15 , 16]fig .
5major bleeding events during treatment with either apixaban , 2.5 mg twice daily , or enoxaparin , 30 mg twice daily , for 1014 days in the advance-1 study ( n = 3,195 ) during total knee arthroplasty ( a ) ; and with either apixaban , 2.5 mg twice daily , or enoxaparin , 40 mg once daily , for 1014 days in the advance-2 study ( n = 3,057 ) during total knee arthroplasty ( b ) .
major bleeding was defined as acute , clinically overt bleeding accompanied by one or more of the following events : a decrease in the haemoglobin level of 2 g / dl or more within a 24-h period ; a transfusion of 2 or more units of packed red cells ; bleeding at a critical site ( i.e. intracranial , intraspinal , intraocular , pericardial or retroperitoneal bleeding ) ; bleeding into the operated joint , requiring an additional operation or intervention ; intramuscular bleeding with the compartment syndrome or fatal bleeding [ 15 , 16 ] composite of any deep vein thrombosis , non - fatal pulmonary embolism and all - cause mortality during treatment with either apixaban , 2.5 mg twice daily , or enoxaparin , 30 mg twice daily , for 1014 days in the advance-1 study ( n = 3,195 ) during total knee arthroplasty ( a ) ; and with either apixaban , 2.5 mg twice daily , or enoxaparin , 40 mg once daily , for 1014 days in the advance-2 study ( n = 3,057 ) during total knee arthroplasty ( b ) [ 15 , 16 ] major bleeding events during treatment with either apixaban , 2.5 mg twice daily , or enoxaparin , 30 mg twice daily , for 1014 days in the advance-1 study ( n = 3,195 ) during total knee arthroplasty ( a ) ; and with either apixaban , 2.5 mg twice daily , or enoxaparin , 40 mg once daily , for 1014 days in the advance-2 study ( n = 3,057 ) during total knee arthroplasty ( b ) . major bleeding was defined as acute , clinically overt bleeding accompanied by one or more of the following events : a decrease in the haemoglobin level of 2 g / dl or more within a 24-h period ; a transfusion of 2 or more units of packed red cells ; bleeding at a critical site ( i.e. intracranial , intraspinal , intraocular , pericardial or retroperitoneal bleeding ) ; bleeding into the operated joint , requiring an additional operation or intervention ; intramuscular bleeding with the compartment syndrome or fatal bleeding [ 15 , 16 ] in summary , apixaban demonstrated superiority compared with the eu dose of enoxaparin ( 40 mg once daily ) but failed to show non - inferiority compared with the north american dose of enoxaparin ( 30 mg twice daily ) for the prevention of vte following total knee replacement surgery [ 15 , 16 ] . in terms of the incidence of major bleeding
of the new oral anticoagulants , dabigatran etexilate and rivaroxaban have been approved for use in patients following hip and knee replacement surgery in many countries .
no direct head - to - head comparisons of these two agents have been made .
however , a meta - analysis of the pivotal studies comparing dabigatran etexilate with enoxaparin ( n = 8,185 ) or rivaroxaban with enoxaparin ( n = 10,220 ) for vte prevention after total hip and total knee replacement surgery was undertaken using standardized bleeding definitions for major , plus clinically relevant non - major , bleeding .
this post hoc analysis demonstrated that dabigatran etexilate showed similar rates of efficacy and bleeding compared with enoxaparin ( symptomatic vte or death , 1.1% versus 0.9% , respectively ; major plus clinically relevant non - major bleeding , 5.6% versus 5.0% , respectively ) , while rivaroxaban was more effective than enoxaparin but had a significantly higher risk of bleeding ( symptomatic vte or all - cause mortality , 0.6% versus 1.2% , respectively , p < 0.001 for the odds ratio ; major plus clinically relevant non - major bleeding , 3.1% versus 2.5% , respectively , p = 0.049 for the odds ratio ) .
three new oral anticoagulant agents have been evaluated in phase iii clinical trials for vte prevention in elective hip and knee replacement surgery compared with the lmwh enoxaparin administered subcutaneously , and the results have been published .
dabigatran etexilate , a direct thrombin inhibitor , at doses of 220 or 150 mg once daily , has been shown to be as effective and safe as the eu dose of enoxaparin ( 40 mg once daily ) and less effective , but equally safe , as the north american dose regimen of enoxaparin ( 30 mg twice daily ) .
the factor xa inhibitor rivaroxaban ( 10 mg once daily ) was more effective than both the eu and north american doses of enoxaparin whilst maintaining comparable rates of major bleeding .
however , in a meta - analysis of the pivotal studies comparing rivaroxaban with enoxaparin using standardized bleeding definitions for major , plus clinically relevant non - major , bleeding , rivaroxaban was associated with significantly higher rates of major bleeding plus clinically relevant non - major bleeding than enoxaparin .
apixaban ( 2.5 mg twice daily ) , also a factor xa inhibitor , demonstrated superior efficacy and comparable safety compared with the eu dose of enoxaparin but was not as effective as the north american dose of enoxaparin .
dabigatran etexilate and rivaroxaban are currently the only new oral anticoagulant agents that are available for thromboprophylaxis following elective hip and knee replacement surgery .
as there has been no head - to - head trial of these two agents , direct comparative data upon which to base clinical decisions are lacking .
however , the choice of which oral anticoagulant agent to use in these surgical patients must be based on an assessment of each individual patient s risk factors for both vte and bleeding , so that the chosen treatment ensures a balance between efficacy and safety . | introductionpatients undergoing elective total hip or total knee replacement surgery are at increased risk of venous thromboembolism in the post - operative period and are recommended to receive thromboprophylaxis for 1035 days .
although several thromboprophylactic agents are available , these are associated with well - recognized limitations .
for the low molecular weight heparins ( lmwhs ) such as enoxaparin , these limitations include parenteral administration , indirect mode of action , inability to inhibit clot - bound thrombin and association with complications such as heparin - induced thrombocytopenia .
these limitations make post - operative thromboprophylaxis challenging .
several new oral anticoagulants are in the advanced stages of clinical development .
these agents have been designed to target either thrombin ( dabigatran etexilate ) or factor xa ( rivaroxaban and apixaban ) , which are key coagulation cascade enzymes.methods and resultsthis review will present the published phase iii clinical trial evidence of the efficacy and safety of dabigatran etexilate , rivaroxaban and apixaban , compared with the lmwh enoxaparin for the prevention of venous thromboembolism in patients who have undergone elective total hip or total knee replacement surgery .
all three agents have shown comparable or superior efficacy compared with the european dose regimen of enoxaparin ( 40 mg once daily ) , and comparable rates of major bleeding events .
dabigatran etexilate and rivaroxaban are currently licensed for use following elective hip and knee replacement surgery in many countries , but no direct comparative data exist upon which to base the choice of agent.conclusiona thorough assessment of each individual patient s thromboembolic and bleeding risks should be the basis of selecting the agent in order to balance efficacy and safety . |
in fact electron microscopy has been used in the pathological diagnosis of glomerular diseases over past few decades and its diagnostic value has been strongly emphasized .
ultrastructural features may enable a diagnosis to be made where the light microscopy is apparently normal , for example minimal change , thin membrane disease , hereditary nephropathy , and fibrillary and immunotactoid glomerulonephritis .
in addition , it can provide information to confirm or elucidate a diagnosis , as in immune complex glomerulonephritis , renal amyloidosis , dense deposit disease , and diabetes.the main limitations of use of electron microscopy are cost and time consumption .
its usefulness in other diagnostic areas , such as tumor pathology has declined considerably , and this along with inevitable financial pressure to reduce expensive investigations prompted us to perform this study , so the goal of the present study is analysis the necessity of electron microscopy for the diagnosis of childhood glomerulopathies .
in a retrospective study we examined pediatric renal biopsies that referred to a referral hospital in tehran between 2004 and 2009 for electron microscopy evaluation . during this
tissues had been submitted for light microscopy and immunofluorescence and reports of them were reviewed by one pathologist , although some cases did n't have immunofluorescence reports .
all renal biopsies that previously had been studied by light and immunofluorescent microscopy referred to this referral hospital for electron microscopy evaluation .
tissues were fixed in glutaraldehyde 2.5% then osmium tetroxide 1% and embedded in epoxy resin . at first semi - thin sections provided and reviewed to identify glomeruli ,
then thin sections prepared with ultramicrotome and stained by uranyl acetate and lead citrate and examined by zeiss transmission electron microscope . each case
was first analyzed using light microscopy and immunofluorescence findings together with the clinical and laboratory data including serum creatinin , urinalysis and 24h protein excretion , and then electrone microscope was used in order to determine ultrastractural changes of tissues .
mesangial hypercellularity , decrease or increase in basement membrane thickness or irregularity within it , characteristics of endothelial cells , presence of dense deposits within mesangium or along basement membrane were the most important pathologic changes that were evaluated .
if necessary the sections were reviewed by second pathologist and the role of electron microscopy for diagnosing the glomerular disease .
the contribution was graded into 3 groups as follow : necessary : if final diagnosis could not have been achieved without electron microscopy.supportive : if the ultrastructural study did n't alter primary diagnosis , however , did provide important information confirming the primary diagnosis and rule out other diagnoses.noncontributory : if the electron microscopy was not needed to confirm the diagnosis .
supportive : if the ultrastructural study did n't alter primary diagnosis , however , did provide important information confirming the primary diagnosis and rule out other diagnoses .
the software used for statiscal analysis was ssps 15 and mostly descriptive statistics were used .
all renal biopsies that previously had been studied by light and immunofluorescent microscopy referred to this referral hospital for electron microscopy evaluation .
tissues were fixed in glutaraldehyde 2.5% then osmium tetroxide 1% and embedded in epoxy resin . at first semi - thin sections provided and reviewed to identify glomeruli ,
then thin sections prepared with ultramicrotome and stained by uranyl acetate and lead citrate and examined by zeiss transmission electron microscope . each case
was first analyzed using light microscopy and immunofluorescence findings together with the clinical and laboratory data including serum creatinin , urinalysis and 24h protein excretion , and then electrone microscope was used in order to determine ultrastractural changes of tissues .
mesangial hypercellularity , decrease or increase in basement membrane thickness or irregularity within it , characteristics of endothelial cells , presence of dense deposits within mesangium or along basement membrane were the most important pathologic changes that were evaluated .
if necessary the sections were reviewed by second pathologist and the role of electron microscopy for diagnosing the glomerular disease .
the contribution was graded into 3 groups as follow : necessary : if final diagnosis could not have been achieved without electron microscopy.supportive : if the ultrastructural study did n't alter primary diagnosis , however , did provide important information confirming the primary diagnosis and rule out other diagnoses.noncontributory : if the electron microscopy was not needed to confirm the diagnosis .
supportive : if the ultrastructural study did n't alter primary diagnosis , however , did provide important information confirming the primary diagnosis and rule out other diagnoses .
the software used for statiscal analysis was ssps 15 and mostly descriptive statistics were used .
clinical information of studied glomerulopathies the most important cases which were studied are as below : alport 's syndrome was observed in 32 cases ( about 24% ) and it was the most common diagnosis and composed of 17 boys and 15 girls .
electron microscopy ( em ) was necessary in all cases.focal segmental glomerulosclerosis ( fsgs ) was observed in 21 cases ( 15% ) and was the second most common diagnosis ; 13 boys and 8 girls .
the final diagnosis by em was supportive in 13 cases and noncontributory in 8 cases.minimal change disease ( mcd ) was observed in 10 cases ( 7.5% ) composed of 7 boys and 3 girls .
em study was necessary in 1 case and noncontributory in 5 cases.chronic interstitial nephritis was seen in 5 patients ( 3% ) , 4 boys and l girl .
alport 's syndrome was observed in 32 cases ( about 24% ) and it was the most common diagnosis and composed of 17 boys and 15 girls .
focal segmental glomerulosclerosis ( fsgs ) was observed in 21 cases ( 15% ) and was the second most common diagnosis ; 13 boys and 8 girls .
the final diagnosis by em was supportive in 13 cases and noncontributory in 8 cases .
minimal change disease ( mcd ) was observed in 10 cases ( 7.5% ) composed of 7 boys and 3 girls .
chronic interstitial nephritis was seen in 5 patients ( 3% ) , 4 boys and l girl .
note the thickening and splitting of glomerular basement membrane microvillous transformation in minimal change disease the data of all patients are summarized in table 2 .
role of electron microscopy in diagnosis of childhood glomerulopathies.gn,glomrrulonephritis gn : glomerolonephritis / ig : immunoglobulin
in our study em study was necessary in 51 cases of 134 ( 38% ) , supportive in 40 cases ( 30% ) and noncontributory in 43 ( 32% ) . in rivera
et al . study about value of electron microscopy in the diagnosis of childhood nephrotic syndrome , em was essential in diagnosis of 73% cases and supportive in a further 27% .
siegel et al . showed that electron microscopy contributed to diagnosis in 48% cases , and sementilli et al . concluded that ultrastructural study is necessary in diagnosis of hereditary nephropathies
another study by daouich et al revealed that electron microscopy was essential for diagnosis in 8 cases ( 40% ) and was helpful in 12 cases ( 60% ) . in conclusion
, the results showed that the ultrastructural study provides essential or helpful information in many cases of glomerular diseases , and therefore electron microscopy should be considered an important tool of diagnostic renal pathology . in our study
the highest percentage of cases in necessary category were alport syndrome [ the most common disease in our series : 32 cases ( 24% ) ] , thin basement membrane disease , congenital nephrotic syndrome finnish - type , collagen iii nephropathy , igm nephropathy and hus .
it is accepted that in hereditary nephropathies electron microscopy is necessary in diagnosis , and present study shows the same results . in alport syndrome light microscopy
can be normal or only shows mesangial hypercellularity and immunofluorescence study is negative for any deposition , so electron microscopy is necessary for diagnosis .
differentiation alport syndrome from thin basement membrane disease can be difficult because these two diseases are closely related , however the major abnormalities of the glomerular basement membrane are visualized only by electron microscopy .
the evaluation of renal biopsy specimens without access to electron microscopy results can lead to missed diagnosis . in our study electron microscopy altered diagnosis in 14% cases and the most common diagnosis that altered by em evaluation was minimal change disease whereas skjoten and halvarsen found that em altered diagnosis in 34% cases .
the most common diseases that electron microscopy was supportive in final diagnosis were igm nephropathy and amyloidosis , and in any cases of chronic interstitial nephritis ultrastructural study did n't help more .
in conclusion the results showed in about 78% of childhood glomerulopathies the ultrastructural study was necessary or supportive , so electron microscopy still remains an important tool in diagnosis of childhood glomerulopathies ; but it has some important limitations such as very few centers which have electrone microscopy , low experience for interpreting the results and high cost of the test and because of these limitations especially in our country it is helpful in cases that light and immunofluorescent microscopic examinations had inevitable limitations in diagnosis , such as basement membrane disorders .
| objectiveoptimum diagnosis of glomerulopathies requires light microscopy , immunofluorescence and electron microcopy .
in fact electron microscopy has a confirmatory role in glomerular diseases .
it provides more information for patient management and can rule out other diseases .
the goal of the present study is analysis the necessity of electron microscopy for the diagnosis of childhood glomerulopathies.methods134 cases of renal biopsy with some clinical data retrospectively were reviewed .
the contribution of electron microscopy to the final diagnosis was graded as necessary diagnosis could not be reached without it , supportive it increased the level of confidence in the final diagnosis and noncontributory the diagnosis do n't need electron microscopy for confirmation.findingsthe contribution of electron microscopy to the final diagnosis was necessary in 51 cases ( 38% ) , supportive in 40 cases ( 30% ) and noncontributory in 43 cases ( 32%).conclusionin conclusion the results showed in about 68% of childhood glomerulopathies the ultrastructural study was necessary or supportive , so electron microscopy still remains an important tool in diagnosis of childhood glomerulopathies . |
periodontal diseases , the most prevalent diseases throughout the world , are predominantly caused by gram - negative , anerobic bacteria present on the tooth root surfaces as a biofilm .
inflamed periodontal tissue produces significant amounts of pro - inflammatory cytokines , mainly il-1 , il-6 , pge2 and tumor necrosis factor alpha ( tnf- ) , reactive oxygen species enzymes , proteins , host cells , ions , hormones , and markers of oxidative stress and antioxidant .
reactive oxygen species ( ros ) play crucial roles in normal physiological processes including response to growth factors , the immune response , and apoptotic elimination of damaged cells but are also highly toxic and destructive when generated during the respiratory burst as it represents an important pathogenic mechanism for tissue damage and diseases associated with phagocytic infiltration . the discovery of the role of free radicals in cancer , diabetes , cardiovascular diseases , autoimmune diseases , neurodegenerative disorders , aging , and other chronic diseases has led to a medical revolution comprising of various antioxidants that is promising a new paradigm of healthcare .
these are the agents , which scavenge free radicals otherwise reactive oxygen species and prevent the damage caused by them .
lycopene , a pigment that gives tomatoes red color , is one of the most potent antioxidants among dietary carotenoids with a singlet - oxygen - quenching ability three times as high as that of - carotene and ten times higher than that of -tocopherol
. dietary intake of tomatoes and tomato products containing lycopene has been shown to be associated with a decreased risk of chronic diseases , such as cancer and cardiovascular disease - tocopherol .
dietary intake of tomatoes and tomato products containing lycopene has been shown to be associated with a decreased risk of chronic diseases , such as cancer and cardiovascular disease .
various biomarkers apart from clinical appearance have been used to evaluate periodontal destruction which includes enzymes , proteins , host cells , markers of cellular and humoral activity , ions , hormones , and markers of oxidative stress and antioxidants .
uric acid is one of the major antioxidants that is present in saliva and can be used to determine the effect of antioxidant therapy in the treatment of periodontal diseases .
the aim of the present study is to evaluate efficacy of antioxidants in the treatment of chronic gingival and periodontal disease and to compare the efficacy of antioxidant as a monotherapy and as an adjunct in the treatment of gingivitis and chronic periodontitis .
70 subjects were selected from those attending the department of periodontics , pacific dental college and hospital , udaipur , rajasthan .
subjects were selected on the basis of community periodontal index of treatment needs ( cpitn ) .
subjects with systemic diseases like diabetes , cardiovascular diseases , and renal diseases , subjects with a habit of smoking , pan chewing , subjects on medications like antibiotics or antioxidants like vitamin c , vitamin e or -carotenes within 3 months and pregnant and lactating mothers were excluded from this study .
the proposed study was reviewed by the ethical committee of the institution and clearance was obtained .
an informed consent was obtained from each subject before conducting the trial , the form of which is enclosed .
the selected subjects were divided into three groups on the basis of cpitn index [ table 1 ] .
subgroup iib : 10 subjects were treated by non - surgical periodontal therapy and were given antioxidants also .
subgroup iiib : 10 subjects were treated with non - surgical periodontal therapy and were given antioxidants also .
antioxidant was given in a dosage of 6 mg per day in three divided doses for 2 weeks .
each softgel was composed of lycopene 2000 mcg , zinc 7.5 mg , and selenium 35 mcg .
1 ml of unstimulated saliva samples were collected by allowing saliva to passively flow into a sterile test tube after rinsing the mouth with water to wash out the exfoliated cells for all the subjects .
supragingival and subgingival scaling were done after sample collection in groups ii and iii subgroup a and b. the samples of saliva from group ii and iii patients were collected again after 15 , 30 , and 45 days of nonsurgical periodontal treatment .
the uric acid level was evaluated by using a reflotron reflectance photometer at the wavelength of 642 nm .
1 ml of unstimulated saliva samples were collected by allowing saliva to passively flow into a sterile test tube after rinsing the mouth with water to wash out the exfoliated cells for all the subjects .
supragingival and subgingival scaling were done after sample collection in groups ii and iii subgroup a and b. the samples of saliva from group ii and iii patients were collected again after 15 , 30 , and 45 days of nonsurgical periodontal treatment .
the uric acid level was evaluated by using a reflotron reflectance photometer at the wavelength of 642 nm .
the mean score for patients of group 1 ( clinically healthy ) was 0.780.26 , 1.870.27 for group 2 ( gingivitis group ) , and 6.110.58 for group 3 ( periodontitis group ) .
on comparison between 1 and 2 , 2 and 3 , and 1 and 3 using post hoc test , highly significant difference ( p=0.000 ) was observed on 0 day .
one - way anova test was applied to compare the periodontal status between and within the groups on 0 , 15 , 30 , and 45 day .
comparison between 0 , 15 , 30 , and 45 days showed a highly significant difference [ table 1 ] .
for patients of group 1 , the mean score on 0 day was 5.190.8 and 5.560.88 on the 45 day .
on comparison between 0 and 45 day using the t test , no significant difference ( p=0.15 ) was observed [ table 2 ] .
comparison of the russell periodontal index between all the groups and subgroups on baseline , 15 , 30 , and 45 day for patients of subgroup a , the mean score was 3.160.32 , subgroup b the mean score was 2.250.35 , subgroup c the mean score was 2.20.26 . on comparison between a and b using the post hoc test , no significant difference ( p=0.7 ) was observed while a highly significant difference ( p=0.00 ) was observed between subgroups b & c and a & c using the post hoc test , on 0 day .
one - way anova test was applied to compare uric acid levels between and within the subgroups of group 2 on 0 , 15 , 30 , and 45 day [ figure 1 ] . on comparison of uric acid on 0 , 15 , and 30 day , significant difference ( p=0.00 , 0.001 and 0.009 , respectively ) was observed . while the uric acid level on 45 day showed non - significant difference ( p=0.53 ) .
comparison of uric acid levels between subgroup a , b and c of group 2 on 0 , 15 , 30 and 45 day for patients of subgroup a , the mean score was 2.430.42 , subgroup b the mean score was 2.290.4 , and subgroup c the mean score was 2.290.39 . on comparison between a and b ,
b and c , and a and c using post hoc test , no significant difference ( p=0.65 , 0.99 , and 0.45 respectively ) was observed on 0 day .
on comparison between a and b using the post hoc test , no significant difference ( p=0.26 ) was observed .
on comparison between b and c and a and c using the post hoc test , significant difference was observed on 15 , 30 , and 45 day .
one - way anova test was applied to compare uric acid levels between and within the subgroups of group 3 on 0 , 15 , 30 , and 45 day [ figure 2 ] . on comparison of uric acid on 15 , 30 , and 45 day , significant difference ( p=0.042 , 0.024 , and 0.00 , respectively ) was observed .
comparison of uric acid levels between subgroup a , b and c of group 3 on 0 , 15 , 30 and 45 day
the mean score for patients of group 1 ( clinically healthy ) was 0.780.26 , 1.870.27 for group 2 ( gingivitis group ) , and 6.110.58 for group 3 ( periodontitis group ) .
on comparison between 1 and 2 , 2 and 3 , and 1 and 3 using post hoc test , highly significant difference ( p=0.000 ) was observed on 0 day .
one - way anova test was applied to compare the periodontal status between and within the groups on 0 , 15 , 30 , and 45 day .
comparison between 0 , 15 , 30 , and 45 days showed a highly significant difference [ table 1 ] .
for patients of group 1 , the mean score on 0 day was 5.190.8 and 5.560.88 on the 45 day .
on comparison between 0 and 45 day using the t test , no significant difference ( p=0.15 ) was observed [ table 2 ] .
comparison of the russell periodontal index between all the groups and subgroups on baseline , 15 , 30 , and 45 day for patients of subgroup a , the mean score was 3.160.32 , subgroup b the mean score was 2.250.35 , subgroup c the mean score was 2.20.26 . on comparison between a and b using the post hoc test , no significant difference ( p=0.7 ) was observed while a highly significant difference ( p=0.00 ) was observed between subgroups b & c and a & c using the post hoc test , on 0 day .
one - way anova test was applied to compare uric acid levels between and within the subgroups of group 2 on 0 , 15 , 30 , and 45 day [ figure 1 ] . on comparison of uric acid on 0 , 15 , and 30 day , significant difference ( p=0.00 , 0.001 and 0.009 , respectively ) was observed . while the uric acid level on 45 day showed non - significant difference ( p=0.53 ) .
comparison of uric acid levels between subgroup a , b and c of group 2 on 0 , 15 , 30 and 45 day for patients of subgroup a , the mean score was 2.430.42 , subgroup b the mean score was 2.290.4 , and subgroup c the mean score was 2.290.39 . on comparison between a and b , b and c , and a and c using post hoc test , no significant difference ( p=0.65 , 0.99 , and 0.45 respectively ) was observed on 0 day .
on comparison between a and b using the post hoc test , no significant difference ( p=0.26 ) was observed .
on comparison between b and c and a and c using the post hoc test , significant difference was observed on 15 , 30 , and 45 day .
one - way anova test was applied to compare uric acid levels between and within the subgroups of group 3 on 0 , 15 , 30 , and 45 day [ figure 2 ] . on comparison of uric acid on 15 , 30 , and 45 day , significant difference ( p=0.042 , 0.024 , and 0.00 , respectively ) was observed .
comparison of uric acid levels between subgroup a , b and c of group 3 on 0 , 15 , 30 and 45 day
for patients of group 1 , the mean score on 0 day was 5.190.8 and 5.560.88 on the 45 day .
on comparison between 0 and 45 day using the t test , no significant difference ( p=0.15 ) was observed [ table 2 ] .
comparison of the russell periodontal index between all the groups and subgroups on baseline , 15 , 30 , and 45 day
for patients of subgroup a , the mean score was 3.160.32 , subgroup b the mean score was 2.250.35 , subgroup c the mean score was 2.20.26 . on comparison between a and b using the post hoc test , no significant difference ( p=0.7 ) was observed while a highly significant difference ( p=0.00 ) was observed between subgroups b & c and a & c using the post hoc test , on 0 day .
one - way anova test was applied to compare uric acid levels between and within the subgroups of group 2 on 0 , 15 , 30 , and 45 day [ figure 1 ] . on comparison of uric acid on 0 , 15 , and 30 day , significant difference ( p=0.00 , 0.001 and 0.009 , respectively ) was observed . while the uric acid level on 45 day showed non - significant difference ( p=0.53 ) .
comparison of uric acid levels between subgroup a , b and c of group 2 on 0 , 15 , 30 and 45 day
for patients of subgroup a , the mean score was 2.430.42 , subgroup b the mean score was 2.290.4 , and subgroup c the mean score was 2.290.39 . on comparison between a and b , b and c , and a and c using post hoc test , no significant difference ( p=0.65 , 0.99 , and 0.45 respectively ) was observed on 0 day .
on comparison between a and b using the post hoc test , no significant difference ( p=0.26 ) was observed .
on comparison between b and c and a and c using the post hoc test , significant difference was observed on 15 , 30 , and 45 day .
one - way anova test was applied to compare uric acid levels between and within the subgroups of group 3 on 0 , 15 , 30 , and 45 day [ figure 2 ] . on comparison of uric acid on 15 , 30 , and 45 day , significant difference ( p=0.042 , 0.024 , and 0.00 , respectively ) was observed .
comparison of uric acid levels between subgroup a , b and c of group 3 on 0 , 15 , 30 and 45 day
the inflammatory and immune responses to the bacteria and also viruses that colonize the periodontal and associated tissues involve the systemic circulation and ultimately the peripheral systems of the body .
this creates a complex bi - directional series of host - microbial interactions involving cellular and humoral factors and networks of cytokines , chemokines , and growth factors . according to haffajee , et al .
, the primary etiological agent is specific which consists predominantly gram - negative anerobic or facultative bacteria within the subgingival biofilm , but the majority of periodontal tissue destruction is caused by an inappropriate host response to those microorganisms and their products .
detection of markers of tissue destruction can thus be incorporated in diagnosis of periodontal diseases .
loss of balance between reactive oxygen species and antioxidant defense has also been implicated as an etiologic factor for periodontal diseases .
it may manifest as an increase in oxidative stress , reduction of total antioxidant capacity , or decrease in individual antioxidant level .
chapple and matthews implicated oxidative stress in the pathogenesis of periodontitis . in this study , significant difference was observed in the periodontal index between healthy , gingivitis , and periodontitis group on 0 day and 15 day .
similar results were also observed in a study by cugini , et al . according to moore , et al . , uric acid is a major antioxidant in saliva and contributes approximately 70% of the total salivary antioxidant capacity .
it has been seen that levels of antioxidants vary according to the severity of disease , and similarly uric acid levels also vary according to the severity of periodontal disease .
significant difference was observed in salivary uric acid levels on 0 day between healthy , gingivitis and periodontitis groups .
a decrease in the salivary uric acid levels were observed in the gingivitis and periodontitis groups .
diab - ladki , et al . in a similar study also found that there was a slight decrease in the concentration of three main antioxidants ( uric acid , ascorbic acid , and albumin ) in saliva with the increase in severity of periodontal disease .
results of this study showed that there was a significant increase in uric acid levels in all the subgroups a , b , and c [ tables 1 and 3 ] on 15 , 30 , and 45 day of both gingivitis and periodontitis groups .
comparison of uric acid levels of group 1 on 0 and 45 day although no significant difference could be observed in uric acid levels between scaling and root planing ( subgroup a ) and scaling and root planing with antioxidant ( subgroup b ) , an increase in the mean uric acid levels was observed as the time elapsed .
chandra , et al . in their study observed that though there was no significant difference in uric acid levels in between groups treated with a combination of oral prophylaxis and antioxidant and group treated with scaling and root planning alone , there was a better response to antioxidant therapy in combination to oral prophylaxis in the gingivitis group . in this study ,
no significant difference was seen in salivary uric acid levels from 30 to 45 day .
this shows that within 45 days , a plateau plasma level of antioxidants was achieved which causes decrease in values of the periodontal index .
there was a reduction in periodontal inflammation with an increase in the salivary uric acid levels seen in subgroups treated by antioxidants in both gingivitis and periodontitis groups .
hence , within the limitations of this study , it can be concluded that antioxidants can be used as an effective adjunct to scaling and root planing for the treatment of gingivitis and periodontitis . to further evaluate long - term effects of antioxidant therapy on periodontal inflammation , more expanded | background : treatment of periodontal diseases by nonsurgical debridement has been considered as a gold standard procedure .
various other treatment modalities have been tried and tested to treat periodontal diseases .
the aim of this study was to investigate the effect of antioxidant therapy on the progression of periodontal disease as monotherapy and/or as an adjunct to nonsurgical debridement.materials and methods:70 subjects were divided into three groups , i.e. clinically healthy , gingivitis and periodontitis group on the basis of community periodontal index of treatment needs score .
gingivitis and periodontitis groups were further subdivided into three subgroups . at the baseline ,
periodontal attachment loss was recorded and scaling and root planing was performed in two subgroups . 6 mg antioxidant was administered in three divided doses for 2 weeks .
saliva samples were collected at baseline , 15th day , 30th day and 45th day for evaluation of uric acid levels.results:uric acid levels were significantly low in patients with more periodontal attachment loss as compared to clinically healthy and gingivitis groups .
as the treatment was initiated , significant increase in uric acid levels was observed.conclusion:rise in salivary antioxidant levels was observed on the administration of antioxidant therapy . hence , antioxidant therapy can be used as an adjunct to the nonsurgical periodontal therapy . |
scrub typhus infection is a common febrile disorder presenting in the tropical region with propensity to involve different systems . amongst them
the cardio - respiratory system is involved in a significant proportion resulting in various manifestations .
herein we describe a case of scrub typhus presenting as acute right sided heart failure and also discuss the different aspects of cardio - pulmonary manifestations in this rickettsial infection .
a 40-year - old female who was previously well - presented to us with complaints of shortness of breath and cough with scanty expectoration for the last 7 days . on examination , she had a heart rate of 132 beats / min , respiratory rate 44 breaths / min , blood pressure 114/82 mm of hg , spo2 of 80% ( on room air ) .
systemic examination revealed raised jugular venous pressure ( jvp ) , mild hepatomegaly , and coarse crepitations in bilateral lung bases .
chest x - ray revealed bilateral patchy nonhomogenous infiltrates in the mid and lower zones [ figure 1 ] .
nt - probnp done in the emergency was > 20,000 pg / ml with normal cardiac enzymes and without any significant electrocardiography ( ecg ) changes .
two - dimensional ( 2d ) echocardiography showed normal left atrium / ventricle but enlarged right atrium / ventricle ( ra / rv ) with shifting of interventricular septum towards left and the presence of moderate pulmonary hypertension ( rv systolic pressure = 43 + right atrial pressure ) [ figure 2 ] .
computed tomography ( ct ) pulmonary angiography was done which did not show any pulmonary embolism .
bilateral pleural effusion was seen along with interlobular septal thickening and ground glass opacities in both lung fields with sparing of periphery of lung fields [ figures 3 and 4 ]
chest x - ray of the patient at presentation investigations of the patient two - dimensional echocardiography ( apical view ) showing marked right atrial and ventricular enlargement computed tomography thorax ( mediastinal window ) showing bilateral pleural effusion computed tomography thorax ( lung window ) showing bilateral pulmonary alveolar edema initially , she was treated symptomatically with oxygen , noninvasive ventilation , fluid restriction and diuretics .
however , her symptoms worsened , oxygen requirement increased along with a drop in platelets ( 80,000/mm ) . in view of multi - organ involvement and newly developing thrombocytopenia
, other possible causes were looked into . immunological workup ( anti - nuclear antibody , anti - double - stranded deoxyribonucleic acid , anti - cyclic citrullinated peptide , and anti - neutrophil cytoplasmic antibody ) were negative .
ultrasound guided pleural fluid aspiration was done which revealed exudative effusion [ table 1 ] .
weil - felix test was positive and igm antibody for scrub typhus was strongly positive ( by elisa ) .
she responded to doxycycline and within 48 h her symptoms decreased significantly and her vitals steadily improved .
within another 48 h , her hemoglobin oxygen saturation improved to 95% ( on room air ) and tachypnea and tachycardia resolved and her nt - probnp fell to < 3000 pg / ml .
chest x - ray repeated after a week revealed significant improvement [ figure 5 ] and a repeat 2d echo after 2 weeks revealed resolution of ra / rv enlargement [ figure 6 ] .
chest x - ray of the patient showing marked improvement after completion of therapy two - dimensional echo of the patient ( apical view ) showing resolution of right heart enlargement after completion of therapy
this case presents several unique features . a patient having scrub typhus , presented with features of acute right heart failure ( acute cor - pulmonale ) and ards .
ards has been rarely described in cases of scrub typhus but scrub typhus presenting as acute cor - pulmonale has not been described in literature to the best of our knowledge .
the fact that the patient was afebrile was another uncommon feature in this case . as the patient was afebrile and did not have eschar mark or history of any insect bite the diagnosis of scrub typhus was not suspected initially and infective conditions were not investigated at the outset .
scrub typhus is a rickettsial disease caused by orientia tsutsugamushi which commonly leads to the features of fever , rash , and eschar . in some cases ,
especially where early treatment is not instituted complications may arise such as meningitis , liver dysfunction , acute kidney injury , and disseminated intravascular coagulation which might lead to multi - organ dysfunction syndrome .
heart failure due to scrub typhus patients has been rarely reported where myocarditis has been implicated in the causation of the same .
, the full - blown picture of heart failure was manifested by raised jvp , hepatomegaly , raised nt - probnp , and right heart enlargement on echocardiography .
the pulmonary edema seen on chest x - ray appeared to be due to ards
the occurrence of acute cor - pulmonale in this case was probably due to ards and associated severe pulmonary vaso - constriction induced increased pressure load on the right ventricle .
alternatively , the interventricular septum might have been pushed to the left with an increase in the rv pressure and corresponding compromise of the left ventricular output .
however , this seems less likely as the pleural effusions in the latter scenario would be expected to be transudative . a right heart catheterization and
pressure studies would have been conclusive but could not be done as the patient was severely hypoxemic and required continuous noninvasive ventilator support .
thus , this case brings forward some important points . scrub typhus in severe cases can lead to complications involving vital organs such as lungs and heart as was evident in this case .
sometimes the classical features of fever , rash , and eschar might all be missing as in our case .
however scrub typhus presenting as ards without much fever has been documented by ichimura et al .
hence , having a high index of suspicion is important in cases of lung and/or heart involvement especially in endemic areas . in patients with multi - organ failure ,
the possibility of scrub typhus infection should be borne in mind and investigated if the cause is otherwise not apparent .
a systematic review of literature was done to evaluate the nature of involvement of cardiorespiratory system in scrub typhus infection .
search was done in pubmed with the following questions with respect to cardiopulmonary involvement in scrub typhus .
chest x - ray and ct imaging features different type of diseases caused complications encountered .
eschar which is said to be pathognomic of scrub typhus were seen in 43.586.3% patients , cough in 13.738% patients and dyspea in 1849% patients .
frequencies of the common symptoms related to the cardio - pulmonary system the x - ray features have been tabulated in table 3 .
the incidence of x - ray abnormalities have been described by qu to be around 44% and 59.4% by song et al . among patients with scrub typhus .
interstitial pneumonia appears to be the most common radiological feature ( ranging from 40% to 51.4% ) . on ct scan of thorax ,
the most common features were ground glass opacities and mediastinal lymphadenopathy ( 91% each ) [ table 4 ] while interlobular septal thickening has been noticed in up to 82% patients .
the complications related to the cardiopulmonary system have been enumerated in tables 5 and 6 .
septic shock has been described in 3 - 65.6% patients and ards in 11.1 - 33.7% patients .
frequencies of chest x - ray findings in scrub typhus infection frequencies of computed tomography thorax findings in scrub typhus infection frequencies of cardiac involvement in scrub typhus infection frequencies of different cardiopulmonary complications in scrub typhus infection wang et al .
8 out of 72 ( 11.1% ) patients studied were seen to develop ards and 25% of patients with ards succumbed .
initial presentations of dyspnea and cough , white blood cell count , hematocrit , total bilirubin , and delayed use of appropriate antibiotics were independent predictors of ards .
settle et al . in their series describing autopsy findings of scrub typhus patients concluded that interstial pneumonia is present in almost all patients with scrub typhus . on chest radiograph abnormalities are present in 5972% patients .
zhang et al . noted the involvement of respiratory system in around 25.5% of cases .
reticulonodular infiltrates , hilar lymph node enlargement and septal lines are the most common findings while consolidation is relatively uncommon and generally appears in the lower zone of lungs .
pleural effusion and unilateral / bilateral hilar enlargement are found in 1243% and 2527% patients respectively . in
more than 50% patients abnormal chest radiographs were observed in the 1 week and progressive changes were frequently observed also in the 1 week .
fifty - three percent of infected patients have been seen to have relative bradycardia as described by aronoff and watt .
scrub typhus increases the risk of acute coronary syndrome by around 37% , and the prominent effect was seen within 1 year of infection .
ecg changes have been seen in 14.7% patients and the common changes describe 12 were t wave changes ( 33.3% ) , st - t changes ( 26.7% ) , partial or complete bundle branch block ( 26.7% ) , sinus bradycardia ( 13.3% ) , ventricular extrasystoles ( 6.7% ) , and abnormal q wave ( 6.7%).19
a systematic review of literature was done to evaluate the nature of involvement of cardiorespiratory system in scrub typhus infection .
search was done in pubmed with the following questions with respect to cardiopulmonary involvement in scrub typhus .
chest x - ray and ct imaging features different type of diseases caused complications encountered .
eschar which is said to be pathognomic of scrub typhus were seen in 43.586.3% patients , cough in 13.738% patients and dyspea in 1849% patients .
frequencies of the common symptoms related to the cardio - pulmonary system the x - ray features have been tabulated in table 3 .
the incidence of x - ray abnormalities have been described by qu to be around 44% and 59.4% by song et al . among patients with scrub typhus .
interstitial pneumonia appears to be the most common radiological feature ( ranging from 40% to 51.4% ) . on ct scan of thorax ,
the most common features were ground glass opacities and mediastinal lymphadenopathy ( 91% each ) [ table 4 ] while interlobular septal thickening has been noticed in up to 82% patients .
the complications related to the cardiopulmonary system have been enumerated in tables 5 and 6 .
septic shock has been described in 3 - 65.6% patients and ards in 11.1 - 33.7% patients .
frequencies of chest x - ray findings in scrub typhus infection frequencies of computed tomography thorax findings in scrub typhus infection frequencies of cardiac involvement in scrub typhus infection frequencies of different cardiopulmonary complications in scrub typhus infection wang et al .
8 out of 72 ( 11.1% ) patients studied were seen to develop ards and 25% of patients with ards succumbed .
initial presentations of dyspnea and cough , white blood cell count , hematocrit , total bilirubin , and delayed use of appropriate antibiotics were independent predictors of ards .
settle et al . in their series describing autopsy findings of scrub typhus patients concluded that interstial pneumonia is present in almost all patients with scrub typhus . on chest radiograph abnormalities are present in 5972% patients .
zhang et al . noted the involvement of respiratory system in around 25.5% of cases .
reticulonodular infiltrates , hilar lymph node enlargement and septal lines are the most common findings while consolidation is relatively uncommon and generally appears in the lower zone of lungs .
pleural effusion and unilateral / bilateral hilar enlargement are found in 1243% and 2527% patients respectively . in more than 50% patients abnormal chest radiographs
were observed in the 1 week and progressive changes were frequently observed also in the 1 week .
fifty - three percent of infected patients have been seen to have relative bradycardia as described by aronoff and watt .
scrub typhus increases the risk of acute coronary syndrome by around 37% , and the prominent effect was seen within 1 year of infection .
ecg changes have been seen in 14.7% patients and the common changes describe 12 were t wave changes ( 33.3% ) , st - t changes ( 26.7% ) , partial or complete bundle branch block ( 26.7% ) , sinus bradycardia ( 13.3% ) , ventricular extrasystoles ( 6.7% ) , and abnormal q wave ( 6.7%).19
cardiopulmonary involvement is not so uncommon in scrub typhus infections and needs to be duly considered when treating such patients .
| we describe a middle aged previoulsy healthy female patient who presented with clinical features suggestive of acute heart failure .
investigations revealed very high nt pro - bnp , right heart enlargement , bilateral pulmonary alveolar edema and bilateral pleural effusion . in view of falling platelet counts and exudative pleural effusion inflammatory / infective causes
were considered .
her weil felix test was strongly positive and igm for scrub typhus also returned positive .
she was started on doxycycline to which there was dramatic improvement .
thus in this case scrub typhus infection presented as acute right heart failure and the cause seemed elusive at the outset .
we also systematically reviewed the existing literature on cardio - pulmonary manifestations of scrub typhus infection . |
exudative retinal detachment , a very rare ocular finding in leukemia , has only been described in a few cases and has not been previously reported in india.12 this case is also the first case to document common acute lymphoblastic leukemia - associated antigen ( calla ) positive precursor b - cell lymphoblastic leukemia manifesting as exudative retinal detachment in an otherwise healthy young adult male from south india .
a previously healthy 36-year - old male presented with gradual decrease in near vision in both eyes over 2 weeks .
there was no history of any systemic disease , steroid intake , ocular trauma , or surgery .
his best corrected visual acuities ( bcvas ) were 20/50 and 20/25 at distance and n12 and n10 at near vision in the right and left eyes , respectively .
fundus examination showed multifocal bilateral exudative retinal detachment in both eyes [ figure 1 ] .
fluorescence angiography ( fa ) in the early phase showed delayed choroidal filling and pinpoint hyperfluorescence at the level of the retinal pigment epithelium [ figure 2a ] .
late phase fa was apparent for pinpoint hyperfluorescent dots remaining the same in size and intensity [ figure 2b ] .
optical coherence tomography ( oct ) revealed multiple areas of subretinal serous fluid pockets in both eyes [ figure 3 ] .
a clinical diagnosis of bilateral exudative retinal detachment was considered . however , systemic evaluation revealed increased white blood cell counts ( 2,90,000/l ) , with an abnormally increased percentage of blast cells ( 30% ) .
the patient was started on systemic chemotherapy of vincristine , prednisolone , daunorubicin , l - asparaginase ( vpdl ) and high - dose steroid therapy , prednisolone 60 mg daily by the oncologist .
fundus examination with multifocal exudative retinal detachment in both eyes ( a ) fluorescence angiography ( fa ) in the early phase showed delayed choroidal filling and pinpoint hyperfluorescence at the level of the retinal pigment epithelium in right eye , ( b ) fluorescence angiography ( fa ) in the early phase showed delayed choroidal filling and pinpoint hyperfluorescence at the level of the retinal pigment epithelium in left eye , ( c ) late phase fa was apparent for pinpoint hyperfluorescent dots remaining the same in size and intensity in right eye , ( d ) late phase fa was apparent for pinpoint hyperfluorescent dots remaining the same in size and intensity in left eye ( a ) optical coherence tomography ( oct ) revealed multiple areas of subretinal serous fluids in left eye , ( b ) optical coherence tomography ( oct ) revealed multiple areas of subretinal serous fluids in right eye
in leukemia patients , vision loss due to choriocapillary occlusion was first reported by zimmerman in 1964.1 beyond that , exudative retinal detachment in leukemia has been reported in only a few cases worldwide , as a presenting sign of the disease or the first sign of relapse.15 our case presented with bilateral exudative retinal detachment , with multiple pinpoint hyper- fluorescent areas on fundus fluorescein angiography fundus fluorescein angiography ( ffa ) with features resembling vogt koyanagi harada ( vkh ) disease .
we ruled out vkh due to the absence of disc leakage and absence of inflammatory signs .
this vkh - like exudative retinal detachment as a presenting sign of leukemia has not been reported from india . bilateral exudative retinal detachment in a young male
can be due to central serous chorioretinopathy ( csc ) , however , our patient did not show any features of csc leaks on ffa .
he did not report any risk factor for csc such as history of steroid usage .
other causes for exudative retinal de tachment such as renal or cardiac dysfunction have been ruled out by systemic investigations .
causative factors leading to exudative retinal detachment in leukemia has been thought to be choroidal ischemia and secondary retinal pigment epithelial dysfunction.3467 the choroid is the most frequently involved ocular tissue in leukemia .
leukemic cell infiltration or hematologic disturbances may cause partial occlusion of the choriocapillaries and delay of choroidal circulation.8 secondary dysfunction of the bruch 's membrane and retinal pigment epithelium may ultimately lead to exudative retinal detachment of the macula.910 histologically , it is confirmed by autopsy that in leukemic patients choroidal thickening and leukemic cell infiltration are the factors causing choroidal ischemia.8 leukemia may present when there is sudden visual loss due to exudative retinal detachment , and the ophthalmologist may be the first clinician to encounter such patients .
a thorough systemic evaluation should be performed in patients presenting with bilateral exudative retinal detachment , especially in those who are otherwise healthy . | acute lymphoblastic leukemia ( all ) can present with various ocular complications but exudative retinal detachment is a rare complication . a 36-year - old healthy young adult male presented with gradual decrease in the vision in both eyes over nearly 2 weeks .
his best - corrected visual acuities were 20/50 and 20/25 at distance and n12 and n10 at near in the right and left eyes , respectively .
fluorescein angiography and optical coherence topography indicated bilateral exudative retinal detachment . systemic workup revealed a marked increase in the number of white blood cells with 30% blast cells and immunophenotyping revealed common acute lymphoblastic leukemia - associated antigen ( calla ) positive precursor b - cell lymphoblastic leukemia .
cerebrospinal fluid ( csf ) tap was negative .
the patient started systemic chemotherapy and steroids .
bilateral exudative retinal detachment may be a presenting sign of acute lymphoblastic leukemiaall in an otherwise healthy young adult .
clinicians should be aware of the possibility of leukemia in such patients .
a simple blood investigation such as complete blood profile confirms the diagnosis . |
the concept of volume transmission , introduced by luigi agnati and kjell fuxe in 1986 , designates is a form of communication in brain tissue in which modulators act across wide distances when their sites of release and removal are further apart than for wired transmission , characteristic of focused synaptic action ( fuxe et al . , 2010 ) .
volume transmission affects large volumes of tissue and undergoes change more slowly than wired transmission .
the concept of volume transmission in brain therefore overlaps with forms of paracrine and autocrine signaling .
the canonical volume transmitters are monoamines , released from varicosities along the fibers of monoaminergic neurons and removed by transporters at sites reached after variable distances of diffusion . however , the list of potential agents of volume transmission is long , as any molecule that engages receptors , transporters , or enzymes far from a place of synthesis or release may qualify as a volume transmitter , including the archetypical wired transmitter glutamate ( okubo and iino , 2011 ) .
another potential volume transmitter is l - dopa , which shares with lactate the ability to move across cellular membranes and reach cells far from the sites of generation ( gjedde et al . , 1993 ; ugrumov , 2009 ) .
the g - protein - coupled 7tm receptor ( gpr ) family includes members that mediate specific actions of hydroxyl carboxylic acids ( hca ) , including gpr81 , also known as hca1 receptor ( blad et al . , 2011 ) , which serves lactate s downregulation of camp , as shown in adipocytes ( ahmed et al . , 2009 )
the gpr81 is prominent in adipose tissue , where it inhibits lipolysis , but it is known also to be expressed in a wider range of organs such as liver , kidney , skeletal muscle , spleen , and testis ( gantz et al . , 1997 ; ge et al . , 2008 ; liu et al . , 2009 ; rooney and trayhurn , 2011 )
evidence from in situ hybridization show a widespread distribution of gpr81 mrna in the brain , predominantly in neurons , including the principal neurons in cortex , hippocampus ( pyramidal and granule cells ) , and cerebellum ( granule cells ) , while labeling of astrocytes can not be excluded ( the allen institute for brain science , genstat , st .
the receptor s reported affinities for l - lactate range from 1.3 to 5 mm ( cai et al .
, 2008 ; liu et al . , 2009 ) , which is consistent with the range of lactate concentrations measured in brain tissue in vivo ( abi - saab et al . , 2002 ) .
the binding of lactate to gpr81 attenuates the formation of camp , which in turn inhibits protein kinase a and hence glycogenolysis , leading to decreases of glucose-1-phosphate and glucose-6-phosphate ( g6p ) that affect glycolysis in the cytosol , as recently shown by kinetic modeling ( dinuzzo et al . , 2010 ) .
the decrease of g6p affects its role as allosteric regulator of hexokinase ( hk ) , including the association of hk with the voltage dependent anion channel ( vdac ) in the outer mitochondrial membrane , with important consequences for the efficiency of oxidative phosphorylation of adp ( wilson , 2003 ; mailloux and harper , 2011 ) .
the main thrust of this perspective is the importance of any physical separation of hk and pyruvate dehydrogenase ( pdh ) activities , which would lead to diffusion of lactate between the sites . as such , this concept is not limited to major compartments or cell types but applies equally well to subdivisions of cells , such as distal vs proximal dendrites and astrocytic processes vs cell bodies rather than to astrocyte / neuron differences ( figure 1 ) . in this illustration
you can follow the two different mechanisms proposed : ( a ) lactate regulates the formation of camp via the lactate receptor gpr81 .
( c ) both the formation of camp and the adjustment of nadh / nad redox ratio can be linked to the maintenance of brain energy turnover and neurovascular coupling .
the role of lactate in neurovascular coupling is included in the figure , but not dealt with in the text , which focuses on cellular effects of lactate in brain tissue .
the roles of lactate as mediator of metabolic information rather than metabolic substrate answer a number of questions raised by the aerobic glycolysis of astrocytes and its controversial contribution to neuronal function .
lactic and pyruvic acids interact through the actions of the cytosolic near - equilibrium lactate dehydrogenase ( ldh ) isozymes , which reflect the cytosolic nadh / nad ratios in cytosol .
the cytosolic and the mitochondrial redox states are linked through a network of redox reactions and inner membrane transport processes , but the exact relation between cytosolic and mitochondrial nadh / nad ratios is not known .
there are reports of mitochondrial ldh activity ( brooks , 2009 ) and therefore potential for coupling of lactate pyruvate and nadh / nad ratios in the mitochondrial matrix .
changes of the nadh / nad redox ratios trigger several intracellular responses , including expression of genes by modification of histone deacetylases , which profoundly affect the regulation of protein synthesis .
for example sirtuins , gene - regulating histone deacetylases with effects on regulation of caloric intake , metabolism and age - related diseases ( finkel et al . , 2009 ) , are tightly redox regulated through the nadh / nad ratio ( gambini et al . , 2011 ) .
genes activated by lactate through lactate - sensitive response elements include c - fos , c - jun , c - ets , hyal-1 , hyal-2 , cd44 , and caveolin-1 ( formby and stern , 2003 ) .
the dna binding of the transcription factor fos jun heterodimer ap-1 depends on a specific cysteine residue being in the reduced sate ( abate et al . ,
in addition , pyruvate , which interacts closely with lactate as dictated by the nadh / nad ratio , is a gene regulator through histone deacetylase inhibition ( thangaraju et al .
both the ldh isozymes and the monocarboxylic acid transporters ( mct ) of the blood brain barrier and cell membranes of brain tissue mediate near - equilibrium transfer of lactate ( bergersen et al .
, 2001 ; bergersen , 2007 ) when unidirectional fluxes exceed net fluxes by several orders of magnitude . therefore ldh and mct proteins
thus , changes of pyruvate and lactate concentrations in one place lead to similar changes of lactate concentrations across large volumes of brain tissue over long times . in turn ,
any effects of changes of lactate on the nadh / nad ratio in one place lead to similar effects in widely distributed populations of cells ( cf .
cerdn et al . , 2006 ; ramrez et al . , 2007 ; rodrigues et al . , 2009 )
in fact , the transfer of lactate is so efficient that it is difficult to observe any differences of lactate concentrations across cell membranes in brain tissue ( gjedde and marrett , 2001 ; ido et al . , 2001 , 2004 ;
2002 ) , such that significant cellular compartmentation of lactate is unlikely to exist under normal conditions , except briefly .
the high concentration of mct2 at the psd of fast excitatory synapses co - localized with glutamate receptors ( bergersen et al . , 2001 , 2005 ) suggests a particular need for lactate transfer at these synapses perhaps involved in volume transmission signaling .
in addition to moving through brain tissue by facilitated transfer across plasma membranes of all cells through mct1 , mct2 , and mct4 , and by diffusion through the extracellular space , lactate spreads through the astroglial network in which individual astrocytes are connected by gap junctions ( dienel , 2011 ; mathiesen et al . , 2011 ) .
one puzzle is the kinetic differences among the isozymes of ldh ( obrien et al . , 2007 ) , the physiological role of which at near - equilibrium is not yet understood ( ross et al . , 2010 ; quistorff and grunnet , 2011 ; ross , 2011 ) , but may be related to the proposed function of lactate as a volume transmitter in cytosolic and perhaps mitochondrial environments with widely differing nadh / nad+ ratios ( figure 1 ) .
the purported changes of lactate concentrations and the consequent redistribution of lactate happen whenever and wherever sites of generation and metabolic conversion of pyruvate are unmatched or physically separated .
pyruvate is the main end product of aerobic glycolysis , which is controlled by the concerted action of the hk and phosphofructokinase ( pfk ) enzyme complex , while the fate of pyruvate is determined by the pdh complex in mitochondria .
the two enzyme complexes are the main flux - generating determinants of brain energy metabolism as controlled by allosteric effectors , and both therefore define the path that is open to the respective so - called pathway substrates , glucose in the case of the hk pfk complex , pyruvate in the case of the pdh complex ( gjedde , 2007 ) .
the temporal and spatial integration of the activities of these enzyme complexes is then the key to the dynamics of lactate inside and among the cells of brain tissue .
both the oxygen glucose index ( ogi ) and the oxygen extraction fraction ( oef ) decline during the temporary departures from steady - state associated with functional activation of brain regions , attributed to increased aerobic glycolysis ( madsen et al .
. the declines are signs of focal disintegration of the hk pfk and pdh activities , resulting in increased lactate
pyruvate ratios , redistribution of lactate and adjustment of nadh / nad ratios within the sphere of action of the redistributed lactate .
this process seems to be so efficient that it leaves no oxygen deficit or abnormal atp , adp , or amp levels , even in seizures ( larach et al .
extracellular lactate concentrations increase during neuronal and synaptic activation in vivo , as determined by microdialysis ( uehara et al .
2011 ) , and proton magnetic resonance spectroscopy minutes after stimulation ( prichard et al .
, 1991 ; sappey - marinier et al . , 1992 ; maddock et al . ,
2006 ) , following a transient decrease 5 s after stimulation ( mangia et al . , 2003 ) .
these observations are consistent with adjustments that follow the perturbation of an existing steady - state and the subsequent return to a potential new steady - state , depending on conditions , such as the intensity of the continuing neuronal activation .
the lactate dynamics are uniquely dependent on the shifts among these steady- and non - steady - states of brain energy metabolism .
the observations that the ogi declines during the non - steady - state of the early stages of functional brain activation , signifies increased lactate production in the tissue as a whole , evidently due to increased glucose consumption relative to oxygen consumption .
the observations are consistent with changes of glucose consumption that match the changes of blood flow during activation , while changes of oxygen consumption generally do not ( gjedde et al . , 2002 ;
recent evidence also shows that the changes of glucose consumption exceed the changes of oxygen consumption at specific regional locations ( vaishnavi et al . , 2010 ) , rather than everywhere , creating the gradients of lactate concentration that serve to redistribute lactate inside as well as outside cells and across the blood
the regional variation of the ogi ( vaishnavi et al . , 2010 ) may possibly be related to different ratios of cell types ( low in cortex with numerous astrocytes , high in cerebellum with numerous neurons ) .
any separation of the sites of lactate generation and lactate metabolism inside or among cells therefore must result in shuttling of lactate among its sites of generation and metabolism .
thus , the temporal and spatial mismatches of lactate generation and metabolism arise because different cellular and subcellular compartments react differently to activating stimuli ( gjedde et al . , 2005 ; vaishnavi et al . ,
it has been shown by mr spectroscopy that blood lactate is an efficient substrate for the brain , and especially for neurons , both in rat ( bouzier et al . , 2000 ; hassel and brthe , 2000 ) and in humans ( boumezbeur et al . , 2010 ) .
the increased lactate also has effects on brain metabolism , which are characterized by reduction of the cerebral ogi in the context of a state known as central fatigue ( dalsgaard , 2006 ; dalsgaard and secher , 2007 ; rasmussen et al . ,
central fatigue precedes the muscle fatigue that also relates to increased lactate ( van hall , 2010 ) .
the mechanism responsible for the onset of central fatigue is not known with certainty but appears to be related to decreased oxygen delivery , which in turn may be due to increased lactate in brain tissue and possible effects on lactate s receptor gpr81 ( rasmussen et al . , 2010 ;
the downregulation of camp formation by binding of lactate to gpr81 offers a novel explanation of central fatigue and over - training distress ( lehmann et al . , 1993 ) , and possibly in part the asthenia seen in advanced cancer , a condition that is known to be characterized by chronically increased blood lactate levels ( koppenol et al . , 2011 ) .
chronically increased lactate levels similarly are held to be characteristic of old age and dementia , based on the properties of a mtdna mutator mouse model ( ross et al . , 2010 ) .
these effects contrast with the upregulation of camp by noradrenaline with effects such as arousal and enhanced brain performance ( berridge , 2008 ) .
many other observed effects of lactate on neuronal function may result from enzyme- or receptor - mediated responses rather than from the direct actions of lactate as a metabolic substrate .
for example , the observation that lactate administration protects against ischemia ( schurr et al .
however , this is not readily explained by metabolic effects , as lactate metabolism can not raise energy turnover under ischemic conditions , although after ischemia and in the penumbra of vascular occlusion , the availability of lactate for oxidation may assist in alleviating ischemia induced damage ( schurr et al . , 2001 ; berthet et al . ,
similarly , the observed protective effect of lactate on glutamate toxicity in the brain ( ros et al . , 2001 ) may be due to receptor - mediated inhibition , rather than the simple satisfaction of the metabolic demands of neurons exposed to high concentrations of glutamate ( schurr et al . , 1999 ) .
in microdialysis of the cerebral cortex , excitotoxic concentrations of glutamate raised lactate at the expense of glucose in the dialysate .
the addition of l - lactate caused the lesion to become smaller and abolished the decrease of glucose . replacing l - lactate with
the non - physiological d - lactate isomer expanded the lesion and raised l - lactate in the dialysate above the level observed with glutamate alone ( ros et al . , 2001 ) , consistent with the claim that endogenously produced lactate is neuroprotective by means of receptor interaction .
the suppression of noradrenalin and adrenalin releases by blood lactate clamps at 4 mm ( fattor et al . , 2005 ) also suggests a receptor mechanism , consistent with the postulated reduction of camp formation by grp81 activation .
interestingly , also -adrenoceptor blockers , which presumably act by reducing intracellular camp , are neuroprotective in stroke and other brain injuries , and also lower extracellular glutamate levels , which may further limit excitotoxic cell damage ( goyagi et al . , 2011 ) .
the proposed role of lactate as a mediator of information on changing nadh / nad ratios among the cells of brain tissue has implications for the understanding of regulation of brain energy metabolism , including the communication between cytosol and mitochondria in large populations of cells ( xu et al . , 2007 ) .
lactate s inhibition of camp formation through g - protein - coupled receptors may be a factor in the development of central fatigue .
an action of lactate may therefore be to smooth the non - steady - states that underlie the mismatches of glycolysis and oxidative phosphorylation , induced by needs for aerobic glycolysis that satisfy the short time constants of atp turnover required for maintenance of rapid de- and repolarizations .
the redistribution of lactate by the volume transmission is both temporal and spatial and potentially reaches large volumes of tissue , aided by the extended syncytium of astrocytic networks connected by gap junctions .
the role of lactate as informant of metabolic states rather than substrate of metabolism solves a number of puzzles that contribute to the controversy surrounding the understanding of astrocytic metabolism and its contribution to neuronal function .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | we present the perspective that lactate is a volume transmitter of cellular signals in brain that acutely and chronically regulate the energy metabolism of large neuronal ensembles . from this perspective
, we interpret recent evidence to mean that lactate transmission serves the maintenance of network metabolism by two different mechanisms , one by regulating the formation of camp via the lactate receptor gpr81 , the other by adjusting the nadh / nad+ redox ratios , both linked to the maintenance of brain energy turnover and possibly cerebral blood flow .
the role of lactate as mediator of metabolic information rather than metabolic substrate answers a number of questions raised by the controversial oxidativeness of astrocytic metabolism and its contribution to neuronal function . |
multiplexing biological
assays on microarrays has been instrumental
for generating the data required to understand biology at a systems - level .
although microarrays have contributed to the exponential growth of
biological data over the past decade , there remain bottlenecks in
the use of this technology .
a primary challenge is the accurate and
expedient analysis of the data contained within the images of the
microarrays .
there are multiple commercial and open source software
packages commonly used to analyze images of arrays , but these packages do not automatically handle the
types of distortions commonly observed in protein microarrays ( e.g. ,
loss of signal , comet tails , grid distortions , etc . ) .
often , considerable
manual adjustments of an overlaid nominal grid are needed to align
it properly to individual features of interest .
most software packages
also provide few , if any , tools to identify artifacts in the images ,
thereby requiring a manual review of features after data analysis
to ensure the quality of the data .
this is a particular concern for
protein microarrays , since the data are more sensitive to low amounts
of spurious signal than dna microarrays .
the majority of features
in analyte channels typically lack signal , enabling small amounts
of spurious signal to increase the measured intensity of a feature
above the positive threshold .
overall , manual segmentation and annotation
not only cost hours of trained labor per array but also introduce
significant variability in data analysis among users . with the motivation
to create ever larger data sets for systems - level analyses of clinical
samples , these inefficiencies represent a significant barrier in efforts
to understand human disease and mechanisms of action for interventions .
numerous approaches have been proposed to extract information from
images of microarrays by both semiautomated and fully automated methods .
initial algorithms used the user - defined specifications
of the array and template matching to find the optimal alignment with
the expected geometries .
approaches using 1-d image projections with and without image filtering
were also implemented for aligning grids to arrays .
clustering
algorithms used to segregate foreground and background pixels have
proven to be some of the most successful algorithms for identifying
features .
other mathematical approaches have also been proposed ,
including seeded region growing , svm , markov random fields , and mixture models , among others . with a few notable
exceptions , most implemented approaches rely heavily on a single approach . in
our experience
, however , no single approach or algorithm can automatically
handle the variety of aberrations that occur on experimentally produced
arrays , especially protein - based arrays . a better approach
therefore
would combine the strengths of different methodologies in a logical
way to create an algorithm for hierarchical gridding that is more
robust to a variety of aberrations common in protein microarrays .
the availability of cheap computational power and parallelized processing
enables the implementation of multiple approaches to registering and
aligning features on the same array within a reasonable processing
time .
the increase in computing power also allows a more in - depth
analysis
of the signal in the image , enabling the deconvolution of true signal
and artifact prior to the extraction of data .
multiple approaches
have been proposed to qualify data extracted from microarrays , but
most rate the reliability of each data point using metrics assigned
after the initial extraction of data ( e.g. , covariance ( cv ) , signal - to - noise
ratio ( snr ) ) .
far more information is encoded in the image itself ,
particularly at the granularity of the location and intensity of individual
pixels .
robust analysis of the image prior to data extraction should
yield a more accurate description of the artifacts present and , thus ,
enable their removal , yielding more accurate and reliable data than
qualification of data after extraction .
previously implemented techniques
for identifying artifacts in images of microarrays include clustering
pixels into more than two groups to identify and remove outlier pixels , and a geometric comparison of bright pixels to a feature template . these approaches , however , can
miss artifacts that overlap the foreground or that have intensities
similar to the true signal , and most have problems with overclustering
of images containing only salt - and - pepper noise .
new
methods for identifying artifacts in the image prior to data extraction
would enhance the accuracy of data sets generated from microarrays ,
particularly for protein microarrays .
microengraving is a technique
developed to produce protein microarrays
wherein each spatial element represents proteins captured from individual ,
or a small number of , cells .
it has been
used to discover antigen - specific antibodies from hybridomas and primary
b cells , to select mammalian and microbial hosts producing biologic
drugs , and to profile the functional responses of activated t cells . in this method , a slide uniformly coated with multiple capture antibodies
seals against an elastomeric array of subnanoliter wells ( nanowells )
containing cells .
the slide captures specific analytes secreted from
the cells along with a known protein present in the media ( e.g. , igg )
to label the location of each well on the slide .
after incubation ,
the slide is removed from the device and stained using fluorescent
antibodies in a manner similar to conventional protein microarrays
.
this process can be repeated multiple times on the same cells to temporally
monitor secretion from the same cells over time or measure other analytes
using slides coated with different capture antibodies .
this large
number of arrays makes automated analysis critical for the timely
evaluation of data and the widespread implementation of this technology
for use in clinical trials with large numbers of biological samples .
here we describe a new , fully automated algorithm that can robustly
and accurately analyze microengraved arrays containing significant
aberrations .
microengraved arrays have several characteristics that
make them particularly difficult to analyze automatically using previously
published approaches and , therefore , a useful model for devising accurate
and efficient means to extract data and overcome image artifacts .
the features are small ( 3050 m ) and densely packed
( 60100 m pitch ) .
the typical signal intensity ( 1.5-
to 3-fold above background ) is considerably lower than that of a typical
dna microarray , requiring sensitive methods for distinguishing the
signal .
although the elastomeric arrays are manufactured with high
precision , the process of microengraving often distorts the lateral
structure of the array and individual features in a nonuniform manner .
the arrays are also very large , covering most of the surface area
of a typical microscope slide , with more than 80,000 features . nonlinear
distortions over large distances make approaches relying on placing
straight lines to delineate the array difficult to implement .
the
features are arranged in small blocks ( 50100 features / block ) ,
and it is not uncommon for a row or two of blocks to be missing from
an edge of the array .
this loss of features makes automatic registration
of blocks impossible with any published technique .
finally , each feature
in a microengraved array represents a unique measurement a
fact that negates any approach that relies on replicate spots for
quality control .
here we describe a hybrid algorithm called crossword
that combines a multifaceted grid - aligning pipeline with a versatile
framework for identifying artifactual pixels within the image .
this
method should greatly aid the application of microengraving technology
to clinical samples as well as improve the quality of data extracted
from standard spotted microarrays .
crossword was designed to be
an integrated software package that receives as input the filename
and basic array specifications of an array ( supporting
information tables 1 and 2 ) and returns measurements of the
signal quality and intensity in the foreground and background of each
feature with no human intervention ( figure 1 , supporting information table 3 ) .
the
output of a microengraving experiment is a tiff image that contains
a fluorescent image of the array for each analyte ( analyte channels )
and one image for the molecule included in the media ( e.g. , igg or
a specific cytokine ) to define the locations of each well ( registration
channel ) .
the algorithm initially estimates the global rotation of
the major axes of the array ( x- and y - axes ) and then straightens the image with respect to each axis .
the nominal location of each block is next registered to the image
using a novel code that distinguishes each block geometrically .
lines
delineating a grid on the array are then adaptively drawn between
blocks .
the subimage for each feature in the delineated blocks is
iteratively clustered to define the foreground area . a novel algorithm
for quality control
is then applied to the image of each feature to
identify pixels containing artifacts .
finally , the signal intensity ,
variance , and quality of the background and foreground pixels in each
feature is extracted and returned in a tabular format along with images
of each feature .
batched processes for multiple files can be implemented
to allow the analysis of tens of arrays overnight with no human intervention .
the image is initially
rotated to make the major axes of the array parallel to the edges
of the image .
the geometric code defining the identity of each block
is then deciphered to register the array .
the location of
each feature is then identified using iterative k - means clustering of the registration channel image .
next , artifactual
pixels in each analyte channel are removed using a combination of k - means clustering and a custom connectivity transform algorithm
to identify signals in the analyte channels and a geometric comparison
of the identified signal across the array channels .
the initial
module in the algorithm
uses linear radon transformations to estimate the rotation of the
major axes of the array , similar to the method reported by rueda et
al .
a radon transformation integrates
the signal that a parallel set of vectors encounters crossing an image
as the angle between the image and the vectors varies .
figure 2a depicts representative radon integrating vectors
at three discrete angles , and the resulting radon transforms of the
image at those angles . when the radon transform angle matches the
rotation of the array , the slope of the transform between areas of
high and low signal is maximized . for microengraved arrays , long - range ,
nonlinear distortions in the structure of the array and an uneven
signal
sometimes make the radon transform less accurate at determining
image rotation when applied to the whole image .
the algorithm , therefore ,
applies the transformation to many subimages containing two vertical
blocks sampled from across the array .
each image is checked for the
appropriate frequency of features to ensure the block images are of
good quality .
nearest neighbor interpolation is used to rotate
the entire image by the median rotation angle of the subimages to
yield an array whose axes are aligned with the edges of the image .
( a ) example images of radon
integrating vectors at three discrete angles ( 10 , 0 , and 10 )
and the resulting radon transform of the image at those angles .
the
slope of each radon transform curve is marked with a dotted line .
( b ) plot of the sums of the absolute slope of the radon curve at each
degree of rotation normalized to the highest value for that sample
image as a function of the degree of rotation for 500 subimages sampled
from the same array .
the degree of rotation most frequently yielding
the highest radon slope ( dotted line ) defines the rotation of the
array .
( c ) the algorithm used to decipher the geometric code in each
block .
a block is transformed into a binary image using a threshold
defined by the expected number of positive pixels and the rank order
of pixel intensity .
the center of each feature is matched to the center
of both a diamond and a square template .
the well score for each feature
is calculated from the number of positive and negative pixels within
each template .
( d ) the well score for each feature in the block ( left
array ) and the cipher used to decode the block location ( right panel ) .
in the left panel ,
a positive score indicates a diamond feature and
is highlighted in yellow ; a negative score indicates a square and
is highlighted in blue .
the location of the diamonds defines the row
and column number for the block . after straightening the image ,
the location of each block
in the
array is registered to assign an identity to each block .
this effect
can lead to misalignment of the entire grid when the identity of each
block is defined using only the visible edges of the array . to overcome
this issue
, the arrays of nanowells employ an internal geometric code
using diamond and square wells within each block ; this code allows
nonambiguous identification of any isolated block .
the
algorithm breaks the image of the array into overlapping , block - sized
subimages .
each subimage is then tested for the appropriate frequency
of features using 1-d projections along the x- and y - axes to identify subimages that contain an entire block .
these subimages are transformed into binary images by rank ordering
the pixels based on intensity and selecting the expected number of
pixels with high intensities as positive .
the expected number of pixels
derives from the array specifications passed to crossword by the user
for the number and size of features in each block ( figure 2c ) .
each individual feature is then aligned with
a square and diamond template sized to fit the average feature size
of the block ( figure 2c ) .
the number of negative
pixels within each template is subtracted from the number of positive
pixels in each template .
the total from the diamond template is then
subtracted from the total from the square template to yield the final
feature score ( figure 2d ) .
a negative score
for a feature identifies a square feature while a positive score identifies
a diamond - shaped one .
once the feature scores are calculated
for each subimage , they
are used to identify the blocks present in each subimage .
all blocks
contain one diamond in the upper left - hand corner to establish the
orientation of the array .
the algorithm initially identifies the corner
feature that was most frequently identified as a diamond and then
automatically flips the entire array ( and all subimages ) to ensure
proper orientation of the geometric code .
the code is then deciphered
using a lookup table ( figure 2d ) . in this way ,
crossword assigns a putative unique identifier to each block .
the
identity of each block with a valid block code is then corroborated
using its spatial ( x , y ) location
within the array to estimate the location of the top left block .
all
blocks that yield a location within a distance of one - half the block
pitch from each other are deemed correct , and the locations of those
blocks are used to register the remainder of the blocks in the array .
the rates at which blocks were correctly identified by this algorithm
for several representative arrays are given in supporting information table 4 . in principle , block
registration gives sufficient information to locate all blocks in
an ideal array by evaluating the interblock distances .
we found , however ,
that these linear relationships often fail to correctly identify the
precise location of blocks due to the nonlinear distortions in experimentally
derived arrays .
we , therefore , developed a method to adaptively assign
the positions of blocks that monitors these distortions and ignores
spurious and missing signals in parts of the array .
the process
begins by applying a series of bandpass filters to the image to emphasize
either the vertical or horizontal interblock signals ( figure 3a , supporting information figure 1 ) similar to the approach recently suggested by wu et al .
the interblock signal is then progressively
monitored every 100 pixels across the array using 1-d projections
along the axis perpendicular to the emphasized signal ( supporting information figure 2 ) .
a 1-d projection
based on the locations of blocks generated during registration establishes
an initial template .
this model projection is then shifted in relation
to the actual 1-d projection of the first 100 pixels to find the location
where the largest number of signals in the projection match the locations
specified by the template .
the movement is limited to 33% of the block
pitch to ensure the grid remains properly registered .
if half of all
signals or a consecutive run of 20% of the signals in the template
match a signal in the projection , the location of each interblock
signal is seeded at the location of the template regardless of whether
a signal was detected .
if the two projections can not be matched , the
position of the template is used as the location on the array , and
then the next 100-pixel region is examined .
once the interblock signal
is seeded , signals identified in further projections are aligned to
the closest seed signal .
if multiple signals align to the same seed
signal , they are all discarded .
if a signal is more than 10 pixels
away from any seed signal , it is also discarded as a spurious signal ,
since distortions of this magnitude over a 100-pixel distance have
not been observed empirically in microengraved arrays .
if no signal
matches a seed signal , the seed signal is carried forward to the next
projection .
this approach enables long - range , nonlinear distortions in the array
to be effectively monitored even if the distortions are not correlated
across the array ( figure 3b ) .
( a ) raw image of an array
and its transformation after passing through a series of low - pass
filters designed to emphasize the interblock vertical frequencies
( red bar = 500 m ) . the 1-d projections of the raw ( black ) and
transformed ( red ) images are displayed below the images .
( b ) the deviation
from the initial interblock signal used for seeding ( top signal trace )
as a function of the y position in the array .
the x position of the actual signal at each y location in the array is noted by a horizontal blue bar .
the
top left corner of each block is compared to the neighboring blocks .
blocks that are not correctly positioned ( red ) are relocated using
their neighbors locations ( green ) .
( d ) an example of a final
overlay for the blocks in an array .
to further increase the accuracy of the block positions ,
we implemented
a metric for quality control that measures the reliability of each
grid line at each point in the array .
as the grid lines are defined ,
a corresponding matrix keeps track of whether a signal for each line
was detected in a given projection ( supporting
information figure 2 ) .
when the location of each interblock
signal is initially seeded by the template , the quality metric for
each line is set to zero . in subsequent alignments of the projection ,
if a signal is not detected , the metric for that line is increased
by one . if a signal is detected , the total score decreases by two
until zero is reached .
the grid metric is used in two ways to
increase the accuracy of
the grid .
first , neighboring grid lines are compared to each other .
if the distance between the lines differs from the expected block
distance by more than the feature pitch , the grid metric
the gridding process is also performed
in both directions across the array ( e.g. , left - to - right and right - to - left )
to address issues of poor signal on the edge of the array during grid
seeding .
the second use of the grid metric is to choose the best grid
location when the grids drawn in opposite directions do not match
( supporting information figure 3 ) . as a final control for the quality of the aligned grid ,
the top
left corner of each block is estimated using 1-d projections of the
feature signals in the block areas defined by the grid lines .
the
corner of each block is then compared to neighboring blocks to make
sure the block - to - block distance is within appropriate bounds ( < 5% )
( figure 3c ) .
any block that is misaligned with
neighboring blocks is realigned , creating the final grid of blocks
( figure 3d ) . at the end of the process ,
each
grid point has been assessed five different times , yielding a robust
protocol for aligning a grid that automatically handles gross distortions
in the array , large areas of missing signal , uneven backgrounds , and
other artifacts that can occur in experimentally produced arrays .
once the location of each
block is defined , features are precisely located using a hybrid clustering / template
method .
a feature grid is created for each block using 1-d projections
on each axis ( supporting information figure
4a ) .
next , k - means clustering is used to identify
pixels in the foreground and background of each feature . an initial
analysis using data from a manually curated array
was performed using
different approaches in the literature to determine the optimal attributes
of the data to use for clustering .
we found that
the raw pixel intensities combined with neighboring pixel intensities
generated foreground and background clusters that yielded signal - to - noise
ratios that best matched the manual curation ( supporting information figure 5 ) . including a preprocessing
transformation of the data , location of the pixel in the feature image
or a third cluster
, we implemented
an iterative approach to clustering because very bright artifact pixels
disrupted the identification of the foreground area when a single
instance of clustering was used ( supporting information figure 4b ) .
the size of both clusters is compared to the nominal
expected sizes of the foreground and background for a feature .
if
either is less than a third of the expected size , those pixels are
discarded as either very bright or very dim artifacts that biased
the clustering of the other pixels .
the remaining pixels are reclustered
until the size criteria are met . in order to more accurately locate
the feature , the final cluster with the higher mean pixel intensity
is convoluted with a template kernel ( supporting
information figure 4c ) .
the shape of the kernel is defined
by the block code and known feature location ; the size is defined
by the average area of the feature calculated by the algorithm while
registering the array .
the optimal location for the foreground is centered
at the pixel that has the highest value in the convolution of the
cluster and the kernel ( supporting information figure 4d ) . to account for features that differ in size from the
average feature size , pixels in the top cluster that are within 2
pixels of the foreground area
are excluded from further analysis to
avoid potential foreground pixels contributing to background measurements ,
and groups of negative pixels larger than 4 within the template are
also excluded to account for smaller feature sizes ( supporting information figure 4d ) . to improve the quality of the data
extracted from each feature in the array , we implemented a new approach
for automated identification of artifacts .
we found previously reported
methods based on iterative clustering or
mixture models were effective in most
cases at separating artifact from signal in the same image .
when analyzing
images containing only salt - and - pepper noise , however ,
we found the methods either overclustered the pixels or , in the case
of the published iterative clustering method , failed entirely , as
the method requires the accumulation of signal in the foreground to
trigger clustering termination , which can not happen if there is no
signal in the image .
efficiently handling images containing only noise
is essential in the context of protein microarrays , as the vast majority
of features are negative in the analyte channels .
we initially attempted
to identify and exclude images containing only noise from the cluster
analysis using measures of the skewedness of the pixel intensity distribution
or image entropy but could not effectively recognize all blank images .
we therefore developed a novel approach to enable artifact removal
using iterative clustering that is robust to the presence of images
containing only noise .
our iterative clustering approach is
based on pixel intensity , location , and correlation between image
channels .
the module for removing artifacts begins by identifying
structured pixels in each feature subimage using iterative k - means clustering ( where k = 3 ) and an
image transformation that we call a connectivity transformation .
the
connectivity transformation changes the values of positive pixels
in a binary image to the pixel s connectivity value that
is , the number of positive pixels any given pixel is touching , including
itself in our implementation ( figure 4a ) .
the
frequency of each connectivity value in a given cluster is then determined ,
thereby providing a simplified description of the proximity of the
pixels to each other in the cluster .
the expected frequencies of connectivity
values for random noise depend on the fraction of the available space
occupied by positive pixels ( figure 4b)that
is , the more space taken up by positive pixels , the more pixels touch
each other . to determine whether the pixels in a cluster are part
of a defined structure , the frequency of each connectivity value is
compared to the frequency expected from random noise ( given the same
fraction of space covered by positive pixels ) .
the presence of structured
pixels in the image leads to an enrichment of high connectivity values
( 69 ) compared to noise ( figure 4c ) .
clusters derived from images with bright structures are enriched in
high connectivity values and depleted of low connectivity values relative
to random noise .
weak or diffuse structures show a modest enrichment
in high connectivity values , and clusters from apparent noise show
little to no enrichment in any values over expected values .
thus ,
the connectivity curves have characteristic traits for different structures
and can indicate the type of structure present in the cluster ( bright ,
dim , noise ) . identifying artifacts using connectivity transform .
( a )
examples
of binary images and their connectivity transforms . each positive
pixel receives a value that is the sum of the number of adjacent positive
pixels and itself .
( b ) plots of the expected fraction of positive
pixels in a binary image with a particular connectivity value based
on random noise as a function of the fraction of positive pixels in
the image .
( c ) examples of three types of images , their top ranked
clusters determined by k - means clustering , and the
enrichment of connectivity values in each cluster relative to random
noise . the plot of the enrichment in the connectivity values is color
coded according to the color of the box surrounding each image .
the registration
channel and two analyte channels for the same feature are displayed
in the top box .
the binary images of the three clusters created by k - means clustering of the pixels based on their intensities
and their neighbors intensities are displayed for each iteration .
the enrichment in connectivity values over random noise for each cluster
is plotted next to the binary images . the structure removed in each
iteration combined with the previous iterations
the binary image / images of the clusters defined
as structure in each iteration is / are boxed in yellow .
clustering
is terminated when no cluster is significantly enriched in connectivity
values relative to noise . the first image in the bottom box overlays
pixels that were identified as structure in both analyte channels
( blue ) , as structure only identified in channel 3 ( green ) , and as
defined foreground area ( red ) .
crossword uses the geometric location of structured
pixels within
each image to identify artifact ( figure 4d ) .
each image channel is iteratively clustered for three groups of pixels
using the pixel intensity and those of its neighbors .
the enrichment
of the connectivity value for each cluster and the combination of
the top and middle cluster is then determined .
the algorithm progresses
from the brightest cluster to the dimmest cluster , classifying each
as noise , diffuse structure , or punctate structure based on the connectivity
enrichment ( supporting information figure
6 ) .
if a structure is found in a cluster , the pixels are labeled as
the appropriate type of structure and removed from the analysis .
the
remaining pixels are reclustered until no cluster has enrichment values
significantly different from noise .
once all channels have been analyzed ,
the structure in each channel is compared to the previously identified
foreground ( supporting information figure
7 ) .
punctate structure that occurs in multiple analyte channels and
does not match the foreground area is labeled as shared punctate artifact
and removed from further analyses .
several geometric criteria are
then used to compare the remaining structure to the shape of the foreground
area .
if the structure covers a defined amount of the foreground pixels
and does not cover more than a defined amount of background pixels ,
the structure covering the foreground area is retained in the image
and the structured background pixels are defined as artifact and excluded
from further analysis .
if the number of structured background pixels
surpasses a set threshold , all structured pixels are defined as artifact .
the exact levels for these cutoffs that are implemented in crossword
are given in supporting information figure
7 ; these thresholds can be adjusted , however , depending on typical
array performance . after removing structured artifacts ,
a ring of
two pixels around the foreground area is also discarded to ensure
no transition pixels are included in the background pixels .
once the
foreground and background pixels are set , pixel intensities and other
relevant metrics are extracted for each feature and exported in tabular
form ( supporting information table 3 ) along
with a file containing each feature subimage for downstream analysis .
we compared the utility of analyzing by connectivity
value enrichment
to previous clustering methods for artifact identification .
we initially
examined the effectiveness of the algorithm at analyzing 20 images
extracted from real array images containing only salt - and - pepper noise
as determined by manual review .
analysis by connectivity enrichment
identified all 20 images as noise , preventing the separation of the
pixels into separate clusters ( figure 5a , data
not shown ) .
in contrast , using minimization of the bayesian information
criterion ( bic ) to select the number of models for gaussian mixture - model
( gmm)-based clustering separated all 20 images into 3 distinct clusters
( figure 5a ) .
we also examined the efficiency
of gmm and connectivity enrichment analysis in removing all structured
pixels from images . while both approaches successfully extracted all
structured pixels from images containing features with moderately
strong signals ( data not shown ) , connectivity enrichment displayed
an improved ability in removing signal spread from bright features
( figure 5b ) .
since signal - to - noise
ratios are decreased both by higher background means and higher background
standard deviations ( eq 1 ) , improvements in
artifact removal can have significant effects on the calculated snr
value.1where f is the mean of the foreground
pixel intensity , b is the mean of the background pixel intensity ,
and b is the standard deviation of the background pixel intensity .
( a ) twenty feature images containing only background noise
were randomly selected from an array image and subjected to clustering
using bic minimization to select the optimal number of gmms or connectivity
enrichment to define the optimal number of clustering cycles .
( b ) feature images containing bright foreground area were extracted
from a microarray image and clustered using gmms or connectivity enrichment .
the mean and standard deviation of the pixels in the cluster with
the lowest mean intensity are displayed for each image .
in order to analyze the
quality of the data produced by our algorithm ,
crossword and the commercial software genepix pro were used to analyze
the same images of three protein microarrays containing different
levels of artifact .
manual review of each feature for a positive signal
in each analyte channel was used as the gold standard
for identifying positive features . to analyze the images with crossword
,
each image file path was passed to the algorithm and the data for
all features was automatically exported with no user intervention .
data was extracted from the same images with genepix pro after manual
adjustment of the locations of blocks . to examine the quality of the
data produced by the two extraction methods , we compared the snr and
median - background values for each feature .
lack of correlation between
mean and median intensity values of features has previously been used
to identify features containing artifacts .
snr values demonstrate even greater disparity from median values
than mean values if artifact is present in the background due to the
inverse relationship between snr and the standard deviation of the
background ( eq 1 ) , thereby making a lack of
correlation between snr and median values a sensitive indicator of
the presence of artifact .
indeed , the snr values and the background - subtracted
median values extracted by crossword demonstrate a much stronger correlation
than the data extracted by genepix pro ( figure 6a , supporting information figure 8) .
the
increase in data quality yielded a significant improvement in the
true positive and false positive rates of snr values extracted by
crossword , particularly for images of arrays that contain medium to
high amounts of artifact ( figure 6b ) .
three images of microengraved arrays containing different levels
of artifact were analyzed with crossword and commercial software genepix
pro .
( a ) plots of the feature snr and background - subtracted median
intensity generated by genepix pro ( left panel ) or crossword ( right
panel ) from the high artifact array .
( b ) roc curves generated by increasing
the snr cutoff using values generated by genepix pro ( red ) or crossword
( blue ) from the three array images measuring cxcl8 ( line , first panel ) ,
ifn ( line , second and third panel ) , il-2 ( dashed line , second
and third panel ) , and mip-1 ( dotted line , second and third
panel ) . to further analyze the rate of
false positives called by crossword
,
the snr values extracted from the high artifact array were grouped
according to whether the corresponding nanowell was occupied during
microengraving .
when the snr values from nanowells
containing cells were compared to the unoccupied wells , there was
a significant enrichment in features with high snr values , corresponding
to measurable events of secreted analytes ( supporting
information figure 9 ) .
interestingly , the features defined
as false positive events by the receiver operating characteristic
( roc ) curve in the first panel of figure 6b
( according to the manually curated data set ) are also enriched in
occupied wells , suggesting many of these events classified as false
positive may in fact be true positive events not readily recognized
by visual inspection due to low signal . therefore , the rate of false
positives may be significantly less than the estimate based on manual
annotation .
these results suggest crossword may increase sensitivity
to low signal events on microengraved arrays compared to manual annotation
of the images .
one motivation for developing
crossword was to create a fully automated
software package that could extract accurate data from images of microengraved
protein arrays irrespective of spatial distortions in the array and
aberrations in signal common in experimentally produced arrays .
the
major approach used to improve the robustness of the algorithm was
to create multiple redundancies in the gridding process .
the location
of each block is interrogated five times by the algorithm , and each
feature relies on three separate techniques to assign the most accurate
location . the ability to effectively combine information provided
by multiple approaches through appropriate hierarchies , and numerical
metrics describing the quality of the aligned grid yields accurate
registration and definition of features .
overall , crossword reduces
a process for extracting data that often takes 12 h of manual
adjustment and annotation per array using existing software such as
genepix pro to 5 min of user time , thereby greatly expanding the number
of arrays that can be feasibly analyzed by a single user .
we
have used crossword to analyze hundreds of microarrays over
the past year , with a failure rate of roughly 510% of microengraved
arrays .
typically , crossword fails when registering blocks using the
geometric code due to degraded resolution of the individual elements
in the registration channel image that prevents distinguishing diamonds
from squares , even with the human eye ( supporting
information figure 10 ) .
if crossword deciphers the codes for
ten or fewer blocks correctly , the software returns a message to the
command line stating that it was unable to properly register the array
and then moves on to the next array in the processing list in order
to continue batch processes .
( if a user wants to extract information
from these degraded arrays , the software also encodes a module for
manual gridding . after manual alignment , artifact removal proceeds
as in the automated process using the manually applied grid . )
crossword was developed , optimized , and implemented for microengraved
protein microarrays , but the algorithms described here should also
be applicable to protein or dna microarrays produced using conventional
technologies .
although the geometric decoding of block identity relies
on a unique feature arrangement of the microengraving method , spotted
arrays could employ a very similar approach by encoding block identity
by spotting fluorescently labeled probes or blank features in defined
locations .
also , the automated analysis of microengraved arrays needs
block decoding because the small block sizes make it possible to lose
whole rows of blocks and the absolute location of an individual block
on the glass slide varies significantly due to imprecise alignment
of the slide with the array of nanowells during microengraving . for
most spotted arrays
, however , the absolute location of a block on
the glass slide , particularly for arrays with larger block structures ,
should enable the identification of individual blocks without the
need for block decoding .
the remaining aspects of crossword could
be used to identify the features within blocks and effectively remove
artifact from measurements .
one disadvantage of crossword for
automated grid alignment is that
it is not currently conducive to the use of hexagonally close - packed
arrays due to the use of orthogonal 1-d projections .
crossword s
algorithms are also not ideal for handling donut - shaped artifacts
produced by some array platforms , as the center will likely still
be considered structured .
if these artifacts are commonly produced
by a platform , a hybrid approach would likely be ideal , using connectivity
enrichment to identify all structured pixels and one of several other
described approaches to
remove the center of the donut from the foreground measure .
the availability of cheap computing power has enabled us to contemplate
ways to improve the quality of the data extracted from the arrays .
fully automating the image analysis in itself
the establishment
of a flexible framework for identifying artifactual pixels within
the image should also substantially improve the quality of data .
one
powerful approach to identify certain artifacts , particularly in protein
arrays , is the comparison of signal across different channels of data .
dust and other debris often cause bright fluorescent signals that
are present in most , if not all , channels of a multichannel array .
this class of artifact in microengraved arrays can be readily identified
by correlated connectivity enrichment patterns present in multiple
channels , allowing the algorithm to confidently remove these pixels
from the analysis .
inclusion of a scanned channel with no corresponding
analyte would make this approach even more robust , as it would eliminate
any discrepancies when the artifact closely matches the foreground
shape .
this modification would also make this metric for quality control
useful for arrays containing a significant signal in all image channels
( such as dna microarrays ) .
the segregation of the remaining structured
pixels into signals arising from artifacts and analytes is accomplished
by a set of criteria for geometric comparisons established predominately
by empirical testing .
these criteria could be further refined using
machine learning algorithms to systematically optimize them .
the simple
yet accurate description of the image structure by nine connectivity
enrichment values combined with pixel location information should
enable easy adaptation of computer learning algorithms to improve
enumeration of artifacts . in its current implementation ,
crossword
requires considerable
computer processing time , requiring roughly 40 min to complete processing
of a 12,000 4,000 pixel image containing four channels .
although
this time is considerably longer than the time required for programs
such as genepix pro ( 25 min ) , it is still less than
the total time required for processing images of microengraved arrays
( 12 h per array if manual alignment is required ) .
this module
is encoded to allow massive parallel processing if sufficient numbers
of compute cores are available ( up to 10 more cores than we
currently use ) . to take full advantage of this capability , we are
currently refining the software implementing crossword to use graphical
processing units ( gpus ) , which have thousands of smaller cores designed
for massively parallel processing .
we are also examining whether iterative
clustering can operate effectively at the block level instead of the
feature level , thereby greatly reducing the necessary time for computation .
increasing
the processing efficiency of the algorithm should enable
even more detailed analysis of pixel structure as well as integration
of methods for computer learning to improve artifact removal further .
intensive analysis of raw images prior to data extraction through
the use of newly developed capabilities for parallel computational
processing , such as implemented here in crossword , represents a major
opportunity for improving the quality of data culled from images of
microarrays or other image - intensive biomolecular assays such as next - generation
sequencing . | biological assays formatted as microarrays
have become a critical
tool for the generation of the comprehensive data sets required for
systems - level understanding of biological processes .
manual annotation
of data extracted from images of microarrays , however , remains a significant
bottleneck , particularly for protein microarrays due to the sensitivity
of this technology to weak artifact signal . in order to automate the
extraction and curation of data from protein microarrays
, we describe
an algorithm called crossword that logically combines information
from multiple approaches to fully automate microarray segmentation .
automated artifact removal is also accomplished by segregating structured
pixels from the background noise using iterative clustering and pixel
connectivity .
correlation of the location of structured pixels across
image channels is used to identify and remove artifact pixels from
the image prior to data extraction .
this component improves the accuracy
of data sets while reducing the requirement for time - consuming visual
inspection of the data .
crossword enables a fully automated protocol
that is robust to significant spatial and intensity aberrations .
overall ,
the average amount of user intervention is reduced by an order of
magnitude and the data quality is increased through artifact removal
and reduced user variability .
the increase in throughput should aid
the further implementation of microarray technologies in clinical
studies . |
the story begins in the 1960s when post - retrieval amnesia was first revealed by donald lewis .
he showed that temporally graded retrograde amnesia could be obtained for a well - established memory in rats , if that memory were activated by a reminder of the original learning experience .
these studies are the real origin of today 's reconsolidation hypothesis , even though neither lewis , nor his colleagues , ever used the term reconsolidation . and with good reason .
cue - dependent amnesia is not predicted by the consolidation hypothesis and is , in fact , in direct contradiction to it .
therefore , rather then superimposing a new hypothetical process on top of the already contested consolidation hypothesis , lewis preferred a phenomenal description , cue - dependent amnesia , to account for his results .
it was assumed that the cue associated with the learning , as a reminder , activated the memory .
its susceptibility to the amnestic effects of electroconvulsive shock ( ecs ) suggested that the active memory was labile , as it was immediately after acquisition ( lewis et al . , 1972 ) .
in the first series of experiments from the lewis laboratory , thirsty rats learned to lick a drinking spout ; when this behavior was well established , a tone , followed by a footshock was presented during the ongoing licking behavior .
subsequent presentations of the tone alone elicited suppression of licking . a day after training ,
when memory expression was robust and reliable in control rats , the tone was presented alone , followed by ecs , a treatment that produces amnesia when administered after learning .
those rats that were reminded before ecs , showed a significant behavioral deficit when tested the following day .
ecs in absence of the cue had no effect on subsequent behavior ( misanin et al . , 1968 ) .
cue - dependent amnesia could likewise be induced by protein synthesis inhibition in much the same way that newly acquired memories are .
judge and quartermain ( 1982 ) trained mice on the conditioned lick suppression task used by lewis .
the protein synthesis inhibitor anisomycin was injected systemically at different time intervals after a single memory reactivation , consisting of a brief exposure to the training context .
there was a clear renewed efficacy of the treatment after reactivation , although the temporal gradient was steeper than for that generated after initial learning .
more recent studies have shown that injections of anisomycin directly into the amygdala after reactivation can produce amnesia for a simplified version of the conditioned suppression task ( nader et al . , 2000 ) .
further experiments from the lewis laboratory showed that the phenomenon of cue - dependent amnesia was not limited to aversive pavlovian conditioning protocols .
rats were trained in a complex maze over several days using food reward as the incentive .
cue - dependent amnesia could be obtained after presentation of different types of reminders associated with the initial task ( lewis and bregman , 1973 ; see sara , 2000a , b , 2008 , for a detailed account of these early studies ) .
we used a modified version of the same task in several experiments to show cue - dependent improvement in memory after a long retention interval .
contextual cue reminder alone deweer et al . , 1980 ) or in combination with pharmacological treatment ( sara and deweer , 1982 ) or electrical stimulation of the mesencephalic reticular formation ( sara et al . , 1980 ) in the presence of the contextual cue reminder facilitated retrieval .
although these experiments lent support to the notion that the cue activated the memory , they unfortunately , did not address the question of reconsolidation , since the rats were tested right after presentation of the cue .
lewis studies clearly demonstrated that memory lability was not time - bound to acquisition , as the consolidation hypothesis holds .
norman spear published a series of monographs around this time providing a strong theoretical framework for retrieval induced reactivation ( see below ; spear , 1973 ; spear and mueller , 1984 ) .
nevertheless , the term to consolidate was not used to account for cue - dependent amnesia until 1997 , when a serendipitous observation of a delayed amnesic effect of a drug on a well - trained spatial memory led to a rekindling of interest in cue - dependent amnesia in our laboratory . remembering the work of lewis , two decades earlier
, we pursued the theme with a series of experiments examining amnesic effects of blockade of nmda receptors after reactivation of different types of robust memory ( przybyslawski and sara , 1997 ; torras - garcia et al .
a well - consolidated spatial memory , acquired over many days , reactivated by a single errorless trial , was dependent upon nmda receptors to maintain stability .
the memory deficit was robust , in that there was no spontaneous recovery 48 h later ( przybyslawski and sara , 1997 , experiment 4 ) .
however , drug - treated rats could relearn the task in only a few trials , suggesting only partial amnesia ( przybyslawski and sara , 1997 , experiment 3 ) .
we later showed that cue - dependent amnesia could also be obtained by blockade of noradrenergic beta receptors at reactivation of memories for both appetitive and fear - driven tasks ( roullet and sara , 1998 ; przybyslawski et al .
, 1999 ; see also debiec and ledoux , 2006 ) . the following decade saw a proliferation of studies by many laboratories implicating protein synthesis , specific neurotransmitters , intracellular signaling pathways in reconsolidation process , and defining behavioral boundaries for obtaining a reconsolidation effect .
after a decade of renewed interest and intensive investigation , reconsolidation remains , as does consolidation for that matter , a hypothetical process , for the most part inferred through cue - dependent amnesia ( see dudai and eisenberg , 2004 ; tronson and taylor , 2007 ; alberini , 2008 ; sara , 2008 ; nader and hardt , 2009 ; nader and einarsson , 2010 for reviews with different perspectives ) .
the notion that off - line memory processing occurs during sleep has been around for a long time .
there was a surge of animal studies in the 1960s and 1970s with a focus on the rapid eye movement ( rem ) stage .
it was hypothesized that the high level of cortical activity associated with this sleep stage is associated with reactiviation of memory traces formed during wakefulness and that this stage of sleep serves to consolidate these memories ( hennevin and leconte , 1971 ) .
the hypothesis was tested by selectively depriving rats of rem sleep or delaying its onset after learning ( fishbein , 1971 ; hennevin and leconte , 1971 ) although these early studies did not adequately control for the stressful effects of the rem deprivation . another approach involved monitoring and quantifying the proportion of rem sleep after learning .
learning - dependent rem increases were found and were correlated with the rate of acquisition of a task over several sessions ( hennevin et al . , 1974 ) .
to further test the hypothesis that a reactivated memory trace undergoes a consolidation process during rem sleep , a contextual cue reminder , associated with the learning situation , was administered during the rem sleep episodes following learning .
the idea was to activate specific networks that had been active during the encoding phase .
rats reminded during rem sleep expressed better memory when tested the following day , compared to rats that received the same reminder treatment during the waking state ( hars et al . , 1985 ) .
these studies were carried out within a conceptual framework of lewis , the idea being that a specific memory was activated by the cue , so as to become labile .
the discovery of spontaneous replay of neural ensembles in rats provided a strong impetus for renewed studies of the role of sleep in memory consolidation .
neurons that are entrained to fire together during awake behavior , tend to fire together again during sleep ( pavlides and winson , 1989 ; wilson and mcnaughton , 1994 ) .
replay has been taken to represent a reactivation of circuits underlying the previously encoded information ( the memory trace ) and reinforces the notion that consolidation of memory occurs during sleep .
the initial hypothesis , discussed above , focused on the rem stage , because of the high level of cortical activity
. however most replay in rats seems to take place during non - rem sleep , although there are some exceptions ( e.g. , louie and wilson , 2001 ) .
replay occurs in strong temporal relation to high frequency oscillations in the hippocampus , called sharpwave / ripple complexes ( kudrimoti et al . , 1999 ;
others have proposed that these sleep - associated high frequency oscillations provide the substrate to promote long - term plasticity and consolidation of the memory trace .
synaptic connections between cells in the reactivated network will be reinforced by the high frequency concerted firing ( buzsaki , 1989 ; steriade and timofeev , 2003 ) .
recording hippocampal local field potentials in the rat , we found a marked increase in the occurrence of ripples in the sleep session immediately following learning of an odor - reward association .
important from the reconsolidation perspective , there was a similar increase in ripples in well - trained rats that had been exposed to a reminder session , just before .
rats that did not learn the task had no increase in ripples ( eschenko et al . , 2008 ) .
in a multi - session spatial discrimination task , an increase in ripples predicted an increase in memory performance in the following session ( ramadan et al . , 2009 ) .
these increases in ripple activity , if they are indeed , accompanied by replay of learning related ensembles of neurons , will promote memory consolidation , or might even be viewed as a manifestation of a consolidation process .
until recently , there have been no strong data linking the content of the replay with the subsequent expression of memory during wakefulness .
one study attempted to drive replay of specific networks by presenting a non - waking contextual cue reminder during sleep .
those subjects reminded by the contextual cue during sleep , showed better memory for the initial material presented within the context , when tested the next day .
this experiment is reminiscent of the earlier study in rats , cited above . in both experiments
, the authors assumed that the reminder treatment caused a specific reactivation of memory circuits to be reinforced during the sleep episode .
two other studies have provided convincing new data relating the reactivation to subsequent memory performance . in one , using in human subjects , the content of dreams was related to previous waking experience and subsequent memory performance ( wamsley et al . , 2010 ) .
an analogous experiment in rats recorded ensembles of hippocampal neurons during learning , monitored their reactivation during hippocampal ripple activity , and then related this activity to subsequent performance on a memory test ( dupret et al . , 2010 ) .
these very recent reports take us a step further in relating encoding of memory in ensemble activity , off - line reactivation of the memory trace and subsequent robust memory performance .
since reactivation seems to be a key to memory consolidation and reconsolidation in and out of sleep , it is essential to understand what governs this reactivation , what brain regions are involved , and whether neuronal assemblies are actually reactivated at retrieval .
james ( 1890 ) stated a truism in that the study of memory is first and foremost a study of retrieval , since without recall , there is no proof that memory exists .
nevertheless , the past decades have seen relatively little literature dealing with neurobiological mechanisms of memory reactivation or retrieval ( sara , 2000a ) .
a notable exception is the work from miyashita 's laboratory involving an electrophysiological approach combined with lesions in monkeys ( miyashita , 1993 ) . from their unit recordings they are able to distinguish two types of retrieval .
automatic or bottom up , depends on the inferior temporal cortex , where a cue reactivates the neural representation of the memory .
active or top down retrieval is effortful and depends upon the prefrontal cortex input to the inferior temporal lobe .
( miyashita and hayashi , 2000 ; osada et al . , 2008 , for review ) .
many imaging studies in humans have confirmed the crucial role played by the frontal regions in executive control of effortful memory retrieval ( review wheeler and buckner , 2004 ) .
imaging approaches have been able to identify other brain regions that are activated during retrieval from different types of remote episodic memory , implicating among others , hippocampus and amygdala ( spiers and maguire , 2007 ) .
in addition , the parietal cortex has now been identified as a major component of the retrieval network , especially when the retrieval is effortful and is initiated top down .
furthermore , a recent study demonstrates that co - activation of left medial temporal lobe regions and temporal parietal cortices is greater for correct than incorrect retrieval of episodic memory .
earlier , the amygdala and the noradrenergic nucleus locus coeruleus were also identified as key players in retrieval , specifically of emotional memories . at retrieval
these two structures were more tightly coupled during correct responses . in this particular study , no other brain regions that were activated by the retrieval effort showed this increased functional connectivity ( sterpenich et al . , 2006 ) .
the demonstration of the engagement of the noradrenergic nucleus locus coeruleus in memory retrieval in humans corroborates previous studies in rats concerning the role of this system in memory retrieval .
electrical stimulation of locus coeruleus neurons or pharmacological increase in availability of forebrain ne can facilitate retrieval from very remote memory in rats , if , and only if , it is applied in the context in which the training took place . as with the cue - dependent amnesia studies ,
the memory must be activated by a cue , in this case the context , in order that stimulation of the noradrenergic system facilitate retrieval ( sara and devauges , 1988 , 1989 ; devauges and sara , 1991 ) .
this tiny pontine nucleus is the sole source of noradrenaline to the forebrain and it projects to all cortical regions and thalamic nuclei , having a strong influence on processing sensory information in all modalities ( sara , 2009 for review ) .
in addition there is a substantial noradrenergic projection to hippocampus where it facilitates synaptic transmission and cellular excitability ( harley , 2007 ) . in the frontal cortex ,
noradrenergic input modulates working memory and focuses attention ( robbins and arnsten , 2009 ) . while the mediating mechanism of retrieval facilitation by activation of the lc is unknown , any or all of the aforementioned effects should be involved .
it is worth emphasizing that all of the key regions revealed by imaging studies in humans shown to be important in retrieval , receive substantial noradrenergic input from the lc .
in addition to its involvement in retrieval processes , the lc ne system is engaged in post - acquisition consolidation and post - retrieval reconsolidation .
a large number of pharmacological studies have established that the noradrenergic input to the amygdala is essential to memory consolidation after initial training ( see mcgaugh and roozendaal , 2008 for review ) .
beta adrenergic receptors are necessary for reconsolidation after reactivation of well - established memories of varying emotional valences .
( przybyslawski and sara , 1997 ; przybyslawski et al . , 1999 ; debiec and ledoux , 2006 ) . those experiments involved systemic injections , precluding a precise determination of the timing of the drug efficacy . in later studies ,
intraventricular and intra cortical injections revealed a relatively narrow time window , around 2 h after training , when injections were effective .
moreover , amnesia was obtained several weeks after initial training , if memory was reactivated by exposure to a training - associated cue 2 h before the injection ( tronel et al . , 2004 ) .
the late involvement of the noradrenergic system in memory processing led us to consider the behavioral state of the animal , at this time window .
recording activity of lc neurons while monitoring the sleep state through cortical electrodes , we found that lc neurons increase their firing rate during non - rem sleep after a learning episode and this increase occurs at around 2 h after learning ( eschenko and sara , 2008 ) .
moreover , we discovered that lc unit activity is time locked to cortical slow oscillations during this phase of sleep .
the slow oscillations serve to group faster rhythms such as cortical spindles and hippocampal ripples and therefore provide the background brain state for consolidation ( siapas and wilson , 1998 ; molle et al . , 2006 ) .
as mentioned in the preceding section , it is during this non - rem sleep - associated ripple activity that the ensemble replay occurs . if indeed , there is potentiation of synapses occurring during this high frequency concerted firing of activate memory networks , then release of ne at a critical period during the replay should reinforce the plasticity in those activated synapses ( harley , 2007 ) . while this scenario is presently highly speculative , it merits further investigation .
only a few investigators have attempted to integrate the sleep research with current ideas concerning reconsolidation ( sara and hars , 2006 ; stickgold and walker , 2007 ) .
the noradrenergic system and perhaps other neuromodulatory systems , may , indeed , be a key to linking off - line memory reactivation , retrieval , and memory reconsolidation processes at both synaptic and systems levels , in and out of sleep .
the view presented here is that memory is a dynamic property of the nervous system , in constant flux as a result of being retrieved within current cognitive environments .
such a view can be found in many earlier accounts of memory , and in particular , permeates the writings of james ( 1890 ) ; tulving and thompson ( 1973 ) argued that remembering is an activity similar to perceiving , in the sense that it involves the apprehension and comprehension of contemporary stimuli in the light of past experience .
accordingly , new episodic memory , to be remembered in a meaningful way , must be consolidated within a preexisting semantic memory
. an updated version of tulving 's view can be found in a recent extensive review of the literature on the neural mechanisms of source memory .
both encoding and remembering are constructive and reconstructive ; they are selective and influenced by a rememberer 's knowledge , beliefs , biases , goals , agendas , and meta - memory assumptions active at the time(mitchell and johnson , 2009 , p. 4 ) . in this view
encoding is preceded by retrieval , so that subsequent off - line consolidation , in and out of sleep , is really reconsolidation .
the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | the neurobiology of memory has taken on a new look over the past decade .
re - discovery of cue - dependent amnesia , wide availability of functional imaging tools and increased dialog among clinicians , cognitive psychologists , behavioral neuroscientists , and neurobiologists have provided impetus for the search for new paradigms for the study of memory .
memory is increasingly viewed as an open - ended process , with retrieval being recognized as an intricate part of the encoding process .
new memories are always made on the background of past experience , so that every consolidation is , in fact reconsolidation , serving to update and strengthen memories after retrieval .
spontaneous reactivation of memory circuits occurs during sleep and there is converging evidence from rodent and human studies that this is an important part of the extended off - line memory processing .
the noradrenergic neuromodulatory system is engaged at retrieval , facilitating recall .
the noradrenergic system is also activated during sleep after learning and noradrenergic neurons fire in concert with cortical oscillations that are associated with reactivation of memory circuits .
we suggest that the noradrenergic system and perhaps other neuromodulatory systems , may be a key to linking off - line memory reactivation , retrieval , and memory reconsolidation processes at both synaptic and systems levels , in and out of sleep . |
cysticercosis , a parasitic disease caused by taenia solium cysticercus , is one of the important parasitic diseases . neurocysticercosis ( ncc ) is accepted to refer to cysts in the central nerve system , including the parenchyma and ventricles of the brain and the spinal cord .
subcutaneous cysticercosis ( scc ) is used for the cysticercosis presenting the form of firm , mobile nodules , mainly in the soft tissues and muscles of on the trunk and extremities .
ncc is clinically more serious than scc because of the severity of the neurologic symptoms , such as epileptic seizures and paralysis that can result from infection .
the disease constitutes a major public health problem in many parts of the world , including china , southeast asia , india , sub - saharan africa , and latin america .
cysticercosis has also become an important parasitic disease in developed countries , such as the united states , particularly in california and other states with a large immigrant population . in japan , although t. solium cysticercosis / taeniasis was endemic to the okinawa region in southern japan 50 - 60 years ago , the disease is no longer endemic in the area .
nonetheless , sporadic cases of cysticercosis have been reported in japan , primarily among japanese returning from abroad and foreigners coming to japan ( table 1 ) .
conversely , taeniasis , which is caused by infection with the adult tapeworm of t. solium or taenia saginata , occurs worldwide , except in countries where people do not eat pork and beef for religious reasons .
taeniasis caused by taenia asiatica is restricted to countries in asia , including south korea , china , taiwan , the philippines , vietnam , thailand , indonesia , and japan .
in japan , sporadic cases of taeniasis have been reported and most of them were caused by infection with t. saginata and were imported cases until t. asiatica infections were confirmed in 2010 ( table 2 ) .
compared to cysticercosis , taeniasis is innocuous or asymptomatic , with most patients presenting with slight intestinal illness and mental discomfort due to persistent expulsion of the proglottids . in japan ,
the " ordinance for enforcement of the food sanitation act " based on the food sanitation law stipulates that food - borne parasitic diseases such as cysticercosis and taeniasis be treated as cases of food poisoning and that authorities be notified of their occurrence immediately .
however , because parasitic diseases have never reported based on the law , it is not possible to accurately estimate the incidence of cysticercosis / taeniasis in japan .
therefore , the author previously examined the epidemiological trends in cysticercosis and taeniasis based on clinical cases in japan published in scientific journals . since then , new cases of cysticercosis and taeniasis have been reported and several cases of cysticercosis have been newly diagnosed in our department .
the department of parasitology at the national institute of infectious diseases , tokyo routinely performs diagnostic tests requested for parasitic diseases from domestic and foreign medical institutions , and cysticercosis and taeniasis also are acceptable for diagnosis .
the purpose of this article is to overview the current status of cysticercosis / taeniasis in japan and to update the data that was reported in 2005 based on the cases cited in pubmed ( national library of medicine ) and japana centra revuo medicina as well as cases diagnosed in our department over the last 5 years ( 2007 - 2011 ) .
according to nishiyama and araki , as many as 389 cases of cysticercosis were reported in japan from 1908 to 1997 .
however , 24 cases reported between 1943 and 1979 were not included in the study .
furthermore , 41 cases , including 10 cases diagnosed by our department , have been newly confirmed between 1997 and 2011 ( cases 26 - 66 in table 1 ) [ 7 - 40 ] . taken together ,
this gives a total of 454 cysticercosis cases that have been reported in japan between 1908 and 2011 .
table 1 shows 66 of the cysticercosis cases that have been reported over the last 22 years ( 1990 - 2011 ) along with cases confirmed by our department between 2007 and 2011 .
of these 66 cases , 54 ( 66.7% ) were ncc ; ncc with multiple cysts ( 28/54 , 51.9% ; fig .
1e ) was more frequent than ncc with a solitary cyst ( 13/54 , 33.5% ; fig .
total 17 cases of scc were reported as cases 4 , 16 - 17 , 24 , 26 , 28 , 29 , 34 , 35 , 44 , 45 , 52 , 56 , 63 , 64 , 65 , and 66 .
two of them were systemic intramuscular cysticercosis with numerous calcified cysts ; cases 44 and 52 ( fig .
very rarely , intramedullary cysticercosis in case 5 and ocular cysticercosis in cases 11 , 36 , 43 , and 58 have also been reported .
ten cases of ncc with either scc or ocular cysticercosis were reported in cases 16 - 17 , 26 , 29 , 35 , 43 , 45 , 56 , 64 , and 65 ( table 1 ) .
more interestingly , dual infection of cysticercosis and taeniasis was observed in 4 cases ; 29 , 58 , 60 , and 65 ( table 1 ) .
furthermore , the adult tapeworm in case 41 was observed in the small intestine using capsule endoscopy to confirm the presence of the adult worm ( table 2 ) .
cysticercosis diagnosis is generally performed by imaging , serologic , and histopathologic examinations . in our department , molecular identification of the etiologic agents is routinely performed , if surgically removed materials are available [ 46 - 48 ] .
indeed , the usefulness of molecular methods for diagnosing the causative agents has successfully been demonstrated by the identification of 2 genotypes of t. solium cysticercus as well as confirmation of the agents in paraffin - embedded sections [ 24,25,28,31,33 - 35,37,40 ] .
in addition , the localities where the patients were infected can also be inferred based on the dna sequences of the causative agents . in scc
, x - ray examinations have revealed the presence of rod - like , scattered , calcified lesions in the soft tissues of the extremities ( fig .
these calcified cysts have histopathologically been confirmed to be t. solium in cases 16 - 17 , 26 , 52 , and 44 ( fig .
two types of t. solium cysticercus , cellulose- and racemose - types , are known to exist .
the cellulose - type cysticercus is characterized by a single bladder measuring 3 to 18 mm in diameter with an invaginated scolex and primarily found in the cerebral parenchyma and musculature .
the racemose - type presents as large multilobulated cystic lesions lacking a scolex and appears to prefer the cisternal and ventricular systems or subarachnoid space .
indeed , the racemose - type cysticercus is frequently found in the subarachnoidal spaces as multilobulated lesions ( fig .
although cysticercosis due to racemose - type t. solium cysticercus is relatively rare , 8 cases have been documented in japan in cases 8 , 15 , 18 , 19 , 39 , 50 , 61 , and 62 ( table 1 ; fig .
2c ) . of these , mitochondrial dna analysis using histopathologic sections revealed that etiologic t. solium was the asian genotype in 3 cases , 50 , 61 , and 62 , and american / african genotype in case 50 ( table 1 ) .
the racemose - type cysticercus is considered to be an aberrant , multilobular , non - viable t. solium cysticercus , possibly the degenerated form of a cysticercus in the basal subarachnoid space .
molecular analysis using formalin - fixed and paraffin - embedded histopathologic specimens has proved that the racemose - type cysticercus is t. solium in cases 50 , 61 , and 62 .
most of the cysticercosis cases in japan are imported cases , meaning that the patients either lived in or visited countries where cysticercosis and taeniasis are still endemic , and where they are presumed to have been exposed to t. solium eggs .
however , 13 cases have suggested that infection occurred within japan ( cases 1 , 8 , 10 , 12 , 20 , 21 , 22 , 23 , 28 , 40 , 52 , 53 , and 62 .
table 2 shows 73 clinical taeniasis case reports that have been published in journals between 1990 and 2011 and diagnosed by our department between 2007 and 2011 .
the most commonly encountered taeniasis cases were t. saginata infections and 48 cases ( 65.8% ) have been confirmed to date ( table 2 ) .
although the route of infection is unknown , the possibility also exists that 4 of these cases may be attributable to domestic infections ; cases 4 , 6 , 19 , and 22 .
t. solium taeniasis is extremely rare in japan and only 1 case was reported in okinawa in 1988 .
however , taeniasis solium cases with either ncc , scc , or ocular cysticercosis have been confirmed , and all these were imported in cases 29 , 58 , 60 , and 65 ( table 1 ) and cases 17 , 41 , 53 , and 64 ( table 2 ) .
taeniasis caused by t. asiatica has been also recently successively confirmed in japan and this will be discussed in the following chapter .
taeniasis is usually diagnosed based on proglottid morphology . however , since t. saginata , t. solium , and t. asiatica are all morphologically similar , it is not always possible to accurately differentiate them . as a result ,
more reliable molecular diagnoses are currently employed to differentiate between taeniasis infections in our department [ 46 - 48 ] .
most recently , t. solium tapeworms have been observed in the small intestine using capsule endoscopy in cases 41 and 53 .
according to nishiyama and araki , as many as 389 cases of cysticercosis were reported in japan from 1908 to 1997 .
however , 24 cases reported between 1943 and 1979 were not included in the study .
furthermore , 41 cases , including 10 cases diagnosed by our department , have been newly confirmed between 1997 and 2011 ( cases 26 - 66 in table 1 ) [ 7 - 40 ] . taken together ,
this gives a total of 454 cysticercosis cases that have been reported in japan between 1908 and 2011 .
table 1 shows 66 of the cysticercosis cases that have been reported over the last 22 years ( 1990 - 2011 ) along with cases confirmed by our department between 2007 and 2011 .
of these 66 cases , 54 ( 66.7% ) were ncc ; ncc with multiple cysts ( 28/54 , 51.9% ; fig .
1e ) was more frequent than ncc with a solitary cyst ( 13/54 , 33.5% ; fig .
total 17 cases of scc were reported as cases 4 , 16 - 17 , 24 , 26 , 28 , 29 , 34 , 35 , 44 , 45 , 52 , 56 , 63 , 64 , 65 , and 66 .
two of them were systemic intramuscular cysticercosis with numerous calcified cysts ; cases 44 and 52 ( fig .
very rarely , intramedullary cysticercosis in case 5 and ocular cysticercosis in cases 11 , 36 , 43 , and 58 have also been reported .
ten cases of ncc with either scc or ocular cysticercosis were reported in cases 16 - 17 , 26 , 29 , 35 , 43 , 45 , 56 , 64 , and 65 ( table 1 ) .
more interestingly , dual infection of cysticercosis and taeniasis was observed in 4 cases ; 29 , 58 , 60 , and 65 ( table 1 ) .
furthermore , the adult tapeworm in case 41 was observed in the small intestine using capsule endoscopy to confirm the presence of the adult worm ( table 2 ) .
cysticercosis diagnosis is generally performed by imaging , serologic , and histopathologic examinations . in our department , molecular identification of the etiologic agents is routinely performed , if surgically removed materials are available [ 46 - 48 ] .
indeed , the usefulness of molecular methods for diagnosing the causative agents has successfully been demonstrated by the identification of 2 genotypes of t. solium cysticercus as well as confirmation of the agents in paraffin - embedded sections [ 24,25,28,31,33 - 35,37,40 ] .
in addition , the localities where the patients were infected can also be inferred based on the dna sequences of the causative agents . in scc
, x - ray examinations have revealed the presence of rod - like , scattered , calcified lesions in the soft tissues of the extremities ( fig .
these calcified cysts have histopathologically been confirmed to be t. solium in cases 16 - 17 , 26 , 52 , and 44 ( fig .
two types of t. solium cysticercus , cellulose- and racemose - types , are known to exist .
the cellulose - type cysticercus is characterized by a single bladder measuring 3 to 18 mm in diameter with an invaginated scolex and primarily found in the cerebral parenchyma and musculature .
the racemose - type presents as large multilobulated cystic lesions lacking a scolex and appears to prefer the cisternal and ventricular systems or subarachnoid space .
indeed , the racemose - type cysticercus is frequently found in the subarachnoidal spaces as multilobulated lesions ( fig .
although cysticercosis due to racemose - type t. solium cysticercus is relatively rare , 8 cases have been documented in japan in cases 8 , 15 , 18 , 19 , 39 , 50 , 61 , and 62 ( table 1 ; fig .
2c ) . of these , mitochondrial dna analysis using histopathologic sections revealed that etiologic t. solium was the asian genotype in 3 cases , 50 , 61 , and 62 , and american / african genotype in case 50 ( table 1 ) .
the racemose - type cysticercus is considered to be an aberrant , multilobular , non - viable t. solium cysticercus , possibly the degenerated form of a cysticercus in the basal subarachnoid space .
molecular analysis using formalin - fixed and paraffin - embedded histopathologic specimens has proved that the racemose - type cysticercus is t. solium in cases 50 , 61 , and 62 .
most of the cysticercosis cases in japan are imported cases , meaning that the patients either lived in or visited countries where cysticercosis and taeniasis are still endemic , and where they are presumed to have been exposed to t. solium eggs .
however , 13 cases have suggested that infection occurred within japan ( cases 1 , 8 , 10 , 12 , 20 , 21 , 22 , 23 , 28 , 40 , 52 , 53 , and 62 .
table 2 shows 73 clinical taeniasis case reports that have been published in journals between 1990 and 2011 and diagnosed by our department between 2007 and 2011 .
the most commonly encountered taeniasis cases were t. saginata infections and 48 cases ( 65.8% ) have been confirmed to date ( table 2 ) .
although the route of infection is unknown , the possibility also exists that 4 of these cases may be attributable to domestic infections ; cases 4 , 6 , 19 , and 22 .
t. solium taeniasis is extremely rare in japan and only 1 case was reported in okinawa in 1988 .
however , taeniasis solium cases with either ncc , scc , or ocular cysticercosis have been confirmed , and all these were imported in cases 29 , 58 , 60 , and 65 ( table 1 ) and cases 17 , 41 , 53 , and 64 ( table 2 ) .
taeniasis caused by t. asiatica has been also recently successively confirmed in japan and this will be discussed in the following chapter .
taeniasis is usually diagnosed based on proglottid morphology . however , since t. saginata , t. solium , and t. asiatica are all morphologically similar , it is not always possible to accurately differentiate them . as a result ,
more reliable molecular diagnoses are currently employed to differentiate between taeniasis infections in our department [ 46 - 48 ] .
most recently , t. solium tapeworms have been observed in the small intestine using capsule endoscopy in cases 41 and 53 .
although t. asiatica was not previously considered to occur in japan , retrospective molecular analyses of proglottids revealed that 2 t. asiatica infections occurred in tottori prefecture on honshu island , japan , in 1968 and 1996 .
unfortunately , it is unknown whether the 2 japanese cases were domestic infections or imported cases .
as the number of japanese travelers visiting asian countries has increased , so too has the number of people from other asian countries visiting japan .
this may mean that the likelihood of encountering cases of imported t. asiatica is increasing .
surprisingly , from june 2010 to december 2011 , an increasing number of human cases with taeniasis have been diagnosed in the kanto region , including tokyo and the neighboring 5 prefectures ( gumma , tochigi , saitama , chiba , and kanagawa ) in central honshu [ 80 - 84 ] . of 31 taeniasis cases ,
taenia asiatica tapeworms were identified based on nucleotide sequence analysis of the mitochondrial cytochrome c oxidase subunit 1 gene and allelic analysis of the 2 nuclear genes for elongation factor 1- and ezrin - radixin - moesin - like protein genes .
nineteen out of 20 patients infected with t. asiatica were japanese nationals residing in the kanto area and 1 was a filipino woman living in same area ( tochigi ) .
sixteen had never been overseas or , if they had undertaken any international travel , they traveled to countries where t. asiatica is not endemic .
the infection in the filipino woman who has returned to the philippines several times was also considered to have been occurred in japan .
the occurrence of taeniasis due to t. asiatica infection is thus considered to have occurred within japan by the following reasons : i ) most of the patients had never been overseas or traveled to areas where t. asiatica is not endemic , ii ) most patients had histories of eating raw pig liver , iii ) based on interviews with patients and meat inspectors , pigs that had been produced and slaughtered in the kanto region were strongly suspected to be possible sources of infection , iv ) although japan imports pork from canada , mexico , and europe , no raw pig liver is imported from these countries . at present , the reasons why t. asiatica infections successively occurred in the kanto region , a region within which the disease was not reported previously , have not yet been satisfactorily clarified . considering that patients have occurred now
, it is possible that the workers and pigs on farms in the kanto region currently constitute the t. asiatica reservoirs responsible for these infections .
we have been investigating the prevalence of t. asiatica metacestodes in pigs from these farms in collaboration with local meat inspection centers .
in addition , we have also disseminated information describing precautions against t. asiatica infections in infectious agents surveillance reports ( http://idsc.nih.go.jp/iasr/32/374/kj3741.html ) published by the infectious diseases information center at the national institute of infectious diseases [ 80 - 84 ] .
it is expected that cysticercosis and taeniasis will primarily be detected as imported cases with the increasing numbers of japanese travelers to foreign countries where these diseases are endemic or visitors from these areas increase .
the occurrence of human infections due to t. asiatica is currently restricted to the kanto region in japan , and the origins of infection have not yet been clarified . thus , further occurrence of the disease is likely to occur , medical practitioners should be aware of the importance accurately identifying the causative agent responsible for infection . | this mini - review describes recent epidemiological trends in cysticercosis and taeniasis in japan .
some of the topics discussed herein were presented at the first symposium on " current perspectives of taenia asiatica researches " , that was held in osong in chungbuk province , south korea , in october 2011 and organized by prof .
k. s. eom , chungbuk national university school of medicine . to better understand the trends in the occurrence of cysticercosis and taeniasis in japan
, clinical cases reported in 2005 have been updated .
in addition , the current status of taenia asiatica infections successively occurring in japan since 2010 is also discussed . |
diffuse normolipemic plane xanthoma ( dnpx ) was first described by altman and winkelmann in 1962 .
the features of this entity are : ( 1 ) xanthelasma palpebrarum ; ( 2 ) diffuse xanthoma planum of the head , neck , trunk , and extremities , and ( 3 ) plasma lipid values that are within normal limits .
several associations have been reported between dnpx and lymphoproliferative and myeloproliferative disorders , particularly multiple myeloma and benign monoclonal gammopathy ( often iga ) [ 2 , 3 ] .
all therapeutic options for the treatment of plane xanthoma include mechanical removal by excision , chemabrasion , dermabrasion , or abrasive laser therapy [ 4 , 5 , 6 ] .
we report on a patient with dnpx who received oral probucol and showed significant clearing of the lesions .
a 70-year - old woman presented with well - defined macular yellowish patches on her eyelids , both cheeks , and the nose lasting over a few years ( fig .
1 ) . she had no history of topical steroid use or extensive sun exposure on her face .
a skin biopsy specimen revealed the accumulation of foam cells and touton giant cells in the superficial dermis ( fig .
complete blood count , and liver and renal function tests were within normal limits , but she had elevated levels of iga [ 460.7 mg / dl ( normal values : 100400 mg / dl ) ] and amylase [ 270 iu / l ( normal values : 40120
plasma lipid levels including total cholesterol , hdl and ldl cholesterols , triglycerides , and apolipoproteins were normal .
she was diagnosed with idiopathic macroamylasemia and treatment was considered unnecessary . based on the clinical and histopathological findings , a diagnosis of dnpx was made and oral administration of probucol ( 500 mg / day ) was initiated .
the lesions began to recede after 2 weeks and had almost resolved within 8 months ( fig .
dnpx , first described in 1962 , is characterized by diffuse , yellow to orange , slightly elevated plaques with sharply delineated borders that may affect any part of the body .
type i contains patients with xanthomas found in association with an altered lipoprotein content or structure .
type iii consists of patients with neither lipoprotein abnormalities nor underlying systemic disease , but in whom local tissue alterations seem to play a role in xanthoma formation .
lesions can be removed by excision , chemabrasion , dermabrasion , or abrasive laser therapy [ 4 , 5 , 6 ] .
lorenz et al . used an er : yag laser for full - face dnpx lesions under general anesthesia and reported that the lesions were almost completely removed after 2 sessions .
although these excisional or abrasive therapies may be useful for limited lesions including palpebral xanthelasmas , they may be too invasive for widespread lesions .
probucol is an antioxidant that may inhibit atherogenesis by limiting the oxidative modification of ldl cholesterol [ 8 , 9 ] and , thus , foam cell formation and/or endothelial cell injury .
. showed that xanthelasma lesions decreased in size in their 7 cases , and 3 lesions disappeared during probucol therapy in patients with hypercholesterolemia .
furthermore , 17 out of 25 xanthelasma patients ( 68% ) with normolipemia exhibited regression after taking probucol . therefore , we used probucol to treat our patient with dnpx .
the results obtained were remarkable , and we suggest that probucol be included as a primary therapy for dnpx . | we report on a 70-year - old woman with diffuse normolipemic plane xanthoma ( dnpx ) who developed macular yellowish patches on the eyelids , both cheeks , and the nose .
histology revealed the accumulation of cd68-positive foam cells and touton giant cells in the superficial dermis .
plasma lipid levels were within normal limits .
the patient had no underlying hematological diseases .
her extensive lesions precluded surgical excision . the patient was given oral probucol instead , which resulted in a significant reduction of the lesions after 2 weeks .
the lesions almost disappeared within 8 months .
plane xanthoma is primarily treated with excisional or abrasive therapies ; however , probucol can be a safe and effective alternative therapy for dnpx . |
bronchiectasis is defined as irreversible , abnormal dilatation of one or more bronchi with chronic airway inflammation and results in a chronic cough , sputum production , recurrent chest infection , and airflow obstruction.1,2 according to us data , the estimated prevalence of bronchiectasis is 53 cases per 100,000 adults.3 seitz et al reported that prevalence of bronchiectasis was 1,106 cases per 100,000 people.4 the prevalence increases with age and is higher in females . as it is a chronic disease , bronchiectasis may lead to a decrease in exercise capacity and cause difficulty in performing daily living activities .
ryu et al reported that depression and anxiety are more prevalent in subjects with chronic airway diseases , and this is associated with low quality of life and impaired adherence to therapy.5 similarly , although psychiatric disorders such as anxiety and depression are related to worsened respiratory symptoms , increased health expenditure , and noncompliance with therapy in the patients with chronic pulmonary diseases , it may frequently be overlooked in daily practice.6,7 there are a limited number of studies on the prevalence of depression and anxiety in either pediatric or adult cases with bronchiectasis , which is a significant chronic pulmonary problem.810 in the present prospective study , we aimed to investigate the presence of depression and anxiety in outpatients with non - cystic fibrosis bronchiectasis using the hospital anxiety depression scale .
in addition , we evaluated the relationship between sociodemographic , clinical factors and depression and anxiety in adult patients with bronchiectasis .
a total of 133 patients with stable bronchiectasis who were diagnosed using high - resolution computed tomography ( hrct ) enrolled to the study .
cases with cystic fibrosis , malignancy , interstitial pulmonary disease on hrct and acute exacerbation of bronchiectasis were excluded .
an acute exacerbation was defined as having at least three of the following criteria : worsened dyspnea and coughing , an increase in the amount and purulence of sputum , hemoptysis , fever ( 38c ) , worsening in clinical examination , and the presence of new signs on a chest x - ray .
demographic data , body mass index , marital status , education , occupation , smoking status , and comorbidity status were recorded for all patients .
in addition , clinical characteristics of the patients , medications , the use of nebulizers ( nebulizer is used for inhaled betamimetic and/or inhaled steroid drugs ) and long - term oxygen therapy ( ltot ; long - term oxygen therapy is extended use of oxygen ; oxygen therapy is delivered as a gas from an oxygen source like concentrator ) , number of emergency and hospital admissions and intensive care stays within the last year , and pulmonary function tests were recorded . after clinical and radiological examination ,
hads was developed in 1983 by zigmond and snaith , and validity and reliability were performed.11 hads questionnaire is a test consisting of 14 questions , of which seven are used to assess depression and the remaining seven are used to assess anxiety .
the answers were evaluated in the form of four - point likert - type scale .
while the cutoff value is 7 for depression , it is 10 for anxiety in the turkish version .
validation of the turkish version of the test was done in 1997.12 the study protocol was approved by the local ethics and clinical research committee of the yedikule chest diseases and thoracic surgery training and research hospital .
statistical analyses were carried out using spss statistics for windows , version 20.0 ( ibm corporation , armonk , ny , usa ) .
descriptive data were presented as mean standard deviation , and median ( range ) , when there is not a normal distribution . the univariate analyses to identify variables associated with patient outcome according to the hads scores ( anxiety and depression )
was investigated using chi - square and fisher exact tests . for the multivariate analysis ,
the possible factors identified with univariate analyses were further entered into the logistic regression analysis to determine independent predictor of patient outcome .
lemeshow goodness of fit statistics were used to assess model fit . a 5% type - i error level ( p<0.05 )
a total of 133 patients with bronchiectasis were enrolled in this study . the mean age of patients was 49.514.5 years ( range , 1877 years ) , and 81 ( 60.9% ) of the patients were females .
the mean diagnosed time of the study group was 6.84 years ( range , 1 month30 years ) .
the clinical symptoms of the patients included in this study are summarized in table 1 .
no statistically significant difference was found between the groups with high and low depression and anxiety scores regarding symptoms ( cough , sputum , dyspnea , and hemoptysis ) ( p>0.05 ) .
concerning medical therapies , 111 ( 83.5% ) were receiving bronchodilators , 17 ( 12.8% ) were using nebulizers , and 14 ( 10.5% ) were on ltot .
when comparing medical therapy for bronchiectasis and had scale scores , no statistically significant difference was found between the groups ( p>0.05 ) .
furthermore , no relationship was found between the use of a nebulizer , ltot and depression and anxiety ( p>0.05 ) .
the mean hads score was 10.98.3 ; the mean depression score was 4.84.3 , and the mean anxiety score was 6.14.7 .
the cutoff point for depression and anxiety was taken as 7 and 10 , respectively , and therefore , 28 ( 21.1% ) patients had depression , and 53 ( 39.8% ) had anxiety .
depression score was related to the family situation ( living without a partner ) , previous depression history and admission to the emergency department within the last year .
anxiety score was related to female gender , employment , family situation ( living without a partner ) , previous depression history , and admission to the emergency department within the last year ( table 2 ) .
the first stepwise multivariate model for depression was performed which included the variables : age , gender , family situation , comorbidity , hospitalization , admission to an emergency department within the last year , and history of depression and anxiety .
this model showed that living with a partner ( odds ratio [ or ] 0.17695% , 95% confidence interval [ ci ] : 0.4590.675 , p=0.011 ) and admission to the emergency department in last year ( or 4.236 , 95% ci : 1.27714.0522 , p=0.018 ) were independently related to depression . when the symptoms were added to the model , only hemoptysis ( or 0.255 , 95% ci : 0.6870.948 , p=0.041 ) was a significant predictor of high scores of depression ( table 3 ) .
however , pulmonary function tests did not affect the risk of depression in adults with bronchiectasis .
the multivariate model was performed including age , gender , employment , family situation , comorbidity , admission to the emergency department within the last year , hospitalization within the last year , and history of anxiety and depression for anxiety .
this analysis identified four variables related to increased risk for clinically relevant anxiety : living with a partner ( or 0.075 , 95% ci : 0.0150.358 , p=0.001 ) , education level ( < 8 years ) ( or 7.613 , 95% ci : 1.5143.2570 , p=0.014 ) , admission to emergency department within the last year ( or 3.177 , 95% ci : 1.0419.695 , p=0.04 ) , and history of depression ( or 7.170 , 95% ci : 2.31722.1847 , p=0.001 ) ( table 4 ) . when symptoms and/or pulmonary function tests were added to the analysis , none of the symptoms were independent risk factors for anxiety , with living with a partner , education level ( < 8 years ) , admission to an emergency department within the last year and history of depression remaining significant .
in the present study , we found that depression and anxiety ratios were high in adults with bronchiectasis , similar to that found in previous studies.8,9 clinically significant depression was associated with living with a partner , admission to the emergency department within the last year and hemoptysis .
also , anxiety was significantly associated with living with a partner , education level ( < 8 years ) , previous depression history and admission to the emergency department within the last year . today , depression and anxiety are an important health problem in both developed and developing countries . according to data from the world health organization , the prevalence of depression ranges from 3% to 16.9%.13 despite the availability of studies on the prevalence of depression and anxiety and the related risk factors in chronic respiratory diseases , particularly in copd
, there is a limited number of studies published on the prevalence of depression and anxiety in adult patients with bronchiectasis.5,14,15 a limited number of previous studies in the literature reported a higher prevalence of depression and anxiety in bronchiectasis cases in comparison to general population.8,9 olveria et al reported depression symptoms in 12.68% and anxiety symptoms in 18% of bronchiectasis cases evaluated by the hads.9 girn moreno et al in their article published in 2013 , reported depression in 34% and trait and state anxiety in 55% of non - cystic fibrosis bronchiectasis cases .
they indicated that depressive symptoms were more prevalent in females and that anxiety was associated with the daily amount of sputum and presence of bacterial colonization in the sputum.8 in the present patient population , female gender was associated with anxiety ; however , no relationship was found between the amount of sputum and depression and anxiety . a study on patients with copd , which is also a chronic airway disease , assessed depression , anxiety , pain , and quality of life and reported more severe anxiety and depression and poorer quality of life in the female patient group.16 most of the earlier studies indicate female gender as an independent risk factor for depression and anxiety . in the present study ,
investigating the relationship between respiratory symptoms and depression and anxiety in bronchiectasis cases , we found that only hemoptysis was an independent risk factor for depression , while anxiety was not associated with any of the symptoms .
goldbeck et al found that hemoptysis and recurrent pneumothorax were associated with anxiety , whereas impaired pulmonary function tests and being a lung transplant candidate were associated with depression in 670 patients with cystic fibrosis aged between 12 and 64 years.17 hemoptysis is a common and distressing symptom in bronchiectasis cases , particularly during exacerbations .
for this reason , recurrent hemoptysis , in particular , may promote depressive mood despite the fact that we failed to determine any relationship with anxiety .
olveira et al investigated depression and anxiety symptoms and health - related quality of life in 93 bronchiectasis cases.6 in this study , age was found to be associated with both depression and anxiety .
likewise , another study reported that the prevalence of anxiety and depression increases but the quality of life decreases with age.9 this may result from the fact that the disease becomes chronic and loss of respiratory functions and comorbidities accompany the disease with aging . in the present study , however , we determined no relationship between age and depression and anxiety .
this may have resulted from a limited number of cases . in the recent study ,
olveira et al evaluated the relationship between depression / anxiety symptoms and quality of life in bronchiectasis patients.6 olveria et al determined depression symptoms in 20% and anxiety symptoms in 38% of bronchiectasis cases and found that the amount of sputum was associated with depression , whereas exacerbation was an association with anxiety . in another study by olveria et al , the number of exacerbations in the previous year was found to be higher in bronchiectasis cases with anxiety.6 in our study , the prevalence of anxiety and depression was as high as in the study by olveria et al.6 however , we questioned the number of emergency room admissions and hospital stays within the last year , but we did not ask history of exacerbations . while hospital stay was not associated with depression or anxiety , emergency room admissions within the year was determined to be an independent risk factor for anxiety and depression .
a study investigating the depression - related factors in copd , chronic airway diseases like bronchiectasis reported that emergency room admissions and hospital stay were more frequent in cases with depression but exacerbations were not significantly high.15 in the present study , patients were inquired for emergency room admissions for respiratory problems within the last year , but whether these were exact exacerbations of bronchiectasis was not investigated .
there is strong evidence that a presence of anxiety and depression in cases with chronic respiratory diseases such as bronchiectasis impairs adherence to therapy and reduces patients quality of life.9,16,18 in the present study , however , adherence to therapy or quality of life was not assessed , although we inquired the patients about their medication use .
considering particularly the fact that adherence to therapy was associated with the frequency of exacerbations and survival , identification and treatment of anxiety and depression gain more importance .
some studies have investigated the relationship between pulmonary function tests ( fev1 , fvc , and fev1/fvc ratio ) and depression and anxiety . particularly in copd ,
fev1 and fvc are considered to be the risk factors for depression.5,15 girn moreno et al conducted a study in cases with non - cystic fibrosis bronchiectasis and found no significant relationship between fev1 and depression or anxiety.8 like girn moreno et al,8 in olveira et al s study there was no relationship between fev1 and depression or anxiety in patients with bronchiectasis.9 in the study by oleary et al , no relationship was found between fev1 and hads scores.19 likewise , the present study found no relationship between fev1 , fvc , fev1/fvc and depression and anxiety .
this may be related to the limited number of cases and/or differences in the extent of disease on hrct .
living with a partner has been found as an independent risk factor for both depression and anxiety . moreover
olveira et al reported a similar result about education level.6 it is difficult to explain why living with a partner is associated with depression and anxiety .
furthermore , patients with high depression and anxiety scores were not referred to psychiatric evaluation .
in conclusion , patients with non - cystic fibrosis bronchiectasis are at increased risk for anxiety and depression . admission to an emergency department within the last year and living with a partner
also , hemoptysis was correlated with depression , and education level , previous depression history was associated to anxiety .
untreated and undetected depressive and anxiety symptoms may increase physical disability , morbidity , and health care utilization .
future research is needed to address the impact , early detection , and management of anxiety and depression from bronchiectasis . | introduction and backgroundpatients with chronic lung diseases frequently have depressive and anxiety symptoms , but there are very few studies looking at this in patients with bronchiectasis.aimthis study aimed to investigate depression and anxiety and related factors among patients with non - cystic fibrosis bronchiectasis.patients and methodsthis was a prospective study of 133 patients with bronchiectasis .
patients with confirmed diagnosis of bronchiectasis with high - resolution computed tomography were enrolled in the study .
patients that were clinically stable in the previous 4 weeks were evaluated with the hospital depression and anxiety scale .
symptoms , pulmonary function tests , and medical treatments were recorded.resultsthe mean age of patients was 49.514.5 years ( range , 1877 years ) , and 81 ( 60.9% ) patients were females .
twenty - eight ( 21.1% ) patients had depression , and 53 ( 39.8% ) had anxiety .
depression score was related to family situation ( living with a partner ) , previous depression history and admission to an emergency department within the last year .
anxiety score was related to female gender , the family situation ( living with a partner ) , previous depression history , and admission to an emergency department within the last year ( p<0.05 ) .
depression was positively correlated with hemoptysis , admission to an emergency department within the last year and living with a partner .
anxiety was positively correlated with education level , previous depression history , admission to an emergency department within the last year , and living with a partner.conclusionpatients with non - cystic fibrosis bronchiectasis are at increased risk for depression and anxiety .
untreated and undetected depressive / anxiety symptoms may increase physical disability , morbidity , and health care utilization .
it is important for clinicians to be aware of the presence of depression and anxiety in bronchiectasis . |
cardiovascular diseases ( cvd ) are the leading cause of morbidity and mortality in patients with chronic kidney disease ( ckd ) , and these people have about twenty times higher risk of cardiac death compared to people of the same sex and age without ckd ( 1 ) . some studies have shown that among older patients with ckd , traditional framingham risk factors were strongly associated with cardiovascular ( cv ) morbidity in relation to new risk factors ( 2 ) . on the other hand ,
some authors point out that with the progression of kidney disease , traditional risk factors only partly explained increased cv risk ( 3 ) .
cardiovascular and ckd are closely associated and there is expected interest in biomarkers that could predict cv morbidity and mortality ( 4 ) .
is one firmly established risk marker of cardiovascular morbidity , where c - reactive protein ( crp ) and leucocytosis are independently associated with adverse cardiovascular outcome ( 6 ) .
we should take into consideration different influences of inflammatory cytokines on renal and cardiac function in evaluation of cardio - renal syndrome ( 7 ) .
some studies suggest that cystatin c shows a stronger linear correlation with cardiovascular morbidity and mortality in comparison with serum level of creatinine ( 8) . the results of
the heart and soul study have indicated that the association of cystatin c with cardiovascular diseases may be attributed to inflammation ( 9 ) .
this included patients with gfrs of 6090 ml / min/1.73 m , a group that previously we had described as
this prospective study included 120 patients older than 18 years , examined and monitored over a period of 24 months .
thirty patients in every stage of ckd from 1 - 4 were included , wherein the stages of ckd are determined according to kdigo ( international kidney disease : improving global outcomes ) classification ( 12 ) : 30 patients in stage 1 of ckd , which is characterized by glomerular filtration rate > 90 ml / min/1.73 m and the presence of albuminuria , proteinuria or pathological urine sediment ; 30 patients in stage 2 of ckd , which is characterized by mildly decreased glomerular filtration rate of 60 - 89 ml / min/1.73 m and the presence of albuminuria , proteinuria or pathological urine sediment ; 30 patients in stage 3 of ckd with moderate reduction of glomerular filtration rate of 30 - 59 ml / min/1.73 m and 30 in stage 4 ( progressed ) of ckd with a glomerular filtration rate of 15 - 29 ml / min/1.73 m .
the research did not include : patients with acute renal failure , patients with kidney transplant , heavier mental state , patients with severe liver failure and liver cirrhosis , with malignant disease , severe infection and sepsis , with primary hematologic disease , type i diabetes , pregnant and lactating women . in the methodological approach in this research we used personal , demographic and anamnesis data , physical examination and methods of laboratory , electrocardiographic and echocardiographic diagnosis .
total cv morbidity is classified as hypertension , left ventricular hypertrophy ( lvh ) , ischemic heart disease , heart failure , arrhythmias , other vascular diseases ( cerebrovascular insult
information about heart attack and coronary revascularization , stenosis and some vascular incident ( dvt , pte ) within 6 months from the start of the research were obtained from patient s medical records .
it is thought that the patient is hypertensive if his systolic blood pressure was higher than 140 mmhg , as well as diastolic blood pressure > 90 mmhg .
the diagnosis of diabetes was based on positive anamnesis , elevated levels of blood sugar and hba1c , or based on information about taking insulin or peroral antidiabetic therapy .
electrocardiography was used for recognition of arrhythmias and acute coronary syndrome while the assessment of systolic lv weaknesses was based on echocardiographic measurement of ejection fraction ( eflv ) .
echocardiography ( ecg ) and coronary angiography were used to confirm diagnosis of ischemic coronary disease .
the research included determining the following laboratory parameters : serum creatinine , serum cystatin c , serum albumin and c - reactive protein , leukocytes in the blood , plasma fibrinogen , d - dimer , antithrombin iii , coagulation factors vii ( fc vii ) and viii ( fc viii ) .
glomerular filtration rate was calculated using mdrd formula ( modification of diet in renal disease ) , while classification of chronic renal disease was made on the basis of kdigo criteria ( 11 ) .
the study results were statistically analyzed by using descriptive statistics and student- t test , with the acceptance of statistical significance at p<0.05 .
the statistical differences in mean values between the examined groups was determined by using anova method with turkeys post hoc test for variables with normal distribution or kruskal - wallis and mann - whitney post hoc test for variables that do not have a normal distribution . for testing relation between two variables
roc ( receiver operator curve ) was used to assess the sensitivity and specificity of the observed parameters .
total cv morbidity is classified as hypertension , left ventricular hypertrophy ( lvh ) , ischemic heart disease , heart failure , arrhythmias , other vascular diseases ( cerebrovascular insult
information about heart attack and coronary revascularization , stenosis and some vascular incident ( dvt , pte ) within 6 months from the start of the research were obtained from patient s medical records .
it is thought that the patient is hypertensive if his systolic blood pressure was higher than 140 mmhg , as well as diastolic blood pressure > 90 mmhg .
the diagnosis of diabetes was based on positive anamnesis , elevated levels of blood sugar and hba1c , or based on information about taking insulin or peroral antidiabetic therapy .
electrocardiography was used for recognition of arrhythmias and acute coronary syndrome while the assessment of systolic lv weaknesses was based on echocardiographic measurement of ejection fraction ( eflv ) .
echocardiography ( ecg ) and coronary angiography were used to confirm diagnosis of ischemic coronary disease .
the research included determining the following laboratory parameters : serum creatinine , serum cystatin c , serum albumin and c - reactive protein , leukocytes in the blood , plasma fibrinogen , d - dimer , antithrombin iii , coagulation factors vii ( fc vii ) and viii ( fc viii ) .
glomerular filtration rate was calculated using mdrd formula ( modification of diet in renal disease ) , while classification of chronic renal disease was made on the basis of kdigo criteria ( 11 ) .
the study results were statistically analyzed by using descriptive statistics and student- t test , with the acceptance of statistical significance at p<0.05 . for determining normal distribution of the examined variables
the statistical differences in mean values between the examined groups was determined by using anova method with turkeys post hoc test for variables with normal distribution or kruskal - wallis and mann - whitney post hoc test for variables that do not have a normal distribution . for testing relation between two variables
roc ( receiver operator curve ) was used to assess the sensitivity and specificity of the observed parameters .
total cv morbidity is classified as hypertension , left ventricular hypertrophy ( lvh ) , ischemic heart disease , heart failure , arrhythmias , other vascular diseases ( cerebrovascular insult
information about heart attack and coronary revascularization , stenosis and some vascular incident ( dvt , pte ) within 6 months from the start of the research were obtained from patient s medical records .
it is thought that the patient is hypertensive if his systolic blood pressure was higher than 140 mmhg , as well as diastolic blood pressure > 90 mmhg .
the diagnosis of diabetes was based on positive anamnesis , elevated levels of blood sugar and hba1c , or based on information about taking insulin or peroral antidiabetic therapy .
electrocardiography was used for recognition of arrhythmias and acute coronary syndrome while the assessment of systolic lv weaknesses was based on echocardiographic measurement of ejection fraction ( eflv ) .
echocardiography ( ecg ) and coronary angiography were used to confirm diagnosis of ischemic coronary disease .
the research included determining the following laboratory parameters : serum creatinine , serum cystatin c , serum albumin and c - reactive protein , leukocytes in the blood , plasma fibrinogen , d - dimer , antithrombin iii , coagulation factors vii ( fc vii ) and viii ( fc viii ) .
glomerular filtration rate was calculated using mdrd formula ( modification of diet in renal disease ) , while classification of chronic renal disease was made on the basis of kdigo criteria ( 11 ) .
the study results were statistically analyzed by using descriptive statistics and student- t test , with the acceptance of statistical significance at p<0.05 . for determining normal distribution of the examined variables
the statistical differences in mean values between the examined groups was determined by using anova method with turkeys post hoc test for variables with normal distribution or kruskal - wallis and mann - whitney post hoc test for variables that do not have a normal distribution . for testing relation between two variables
roc ( receiver operator curve ) was used to assess the sensitivity and specificity of the observed parameters .
analysis of the correlation coefficient of relation of cystatin c value towards other variables indicates that the statistically significant positive correlation was recorded to the group , age , creatinine , fibrinogen , d - dimer , fc viii and total cardiovascular morbidity .
statistically significant negative correlation was recorded only by the values of egfr , antithrombin iii and serum albumins . the strongest correlation between cystatin c value
is achieved towards creatinine , egfr , fc viii moderately strong correlation towards cardiovascular morbidity , followed by age , fibrinogen , antithrombin iii , serum albumins and the lowest towards the d - dimer .
significant correlation of cystatin c value has not been achieved towards the number of leukocytes , crp and fc vii .
analysis of correlation coefficient of relation of egfr values towards other variables , indicates that the statistically significant negative correlation was recorded and according to age , creatinine , cystatin c , fibrinogen , coagulation factor viii and total cardiovascular morbidity .
the strongest correlation of egfr value was achieved towards serum creatinine , cystatin c , moderate towards age , fc viii , total cardiovascular morbidity and weak towards fibrinogen .
significant correlation of egfr towards leukocytes , crp , serum albumin , d - dimer , antithrombin iii , fc vii has not been achieved .
value of mean creatinine statistically significant negative correlated with egfr values , while positive correlation was confirmed towards cystatin c , fc viii and total cardiovascular morbidity .
the strongest correlation of serum creatinine value was achieved towards egfr values , cystatin c , moderate to total cardiovascular morbidity and the lowest towards fc viii .
significant correlation of serum creatinine value towards leukocytes , crp , serum albumin , d - dimer , antithrombin iii , fc vii has not been proven ( table 1 ) .
analysis of area under the roc for cystatin c , creatinine and egfr in relation to the presence of cardiovascular morbidity suggests that cystatin c has the highest sensitivity , followed by egfr and , finally , the lowest creatinine , with a statistically significant difference between cystatin c and creatinine ( p = 0.04 ) , but without statistically significant differences between cystatin c and egfr ( p > 0.05 ) ( figure 1 ) .
corelation of serum cystatin c , serum creatinine and egfr with the observed variables . *
* correlation is significant at p < 0.01 ; * correlation is significant at p < 0.05 ; rho
person s coefficient of correlation ; crp c reactive protein ; fc vii coagulation factor vii ; fc viii coagulation factor viii .
roc curve of sensitivity and specificity for cystatin c , creatinine and egfr in relation to the presence of cardiovascular morbidity notes : the area under the roc curve -auc for egfr is 0,779 ( standard error is 0,0711 , confidence interval 95% ci -0,694 to 0,849 ) vs. auc for serum creatinine of 0,736 ( 0,0581 with a standard error , confidence interval 95% ci -0,648 to 0,812 ) vs. auc for cystatine c of 0,825 ( a standard error 0,0447 , confidence interval 95%cl-0,745 to 0,889 ) .
the paper follows the relationship of renal function assessed through serum creatinine , cystatin c and egfr with inflammatory and procoagulant markers on one side and the overall cardiovascular morbidity on the other .
the connection of inflammation with disorder of renal function and increased cardiovascular morbidity and mortality is an important subject of research by many authors .
earlier studies have shown an association of ckd with elevated crp , as well as the connection of crp with cardiovascular risk in patients with esrd ( 12 ) .
relation of cv risk and inflammation in patients with milder degree of renal impairment is not sufficiently tested .
one recent study showed that inflammation estimated by measuring the levels of crp correlate with endothelial dysfunction and atherosclerotic changes in patients with ckd ( 13 ) .
cystatin c is a biomarker of renal function closely associated with the risk of cv morbidity and mortality in patients with and without ckd , as evidenced by a series of prospective studies ( 14 ) .
cystatin c may be a useful alternative to creatinine for detecting high risk of death and cvd in elderly with ckd ( 15 ) .
renal dysfunction , on one hand , and inflammatory biomarkers , on the other , are associated with increased cardiovascular risk .
particularly this connection is shown in patients with end stage of renal disease ( 16 ) .
we found the strongest correlation between cystatin c with age , fibrinogen , serum albumin , antithrombin iii , fc viii and total cardiovascular morbidity ( p<0.01 ) , as well as with d - dimer ( p<0.05 ) .
significant correlation of serum creatinine and egfr was confirmed only in relation with fc viii , overall cardiovascular morbidity ( p<0.01 ) and value of fibrinogen ( p < 0.05 ) .
it is clear that the results of the study point to significantly stronger association of cystatin c with inflammatory biomarkers and procoagulants compared to serum creatinine and renal function assessed by value of egfr .
the correlation of cystatin c is significantly stronger in relation with fibrinogen , serum albumin , antithrombin iii and d - dimer .
it would be necessary to give priority to this relationship of cystatin c with inflammation as a prognostic marker in relation to creatinine and egfr , which in practice can identify the patients of
our results confirmed that cystatin c is the highest sensitive marker for detection of presence of cv morbidity in comparison with other two parameters ( serum creatinine and egfr ) using the roc curve ( auc for cystatin c of 0.825 with a standard error 0.0447 , confidence interval 95%cl -0.745 to 0.889 ) .
this investigation also indicate that serum cystatin c compared to serum creatinine and egfr is stronger predictor of cardiovascular risk in ckd patients .
previously publised study showed that the value of cystatin c over 1.3 mg / l was strongly associated with increased cv risk ( 17 ) .
studies that have compared the cystatin c and egfr for prediction of cardiovascular risk , indicate the possibility that egfr is not sensitive enough to reflect the connection between mild renal impairment and cardiovascular risk ( 18 ) . in the multi
ethnic study of atherosclerosis , serum cystatin c was significantly associated with cardiovascular morbidity in relation to serum creatinine ( 14 ) .
one published study which included an older population of patients also showed that serum cystatin c is a stronger predictor of the risk from cardiovascular morbidity and mortality as compared to values of creatinine and egfr ( 2 ) .
correlation between cystatin c and cardiovascular outcome can be a result of other factors which also affect the level of cystatin c , independently from egfr , such as older age , hypertension , high level of crp , and together with renal function may affect level of serum cystatin c and increase cardiovascular risk ( 19 ) .
several studies also indicate how cystatin c could be a better predictor of adverse cardiovascular outcome and all causes of death rather than serum creatinine and egfr ( 20 ) .
serum cystatin c is strongly correlated with some biomarkers ( fibrinogen , serum albumin , d - dimer , antithrombin iii ) , while simultaneously shows a stronger sensitivity in relation to total cardiovascular morbidity compared with the assessment of kidney function based on serum creatinine and egfr .
cystatin c is important and strong predictor of cardiovascular risk in ckd patients stages 1 to 4 in compared to serum creatinine and egfr .
stronger correlation of cystatin c with cardiovascular morbidity and simultaneously with inflammatory markers could draw attention to finding new therapeutic options . | aim : the aim of the research was to compare the relationship between inflammatory biomarkers and procoagulants with kidney function assessed by using cystatin c , serum creatinine , and egfr and determine the sensitivity of cystatin c , serum creatinine and egfr to total cardiovascular morbidity in patients with ckd stages 1-4.methods:the research included 120 patients older than 18 years with ckd stages 1 - 4 monitored over a period of 24 months.results:serum cystatin c correlates with fibrinogen ( p<0.01 ) , serum albumin ( p<0.01 ) , d - dimer ( p<0.05 ) , antithrombin iii ( p<0.01 ) strongly in relation to the evaluation of kidney function based on serum creatinine and egfr . by following cystatin c , creatinine and egfr with comparison of roc to total cardiovascular morbidity ,
the highest sensitivity in relation to the presence of cardiovascular morbidity shows cystatin c , then egfr and the lowest , creatinine , with a significant difference between cystatin c and serum creatinine ( p<0.05).conclusion : serum cystatin c is more strongly correlated with some biomarkers ( fibrinogen , serum albumin , d - dimer , antithrombin iii ) , while simultaneously showing a stronger sensitivity in relation to total cardiovascular morbidity compared with the assessment of kidney function based on serum creatinine and egfr . |
diabetic macrovascular complications are the leading cause of death and disability causing 7080% of deaths in diabetic patients . at present , there are many theories about the pathogenesis of diabetic vascular diseases , including insulin resistance , oxidative stress , lipid metabolism disorder , and inflammation theory . according to these theories , many medications have been developed to treat diabetic vascular diseases .
however , these medications are not good enough with the limited effect or adverse effect ; therefore we used the traditional chinese medicine to treat this disease .
we have found that ddd combined with oral hypoglycemic agents significantly increases the diastolic rate of brachial artery blood flow as well as serum no expression and decreases plasma et-1 levels , therefore repairing endothelial cell injury and delaying the progress of vascular disease in diabetic patients . in another study
, we confirmed that early intervention with ddd can significantly increase the serum levels of il-4 and il-3 and reduce the expression of tnf- , mcp-1 , cd68 , and e - selectin in the aorta , thereby inhibiting the inflammatory injury and delaying the development of diabetic vascular disease in type 2 diabetic rats [ 3 , 4 ] .
this study investigated the effect ddd on the permeability of vascular endothelial cells when used early and discusses its roles in improving endothelial cell damage and its promise in the prevention of diabetic macrovascular complications .
streptozotocin ( stz ) was obtained from sigma ( usa ) ; glucometer and blood glucose test strips were obtained from accu - chek performa ; real time pcr kits were obtained from beijing cwbio co. ltd . raw ddd herbs including 6 g rhubarb ,
10 g leech , 10 g peach seed , and 10 g gadflies were purchased from the pharmacy department of the first teaching hospital of tianjin university of traditional chinese medicine . according to the traditional preparation of a water decoction
, all the herbs were boiled in water for 1 hour , 3 times ; the filtrates were collected and concentrated to 1 g / ml ( rude herbs ) under reduced pressure and then stored at 4c .
150 healthy sprague dawley ( sd ) male rats aged one month ( body weight 195.99 g 15.10 g ) were provided by the tianjin experimental animal center ( qualification certificate number scxk army 2014 - 0001 ) ; after one week of adaptive feeding , 150 sd male rats were randomly divided into control ( 20 rats ) and diabetic ( 130 rats ) groups .
the rats in the control group were feed with a normal chaw diet , whereas rats in the diabetic groups were feed with a high - fat diet .
after 12 weeks , blood from the angular vein was taken , and fasting blood glucose ( fbg ) and serum insulin ( ins ) were determined . the insulin resistance index ( isi )
was calculated by using the following steady state model evaluation method ; isi = ln[(fbg)(fins ) ] .
after the appearance of insulin resistance , all rats in the diabetic groups were injected intravenously with 30 mg / kg streptozotocin ( stz ) to induce diabetes , whereas rats in the normal control group were injected with the same dose of citric acid buffer .
diabetes was determined to be successfully established if the blood glucose level was higher than 16.7 mmol / l 3 days after stz injection .
diabetes was induced successfully in 108 rats ( 80% ) . except for rats in the ddd early - phase intervening group ,
all other diabetic rats were randomly subdivided into diabetic nonintervening , simvastatin , ddd mid - phase intervening , or ddd late - phase intervening groups .
ddd was initiated 4 weeks before diabetes was induced in the ddd early - phase intervening group .
ddd was initiated upon induction of diabetes in rats in the ddd mid - phase intervening group .
ddd was initiated 4 weeks after diabetes was induced in the ddd late - phase intervening group .
the dosage of ddd was 2.3 g/(kgd ) based on the equivalent dose for humans .
rats in the simvastatin group were administered 0.16 g/(kgd ) simvastatin calculated according to 6.3 times of the human clinical dose ; rats in the control group and the diabetic nonintervening group were given the same amount of sterile water .
the expression level of myosin light chain kinase ( mlck ) and cyclic adenosine monophosphate ( camp-1 ) of the thoracic aorta was detected using western blot analysis .
rat aortic tissue was collected , centrifuged , washed , and cleaned with a cleaning solution .
the proteins were separated by denaturation gel electrophoresis and then incubated with primary antibody ( mlck antibody dilution was 1 : 300 and loading control dilution was 1 : 1000 ; camp-1 antibody dilution was 1 : 500 and loading control dilution was 1 : 800 ) and horseradish peroxidase labeled second antibody ( dilution was 1 : 3000 ) . -actin expression was evaluated to confirm equal amounts of loading control using a mouse monoclonal anti--actin antibody .
real time pcr was used to detect mrna levels of protein kinase c ( pkc ) and protein kinase a ( pka ) .
the sequence of pcr primers is listed as follows : pkc : the length of the amplified fragment was 133 bp , upstream 5tggcaaggtcatgctctcag3 , downstream 5ggaagcaggaatggagctga3 ; pka :
the length of the amplified fragment was 80 bp , upstream 5cgtacttggaccttgtgtg3 , downstream 5cagccatctcgtagatga3. the pcr products were separated by agarose gel electrophoresis and then quantified by gel image analysis . using an abi 7500 fluorescence quantitative pcr instrument , we analyzed the relative quantitative data using the 2 method .
the expression levels of mlck and pkc of the thoracic aorta were detected by the immunohistochemical method .
the aortic endothelium of rats in experimental group and control group was fixed , encased , sliced , dewaxed , and so forth .
then the images of the positive and negative structure were collected and read under the microscope .
the ultrastructure of the endothelial cells and endothelial intercellular connection were observed under the electron microscope .
all data are expressed as the mean and the standard deviation ( mean sd ) .
the difference between the 7 groups was analyzed by the single factor analysis of variance ( anova one - way ) ; difference between two groups was analyzed by the lsd method if the homogeneity of variance was satisfied , and dunnett 's t3 method was used if the homogeneity of variance was not satisfied ; the test level was = 0.05 .
as shown in figure 2 , at 12 weeks , compared with the control group , rats in the diabetic groups had significantly higher levels of blood glucose ( p < 0.05 ) but lower levels of the insulin sensitivity index ( p < 0.05 ) . the results of blood glucose are shown in figure 3 and no significant differences were found in blood glucose levels between diabetic groups ( p > 0.05 ) . as shown in figures 1 and 4 , compared with the control group , the expression of camp-1 and pka was decreased in all diabetic groups , whereas the expression of mlck and pkc was increased ( p < 0.05 ) . compared with the t2 dm nonintervening group , the expression of camp-1 and pka was increased , but the expressions of mlck and pkc were decreased in the early- and mid - phase ddd - intervening groups ( p < 0.01 ) ; the expressions of pka , mlck , pkc , and camp-1 in the early - phase ddd - intervening group were better than those of the late - phase ddd - intervening group ( p < 0.05 ) .
as shown in figures 5 and 6 , compared with the t2 dm nonintervening group , the expression of mlck and pkc was decreased in ddd - intervening groups ( p < 0.01 ) .
compared with the late - phase ddd - intervening group , the expression of mlck and pkc was decreased in early - phase ddd - intervening group ( p < 0.05 ) .
the results of electron microscopy for the control group show a smooth cord - like connection between endothelial cells .
the connection in the early - phase ddd - intervening group and the simvastatin group was continuous and compact , significantly better than those in the other diabetic groups . in the diabetic group ,
the density of the cell membrane on both sides was decreased , the cell profile was not clear , and the nuclei were loose to different degrees .
macrovascular disease is one of the main complications of type 2 diabetes , and atherosclerosis is the main pathological change .
our previous study has found that ddd is efficient in the treatment of diabetic patients .
this study investigated the effect of early intervention with ddd on the expression of mlck , camp-1 , pkc , and pka and gene expression in vascular endothelial cells of aortas of diabetic rats , to explore the roles of ddd on the permeability of vascular endothelial cells and its relationship with the mlck signaling pathway .
the main vascular endothelial cell permeability modulation is contraction caused by the interaction of actin and myosin . when the contraction is greater than the adhesion , vascular endothelial cell permeability is increased .
mlck modulates endothelial cell permeability mainly by phosphorylating the myosin light chain ( mlc ) , which then activates the myosin heavy chain atp enzyme .
activating the atp enzyme produces the energy to enhance the interaction of myosin and actin , causing cell contraction and cell junction changes , which then leads to increased permeability [ 6 , 7 ] .
recent studies have indicated that protein kinase c ( pkc ) is involved in the regulation of mlck phosphorylation .
some studies suggest that pkc phosphorylation may change mlck activity and eventually cause mlc phosphorylation .
in addition , pkc plays a role in increasing the level of cgmp and no by the phosphorylation of s1179 in enos . the increased level of cgmp increases the level of cyclic adenosine monophosphate ( camp ) ; however , almost all the effects of camp-1 in the cell are accomplished by activating pka , which then phosphorylates its substrate protein .
it has been shown that [ 11 , 12 ] increasing the concentration of intracellular camp-1 can upregulate the activity of pka .
the pka phosphorylation site has been confirmed in mlck of endothelial cells ; therefore , camp-1 can inhibit the activity of mlck by the activation of pka and regulate vascular endothelial permeability .
studies have shown that the phosphorylation of myosin light chain induces the concentric contraction of vascular smooth muscle cells , resulting in the increased thickness of the intima of vascular smooth muscle cells and the formation of a large number of foam cells , leading to the occurrence of atherosclerosis
. therefore , mlck in arterial endothelial cells and smooth muscle cells plays a key role in the occurrence and development of diabetic macrovascular disease .
statins in addition to their lipid - lowering effect can also improve inflammation and oxidative stress , promote angiogenesis formation , improve the bioavailability of the nitric oxide ( no ) , repair the damaged vascular endothelial cells , and stabilize and reverse atherosclerotic plaque .
simvastatin is used as the positive control for diabetic vascular disease in this research because of its pleiotropic effects .
ddd originates from treatise on cold pathogenic diseases , which is mainly composed of leech , gadfly , and peach seed , and can improve blood circulation and remove obstructions in collaterals , as well as eliminate blood stasis by catharsis .
emodin has the effect of anticoagulation and promotion of blood circulation , whereas rheochrysin inhibits platelet aggregation ; both emodin and rheochrysin are in rhubarb .
the alcohol extract of peach seed has an anticlotting effect , and its glycerol trioleate has anticoagulant activity . in chinese medicine , diabetic macrovascular disease is classified as
the basic pathogenesis of this disease includes yin deficiency and hot continually thirsty and wasting , disharmony of qi and blood , fluid depletion , and blood stasis , accompanied by blood heat and blood stasis . at this stage
as the inner canon of yellow emperor ( one of the four classics of tcm ) said , when a person has beening [ sic ] feel thirsty then began to dig a well or the war has beening [ sic ] begun that the soldiers began to making weapons .
it means that something had happened but you have not prepared for it , just like the disease is serious to find a doctor .
it is too late to treat diseases such as this , so traditional chinese medicine pays more attention to the prevention of diseases and emphasizes boosting the body 's defense capabilities in the early stages of disease . here
, we comply with the principles of the prevention theory and use ddd in the early phase of diabetic macrovascular diseases to explore its improvement of the damaged tissues as well as its protective roles in exempting these tissues from further damage caused by many pathogenic factors .
we used high - fat diet followed by the small dose of stz to establish type 2 diabetic animal model in this experiment .
the high - fat diet followed by small dose of stz induced the obvious pathological changes in the blood vessel endothelium of diabetic rats .
the finding suggested that the traditional chinese medicine ddd intervention , particularly early intervention of ddd , significantly ameliorated the injury of vascular endothelium , regulated intercellular junctions of endothelial cells , changed the permeability of vascular endothelial cells , and eventually prevented vascular atherosclerosis .
further mechanisms of investigation indicated that the effect of ddd intervention is related to upregulating the expression of camp-1 and pka and downregulating the expression level of mlck and pkc .
the regulation of cell permeability of vascular endothelial cells is a complex process . in this study
, we found a significant improvement of vascular endothelial cell permeability after early intervention with ddd .
however , our study has some limitations ; we did not quantify the permeability of endothelial cell ; moreover , further studies need to address the multiple roles and mechanism of ddd in the prevention and treatment of diabetic macrovascular disease . | in the study , type 2 diabetic rat model was established using streptozotocin ( stz ) combined with a high - fat diet , and the rats were divided into control and diabetic groups .
diabetic groups were further divided into nonintervening , simvastatin , didang decoction ( ddd ) early - phase intervening , ddd mid - phase intervening , and ddd late - phase intervening groups .
the expression level of mlck was detected using western blot analysis , and the levels of cyclic adenosine monophosphate ( camp ) , protein kinase c ( pkc ) , and protein kinase a ( pka ) were examined using real time pcr . under the electron microscope ,
the cells in the early - ddd - intervention group and the simvastatin group were significantly more continuous and compact than those in the diabetic group . compared with the control group ,
the expression of camp-1 and pka was decreased in all diabetic groups , whereas the expression of mlck and pkc was increased in early- and mid - phase ddd - intervening groups ( p < 0.05 ) ; compared with the late - phase ddd - intervening group , the expression of camp-1 and pka was higher , but the level of mlck and pkc was lower in early - phase ddd - intervening group ( p < 0.05 ) . in conclusion , the early use of ddd improves the permeability of vascular endothelial cells by regulating the mlck signaling pathway . |
caries is today , regardless of familiarity of its multi causal etiology of the disease and the possibility of its effective prevention still the most widespread disease of our civilization , which affects about 95% of our population .
it covers all populations and age groups ( 1 ) , and is a disease that is very difficult to completely eradicate due to a complex interaction of biological factors , eating habits , social status , etc .
although it rarely leads to dramatic medical states as some other diseases , tooth decay may be a cause of many disorders in the body ( 3 ) . in the oral cavity due to carious destruction of tooth structure
is reduced chewing ability , because it can cause pain and insufficiently chewed food can cause disturbances in the gastrointestinal system , which over time can cause irreversible changes in the mucosa of the stomach and intestines .
sharp edges of by caries damaged teeth irritate oral soft tissue and enable the development of various diseases due to local irritation , such as gingivitis , glossitis , stomatitis and even precancerous lesion .
progression of caries to the pulp opens the door to bacterial invasion of the body and can cause various diseases such as osteomyelitis , osteitis , various forms of abscess , phlegmon , acute and chronic lymphadenitis and sepsis .
it has possibility to create a secondary disease of the skin , eyes , heart , lungs , kidneys and the joints ( 4 ) . according to the definition of the world health organization ( who ) the term caries implies local , pathological process of exogenous origin , with progressive flow of universal nature and unclear etiology ( 5 ) , but one of the best definitions , which also provides
further guidance for its effective prevention has been given by professor loesch : tooth caries is a chronic , complex bacterial infection , which results in milligram loss of minerals from the tooth , which is affected by the infection . despite multi causal etiology ,
the main factors are bacteria and eating habits , which ensure conditions for disease development and its detection ( 6 ) .
systematic examinations of children attending the first and seventh grade are carried out each year by the who recommendations and are performed in the dental clinic of primary health care center in gorazde .
the research was conducted using cross - sectional epidemiological study , also called prevalence study , so to measure the incidence of dental caries among children examined the prevalence was calculated ( % ) . included
are children who attended the first and seventh grades of primary schools in the municipality gorazde .
examinations students were carried out in the dental clinic of the primary health care center gorazde with unique access to all respondents ( 7 ) .
all data that were determined by examination were entered into a single chart , which is used during regular check - ups at the health care center ( figure 1 ) .
the data , which were entered in this chart are obtained on the basis of an objective review , which was carried out by dentists , skilled for this type of research ( 8 , 9 ) . for the analysis of caries prevalence in populations most
commonly is used dmf index ( d - decay , m - missing , f - filled ) , also called the klein - palmer index .
th is index is simple , fast and versatile diagnostic tool to assess the state of the teeth . for baby teeth
if for a statistical analysis is taken the whole tooth , then this index is marked as dmft and if only tooth surface is taken then it is called dmfs . in determining the dental status
was used visual and tactile methods of caries detection with the help of a flat dental mirrors and probes .
the teeth were used letters for baby teeth and permanent teeth numbers for the codes listed in table 2 . the basic criterion for
the presence of teeth was to have at least one active area of the studied teeth . in the case of the presence of milk and permanent teeth at the same place the presence of permanent teeth
examinations students were carried out in the dental clinic of the primary health care center gorazde with unique access to all respondents ( 7 ) .
all data that were determined by examination were entered into a single chart , which is used during regular check - ups at the health care center ( figure 1 ) .
the data , which were entered in this chart are obtained on the basis of an objective review , which was carried out by dentists , skilled for this type of research ( 8 , 9 ) .
for the analysis of caries prevalence in populations most commonly is used dmf index ( d - decay , m - missing , f - filled ) , also called the klein - palmer index . th
is index is simple , fast and versatile diagnostic tool to assess the state of the teeth . for baby teeth
if for a statistical analysis is taken the whole tooth , then this index is marked as dmft and if only tooth surface is taken then it is called dmfs . in determining the dental status
was used visual and tactile methods of caries detection with the help of a flat dental mirrors and probes .
the teeth were used letters for baby teeth and permanent teeth numbers for the codes listed in table 2 . the basic criterion for
the presence of teeth was to have at least one active area of the studied teeth . in the case of the presence of milk and permanent teeth at the same place the presence of permanent teeth
the prevalence of dental caries in children who are just enrolled in school in the municipality gorazde is extremely high , as it can be seen in the figure 2 .
dmft - index in children in the first grade in the municipality gorazde ranged from 7.93 to 9.86 . over 90% of the dmft - index
fillings of primary teeth are very scarce as structure itself , as well as value of dmft index shown in figure 3 and 4 .
dmft - index in children in the first grade in the municipality gorazde has a tendency to change the structure of dmft index in favor of repaired teeth .
also is encouraging the fact that in 2009 there was not a single extracted tooth .
caries prevalence ranging from 91.7% in 2012 to 98.15% in 2007 , which can be seen in the figure 5 . analyzing the intensity of caries in the municipality gorazde among children of seventh grade
, we came to the result that the dmft index in the period 2007 - 2012 range from 5.42 in 2012 to 6.67 in 2007 .
the largest component of dmft index is still untreated caries , although there is apparent positive trend in terms of increase in recently healed teeth .
the prevalence of dental caries in children who are just enrolled in school in the municipality gorazde is extremely high , as it can be seen in the figure 2 .
dmft - index in children in the first grade in the municipality gorazde ranged from 7.93 to 9.86 . over 90% of the dmft - index
fillings of primary teeth are very scarce as structure itself , as well as value of dmft index shown in figure 3 and 4 .
dmft - index in children in the first grade in the municipality gorazde has a tendency to change the structure of dmft index in favor of repaired teeth .
also is encouraging the fact that in 2009 there was not a single extracted tooth .
the prevalence of dental caries in children who are just enrolled in school in the municipality gorazde is extremely high , as it can be seen in the figure 2 .
dmft - index in children in the first grade in the municipality gorazde ranged from 7.93 to 9.86 . over 90% of the dmft - index makes untreated tooth caries .
fillings of primary teeth are very scarce as structure itself , as well as value of dmft index shown in figure 3 and 4 .
dmft - index in children in the first grade in the municipality gorazde has a tendency to change the structure of dmft index in favor of repaired teeth .
also is encouraging the fact that in 2009 there was not a single extracted tooth .
caries prevalence ranging from 91.7% in 2012 to 98.15% in 2007 , which can be seen in the figure 5 . analyzing the intensity of caries in the municipality gorazde among children of seventh grade
, we came to the result that the dmft index in the period 2007 - 2012 range from 5.42 in 2012 to 6.67 in 2007 .
the largest component of dmft index is still untreated caries , although there is apparent positive trend in terms of increase in recently healed teeth .
caries prevalence ranging from 91.7% in 2012 to 98.15% in 2007 , which can be seen in the figure 5 .
analyzing the intensity of caries in the municipality gorazde among children of seventh grade , we came to the result that the dmft index in the period 2007 - 2012 range from 5.42 in 2012 to 6.67 in 2007 .
the largest component of dmft index is still untreated caries , although there is apparent positive trend in terms of increase in recently healed teeth .
dmft - index in children in the first grade in the municipality gorazde during the period 2007 - 2012 ranged from 7.93 to 9.86 . in the study published in 1987
hatibovic presented the fact , that the average dmft index of six years old children in bosnia and herzegovina 6.54 , while vrbic in his study that year reported that the average dmft index of six years old in bosnia and herzegovina was 7.3 ( 10,11 ) .
kobaslija et al . in study conducted 1999 in sarajevo found that the average dmft in children at age from 5 - 7 years was 7.53 , with caries prevalence of 89.6% ( 12 ) .
selimovic - dragas in the study , which was carried out in sarajevo in 2001 listed information that the average dmft index at sex year - old children in sarajevo was 8.32 to 8.74 , depending on whether the child was born or came to live later in sarajevo ( 13 ) .
deljo in extensive research conducted in 2008 in the bosnia - podrinje canton , which center is municipality gorazde determined that the dmft index for children at first grade was 9.26 ( 14 ) .
dmft - index for five - year olds in denmark amounted to 1.0 in 2001 , in norway 1.4 for 2005 . in finland ,
56% of six years old was without any teeth with caries in 2000 ( 15 - 17 ) .
according to a study from portugal , which was published in 2003 the prevalence of dental caries in six year - old children was 46.9% and the average dmft index in this age group was 2.1 ( 18 ) . in saudi arabia , according to a study from the 2006 the caries is registered in 96% of children at the age of six , and the dmft was 8.06 ( 19 )
. in western europe , the united states , or in the developed industrial countries caries is becoming rarer ( 20,21 ) .
the main reasons for the reduction in the prevalence of dental caries and periodontal diseases are conducting systematic school - based prevention programs and health education programs , then mass and continuous application of fluoride , improved oral hygiene , more sensitive approach to the consumption of sugar , as well as changes in lifestyle and living conditions ( 22,23 ) . in finland , there were 56% of six years old children without any teeth caries in 2000 , while the dmft for this age group was 0.2 , while the value of dmft index in seven year old in norway amounted to 0.1 ( 15 - 17 ) .
dmft in children of seventh grade ranged from 5.42 in the 2012 to 6.67 in 2007 .
these values do not differ much from the values from vrbic study , which was conducted in 1986 , where it was found that the dmf index was 6.3 ( 10 ) .
hatibovic in 1987 found that the average dmf index at twelve years old in bosnia and herzegovina is 6.15 ( 11 ) .
ivankovic in his research from 2003 determined value of dmf index of 6.2 with the prevalence of caries of 94% ( 24 ) .
sulejmanagic et al ( 2000 ) presented data that the dmf index at twelve years old in bosnia and herzegovina was 6.10 ( 25 ) .
deljo in his research from 2008 determined dmft index in children of seventh grade at 5.84 ( 26 ) .
something better oral health is determined in 2008 by muratbegovic in his research from the entire territory of bosnia and herzegovina , and is registered dmft - index for b&h of 4.16 for twelve years old , with a prevalence of 91% teeth aff ected by caries ( 27 ) .
worse values of dmf index of 7.9 and prevalence of caries of 98.25% were recorded in montenegro , but much better value is registered in italy : dmf index 1.09 and caries prevalence of 43.1% ( 28,29 ) . for the twelve years old in portugal dmft was 1.5 and the prevalence of caries was 52.9% ( 17 ) .
there are many reasons for such a poor state of oral health in bosnia - podrinje canton .
the first reason is the low level of knowledge among parents about oral health , especially in the primary dentition , and rare are parents which bring the child to the dental clinic before the onset of acute symptoms .
a large number of parents do not know that the sixes are permanent teeth , or why baby teeth are important and need to be brushed regularly .
one important reason is the insufficient amount of fluorine , which is introduced into the body , because the natural water in bosnia and herzegovina is deficient in fluoride .
probable cause may be a lack of prevention programs , which can be implemented in early childhood and the lack of preschool dental clinics . in bosnia - podrinje canton
there is nt a single specialist pediatric dentists but with children are working polyvalent dentists , who , due to the volume of work preferred permanent dentition , and to the primary teeth are not given special attention .
based on the results of this epidemiological study and comparison with similar studies it can be concluded that in the area of bosnia - podrinje canton oral health is a major health and social problem .
this finding is in some way are warning alarm for the health care system but also for the whole society . improving oral health and dental health
can only be achieved if the programs for the promotion of oral health and disease prevention are implemented at the community , region or state level . to lead to improvement of oral health
it is necessary to find effective modes for solving problems related to oral health , putting emphasis on the organization of primary health care system and the introduction of measures and prevention programs that will provide optimal results in the future period .
since the state of oral health in bosnia - podrinje canton is really poor , it is necessary as soon as possible to introduce into practice a preventive program for children aged up to 15 years , which would in the near future give positive results .
then it is necessary the involvement of all sectors of health and education in the prevention of oral diseases and risk factors for oral diseases , as well as wider use of the mass media in order to improve and strengthen individual awareness about the importance of oral health .
| introduction : dental caries today , regardless of known multi causal etiology of the disease and the possibility of its effective prevention still represents the most widespread disease of our civilization , which affects about 95% of our population .
it affects all populations and age groups and is a disease that is very difficult to completely eradicate due to a complex interaction of biological factors , eating habits , social status etc.goal:goal is to report the prevalence of dental caries , dmft - index and dmft index in the first and seventh grades of grammar school in the municipality gorazde during the last six years.material and methods : children , which have yet to enroll in school and in the seventh grade children , have required medical examinations . a total of 1198 first grade and 1666 seventh - grade students are included . to determine the prevalence of dental caries dmft was used .
examinations are carried out in accordance with the methodology and criteria of the who , by a dental mirror and dental probe.results:the prevalence of dental caries is extremely high as well as the values of dmft index in the first and seventh grades in the municipality gorazde.conclusion:in practice it is necessary to introduce prevention programs for pregnant women , toddlers , preschool and school - aged children with a wider use of the mass media . |
one of the most common causes of pain in patients with malignant disease is cancer - induced bone pain ( cibp ) , affecting patients with primary bone sarcomas and those with bone metastases .
the pain consists of a triad of states ; background pain , spontaneous pain , and movement - induced ( incident ) pain .
current interventions including antiinflammatory drugs , opioids , bisphosphonates and radiation are often effective in controlling tonic pain , but not incident pain , calling for new therapeutic methods to be developed .
bone remodeling and its homeostasis are delicately maintained via bone resorption by osteoclasts and bone formation by osteoblasts .
it is suggested that bone destruction caused by unbalanced osteoclastogenesis in the tumor bone microenvironment could be a major reason for cibp . besides the classic antiresorptive agent bisphosphonate , other therapies targeting osteoclasts are also under extensive investigation for alleviating tumor - induced bone remodeling .
it is proven that the receptor activator of nuclear factor - kappab ligand ( rankl ) is the main driver of osteoclast formation , function , and survival .
sequestration of rankl with opg attenuates cibp , bone remodeling , and tumor growth within the bone .
moreover , currently phase iii trials have already been completed and have proven that denosumab , a humanized rankl monoclonal antibody , can effectively reduce bone absorption and skeletal - related events , including cibp .
calpains are a family of calcium - dependent intracellular cysteine protease that catalyze the limited cleavage of specific proteins during regulatory signaling .
they play a major role in various cellular processes , such as signal transduction , cell growth , differentiation and fusion , apoptosis , necrosis , etc . among them , -calpain is known to degrade various substrates , particularly ib , c - jun , and c - fos , all of which are essential molecular players in osteoclastogenesis . our previous study has already shown that a calpain inhibitor can significantly attenuate rankl - induced osteoclastogenesis in murine raw264.7 cells in vitro . therefore , calpain might play a pivotal role in the regulation of osteoclastogenesis
. however , whether such an effect exists in an in vivo animal model and its mechanisms are yet to be tested .
the aim of this study was to determine the efficacy of a calpain inhibitor on bone resorption and behavioral responses to pain in vivo in intratibial tumor injected cibp rats .
all experiments were performed in accordance with the national institutes of health guide for the care and use of laboratory animals and the ethical issues of the iasp and were approved by the chinese academy of medical sciences / peking union medical college hospital committee on animal care .
adult male sprague - dawley rats ( 240270 g ) used for the study were housed under a 12-h light / dark cycle in a pathogen - free area with ad libitum access to water and food .
walker 256 breast cancer cells were kindly provided by the department pharmacology , institute of pharmacology of chinese academy of medical sciences .
briefly , anesthesia was induced and maintained via a nose cone with halothane ( 1.52.0% ) . the right hind leg was shaved and disinfected with 70% ( v / v ) ethanol .
the medullary canal of the tibia was approached from a 1-cm long skin incision , by inserting a 23-gauge needle through a drilled hole .
a 10-l volume of walker 256 cells ( 5 10 cells ) was injected into the bone cavity .
the hole was sealed using bone wax , and the wound was irrigated with gentamicin saline and was closed with 10 silk threads .
the rats were allowed unrestricted movement in their cages after recovery and carefully monitored . immediately after the operation , calpain inhibitor iii ( mdl 28170 , calbiochem merck , darmstadt , germany ) dissolved in 0.1% dimethyl sulfoxide ( dsmo ) was given at 1 mg / kg ( in a volume of 8 ml / kg body weight ) intraperitoneally for the inhibitor group , and 0.1% dsmo solution only was given at 10 ml / kg to the vehicle group .
rats were divided into seven groups : ( 1 ) sarcoma group ( n = 9 ) : received intratibial injection of walker 256 cells ; ( 2 ) sarcoma + inhibitor group ( n = 9 ) : received intratibial injection of walker 256 cells and intraperitoneal injection of calpain inhibitor iii every day postoperatively ; ( 3 ) sarcoma + vehicle group ( n = 9 ) : received intratibial injection of walker 256 cells and intraperitoneal injection of 0.1% dsmo every day postoperatively ; ( 4 ) sham group ( n = 9 ) : received intratibial injection of saline ; ( 5 ) sham + inhibitor group ( n = 9 ) : received intratibial injection of saline and intraperitoneal injection of calpain inhibitor iii every day postoperatively ; ( 6 ) sham + vehicle group ( n = 9 ) : received intratibial injection of saline and intraperitoneal injection of 0.1% dsmo every day postoperatively ; ( 7 ) nave group ( n = 9 ) : no inoculation and no treatment .
behavioral signs of mechanical hyperalgesia and cold allodynia were assessed preoperatively and on postoperative days ( pods ) 2 , 5 , 8 , 11 and 14 .
mechanical sensitivity was assessed by application of four von frey filaments with increasing bending forces of 1 , 5 , 9 , and 15 g ( electronic von frey anesthesiometer ; iitc , woodland hills , ca , usa ) .
the nociceptive stimulus was applied perpendicularly to the medial surface of the hind paw with increasing forces .
the endpoint was taken as nocifensive paw withdrawal accompanied by head turning , biting and/or licking , and the required pressure was considered the mechanical withdrawal threshold ( mwt ) value .
bilateral hind paws of each rat were tested in triplicate at each time point , and the average for the three measurements was then calculated .
cold allodynia was assessed by five applications of 100 l of acetone to the plantar surface of the hind paw . as with mechanical testing ,
this was carried out on bilateral hind paws , with each application separated by at least 5 min .
the number of lifts observed of the maximum total of five was expressed as percentage response .
bone powder was used to measure calpain activity using a calpain activity assay kit ( biovision , mountain view , ca , usa ) .
then the bone powder was lysed with extraction buffer in the kit on ice for 30 min .
tissue lysates were centrifuged at 12,000 g at 4c for 15 min , and the supernatants were collected .
after quantification of protein in the supernatant with the biobarcode assay kit ( qcbio s and t , beijing , china ) , 100 g of protein was used for the calpain activity assay with ac - lly - afc , a fluorescent calpain substrate , in an all - dark fluorescent microplate at 37c for 1 h. the samples were read in a fluorometer equipped with 400 nm excitation and 505 nm emission filters .
tissue sections were then fixed with a solution of formaldehyde , acetone and citrate for 30 s , and incubated for 40 min at 37c in a staining solution provided in the tartrate - resistant acid phosphatase ( trap ) staining kit ( sigma - aldrich , st .
trap - positive cells with three or more nuclei were counted as multinucleated osteoclasts under 40 light microscope .
the extent of sarcoma induced bone destruction was examined by x - ray assessment of bilateral hind paws of anesthetized rats on pod 14 .
the conditions of x - ray exposure were 56 kv , 200 ma , and 20 ms . according to the bone destruction standard reported by honore et al .
, radiographs of tumor - bearing tibia revealed loss of bone that was quantified on a 05 scale : 0 normal bone ; 1 13 spotted bone resorption sites ; 2 46 spotted bone resorption sites with minor loss of bone in the medullary canal ; 3 substantial loss of bone in the medullary canal with some destruction of the distal cortical bone ; 4 total destruction and discontinuity of cortical bone ; 5 total destruction and discontinuity of cortical bone with displaced fractures .
the scale of the bilateral tibia bone of each group was examined and recorded by the same investigator .
data are presented as mean standard deviation unless otherwise stated . for quantitative data ,
differences between treated and control groups were analyzed with one - way anova test using the statistical package for the social sciences ( spss ) software ( version 17.0 , spss inc .
adult male sprague - dawley rats ( 240270 g ) used for the study were housed under a 12-h light / dark cycle in a pathogen - free area with ad libitum access to water and food .
walker 256 breast cancer cells were kindly provided by the department pharmacology , institute of pharmacology of chinese academy of medical sciences .
briefly , anesthesia was induced and maintained via a nose cone with halothane ( 1.52.0% ) . the right hind leg was shaved and disinfected with 70% ( v / v ) ethanol .
the medullary canal of the tibia was approached from a 1-cm long skin incision , by inserting a 23-gauge needle through a drilled hole . a 10-l volume of walker 256 cells ( 5 10 cells )
the hole was sealed using bone wax , and the wound was irrigated with gentamicin saline and was closed with 10 silk threads .
immediately after the operation , calpain inhibitor iii ( mdl 28170 , calbiochem merck , darmstadt , germany ) dissolved in 0.1% dimethyl sulfoxide ( dsmo ) was given at 1 mg / kg ( in a volume of 8 ml / kg body weight ) intraperitoneally for the inhibitor group , and 0.1% dsmo solution only was given at 10 ml / kg to the vehicle group .
rats were divided into seven groups : ( 1 ) sarcoma group ( n = 9 ) : received intratibial injection of walker 256 cells ; ( 2 ) sarcoma + inhibitor group ( n = 9 ) : received intratibial injection of walker 256 cells and intraperitoneal injection of calpain inhibitor iii every day postoperatively ; ( 3 ) sarcoma + vehicle group ( n = 9 ) : received intratibial injection of walker 256 cells and intraperitoneal injection of 0.1% dsmo every day postoperatively ; ( 4 ) sham group ( n = 9 ) : received intratibial injection of saline ; ( 5 ) sham + inhibitor group ( n = 9 ) : received intratibial injection of saline and intraperitoneal injection of calpain inhibitor iii every day postoperatively ; ( 6 ) sham + vehicle group ( n = 9 ) : received intratibial injection of saline and intraperitoneal injection of 0.1% dsmo every day postoperatively ; ( 7 ) nave group ( n = 9 ) : no inoculation and no treatment .
behavioral signs of mechanical hyperalgesia and cold allodynia were assessed preoperatively and on postoperative days ( pods ) 2 , 5 , 8 , 11 and 14 .
mechanical sensitivity was assessed by application of four von frey filaments with increasing bending forces of 1 , 5 , 9 , and 15 g ( electronic von frey anesthesiometer ; iitc , woodland hills , ca , usa ) .
the nociceptive stimulus was applied perpendicularly to the medial surface of the hind paw with increasing forces .
the endpoint was taken as nocifensive paw withdrawal accompanied by head turning , biting and/or licking , and the required pressure was considered the mechanical withdrawal threshold ( mwt ) value .
bilateral hind paws of each rat were tested in triplicate at each time point , and the average for the three measurements was then calculated .
cold allodynia was assessed by five applications of 100 l of acetone to the plantar surface of the hind paw . as with mechanical testing ,
this was carried out on bilateral hind paws , with each application separated by at least 5 min .
the number of lifts observed of the maximum total of five was expressed as percentage response .
bone powder was used to measure calpain activity using a calpain activity assay kit ( biovision , mountain view , ca , usa ) .
then the bone powder was lysed with extraction buffer in the kit on ice for 30 min .
tissue lysates were centrifuged at 12,000 g at 4c for 15 min , and the supernatants were collected .
after quantification of protein in the supernatant with the biobarcode assay kit ( qcbio s and t , beijing , china ) , 100 g of protein was used for the calpain activity assay with ac - lly - afc , a fluorescent calpain substrate , in an all - dark fluorescent microplate at 37c for 1 h. the samples were read in a fluorometer equipped with 400 nm excitation and 505 nm emission filters .
tissue sections were then fixed with a solution of formaldehyde , acetone and citrate for 30 s , and incubated for 40 min at 37c in a staining solution provided in the tartrate - resistant acid phosphatase ( trap ) staining kit ( sigma - aldrich , st .
trap - positive cells with three or more nuclei were counted as multinucleated osteoclasts under 40 light microscope .
the extent of sarcoma induced bone destruction was examined by x - ray assessment of bilateral hind paws of anesthetized rats on pod 14 .
the conditions of x - ray exposure were 56 kv , 200 ma , and 20 ms . according to the bone destruction standard reported by honore et al .
, radiographs of tumor - bearing tibia revealed loss of bone that was quantified on a 05 scale : 0 normal bone ; 1 13 spotted bone resorption sites ; 2 46 spotted bone resorption sites with minor loss of bone in the medullary canal ; 3 substantial loss of bone in the medullary canal with some destruction of the distal cortical bone ; 4 total destruction and discontinuity of cortical bone ; 5 total destruction and discontinuity of cortical bone with displaced fractures .
the scale of the bilateral tibia bone of each group was examined and recorded by the same investigator .
data are presented as mean standard deviation unless otherwise stated . for quantitative data ,
differences between treated and control groups were analyzed with one - way anova test using the statistical package for the social sciences ( spss ) software ( version 17.0 , spss inc . , usa ) . for semi - quantitative data ,
whether calpain activity was inhibited after intraperitoneal injection of calpain inhibitor in the established cibp model was essential to this study .
therefore , total protein of the tumor injected tibia was extracted , and calpain activity was measured in all groups .
the results showed that the calpain activity in the sarcoma + inhibitor group and sham + inhibitor group were significantly decreased compared with the other groups ( p < 0.05 ) [ figure 1 ] , providing the foundation for further explaining the effect of calpain inhibition .
* p < 0.05 for both sham + inhibitor group and sarcoma + inhibitor group versus nave group . since activated osteoclastogenesis is one of the reasons for cibp , the effect of calpain inhibitor on the pain behavioral level in vivo was tested . after establishing the rat cibp model , the mwts of both the tumor injected side and the contralateral side hind paws of all groups
were recorded before surgery and on pod 2 , 5 , 8 , 11 and 14 . for the surgical side , after calpain inhibition , the mwt of the sarcoma + inhibitor group recovered and was significantly higher than that of the sarcoma + vehicle group on pod 5 , 8 and 11 ( p < 0.05 ) , but it was not normalized to the level of the nave group ( p < 0.05 ) [ figure 2a ] .
the mwt of the sarcoma + inhibitor group was also increased compared with the sarcoma + vehicle group ( p < 0.05 ) but was still lower than the nave group on pod 8 , 11 and 14 ( p < 0.05 ) [ figure 2b ] .
the behavioral score of cold allodynia was also examined on bilateral hind paws . however , there was no difference between the sarcoma + inhibitor group and the sarcoma + vehicle group from pod 2 to 14 ( results not shown ) . mechanical withdrawal threshold of surgical side ( a ) and nonsurgical side ( b ) hind paws of each group . * p < 0.05 for sarcoma + inhibitor versus nave .
p < 0.05 for sarcoma + inhibitor versus sarcoma + vehicle . to determine whether the calpain inhibitor can suppress ranl - induced osteoclastogenesis in vivo
the results of the sarcoma group and sarcoma + vehicle group clearly showed more fused multi - nucleated cells , meaning the osteoclastogenesis process was activated after tumor injection [ figure 3a ] . however , after calpain inhibition , the trap - positive cell count was significantly decreased in the sarcoma + inhibitor group comparing with the sarcoma + vehicle group ( p < 0.05 ) [ figure 3b ] , indicating that the osteoclastogenesis process could be blocked with calpain inhibitor in vivo in the cibp rats . ( a )
tartrate - resistant acid phosphatase ( trap ) stain of matured osteoclasts in tumor bone site ( left : original magnification , 100 , right : original magnification , 200 ) ; ( b ) trap positive cell count in tumor injected tibia bone of each group . * p < 0.05 for sarcoma + inhibitor versus nave .
p < 0.05 for sarcoma + inhibitor versus sarcoma + vehicle . on pod 14 , cibp rats of all groups were subjected to the radiology assessment . as shown in the tibia x - ray radiographs in figure 4a , the tibia bones of the sarcoma groups , including the sarcoma , sarcoma + inhibitor and sarcoma + vehicle groups , exhibited pathological bone characteristics such as high density mass or low density defects in the bone and cortical bone discontinuity .
on the contrary , tibia bones of the sham group , nave group , and nonsurgical side legs of all groups appeared normal .
after examining the scale of the radiographs , the sarcoma groups had higher scores than the nave group and a sham group ( p < 0.01 ) [ figure 4b ] .
however , there was no significant difference between the sarcoma + inhibitor group and sarcoma + vehicle group , indicating no anti - bone destruction effect of calpain inhibition in cibp rats in vivo .
a1 : normal bone ; a2 : spotted bone resorption sites ; a3 : loss of bone in medullary canal with destruction of distal cortical bone ; a4 : total destruction and discontinuity of cortical bone ; a5 : non - surgical side hind paw ; ( b ) radiology scale of surgical side hind paws .
whether calpain activity was inhibited after intraperitoneal injection of calpain inhibitor in the established cibp model was essential to this study .
therefore , total protein of the tumor injected tibia was extracted , and calpain activity was measured in all groups .
the results showed that the calpain activity in the sarcoma + inhibitor group and sham + inhibitor group were significantly decreased compared with the other groups ( p < 0.05 ) [ figure 1 ] , providing the foundation for further explaining the effect of calpain inhibition .
* p < 0.05 for both sham + inhibitor group and sarcoma + inhibitor group versus nave group .
since activated osteoclastogenesis is one of the reasons for cibp , the effect of calpain inhibitor on the pain behavioral level in vivo was tested . after establishing the rat cibp model , the mwts of both the tumor injected side and
the contralateral side hind paws of all groups were recorded before surgery and on pod 2 , 5 , 8 , 11 and 14 . for the surgical side ,
after calpain inhibition , the mwt of the sarcoma + inhibitor group recovered and was significantly higher than that of the sarcoma + vehicle group on pod 5 , 8 and 11 ( p < 0.05 ) , but it was not normalized to the level of the nave group ( p < 0.05 ) [ figure 2a ] .
the mwt of the sarcoma + inhibitor group was also increased compared with the sarcoma + vehicle group ( p < 0.05 ) but was still lower than the nave group on pod 8 , 11 and 14 ( p < 0.05 ) [ figure 2b ] .
the behavioral score of cold allodynia was also examined on bilateral hind paws . however , there was no difference between the sarcoma + inhibitor group and the sarcoma + vehicle group from pod 2 to 14 ( results not shown ) . mechanical withdrawal threshold of surgical side ( a ) and nonsurgical side ( b ) hind paws of each group . * p < 0.05 for sarcoma + inhibitor versus nave .
to determine whether the calpain inhibitor can suppress ranl - induced osteoclastogenesis in vivo , the tibia bone tissue of all groups were subjected to trap staining .
the results of the sarcoma group and sarcoma + vehicle group clearly showed more fused multi - nucleated cells , meaning the osteoclastogenesis process was activated after tumor injection [ figure 3a ] . however , after calpain inhibition , the trap - positive cell count was significantly decreased in the sarcoma + inhibitor group comparing with the sarcoma + vehicle group ( p < 0.05 ) [ figure 3b ] , indicating that the osteoclastogenesis process could be blocked with calpain inhibitor in vivo in the cibp rats .
( a ) tartrate - resistant acid phosphatase ( trap ) stain of matured osteoclasts in tumor bone site ( left : original magnification , 100 , right : original magnification , 200 ) ; ( b ) trap positive cell count in tumor injected tibia bone of each group . * p < 0.05 for sarcoma + inhibitor versus nave .
on pod 14 , cibp rats of all groups were subjected to the radiology assessment . as shown in the tibia x - ray radiographs in figure 4a , the tibia bones of the sarcoma groups , including the sarcoma , sarcoma + inhibitor and sarcoma + vehicle groups , exhibited pathological bone characteristics such as high density mass or low density defects in the bone and cortical bone discontinuity . on the contrary
, tibia bones of the sham group , nave group , and nonsurgical side legs of all groups appeared normal .
after examining the scale of the radiographs , the sarcoma groups had higher scores than the nave group and a sham group ( p < 0.01 ) [ figure 4b ] .
however , there was no significant difference between the sarcoma + inhibitor group and sarcoma + vehicle group , indicating no anti - bone destruction effect of calpain inhibition in cibp rats in vivo .
radiographs and radiology scale of surgical side tibia of each group . ( a ) radiographs of different levels of bone destruction .
a1 : normal bone ; a2 : spotted bone resorption sites ; a3 : loss of bone in medullary canal with destruction of distal cortical bone ; a4 : total destruction and discontinuity of cortical bone ; a5 : non - surgical side hind paw ; ( b ) radiology scale of surgical side hind paws .
this study shows that the calpain inhibitor can alleviate mechanical hyperalgesia of bilateral hind paws determined by mwt testing in cibp rats in vivo
. this might be mainly due to the suppression of the osteoclastogenesis process in the tumor bone microenvironment proved by the significant decrease of the trap - positive cell count .
since ib is one of calpain 's hydrolysis substrates and also the inhibitor of nuclear factor - kappab ( nf-b ) , the suppressed osteoclastogenesis after calpain inhibition could be due to the reduction of ib hydrolysis , leading to the inhibition of rankl - induced nf-b activation , as proved by lee et al .
similar with our previous in vitro study , trap - positive cells in the tibia were significantly decreased after calpain inhibition , indicating that the osteoclastogenesis process can also be interfered with by a calpain inhibitor in vivo . however , after the radiology assessment , there was no statistical significance demonstrated of the bone resorption between the calpain inhibitor group and the control group , which was contrary to the existing evidence .
the reason for metastatic bone resorption is that tumor cells destroy the balance between osteoblasts and osteoclasts by alteration of the microenvironment .
several human clinical trials have already proven that anti - rankl antibody can reduce metastatic cancer induced bone resorption through inhibition of the rank / rankl / opg pathway .
the result of this study could be attributable to the fact that tumor bone destruction was too serious for the amount of calpain inhibitor we used to take effect , or that the x - ray radiology measurement was not sensitive enough to detect the already decreased bone resorption .
the dosage of calpain inhibitor iii , 1 mg / kg , administered in the present study was set according to the previous research by yu and geddes , who investigated the same agent in a rat spinal cord injury model .
unfortunately , this is among the very few studies that have ever explored the effect of a calpain inhibitor in pain studies in vivo . until date , there has not been any study that reported focusing on the cibp model and osteoclastogenesis , therefore , we had very few references to consult . whether an increased dosage of calpain inhibitor or a more sensitive method , such as mri analysis , is effective can be addressed in future studies .
our study also showed that the mwts of not only the surgical side but also the nonsurgical side hind paws were decreased after bone cancer induction in the sarcoma groups . since the nonsurgical side hind paws did not exhibit signs of bone resorption under radiology testing , bone cancer metastasis was not the reason .
therefore , bilateral hyperalgesia , or mirror - image pain , was revealed in cibp rats .
suggested that trans - median sprouting of the commissural interneurons present in the spinal cord and brainstem could be the reason , whereas milligan et al .
believed that mirror - image allodynia is created through glial and proinflammatory cytokine actions . aside from the cibp models , mirror - image pain can be seen in many types of neuropathic pain models .
several classic neuropathic pain indicators , such as spinal microglial cell activation and up - regulation of postsynaptic receptor proteins in dorsal root ( dr ) ganglion , were proven to exist in cibp models .
moreover , donovan - rodriguez et al . reported that gabapentin , the well - accepted neuropathic pain inhibitor , can normalize cibp induced dorsal horn neuronal changes and attenuated pain behavior .
therefore , it is consistent with the fact that cibp has a neuropathic pain component .
interestingly , our study demonstrates that a calpain inhibitor can also ameliorate mirror - image pain through increase of mwt of the nonsurgical side hind paws in cibp rats , suggesting that calpain might somehow be involved in the neuropathic pain mechanism .
reported that a calpain inhibitor significantly blocked nerve injury - induced myelin - associated glycoprotein down - regulation in spinal dr and lysophosphatidic acid - induced neuropathic pain .
however , there are still very few studies focused on the mechanism of calpain and neuropathic pain . | background : calpain , a calcium - dependent cysteine protease , has been demonstrated to regulate osteoclastogenesis , which is considered one of the major reasons for cancer - induced bone pain ( cibp ) . in the present study ,
calpain inhibitor was applied in a rat cibp model to determine whether it could reduce cibp through regulation of osteoclastogenesis activity.methods:a rat cibp model was established with intratibial injection of walker 256 cells .
then , the efficacy of intraperitoneal administered calpain inhibitor iii ( mdl28170 , 1 mg / kg ) on mechanical withdrawal threshold ( mwt ) of bilateral hind paws was examined on postoperative days ( pods ) 2 , 5 , 8 , 11 , and 14 . on pod 14 , the calpain inhibitor 's effect on tumor bone tartrate - resistant acid phosphatase ( trap ) stain and radiology was also carefully investigated.results:pain behavioral tests in rats showed that the calpain inhibitor effectively attenuated mwts of both the surgical side and contralateral side hind paws on pod 5 , 8 , and 11 ( p < 0.05 ) .
trap - positive cell count of the surgical side bone was significantly decreased in the calpain inhibitor group compared with the vehicle group ( p < 0.05 )
. however , bone resorption and destruction measured by radiographs showed no difference between the two groups.conclusions:calpain inhibitor can effectively reduce cibp of both the surgical side and nonsurgical side after tumor injection in a rat cibp model .
it may be due to the inhibition of receptor activator of nuclear factor - kappa b ligand - induced osteoclastogenesis . whether a calpain inhibitor could be a novel therapeutic target to treat cibp
needs further investigation . |
to detect the expression of hsp25 in rat dental follicles both in vivo and vitro , and explore the underlying mechanism of hsp25 on the proliferation and differentiation of rat dental follicle cells ( dfcs ) .
immunohistochemistry was performed to detect the expression of hsp25 in mandibles of postnatal rats on days 1 , 3 , 5 , 7 , 9 and 11 in vivo . in vitro ,
thiazolyl blue tetrazolium bromide ( mtt ) assay , flow cytometry and alkaline phosphatase ( alp ) assay were used to identify the time - course effect mediated by different concentrations of recombinant murine hsp25 of 0 , 1 , 10 , 50 and 100 ng / ml on rat dfcs .
expression of hsp25 was not detected in dental follicles of the rats until day 5 after birth , but became up - regulated in a time - dependent manner till day 11 .
no significant difference could be observed in the proliferation of dfcs after stimulation with different concentrations of hsp25 on days 1 , 2 and 3 ( p>0.05 ) .
hsp25 at concentrations of 50 ng / ml and 100 ng / ml up - regulated the alp activity of dfcs on day 9 ( p<0.05 ) .
hsp25-immunoreactivity increased chronologically during the development of dental follicles . the protein had no significant effect on cell proliferation but may play a role in cementoblast / osteoblast differentiation of dfcs . | aimto detect the expression of hsp25 in rat dental follicles both in vivo and vitro , and explore the underlying mechanism of hsp25 on the proliferation and differentiation of rat dental follicle cells ( dfcs).methodologyimmunohistochemistry was performed to detect the expression of hsp25 in mandibles of postnatal rats on days 1 , 3 , 5 , 7 , 9 and 11 in vivo . in vitro ,
the expression of hsp25 in dfcs was detected by an indirect immunofluorescence assay .
thiazolyl blue tetrazolium bromide ( mtt ) assay , flow cytometry and alkaline phosphatase ( alp ) assay were used to identify the time - course effect mediated by different concentrations of recombinant murine hsp25 of 0 , 1 , 10 , 50 and 100 ng / ml on rat dfcs.resultsexpression of hsp25 was not detected in dental follicles of the rats until day 5 after birth , but became up - regulated in a time - dependent manner till day 11 .
hsp25 was detected in the cytoplasm of cultured rat dfcs .
no significant difference could be observed in the proliferation of dfcs after stimulation with different concentrations of hsp25 on days 1 , 2 and 3 ( p>0.05 ) .
hsp25 at concentrations of 50 ng / ml and 100 ng / ml up - regulated the alp activity of dfcs on day 9 ( p<0.05).conclusionhsp25-immunoreactivity increased chronologically during the development of dental follicles . the protein had no significant effect on cell proliferation but may play a role in cementoblast / osteoblast differentiation of dfcs . |
lung cancer is one of the most frequent cancers and the leading cause of cancer - related mortality in denmark and worldwide.1 on a global basis approximately 1.6 million people are afflicted by lung cancer annually1 and the 5-year survival rate is less than 15%.24 lung cancer is associated with high age and presence of comorbidity5 and , in denmark , the median age at diagnosis is 69 years , with the prevalence of comorbidity in lung cancer patients at about 50%.6 smoking is a likely explanation to much of the association between comorbidity and lung cancer,7 as smoking causes the majority of lung cancer cases8 and is also associated with a range of comorbid conditions such as chronic obstructive pulmonary disease ( copd)9 and cardiovascular disease .
the prognosis for lung cancer patients depends on age , cancer stage , sex , and level of comorbidity.1013 the impact of comorbidity on lung cancer survival has been studied across different populations and cancer stages.2,5,11,14,15 these cohort studies found mortality hazard ratios ( hrs ) ranging from 1.3 to 1.5 in patients with comorbidity and suggested that the increased mortality was due to poorer outcome after surgery.2,15,16 however , other studies have claimed that comorbidity is of minor importance because of the dismal prognosis for lung cancer patients per se.17,18 it is also unclear whether the impact of comorbidity on lung cancer survival is a constant property or if the association has changed over time . in denmark , a number of nationwide clinical quality programs to improve cancer survival have been introduced since 2000 . the national cancer plan which focuses on cancer prevention , early detection , and improved treatment
the national integrated cancer pathways , allowing fast , structured , and uniform work - up and initiation of treatment for all patients with suspected cancer in the public health care system was implemented in 2009.20 moreover , the proportion of patients who received adjuvant chemotherapy after resections or platinum - based chemotherapy for stage iii and iv lung cancer increased from 10% in 2003 to 31% in 2011.21 thus , time - trends in lung cancer survival during this period are highly relevant . in this context , we examined overall survival in danish lung cancer patients from 2000 through 2011 and stratified the analysis by age , sex , and level of comorbidity .
we conducted this population - based cohort study in the central denmark region with a population of approximately 1.3 million citizens .
the danish national health service provides universal , tax - supported health care , guaranteeing unconstrained access to general practitioners and hospitals .
accurate and unambiguous individual - level linkage of all registries is enabled by means of the unique personal identifier issued by the danish civil registration system to all danish citizens at birth or emigration .
this registry also records the exact date of death or emigration for all danish citizens and is continuously updated .
the danish national registry of patients ( dnrp ) contains information on all discharges from non - psychiatric hospitals in denmark since 1977 , and from emergency room and outpatient visits at hospitals since 1995 . each hospital discharge or outpatient visit
is recorded in the registry with one primary diagnosis and one or more secondary diagnoses classified according to the international classification of diseases 10th revision ( icd-10 ) . using the dnrp , we identified all patients with a diagnosis of lung cancer ( icd-10 codes : dc34 ) from january 1 , 2000 to december 31 , 2011 .
we computed charlson comorbidity index ( cci)22 scores for each lung cancer patient based on dnrp hospitalization records of outpatient visits and inpatient hospitalizations within 10 years preceding the date of cancer diagnosis .
the cci has been adapted and validated for use with hospital discharge data for the prediction of short- and long - term survival.23 the following disease categories are included : liver diseases , myocardial infarction , congestive heart failure , peripheral vascular disease , chronic pulmonary disease , cerebrovascular disease , hemiplegia , dementia , connective tissue disease , peptic ulcer disease , type 1 and 2 diabetes , renal disease , hematological and solid cancer , and hiv/ aids .
cancer diagnoses within 60 days before the lung cancer diagnosis were excluded from the cci score calculations , to eliminate possible nonspecific cancer diagnoses assigned during the diagnostic work - up for lung cancer .
we categorized comorbidities as no ( cci score = 0 ) , medium ( cci score = 12 ) , or high ( cci score 3 ) .
we computed the prevalence of comorbidity in study patients during four , 3-year study periods ( 20002002 , 20032005 , 20062008 , and 20092011 ) . for each comorbidity category , we constructed kaplan meier survival curves for the different study periods . follow - up was based on date of death or december 31 , 2011 , whichever occurred first .
next , we used cox proportional hazards regression to compute 1- and 5-year crude , age , and sex - adjusted hrs , as a measure of relative mortality ( mortality rate ratios [ mrr ] ) to assess the association of comorbidity with relative survival using the charlson score of 0 as the reference category in each time period , and to compare the survival for each study period to the survival in 20002002 ; additionally , we adjusted for comorbidity in the latter analysis .
the 5-year survival of patients diagnosed later than 2006 was estimated using a hybrid analysis in which survival was estimated using the survival experience of patients in the previous periods.24 estimated values are denoted with a dagger ( ) .
all analyses were performed using sas version 9.2 ( sas institute inc , cary , nc , usa ) and results are presented with corresponding 95% confidence intervals ( ci ) .
the danish data protection agency approved the study ( record number 2009 - 41 - 3866 ) .
we conducted this population - based cohort study in the central denmark region with a population of approximately 1.3 million citizens .
the danish national health service provides universal , tax - supported health care , guaranteeing unconstrained access to general practitioners and hospitals .
accurate and unambiguous individual - level linkage of all registries is enabled by means of the unique personal identifier issued by the danish civil registration system to all danish citizens at birth or emigration .
this registry also records the exact date of death or emigration for all danish citizens and is continuously updated .
the danish national registry of patients ( dnrp ) contains information on all discharges from non - psychiatric hospitals in denmark since 1977 , and from emergency room and outpatient visits at hospitals since 1995 . each hospital discharge or outpatient visit
is recorded in the registry with one primary diagnosis and one or more secondary diagnoses classified according to the international classification of diseases 10th revision ( icd-10 ) . using the dnrp
, we identified all patients with a diagnosis of lung cancer ( icd-10 codes : dc34 ) from january 1 , 2000 to december 31 , 2011 .
we computed charlson comorbidity index ( cci)22 scores for each lung cancer patient based on dnrp hospitalization records of outpatient visits and inpatient hospitalizations within 10 years preceding the date of cancer diagnosis .
the cci has been adapted and validated for use with hospital discharge data for the prediction of short- and long - term survival.23 the following disease categories are included : liver diseases , myocardial infarction , congestive heart failure , peripheral vascular disease , chronic pulmonary disease , cerebrovascular disease , hemiplegia , dementia , connective tissue disease , peptic ulcer disease , type 1 and 2 diabetes , renal disease , hematological and solid cancer , and hiv/ aids .
cancer diagnoses within 60 days before the lung cancer diagnosis were excluded from the cci score calculations , to eliminate possible nonspecific cancer diagnoses assigned during the diagnostic work - up for lung cancer .
we categorized comorbidities as no ( cci score = 0 ) , medium ( cci score = 12 ) , or high ( cci score 3 ) .
we computed the prevalence of comorbidity in study patients during four , 3-year study periods ( 20002002 , 20032005 , 20062008 , and 20092011 ) . for each comorbidity category , we constructed kaplan meier survival curves for the different study periods . follow - up was based on date of death or december 31 , 2011 , whichever occurred first .
next , we used cox proportional hazards regression to compute 1- and 5-year crude , age , and sex - adjusted hrs , as a measure of relative mortality ( mortality rate ratios [ mrr ] ) to assess the association of comorbidity with relative survival using the charlson score of 0 as the reference category in each time period , and to compare the survival for each study period to the survival in 20002002 ; additionally , we adjusted for comorbidity in the latter analysis .
the 5-year survival of patients diagnosed later than 2006 was estimated using a hybrid analysis in which survival was estimated using the survival experience of patients in the previous periods.24 estimated values are denoted with a dagger ( ) .
all analyses were performed using sas version 9.2 ( sas institute inc , cary , nc , usa ) and results are presented with corresponding 95% confidence intervals ( ci ) .
the danish data protection agency approved the study ( record number 2009 - 41 - 3866 ) .
we identified 9,369 lung cancer patients ( 54% males ) in the central denmark region , from 2000 to 2011 .
of these , 4,716 patients ( 50% ) had no hospital - recorded comorbidity ; 3,390 ( 36% ) had medium level comorbidity ; and 1,263 ( 14% ) had high level comorbidity .
median age at diagnosis increased from 69 years in 20002002 to 71 years in 20092011 .
patients with comorbidity were older than those without and there was a slight increase in the prevalence of patients with a high level comorbidity from 11% in 20002002 to 15% in 20092011 , whereas the prevalence of medium comorbidity remained stable ( data not shown ) .
overall 1-year survival increased from 31% ( 95% ci : 29%33% ) in 20002002 to 37% ( 95% ci : 35%39% ) in 20092011 with a corresponding age , sex , and comorbidity adjusted mrr of 0.80 ( 0.740.86 ) in 20092011 versus 20002002 ( table 1 and figure 1 ) .
overall 5-year survival increased from 10% ( 95% ci : 9%12% ) in 20002002 to 13% ( 95% ci : 12%15% ) in 20092011 , with a corresponding adjusted mrr of 0.83 ( 95% ci : 0.780.88 ) when comparing 20092011 with 20002002 ( table 1 and figure 1 ) .
there was a moderate increase in 1-year survival of about 6% among men in all age groups from 2002 to 2011 .
the increase in 1-year survival among women was most prominent in women aged 7079 years ( from 29% to 41% ) , whereas it was moderate in women aged 1569 years ( from 39% to 48% ) , and unaltered among women above 80 years .
the 5-year survival among men of all age groups remained unchanged over time ; around 14% for men aged 1569 years and less than 5% for men above 80 years , except for a moderate increase in those aged 7079 years from 8% to 12% .
in contrast , the 5-year survival among women increased from 14% to 21% in women aged 1569 years , and from 7% to 14% in those aged 7079 years , while women above 80 years saw no improvement ( table 2 ) . across all calendar time periods ,
a high level of comorbidity was a negative predictor of 1-year and 5-year cancer survival .
the 1-year survival for patients with no comorbidity increased from 33% ( 95% ci : 31%36% ) in 20002002 to 41% ( 95% ci : 38%44% ) in 20092011 , while the 1-year survival for patients with medium level comorbidity increased from 29% ( 95% ci : 26%32% ) to 37% ( 95% ci : 33%40% ) . in comparison ,
the increase in 1-year survival for patients with a high level of comorbidity was less prominent from 25% ( 95% ci : 20%31% ) to 28% ( 95% ci : 23%33% ) .
the corresponding 1-year mrr adjusted for age and sex in patients with a high level of comorbidity versus no comorbidity was 1.23 ( 95% ci : 1.051.46 ) in 20002002 and 1.35 ( 95% ci : 1.171.56 ) in 20092011 ( table 3 , figures 24 ) .
the 5-year survival for patients with no comorbidity increased from 12% ( 95% ci : 10%14% ) in 20002002 to 15% ( 95% ci : 13%18% ) in 20092011 ( table 3 , figure 2 ) and the 5-year survival for patients with medium level comorbidity increased from 9% ( 95% ci : 7%11% ) in 20002002 to 13% ( 11% 15% ) in 20092011 ( table 3 , figure 3 ) , while the 5-year survival for patients with high level comorbidity remained stable around 7% ( table 3 , figure 4 ) .
the corresponding 5-year mrrs adjusted for age and sex in patients with a high level of comorbidity versus no comorbidity remained essentially unchanged at 1.21 ( 95% ci : 1.041.40 ) in 20002002 and 1.26 ( 95% ci : 1.111.42 ) in 20092011 .
this population - based cohort study revealed an improvement in overall survival of lung cancer patients diagnosed in the central denmark region from 2000 through 2011 .
the improvement was most prominent in women , patients below 80 years , and in patients with no or medium level comorbidity .
nonetheless , the long - term prognosis of lung cancer remained poor with an overall 5-year survival of about 13% . and
, comorbidity remained a negative predictor of survival with adjusted mortality rates elevated 1.3-fold when comparing patients with high comorbidity level with patients without comorbidity in 20092011 .
our findings of an adverse prognostic impact of comorbidity after adjustment for age and sex are in agreement with several previous studies.10,11,25 but they disagree with the findings in a norwegian study on the survival and risk of side effects among 402 stage iiib / iv lung cancer patients using data from a phase iii trial of two different platinum - based chemotherapy regimes.17 in that study , comorbidity had no effect on survival ( hr for severe versus no comorbidity was 0.98 ) ( 95% ci : 0.661.44 ) .
patients with world health organization performance status < 2 were however excluded from this study , and therefore most likely also the patients with the most severe comorbidity and hence worst prognosis , which may explain the lack of association between survival and level of comorbidity .
there are several plausible explanations for the improvement in the overall survival of lung cancer patients between 2000 and 2011 .
both the introduction of the national cancer plan and the national integrated cancer pathways in denmark along with more aggressive therapy , especially the introduction of adjuvant chemotherapy4 and platinum - based chemotherapy for stage iii and iv lung cancer26 in this period , are likely to have contributed . indeed , the proportion of patients who received chemotherapy for lung cancer in denmark increased from 10% to 31% in this period.21 most importantly , the unequal improvements in survival between strata of age , sex , and comorbidity in our study suggest that the improved overall survival is caused by factors other than just a potential lead time bias introduced by the faster work - up , and thus earlier diagnosis incorporated in the national integrated cancer pathways .
it is however unclear , why patients with a high comorbidity level seem to be less affected by this survival improvement compared to patients with low , or no comorbidity .
the design of our study prevents us from investigating this further , though we may hypothesize some mechanisms .
patients with comorbidity have a higher risk of dying from other causes than patients without comorbidity , and changes in lung cancer treatment might therefore have a smaller impact in the overall prognosis in this group of patients .
further , comorbidity may represent a barrier to treatment in some patients , for instance by contraindication for surgery ( eg , severely affected lung function in copd ) or chemotherapy ( eg , low world health organization performance status in disabling congestive heart failure ) . as more aggressive treatments become available over time , patients with comorbidity may be offered these treatments less often or tolerate them less well than previously
patients , and thereby increase the gap in survival between patients with and without comorbidity . finally , earlier cancer diagnosis in some patients with comorbidities is plausible , because people with comorbidity are subject to closer clinical attention with frequent periodical monitoring and care.10 this possible advantage in comorbid patients may have been weakened by the generally increased attention to cancer symptoms and more effective work - up introduced by the national cancer plan .
strengths of our study include the population - based design and complete follow - up in a uniform health care system . still , the accuracy of our estimates depends on the quality of our data .
the validity of diagnoses in the dnpr is generally high27,28 and , though we are unaware of studies on the specific validity of lung cancer diagnoses in the dnpr , the survival data on colorectal , breast , prostate , bladder , and ovarian cancer are similar , when comparing data from the dnpr with the national cancer registry.29,30 additionally , we see no reason to suspect that the validity has changed from 2000 to 2011 .
any misclassification of lung cancer patients would most likely be non - differential over time and between different levels of comorbidity ; because we expect all lung cancer cases to be hospitalized , and it is unlikely that such bias would produce the time - trends in survival or change in the impact of comorbidity that we found . finally , we measured comorbidity by the cci which has a documented high accuracy when used with icd diagnoses in the dnpr.31 our study also has certain limitations .
first , we lacked information on cancer stage at diagnosis , and treatment , which would have enabled us to examine whether improvements in survival were caused by earlier diagnosis and hence more localized disease at diagnosis or by improvements in treatments . on the other hand ,
our finding of a moderate and perhaps relatively increasing impact of comorbidity on prognosis would be unaffected by this .
second , our use of survival estimates from hybrid analysis might be less correct than observed survival estimates . in our view , this disadvantage is balanced by the possibility of tracking recent improvements in survival ; moreover the predictions of the hybrid analysis are based on the survival experience in previous study periods , and are thus conservative estimates .
but , this region consists of mixed rural and urban areas , reflecting denmark s overall population ; likewise the region has both several district hospitals and one large teaching hospital , so that we assume that selection problems are minimal .
. only severe cases of chronic diseases have been treated in hospitals and thereby registered in the dnpr with the disease .
mild or moderate comorbidity ( ie , copd , diabetes ) may only have received treatment in general practice and therefore was not included in this study .
in conclusion , we found an increasing survival of lung cancer patients diagnosed in the central denmark region from 2000 to 2011 , which was most prominent for women , patients under 80 years , and in patients with no or medium level of comorbidity .
the survival has improved after the introduction of several health initiatives started by the danish government in the last decade along with the introduction of more aggressive treatments regiments . despite improvements in survival ,
the prognosis for lung cancer is still poor with an overall 5-year survival of about 15% , and comorbidity remains a negative prognostic factor .
finally , our results support a recent initiative launch by the danish national board of health , which focuses on optimizing the treatment of comorbidities among cancer patients . | objectiveto examine lung cancer survival and the impact of comorbidity in the central denmark region from 2000 to 2011.methodswe performed a population - based cohort study of lung cancer patients diagnosed during four 3-year calendar periods ( 20002002 , 20032005 , 20062008 , and 20092011 ) in the central denmark region .
the danish national registry of patients was used to identify 9,369 incident lung cancer patients , and to obtain data on their charlson comorbidity index score , categorized as no ( score = 0 ) , medium ( score = 12 ) , or high ( score 3 ) level comorbidity .
we calculated 1- and 5-year survival in different calendar time periods overall , and by age , sex , and level of comorbidity , and used cox regression to compute mortality rate ratios ( mrr ) for each level of comorbidity versus no comorbidity in different calendar time periods.resultsoverall 1-year survival increased from 31% in 20002002 to 37% in 20092011 , while the 5-year survival increased from 10% in 20002002 to predicted 13% in 20092011 with the largest improvement observed for women and patients less than 80 years .
the adjusted 1-year mrr in patients with high comorbidity compared with those without comorbidity was 1.23 ( 95% confidence interval [ ci ] : 1.051.46 ) in 20002002 and 1.35 ( 95% ci : 1.171.56 ) in 20092011 .
the corresponding adjusted 5-year mrrs were 1.21 ( 95% ci : 1.041.40 ) in 20002002 and 1.26 ( 95% ci : 1.111.42 ) in 20092011.conclusionlung cancer patients survival increased from 2000 to 2011 in the central denmark region , most prominently for women under 80 years and patients with no , or medium level of comorbidity .
their prognosis remained nonetheless dismal with overall 5-year survival of 13% , and comorbidity remained a negative prognostic factor . |
it has become clear that cells of the immune system can affect the brain and a host of behavioral processes ( blalock , 1984 ) . for instance
, it is now accepted that circulating t lymphocytes and other peripheral immune cells routinely enter the central nervous system ( cns ) , albeit in limited concentrations , and perform a variety of housekeeping tasks that are essential for immunosurveillance .
the converse is also true , psychological stressors ( which induce neurotransmitter changes ) have been demonstrated to disturb functioning of cells of the adaptive immune system , including t and b lymphocytes , as well as innate immune cells , particularly natural killer ( nk ) cells and macrophages ( griffiths et al . , 2000 ) .
it should be underscored that the blood brain barrier ( bbb ) , as well as endogenous inhibitory and apoptotic mechanisms within the brain normally tightly regulate the flow of immune factors into and how long they persist within the brain .
however , increasing evidence indicates that a range of neurological diseases , including multiple sclerosis , alzheimer 's and parkinson 's disease have a prominent neuroinflammatory component , involving some degree of immune cell infiltration , coupled with activation of brain glial cells ( cotter et al . , 1999 ;
in addition to the entry of immune cells into the brain parenchyma , substantial evidence has revealed that immune factors can influence cns functioning through activation of receptors located on peripheral organs or the bbb ( goehler et al . ,
indeed , one of the primary mechanisms facilitating neuro - immune communication is the release of soluble low molecular weight glycoprotein messengers called cytokines .
cytokines can bind their receptors located on organs , such as the liver or spleen or the nodose ganglion and trigger the firing of neural fibers from these sites , which then signal the cns ( cunningham and de souza , 1993 ) .
cytokines can also interact with bbb receptors to induce cyclooxygenase-2 ( cox-2 ) inflammatory signaling within the brain parenchyma ( rivest , 2001 ; hayley et al . , 2008 ) . although cytokines are normally produced by peripheral immune cells , evidence in recent decades
has also convincingly uncovered their production from cns glial cells ( buttini and boddeke , 1995 ) .
in particular , the immunocompetent , microglia , produce several cytokines and bear receptors for these immunotransmitters , which can act locally in an autocrine or paracrine manner to regular functioning of the original or neighboring cells , respectively ( benveniste , 1992 ) .
perhaps one of the most intriguing findings in recent years has been that cytokines can markedly affect neurotransmission within emotion regulatory brain circuits , and can induce hormonal changes akin to those normally observed following stressor exposure ( herman and cullinan , 1997 ; hayley et al . ,
moreover , numerous studies have implicated cytokines in the genesis of clinical depression and anxiety disorders . to this end
, the current perspective review will focus upon evidence that neuro - immune interactions involving peripheral and glial derived cytokines play an important role in depression .
particular attention will be devoted to understanding the mechanisms through which inflammatory cytokines can affect brain processes to cause depressive symptoms and how novel treatment strategies could be developed based on these findings .
owing to the intimate relationship between stressor exposure and the onset of depression , virtually all - animal models of the disorder involve administration of some degree of stress . in general ,
acute and chronic stressor exposure has been demonstrated to alter adaptive t and b lymphocyte proliferative responses and impair certain aspects of innate immunity , most notably nk cell activity ( maes , 1999 ) .
not surprisingly then , clinical depression is also associated with some degree of disturbed immunological responding , along with increased levels of prostaglandin and corticoid hormones , as well as complement and positive acute phase proteins ( miller et al . , 2002 ; dantzer , 2006 ) .
pro - inflammatory cytokine release has been reported to be increased in stressed animals and in depressed individuals .
indeed , elevations of circulating interleukin-1 ( il-1 ) , il-2 , il-6 , and interferon- ( ifn- ) have reported in major depression ( maes , 1999 ) .
however , some reported reductions of il-2 production occurred with depression and were related to peripheral norepinephrine levels but not depressed mood per se ( anisman et al . , 1999 ) .
interestingly , dysthymia ( chronic low grade depression ) was actually associated with greater reductions in mitogen induced lymphocyte proliferation and elevations of circulating il-1 compared to major depression ( anisman et al . , 1999 ; zaharia et al . , 2000 ) .
similarly , dysthymic children / adolescents were reported to display elevated il-1 but reduced tumor necrosis factor- ( tnf- ) plasma concentrations , whereas those with major depression showed no such changes ( brambilla et al .
there have been indications that the elevated systemic levels of il-1 , il-6 , tnf- , and ifn- normalized with anti - depressant administration ( basterzi et al . , 2005 ; tsao et al . ,
yet , the elevated production of il-6 , il-10 , and the soluble il-6 receptor in severe depression ( sluzewska et al . , 1995 ; maes , 1999 ) and the elevated il-1 associated with dysthymia ( griffiths et al . , 2000 ) were not attenuated with anti - depressant treatments .
it might be the degree of clinical efficacy achieved that influences cytokine levels since elevated il-6 and tnf- plasma levels in depressed subjects diminished in parallel with a successful anti - depressant response ( either with an ssri or snri anti - depressant ) ( yoshimura et al . , 2009 ) .
further , elevations of cerebrospinal fluid il-6 levels correlated with depressive symptom severity ( being most pronounced in suicide attempters ( lindqvist et al . , 2009 ) .
it is important to note that although many significant cytokine differences have been reported , substantial variability exists in cytokine levels normally apparent in clinical populations .
consequently , some researchers ( e.g. , kubera et al . , 2000 ; huang and lee , 2007 ) not surprisingly have failed to identify differences in cytokines that others report altered in depression ( e.g. , il-1 ) . yet ,
the pro - inflammatory cytokines , il-1 , il-6 , and tnf- have generally emerged from the literature as important players in depression . indeed , one recent meta - analysis that assessed 24 cytokine studies involving patients meeting dsm criteria for depression revealed elevated levels of il-6 and tnf- , yet levels of il-1 , il-2 , il-4 , il-8 , il-10 , and ifn- were not significantly affected ( dowlati et al . , 2010 ) .
a second meta - analysis further reported that il-1 , il-6 , and the inflammatory marker , c - reactive protein ( which is important in cardiac illness ) were likewise positively associated with depression ( howren et al . , 2009 ) . although the data are particularly scant , a few recent postmortem studies have assessed brain cytokine variations in depressed individuals that died from suicide .
these have revealed some statistically significant ( albeit modest ) cytokine variations in stressor - sensitive limbic brain regions .
for instance , the mrna for the type 2 t helper cytokines , il-4 and il-13 , were elevated in a gender - dependent manner ( il-4 in females and il-13 in males ) in the orbitofrontal cortex of depressed suicides ( tonelli et al . , 2008 ) .
similarly , tnf- was increased within the left hemisphere of the dorsolateral prefrontal cortex ( pfc ) of individuals that suffered from major depression ( dean et al . , 2010 ) .
although cns cytokine elevations in depression could stem , in part , from peripheral sources , brain glia are also very likely contributors . along these lines ,
a reduction in the number of glia was apparent within the amygdala , anterior cingulate cortex ( acc ) and pfc of individuals with major depression ( bowley et al .
further studies confirmed a reduction in expression of the astrocyte marker , gfap , in postmortem brain tissue from depressed subjects ( webster et al . , 2005 ) .
parallel animal studies likewise revealed reductions in hippocampal gfap following stressor exposure that correlated with depressive - like behaviors ( liu et al . , 2009 ) .
this is important in light of the fact that astrocytes are primary producers of the trophic factor , brain - derived neurotrophic factor ( bdnf ) , which has also been reported to be reduced in the human depressed brain and in animal stressor models ( duman et al . , 1999 ;
in contrast to the astrocyte reduction , an increased density of microglial cells was reported within the acc and pfc of depressed individuals that committed suicide ; yet , schizophrenic suicides also showed such an effect ( steiner et al . , 2008 ) .
hence , it might be some aspect of the suicidal behavior itself that contributed to the microgliosis .
in fact , the profile of circulating cytokines was found to differ in suicide attempters compared to non - suicidal depressed patients , with the former group showing greater il-6 and tnf- elevations , coupled with il-2 reductions ( janelidze et al . , 2010 ) .
nonetheless , it is informative that animal studies reported elevated microglial density and morphological changes following stressor exposure ( tynan et al . , 2010 ) .
ultimately , one could speculate that stressors favor diminished plasticity and neurochemical changes aligned with depressive pathology by reducing astrocyte trophic responses , while concomitantly augmenting microglial production of pro - inflammatory and oxidative factors .
when considering the involvement of cytokines in depression it is important to point out the likelihood that cytokines are important for a subset but not all depressive symptoms . in this regard , cytokines have potent sickness inducing effects , which are often taken to reflect some form of depression ( anisman et al . , 2008 ; dantzer et al . , 2008
) . while it is certainly reasonable that many aspects of sickness , such as the lethargy and flu - like symptoms , do resemble some of the more vegetative aspects of depression , the profound melancholia is harder to model in animals and might be somewhat independent from cytokine effects .
thus , it may be useful to view cytokines as being only one potentially very important trigger that acts together with psychosocial challenges to provoke the manifestation and evolution of the disorder .
administration of il-1 or tnf- , typically engender an array of behavioral symptoms ( soporific effects , ptosis , anorexia , fever , fatigue , reduced motor activity , curled body posture ) referred to as sickness behaviors
pituitary adrenal ( hpa ) axis and promote increased monoamine utilization in numerous brain regions ( dunn , 2006 ; anisman et al . , 2008 ) .
importantly , at least some of the behavioral consequences appear to be mediated , in part , by central mechanisms , as low doses of il-1 or tnf- administered directly into the brain elicited these behaviors ( maier et al . , 1999 ;
the behavioral and neurochemical impact of il-6 , although similar in profile , is somewhat less pronounced than that of il-1 or tnf- ( dunn et al .
, 1999 ; brebner et al . , 2000 ; hayley et al . , 2005 ) . however , the cytokine normally requires its endogenous soluble receptor ligand for its full range of biological effects ( in contrast to the endogenous il-1 and tnf- soluble antagonists , the il-6 soluble receptor acts as an agonist ) and hence , exogenous il-6 alone might have moderate cns effects .
it is highly likely that the effects of cytokines are intermingled with the impact of the daily stressors that one normally faces . in this regard ,
it is important to note that social stressors were reported to augment the impact of immunological challenges on cns functioning ( avitsur et al . , 2005 ;
for instance , we previously found that when mice were subjected to a psychosocial stressor ( disruption of social housing ) , they displayed greatly augmented behavioral changes and hpa activation to concomitant or subsequent immune ( lps , poly i : c ) or cytokine ( interferon- ) challenge ( anisman et al . , 2007 ; gandhi et al .
interestingly , the bacterial mimic , lps , but not the viral analog , poly i : c , synergistically increased the impact of the social stressor upon sickness and plasma corticosterone levels .
moreover , lps also interacted with the social stress to additively or synergistically enhance cns mrna for the cytokines il-6 , il-10 , and tnf- ( in a brain region and cytokine specific manner ; gibb et al . , 2011 ) .
the fact that many of the cns effects of cytokine and stressor exposure were strain - dependent is of importance given that genetic vulnerability likely contributes to stressor sensitivity and hence , depressive illness .
indeed , the behavioral and hpa variations induced by stressor + lps treatments appeared to be more pronounced in balb / cbyj mice ( which were previously reported to be a
yet , the fact that elevations in circulating and central cytokines were greater in the c57bl/6byj strain suggests that the role of genetics and cytokine signaling is probably quite complex . in terms of potential signaling cns pathways that might subserve the common effects of cytokines and stressors ,
recent studies have revealed that il-1 and its downstream transcription factor , nfkb , are important mediators of the anti - neurogenic and depressive - like effects of acute and chronic stressor exposure . specifically , pharmacological or genetic inhibition of either il-1 or nfkb prevented the depressive - like behavioral changes ( reduced mobility in a forced swim test and reduced consumption of a sucrose solution ) and reduction of hippocampal neurogenesis normally provoked by acute restraint or repeated exposure a series of different mild stressors ( koo and duman , 2008 ; koo et al .
interestingly , nfb mediated signaling following toll - like receptor ( tlr ) activation was also reported to be influenced by psychosocial stressors ( bailey et al . , 2007 ) , raising the possibility that this signaling pathway might be especially sensitive to the impact of both immune and psychological challenges .
given their potent anti - viral and anti - tumor effects that have resulted in widespread clinical use , coupled with their numerous cns effects , ifns might be particularly important with regards to neuropsychiatric pathology .
indeed , ifn- ( and il-2 in earlier studies ) , which is often used as a therapeutic treatment for certain cancers and hepatitis c , has been reported to cause a depressive syndrome ( as well as irritability , anxiety , and cognitive problems ) amenable to anti - depressant treatment ( denicoff et al . , 1987 ;
dieperink et al . , 2003 ; constant et al . , 2005 ; raison et al
it is also important to note that the cancer and hepatitis c patients are undoubtedly under considerable emotional distress , and hence , the impact of ifn- would be expected to be augmented by the concomitant stressor exposure , as we previously reported for mice exposed to the cytokine in the context of a psychosocial stressor ( anisman et al . , 2007 ) .
animal studies revealed that rodents treated with ifn- displayed marked signs of anhedonia , impaired hippocampal neurogenesis and a reduction of cortical neuronal fiber density ( kaneko et al .
some studies also report that systemic ifn- administration induced neurochemical changes ( 5-ht and ne in several brain regions ) in rodents ( anisman et al . , 2007 ) , as well as in rhesus monkeys ( altered csf da metabolite , along with il-6 and hpa hormones , coupled with reduced exploration and huddling behaviors ; felger et al . , 2007
) . many anti - depressants , including fluoxetine , trimipramine , and reboxetine , either suppress ifn- production or reduce the ifn-/il-10 ratio ( diamond et al . , 2006 )
consistent with these findings , anti - depressant treatment was shown to normalize the otherwise high levels of ifn- expression observed in depressed patients ( kubera et al . , 2001 ) .
similarly , genetic knockout of the ifn- receptor prevented the depressive - like effects of bacillus calmette - guerin infection in mice ( a model of immune - mediated depression ; o'connor et al .
the depressive - like effects of ifn- as well as other pro - inflammatory cytokines , including il-1 and ifn- , have been suggested to stem from the ability of these cytokines to affect the enzyme , indoleamine 2,3-dioxygenase ( ido ) , which is responsible for the catabolism of tryptophan to kynurenine ( hu et al . , 1995 ; menkes and macdonald , 2000 ; capuron et al .
essentially , tryptophan can be metabolized to 5-ht or be affected sequentially by the enzymes , atp bind cassette and ido , resulting in the production of kynurenine , which can further follow two different metabolic routes resulting in production of : ( 1 ) the nmda antagonist , kynurenic acid , or ( 2 ) the potentially toxic metabolites , 3-hydroxykynurenine and quinolinic acid .
the potential importance of the tryptophan kynurenine pathway in depression was first proposed by mangoni ( 1974 ) and later expanded upon by myint and kim ( 2003 ) with subsequent in vitro and in vivo experiments demonstrated that ifn- did alter ido activity and reduce 5-ht levels ( myint et al .
in fact , reduced tryptophan and increased levels of toxic kynurenine metabolites correlated with the depressive symptoms observed in hepatitis c patients treated with ifn- ( bonaccorso et al .
besides being increased with depression , these kynurenine metabolites ( 3-hydroxykynurenine and quinolinic acid ) have neurotoxic effects and have been reported to synergistically induce free radicals in several neurodegenerative diseases ( wichers and maes , 2004 ; hartai et al . , 2005 ; wichers et al . , 2005 ) . ultimately , an imbalance in tryptophan metabolism that favors activation of the kynurenine
quinolinc acid pathway could foster depressive pathology through : ( 1 ) a reduction in available 5-ht and ( 2 ) accumulation of toxic metabolites .
administration of il-1 or tnf- , typically engender an array of behavioral symptoms ( soporific effects , ptosis , anorexia , fever , fatigue , reduced motor activity , curled body posture ) referred to as sickness behaviors
pituitary adrenal ( hpa ) axis and promote increased monoamine utilization in numerous brain regions ( dunn , 2006 ; anisman et al . , 2008 ) .
importantly , at least some of the behavioral consequences appear to be mediated , in part , by central mechanisms , as low doses of il-1 or tnf- administered directly into the brain elicited these behaviors ( maier et al . , 1999 ;
the behavioral and neurochemical impact of il-6 , although similar in profile , is somewhat less pronounced than that of il-1 or tnf- ( dunn et al .
, 1999 ; brebner et al . , 2000 ; hayley et al . , 2005 ) . however , the cytokine normally requires its endogenous soluble receptor ligand for its full range of biological effects ( in contrast to the endogenous il-1 and tnf- soluble antagonists , the il-6 soluble receptor acts as an agonist ) and hence , exogenous il-6 alone might have moderate cns effects .
it is highly likely that the effects of cytokines are intermingled with the impact of the daily stressors that one normally faces . in this regard ,
it is important to note that social stressors were reported to augment the impact of immunological challenges on cns functioning ( avitsur et al . , 2005 ;
for instance , we previously found that when mice were subjected to a psychosocial stressor ( disruption of social housing ) , they displayed greatly augmented behavioral changes and hpa activation to concomitant or subsequent immune ( lps , poly i : c ) or cytokine ( interferon- ) challenge ( anisman et al .
, 2007 ; gandhi et al . , 2007 ; gibb et al . , 2008 ) .
interestingly , the bacterial mimic , lps , but not the viral analog , poly i : c , synergistically increased the impact of the social stressor upon sickness and plasma corticosterone levels .
moreover , lps also interacted with the social stress to additively or synergistically enhance cns mrna for the cytokines il-6 , il-10 , and tnf- ( in a brain region and cytokine specific manner ; gibb et al . , 2011 ) .
the fact that many of the cns effects of cytokine and stressor exposure were strain - dependent is of importance given that genetic vulnerability likely contributes to stressor sensitivity and hence , depressive illness .
indeed , the behavioral and hpa variations induced by stressor + lps treatments appeared to be more pronounced in balb / cbyj mice ( which were previously reported to be a
yet , the fact that elevations in circulating and central cytokines were greater in the c57bl/6byj strain suggests that the role of genetics and cytokine signaling is probably quite complex . in terms of potential signaling cns pathways that might subserve the common effects of cytokines and stressors ,
recent studies have revealed that il-1 and its downstream transcription factor , nfkb , are important mediators of the anti - neurogenic and depressive - like effects of acute and chronic stressor exposure . specifically , pharmacological or genetic inhibition of either il-1 or nfkb prevented the depressive - like behavioral changes ( reduced mobility in a forced swim test and reduced consumption of a sucrose solution ) and reduction of hippocampal neurogenesis normally provoked by acute restraint or repeated exposure a series of different mild stressors ( koo and duman , 2008 ; koo et al . , 2010 ) .
interestingly , nfb mediated signaling following toll - like receptor ( tlr ) activation was also reported to be influenced by psychosocial stressors ( bailey et al . , 2007 ) , raising the possibility that this signaling pathway might be especially sensitive to the impact of both immune and psychological challenges .
given their potent anti - viral and anti - tumor effects that have resulted in widespread clinical use , coupled with their numerous cns effects , ifns might be particularly important with regards to neuropsychiatric pathology .
indeed , ifn- ( and il-2 in earlier studies ) , which is often used as a therapeutic treatment for certain cancers and hepatitis c , has been reported to cause a depressive syndrome ( as well as irritability , anxiety , and cognitive problems ) amenable to anti - depressant treatment ( denicoff et al . , 1987 ;
dieperink et al . , 2003 ; constant et al . , 2005 ; raison et al
it is also important to note that the cancer and hepatitis c patients are undoubtedly under considerable emotional distress , and hence , the impact of ifn- would be expected to be augmented by the concomitant stressor exposure , as we previously reported for mice exposed to the cytokine in the context of a psychosocial stressor ( anisman et al . , 2007 ) .
animal studies revealed that rodents treated with ifn- displayed marked signs of anhedonia , impaired hippocampal neurogenesis and a reduction of cortical neuronal fiber density ( kaneko et al .
, 2006 ; ishikawa et al . , 2007 ) . some studies also report that systemic ifn- administration induced neurochemical changes ( 5-ht and ne in several brain regions ) in rodents ( anisman et al . , 2007 ) , as well as in rhesus monkeys ( altered csf da metabolite , along with il-6 and hpa hormones , coupled with reduced exploration and huddling behaviors ; felger et al . , 2007 ) . many anti - depressants , including fluoxetine , trimipramine , and reboxetine , either suppress ifn- production or reduce the ifn-/il-10 ratio ( diamond et al . , 2006 )
consistent with these findings , anti - depressant treatment was shown to normalize the otherwise high levels of ifn- expression observed in depressed patients ( kubera et al . , 2001 ) .
similarly , genetic knockout of the ifn- receptor prevented the depressive - like effects of bacillus calmette - guerin infection in mice ( a model of immune - mediated depression ; o'connor et al . , 2009a ) .
the depressive - like effects of ifn- as well as other pro - inflammatory cytokines , including il-1 and ifn- , have been suggested to stem from the ability of these cytokines to affect the enzyme , indoleamine 2,3-dioxygenase ( ido ) , which is responsible for the catabolism of tryptophan to kynurenine ( hu et al . , 1995 ; menkes and macdonald , 2000 ; capuron et al . , 2003
essentially , tryptophan can be metabolized to 5-ht or be affected sequentially by the enzymes , atp bind cassette and ido , resulting in the production of kynurenine , which can further follow two different metabolic routes resulting in production of : ( 1 ) the nmda antagonist , kynurenic acid , or ( 2 ) the potentially toxic metabolites , 3-hydroxykynurenine and quinolinic acid .
the potential importance of the tryptophan kynurenine pathway in depression was first proposed by mangoni ( 1974 ) and later expanded upon by myint and kim ( 2003 ) with subsequent in vitro and in vivo experiments demonstrated that ifn- did alter ido activity and reduce 5-ht levels ( myint et al . , 2007 ) .
in fact , reduced tryptophan and increased levels of toxic kynurenine metabolites correlated with the depressive symptoms observed in hepatitis c patients treated with ifn- ( bonaccorso et al . , 2002 ; raison et al . , 2010 ) . besides being increased with depression , these kynurenine metabolites ( 3-hydroxykynurenine and quinolinic acid )
have neurotoxic effects and have been reported to synergistically induce free radicals in several neurodegenerative diseases ( wichers and maes , 2004 ; hartai et al . , 2005
; wichers et al . , 2005 ) . ultimately , an imbalance in tryptophan metabolism that favors activation of the kynurenine
quinolinc acid pathway could foster depressive pathology through : ( 1 ) a reduction in available 5-ht and ( 2 ) accumulation of toxic metabolites .
many broad - spectrum anti - inflammatory agents presently are available for a controlling fever , pain , and edema for a range of peripheral immune related conditions .
importantly , many of these compounds have also been shown to have beneficial cns effects , including having neuroprotective effects in animal models of cerebral stroke , alzheimer 's and parkinson 's disease ( teismann et al . , 2003 ; phillis et al . , 2006 ) . moreover ,
some scattered preclinical and stressor - based animal studies suggest that non - steroidal anti - inflammatory drugs ( nsaids ) , including aspirin , ibuprofen , celecoxib , and naproxen might possibly have some anti - depressant properties ( mller et al . , 2006 ; mller and schwarz , 2008 ) .
these drugs typically work by blocking cyclooxygenases , which of course are the rate - limiting enzymes ( cox-1 , -2 , and -3 present in the cns ) in prostaglandin synthesis .
cox-2 is subject to induction by a variety of inflammatory stimuli , many of which ( e.g. , cytokines ) have been implicated in the generalized activation of microglial cells in response to and as a corollary of brain injury and infection ( hayley et al . , 2008 ) .
one recent study found that celecoxib alleviated the depressive - like behaviors and prevented the cox-2 elevations associated with 21 days of chronic stress ( guo et al .
similarly , administration of celecoxib augmented the clinical impact of the anti - depressant , fluoxetine ( akhondzadeh et al . , 2009 ) .
this important finding suggests the possibility that anti - inflammatory drugs might be useful adjunct or
add - on treatments , which could act additively or synergistically with ssri or snri anti - depressants to bolster the clinical efficacy .
mechanistically , nsaids could contribute anti - depressant - like effects by blocking cox-2 activity , since this inflammatory enzyme , along with its associated products , prostaglandins and kynurenine , have been associated with depression ( mller and schwarz , 2008 ) .
moreover , the immune alterations that likely occur with depression have been reported to alter tryptophan / kynurenine metabolism , favoring the neurotoxic effects of quinolinic acid ( wichers and maes , 2004 ) .
of course , the possibility exists that cox - signaling could also influence depressive symptoms by affecting hormonal activity .
indeed , aspirin was reported to reduce waking cortisol levels and improve memory in depressed subjects ( watson et al . , 2009 ) .
another compound of significance is the tetracycline antibiotic , minocycline , which has potent anti - inflammatory effects ( including a suppression of microglial activity ) that are independent of its antimicrobial actions ( pae et al . , 2008 ) .
recently , brain infusion ( into the nucleus accumbens ) or systemic administration of minocycline was shown to impart anti - depressive - like effects in the forced swim test . moreover
, co - administration of minocycline with the ssri anti - depressant , fluoxetine , induced a synergistic anti - depressive effect ( molina - hernndez et al .
the anti - depressive effects of minocycline could stem from its ability to block ido activity , resulting in a normalization of the kynurenine / tryptophan ratio ( myint et al . , 2007 ) .
in addition to broad - spectrum pharmacological agents , specific cytokines with anti - inflammatory or neurotrophic properties have been suggested to have clinical anti - depressant properties .
for instance , erythropoietin is a cytokine produced predominately by the kidney , which , besides directing the trafficking of immune cells and having anti - apoptotic actions , was reported to provoke anti - depressant - like effects in the forced swim and novelty induced hypophagia tests ( girgenti et al . , 2009 ) .
this cytokine , as well as related hematopoietic cytokines , including granulocyte colony stimulating factor , might act , in part , through their ability to induce bdnf expression within the cns .
central infusion of bdnf ( considered a neurotrophic cytokine itself ) was shown to induce an anti - depressant - like effect while concomitantly promoting sprouting of central 5-ht neurons ( altar , 1999 ) .
likewise , hippocampal infusion of bdnf produced anti - depressant - like effects in the learned helplessness and forced swim models of depression ( shirayama et al . , 2002 ) . as would be expected , several clinically beneficial treatments , including ssris , tricyclics , and electroconvulsive therapy , increased hippocampal bdnf expression ( shirayama et al .
the reduced bdnf associated with restraint stress was prevented by anti - depressant treatment ( duman et al . , 1999 ) .
finally , one promising approach to treating the inflammatory aspects of depression is the use of specific cytokine antagonists . in this regard
, most evidence would favor targeting il-1 using the endogenous il-1 receptor antagonist , il-1ra .
indeed , il-1ra was reported in several studies to prevent the development of depressive - like behavioral and neurochemical pathology , as well as the reduction of hippocampal neurogenesis that was induced by chronic stressor exposure ( koo and duman , 2008 ; norman et al . ,
this review discusses the evidence for involvement of cytokines and their inflammatory signaling components in clinical depression .
it is posited that normalization of some of the pro - inflammatory aspects of depression would have beneficial clinical effects .
hence , anti - inflammatory agents ( e.g. , those affecting cox-2 and ido or targeting specific cytokines , such as il-1 ) could hold therapeutic potential as add - on or adjunct treatment with more traditional anti - depressant strategies . at the same time , novel cytokines with neurotrophic consequences , particularly bdnf , appear attractive . indeed , mounting data indicate structural and neuroplastic ( e.g. , reduced hippocampal volume and neurogenesis ) disturbances may occur in depression .
whatever the case , it is being increasingly recognized that depression is a spectrum disorder with several endophenotypes , which are likely characterized by specific differences in their neurochemistry and underlying inflammatory immunological changes .
hence , first recognizing the nature of immune and cytokine changes in these depressive subtypes is necessary in order to tailor specific interventions .
once brought to the clinical arena , several practical issues require addressing including , bioavailability and cns penetration of the agents ( as cytokines typically do not readily cross the bbb ) , as well as consideration of the possibility that manipulation of immunity could have drastically undesirable consequences ( e.g. , increased infection or tumor production ) . in effect , further data are required to more completely understand the critical inflammatory components to be targeted and the long - term consequences of their manipulation .
the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | it has become clear that the inflammatory immune system is altered during the course of clinical depression . in particular , studies on human patients
have found depression to be associated with disturbances in the trafficking of cells of the adaptive immune system , coupled with elevations of innate immune messengers and pro - inflammatory cytokines . paralleling these findings , stressor - based animal models of depression
have implicated several cytokines , most notably interleukin-1 ( il-1 ) , il-6 , and tumor necrosis factor-. elevations of these cytokines and general inflammatory indicators , such as c - reactive protein , together with reductions of specific immune cells ( e.g. , t lymphocytes ) might serve as useful biomarkers of depression or at least , certain subtypes of the disorder .
recent reports also suggest the possibility that anti - inflammatory agents could have therapeutic value in acting as adjunct treatments with traditional anti - depressants .
along these lines , we presently discuss the evidence for pro - inflammatory cytokine involvement in depression , as well as the possibility that anti - inflammatory agents and trophic cytokines themselves might have important anti - depressant properties . |
type 1 diabetes is a heterogeneous autoimmune disorder characterized by severe pancreatic -cell loss [ 14 ]
. discoveries of genetic variants associated with risk to t1d have provided new insights into their functional outcomes and affected pathways and until now more than 60 loci across the human genome have been associated with t1d susceptibility ( http://www.t1dbase.org ) .
the major histocompatibility complex ( mhc ) contributes to the main risk , followed by the insulin and the protein tyrosine phosphatase nonreceptor 22 ( ptpn22 ) genes [ 2 - 4 ] , including in the brazilian population [ 57 ] .
nevertheless , established genetic associations explain only half of the genetic risk of t1d , indicating that other loci may concur with it .
indeed , genetic risk differ among different populations and sometimes even among groups with the same ethnicity [ 2 , 3 ] .
the brazilian population is one of the most heterogeneous in the world with a wide degree and diverse patterns of admixture .
major contributions come from european ancestry ( 0.771 ) , followed by african ( 0.143 ) and amerindian ancestries ( 0.085 ) .
although the incidence of t1d seems to be increasing in brazil , scarce information is available about genetic and epidemiological data in this country .
genome - wide association studies ( gwas ) identified the association between the nonsynonymous p.gly307ser coding variant ( rs763361 ) in cd226 gene , located at 18q22.3 and t1d susceptibility in a european population .
the cd226 gene encodes a 67 kda glycoprotein ( 336 amino acids ) also known as dnax accessory molecule-1 ( dnam-1 ) .
cd226 is constitutively expressed in the majority of cd4 + and cd8 + t lymphocytes , natural killer ( nk ) cells , monocytes / macrophages , platelets and megakaryocytes , and a subset of b lymphocytes , most of which are involved in immune mechanisms leading to -cell destruction .
the poliovirus receptor ( cd155 ) and its family member , nectin 2 ( cd112 ) , were identified as the ligands for cd226 and interaction of cd226 with the ligands inducing nk cell and cd8 + t cell - mediated cytotoxicity and cytokine secretion .
recently , lozano et al . verified that cd226 and its ligand cd155 were decreased on th2 polarized nave t cells , whereas both were highly expressed under th17 conditions .
cd226 provides a positive costimulatory signal for t cell proliferation and enhances proinflammatory cytokine production , thereby shifting the balance between th1/th17 and th2 cells toward a proinflammatory response .
these data suggested that cd226 blockade may represent an alternative approach for treatment of th1- and th17-driven autoimmune diseases , allowing inhibition of t cell proliferation and proinflammatory cytokine production while sparing th2 response .
further , a new axis related to human t cell function , tigit / cd226 , was described .
tigit is a t - cell coinhibitory receptor that binds to cd155 on the dendritic cell surface , driving them to a more tolerogenic phenotype .
the cd226 rs763361 variant is located in exon 7 encoding the cytoplasmic tail of cd226 which harbors two phosphorylation sites .
the substitution from glycine to serine at residue 307 may affect phosphorylation at residues 322 and 329 .
tyrosine phosphorylation at residue 322 of cd226 may be important for lfa-1 ( 2 integrin lymphocyte function - associated antigen-1 ) mediated signaling in t cells .
in addition , serine phosphorylation at residue 329 is also required for physical association of cd226 with lfa-1 in t cells .
alternatively , this snp may alter rna splicing by disrupting splice site enhancers or silencers , resulting in an isoform of cd226 with altered function [ 16 , 17 ] besides tid , the nonsynonymous rs763361 variant has also been associated with several autoimmune diseases such as rheumatoid arthritis , celiac disease , graves ' disease , systemic lupus erythematosus , multiple sclerosis , systemic sclerosis , wegener granulomatosis , and psoriasis mainly in caucasian populations [ 1821 ] . reinforcing the role of cd226 in autoimmune disorders , a three - variant haplotype in cd226 , rs763361-rs34794968-rs727088 , was associated with systemic lupus erythematosus ( sle ) and systemic sclerosis - related pulmonary fibrosis .
however , it was proposed that in this context rs727088 could be the risk snp interfering on cd226 transcription levels . indeed
, the association of t1d and the rs763361 variant in cd226 identified by gwas could indicate that other variants might exist and contributed to this risk .
however , there was only a trend of possible association of rs763361 with sle in chinese and with t1d in colombians and there is no data about cd226 variants in patients with t1d in the very heterogeneous brazilian population .
therefore , the aim of this study was to investigate the contribution of cd226 sequence variants to susceptibility to type 1 diabetes in our population and to correlate risk variants with clinical data , autoantibody status , c peptide levels , and hla ( dr ) alleles .
we found that rs763361 in cd226 is associated with type 1 diabetes risk , mainly in females , and with greater frequency of gad autoantibody and lower c - peptide levels , probably reflecting a more aggressive pattern of autoimmune aggression .
we believe that this association in the very heterogeneous brazilian population indicates an even stronger role for cd226 in susceptibility to t1d .
532 t1d patients ( mean age 23.9 12.8 years , age at diagnosis 11.6 7.5 years ) were recruited from hospital das clnicas da faculdade de medicina da universidade de sao paulo .
all patients were diagnosed according to the criteria established by the american diabetes association ( ada ) and treated with two or more doses of insulin per day .
the control group was composed by 592 health volunteers ( 28 11.5 years ) without family history of type 1 or 2 diabetes and autoimmune diseases and with normal fasting plasma hba1c and glucose levels .
the study design was approved by institutional board review and all subjects gave written informed consent .
fasting plasma glucose was determined using an enzymatic colorimetric assay ( labtest god - ana , brazil ) .
hba1c was measured using hplc ( clae ) and fasting serum c - peptide levels by radioimmunoassay ( hcp-20k , usa ) ; the coefficients of variation ( cv ) intra- and inter - assay were , respectively , 4.5%9.3% .
the coding region ( exons 2 , 3 , 4 , 5 , 6 , and part of exon 7 ) of cd226 ( ensg00000150637 ) were amplified by polymerase chain reaction ( pcr ) , using six primers pairs ( invitrogen life technologies , brazil ) in a veriti thermal cycler ( applied biosystems , foster city , ca ) .
pcr amplified products were submitted to direct sequencing in an abi 3130 capillary sequencer ( applied biosystem , foster city , ca ) using the big dye terminator v3.1 cycle sequencing kit- ( applied biosystem - life technologies ) and analyzed with the chromas lite 2 and sequencher 4.8 programs .
two snps ( rs763361 and rs727088 ) were selected as genetic markers on the basis of literature reports .
genotyping was accomplished in 525 t1d patients and 592 controls using commercially available genotyping assays taqman ( applied biosystems life technologies , usa ) .
all reactions were carried out using taqman genotyping mastermix ( applied biosystems ) on a steponeplus real - time pcr cycler ( applied biosystems , usa ) according to manufacturer 's instructions .
genotyping was completed in > 99% of the sample and the accuracy was > 95% , determined by direct sequencing of 10% of all samples .
hla drb1 alleles were amplified by pcr - ssp ( polymerase chain reaction - sequence specific primers ) using a generic kit of drb1 diagnosing typing ( micro ssp allelegeneric hla class ii dna typing tray - one - lambda inc ) .
serum levels of autoantibodies against glutamic acid decarboxylase and tyrosine phosphatase were determined by radioimmunoassay ( rsr limited , uk ; cv < 7% ) .
normal values ( nv ) of 700 health controls ( considering 3 sd ) were > 1.0 iu and > 0.8 iu for anti - gad and anti - ia2 , respectively .
autoantibodies against thyroid peroxidase ( auto delfia , turku , finland , cv = 3.6%8.2% ; nv 35 u / ml ) , thyroglobulin ( auto delfia , turku , finland ; cv = 2.9%5.7% ; nv 35 u / ml ) , and 21-hydroxylase enzyme ( rsr limited , uk ; cv < 7% ; nv > 1
iu / ml ) were determined by radioimmunoassay . anti - nuclear ( nv < 1/80 ) , anti - liver / kidney microsomal type 1 antibody , anti - gastric parietal cell , anti - endomysium , and anti - smooth muscle ( nv - negative ) were quantified by indirect immunofluorescence .
rheumatoid factor ( rf ; nv < 20 iu / ml ) was evaluated using nephelometry and tsh receptor autoantibody ( rsr limited , uk ; cv = 6%10,6% ; nv < 19% ) by iodine radioreceptor assay .
allelic and genotypic association between cd226 polymorphisms and t1d was carried out using pearson 's 2 2 contingency tables as implemented in graph pad 2.00 software .
- chi - square test was used to compare qualitative variables and the fisher exact test for small samples .
numerical variables with parametric and nonparametric distributions were compared using student 's t - test and mann - whitney test , respectively . in the case of two samples comparison
results were presented as means and standard deviations . for the analyses of effects of two independent variables on a qualitative dependent variable ( presence or absence )
, we used a nominal logistic fit , available in the jmp 6.03 software ( sas institute inc . ,
genotype frequencies were tested for hardy - weinberg equilibrium ( hwe ) by chi - square test .
for the analysis of the effects of genetic markers , the critical p value was corrected by bonferroni adjustments and indicated in the tables as pc .
haplotype frequencies and pairwise linkage disequilibrium between variants were evaluated with the cubex software ( bgel / caite , university of bristol , uk ) .
it was estimated ( http://www.lee.dante.br/ ) that differences of allelic variant distribution could be detected with a power exceeding 80% ( > 95% ) at the 0.05 level of significance .
demographic and laboratory data of subjects are provided in table 1 . as expected , hba1c and glucose levels were higher and c - peptide levels were lower in patients ( p < 0.01 ) .
hla dr3 or -dr4 alleles prevailed in t1d patients compared to controls ( p < 0.0001 ) .
european ancestry and females were more frequent in t1d patients as well as several autoantibodies . with the exception of rheumatoid factor , anti-21 hydroxilase ,
anti - liver / kidney microsomal type 1 antibody , and anti - smooth muscle antibody , all the other autoantibodies were significantly more frequent in t1ad patients than in the healthy controls ( pc < 0.003 ) . the greater frequency of autoantibodies , in patients with t1d , was not related to gender ( table 2 ) .
twelve variants already described in public repositories ( http://www.ensembl.org/ ) were detected by direct sequencing : three in exonic regions ( rs72481820 , rs72481819 , and rs763361 ) and nine in exon - intron boundaries ( rs75418532 , rs57743896 , rs1630425 , rs73970293 , rs77826708 , rs1788101 , rs3737395 , rs62090790 , and rs763362 ) .
genotype frequencies were in hardy - weinberg equilibrium in all variants for the control population .
allele , genotype , and estimated haplotype frequencies of variants in cd226 did not differ between t1d patients ( n = 106 ) and controls ( n = 102 ) ( data not shown ) . in sequence ,
two cd226 variants that were previously related to autoimmune diseases were genotyped in 531 t1d patients and 590 controls .
the tt genotype prevailed in t1d group ( 33.5% ) when compared with controls ( 25.7% ) ( or = 1.45 , 95% ci = 1.121.8 , p = 0.0044 ) ( table 3 ) .
the second variant tested , rs727088 , was found to be in strong linkage disequilibrium with rs763361 ( d = 0.948 , = 453.08 ) .
the cc genotype was also associated with t1d patients susceptibility ( 31.4% versus 24.6% ; or = 1.41 ; 95% ci = 1.081.84 ; p = 0.0143 ) but , as the control group was not in hardy - weinberg equilibrium ( p = 0.0186 ) , it was excluded in further analyzes .
the predisposing effect of rs763361 tt genotype to type 1 diabetes was independent of the ancestrality .
it prevailed both in t1d patients of european ancestry ( 32.5% 24.2% ; or = 1.51 ; 95% ci = 1.092.07 , p = 0.013 ) as in those of non - european ancestry ( 41.2% 28.0% ; or = 1.8 ; ( 95% ci = 1.092.98 , p = 0.0281 ) when compared to controls .
compared to pooled cc + tc genotypes , the cd226 rs763361 tt genotype had no association with high risk hla genotypes ( dr3 or dr4 ) , which frequencies were similar between patients with tt ( 85.9% ) or ct / cc genotypes ( 82.9% ; p = 0.42 ) , or with age at diagnosis ( before or after 15-year old ) , p = 0.23 .
patients with new onset diabetes ( less than 2 years of duration ) carrying the rs763361 tt genotype also had lower serum levels of c peptide ( 0.4 0.3 ng / dl ) when compared with those with tc + cc genotypes ( 0.7 0.5 ng / dl ) ; p = 0.013 . when the frequencies of rs763361 tt genotype in t1d patients and controls were stratified for gender , the susceptibility risk was observed for t1d females ( p = 0.0012 ) , but not for males ( table 4).further , when considering the entire population ( patients with t1d and controls ) , those subjects carrying the rs763361 tt genotype had an increased frequency of anti - gad65 autoantibody : 31.9% 24.5% ; or = 1.57 ; ci = 1.1362.194 ; and p = 0.0081 ( table 5 ) . the mean titer of anti - gad65 was higher in females with tt genotypes ( 9.8 25.2 iu / ml ) than in cc + ct females at the cd226 rs763361(4.3 13.7 , p = 0.0003 ) .
the anti - gad mean titers for tt against cc + ct males were not significantly different ( 2.0 8.2 iu / ml and 1.4 6.0 iu / ml , resp .
however , c peptide levels in recent onset patients with t1d were similar between tt females ( 0.42 0.28 ng / ml ) and males ( 0.39 0.33 ) ; p = 0.79 .
in addition , the rs763361 tt genotype of cd226 had no effect on frequency of extrapancreatic autoantibodies related to other autoimmune diseases that usually coexist with t1d ( table 5 ) .
in this report we show that rs763361 in exon 7 of cd226 is associated with type 1 diabetes risk in a brazilian cohort ( p = 0.0044 ) .
our results replicate findings of previous european studies [ 10 , 23 ] and were independent of ancestry . despite of the great admixture of the brazilian population ,
the t1d patients consisted mostly of caucasians with hla - dr3 or -dr4 hla risk alleles .
including , the direct sequencing of cd226 coding regions identified twelve variants previously described in other populations and no new variant was found .
new onset t1d patients ( with less than two years of disease duration ) bearing the rs763361 tt genotype presented lower c - peptide levels , indicating accelerated pancreatic beta - cell destruction and a more aggressive autoimmune phenomenon
. moreover subjects carrying the rs763361 tt genotype had an increased frequency of anti - gad65 autoantibody .
these novel findings might therefore reinforce cd226 's role in susceptibility to t1d and in disease features .
the amino acid exchange gly307ser attributed by the rs763361 within the cd226 protein could alter the two intracytoplasmic phosphorylation sites which are important in cd226 mediated signaling [ 16 , 17 ] . as this protein
is involved with cytotoxicity and differentiation of nave t cd4 + cells any disturbance in these processes might contribute to exacerbation of the immune response . however , wallace et al . observed that t1d risk correlates with lower cd226 mrna , which could reduce cell activation on cross - linking , altering the interactions of monocytes with lymphocytes and other immune cells and the cd226 receptors , cd112 and cd155 . the t1d risk associated with
rs763361 was more evident in females than in males , determining increased anti - gad titer and frequency , suggesting an additive effect of female hormones .
gender is associated with differences in clinical presentation , onset , progression , and outcome of several autoimmune diseases , and females have stronger cellular and humoral immune reactions compared with males .
elevated levels of estrogen and progesterone are supposed to induce th2 responses , while low estrogen and prolactin concentrations have been reported to enhance th1 responses . as a matter of fact
, clinical evidences show that menstrual cycle , pregnancy , and menopausal status that are characterized by fluctuations of endogenous estrogens significantly influence the course of autoimmune diseases .
in addition , estrogen treatment was found to protect isolated primary b cells from b cell receptor - mediated apoptosis .
this fact suggested that estrogen could modulate survival and activation of b cells skewing the nave immune system toward autoreactivity and proliferation .
c peptide levels in recent onset patients with t1d were similar between tt females ( 0.42 0.28 ng / ml ) and males ( 0.39 0.33 ) ,
although the global incidence of t1d seems not to differ between male and female , countries with a high incidence of t1d have a high male to female ratio and those of low incidence have a low ratio .
the increased number of females in t1d group is consistent with findings of higher t1d prevalence among females in brazil .
we have found that rs763361 in cd226 is associated with type 1 diabetes risk , greater frequency of gad autoantibody , and lower c - peptide levels in a brazilian cohort , reflecting a more aggressive pattern of autoimmune disease .
we believe that this association in the very heterogeneous brazilian population indicates an even stronger role for cd226 in susceptibility to t1d . the great risk conferred to female t1d patients | cd226 rs763361 variant increases susceptibility to type 1 diabetes ( t1d ) in caucasians .
there is no data about cd226 variants in the very heterogeneous brazilian population bearing a wide degree of admixture .
we investigated its association with t1d susceptibility , clinical phenotypes , and autoimmune manifestations ( islet and extrapancreatic autoantibodies ) .
casuistry .
532 t1d patients and 594 controls in a case - control study .
initially , cd226 coding regions and boundaries were sequenced in a subset of 106 t1d patients and 102 controls . in a second step ,
two cd226 variants , rs763361 ( exon 7 ) and rs727088 ( 3 utr region ) , involved with cd226 regulation , were genotyped in the entire cohort .
c - peptide and autoantibody levels were determined .
no new polymorphic variant was found .
the variants rs763361 and rs727088 were in strong linkage disequilibrium .
the tt genotype of rs763361 was associated with tid risk ( or = 1.503 ; 95% ci = 1.1351.991 ; p = 0.0044 ) , mainly in females ( p = 0.0012 ) , greater frequency of anti - gad autoantibody ( 31.9% 24.5% ; or = 1.57 ; ci = 1.1362.194 ; p = 0.0081 ) , and lower c - peptide levels when compared to those with tc + cc genotypes ( 0.41 0.30 ng / dl versus 0.70 0.53 ng / dl p = 0.0218 ) . conclusions .
the rs763361 variant of cd226 gene ( tt genotype ) was associated with susceptibility to t1d and with the degree of aggressiveness of the disease in t1d patients from brazil .
ancestry had no effect . |
the nature of fast pathway conduction , especially during atypical avnrt of the fast - slow type , is poorly understood .
there is evidence that atypical fast - slow and typical atrioventricular avnrt do not utilize the same limb for fast conduction , but no data exist on patients who have presented with both typical and atypical forms of this tachycardia .
we investigated the nature of the fast pathway in patients displaying both slow - fast and , so - called , fast - slow avnrt .
our data provide further evidence that typical slow - fast and atypical fast - slow avnrt utilize different anatomical pathways for fast conduction .
anterograde fast conduction during atypical avnrt is distinct from retrograde fast conduction during typical avnrt .
data from adult patients with avnrt undergoing catheter ablation at 5 centers , beth israel deaconess medical center boston , ma , and rhode island hospital , boston , ma ( 20092013 ) ; athens euroclinic , athens , greece ( 20072014 ) ; the johns hopkins hospital , baltimore , md ( 20112014 ) ; and the university of michigan health system , ann arbor , mi ( 20092014 ) , were analyzed .
the subjects of this study were the patients in whom both typical and atypical avnrt were induced in the same procedure and in whom tracings suitable for evaluation were available .
all patients were studied in the postabsorptive state , under mild sedation , and after all antiarrhythmic agents had been discontinued for > 5 half - lives .
avnrt was diagnosed by fulfillment of established criteria during detailed atrial and ventricular pacing maneuvers and subsequent abolition of the tachycardia by anatomic ablation of the slow pathway .
typical ( slow fast ) avnrt was defined by an atrial - his / his - atrial ratio ( ah / ha ) > 1 and ha interval of 70 ms .
atypical avnrt was defined by delayed retrograde atrial activation with ha>70 ms . if the ah was < 200 ms and the ah < ha , the atypical form was characterized as fast slow .
tachycardias with a prolonged ah interval of > 200 ms but ah < ha , or with ah<200 ms and ah > ha , or with variable intervals during the same or different episodes , were classified as indeterminate .
if the anatomic models are correct , avnrt types that coexist in the same patient may use the same distinct limbs of the circuit regardless of the tachycardia type , and retrograde atrial and anterograde ventricular activation should use the same anatomic pathways in all forms of avnrt .
therefore , conduction times such as the ah and ha intervals during types of tachycardia coexisting in the same patient can be calculated and used to provide data on the characteristics of the fast and slow circuit limbs .
figure 1 depicts one of the proposed fixed , anatomic models of slow fast and fast slow avnrt . according to this model , during avnrt
, the tachycardia circuit is confined within the av node region , and activation of the atrium takes place after activation of the retrograde pathway .
thus , during typical slow fast avnrt , the ha interval represents the time difference between activation of the his bundle and activation of the atrium ; this is ha = fr+ah , where fr is the time the impulse travels retrogradely along the fast pathway , a is the time the impulse travels from the av node to right atrium as recorded by the electrode positioned on the his bundle , and h is the time the impulse travels from the av node to the his bundle .
similarly , the ah interval represents the time difference between activation of the right atrium as recorded by the catheter positioned on the his bundle and the next activation of the his bundle .
this is ah = sa+ha , where sa is the anterograde conduction along the slow pathway , h is the time the impulse travels from the av node to the his bundle , and a the time the impulse travels from the av node to right atrium . during atypical fast slow avnrt , ha = sr+ah , where sr is the time required for the impulse to travel retrogradely along the slow pathway , a is the time the impulse travels from the av node to right atrium , and h is the time the impulse travels from the av node to the his bundle .
ah = fa+ha , where fa is the time required for anterograde conduction along the fast pathway , h is the time the impulse travels from the av node to the his bundle , and a the time the impulse travels from the av node to right atrium . assuming that conduction velocity over the slow pathway is similar in the anterograde and retrograde direction ( ie , sa = sr ) ,
as happens in some types of accessory pathways , and retrograde atrial activation takes similar paths in all forms of avnrt in the same patient , then ha ( fs)+ah ( sf)=(sr+ah)+(sa+ha)=2s . because tachycardia cycle length = ah+ha = s+f , by definition , derivation of the s interval can provide the value of f. if derived fr values are significantly different than those for fa , then the possibility of typical and atypical avnrt using the same anatomic limb for fast conduction is unlikely .
depiction of conduction and resultant ah and ha during typical and atypical atrioventricular nodal re - entrant tachycardia ( avnrt ) types .
a indicates conduction from the av node to right atrium as recorded by the electrode positioned on the his bundle ; ah , time difference between activation of right atrium and the next his ; fa , anterograde conduction over the fast pathway that is used by the fast slow form ; fr , retrograde conduction over the fast pathway ; h , conduction from the av node to his bundle ; ha , time difference between activation of the his bundle and right atrium ; s , conduction over the slow pathway ( anterogradely or retrogradely ) ( see text for details ) .
statistical analysis was performed to compare the measured difference between fr and fa ( frfa ) to the anticipated difference considering the variability between repeated measurements on the same subject . to determine the maximum difference that could be attributed to between - measurement variability
, we measured the ah interval , ha interval , and tachycardia cycle length during the typical form of avnrt and computed fr twice for each patient .
the mean absolute value of the difference between these 2 measurements and its se ( 3.690.44 ms ) was used to estimate 95% confidence intervals for the between - measurement error ( 2.724.66 ms ) . accordingly , using 1 sample t test , we compared the mean of the absolute values of frfa to the upper bound of the 95% confidence interval ( 4.7 ms ) . to further examine the relationship of measured frfa values to an expected between - measurement error , we have plotted measured frfa values together with 95% confidence intervals of between - measurement error , in a manner analogous to a bland altman plot .
statistical analyses were performed using ibm spss statistics version 22 ( ibm corp , armonk , ny ) .
data from adult patients with avnrt undergoing catheter ablation at 5 centers , beth israel deaconess medical center boston , ma , and rhode island hospital , boston , ma ( 20092013 ) ; athens euroclinic , athens , greece ( 20072014 ) ; the johns hopkins hospital , baltimore , md ( 20112014 ) ; and the university of michigan health system , ann arbor , mi ( 20092014 ) , were analyzed .
the subjects of this study were the patients in whom both typical and atypical avnrt were induced in the same procedure and in whom tracings suitable for evaluation were available .
all patients were studied in the postabsorptive state , under mild sedation , and after all antiarrhythmic agents had been discontinued for > 5 half - lives .
avnrt was diagnosed by fulfillment of established criteria during detailed atrial and ventricular pacing maneuvers and subsequent abolition of the tachycardia by anatomic ablation of the slow pathway .
typical ( slow fast ) avnrt was defined by an atrial - his / his - atrial ratio ( ah / ha ) > 1 and ha interval of 70 ms .
if the ah was < 200 ms and the ah < ha , the atypical form was characterized as fast slow . if ah>200 ms and ah > ha , the atypical form was considered slow
tachycardias with a prolonged ah interval of > 200 ms but ah < ha , or with ah<200 ms and ah > ha , or with variable intervals during the same or different episodes , were classified as indeterminate .
if the anatomic models are correct , avnrt types that coexist in the same patient may use the same distinct limbs of the circuit regardless of the tachycardia type , and retrograde atrial and anterograde ventricular activation should use the same anatomic pathways in all forms of avnrt .
therefore , conduction times such as the ah and ha intervals during types of tachycardia coexisting in the same patient can be calculated and used to provide data on the characteristics of the fast and slow circuit limbs .
figure 1 depicts one of the proposed fixed , anatomic models of slow fast and fast slow avnrt . according to this model , during avnrt
, the tachycardia circuit is confined within the av node region , and activation of the atrium takes place after activation of the retrograde pathway .
thus , during typical slow fast avnrt , the ha interval represents the time difference between activation of the his bundle and activation of the atrium ; this is ha = fr+ah , where fr is the time the impulse travels retrogradely along the fast pathway , a is the time the impulse travels from the av node to right atrium as recorded by the electrode positioned on the his bundle , and h is the time the impulse travels from the av node to the his bundle .
similarly , the ah interval represents the time difference between activation of the right atrium as recorded by the catheter positioned on the his bundle and the next activation of the his bundle .
this is ah = sa+ha , where sa is the anterograde conduction along the slow pathway , h is the time the impulse travels from the av node to the his bundle , and a the time the impulse travels from the av node to right atrium . during atypical fast slow avnrt , ha = sr+ah , where sr is the time required for the impulse to travel retrogradely along the slow pathway , a is the time the impulse travels from the av node to right atrium , and h is the time the impulse travels from the av node to the his bundle .
ah = fa+ha , where fa is the time required for anterograde conduction along the fast pathway , h is the time the impulse travels from the av node to the his bundle , and a the time the impulse travels from the av node to right atrium . assuming that conduction velocity over the slow pathway is similar in the anterograde and retrograde direction ( ie , sa = sr ) , as happens in some types of accessory pathways , and retrograde atrial activation takes similar paths in all forms of avnrt in the same patient , then ha ( fs)+ah ( sf)=(sr+ah)+(sa+ha)=2s . because tachycardia cycle length = ah+ha = s+f , by definition , derivation of the s interval can provide the value of f. if derived fr values are significantly different than those for fa , then the possibility of typical and atypical avnrt using the same anatomic limb for fast conduction is unlikely .
depiction of conduction and resultant ah and ha during typical and atypical atrioventricular nodal re - entrant tachycardia ( avnrt ) types .
a indicates conduction from the av node to right atrium as recorded by the electrode positioned on the his bundle ; ah , time difference between activation of right atrium and the next his ; fa , anterograde conduction over the fast pathway that is used by the fast slow form ; fr , retrograde conduction over the fast pathway ; h , conduction from the av node to his bundle ; ha , time difference between activation of the his bundle and right atrium ; s , conduction over the slow pathway ( anterogradely or retrogradely ) ( see text for details ) .
statistical analysis was performed to compare the measured difference between fr and fa ( frfa ) to the anticipated difference considering the variability between repeated measurements on the same subject . to determine the maximum difference that could be attributed to between - measurement variability
, we measured the ah interval , ha interval , and tachycardia cycle length during the typical form of avnrt and computed fr twice for each patient .
the mean absolute value of the difference between these 2 measurements and its se ( 3.690.44 ms ) was used to estimate 95% confidence intervals for the between - measurement error ( 2.724.66 ms ) . accordingly , using 1 sample t test , we compared the mean of the absolute values of frfa to the upper bound of the 95% confidence interval ( 4.7 ms ) . to further examine the relationship of measured frfa values to an expected between - measurement error , we have plotted measured frfa values together with 95% confidence intervals of between - measurement error , in a manner analogous to a bland altman plot .
statistical analyses were performed using ibm spss statistics version 22 ( ibm corp , armonk , ny ) .
in total , 1299 patients with avnrt were studied at beth israel deaconess medical center , boston , ma , and rhode island hospital , boston , ma ( n=188 ) ; athens euroclinic , athens , greece ( n=287 ) ; the johns hopkins hospital , baltimore , md ( n=271 ) ; and the university of michigan health system , ann arbor , mi ( n=553 ) . using the criteria mentioned above , 20 patients had both typical and atypical avnrt during the electrophysiology study .
the mean age of all patients was 47.6 + -10.9 years ( range , 3275 years ) , and 11 patients ( 55% ) were women . among these 20 patients , 13 patients ( 65% ) displayed atypical avnrt with characteristics compatible with the fast slow type according to both the ah < ha and the ah<200 ms , and 4 patients ( 20% ) had slow
slow form of avnrt . the remaining 3 patients ( 15% ) could not be reliably classified because of inconsistent ah and ha / ah patterns or variable intervals .
typical anterograde conduction jumps during av conduction curves were demonstrated in 11 of 20 patients .
conduction intervals during typical and atypical avnrt of all types typical tachycardia induction during atrial pacing was seen in 8 of 20 patients , and in 2 of them only after isoproterenol infusion .
tachycardia induction with typical anterograde conduction jumps was seen in 9 patients . in 2 patients ,
atypical avnrt was induced by atrial pacing in 3 patients , and by ventricular pacing in 7 patients ( in 1 patient with isoproterenol ) .
no typical retrograde conduction jumps were seen at induction ; in 1 patient , 2:1 retrograde conduction was noted at tachycardia induction .
earliest retrograde activation was variable and documented at the coronary sinus ostium in the majority of patients for both types of avnrt . in all patients , both tachycardias were abolished after anatomic slow pathway ablation . using the strict criteria in this study , 13 patients had both slow fast and fast slow avnrt according to our definitions .
conduction times over the fast pathway during slow fast avnrt ( fr ) and during fast slow avnrt ( fa ) are presented for each patient in figure 2a .
this was significantly different when compared with the estimated between - measurement error ( p=0.0055 ; figure 2b ) .
patients with typical ( slow fast ) and atypical avnrt of the fast slow type a , conduction times over the fast pathway during slow fast atrioventricular nodal re - entrant tachycardia ( avnrt ) ( fr ) and during fast slow avnrt ( fa ) for each patient .
b , scatter plot of the difference in conduction times over the fast pathway during slow fast avnrt ( fr ) and during fast slow avnrt ( fa ) ( frfa ) against mean conduction time over the fast pathway for each patient .
the 95% confidence intervals of the estimated between - measurement error are superimposed ( dotted lines ) for comparison .
in total , 1299 patients with avnrt were studied at beth israel deaconess medical center , boston , ma , and rhode island hospital , boston , ma ( n=188 ) ; athens euroclinic , athens , greece ( n=287 ) ; the johns hopkins hospital , baltimore , md ( n=271 ) ; and the university of michigan health system , ann arbor , mi ( n=553 ) . using the criteria mentioned above , 20 patients had both typical and atypical avnrt during the electrophysiology study .
the mean age of all patients was 47.6 + -10.9 years ( range , 3275 years ) , and 11 patients ( 55% ) were women . among these 20 patients , 13 patients ( 65% ) displayed atypical avnrt with characteristics compatible with the fast slow type according to both the ah < ha and the ah<200 ms , and 4 patients ( 20% ) had slow
slow form of avnrt . the remaining 3 patients ( 15% ) could not be reliably classified because of inconsistent ah and ha / ah patterns or variable intervals .
typical anterograde conduction jumps during av conduction curves were demonstrated in 11 of 20 patients .
typical tachycardia induction during atrial pacing was seen in 8 of 20 patients , and in 2 of them only after isoproterenol infusion .
tachycardia induction with typical anterograde conduction jumps was seen in 9 patients . in 2 patients ,
atypical avnrt was induced by atrial pacing in 3 patients , and by ventricular pacing in 7 patients ( in 1 patient with isoproterenol ) .
no typical retrograde conduction jumps were seen at induction ; in 1 patient , 2:1 retrograde conduction was noted at tachycardia induction .
earliest retrograde activation was variable and documented at the coronary sinus ostium in the majority of patients for both types of avnrt . in all patients , both tachycardias were abolished after anatomic slow pathway ablation .
using the strict criteria in this study , 13 patients had both slow fast and fast slow avnrt according to our definitions .
conduction times over the fast pathway during slow fast avnrt ( fr ) and during fast slow avnrt ( fa ) are presented for each patient in figure 2a .
this was significantly different when compared with the estimated between - measurement error ( p=0.0055 ; figure 2b ) .
patients with typical ( slow fast ) and atypical avnrt of the fast slow type a , conduction times over the fast pathway during slow fast atrioventricular nodal re - entrant tachycardia ( avnrt ) ( fr ) and during fast slow avnrt ( fa ) for each patient .
b , scatter plot of the difference in conduction times over the fast pathway during slow fast avnrt ( fr ) and during fast slow avnrt ( fa ) ( frfa ) against mean conduction time over the fast pathway for each patient .
the 95% confidence intervals of the estimated between - measurement error are superimposed ( dotted lines ) for comparison .
our study represents the largest series of avnrt cases with coexistence of both typical and atypical forms of which we are aware .
interestingly , in the majority of these patients , earliest retrograde atrial activation was detected at the coronary sinus ostium in both types of tachycardia .
our results argue against the conventional notion of a common anatomic fast pathway that supports both slow fast and fast slow avnrt by conducting opposite directions . derived fr and fa values were significantly different in our study , and this difference is unlikely to be because of a between - measurement error . because tachycardia cycle length = f+s , and according to the fixed anatomic model
, both types of avnrt use the same slow pathway , an indirect comparison of fast pathway conduction during typical and atypical avnrt could be also derived by comparing tachycardia cycle lengths .
however , changes in autonomic tone , either spontaneously or after isoprenaline infusion , do not make such a comparison legitimate .
our method of deriving slow pathway values by taking into account both tachycardias in the same patient represents an attempt to overcome this limitation . considering the anatomic models of the avnrt circuit , our results provide further evidence in support of our proposed scheme of re - entry along the posterior nodal extension in all forms of atypical avnrt .
attempts to provide a functional circuit model have also been made by reference to contextual considerations , such as the anisotropic conduction properties of the transitional area between the atria and the av node , and variability in the space constant of tissue and poor gap junction connectivity because of differential expression of connexin isoforms in the nodal area .
regardless of the nature of the re - entry circuit in avnrt , our results suggest that anterograde fast conduction during atypical avnrt is distinct from retrograde fast conduction during typical avnrt .
the main limitation of our study is that we considered a hypothetical model based on theoretical assumptions such as similar anterograde and retrograde conduction velocities for the slow and fast pathways in both types of avnrt .
although studies on orthodromic and antidromic conduction of lateral accessory pathways do not indicate fundamental differences in conduction velocity , whether this is true also for decremental av nodal pathways is not known .
it is likely that much of the difference between anterograde and retrograde conduction properties relates to impedance mismatch between ventricular or atrial muscle and that of the bypass tract .
this does not directly parallel the situation in the av node , and there are no data to allow any definitive conclusion in this respect .
in addition , retrograde atrial activation , in particular , may not take similar paths in all forms of avnrt as accepted in purely anatomic models .
finally , one could argue that using the same data and the same formula , an investigator who believes that there is a single fast pathway can prove that there are discrete slow pathways .
the fact that anatomic slow pathway ablation abolishes both typical and atypical avnrt argues against such a hypothesis although it can not exclude the possibility of anatomically close , but discrete , slow pathways affected by anatomic ablation .
our data provide further evidence that both slow fast and fast slow avnrt do not use the same anatomic pathway for fast conduction .
the main limitation of our study is that we considered a hypothetical model based on theoretical assumptions such as similar anterograde and retrograde conduction velocities for the slow and fast pathways in both types of avnrt .
although studies on orthodromic and antidromic conduction of lateral accessory pathways do not indicate fundamental differences in conduction velocity , whether this is true also for decremental av nodal pathways is not known .
it is likely that much of the difference between anterograde and retrograde conduction properties relates to impedance mismatch between ventricular or atrial muscle and that of the bypass tract .
this does not directly parallel the situation in the av node , and there are no data to allow any definitive conclusion in this respect .
in addition , retrograde atrial activation , in particular , may not take similar paths in all forms of avnrt as accepted in purely anatomic models .
finally , one could argue that using the same data and the same formula , an investigator who believes that there is a single fast pathway can prove that there are discrete slow pathways .
the fact that anatomic slow pathway ablation abolishes both typical and atypical avnrt argues against such a hypothesis although it can not exclude the possibility of anatomically close , but discrete , slow pathways affected by anatomic ablation .
our data provide further evidence that both slow fast and fast slow avnrt do not use the same anatomic pathway for fast conduction .
| background there is evidence that atypical fast slow and typical atrioventricular nodal re - entrant tachycardia ( avnrt ) do not use the same limb for fast conduction , but no data exist on patients who have presented with both typical and atypical forms of this tachycardia .
we compared conduction intervals during typical and atypical avnrt that occurred in the same patient.methods and results in 20 of 1299 patients with avnrt , both typical and atypical avnrt were induced at electrophysiology study by pacing maneuvers and autonomic stimulation or occurred spontaneously .
the mean age of the patients was 47.610.9 years ( range , 3275 years ) , and 11 patients ( 55% ) were women .
tachycardia cycle lengths were 368.043.1 and 365.841.1 ms , and earliest retrograde activation was recorded at the coronary sinus ostium in 60% and 65% of patients with typical and atypical avnrt , respectively .
thirteen patients ( 65% ) displayed atypical avnrt with fast slow characteristics . by comparing conduction intervals during slow fast and fast slow avnrt in the same patient ,
fast pathway conduction times during the 2 types of avnrt were calculated . the mean difference between retrograde fast pathway conduction during slow fast avnrt and anterograde fast pathway conduction during fast
slow avnrt was 41.839.7 ms and was significantly different when compared with the estimated between - measurement error ( p=0.0055).conclusions our data provide further evidence that typical slow fast and atypical fast slow avnrt use different anatomic pathways for fast conduction . |
several adverse health effects ( including cancer and noncancer effects ) may be the result of an imbalance between exogenous and endogenous invading substances and defense mechanisms . in these cases
the probability of an adverse effect depends on how much the exposure to a substance increases or decreases the number of defenders or their efficiency as well as increasing or decreasing the number of invaders . rather than using a dose scale such as parts per million or milligram / kilogram / day in these cases , dose - response models
can directly incorporate the impact of defense mechanisms by using a dose scale that corresponds to the number of invaders that break through the defenders and become free to do their damage .
the number of breakthroughs at a specific age , the cumulative number of breakthroughs by a specific age , or the cumulative number of breakthroughs in a window of time would usually be the appropriate age - dependent dose .
although a lifetime average daily dose level can be used as a surrogate for an age - dependent dose in simplistic dose - response models , the age - dependent dose itself can be used in more biologically based models that include time , reflect the key role of feedback mechanisms , and treat the human body as an age - dependent dynamic system responding to internal and external stimuli and not as a system at equilibrium .
some illustrative biologic examples of defense mechanisms and invader - defender interactions are presented .
several numerical examples are given in which the dose incorporates the age - dependent effects of a substance on the number of invaders , the number of defenders , and/or the defenders ' efficiencies.imagesfigure 1figure 2 | |
cytomegalovirus ( cmv ) infections are commonly reported in severely immunocompromized patients , including those with acquired immunodeficiency syndrome and patients who have received immunosuppressive therapy after transplantation or chemotherapy for malignant disease .
cmv is a ubiquitous member of the herpes virus family and is a dna virus .
the alimentary tract is the target organ of cmv infection , which may affect the gastrointestinal tract anywhere from the mouth to the anus .
the most commonly affected site is the colon , followed by the duodenum , stomach , esophagus and small intestine .
esophagitis , gastritis , duodenitis and enterocolitis are induced by cmv infection in the gastrointestinal tract .
many reports show that cmv infection can cause colitis , ulcers , and , very rarely , pseudopolyps , pseudomembranes and even mass lesions .
the most common manifestations of cmv colitis are diarrhea , fever , gastrointestinal bleeding and abdominal pain .
we report a case of massive upper and lower gastrointestinal bleeding due to cmv - related duodenal and colonic ulcers in an elderly patient treated for non - hodgkin lymphoma .
an 82-year - old turkish woman was admitted to the emergency department for widespread abdominal pain , diffuse arthralgia , dyspnea and weakness in the upper and lower limbs .
she was treated with immunosuppressive drugs for non - hodgkin lymphoma ( diffuse b - cell lymphoma ) six months beforehand . according to the protocol for non - hodgkin lymphoma
, she was given a course of systemic chemotherapy consisting of rituximab , cyclophosphamide , doxorubicin and vincristine .
additionally , she was chronically treated for parkinson disease , diabetes mellitus , hypertension and hypercholesterolemia .
her pain was resistant to painkillers , including non - steroid anti - inflammatory drugs and morphine derivatives .
initial physical examination revealed mild abdominal discomfort , anorexia , nausea and absence of fever .
an examination of the abdomen revealed mild direct tenderness of the epigastrium and the right periumbilical area , but no masses or organomegaly .
routine laboratory investigations revealed : hemoglobin 9.24 g / dl , leukocyte count 18,800/mm , platelet count 128,000/mm , c - reactive protein level 38 mg / dl , international normalized ratio 1.4 , protein level 6.1 g / dl , albumin level 2.8 g / dl .
abdominal computerized tomography showed significant thickening of the wall of the first part of the duodenum , with infiltration of the locoregional fat .
since vital signs were stable , we decided not to perform any urgent endoscopic examinations . at day 9 of hospitalization ,
the patient was transferred to the intensive care unit due to a high risk for major gastrointestinal bleeding .
esophagogastroduodenoscopy was performed and revealed a deep 3 cm - diameter ulcer with blood clots , without fresh blood in the first portion of the duodenum .
three hours after the gastroscopy , the patient still had a low arterial blood pressure ( 70/45 mmhg ) , and her hemoglobin concentration decreased to 6.2 g / dl .
up to 4 hours before surgical exploration , a total of 8 pints of packed red blood cells were transfused . on exploration , intraluminal blood
since the endoscopy showed fresh bleeding from the ulcer , localized in the first part of the duodenum , a distal gastrectomy was performed .
the source - origin of the lower intestinal bleeding could not be precisely evaluated by simultaneous colonoscopy , and the patient underwent total colectomy with end ileostomy .
histological examination of the resected specimen showed focal areas of mucosal ulceration , with an underlying chronic inflammatory infiltrate ( figure 1 ) .
scattered cytomegalic cells were present , with a characteristic owl s eye pattern of intranuclear inclusion , surrounded by a clear halo and a smaller granular cytoplasmic inclusions .
immunostaining for cmv was positive for the cytomegalic cells both in the duodenum and in the colon ( figure 2 ) .
after the pathological diagnosis , cmv polymerase chain reaction on blood was performed and it resulted weakly positive ( 2000 copies / ml in whole blood ; qiagen symphony quantitative real - time pcr , qiagen sample & assay technologies , germany).during the post - operative period , the patient was stable and exhibited a hemoglobin level of 10.2 g / dl with no need of further blood transfusions . because of the severe respiratory distress related to cmv pneumonia , the patient continued to stay in the intensive care unit .
ganciclovir ( 2200 mg / day ) was given intravenously to treat the cmv disease .
the tough ache complaints ( such as arthralgia or epigastric pain ) that were resistant to traditional painkillers ( non - steroid anti - inflammatory drugs and morphine derivatives ) , dissolved particularly after ganciclovir treatment . on day 16 , the patient died from cardiorespiratory complications .
this is due to the increasing number of immunosuppressive medications , intensive cancer chemotherapy use , recurrent transplantations , progressively aging population , and the higher number of human immunodeficiency virus infections .
cmv infection often develops latently , after acute infection , with no evidence of signs or symptoms .
this disease is often diagnosed thanks to a pathologic and serologic examination , since the clinical symptoms are not specific .
the symptoms of cmv in the alimentary tract can range from mild anorexia to obvious hemorrhage and perforation .
this virus can infect any part of the gastrointestinal tract , from the mouth to the anus , with the colon being the most commonly affected organ , and the stomach and small bowel being relatively affected . additionally , the sigmoid colon and the rectum are the most affected portions of colon .
the antrum is the most common site affected by cmv in the upper gastrointestinal tract .
the clinical presentation of cmv disease in the gastrointestinal tract is multiple , with symptoms such as odynophagia , hematemesis , dyspepsia - like symptoms , diarrhea , rectal bleeding and even intestinal perforation .
however , cmv may also rarely involve the duodenum , causing duodenitis and presenting with upper gastrointestinal bleeding .
the present case describes the first cmv infection of both duodenum and colon , simultaneously presenting with bleeding .
it is difficult to recognize the cmv infection of the gastrointestinal tract , however , it can be suspected in febrile immunocompromized patients with gastrointestinal signs and symptoms .
the endoscopic features are relatively variable and may include macroscopically normal mucosa , diffuse erythema , nodules , pseudotumors , erosions and ulcers .
cmv infection can not be initially demonstrated on gastrointestinal biopsies , but it can be exactly diagnosed using the specimens collected during surgery .
since the virus is located in deep tissue , biopsies should be performed deeply enough to obtain endothelial cells and fibroblasts within the lamina propria .
the owl s eye pattern is the hallmark of cmv infection in microscopic evaluation ; however , classical intranuclear inclusions are not always found because cmv may infect the vascular endothelium or the stromal cells under ulcers as well as the mucosal epithelium .
serology , on the other side , is not sufficient to diagnose the disease . of note , as a limitation of our case report , cmv molecular biology was not performed ; however , histopathological changes suggestive for cmv infection were detected only in the surgical specimen and not in the specimen taken during endoscopy . in the present case , the initial complaints of our patient were widespread abdominal pain , diffuse arthralgia and weakness in the upper and lower limbs .
after microscopic evaluation of a specimen , hypertrophy was detected in nerve cells , justifying the intense pain complained by our patient .
meyer et al . reported neural hyperplasia in cmv infection likely due to cmv inclusions and acute inflammatory changes .
another important point in our report was the improvement in pain symptoms following ganciclovir treatment , likely related to recovery of neural hyperplasia .
systemic antiviral treatment has resulted in dramatically improved outcomes , and the treatment time usually ranges from 1 to 4 weeks .
the gastrointestinal complications of cmv infection , which include massive hemorrhage , toxic megacolon , perforation and stenosis , necessitate surgical resection . due to the high risk of complications and mortality from cmv infection in the elderly , all older patients must be offered antiviral treatment as soon as possible . in our case , delay in diagnosis and treatment onset were strongly associated with the fatal outcome .
most gastrointestinal cmv infections respond well to ganciclovir treatment , independently from the cause of the underlying immunosuppression .
early diagnosis of suspected cmc infection in immunosuppressed patients with gastrointestinal symptoms is of the utmost importance .
it should not be forgotten that delayed diagnosis and treatment might increase the morbidity and mortality from cmv infection with major gastrointestinal bleeding . | in recent years , cytomegalovirus ( cmv ) has been recognized as an important common pathogen in immunocompromized patients .
this is due to the increasing number of immunosuppressive medications , intensive cancer chemotherapy use , recurrent transplantations , progressively aging population , and the higher number of human immunodeficiency virus infections .
cytomegalovirus infection especially interests the gastrointestinal tract , anywhere , from the mouth to the anus .
namely , the most commonly affected area is the colon , followed by duodenum , stomach , esophagus and small intestine .
the most frequent manifestations of cmv colitis are : diarrhea , fever , gastrointestinal bleeding and abdominal pain .
we report here the case of an 82-year - old woman , who was treated for non - hodgkin lymphoma ; she was admitted to the emergency department for abdominal pain and diffuse arthralgia , following massive upper- and lower- gastrointestinal bleeding , due to duodenal and colonic ulcers related to cmv infection . |
in the beginning of october 2014 , six children who were vomiting and experiencing abdominal cramping and diarrhea were admitted to the local hospital in gyeongsangnam - do , republic of korea ( south korea ) .
all patients attended the same daycare center that provided care and food to children from low - income families .
fecal specimens from 6 patients were submitted to the local public health laboratory and were processed according to a standard bacterial culture method . on october 6 ,
korea centers for disease control and prevention was notified that s. sonnei phase ii were identified from all fecal samples . an epidemiologic investigation was conducted to determine the extent of the outbreak and to identify the mode of transmission .
a confirmed case was identified by passive and active case - finding on the basis of laboratory - identified s. sonnei isolates in the fecal specimens of center attendees and staff members , families of the children , and persons in the community .
a probable case was defined as a person with any shigellosis symptoms and an epidemiologic link to infected patients whose cultures were negative .
the children s guardians were interviewed by using a standardized questionnaire that requested information on symptoms , food consumption , recent travel history , and contact persons .
this investigation was part of a public health emergency response and was accordingly exempt from institutional review board approval .
the investigation revealed that an 8-year - old boy ( the index case - patient in this outbreak ) had recently returned after visiting family in vietnam , where s. sonnei infection is highly endemic .
he had experienced sustained diarrheal episodes since his return , and after returning to the daycare center , children in the daycare center began having similar symptoms .
cases of shigellosis were also identified among the grandparents of the index case - patient and a person the family visited in a geographically distant location on september 27 .
no isolates were obtained from the environmental samples collected , including foods , drinking water , and surface swab specimens of the daycare facility .
the median age of the patients in the daycare center was 7.8 ( range 413 ) years .
overall , the reported symptoms were diarrhea ( 3 loose stools during 24 hours ) and abdominal cramping ; 4 patients were asymptomatic but their stool samples were culture - positive .
of the 15 persons who became ill ( figure 1 ) , 10 were treated with cefotaxime or ciprofloxacin , after which their stool samples were culture - negative . for 5 patients with continuing positive fecal culture , antibiotic drug treatment
was later changed to cabapenems ( meropenem or imipenem ) . according to local infection control guidelines
, symptomatic patients were isolated in single - bed rooms until 2 consecutive fecal cultures tested negative for s. sonnei . to prevent the further spread of the disease , public health interventions were encouraged during the outbreak period : enforced handwashing at predetermined times at the daycare facility , strict hygiene measures in affected households , education about shigellosis , and environmental disinfection of the facility .
epidemic curve of the outbreak of illness caused by shigella sonnei infection , by symptom onset date , south korea , 2014 .
black bar sections indicate laboratory - confirmed cases ; white bar sections indicate probable cases ; stars indicate cases found in daycare center .
arrows indicate dates of the events for an index case - patient with travel history to vietnam and of public health notification of the outbreak .
laboratory - confirmed strains of s. sonnei were sent to korea national institute of health for further characterization .
all 15 isolates had identical or highly similar pulsed - field gel electrophoresis ( pfge ) patterns after the xbai digestion of chromosomal dna . the main pfge pattern of this outbreak ( sznx01.183 ; pfge pattern number assigned by korea national institute of health ) had not been previously reported in domestic cases , and the isolate was genetically indistinguishable from a ciprofloxacin - resistant s. sonnei strain isolated from a traveler returning from vietnam during 2012 ( figure 2 ) . xbai pulsed - field gel electrophoresis patterns of shigella sonnei strains identified during a 2014 outbreak in south korea and 2 isolated from samples from persons in vietnam .
the dendrogram was constructed by using dice coefficient and upgma clustering , with 1.5% optimization and 1.5% position tolerance .
antibiotic resistance profiles and resistance determinants to extended - spectrum cephalosporins and fluoroquinolones are plotted next to the dendrogram .
all strains had qrdr mutations gyra(s83l , d87 g ) and parc(s80i ) . * strains 14 - 5222 and 12 - 3580 originated in vietnam .
amp , ampicillin ; cip , ciprofloxacin ; ctx , cefotaxime ; nal , nalidixic acid ; tet , tetracycline ; sxt , trimethoprim / sulfamethoxazole ; qrdr , quinolone resistance determining region .
scale bar indicates percentage relatedness . on the basis of mics of antimicrobial agents determined by using a broth microdilution method ( 5 ) ,
the outbreak strains were found to be resistant to both extended - spectrum cephalosporins ( cefotaxime , mic > 32 g / ml ) and fluoroquinolones ( ciprofloxacin , mic > 8 g / ml ) .
the strains were also resistant to tetracycline and trimethoprim / sulfamethoxazole but were susceptible to chloramphenicol , gentamicin , amikacin , and carbapenem . for azithromycin , an alternative oral agent for shigellosis ,
extended - spectrum -lactamase ( esbl ) typing by using pcr and further sequencing ( 6 ) showed that all isolates carried the blactx - m-15 and blatem-1 genes .
esbl plasmid of s. sonnei isolate from the index case - patient were successfully transferred to the recipient e. coli j53 azi strain .
pcr - based inc / rep typing and pmlst analysis of a transconjugant strain ( 7,8 ) showed that this esbl plasmid was of the st16/inci1 type , which was previously identified in strain pkhsb1 from vietnam ( 9 ) .
the genetic environment of the blactx - m-15 gene was analyzed by pcr and sequencing with specific primers for the insertion sequences isecp1 and orf477 ( 6 ) .
an intact isecp1 and truncated orf477 were identified at 48 bp upstream and downstream of the bla gene , which has also been found in ctx - m-15-encoding plasmids from enterobacteriaceae ( 6,9,10 ) .
the outbreak strains had 2 mutations in the quinolone resistance - determining region of gyra ( ser83leu and asp87gly ) and 1 mutation in parc ( ser80ile [ figure 2 ] ) , which have been reported to be responsible for ciprofloxacin resistance in s. sonnei ( 11 ) .
however , gyrb and pare mutations and plasmid - mediated quinolone resistance genes were not detected ( 12 ) .
we describe a shigellosis outbreak affecting children attending a daycare center , their family members , and residents of the surrounding community . to limit the extent of the outbreak , laboratory investigations of outbreak strains and infection - control measures including contact isolation and hand hygiene were immediately implemented , which may have contributed to preventing the further spread of this multidrug - resistant s. sonnei strain .
the outbreak strain was resistant to extended - spectrum cephalosporins and fluoroquinoloness and was introduced by a daycare center attendee who had returned from travel to vietnam .
the blactx - m-15 gene in s. sonnei was first described in 2005 ( 13 ) and since then has been reported worldwide ; we described an outbreak of ctx - m-15producing s. sonnei in korea in 2008 ( 6 ) .
the pfge pattern of the 2008 outbreak strain ( sznx01.176 ) showed only 82.8% genetic similarity with that of the outbreak strains of the current study but was observed in several traveler - associated cases originating from china .
these findings suggest that , despite the lack of direct evidence , various antimicrobial drug
resistant s. sonnei clones have been imported across geographic regions and may eventually spread globally and lead to increased illness and death rates . in summary , we report a shigellosis outbreak in south korea caused by a ciprofloxacin - resistant ctx - m-15producing s. sonnei strain that originated from vietnam .
because international travel can contribute to the spread of multidrug - resistant pathogens , enhanced surveillance is necessary to control the dissemination of antimicrobial drug resistance .
improved hygiene , infection control plans , and better education for travelers are also required . | we investigated an october 2014 outbreak of illness caused by shigella sonnei in a daycare center in the republic of korea ( south korea ) .
the outbreak strain was resistant to extended - spectrum cephalosporins and fluoroquinolones and was traced to a child who had traveled to vietnam . improved hygiene and infection control practices are needed for prevention of shigellosis . |
a throwing event is a sports competition that displays a player s ability to throw an
object , such as a shot put , discus , javelin , or hammer . to achieve a high level of
performance in this sport , total physical fitness , including explosive muscle power ,
flexibility , agility , and coordination is required1 .
in particular , core and low extremity muscles are considered to be
important muscles for creating a greater rotatory force and maximum speed2 , 3 .
the core muscle is found to improve the performance of athletes by increasing balance , as
well as trunk and lower extremity strength in various sports , including short - distance
running , volleyball , and golf , as core muscle training exercises enhance the stability of
the lumbus and spine balance by increasing the musculus transversus abdominis
contraction4,5,6,7,8,9 .
thus , the core exercise
program , which maximizes the mobility and stability of the core muscles , is greatly
emphasized for athletes11 .
although previous studies examined the effect of core exercises on isokinetic muscle
functions in various sports5,6,7,8 , 12 , only limited studies are
available to establish an effective and practical muscle training program focusing on
throwing events in particular . therefore , this study aimed to investigate the effect of
peculiar complex core balance training on isokinetic muscle function of the knee joint and
lumbus to provide fundamental data for establishing a training program that improves the
performance and prevention of injury by developing the core and low extremity muscles .
a total of ten high school athletes , who have been performing in throwing events for over
five years , participated in this study .
the subjects were randomly divided into two groups :
the experimental group ( n=5 ) and the control group ( n=5 ) .
the experimental group underwent
peculiar complex core balance training ( 60 min / three times a week/16 weeks ) while the
control group did not participate in such training .
all subjects were educated about the
content and purpose of the experiment and provided written informed consent before beginning
the study .
a peculiar complex core balance training program was established based on
previous studies13 with two sports
training and conditioning experts , and three current throwing coaches ( table 1table 1.peculiar complex core balance training programstage 1 ( week 14 ) programcore exercisesling exercisestraight leg lifts , twisted waist oblique crunches , butt raises ,
shoulder - to - knee leg overs , side to side planks , plank with hip drops , around the
world plank , bridge plank , straight plank , mountain climbers , side plank hip
abduction with a twist , spiderman plank , side planks with reachsuspended plank , suspended single plank , suspended double pike ,
reverse , climber , outsiders , roll - outs , bicep curl , push curl , single - leg lunge ,
hamstring curl , hip raise , oblique twist , tricep extension , rear deltoid ,
captain america workout intensity = rpe 1314 , 10 rep 3 set ; duration = 50
min ; rest = 1 min between setstage 2 ( week 510 ) programcore exercisesling exercisesky reachers , sit - up , feet up crunch , bicycle pausers , fast
bicycles , extended reverse crunch , compound push up , burpees , dynamic push up ,
leaping lunges , bring knee to elbow on the way down , ski abs , plank squatsbicep curl , push curl , single - leg lunge , hamstring curl , hip
raise , oblique twist , tricep extension , rear deltoid , captain america workout ,
suspended crunch 1 & 2 , pendulum 1 & 2 , standing body crunch , standing
oblique twist , suspended oblique crunchintensity = rpe 1314 , 15 rep 3 set ; duration = 60
min ; rest = 1 min between setstage 3 ( week 1116 ) programcore exercisesling exercisesingle rowers , supermans , oppo - raisers , bird dogs , throw downs , hip
to hip , hand walk - outs , , bicycle pausers , plank push up , side plank rotation ,
side planks reach throughs , tricep dip oblique crunches , hip thrust , grass
hoppers , russian twist , bicycle crunchbicep curl , push curl , single - leg lunge , hamstring curl , hip
raise , oblique twist , tricep extension , rear deltoid , captain america workout ,
suspended crunch 1 , suspended crunch 2 , pendulum 1 , pendulum 2 , standing body
crunch , standing oblique twist , suspended oblique crunchintensity = rpe 1314 , 20 rep 3 set ; duration = 60
min ; rest = 1 min between set ) .
the training consisted of 16 weeks of mat , medicine ball , and sling training , focusing on
the development of core muscles with three stages , including basic balancing and muscle
adaptation ( 4 weeks ) , kinetic balancing and muscle development ( 6 weeks ) , and complex
training of kinetic balancing and muscle development ( 6 weeks ) .
the intensity of training
was decided by rating the perceived exertion ( rpe)14 . in this study
all subjects
underwent measurement of the lower extremity ; lumbus muscular strength was measured by
isokinetic measurement equipment ( cyber-770 , lumax .
all experiments were thoroughly
reviewed and approved by the institutional review board of daegu university .
the means and standard deviations of the two groups
were calculated , and the analysis of covariance ( ancova ) was conducted to examine the
differences between the groups and between measurement time points .
the results of the ancova indicate a significant effect of peculiar complex core balance
training and difference between the experimental and control groups .
first , in terms of the
change of isokinetic strength of the knee joint , ancova [ between - subjects factor : group
( experimental , control ) ; covariate : time ( pre - post ) ] revealed the main effects of group and
time in all measurements ( p<0.05 ) , excluding extension of muscle power ; the interaction
between group and time in extension of muscle power was also significant ( p<0.05 ) ( table 2table 2.result of ancova for knee joint strength and muscle powertypeexperimental groupcontrol group strength ( nm)lextensionpre254.614.2258.121.6post268.417.3260.219.7**flexionpre207.011.6198.311.2post224.913.6201.218.3*rextensionpre268.420.3257.421.6post270.719.1256.396.0**flexionpre181.618.3189.614.2post210.121.3194.415.7*muscle power ( nm)lextensionpre57.214.154.110.5post72.112.156.911.2**flexionpre145.210.1143.516.3post158.213.8143.817.1*rextensionpre68.117.269.810.1post75.116.370.120.7**flexionpre156.210.1158.109.1post162.209.3158.417.3*values are meansd . significantly different ( * * p<0.01 , * p<0.05 ) from the
experimental group . significantly different ( p<0.05 ) between pre and
post in the experimental group .
significant interaction ( p<0.05 )
between group and time in the experimental group ) .
values are meansd . significantly different ( * * p<0.01 , * p<0.05 ) from the
experimental group . significantly different ( p<0.05 ) between pre and
post in the experimental group .
significant interaction ( p<0.05 )
between group and time in the experimental group secondly , regarding the change of isokinetic strength of the lumbus , ancova
[ between - subjects factor : group ( experimental , control ) ; covariate : time ] revealed the main
effects of group and time in all measurements ( p<0.05 ) ; the interaction between groups
and time in flexion of strength ( p<0.05 ) and extension of muscle power ( p<0.05 ) were
also significant ( table 3table 3.results of ancova for lumbus strength and muscle powertypeexperimental groupcontrol groupstrength ( nm)extensionpre297.121.8288.222.3post317.119.3291.322.0**flexionpre334.217.7335.220.1post359.219.1339.219.2*muscle power ( nm)extensionpre354.122.6361.220.2post369.118.0368.111.2**flexionpre321.114.2319.220.2post342.220.1324.116.3*values are meansd . significantly different ( * * p<0.01 , * p<0.05 ) from the
experimental group .
significant interaction ( p<0.05 )
between group and time in the experimental group ) .
therefore , the isokinetic muscle function of the knee joint and the lumbus
in the experimental group was significantly increased compared to the control group .
values are meansd . significantly different ( * * p<0.01 , * p<0.05 ) from the
experimental group . significantly different ( p<0.05 ) between pre and
post in the experimental group .
core exercises mostly include the raising of legs and arms in the supine position to create
resistance in the abdomen and waist .
core muscle training also helps athletes develop and
maintain total body balance . throwing , in particular , requires the creation of a unified
movement by connecting various steps of positions to maximize the performance , and the core
muscles are especially important1 .
strong
core muscle training is especially important to improve the distribution of kinetic
efficiency to the whole body15 .
core
muscle training improves the following fitness components : muscle strength , endurance ,
agility , speed , balance , and the nervous system , including the vestibular system and the
proprioceptive system4 , 16,17,18 . in this study ,
peculiar complex core balance training
significantly increased the isokinetic strength of the knee joint and lumbus .
this result is
consistent with previous studies , which suggest a positive effect of core muscle training on
the lower extremity and lumbus muscle reinforcement5,6,7,8 , 12 .
according to yang s study12 , a 12-week
core training increased isokinetic muscle power of the knee joint and lumbar in
short - distance athletes .
kim and chung5
conducted a 10-week core exercise program for athletes , and found lumbar strength increased .
a study by shin , kim , and park6 showed
that a 4-week core exercise program had a positive impact on lumbar strength in golfers .
han , kim , and hyun7 reported that a
12-week specificity core balance training increased the isokinetic muscular functions of the
knee joint and lumbar in high school volleyball players .
moreover , song and hong s
study8 indicated that an 8-week core
strengthening program had a positive impact on knee extensor and flexor muscular strength in
college baseball players . in conclusion , this study found a positive effect on peculiar complex core balance training
on the isokinetic muscle functions of the knee and lumbus in throwing event athletes .
therefore , core balance training would improve the performance of throwing event athletes by
improving balance and distribution of kinetic energy through the arms and legs .
hence ,
establishing an effective core training program that incorporates a mat , medicine ball , and
sling training , as this study has utilized , is required for athletes .
it is also worthy to
note that this kind of core balance training prevents injury as well .
although the results
of this study indicated that peculiar complex core balance training develops the isokinetic
muscle function in throwing event athletes , more specific and diverse research is necessary
to identify how exercises can be integrated into an ideal physical activity program that
caters to each athlete s own characteristics ( e.g. , age , gender , exercise career , and etc . )
and type of sport . | [ purpose ] this study aimed to investigate the effect of peculiar complex core balance
training on the isokinetic muscle function of the knee joint and lumbus to provide
fundamental data for establishing a training program that focuses on improving the
performance and prevention of injury by developing the core and low extremity muscles .
[ subjects and methods ] the participants in this study included a total of ten high school
athletes involved in a throwing event for over five years .
the subjects were randomly
divided into two groups : the experimental group ( n=5 ) and the control group ( n=5 ) .
the
experimental group underwent peculiar complex core balance training .
[ results ] according
to the analysis of covariance , there was a significant effect of peculiar complex core
balance training
. therefore , the isokinetic muscle function of the knee joint and lumbus
in the experimental group participating in peculiar complex core balance training was
significantly increased compared to the control group .
[ conclusion ] it is concluded that
peculiar complex core balance training had a positive effect on the isokinetic muscle
function of the knee and lumbus in throwing event athletes . |
three - dimensional ( 3d ) culture systems have recently gained increasing recognition as an effective tool for biological and biomedical research . compared to conventional monolayer culture systems ,
they have closer resemblance to the cells growing in the in vivo tissue environment ( 2 ) .
they further contain specific characteristics similar to the corresponding tissues in vivo and can stay active and functional for weeks ( 3 ) .
it is important to study the cells growth , proliferation and response to chemical agents in an environment organized with cell to cell and cell to matrix interactions plus a well - defined morphological geometry .
monolayer cell culture systems of cancer cell lines are commonly used to evaluate the antitumor effects of anticancer drugs ( 5 ) .
most tumor cells are supported by an extracellular matrix microenvironment , with an important role in resistance against anticancer drugs ( 6 ) .
three - dimensional culture systems have allowed the study of cell - to - cell interactions and tumor - mediated angiogenesis ( 3 ) .
in addition , spheroid cultures that use a compound derived from basement membrane , organotypic cultures , and soft agar cultures as well as cells embedded in collagen gel have been developed to investigate the biology of cancer cell lines ( 7 ) .
we have used the collagen extracted from persian gulf squid ( uroteuthis duvauceli ) as a 3d culture system to study the capacity of pectic acid to inhibit tumor cells growth in mda - mb-231 breast cancer cells .
whole apple extract can inhibit mammary cancer in a dose - dependent manner in rat model ( 8) . the major component of apple is a kind of polysaccharide called pectin .
dietary pectic and its degradation products ( pectic oligosaccharides ) caused decreased proliferation in ht-29 cells ( 9 ) .
there are a number of studies related to pectic ( mostly citrus pectin ) and cancer .
studies on the effect of pectic on different types of cancers such as blood - borne , prostate and colorectal indicated that pectic intake was beneficial to inhibit tumor growth and metastasis ( 10 , 11 ) .
in addition , the effect of apple pectic on colon cancer through enhancement of apoptosis and inhibition of tumor formation has been reported both on animal and cellular models ( 12 , 13 ) .
the main objective of this research was to apply the collagen extracted from persian gulf squid as a biomaterial to be used in cell culture systems in order to study the development of anticancer drugs and treatments .
the skin was mechanically separated from the squid body , defatted in 10% butyl alcohol , and rinsed in acetic acid and nacl .
the total collagen obtained was determined according to aoac using standard procedures ( 15 ) .
ssd - page analysis was performed on 12% resolving gel and 5% stacking gel ( 16 ) .
the crude extracted collagen was dissolved in phosphate buffer containing 1% sds and 0.5 m urea ( merck ) ( 17 ) to give a final concentration of 5mg / ml . the gels were stained with coomassie brilliant blue r-250 ( merck ) and detained in methanol / acetic acid .
the mda - mb-231 cell line was obtained from ncbi ( national cell bank of iran ) .
the cells were grown in rpmi 1640 medium ( gibco ) in tissue culture flasks at 37 c in 5% co2 until reaching confluence .
the medium contained 10% fetal calf serum ( fcs ) ( gibco ) and 0.1% penicillin - streptomycin .
the cells were detached with 0.25% ( w / v ) trypsin edta ( sigma ) .
cell number and viability was determined using trypan blue ( sigma ) exclusive dye and hemocytometer .
the extracted collagen was prepared at 5 mg / ml concentration by suspending in sterile 0.01 m acetic acid and stirring overnight at 4 c . the gel was prepared on ice by adding dmem / ham f12 3x , 5% fbs and naoh to neutralize its acidity . to form the gel ,
then , mda - mb-231 cells were decanted onto the collagen in two models : collagen - coated and collagen gel ( collagel ) . for both models ,
mda - mb-231 cells were treated with different concentrations of pectic acid ( 0 , 0.5 , 1.5 , 3 mg / ml ) for 24 and 48 h. the effect of pectic acid on cell proliferation was measured using mtt - based assay .
the cells were incubated with 10l of 5mg / ml mtt ( 3-[4 , 5-dimethylthiazole-2-yl]-2 , 5-diphenyltetrazoliumbromide ) solution for 3 h in phosphate - buffered saline ( pbs ) . the formazan crystals produced from mtt were dissolved in dmso , and their absorbance was recorded by elisa reader at 630 nm .
the proliferation rate ( pr ) was calculated based on the following formula :
pr percentage=[absorbance of drug treatmentgroupabsorbance of blank / absorbance of controlgroupabsorbance of blank]100 . all the experiments were done at least 3 times , and the data were shown as mean standard error of the mean ( sem ) . the results were analyzed for significance using anova test with tukey s post hoc test .
the skin was mechanically separated from the squid body , defatted in 10% butyl alcohol , and rinsed in acetic acid and nacl .
the total collagen obtained was determined according to aoac using standard procedures ( 15 ) .
ssd - page analysis was performed on 12% resolving gel and 5% stacking gel ( 16 ) .
the crude extracted collagen was dissolved in phosphate buffer containing 1% sds and 0.5 m urea ( merck ) ( 17 ) to give a final concentration of 5mg / ml . the gels were stained with coomassie brilliant blue r-250 ( merck ) and detained in methanol / acetic acid .
to characterize the extracted collagen , mda - mb-231 breast cancer cell line was grown on the squid collagen .
the mda - mb-231 cell line was obtained from ncbi ( national cell bank of iran ) .
the cells were grown in rpmi 1640 medium ( gibco ) in tissue culture flasks at 37 c in 5% co2 until reaching confluence .
the medium contained 10% fetal calf serum ( fcs ) ( gibco ) and 0.1% penicillin - streptomycin .
the cells were detached with 0.25% ( w / v ) trypsin edta ( sigma ) .
cell number and viability was determined using trypan blue ( sigma ) exclusive dye and hemocytometer .
the extracted collagen was prepared at 5 mg / ml concentration by suspending in sterile 0.01 m acetic acid and stirring overnight at 4 c .
the gel was prepared on ice by adding dmem / ham f12 3x , 5% fbs and naoh to neutralize its acidity . to form the gel ,
then , mda - mb-231 cells were decanted onto the collagen in two models : collagen - coated and collagen gel ( collagel ) . for both models ,
mda - mb-231 cells were treated with different concentrations of pectic acid ( 0 , 0.5 , 1.5 , 3 mg / ml ) for 24 and 48 h.
the effect of pectic acid on cell proliferation was measured using mtt - based assay .
the cells were incubated with 10l of 5mg / ml mtt ( 3-[4 , 5-dimethylthiazole-2-yl]-2 , 5-diphenyltetrazoliumbromide ) solution for 3 h in phosphate - buffered saline ( pbs ) .
the formazan crystals produced from mtt were dissolved in dmso , and their absorbance was recorded by elisa reader at 630 nm .
the proliferation rate ( pr ) was calculated based on the following formula :
pr percentage=[absorbance of drug treatmentgroupabsorbance of blank / absorbance of controlgroupabsorbance of blank]100 .
all the experiments were done at least 3 times , and the data were shown as mean standard error of the mean ( sem ) . the results were analyzed for significance using anova test with tukey s post hoc test .
the collagen content of the outer sheath of squid skin is high ( 18 ) .
the skin collagen content of persian gulf squid was about 3% , the extracted collagen contained low amounts of fat ( 0.5% ) and approximately 98% moisture ( table 1 ) . in sds - page pattern ,
the extracted collagen contained two chains , one chain and chain components ( 1 about 50 kda and 2 about 80 kda ) ; accordingly , it was similar to type i collagen ( fig .
sds - page patterns of squid collagen showing that the collagen extracted from squid contained and chains physicochemical properties of collagen extracted from persian gulf squid mda - mb-231 cells displayed flat cell bodies and a sheet - like monolayer spread over the culture plates in 2d in vitro system . to investigate the extracted collagen as a scaffold for cell culture
, mda - mb-231 cells were cultured in squid collagen gels for a period of four days .
additionally , the cells began to proliferate and show cell - to - cell interactions , especially in collagen - coated cultures ( fig .
these interactions ( cell to cell and cell to matrix ) closely resembled in vivo biological systems .
mda - mb-231 cells 48 h after cell cultivation on collagen extracted from persian gulf squid .
3d population of cells can be seen in the collagen cultures ( 100x ) in order to peruse the proliferation of mdamb-231 cells on collagen , the cells were cultivated on the squid collagen , and their proliferation rate was assessed for a period of 72 h. mtt test showed that the proliferation rate of cells was increased in collagen - coated plates after 24 h ( fig .
mda - mb-231 cells cultivated on the squid collagen did not show the same increase in proliferation rate as did the coated cells .
the proliferation rate of the cells was significantly increased after 48 h in both the coated and squid collagen cultures , and the cells density was so high in 96 h tests ( fig .
mda - mb-231 cells cultured in the collagen extracted from squid . as shown , proliferation rate is higher in the cultures containing collagen .
each value shown is meansd ( n=8 ) . * significantly different from cells grown in 2d condition ( * * p<0.01 , * * * p<0.001 ) in the first step , cell proliferation assay was performed to determine the effect of pectic acid on mda - mb-231 cells . to reach this goal ,
mdamb-231 cells were treated with different concentrations of pectic acid ( 0 , 0.5 , 1.5 , 3 mg / ml ) for 24 h. fig .
4 indicate that pectic acid inhibited cell growth and reduced the number of attached cells after 24 h. in this condition , degenerative changes like loss of cell sheet were detected .
thus , pectic acid had a cytotoxic effect on mdamb-231 cells in 2d in vitro system .
subsequently , the culture of mda - mb-231 cells on the squid collagen was treated with pectic acid .
even higher concentration of pectic acid ( 3 mg / ml ) could not inhibit the mda - mb-231 cells growth both on collagen - coated and collagel cultures ( fig .
treatment with pectic acid for 24 h in 2d conventional condition inhibited the growth of mda - md-231 cells while pectic acid could not affect the cells in collagen - coated cultures .
columns show percent viable cells ( n=8 ) ; * * indicate significant differences ( p<0.01 ) treatment with pectic acid for 24 h on the collagel culture obtained from the squid indicated no significant effect .
columns show percent viable cells ( n=8 ) ; * * indicates significant differences ( p<0.01 ) to verify this result , higher concentrations of pectic acid ( 5 and 10 mg / ml ) were applied on the cells . in these circumstances ,
morphological analysis of the cells indicated no obvious changes in culture of mdamb-231 cells on the squid collagen ( coated and collagel ) in presence of pectic acid ( fig .
7 ) ; how - ever , the cells treated with pectic acid in 2d cultures showed changes such as irregular cell walls and cell debris in the medium . the majority of cells were floating , became rounded , and detached from the surface ( fig . 8) .
therefore , the collagen extracted from squid could mimic 3d culture conditions through increased resistance of cells to chemical agents .
treatment with higher concentrations of pectic acid for 24h on the collagel culture inhibited the growth of mda - mb-231 cells .
columns show percent viable cells ( n=4 ) ; * * indicates significant differences ( p<0.01 ) morphological changes of mda - mb- 231 cells treated with pectic acid on the collagen extracted from squid .
there is no significant change in cell morphology compared to control cells ( 100x ) morphological changes of the mda - mb- 231 cell treated with pectic acid on 2d conventional culture system .
cell debris and irregular rounded cell shapes are seen by increasing of pectic acid concentration ( 100x )
the collagen content of the outer sheath of squid skin is high ( 18 ) .
the skin collagen content of persian gulf squid was about 3% , the extracted collagen contained low amounts of fat ( 0.5% ) and approximately 98% moisture ( table 1 ) . in sds - page pattern ,
the extracted collagen contained two chains , one chain and chain components ( 1 about 50 kda and 2 about 80 kda ) ; accordingly , it was similar to type i collagen ( fig .
sds - page patterns of squid collagen showing that the collagen extracted from squid contained and chains physicochemical properties of collagen extracted from persian gulf squid
mda - mb-231 cells displayed flat cell bodies and a sheet - like monolayer spread over the culture plates in 2d in vitro system . to investigate the extracted collagen as a scaffold for cell culture
, mda - mb-231 cells were cultured in squid collagen gels for a period of four days .
additionally , the cells began to proliferate and show cell - to - cell interactions , especially in collagen - coated cultures ( fig .
these interactions ( cell to cell and cell to matrix ) closely resembled in vivo biological systems .
mda - mb-231 cells 48 h after cell cultivation on collagen extracted from persian gulf squid .
in order to peruse the proliferation of mdamb-231 cells on collagen , the cells were cultivated on the squid collagen , and their proliferation rate was assessed for a period of 72 h. mtt test showed that the proliferation rate of cells was increased in collagen - coated plates after 24 h ( fig .
mda - mb-231 cells cultivated on the squid collagen did not show the same increase in proliferation rate as did the coated cells .
the proliferation rate of the cells was significantly increased after 48 h in both the coated and squid collagen cultures , and the cells density was so high in 96 h tests ( fig .
mda - mb-231 cells cultured in the collagen extracted from squid . as shown , proliferation rate is higher in the cultures containing collagen .
each value shown is meansd ( n=8 ) . * significantly different from cells grown in 2d condition ( * * p<0.01 , * * * p<0.001 )
in the first step , cell proliferation assay was performed to determine the effect of pectic acid on mda - mb-231 cells . to reach this goal ,
mdamb-231 cells were treated with different concentrations of pectic acid ( 0 , 0.5 , 1.5 , 3 mg / ml ) for 24 h. fig .
4 indicate that pectic acid inhibited cell growth and reduced the number of attached cells after 24 h. in this condition , degenerative changes like loss of cell sheet were detected .
thus , pectic acid had a cytotoxic effect on mdamb-231 cells in 2d in vitro system .
subsequently , the culture of mda - mb-231 cells on the squid collagen was treated with pectic acid .
even higher concentration of pectic acid ( 3 mg / ml ) could not inhibit the mda - mb-231 cells growth both on collagen - coated and collagel cultures ( fig .
treatment with pectic acid for 24 h in 2d conventional condition inhibited the growth of mda - md-231 cells while pectic acid could not affect the cells in collagen - coated cultures .
columns show percent viable cells ( n=8 ) ; * * indicate significant differences ( p<0.01 ) treatment with pectic acid for 24 h on the collagel culture obtained from the squid indicated no significant effect .
columns show percent viable cells ( n=8 ) ; * * indicates significant differences ( p<0.01 ) to verify this result , higher concentrations of pectic acid ( 5 and 10 mg / ml ) were applied on the cells . in these circumstances ,
morphological analysis of the cells indicated no obvious changes in culture of mdamb-231 cells on the squid collagen ( coated and collagel ) in presence of pectic acid ( fig .
7 ) ; how - ever , the cells treated with pectic acid in 2d cultures showed changes such as irregular cell walls and cell debris in the medium . the majority of cells were floating , became rounded , and detached from the surface ( fig . 8) .
therefore , the collagen extracted from squid could mimic 3d culture conditions through increased resistance of cells to chemical agents .
treatment with higher concentrations of pectic acid for 24h on the collagel culture inhibited the growth of mda - mb-231 cells .
columns show percent viable cells ( n=4 ) ; * * indicates significant differences ( p<0.01 ) morphological changes of mda - mb- 231 cells treated with pectic acid on the collagen extracted from squid .
there is no significant change in cell morphology compared to control cells ( 100x ) morphological changes of the mda - mb- 231 cell treated with pectic acid on 2d conventional culture system .
cell debris and irregular rounded cell shapes are seen by increasing of pectic acid concentration ( 100x )
collagen is involved in many cellular processes , including regulation of cell motion , cell proliferation and apoptosis ( 20 ) .
for example , type i collagen has been used as coating for culture dishes or as scaffold for microbiological adherence and invasion test systems .
a 3d - culture matrix of collagen can act as a support for cells and mimic the real extracellular matrix ( ecm ) ( 21 ) .
alternative sources of collagen have been developed since the use of main sources of collagen ( land - based animals such as bovine or porcine ) involves hygienic , social and cultural concerns .
marine creatures might offer a good collagen source since high obtainability , lack of disease transmission risk and religious barriers as well as extraction capacity of high - yield collagen ( 22 , 14 ) .
moreover , fish waste , including bones , skins , scales as well as squid collagenous membranes detached during mechanical processing may be a new source for collagen ( 23 ) .
the collagen extracted from persian gulf squid ( uroteuthis duvauceli ) contained type i collagen , and could be formed as collagel .
finally , the mda - mb-231 breast cancer cells grown in 3-d culture of squid collagel are more resistant to pectic agents than the cells in 2-d culture . the cells cultured within three - dimensional ( 3d ) conditions exhibited phenotypes and responses to stimuli analogous to in vivo biological systems .
this characteristic can be used in tissue engineering and in vitro tumor models ( 24 ) .
morphological and protrusion analyses of mda - mb-23 cells indicated that cell to cell and cell to matrix interactions occurred during incubation of cells within the collagen extracted from persian gulf squid .
in addition , the collagen extracted from persian gulf achieved biocompatibility to support cellular proliferation .
these results were observed in both the collagen - coated and collagel cultures , which are consistent with a report ( 25 ) . in this condition , the cell s response to drugs was significantly changed .
the cells cultured in 3d culture systems ; we expect to obtain an in vivo phenotype ( 26 ) .
co - culture of mda - mb-231 cells within squid collagen caused higher concentrations of pectic acid to inhibit proliferation of cells .
pectic acid could inhibit mda - mb-231 breast cancer cell growth , correlated with cell death and apoptosis induction ( 27 ) .
the data achieved in this study indicated that the half - maximal inhibitory concentration of pectic acid was about 1 mg / ml when the mda - mb-231 cells were cultured in a 2d traditional system .
this concentration showed a 5-fold increase in the 3d culture system using the collagen extracted from persian gulf squid .
squid collagen contains a porous structure sufficient to promote cellular adhesion , aggregation , morphogenesis and growth . as sem analysis showed ,
a fibrous network and porous structure was observed including interconnected joints in an irregular and wavy shape for the extracted collagen ( data not shown ) .
these data imply that the collagen extracted from persian gulf squid is capable of generating a 3d culture system , which closely mimics in vivo conditions .
our data are in agreement with the report that showed 3d type i collagen system maintained the growth of mdamb-231 and mcf-7 breast cancer cells and decreased the cytotoxicity of apoptotic drugs such as adriamycin in this system ( 2829 ) .
in addition , the mda - mb-231 cells cultured in 3d hydrogel of collagen scaffolds demonstrated greater resistance to paclitaxel as a cytotoxic chemotherapeutic agent ( 30 ) . in all such these studies ,
collagen i extracted from rat - tail was used as cell 3d scaffold . the collagen extracted from persian gulf squid
conventional cell culture models are useful to investigate certain biological functions ; however , physiologically relevant 3d cell culture models , including the one used in this study , have the potential to yield more effective and cost - efficient results for development of anticancer drugs and treatments .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors . | background : collagen - based three - dimensional ( 3d ) in vitro systems have been introduced to study the physiological states of cells . as a biomolecule
, collagen is usually extracted from terrestrial animals whilst aquatic animals like squid contain large amounts of collagen.methods:in order to make effective use of marine organisms , we selected persian gulf squid in 2015 to extract the required collagen .
then , a 3d culture system based on the extracted collagen was applied to investigate cellular mechanisms in a native microenvironment .
the formed collagen gel was used to investigate the growth of mda - mb-231 breast cancer cells as well as responses to pectic acid.results:the results revealed that the extracted collagen contained , and components with high water holding capacity .
this collagen formed a gel - like structure , which could promote the proliferation of mda - mb-231 breast cancer cells .
the mda - mb-231 cells viability in presence of pectic acid , demonstrating the cells behavior in a 3d culture system.conclusion:it seems that the collagen extracted from squid skin has type i collagen properties .
it might be used as a substrate in 3d cell culture systems . |
the most important reason for this is the apparent development of a nondepolarizing , relaxant - induced neuropathy , which leads to difficulty in weaning patients from artificial ventilation , among other problems .
some frequently used drugs , such as corticosteriods and aminoglycoside antibiotics , contribute to this neuropathy .
therefore , nowadays relaxants are only administered in the icu for specific indications , such as when decreased muscle tone is required , for treating patients who fight the ventilator and in order to allow permissive hypercapnia .
relaxants are still needed frequently in surgical anaesthesia to facilitate quick procedures such as endotracheal intubation .
its ultra - short duration of action renders rapid return of spontaneous breathing possible if intubation fails .
the situation in the icu is different , however . during anaesthesia , intubation and artificial ventilation
are only indicated to facilitate surgery by ensuring an open airway . in the icu these are absolute indications , and
rapid return of spontaneous ventilation is not necessary , given that intubation is mainly indicated to start artificial ventilation .
its mechanism of action ( depolarization of muscle cell membrane ) results in the release of intracellular potassium by upregulating acetylcholine receptors , especially outside the motor endplate , and changing their characteristics .
potassium release is already massively increased in a number of circumstances and diseases that are frequently present in icu patients , including long - term immobilization , extensive muscle trauma , many neuromuscular diseases , denervation of muscles , burns , sepsis , encephalitis and acute renal failure .
potassium release can be further augmented by acid - base balance disturbances and by corticosteroids .
when such an arrest occurs it is difficult to resuscitate the patient . in patients with myopathy or those receiving long - term treatment with corticosteroids
it is likely that cardiac arrest in such cases has an even higher mortality rate than cardiac arrest in succinylcholine - induced hyperkalaemia alone .
in intensive care patients there is large variability in the activity of plasma cholinesterase , an enzyme that metabolizes succinylcholine . for example , many drugs decrease plasma cholinesterase activity , including ecothiopate , bambuterol , corticosteroids , cytotoxics , anticonceptives and oestrogens .
heart - lung machines that are used during cardiac surgery induce a decrease in plasma cholinesterase activity , which lasts for approximately 10 days .
repeated plasma exchange decreases plasma cholinesterase activity . in pregnancy ( i.e. in patients with hellp syndrome [ haemolysis , elevated liver enzymes , low platelets ] , eclampsia , etc . ) , plasma cholinesterase activity is markedly decreased , resulting in a prolonged succinylcholine effect .
the same holds for patients with sepsis , malignancy , burn trauma and liver disease . in such patients
there is a wide variability in the neuromuscular blocking effect , onset and duration of paralysis caused by succinylcholine .
muscle hypertonia , myalgia , hypersalivation , elevated intraocular and intracranial pressures , and induction of malignant hyperthermia are also side effects of succinylcholine .
occasionally , harmful cardiovascular effects also occur following succinylcholine administration , caused by stimulation of nicotinic receptors in the autonomic ganglia ( sympathetic and parasympathetic ) and of cardiac muscarinic receptors .
furthermore , succinylcholine increases plasma noradrenaline ( norepinephrine ) concentrations , resulting in cardiovascular effects .
finally , the histamine - releasing properties of muscle relaxants are well known , and succinylcholine has the strongest histamine - releasing effect of all such agents .
given the profile described above , it is unlikely that many authorities would approve succinylcholine for registration if it were presented today as a new drug .
nondepolarizing muscle relaxants do not have the deleterious effects connected with depolarization . in order to be useful for facilitating endotracheal intubation in the icu , they must have an acceptable speed of onset , have a relatively short to intermediate duration of action , be noncumulative , and preferably should not have cardiovascular side effects or induce histamine release .
candidates to replace succinylcholine for intubation include vecuronium , rocuronium , atracurium , cisatracurium and mivacurium .
the onset of action of atracurium , cisatracurium and vecuronium is rather long , and atracurium and cisatracurium can release histamine .
rocuronium has an onset of action similar to that of succinylcholine , and provides similar intubation conditions 1 min after administration .
the duration of action of mivacurium is shorter , but it has a slower onset , the intubation conditions are comparable only after 45 min , and it has stronger histamine - releasing properties than does rocuronium . because mivacurium is metabolized by plasma cholinesterase , the interindividual variability in effect is as wide as with succinylcholine .
many studies have shown that rocuronium is a highly acceptable replacement for succinylcholine in the icu ; therefore , in my opinion , succinylcholine is obsolete .
suitability of relaxants for use in the icu the number of ' + 's or ' - 's indicates the degree to which the drug is favourable or unfavourable with respect to the parameter under question . | muscle relaxants in intensive care unit ( icu ) patients are predominantly administered to facilitate intubation .
the adverse effect profile of succinylcholine is such that its use in the icu must be considered obsolete .
suitable alternatives are the intermediately long - acting nondepolarizing relaxants , of which rocuronium is probably preferable . |
in 2010 , hispanics accounted for more than half of the growth in the total us population between 2000 and 2010 , making them the fastest growing ethnic group .
this expansion of hispanics is largely due to the natural increase ( births minus deaths ) of the existing population . since 2000 , of the total hispanic growth in the us , 40% of the increase was due to net international migration . in numbers ,
hispanics currently exceed african americans and account for 15.1% of the total us population . particularly , the south has experienced a larger overall hispanic growth than any other region in the us . in georgia ,
the hispanic population increased 96.1% from 453,227 in 2000 to 853,689 in 2010 ; the overall total population increase between 2000 and 2010 was 18.3% .
this explosive growth of hispanics in the us makes these residents a vital and underutilized source of potential blood donors .
currently , in georgia , hispanics donate at significantly lower rates than non - hispanic whites and african americans .
approximately 1.4% of hispanics donate blood each year when compared to 4.2% of non - hispanic whites and 2.4% of african americans .
the disparity between these groups ' donation frequencies is especially vexing since a high percentage of hispanics ( 5770% ) are blood group o and their inclusion in the donor pool could significantly improve blood supply logistics . in an effort to increase blood donation among hispanics , an evaluation of their culture , education , language obstacles , and
cuban , central and south american , mexican , and puerto rican [ 6 , 7 ] .
for example , the majority of cubans reside in florida ; central americans and south americans reside mostly in the south , northeast , and the west ; mexicans reside primarily in the southwest and the majority of puerto ricans live in the northeast of the us .
cultural differences exist between the primary hispanic subgroups , and additional divergences exist with blending of hispanics from distinct subgroups .
acculturation is another important factor influencing hispanics differently depending on whether one is born in , rather than immigrates to , the us . to this end
, there is a need for more epidemiologic - based blood donor studies that focus on hispanic subgroups .
knowledge of the demographics of hispanic donors could lead to a better understanding of hispanic blood donation behaviors and is an important step for developing effective recruitment strategies that may help increase blood donations .
thus , the purpose of this study is to evaluate the demographics and patterns of blood donation of hispanics , foreign - born , and us - born .
data from the retrovirus epidemiology donor study - ii ( reds - ii ) database at the american red cross blood services ( arc ) , southern region ( atlanta , ga ) , were included in this study .
donors were selected for this study based on their self - identification as being hispanic from 19 spanish - speaking countries and the us .
the selection criteria also included ages between 16 and 82 years who gave between one and twenty - four whole blood donations from 2006 to 2009 at the arc in metro atlanta .
donors selected their country of birth from a list that included south american , central american , and caribbean countries .
since the us was included in the list to choose from , hispanic donors could be categorized as either foreign - born or us - born . for purposes of this analysis , foreign - born donors were classified as cuban , central american , south american , mexican , and puerto rican .
study variables consisted of date of donation , age , gender , highest level of education attained , history of deferral , history of blood transfusion , site of donations ( fixed or mobile centers ) , and ever pregnant .
the mean donation frequency was calculated by dividing the total number of donations by the total number of blood donors .
donor rates were calculated as the total number of successful donations in counties where blood was collected over the total hispanic subgroup population living in georgia using data from the 20062008 us census .
deferral rates were calculated by the number of deferrals divided by the total number of deferrals and successful presentations and expressed per 1,000 donor presentations . for this analysis , screening test positives rather than confirmatory testing results
we used odds ratios ( ors ) , 95% confidence intervals ( ci ) , and chi - square analyses to examine the relationships between foreign- versus us - born donors and donation sites .
in addition , multivariate logistic regression model was constructed to predict whether the donor was foreign - born versus us - born using gender , age , education , first - time donor status , history of transfusion and deferrals , and donation site as independent variables .
the study population consisted of 5,119 foreign - born ( 30.2% ) and 11,839 us - born hispanic blood donors ( 69.8% ) between 2006 and 2009 ( see table 1 ) .
foreign - born hispanics represented 0.7% cuban , 7% central american 7.9% south american , 9.6% mexican , and 4.9% puerto rican of all hispanic donors .
more than half of all donors were females ( 56.2% ) , and donor ages ranged between 16 and 82 years with 73.7% of donors younger than 35 years .
overall , the mean age was 27.3 12.4 years . the mean age among foreign - born donors was higher ( 30.8 13.2 years ) than us - born donors ( 25.8 11.7 years ) ( p < .001 ) . educational levels varied among subgroups . a greater percent of donors from cuba ( 55.9% ) and puerto rico ( 50.2% ) represented the highest educated donors followed by south americans ( 46.4% ) , us - born ( 35.0% ) , central americans ( 27.0% ) , and mexican donors ( 14.3% ) .
mexican donors represented the highest percent of donors without a high school diploma ( 22.1% ) followed by central americans ( 9.5% ) , us - born ( 3.8% ) , south americans ( 3.2% ) , cubans ( 2.9% ) , and puerto ricans ( 2.1% ) .
the majority of donors with less than a 9th grade education were mexicans ( 13.5% ) and central americans ( 6.5% ) .
there was no significant difference in earning a high school diploma or bachelor 's degree between foreign - born and us - born donors .
the numbers of screening test positive donors for cytomegalovirus ( cmv ) ( 834 ) , hepatitis b ( 104 ) , syphilis ( 58 ) , hepatitis c ( hcv ) ( 35 ) , human immunodeficiency virus ( hiv ) ( 25 ) , and chagas disease ( 7 ) were relatively low .
the majority of cmv ( 459 ) and hiv ( 23 ) infections were diagnosed among us - born hispanics .
most hcv infections were diagnosed among us - born hispanics ( 23 ) , puerto ricans ( 5 ) , and mexicans ( 4 ) .
overall , us - born hispanics were more likely to be infected with hiv than foreign - born hispanics ( 0.2% versus 0.0% , p = .015 ) ; less likely to be infected with hepatitis b ( 0.5% versus 1.0% , p = .001 ) ; less likely to be infected with syphilis ( 0.3% versus 0.6% , p = .005 ) ; less likely to be infected with cmv ( 49.9% versus 70.8% , p <
.001 ) ; less likely to be infected with chagas disease ( 0.0% versus 0.2% , p = .002 ) .
there was no statistically significant difference in hcv infection between us - born hispanics and foreign - born hispanics .
overall , the age - relevant donor rate including both foreign - born and us - born hispanics was 34 per 1,000 population .
donor rates were sharply diminished among donors after the age of 24 years and were considerably varied across age groups .
the rate among us - born donors ( 55 per 1,000 population ) was higher when compared to foreign - born donors ( 18 per 1,000 population ) .
the donor rate among younger mexicans ( 1624 yrs old ) decreased from 21 per 1,000 population compared to a rate of 2 per 1,000 population among older mexicans ( 5564 yrs old ) .
the donor rates of cuban , south american , and puerto rican donors were consistently higher than the rates of central american and mexican donors .
overall , donor deferral rates ranged from 123 per 1,000 presentations among puerto ricans to 177 per 1,000 presentations among south americans .
the most common reasons for deferral were low hematocrit ( hct ) or low hemoglobin ( hb ) , malaria travel , feeling unwell , and high blood pressure or pulse .
south americans ( 85 per 1,000 presentations ) , cubans ( 74 per 1,000 presentations ) , and central americans ( 68 per 1,000 presentations ) had the highest deferral rates due to low hct or hb ; the deferral rate among us - born hispanics was 60 per 1,000 presentations .
central americans ( 17 per 1,000 presentations ) and south americans ( 10 per 1,000 presentations ) had the highest deferral rates due to travel to a malaria endemic area ; the deferral rate among us - born hispanics was 6 per 1,000 presentations .
women were the predominant us - born hispanic donors ( 57.3% ) of whom the majority were between 16 and 34 years old ( 62.0% ) .
at least 35.0% earned a bachelor 's degree , and 17.4% received a high school diploma .
approximately 48.8% were first - time donors ; 58.8% donated blood once ; 10.1% had a history of deferrals ; 9.1% donated at a fixed site .
overall , us - born donors were less likely to return than foreign - born donors ( 41.2% versus 46.5% , p <
p < .001 ) ; 7 donation . a preponderance of foreign - born hispanic donors were female ( 53.4% ) , mostly between the ages of 1634 , ( 63.3% ) .
foreign - born donors were more likely to be male than us - born donors ( or = 1.13 , 95% ci : 1.091.29 ) and less likely to be younger ( 1634 years ) than donors born in the us ( or = 0.48 , 95% ci : 0.450.66 ) .
at least 34.1% earned a bachelor 's degree and 17.7% had received a high school diploma . as a group ,
foreign - born hispanics were more likely to be blood type o and become repeat donors ; 57.6% of foreign - born donors were blood type o , and these donors were 24% more likely to be repeat donors than us - born donors ( or = 1.24 , 95% ci : 1.161.32 ) .
foreign - born donors were more likely to have a history of deferrals than us - born donors ( or = 1.18 , 95% ci : 1.061.31 ) .
after adjustment of variables in the model , foreign - born donors were 20% more likely to use fixed donation centers than us - born donors ( or = 1.20 ; 95% ci : 1.06 , 1.35 ) .
foreign - born donors were 17% more likely to be males than us - born donors ( or = 1.17 , 95% ci : 1.09 , 1.27 ) ; foreign - born donors were more likely to be first - time donors than us - born donors ( or = 1.30 , 95% ci : 1.18 , 1.42 ) ( see table 2 ) .
table 3 shows that foreign - born donor characteristics were not homogenous but rather varied with the country of birth .
the highest percentage of group o donors were found among mexicans ( 63% ) , followed by south american donors ( 57.2% ) , central american donors ( 57% ) , puerto rican donors ( 50.3% ) , and cuban donors ( 45.4% ) .
cuban - born hispanics also had the highest rates of return donation ; the percent of repeat donors between donating between 2 and at least 7 donations was 63.2% , 43.2% , 30.4 , 22.4% , 15.2% , and 9.6% , respectively .
the frequencies of repeat donations per year among the other foreign - born hispanics are south american ( 51.6% , 27.3% , 17.1% , 10.8% , 7.8% , and 5.7% ) , puerto rican ( 49.2% , 29.6% , 18.8% , 11.4% , 8.6% , and 6.4% ) , central american ( 43.4% , 24.1% , 16.0% , 10.0% , 7.3% , and 4.6% ) , and mexican ( 42.0% , 18.0% , 9.0% , 5.0% , 3.0% , and 1.8% ) .
mexican donors had the lowest percentage of historical deferrals ( 9.3% ) , followed by puerto ricans ( 10.3% ) , central americans ( 12.2% ) , south americans ( 14.6% ) , and cubans ( 16% ) . the mean donation frequency ( 2.0 donations per year ) varied by demographic group and ranged from 1.8 among mexicans to 3.1 among cubans .
the mean donation frequency of foreign - born hispanic donors was higher ( 2.2 ) when compared to us - born donors ( 2.0 .
p < .001 ) . donors who visited fixed donor centers had a higher mean donation frequency ( 3.1 ) compared to donors who visited mobile sites ( 1.0 , p < .001 ) .
donors who were older ( 3582 years ) had a higher mean donation frequency ( 2.6 ) compared to younger donors ( 1.8 ) ( p < .001 ) . during this study period ,
of the donors evaluated , 9701 ( 57.2% ) donated one time , while 7257 ( 42.8% ) donated two times ( median return time 6.2 months ) .
of the remaining donors , 21.7% donated 3 times , 12.2% donated 4 times , 7.4% donated 5 times , 5.2% donated 6 times , and 3.6% donated blood at least 7 times .
the findings in this study reveal variations in blood donation patterns among hispanic groups in the us .
the diversity in demographics between hispanics who are foreign - born and hispanics born in the us may account for these differences in donation practices .
foreign - born donors were more likely to be male and older compared to us - born donors ( p < .001 ) .
hispanics born abroad tend to be older and are therefore less likely to donate at school blood drives , the most common site for recruiting first - time donors .
hispanics born in the us tend to donate at a younger age and are more likely to participate as first time donors in school drives .
further analysis suggests that foreign - born donors were more likely to donate and become repeat donors than those born in the us .
some have suggested that hispanic immigrants are not a random sample of their home countries since they tend to have more resources , education , psychological strength , and motivation to emigrate [ 911 ] , and may be more willing to donate blood .
other researchers have shown that age , gender , and education are strong predictors for blood donations .
the findings of this study show that the hispanic donor population is more highly educated than the us hispanic population .
this study echoes previous findings ; the donor rates of non - hispanic whites ( 68.9/1,000 population ) and african americans ( 34.9/1,000 population ) are significantly higher than that of hispanics ( 34.1/1,000 population ) .
this study demonstrates that mexicans were least likely to donate blood when compared to all hispanic subgroups , including those born in the us .
this is troubling since mexicans are the largest subgroup , representing 63% of the total hispanic population living in the us in 2010 [ 1 , 3 , 13 ] . an estimated 32 million mexicans account for three - fourths of the 15.2 million increase in the total hispanic population between 2000 and 2010 , including more than half who represent undocumented immigrants .
the results of this current study , revealing the highest prevalence of universal blood type o among mexicans ( 63% ) and the lowest rates of previous deferrals , emphasize the need for recruitment strategies targeted at this subgroup in an effort to expand the current blood supply .
enrollment programs must necessarily address the immigration concerns in the wake of recently enacted immigration laws and the reluctance perhaps to show a photo i d needed to donate blood . the findings in this and other studies of the relatively low level of education among mexicans also support enlistment strategies that provide blood donor education to this subgroup , at least 22% of whom have not graduated from high school .
possible donor selection bias towards hispanics should be evaluated that might be contributing to underrepresentation of hispanics in the donor base , namely , of mexicans .
to this end , mobile drive campaigns could target sites or areas that appear to represent potential recruiting grounds for prospective hispanic donors .
in addition , enlistment of all hispanics should be offered in their native spanish for both newly immigrants and older generations of potential donors to increase their degree of comfort and understanding of donating blood . among the hispanic subgroups ,
colombians , cubans , and puerto ricans were more likely to , and consistently , donate ( p < .001 ) .
for example , cubans were among the highest to repeat with a second donation ( 63% ) and donated most frequently ( 3.1 ) .
the high rates of cuban blood donors may be due to the efficiency of cuba 's national blood system that may mandate blood donations .
for instance , cuba has the highest blood donation rate in latin america and the caribbean ( 439.6/10,000 inhabitants ) .
the donation rates in colombia and mexico are 115.7/10,000 and 126.2/10,000 inhabitants , respectively . the world health organization ( who ) and the international federation of the red cross recognize that a country must collect the equivalent of 3%5% of its population to ensure an adequate volunteer blood supply . in comparison , the us and latin america collect blood from just slightly over 4.0% and 1.4% of their population , respectively . complicating recruitment planning
, this analysis demonstrated that cuban donors had the highest percentage of deferrals , with up to 50% of perspective donors having a low hemoglobin level yet another fact to consider in donation planning strategies . in another study finding ,
foreign - born donors were more likely to visit a fixed site than a mobile site , and return for repeat donations much earlier is probably due to the impact of recruitment efforts .
individuals who want to donate more frequently often make return visits to fixed sites [ 17 , 18 ] .
it can be speculated that higher donor rates occur at fixed sites because of the center 's availability , whereas donors at a mobile must depend on the frequency and convenience of the mobile rather than the donor 's .
thus , policy makers could consider areas of heavily populated hispanics and perhaps survey potential donors in these areas to consider the most convenient times for the blood mobiles to visit these communities .
education on the importance and ease of blood donation could target the areas to stimulate reasons to donate .
the need to emphasize the need for and merit of altruistic blood donations is important in the hispanic community . to approximate the rate of blood donation of non - hispanic whites in the us
it is known that there is a greater willingness among hispanics to offer blood for family members yet limit donations for the wider community as a consequence of a dearth of appropriate donor recruitment and a lack of knowledge and/or mistrust of the us blood system . since
directed donation is deemphasized in the us , the need for family donations is limited .
fortunately , the last decade has seen a shift to promote voluntary donations in latin america and the caribbean , where blood safety can be assured . the proportion of voluntary blood donors in latin america and the caribbean increased from 15% in 2001 to 36% in 2003 [ 15 , 21 ] .
while donors from this study are from a limited metropolitan area and might not represent hispanic populations in other areas of the country , it demonstrates that donors from numerous countries have cultural , social , economic , and educational divergences that may have an impact on their blood donations in the us .
while current epidemiologic data are not collected solely on cultural subgroups , studies could be proposed in predominantly puerto rican , colombian , or cuban communities that could help highlight and report their divergences from another subgroup with regards to their knowledge of blood donation .
the limitations of this study consist in the small number of foreign - born donors to analyze per country , such as cuba .
the study was also unable to determine the number of years lived in the us by foreign - born donors that may have impacted their blood donation knowledge and practices .
additionally , distinct acculturation processes over time and among subgroups of hispanics may have profoundly influenced donation practices .
a study of hispanic donors , powered to reach a greater number of hispanics and yield greater distinctions among the individual and subgroup demographics and cultural patterns , is needed .
blood donation recruiters are the yeomen of the blood supply chain who rely on information describing current hispanic blood donation practices to guide them in the formulation of new recruitment strategies and programs .
the growing size and importance of the hispanic community efforts , including education adapted to hispanic subgroups , could render a larger and more diverse donor pool which offers the priceless gift of life .
1 p01 hl 086773 : mechanisms and interventions addressing serious hazards of transfusion and cellular therapies .
| background .
the explosive growth of hispanics in the us makes this population a significant and untapped source for blood donation
. methods .
a cross - sectional study was performed to evaluate blood donation behaviors and demographics of foreign - born and us - born hispanic donors between 2006 and 2009 in metropolitan atlanta , ga , usa .
bivariate analyses and multivariate logistic regression were used to assess factors associated with foreign - born donors .
results .
5,119 foreign - born and 11,841 us - born hispanics donated blood .
foreign - born hispanic donors were more likely than us - born donors to be blood group o ( 57.6% versus 52.0% ; p < .001 ) and more frequent donors ( 2.2 versus 2.0 ; p < .001 ) .
cuban - born donors had the highest rates of return donation ( 63.2% ) .
in contrast , mexicans , the most prevalent subpopulation among foreign - born hispanic donors ( 31.8% ) , had the lowest rates of return donation ( 42.0% ) .
conclusions .
the heterogeneity found among hispanic donors in this study is valuable for the design of recruitment strategies to increase blood donations . |
a 76-year - old male ex - smoker presented with a recent history of hematuria and transient right - flank pain . on physical examination , no mass was palpable in the abdomen , and no costovertebral angle tenderness was found .
hemogram and blood chemistry results were normal , except for azotemia ( serum creatinine , 2.2 ng / ml ) .
magnetic resonance urography confirmed an irregular ureter mass 2 cm from the ureterovesical junction of approximately 5 cm ( fig .
cystoscopy showed no abnormalities in the urinary bladder , and the findings of urine cytologic examination were negative .
grossly , several small and large simple cysts were observed in the renal cortex , of which the largest measured 32 cm .
the distal end area was dilated , and an irregular polypoid mass measuring 51.51.2 cm was identified 2 cm from the bladder cuff ( fig .
2 ) . microscopically , a population of mononuclear cells with numerous interspersed multinucleated giant cells were observed .
the mononuclear cells contained round- to oval - shaped nuclei with vesicular chromatin , inconspicuous nucleoli , moderate nuclear clearing , and mild nuclear pleomorphism .
ogcs had multiple round - to - oval , bland - appearing nuclei ranging from 4 to 34 in number .
the tumor invaded focally into the periureteric adipose tissue and was categorized as american joint committee on cancer stage pt3nxmx .
immunohistologic examination showed that the multinucleated giant cells were positive for cd68 , cd45 , epithelial membrane antigen ( ema ) , vimentin , and cytokeratin ( cytoplasmic but not nuclear staining ) and negative for desmin and cd31 ( fig .
the 5-month postsurgical follow - up , the patient was doing well , had no evidence of disease recurrence , and had a serum creatinine level of 2.5 ng / ml .
extraskeletal ogc carcinoma of the urinary tract is extremely rare and has most frequently been reported in the breast and pancreas .
fewer than 30 case reports of ogc tumors of the urinary tract have been published in the english literature [ 2 - 6 ] .
the most common tumor locations in the urinary tract are the kidney , renal pelvis , and bladder .
only one case of ogc carcinoma of the bladder with right ureter invasion has been reported . to the best of our knowledge ,
this is the first case report of an ogc carcinoma of the distal ureter without a bladder tumor .
much controversy exists regarding the nature and origin of epithelial , histiocytic , and mesenchymal ogcs .
one study indicated that these types of ogcs may result from the fusion of mononuclear histiocytes / macrophages , which are attracted to the tumor by growth or chemotactic factors released by neoplastic epithelial cells .
immunohistochemical analysis in this previous study showed that the ogcs were positive for vimentin , ema , and the cell surface proteins cd68 and cd45 and were negative for cytokeratin .
as is well known , hematuria and flank pain are the most common and frequent initial symptoms .
the appearance of ogc carcinoma under cystoureteroscopy is similar to that of other urothelial tumors . because of the rarity of ogc tumors in the urinary tract ,
previous reports indicate that the median survival rate associated with ogc tumors is less than 2 years .
aggressive management is recommended because of the poor prognosis of this condition ; however , no adjuvant treatment has yet been established .
adjuvant radiation therapy may be beneficial , because giant cell tumors of the bone are radiosensitive .
although adjuvant chemotherapy , such as mitoxantrone / etoposide / cyclosporine , has been reported to be beneficial in patients with transitional cell carcinoma of the urinary tract , a large population - based study is needed to confirm the benefits of such therapy in the treatment of invasive ogc tumors of the urinary tract .
previous reports indicate that extensive surgical excision appears to be the recommended treatment for primary or recurrent lesions until the treatment benefits of adjuvant chemotherapy or radiotherapy are established . | extraskeletal osteoclast - like giant cell ( ogc ) tumors are uncommon and have mainly been found in the breast and pancreas .
ogc neoplasms of the urinary tract are extremely rare .
most cases found in the renal pelvis and bladder are associated with either an in situ urothelial malignancy or a conventional high - grade urothelial carcinoma .
these malignancies tend to be associated with a poor prognosis and disease course . to our knowledge
, no cases of ogc tumors of the distal ureter only have been published . here , we present the case of a 76-year - old man who underwent hand - assisted laparoscopic nephroureterectomy because of painless gross hematuria with right flank pain .
pathologic examination showed ogc carcinoma of the right distal ureter . no local tumor recurrence or distant metastasis
was found at the 5-month follow - up . |
deposited data can be found in the gene expression omnibus ( geo ) database : http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=gse77286
a. thaliana ecotype columbia ( col-0 ) , and an arabidopsis t - dna insertion double mutant ( bzip19 bzip23 ) , were grown in a climate chamber with a long day photoperiod ( 16 h light at 22 c , 8 h dark at 20 c ) , at 120 mol photon m s , and 50% relative humidity . before germination
, seeds were subjected to a 3-day stratification treatment in a cold room at 4 c , in the dark , to promote uniform germination .
seeds were sown onto 0.55% ( w / v ) agar - filled microtubes , and grown in hydropony on a modified half - strength hoagland 's nutrient solution containing 2 m znso4 ( zn + ) .
the hydroponic system consisted of 8-l - capacity containers ( 46 31 8 cm ) , with a non - translucent 3-mm - thick plastic lid containing holes for placement of agar - filled tubes .
the nutrient solution was replaced once in the first week , and twice a week in weeks thereafter .
the two genotypes , i.e. , wild - type ( col-0 ) and double mutant ( bzip19 bzip23 ) , were grown for three weeks with normal zinc supply ( zn + , 2 m znso4 ) and then one week with low ( zn- , 0.05 m znso4 ) , normal ( zn + ) or excess zinc supply ( zn + + , 25 m znso4 ) . for each genotype and treatment ( zn /zn + /zn
+ + ) , roots or shoots of six plants ( two containers ) were pooled .
plant tissue was snap frozen into liquid nitrogen and stored at 80 c .
rna was extracted with the rneasy plant mini kit ( qiagen ) . for cdna synthesis ,
targets were prepared with the one - cycle cdna synthesis kit followed by biotin - labeling with the ivt labeling kit ( genechip one - cycle target labeling and control reagents ; affymetrix ) , and hybridized to the ath1 gene chip for 16 h , as recommended by the supplier ( gene expression analysis manual ; affymetrix ) .
four and three hybridizations were performed for independent biological replicates of the root and shoot material , respectively .
raw data files were processed in bioconductor / r using packages affy and limma .
background correction and quantile normalization were performed using the robust multichip average ( rma ) function .
principal component analysis ( pca ) was conducted using multi experiment viewer v4.0 ( www.tm4.org/mev.html ) .
a. thaliana ecotype columbia ( col-0 ) , and an arabidopsis t - dna insertion double mutant ( bzip19 bzip23 ) , were grown in a climate chamber with a long day photoperiod ( 16 h light at 22 c , 8 h dark at 20 c ) , at 120 mol photon m s , and 50% relative humidity . before germination
, seeds were subjected to a 3-day stratification treatment in a cold room at 4 c , in the dark , to promote uniform germination .
seeds were sown onto 0.55% ( w / v ) agar - filled microtubes , and grown in hydropony on a modified half - strength hoagland 's nutrient solution containing 2 m znso4 ( zn + ) .
the hydroponic system consisted of 8-l - capacity containers ( 46 31 8 cm ) , with a non - translucent 3-mm - thick plastic lid containing holes for placement of agar - filled tubes .
the nutrient solution was replaced once in the first week , and twice a week in weeks thereafter .
the two genotypes , i.e. , wild - type ( col-0 ) and double mutant ( bzip19 bzip23 ) , were grown for three weeks with normal zinc supply ( zn + , 2 m znso4 ) and then one week with low ( zn- , 0.05 m znso4 ) , normal ( zn + ) or excess zinc supply ( zn + + , 25 m znso4 ) . for each genotype and treatment ( zn /zn + /zn
+ + ) , roots or shoots of six plants ( two containers ) were pooled .
plant tissue was snap frozen into liquid nitrogen and stored at 80 c .
rna was extracted with the rneasy plant mini kit ( qiagen ) . for cdna synthesis ,
targets were prepared with the one - cycle cdna synthesis kit followed by biotin - labeling with the ivt labeling kit ( genechip one - cycle target labeling and control reagents ; affymetrix ) , and hybridized to the ath1 gene chip for 16 h , as recommended by the supplier ( gene expression analysis manual ; affymetrix ) .
four and three hybridizations were performed for independent biological replicates of the root and shoot material , respectively .
raw data files were processed in bioconductor / r using packages affy and limma . background correction and quantile normalization
were performed using the robust multichip average ( rma ) function . principal component analysis ( pca )
knowledge on of the molecular network modulating the response to zinc nutrition in the arabidopsis plant model system is a timely subject , and will contribute to the development of plant - based solutions addressing nutrient use efficiency and adaptation to nutrient - limited or toxic soils , , , .
previously , the transcription factors bzip19 and bzip23 were identified as essential regulators of the response to micronutrient zinc deficiency in arabidopsis . here , we describe a microarray dataset that provides a comparative analysis between arabidopsis wild - type and the bzip19 bzip23 double mutant , the latter displaying a hypersensitive response to zinc deficiency .
the experimental conditions include analysis of root and shoot tissues , and plant growth in varying zinc supply , i.e. , deficient , normal and excess zinc ( fig .
this dataset extends significantly on the previously reported transcriptomics study , by including shoot tissue analysis and the expression profile under sufficient and excess zinc supplementation .
the quality of the dataset was demonstrated by the homogenous distribution of spot intensity values across replicates and even between traits ( zn levels ) , as depicted by boxplot graphs in roots ( fig .
1b , c ) and shoots ( fig . 1d , e ) , where the effectiveness of the quantile normalization can be checked as well .
subsequently , we used pca to analyze variance in the datasets for each of the 42 hybridizations , allowing us to infer on 1 ) quality of the datasets , 2 ) length of transcriptional rearrangements given the three working variables ( zinc supply , genotype , tissue type ) ( fig . 1f
replicates within the 12 experimental conditions clearly clustered together across pca components 13 , demonstrating the quality of hybridization and data normalization procedures , and ensuring the biological significance of future differential expression analysis on these datasets . regarding the latter ,
results demonstrate that variance in component 1 clearly reflects root vs. shoot datasets ( fig .
1f ) , with at least 85% of gene expression variability being attributed to this variable ( fig .
even though components 2 and 3 still demonstrate the weight of the tissue type variable on transcriptional data , they also resolve datasets across a gradient of zinc supply , indicating that this is the second most significant variable affecting transcription variance ( fig .
the impact of the bzip19 bzip23 mutant genotype on transcription is therefore likely to be less extensive than remaining variables , which is foreseeable given that a reduce number of genes seems to be transcriptionally regulated by bzip19/23 .
this dataset is a resource that can provide valuable information , generate extensive differential expression comparisons , or complement results of other experiments .
ultimately , it can contribute to a better understanding of the regulatory network modulating the response to zinc nutrition in arabidopsis .
in addition , it should provide further insight onto the particular roles that bzip19 and bzip23 transcription factors play in zinc homeostasis . | deficiency of the micronutrient zinc is a widespread condition in agricultural soils , causing a negative impact on crop quality and yield .
nevertheless , there is an insufficient knowledge on the regulatory and molecular mechanisms underlying the plant response to inadequate zinc nutrition [ 1 ] .
this information should contribute to the development of plant - based solutions with improved nutrient - use - efficiency traits in crops .
previously , the transcription factors bzip19 and bzip23 were identified as essential regulators of the response to zinc deficiency in arabidopsis thaliana [ 2 ] .
a microarray experiment comparing gene expression between roots of wild - type and the mutant bzip19 bzip23 , exposed to zinc deficiency , led to the identification of differentially expressed genes related with zinc homeostasis , namely its transport and plant internal translocation [ 2 ] .
here , we provide the detailed methodology , bioinformatics analysis and quality controls related to the microarray gene expression profiling published by assuno and co - workers [ 2 ] .
most significantly , the present dataset comprises new experimental variables , including analysis of shoot tissue , and zinc sufficiency and excess supply .
thus , it expands from 8 to 42 microarrays hybridizations , which have been deposited at the gene expression omnibus ( geo ) under the accession number gse77286 .
overall , it provides a resource for research on the molecular basis and regulatory events of the plant response to zinc supply , emphasizing the importance of arabidopsis bzip19 and bzip23 transcription factors . |
neurofibromatosis ( nf ) is considered one of a group of multisystem hereditary diseases that also include tuberous sclerosis , von hippel
this heterogeneous group of diseases has been alternatively defined as phakomatoses , neurocutaneous syndromes , tumor predisposition syndromes , and ectodermal dysplasia by different authors over the years .
the eye and the ocular adnexa may be affected by characteristic lesions that are relatively frequent , and are , therefore , considered as diagnostic hallmarks of the disease , while other ocular manifestations are rare and inconstant .
a number of authors have chosen the name disseminated hamartomatosis because of findings of hamartoma and tumors in various organs .
the associated tumors may lead to morbidity due to their progressive growth and mass effect , and although initially not characterized by aggressive histological characteristics , they can show malignant transformation in a small proportion of cases . since nf is characterized by considerable variability of clinical features , riccardi1 proposed the classification of nf into seven types , but a more recent classification only includes nf type 1 ( nf1 ) and nf type 2 ( nf2 ) , while the other types are now considered as variants .
in fact , the genetic alteration in the main two variants is different , being on chromosome 17 - 17q11.2 in nf12 and chromosome 22 - 22q12.2 in nf2.2 the prevalence of nf1 is about one in 3,500 live births.1 the transmission modality is autosomal dominant ; however , approximately 50% of cases are caused by spontaneous mutations , and there is considerable variability of expression between affected families .
diagnosis is usually performed clinically and is based on specific diagnostic criteria . mutation analysis using multiple molecular diagnostic techniques for genomic dna and rna can also be considered in some cases , for example , in very young children when the diagnosis is suspected but not clinically confirmed . this is because many clinical features of nf1 are age dependent , and diagnosis is occasionally more challenging in the pediatric population.3 the genetic modification in nf1 leads to alteration of expression of the cytoplasmatic protein normally encoded by the nf1 gene known as neurofibromin , a 220 kda guanosine triphosphate ( gtp)ase - activating cytoplasmatic protein that is involved in cell growth regulation mechanisms by regulating the ras protein , specifically by converting ras - gtp active form to ras - gdp inactive form.3,4 the consequence of the lack of neurofibromin results in an excess of the ras - gtp active form , which promotes excessive cell growth , leading to deregulation and tumorigenesis .
for this reason , nf1 is also considered as an rasopathy , which is defined as a disorder caused by a germline mutation that causes deregulation of the ras mitogen - activated protein kinase pathway.3,4 nf1 is characterized by considerable clinical heterogeneity and age - related nature of clinical expression .
the disease may also be seen as mosaicism , also called segmental nf1 . in these cases
, nf1 maintains the usual characteristics of the disease but is localized only in a body segment.57 segmental nf1 is approximately ten times less frequent than nf1.8 in fact , prevalence of these forms is 1/36,00040,000.9 patients with segmental nf1 are also at relatively lower risk for life - threatening complications . as for other features of nf1 , ocular findings in segmental nf , such as lisch nodules , are found only when the ocular district is involved .
in nf1 , the various clinical features affecting the nervous , dermatologic , ocular , and skeletal systems are usually absent at birth but develop shortly after .
approximately 95% of nf1 patients meet diagnostic criteria by age 8 , and all do so by age 20 .
the diagnostic criteria currently used for diagnosis were presented by the national institute of health statement in 1987.10 an individual with at least two of the following criteria is considered affected by the disease : at least six caf au lait spots with a minimum diameter of 0.5 cm prior to puberty or a minimum diameter of 1.5 cm following puberty , inguinal and/or axillary freckling , at least two lisch nodules , optic pathway glioma , typical bony lesions such as sphenoid wing dysplasia , pseudoarthritis of the tibia , and a first - degree relative with nf1.10
caf au lait spots are not present at birth but become evident at about 1 year of age ; they are pigmentary lesions of the skin with well - characterized , uniform pigmentation and defined margins .
freckling is found in approximately 80% of patients under the age of 6 and in 90% of adults over age 30.11 they appear as small freckles less than 5 mm in size and are localized usually in the axillary or inguinal area ( crowes sign ) .
neurofibromas , found in almost all nf1 patients over 30 years of age , are prevalently located over the trunk , with 20% seen in the head and neck region.12 they are divided into cutaneous , subcutaneous , and plexiform neurofibromas ; the latter are observed in 25%30% of cases.12,13
histologically , neurofibromas are formed by schwann cells , nonneoplastic fibroblast - like cells , mast cells and macrophages , and endothelial and perineural cells.11,14 clinically , cutaneous neurofibromas are asymptomatic , soft , brown - colored tumors that range from a few millimeters to several centimeters in size .
the subcutaneous variety is characterized by firm consistency , tenderness on manipulation , and a size of approximately 34 cm .
the plexiform neurofibroma shares characteristics similar to the other types , but is more prone to transformation into variants of malignant nerve sheath tumors ( 7%13% of cases also known as mpnst tumors ) such as neurofibrosarcoma or malignant schwannoma.15 with advancing age , these tumors can continue to grow to significant sizes and may physically hinder functionality .
in fact , enormous neurofibromas , invading the palpebrae , have been described , and these can create functional disturbances .
rare systemic alterations of nf1 include cardiovascular abnormalities with hypertension , increased incidence of pheochromocytoma and aortic coarctation , neurocognitive deficits of various severities in 60% of cases,13 leukemia , and lymphoma.16 in nf1 , various skeletal anomalies may be found : scoliosis in 10%15% of patients , thinning of the long bones , pseudoarthrosis of tibia , and absence of the greater wing of the sphenoid bone in 1%6% of patients.16
palpebral plexiform neurofibroma is usually monolateral , frequently affects the upper eyelid , and appears usually after 2 years of age ; it has the tendency to grow and cause asymmetric ptosis associated with deformation of the palpebral margin ( figure 1 ) . in some cases , enormous neurofibroma of the palpebra , defined palpebral elephantiasis ,
may result.15 the hypertrophy of the nerve fibers of the nerve sheath tumor can be occasionally felt by digital palpation during physical examination of the eyelids .
katz syndrome.15 an unusually rapid growth , increase in tenderness , or bleeding , warrants further investigation to rule out malignant transformation .
these palpebral plexiform neurofibromas have a propensity to relapse , and surgical operations are complicated with profuse bleeding with disappointing results.1719 other rare ocular findings in nf1 include conjunctival neurofibroma ( figure 2 ) and a characteristic hypertrophy of corneal intrastromal nerves known as
lignes grise.20 iris hamartoma in nf1 known as lisch nodules21 are unusual before 2 years of age , may be occasionally observed before 6 years , but their prevalence , number , and dimensions in individual cases increase considerably with age.22,23 lewis and riccardi24,25 described the case of a woman with lisch nodules as the sole clinical manifestation of nf1 other than having two sons with the disorder .
histologically , lisch nodules are melanocytic hamartomas composed of melanocytes , elongated fibroblasts , and mast cells .
mast cells have been found to be present both in neurofibromas and lisch nodules.26 lisch nodules do not represent a cause of morbidity or disability , but they are diagnostically significant , being one of the principal hallmark manifestations of nf1.8 slit - lamp observation reveals characteristic nodules with dimensions of approximately 2 mm , absence of vasculature , and a certain chromatic variability ranging from white to yellow or brown15,23 ( figure 3 ) .
it has been reported in 1/300 nf1 patients.29 recent studies have made a distinction between nf1 patients with or without orbital facial involvement ( such as plexiform palpebral neurofibroma ) , and a finding of glaucoma was seen in 23% of the patients with orbital
facial nf1.30 asymmetric globe enlargement in ipsilateral orbital facial nf1 was found in patients with glaucoma , with axial lengths ranging from 26 to 36 mm ; difference with the contralateral unaffected eye was of 46 mm.29,30 interestingly , this study revealed slight ocular enlargement in oculofacial nf1 , even in eyes with normotensive intraocular pressure ; indeed , it has been speculated that megalophthalmous may be present in nf1 irrespective of ocular hypertension.30 during clinical evaluation of patients with glaucoma , ultrasound biomicroscopy and anterior chamber optical coherence tomography ( oct ) is fundamental to evaluate the ciliary body and anterior chamber3134 ( figure 4 ) .
the ciliary body may show thickening , and there may be signs of angle infiltration by neurofibroma or lisch
nodules.3133 glaucoma evident at birth usually suggests congenital abnormality of the angle , while onset at a later date suggests involvement of the anterior angle secondary to nf115,35,36 ( figure 4 ) .
assessment for glaucoma , including intraocular pressure evaluation , gonioscopy , visual field examination , and optic nerve assessment , is advisable in patients with nf1.3740 choroidal abnormalities of nf1 are undetectable by fundus biomicroscopic examination or fluorescein angiography .
rescaldani et al41 used indocyanine green angiography to study the choroid in nf1 patients and showed that there were hypofluorescent areas in the early phases of angiography corresponding to choroidal nodules and speculated that there could be delayed perfusion of the choriocapillaris in these areas .
yasunari et al42 first described the choroidal findings with the use of confocal microscopy using infrared light and found numerous bright patchy areas , especially localized in the posterior pole of the fundus .
these authors also performed indocyanine green angiography and found that these bright areas corresponded to hypofluorescence .
more recently , the use of new noninvasive technology such as near infrared reflectance ( nir ) and oct has made it possible to better evaluate choroidal alterations .
viola et al43 evaluated choroidal abnormalities in nf1 patients using nir in a large group of patients and found nodules in 82% of patients .
they found a diagnostic sensitivity of 83% and a specificity of 96% , with a cut - off value of 1.5 nodules ( figure 5 ) .
nakakura et al44 found that most choroidal nodules were located at the posterior pole especially in pediatric patients and also found that there was a higher number of choroidal alterations in the arcade regions and that the extent of choroidal alterations increased with age .
oct uses an 830 nm near infrared light source and measures light waves reflected from and scattered by the tissues of the eye , enabling the acquisition of cross - sectional , high - quality in vivo images with accurate differentiation of the retinal layers.45 furthermore , enhanced depth imaging ( edi ) in spectral domain oct sets the peak sensitivity , or zero - delay line , behind the retinal pigment epithelium and enables the study of the choroid.46 in a recent investigation , using spectral domain technology , choroidal nodules were studied both with nir imaging and cross - sectional edi - oct images , and the authors showed that nir detected choroidal alterations corresponding to two types of hyperreflective choroidal nodules that were either dome - shaped or had placoid
morphology.47 furthermore , as the spectral domain software enables segmentation measurements , the authors evaluated choroidal and individual retinal layer thicknesses in patients with nf1 and reported a reduction of the mean choroidal thickness .
interestingly , the neuroepithelium , photoreceptor - retinal pigment epithelium , and outer nuclear layer were also reduced in thickness in nf1 patients compared to healthy control subjects .
the authors speculated that altered choroidal circulation , due to the presence of nodules , could be the cause of retinal thinning .
a number of other case reports have also shown choroidal and retinal thickness alterations in nf1.48,49 retinal alterations in nf1 have not been frequently reported .
there are a few reports on cases with retinal hamartomas also involving the retinal pigment epithelium.50 muci - mendoza et al51 reported retinal microvessel alterations or corkscrew vessels in 38% of 32 patients with nf1 .
these were described as second- or third - order microvenules more frequently found close to the temporal veins ( figure 6 ) .
they had a morphological spectrum from very small subtle microvascular alterations to corkscrew - shaped vessels or larger microvessel venous anastomoses .
similar retinal alterations were also recently reported in another study in 35% of 17 patients ; the microvascular abnormalities were found overlying choroidal nodules as demonstrated with nir imaging of the fundus .
the authors speculated that neural crest alterations in nf1 can cause functional abnormalities in autonomic vasomotor nerve cells , leading to the formation of retinal microvessel abnormalities.52 makino et al53 reported a patient with retinal microvascular abnormalities linked with congenital retinal macrovessels across the macula , showing dynamic changes over time .
optic pathway glioma has been described in 15%25% of patients with nf1 ; they usually develop at an early age , typically from age 3 to 5 years .
these are actually low - grade tumors and do not possess malignant histological characteristics , nor do they show tendency to malignant transformation .
they are classified as who grade 1 pilocytic astrocytoma.54 these frequently arise within the optic pathway , optic nerve , optic chiasma , and postchiasmatic radiations , but may arise in 25% of cases in the brainstem.5456 essentially , clinical consequences of these tumors are caused by their volume - occupying characteristics , so depending on location and size , various consequences can follow .
orbital localization at the optic nerve may cause proptosis , strabismus , edema of the papilla , visual field defects , and reduction of visual acuity .
intracranial localization may cause general neurological symptoms of mass - occupying lesions associated with more specific signs based on the localization of tumor , such as visual field alterations , pupillary defects , and puberal precocity .
magnetic resonance imaging is , therefore , indicated in these nf1 cases to rule out progression and to follow - up intracranial / intraorbital tumors .
visual acuity and visual field analysis can not be immediately evaluated in young and uncooperative children.57,58 some authors have used visual - evoked potentials to objectively evaluate the visual pathways and to detect vision variations in nf1.59 however , this testing is not sensitive or specific and is technically stringent ; thus , evidence that is reliable in evaluating vision loss in children with nf1 is lacking.55 oct also allows evaluation of the peripapillary retinal nerve fiber layer ( rnfl ) .
novel research suggests that peripapillary rnfl alterations are detected with oct earlier than with conventional methods such as visual field testing.60 furthermore , the peripapillary rnfl can be compared with the macular rnfl thickness and ganglion cell layer thickness to potentially monitor disease progression . using oct rnfl thickness analysis ,
some authors have reported a reduced thickness of the peripapillary rnfl in children affected with nf1 who have optic nerve gliomas.6163 gu et al64 also showed a thinning of the ganglion cell layer - inner plexiform layer in children with optic nerve gliomas .
furthermore , avery et al65 showed that handheld oct gives highly reproducible thickness measurement of the ganglion cell layer - inner plexiform layer in children with optic pathway gliomas .
recently , spectral domain oct was used in adult nf1 patients without optic pathway glioma to evaluate the peripapillary rnfl using the circular diameter scan on the optic disc .
the authors also evaluated the thickness of the macular rnfl and the ganglion cell - inner plexiform layer using the spectral domain software , which allows manual segmentation thickness measurements .
these authors reported thinning of the peripapillary and macular rnfl and the ganglion cell - inner plexiform layer in adult patients with nf1 compared to healthy controls , which suggested neuronal and axonal loss.66
figure 7 shows evaluation of the peripapillary rnfl in a patient with nf1 .
noonan syndrome is characterized by ocular hypertelorism , low - set ears , downslanting palpebral fissures and may occur in almost 12% of nf1 patients.67 segmental nf1 is diagnosed in patients with both parents unaffected and with clinical nf1 features localized to one part of the body in a circumscribed , patchy , or linear arrangement , or in localized regions or organs.6870 unilateral lisch nodules with no other clinical manifestations have also been described in isolated case reports of segmental nf1.71
nf2 is also an autosomal dominant disease caused due to a mutation in the gene for nf2 , which is located on chromosome 22 - 22q12.2.72 this gene encodes for merlin , which is a protein that assists in linking actin cytoskeleton to the surface of glycoproteins and has an important function in remodeling cells and regulating growth.73 there is a 50% chance of transmission from an affected individual to their offspring , but 50%60% of patients have no family history , having instead de novo mutations.16 clinical characteristics of the condition may include bilateral vestibular schwanomas , multiple meningiomas , cranial nerve tumors , spinal tumors , and eye abnormalities .
the most serious ocular findings are optic nerve hamartomas and hamartomas of the retina ( combined pigment epithelial and retinal hamartomas)16,74 ( figures 8 and 9 ) .
a large proportion ( 60%80% ) of patients have early - onset cataracts , usually with an onset of posterior subcapsular lenticular opacities or cortical wedge opacities.74 fluorescein angiography images of combined hamartomas of the retina and the retinal pigment epithelium can provide further details .
early angiography phases show tortuous vessels due to the retraction of the internal limiting membrane and patchy areas of hypofluorescence due to hyperpigmentation.16 other sporadic findings in nf2 are as follows : dystrophic keratitis due to fifth cranial nerve involvement or facial paresis due to seventh cranial nerve involvement.75 patients with a diagnosis of nf2 should undergo magnetic resonance imaging of the brain to better evaluate any tumor involvement . over the past decades , radiation therapy was used in the management of nf2-related tumors ; today , surgery is considered the standard treatment even if it is not always possible or advisable to remove all lesions.76 since the introduction of anti - vascular endothelial growth factors ( anti - vegf ) , this treatment has been used in a broad range of pathologies.7780 studies with bevacizumab suggest that anti - vegf therapies may cause significant reductions in tumor volume and significant improvement in hearing function in nf2 patients.81
since the description by von recklinghausen in 1882,82 nf1 has been extensively studied . nf1 together with other phakomatoses such as von hippel s disease and sclerosis tuberous complex are now known to be caused by alterations of tumor suppressor genes . however
, many questions about these diseases remain unanswered ; the role of the neural crest and why different types of neurocutaneous conditions occur together in the same individual , still need clarification .
weber syndrome from the group of phakomatoses,8385 but further advances in the field of molecular genetics are necessary and can certainly contribute to the diagnosis and management of nf . in ophthalmology
, we believe that the advent of new diagnostic instruments such as near infrared imaging and oct have provided new insight to study the ophthalmic manifestations of the disease . | neurofibromatosis ( nf ) is a multisystem disorder and tumor predisposition syndrome caused by genetic mutation on chromosome 17 - 17q11.2 in nf type 1 ( nf1 ) , and on chromosome 22 - 22q12.2 in nf type 2 .
the disorder is characterized by considerable heterogeneity of clinical expression .
nf1 is the form with the most characteristic ocular manifestations .
lisch nodules of the iris are among the well - known diagnostic criteria for the disease . glaucoma and associated globe enlargement
have been described in a significant proportion of patients with nf1 and orbital facial involvement .
optic nerve glioma may cause strabismus and proptosis , and palpebral neurofibroma may reach considerable size and occasionally show malignant transformation . near infrared reflectance
has greatly contributed to enhancing our knowledge on choroidal alterations in nf1 .
indeed , some authors have proposed to include these among the diagnostic criteria .
optical coherence tomography has given new insight on retinal alterations and is a noninvasive tool in the management of optic nerve gliomas in children .
ocular manifestations in nf type 2 can range from early - onset cataracts in up to 80% of cases to optic nerve hamartomas and combined pigment epithelial and retinal hamartomas . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.